Field of the invention

The invention provides an antisense oligonucleotide able to induce the skipping of an exon of a BAFF mRNA in order to produce a truncated form of a BAFF protein when present in a cell expressing the BAFF mRNA. This oligonucleotide may be used for treating the Sjogren's syndrome.

Background of the invention

Sjogren' s syndrome (SS) is an innate-immune triggered autoimmune epithelitis, responsible for disabling dryness, fatigue, pain and systemic involvement. No specific treatment exists to date for this disease affecting nearly 0.1 % of the general population and can be either isolated (primary SS, pSS) or associated to various other autoimmune diseases, such as rheumatoid arthritis, systemic lupus erythematosus (SLE), systemic sclerosis. The pathogenesis of the disease involves the activation of innate immunity, and interferon pathways resulting in the activation of adaptive immunity, notably B lymphocytes. Targeting B cells, either using monoclonal antibodies against CD20 or CD22 may result in decreased dryness. This suggests that dryness is not the only consequence of damage but also from ongoing B-cell activation, maybe through the antigen-presenting properties of B cells, their co-stimulatory effect on T cells and autoantibody secretion.

BAFF (B-cell activating factor or BLyS) might be one key cytokine linking interferon to B-cell activation and autoimmunity to lymphomas, which have a 18-fold increase in patients with pSS compared to the general population. BAFF is a cytokine of the TNF family, which plays a pivotal role in the activation and survival of autoreactive B-cells. BAFF transgenic mice have a phenotype of SLE and SS and levels of BAFF are increased in serum, saliva and target organs of patients with pSS, and in serum of various other autoimmune diseases and in serum and lymphoid proliferations of patients with lymphomas, notably those with a bad prognosis. In SS, BAFF is not only over-expressed by myeloid and dendritic cells, and T and B lymphocytes (Daridon C, Arthritis Rheum. (2007), 56: 1134-44) but also by salivary gland epithelial cells and by epithelial cells of the ocular surface. After initial triggering of innate immunity, epithelial cells are induced to secrete BAFF locally, inside the target organs of autoimmunity in SS, which in turn play a pivotal role in the activation of adaptive immunity.

Thus, direct targeting of BAFF using salivary gland local gene therapy might offer a new therapeutic perspective. However, to date, only systemic approaches of BAFF inhibition were used in other models of autoimmune diseases, including diabetes, SLE, collagen-induced arthritis, and autoimmune thyroiditis. There are as yet no data available regarding the efficacy of BAFF inhibition on salivary gland (SG) inflammation and dysfunction in animal models of SS. The NOD model of SS has numerous similarities to its human counterpart, including dryness, presence of autoantibodies, nature of the lymphocytic infiltrates. Moreover, in NOD mice, early overexpression of BAFF is observed in salivary glands (Killedar S.J., Lab. Invest., (2006), 86: 1243-60), which suggests that BAFF could be a relevant therapeutic target in this SS model.

Among the possibilities to decrease BAFF secretion, soluble receptors and monoclonal antibodies, such as TACI-Fc, BAFF-R-Fc or belimumab, currently evaluated in clinical trials of patients with SLE, RA and blood malignancies, have no impact on BAFF intracellular processing and secretion.

The invention provides a new treatment for SS which does not have all the drawbacks of existing treatments and which induces a specific decrease of BAFF secretion.

Description of the invention

Another possibility to alter BAFF secretion is to target BAFF messenger RNA (mRNA), using either small-interfering RNA or micro-RNAs, or by regulating BAFF mRNA splicing. Interestingly, delta-BAFF, a splice variant of BAFF, with a 57-bp single exon deletion (exon 3 and 4 are skipped in human and mouse, respectively) inhibits BAFF secretion and activity by affecting the intracellular compartimentalization of BAFF and its receptor binding specificity. Thus, delta-BAFF prevents the intracellular binding of BAFF to other monomers of BAFF and APRIL, and inhibits the shedding of membrane-bound BAFF. Full-length BAFF is naturally more abundant than delta-BAFF. We hypothesize that increasing the expression of delta-BAFF instead of full-length BAFF might result in the decrease of BAFF secretion and activity resulting from the decrease of BAFF mRNA (BAFF pre-mRNA being preferentially spliced into delta-BAFF), and the decrease of BAFF protein release to the membrane and subsequent shedding.

Since no information is available regarding the expression of delta-BAFF in patients with pSS, we first analyzed the expression of delta-BAFF in blood and salivary gland epithelial cells of patients with pSS. We observed a decreased ratio of delta-BAFF to BAFF with disease activity or, ex vivo, after interferon stimulation, suggesting that increasing such a ratio might have a therapeutic effect.

Interestingly, the use of exon skipping to promote the expression of one shorter variant over the predominant full length mRNA has shown encouraging effects for the treatment of monogenic diseases and offers exciting therapeutic opportunities for many other diseases. We therefore hypothesized that targeting the splicing of BAFF mRNA using exon skipping and thereby decreasing BAFF may improve features of SS. The present study demonstrates that targeting the splicing of BAFF in salivary glands results in decreased dryness and lymphocytic infiltration.

Accordingly in a first aspect, there is provided an antisense oligonucleotide able to induce the skipping of an exon of a BAFF mRNA in order to produce a truncated form of a BAFF protein when present in a cell expressing the BAFF mRNA. Such oligonucleotide is said functional.

A preferred human full length BAFF protein is represented by an amino acid sequence comprising or consisting of SEQ ID NO: l . This preferred human full length BAFF protein is preferably encoded by a nucleic acid molecule represented by a nucleotide sequence comprising or consisting of SEQ ID NO:2.

A preferred murine full length BAFF protein is represented by an amino acid sequence comprising or consisting of SEQ ID NO:3. This preferred murine full length BAFF protein is preferably encoded by a nucleic acid molecule represented by a nucleotide sequence comprising or consisting of SEQ ID NO:4.

A preferred human truncated BAFF protein is represented by an amino acid sequence comprising or consisting of SEQ ID NO:5. This preferred human truncated BAFF protein is preferably encoded by a nucleic acid molecule represented by a nucleotide sequence comprising or consisting of SEQ ID NO:6.

A preferred murine truncated BAFF protein is represented by an amino acid sequence comprising or consisting of SEQ ID NO:7. This preferred murine truncated BAFF protein is preferably encoded by a nucleic acid molecule represented by a nucleotide sequence comprising or consisting of SEQ ID NO:8.

Preferably, an antisense oligonucleotide is such that in said cell less secretion of a full length BAFF protein is found compared to the secretion of the same full length BAFF protein in a cell wherein said oligonucleotide is not present. This is a preferred assay for testing the functionality of the oligonucleotide of the invention. Such

oligonucleotide may also be called an antisense oligonucleotide. A preferred cell is the cell line U937 or human salivary epithelial duct cells or human salivary gland cells (HSG).

Another cell may be a murine cell from a NOD mouse, preferably a salivary duct epithelial cells from said mouse or a cell from a treated human being. Depending on the model used, a full length/truncated BAFF protein is preferably a human full length/truncated or a murine full length./truncated proteins. Preferred human and murine full length/truncated BAFF proteins have already been defined herein. Preferred primers are identified in the experimental part. A preferred treated cell from a human being is a salivary epithelial duct cells. In this context less is at least 5% less or at least 10%, or at least 15%, or at least 20%, or at least 30%, or at least 40%, or at least 50%, or at least 60% or at least 70%, or at least 80%, or at least 90%, or at least 100% as assessed by Northern blotting. Most preferably, no full length BAFF is detectable outside of the cells.

The assessment of the functionality of said oligonucleotide may be carried out at the mRNA level, preferably using RT-PCR or Northern blotting. Alternatively, the assessment of the functionality may be carried out at the protein level, preferably using western blot analysis or immunofluorescence analysis of cross-sections. The experimental part described preferred ways of assessing the presence of a full length BAFF protein knowing preferred sequences of amino acid or preferred sequences of nucleotides encoding said amino acid sequences of a human/murine full

length/truncated BAFF as identified above. Preferred primers are identified in the experimental part.

An oligonucleotide of the invention may target or may be complementary to or may bind to an exonic sequence of a BAFF mRNA.

An oligonucleotide as used herein preferably comprises an antisense oligonucleotide or antisense oligoribonucleotide. In a preferred embodiment an exon skipping technique is applied. An antisense oligonucleotide is preferably

complementary to at least part of a BAFF exon, said part having at least 8, 10, 13, 15, 20 nucleotides. However, said part may also have at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides. A part of BAFF mRNA to which an oligonucleotide is complementary may also be called a contiguous stretch of a BAFF mRNA.

A preferred exon to which an oligonucleotide of the invention is complementary to or binds is part of exon 3 of a human BAFF mRNA or part of exon 4 of a murine BAFF mRNA. This oligonucleotide may comprise at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides. " Part of has been defined above. Exon 3 of a human BAFF mRNA corresponds to exon 4 of a murine BAFF mRNA. A preferred sequence of a nucleic acid encoding exon 3 of a human BAFF mRNA is represented by SEQ ID NO: 18. A preferred sequence of a nucleic acid encoding exon 4 of a murine BAFF mRNA is represented by SEQ ID NO: 19. Therefore a preferred oligonucleotide is encoded by a nucleic acid molecule that binds or is complementary to a contiguous stretch of SEQ ID NO: 18 or SEQ ID NO: 19. This contiguous stretch may have at least 8, 10, 13, 15, 20 nucleotides. However, said contiguous stretch may also have at least 8, 9, 10, 11, 12, 13, 14, 15, 16, 17 , 18, 19, 20, 21, 22, 23, 24, 25, 26, 27 , 28 , 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50 nucleotides.

A preferred murine BAFF antisense oligonucleotide is encoded by a nucleic acid molecule represented by a sequence comprising or consisting of SEQ ID NO:9. A preferred human BAFF antisense oligonucleotide is encoded by a nucleic acid molecule represented by a sequence comprising or consisting of SEQ ID NO:20.

The term complementarity is used herein to refer to a stretch of nucleic acids that can hybridise to another stretch of nucleic acids under physiological conditions. Different types of nucleic acid may be used to generate an oligonucleotide. Preferably, said oligonucleotide comprises RNA, as RNA/RNA hybrids are very stable. An

oligonucleotide may be modified in order to provide an additional property, for instance resistance to endonucleases, exonucleases, and RNaseH, additional hybridisation strength, increased stability (for instance in a bodily fluid), increased or decreased flexibility, reduced toxicity, increased intracellular transport, tissue- specificity, etc.

Dose ranges of oligonucleotide according to the invention are preferably designed on the basis of rising dose studies in clinical trials (in vivo use) for which rigorous protocol requirements exist. An oligonucleotide as defined herein may be used at a dose which is from 0.1 to 20 mg/kg. In vivo use include the use in an animal model such as a NOD mouse or in a patient.

In a preferred embodiment, a concentration of an oligonucleotide as defined herein, which is from 0.1 nM to 1 μΜ is used. Preferably, this range is for in vivo use in a cellular model such as a U937 cell or a human salivary gland (HSG) cell or in salivary duct epithelial cells from a NOD mouse.

The ranges of concentration or dose of oligonucleotide(s) as given above are preferred concentrations or doses for in vitro or ex vivo uses. The skilled person will understand that depending on the oligonucleotide(s) used, the target cell to be treated, the expression level of the BAFF gene, the medium used and the transfection and incubation conditions, the concentration or dose of oligonucleotide(s) used may further vary and may need to be optimised any further.

An oligonucleotide as defined herein for use according to the invention may be suitable for administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing Sjogren's syndrome, and may be administered in vivo, ex vivo or in vitro. Said oligonucleotide may be directly or indirectly administrated to a cell, tissue and/or an organ in vivo of an individual affected by or at risk of developing the

Sjogren's syndrome, and may be administered directly or indirectly in vivo, ex vivo or in vitro. A preferred tissue or organ is a salivary gland. A preferred cell is a ductal epithelial cell.

An oligonucleotide of the invention may be indirectly administrated using suitable means known in the art. An oligonucleotide may for example be provided to an individual or a cell, tissue or organ of said individual in the form of a vector or an expression vector wherein the vector or expression vector comprises a nucleic acid molecule encoding the antisense oligonucleotide. The expression vector is preferably introduced into a cell, tissue, organ or individual via a gene delivery vehicle. In a preferred embodiment, there is provided a viral vector comprising an expression cassette or a transcription cassette that drives expression or transcription of the antisense oligonucleotide as identified herein. A preferred delivery vehicle is a viral vector such as an adeno-associated virus vector (AAV), or a retroviral vector such as a lenti virus vector and the like. In vivo, vectors are delivered into the submandibular glands by retrograde ductal instillation using a thin cannula. This way of administration of a vector into a salivary gland is already known to the skilled person and has already been described (Katano H., et al, (20060, Gene Therapy, 13: 594-601).Accordingly, in a second aspect, there is provided a vector comprising a nucleic acid molecule encoding the antisense oligonucleotide as identified earlier herein. A preferred vector comprises a nucleic acid molecule encoding an antisense oligonucleotide as identified before, preferably said nucleic acid molecule encoding an antisense oligonucleotide comprises or consists of SEQ ID NO:9 or 20.

Also plasmids, artificial chromosomes, plasmids suitable for targeted homologous recombination and integration in the human genome of cells may be suitably applied for delivery of an oligonucleotide as defined herein. Preferred for the current invention are those vectors wherein a transcript is in the form of a fusion with the antisense oligonucleotide of the invention with a U7 transcripts, which yield good results for delivering small transcripts (Schumperli, D. Et al, Cell Mol. Life Sci., (2004), 61 :2560- 70). It is within the skill of the artisan to design suitable transcripts. Most preferred is a fusion transcript with a U7 transcript as described in the experimental part. A preferred nucleic acid molecule encoding a mus musculus U7 transcript is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 10. A preferred nucleic acid molecule encoding a murine U7 transcript is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 11. However, the oligonucleotide may also be encoded by the viral vector. Typically this is in the form of an RNA transcript that comprises the sequence of the oligonucleotide in a part of the transcript. A preferred vector comprises a nucleic acid molecule encoding a small nuclear protein U7 linked with a nucleic acid molecule encoding the antisense oligonucleotide of the invention. A preferred nucleic acid molecule encoding a murine small nuclear protein U7 linked with a nucleic acid molecule encoding a murine BAFF antisense oligonucleotide of the invention is represented by a nucleotide sequence comprising or consisting of SEQ ID NO: 12 A preferred vector of the invention comprising a nucleic acid molecule encoding a small nuclear protein U7 linked with a nucleic acid molecule encoding the antisense oligonucleotide of the invention is identified as AAV161 or AAV 162 and is represented by a nucleotide sequence identified as SEQ ID NO: 13 or 14. Most preferred is AAV 162.

When administering an oligonucleotide, it is preferred that an oligonucleotide is dissolved in a solution that is compatible with the delivery method. For intravenous, subcutaneous, intramuscular, intrathecal and/or intraventricular administration it is preferred that the solution is a physiological salt solution. Particularly preferred in the invention is the use of an excipient that will aid in delivery of each of the constituents as defined herein to a cell and/or into a cell. Preferred are excipients capable of forming complexes, nanoparticles, micelles, vesicles and/or liposomes that deliver each constituent as defined herein, complexed or trapped in a vesicle or liposome through a cell membrane. Many of these excipients are known in the art. Suitable excipients comprise polyethylenimine (PEI), or similar cationic polymers, including

polypropyleneimine or polyethylenimine copolymers (PECs) and derivatives, synthetic amphiphils (SAINT- 18), lipofectinTM, DOTAP and/or viral capsid proteins that are capable of self assembly into particles that can deliver each constitutent as defined herein to a cell.

The skilled person may select and adapt any of the above or other commercially available alternative excipients and delivery systems to package and deliver an oligonucleotide for use in the current invention to deliver it for the treatment of the Sjogren's syndrome in humans. A preferred oligonucleotide is for preventing or treating the SS in an individual. An individual which may be treated using an oligonucleotide of the invention may already have been diagnosed as having a SS. Alternatively an individual which may be treated using an oligonucleotide of the invention may not have yet been diagnosed as having a SS but may be an individual having an increased risk of developing a SS in the future given his or her genetic background. A preferred individual is a human being.

In a further aspect, there is provided a composition comprising an oligonucleotide or a vector as defined herein. In a preferred embodiment, said composition being preferably a pharmaceutical composition said pharmaceutical composition comprising a pharmaceutically acceptable carrier, adjuvant, diluent and/or excipient.

Such a pharmaceutical composition may comprise any pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient is also provided. Such pharmaceutically acceptable carrier, filler, preservative, adjuvant, solubilizer, diluent and/or excipient may for instance be found in Remington: The Science and Practice of Pharmacy, 20th Edition. Baltimore, MD: Lippincott Williams & Wilkins, 2000. Each feature of said composition has earlier been defined herein. In a further aspect, there is provided a vector as defined herein or an antisense oligonucleotide as defined herein, wherein the vector or the oligonucleotide is for treating the SS in a patient or for treating a patient predisposed to said syndrome.

In a further aspect, there is provided a method for treating the SS in a patient or for treating a patient predisposed to said syndrome by using the vector as defined herein or an antisense oligonucleotide as defined herein. A preferred method or use is for alleviating one or more symptom(s) of SS in an individual or alleviate one or more characteristic(s)of a salivary gland cell of said individual, the method comprising administering to said individual an oligonucleotide or a composition or a vector as defined herein. In a preferred embodiment, a symptom is dryness for mouth or eyes, fatigue and/or pain that could be assessed by a physician. Dryness for mouth may be assessed using the stimulated saliva test. Dryness for eyes may be assessed using the Schimmer test or tear break-up time. Fatigue and pain may be assessed using a questionnary. Pain may also be assessed using the VAS-score. All these test are known to the skilled person.

The diagnosis of SS is preferably assessed based on a global assay as described in Vitali, C. et al (Vitali C, et al (2002), Ann. Rheum. Dis., 61 : 554-8).

In a preferred method or use for alleviating one or more symptom(s) of SS in an individual, at least one of these symptoms (dryness for mouth, dryness for eyes, fatigue and/or pain and/or the global score as assessed using Vitali C. et al) is improved after at least one week, at least one month, 2, 3, 4,5 6, 7, 8, 9, 10, 11, 12 months of treatment by comparison to the same symptom in the same individual at the onset of the treatment.

In a preferred embodiment, a parameter is the amount of secreted full length BAFF. There is further provided a method for enhancing, inducing or promoting skipping of an exon from a BAFF mRNA in a cell expressing said mRNA in an individual suffering from SS, the method comprising administering to said individual an oligonucleotide or a composition or a vector as defined herein. In this method, preferably, an antisense oligonucleotide or a composition or a vector as defined herein is such that in a cell from said individual less secretion of a full length BAFF protein is found compared to the secretion of the same full length BAFF protein in a cell from the same individual at the onset of the treatment. A preferred cell is a human salivary epithelial duct cells from said individual. In this context less is at least 5% less or at least 10%, or at least 15%, or at least 20%>, or at least 30%>, or at least 40%>, or at least 50%, or at least 60% or at least 70%, or at least 80%, or at least 90%, or at least 100% as assessed by Northern blotting. Most preferably, no full length BAFF is detectable outside of the cells. The assessment of a full length BAFF protein may be assessed as earlier defined herein.

In one embodiment said method is performed in vivo, for instance using a cell culture or in an animal model such as a NOD mouse or in a human cell from a SS patient or in a salivary gland from a patient or in a patient.

A treatment in a use or in a method according to the invention is at least one week, at least one month, at least several months, at least one year, at least 2, 3, 4, 5, 6 years or more. Each antisense oligonucleotide or vector or composition as defined herein for use according to the invention may be suitable for direct administration to a cell, tissue and/or an organ in vivo of individuals affected by or at risk of developing SS, and may be administered directly in vivo, ex vivo or in vitro. The frequency of administration of an antisense oligonucleotide or vector or composition of the invention may depend on several parameters such as the age of the patient, the formulation of said molecule. The frequency may be ranged between at least once in two weeks, or three weeks or four weeks or five weeks or a longer time period. Within the context of the invention, in vitro preferably means a cell free system wherein cellular extracts comprising mRNA are being used and wherein exon skipping may be assessed. In vivo preferably means a cellular model or an animal model or in a human being. General information on vector for gene therapy

Some aspects of the invention concern the use of a vector comprising a nucleic acid molecule as defined above, wherein the vector is a vector that is suitable for gene therapy. Vectors that are suitable for gene therapy are described in Anderson 1998, Nature 392: 25-30; Walther and Stein, 2000, Drugs 60: 249-71; Kay et al, 2001, Nat. Med. 7: 33-40; Russell, 2000, J. Gen. Virol. 81 : 2573-604; Amado and Chen, 1999, Science 285: 674-6; Federico, 1999, Curr. Opin. Biotechnol.10: 448-53; Vigna and Naldini, 2000, J. Gene Med. 2: 308-16; Marin et al, 1997, Mol. Med. Today 3: 396- 403; Peng and Russell, 1999, Curr. Opin. Biotechnol. 10: 454-7; Sommerfelt, 1999, J. Gen. Virol. 80: 3049-64; Reiser, 2000, Gene Ther. 7: 910-3; and references cited therein.

A particularly suitable gene therapy vector includes an Adenoviral and Adeno- associated virus (AAV) vector. These vectors infect a wide number of dividing and non-dividing cell types. In addition adenoviral vectors are capable of high levels of transgene expression. However, because of the episomal nature of the adenoviral and AAV vectors after cell entry, these viral vectors are most suited for therapeutic applications requiring only transient expression of the transgene (Russell, 2000, J. Gen. Virol. 81 : 2573-2604; Goncalves, 2005, Virol J. 2(1):43) as indicated above. Preferred adenoviral vectors are modified to reduce the host response as reviewed by Russell (2000, supra).

A preferred retroviral vector for application in the present invention is a lentiviral based expression construct. Lentiviral vectors have the unique ability to infect non- dividing cells (Amado and Chen, 1999 Science 285 : 674-6). Methods for the construction and use of lentiviral based expression constructs are described in U.S. Patent No.'s 6,165,782, 6,207,455, 6,218,181, 6,277,633 and 6,323,031 and in Federico (1999, Curr Opin Biotechnol 10: 448-53) and Vigna et al. (2000, J Gene Med 2000; 2: 308-16).

Generally, gene therapy vectors will be considered expression vectors described above in the sense that they comprise a nucleic acid molecule encoding an antisense oligoncucleotide of the invention to be expressed, whereby said nucleic acid molecule is operably linked to the appropriate regulatory sequences as indicated above. Such regulatory sequence will at least comprise a promoter sequence. Suitable promoters for expression of a nucleotide sequence encoding a polypeptide from gene therapy vectors include e.g. cytomegalovirus (CMV) intermediate early promoter, viral long terminal repeat promoters (LTRs), such as those from murine moloney leukaemia virus (MMLV) rous sarcoma virus, or HTLV-1 , the simian virus 40 (SV 40) early promoter and the herpes simplex virus thymidine kinase promoter. Suitable promoters are described below.

Several inducible promoter systems have been described that may be induced by the administration of small organic or inorganic compounds. Such inducible promoters include those controlled by heavy metals, such as the metallothionine promoter (Brinster et al. 1982 Nature 296: 39-42; Mayo et al. 1982 Cell 29: 99-108), RU-486 (a progesterone antagonist) (Wang et al. 1994 Proc. Natl. Acad. Sci. USA 91 : 8180-8184), steroids (Mader and White, 1993 Proc. Natl. Acad. Sci. USA 90: 5603-5607), tetracycline (Gossen and Bujard 1992 Proc. Natl. Acad. Sci. USA 89: 5547-5551; U.S. Pat. No. 5,464,758; Furth et al. 1994 Proc. Natl. Acad. Sci. USA 91 : 9302-9306; Howe et al. 1995 J. Biol. Chem. 270: 14168-14174; Resnitzky et al. 1994 Mol. Cell. Biol. 14: 1669-1679; Shockett et al. 1995 Proc. Natl. Acad. Sci. USA 92: 6522-6526) and the tTAER system that is based on the multi- chimeric transactivator composed of a tetR polypeptide, as activation domain of VP16, and a ligand binding domain of an estrogen receptor (Yee et al, 2002, US 6,432,705).

A gene therapy vector may optionally comprise a second or one or more nucleic acid molecule coding for a polypeptide. A polypeptide may be a (selectable) marker polypeptide that allows for the identification, selection and/or screening for cells containing the expression construct. Suitable marker proteins for this purpose are e.g. the fluorescent protein GFP, and the selectable marker genes HSV thymidine kinase (for selection on HAT medium), bacterial hygromycin B phosphotransferase (for selection on hygromycin B), Tn5 aminoglycoside phosphotransferase (for selection on G418), and dihydro folate reductase (DHFR) (for selection on methotrexate), CD20, the low affinity nerve growth factor gene. Sources for obtaining these marker genes and methods for their use are provided in Sambrook and Russel (2001) "Molecular Cloning: A Laboratory Manual (3 ^rd edition), Cold Spring Harbor Laboratory, Cold Spring Harbor Laboratory Press, New York.

A vector, preferably a gene therapy vector is preferably formulated in a pharmaceutical composition as defined herein. Sequence identity

"Sequence identity" is herein defined as a relationship between two or more amino acid (polypeptide or protein) sequences or two or more nucleic acid (nucleotide, polynucleotide) sequences (SEQ ID NO), as determined by comparing the full length sequences or part thereof. Preferably the full length of two given SEQ ID NO is being used. Throughout this application, each time one refers to a specific nucleotide sequence SEQ ID NO, one may replace it by a nucleotide sequence comprising a nucleotide sequence that has at least 60%, 70%, 80%, 90%, 95%, 98%, 99% sequence identity or similarity with it.

Throughout this application, each time one refers to a specific amino acid sequence SEQ ID NO, one may replace it by a polypeptide comprising an amino acid sequence that has at least 60%, 70%, 80%, 90%, 95%, 98%, 99% sequence identity or similarity with it.

In the art, "identity" also means the degree of sequence relatedness between amino acid or nucleic acid sequences, as the case may be, as determined by the match between strings of such sequences. "Similarity" between two amino acid sequences is determined by comparing the amino acid sequence and its conserved amino acid substitutes of one polypeptide to the sequence of a second polypeptide. "Identity" and "similarity" can be readily calculated by known methods, including but not limited to those described in (Computational Molecular Biology, Lesk, A. M., ed., Oxford University Press, New York, 1988; Biocomputing: Informatics and Genome Projects, Smith, D. W., ed., Academic Press, New York, 1993; Computer Analysis of Sequence Data, Part I, Griffin, A. M., and Griffin, H. G., eds., Humana Press, New Jersey, 1994; Sequence Analysis in Molecular Biology, von Heine, G., Academic Press, 1987; and Sequence Analysis Primer, Gribskov, M. and Devereux, J., eds., M Stockton Press, New York, 1991; and Carillo, H., and Lipman, D., SIAM J. Applied Math., 48: 1073 (1988).

Preferred methods to determine identity are designed to give the largest match between the sequences tested. Methods to determine identity and similarity are codified in publicly available computer programs. Preferred computer program methods to determine identity and similarity between two sequences include e.g. the GCG program package (Devereux, J., et al, Nucleic Acids Research 12 (1): 387 (1984)), BestFit, BLASTP, BLASTN, and FASTA (Altschul, S. F. et al., J. Mol. Biol. 215 :403-410 (1990). The BLAST X program is publicly available from NCBI and other sources (BLAST Manual, Altschul, S., et al, NCBI NLM NIH Bethesda, MD 20894; Altschul, S . , et al., J. Mol. Biol. 215 :403-410 (1990). The well-known Smith Waterman algorithm may also be used to determine identity.

Preferred parameters for polypeptide sequence comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48:443-453 (1970); Comparison matrix: BLOSSUM62 from Hentikoff and Hentikoff, Proc. Natl. Acad. Sci. USA. 89: 10915-10919 (1992); Gap Penalty: 12; and Gap Length Penalty: 4. A program useful with these parameters is publicly available as the "Ogap" program from Genetics Computer Group, located in Madison, WI. The aforementioned parameters are the default parameters for amino acid comparisons (along with no penalty for end gaps).

Preferred parameters for nucleic acid comparison include the following: Algorithm: Needleman and Wunsch, J. Mol. Biol. 48 :443-453 (1970); Comparison matrix: matches=+10, mismatch=0; Gap Penalty: 50; Gap Length Penalty: 3. Available as the Gap program from Genetics Computer Group, located in Madison, Wis. Given above are the default parameters for nucleic acid comparisons.

Optionally, in determining the degree of amino acid similarity, the skilled person may also take into account so-called "conservative" amino acid substitutions, as will be clear to the skilled person. Conservative amino acid substitutions refer to the interchangeability of residues having similar side chains. For example, a group of amino acids having aliphatic side chains is glycine, alanine, valine, leucine, and isoleucine; a group of amino acids having aliphatic-hydroxyl side chains is serine and threonine; a group of amino acids having amide- containing side chains is asparagine and glutamine; a group of amino acids having aromatic side chains is phenylalanine, tyrosine, and tryptophan; a group of amino acids having basic side chains is lysine, arginine, and histidine; and a group of amino acids having sulphur-containing side chains is cysteine and methionine. Preferred conservative amino acids substitution groups are: valine-leucine-isoleucine, phenylalanine-tyrosine, lysine-arginine, alanine- valine, and asparagine-glutamine. Substitutional variants of the amino acid sequence disclosed herein are those in which at least one residue in the disclosed sequences has been removed and a different residue inserted in its place. Preferably, the amino acid change is conservative. Preferred conservative substitutions for each of the naturally occurring amino acids are as follows: Ala to ser; Arg to lys; Asn to gin or his; Asp to glu; Cys to ser or ala; Gin to asn; Glu to asp; Gly to pro; His to asn or gin; He to leu or val; Leu to ile or val; Lys to arg; gin or glu; Met to leu or ile; Phe to met, leu or tyr; Ser to thr; Thr to ser; Trp to tyr; Tyr to trp or phe; and, Val to ile or leu.

In this document and in its claims, the verb "to comprise" and its conjugations is used in its non-limiting sense to mean that items following the word are included, but items not specifically mentioned are not excluded. In addition the verb "to consist" may be replaced by "to consist essentially of meaning that an oligonucleotide or a

composition or a vector as defined herein may comprise feature(s) than the ones specifically identified, said additional feature(s) not altering the unique characteristic of the invention.

In addition, reference to an element by the indefinite article "a" or "an" does not exclude the possibility that more than one of the element is present, unless the context clearly requires that there be one and only one of the elements. The indefinite article "a" or "an" thus usually means "at least one".

All patent and literature references cited in the present specification are hereby incorporated by reference in their entirety.

The following examples are offered for illustrative purposes only, and are not intended to limit the scope of the present invention in any way.

Description of the figures Figure 1: Derived from a review by P Schneider et al. Current Opinion in Imunology, Volume 17, Issu e 3, June 2005, Pages 282-289 " The role of APRIL and BAFF in lymphocyte activation".

Figure 2: Schematic of BAFF and delta BAFF. BAFF and delta BAFF share the same pre-mRNA. Naturally occurring alternative splicing can lead to exon skipping that leads to mRNA encoding for delta BAFF. Figure 3: Exon skipping can be induced by an U7 antisense sequence that covers the exon and results in the removal of 2 introns and 1 exon in the mRNA instead of one intron. Figure 4: Schematic of action of delta BAFF. Delta BAFF binds to BAFF

intracellularly and inhibits secretion of BAFF, therefore BAFF is not available for binding to its receptors.

Figure 5: In vitro infection of lymphoma cell line U937 (that constitutively expresses but not secretes BAFF) with a lentiviral construct encoding for a U7 antisense reduced BAFF and increased delta BAFF mRNA over time. Northern blot of U937 cell RNA is shown for day 0, day 5, day 12 and day 14 after infection. Actin was used as a loading control. Figure 6: NOD mice develop lymphocytic foci in the salivary gland with age consisting of B and T cells. Left: focal infiltrates (in purple, arrows) in H&E staining. Middle: focus score with age. Shown is average focal infiltrates per mm ² of the submandibular gland counted in H&E cross sections of the SG, each dot represents one mouse. Top right: Salivary glands consists of two type of cells; ductal epithelial cells and secretory acinar cells. Bottom right: BAFF expression in 20 week old NOD mice. BAFF (brown staining) can clearly be seen in the ducts and in the infiltrating lymphocytes surrounding the ducts.

Figure 7: Schematic of experimental set up. Mice are cannulated at 10 weeks of age with an adeno-associated viral vector (AAV161) or a control vector LacZ and the outcome was analysed at 20 weeks of age.

Figure 8: The presence of BAFF was determined by IHC of paraffin sections. Therapy with the exon skipping inducing adeno-associated vector (from now on named

AAV161) reduced BAFF dramatically in the salivary gland of treated mice compared with control (LacZ). (Shown is average optical instenisity of the staining per mm ² . n=9 mice per group) Figure 9: Salivary flow at 20 weeks was increased for the AAV161 treated mice. Mice were anesthesized and salivary flow was induced by injection of pilocarpine. Saliva was collected for 20 minutes and corrected for body weight (BW). Figure 10: Overall inflammation was reduced in AAV161 treated mice. Focus score (average focal infiltrates per mm ² salivary gland section) was determined at 20 weeks. Treatment with AAV161 reduced focus score.

Figure 11: Sub analysis by IHC of treated and control mice showed dramatic reduction of B220+ cells (left panel) and CD138+ cells in the SG of treated mice. Shown is number of positive cells per mm ² in submandibular glands of mice).

Figure 12: genetic map of AAV161 Figure 13: genetic map of AAV 162

Examples

Example 1:

MATERIALS AND METHODS

Vector production

Pseudotyped AAV vectors were generated by packaging AAV2-based recombinant genomes in AAV capsids. The vector used in the study was produced by a three- plasmid transfection protocol. Briefly, HEK293 cells were tri-transfected with the adenovirus helper plasmid pXX6 (Xiao et al, 1998); a pAAV packaging plasmid expressing the rep and cap genes, and the relevant pAAV vector plasmid contaning the U7 antisens construct. The recombinant vector was purified by double-cesium chloride ultracentrifugation followed by dialysis against sterile phosphate-buffered saline (PBS). Viral genomes were quantified by real-time polymerase chain reaction and vector titers are expressed as viral genomes per milliliter (VG/ml).

Animals, vector administration and detection Female NOD mice (Jackson Laboratory, Bar Harbor, ME) were kept under specific pathogen free conditions in the animal facilities of the National Institute of Dental and Craniofacial Research (NIDCR). Animal protocols were approved by NIDCR Animal Care and Use Committee and the National Institutes of Health (NIH) Biosafety Committee. Vectors were delivered into the submandibular glands by retrograde instillation. In short, female NOD mice were anesthetized with a mild anesthesia (a combination of ketamine and xylazine) at the age of 10 weeks and 50 μΐ containing lxlO ¹¹ vector particles was administered to each submandibular gland by retrograde ductal instillation using a thin cannula (Intermedic PE10, Clay Adams, Parsippany, NJ) and sacrificed at 20 weeks of age. Salivary glands were removed, homogenized and total genomic DNA was isolated using DNeasy blood & tissue kit (Qiagen, Venlo, The Netherlands). The following primer/probe sets were designed for vector DNA detection in the murine U7 region: forward '5-GTAGCCATGCTCTAGCCACA-3 ' (SEQ ID

NO: 15), reverse 5'- CGGTGTGTGAGAGGGGCTTTG-3' (SEQ ID NO: 16) and probe 5'- CTAGGAAACC AGAGAAG-3 ' (SEQ ID NO: 17). Vector was detected using quantitative-polymerase chain reaction (Q-PCR) on an ABI StepOnePlus Real-Time PCR system (Applied Biosystems, Carlsbad, CA).

Quantification of BAFF and delta-BAFF mRNA

Primers specific for BAFF and delta-BAFF were used to detect the mRNA of BAFF and delta BAFF specifically. For in vitro: cells were infected with a lentiviral vector containing the exon skipping inducing U7 sequence and mRNA levels were followed for 2 weeks for levels of specific BAFF and delta BAFF mRNA. For mouse salivary glands, RNA was isolated from salivary glands collected in RNAeasy and levels of BAFF and delta BAFF mRNA was measured and compared.

The following primers were used: Murine primers

BAFF F AATAGCCTGTTTGCCTCACC (SEQ ID NO:21)

BAFF R GACTGTCTGCAGCTGATTTGC (SEQ ID NO:22) Delta BAFF F GGAATGAACCTCAGAAACAAACTTAC (SEQ ID NO:23)

Delta BAFF R CCGTGTATAGAACCTGGCTGTAG (SEQ ID NO:24)

BAFF non SP ch BAFFFo CATCACTCCGCAGAAGGAG (SEQ ID NO:25)

BAFF non SP ch BAFFRe GGAATTGTTGGGCAGTGTTT (SEQ ID NO:26)

Human primers

BAFF

Baff6 for : AGACAGTGAAACACCAACTATA (SEQ ID NO:27)

Baff6 rev: GGCGTAGGTCTTATCAGT (SEQ ID NO:28)

Delta BAFF

DBaffs-for : AGAAGAAACAGGATCTTACACA (SEQ ID NO:29)

DBaffs-revl : TGGCGTAGGTCTTATCAGT— -- (SEQ ID NO:30)

Saliva collection

Saliva collection was done at 20 weeks of age. Mice were anesthetized as described above and saliva secretion was induced by subcutaneous (sc) injection of pilocarpine (0.5 mg/kg BW; Sigma- Aldrich, St. Louis, MO). Stimulated whole saliva was collected for 20 minutes from the oral cavity with a hematocrit tube (Drummond Scientific Company, Broomall, PA) placed into a preweighed 0.5 ml microcentrifuge tube, and the volume was determined by weight.

Histological assessment and immunohistochemistry

One cross sectional part of the submandibular gland was embedded in paraffin and sections were cut at 5 μιη. Three sections were stained with hematoxylin and eosin (H&E) and focus score (FS) was determined for each mouse, in which one focus is defined as an average aggregate of 50 or more lymphocytes per 4 mm ² SG tissue. Other slides were stained with anti-CD 138 (BD, Breda, The Netherlands), anti-BAFF (Alexis Biochemicals, San Diego, CA), and anti- APRIL (Abeam, Cambridge, MA) after heat- induced citrate antigen-retrieval. Another cross-sectional part of the SG was collected and frozen into OCT compound and cut at 5 μιη. Sections were stained anti-CD4 (eBioscience, San Diego, CA), anti-CD8 (eBioscience), anti-CD 19 (BD), and anti-IgD (eBioscience). As a secondary antibody goat anti-rat-HRP (Southern Biotechnology, Birmingham, AL) was used. Determination of substes of plasma cell numbers in SG of NOD mice was done in paraffin embedded SG sections using HRP conjugated anti- mouse-IgA and anti-IgM (AbD serotec, Oxford, UK), and Ig (Jackson

immunoresearch, PA, USA). All peroxidase was developed by AEC substrate (Dako, Glostrup, Denmark). All sections were randomly analyzed by computer-assisted image analysis. The images of the high-power fields were analyzed using the Qwin analysis system (Leica, Cambridge, UK). Positive staining for the cellular markers was expressed as the number of positive cells/mm ² and the staining for the cytokine markers as integrated optical density (IOD)/mm ² .

Assessment of BAFF and delta-BAFF protein using western blotting

Salivary gland (SG) lysates made from snap frozen SG in the presence of protease inhibitors were analyzed by western blot and showed reduced BAFF and increased delta BAFF in treated mice compared with control mice.

Detection of autoantibody and immunoglobulin levels

Immunoglobulins (G, A and M) and autoantibodies against Ro- and La-antigens were determined in serum and SG protein extract. SGs were homogenized and the total protein was determined with BCA™ protein assay kit (Pierce, Rockford, IL). Samples were analyzed for autoantibodies against SSA/Ro using an in house validated ELISA method to detect 60-kD Ro peptide antibodies. The autoantibody against SSB/La (Alpha Diagnostic International, San Antonio, TX), and IgG, A and M (Bethyl Laboratories, Montgomery, TX) were measured by a commercial available ELISA kit according the manufacturer's protocol.

Quantification of cytokines

ELISA

The levels of several cytokines were determined in homogenized SGs and serum. Cytokines were measured commercially using a multiplex sandwich-ELISA assay (Aushon Biosystem, Billerica, MA). Values were corrected for protein content in the SG protein homogenates. Immunohistochemical stainings

In addition cytokines were tested by ELISA and by IHC using specific antibody for each cytokine to confirm local levels. Paraffin-embedded sections were dewaxed in xylene and rehydrated in a gradient of ethanol, followed by incubation with 30% hydrogen peroxidase in 0.1% sodium azide in PBS to block endogenous peroxidase activity. Antigen retrieval was performed by boiling the sections in citrate buffer (pH 6.0) for 10 minutes. TNF, IL-6, IL-10, IL-4, TGFbeta, IL-17, IL-1, IL-12P40 and IFNgamma expression were studied by staining the sections overnight at 4°C with specific anti bodies to the cytokines(Santa Cruz Biotechnology, Santa Cruz, CA and Dako, Glostrup, Denmark) in PBS containing 1 % bovine serum albumin (BSA). Subsequently, the sections were incubated with horseradish peroxidase (HRP)- conjugated secondary antibody in PBS containing 1% BSA and 10% normal human serum, for 30 minutes at room temperature. Signal amplification was performed by incubating the slides for 15 minutes with biotinylated tyramine (PerkinElmer, Boston, MA) followed by HRP-conjugated streptavidin (DakoCytomation, Glostrup, Denmark) as previously described (23 ) . Peroxidase activity was revealed using an amino ethylcarbazole substrate kit (SK-4200; Vector, Burlingame, CA). Sections were briefly counterstained with Mayer's hemalum solution (Fluka, St. Gallen, Switzerland). The sections were washed extensively between all steps, unless otherwise specified.

Statistical analysis

Differences in cytokines among experimental groups were assessed using the non- parametric Wilcoxon's ranksum test or parametric unpaired Student's t-test depending on the Gaussian distribution. Differences in all the other experiments were assessed using unpaired Student's t-test. All analyses were performed with GraphPad Prism statistical software (GraphPad Software Inc. version 5.01, La Jolla, CA) using a P value < 0.05 as statistically significant.

RESULTS

Prior to in vivo transduction of the salivary glands (SGs) of NOD mice, we confirmed that the over expression of a U7 antisense construct by a lentiviral vector in vitro was biologically active in reducing BAFF- and increasing delta BAFF mRNA expression. U937 cells were infected and total RNA was isolated. With Northern blotting using a probe for BAFF and delta BAFF and BAFF we demonstrated that in vitro expression of U7 induces ABAFF and reduces BAFF gene expression based on the clear difference in size of the band. On day 5 after infection already a significant increase in delta BAFF mRNA was observed with in parallel a reduction in BAFF mRNA (Figure 5). Thereafter, we analyzed the effect of an AAV vector expressing U7 antisense (AAV161) in vivo after local delivery to the SG. At week 20, mice were sacrificed and salivary glands were collected and embedded in paraffin. Sections were stained with a specific antibody for BAFF and analyzed by digital image analysis. In mice treated with the AAV161 vector expression of BAFF was significantly reduced in the SG compared to mice treated with the control vector (P<0.04, Figure 8). To investigate the effect of delivery of the AAV161 vector expressing the U7 antisense on SG function, stimulated saliva flow was measured at 20 weeks of age (10 weeks after delivery of AAV161). There was a significant difference (P = 0.01) between the mean saliva volume in the treatment group compared to the animals that were treated with a vector expressing a marker gene (LacZ), showing that the treatment with the AAV161 vector increases salivary flow rate in NOD mice (Figure 9).

To determine if the increase of SG activity was the result of reduced autoimmune activity in the glands, we compared the number of focal infiltrations of inflammatory cells within the SGs. Sections from the submandibular glands of AAV161 (N = 9) and LacZ (N = 10) treated mice sacrificed at 20 weeks were examined histologically with H&E staining to assess inflammatory infiltrates. Treatment with the AAV161 vector resulted in a decrease in focus score in NOD mice compared to group treated with the control vector (P<0.03, Figure 10). In addition to scoring the number of foci, infiltrating lymphocytes were phenotyped in the SG of both experimental groups. The paraffin embedded sections of the SGs were stained with specific antibodies for B cells (B220) and plasma cells (CD138). Both the Bcells (P=0.005) and the plasma cells (P<0.04) were significantly reduced in the mice that received AAV161 (Figure 11). CD4+ and CD8 + T cells were also reduced whereas minimal effect was seen on CD68+ and CDl lc+ cells.

To investigate if local expression of U7 antisense in the SG could change cytokine levels either systemically in the plasma or locally in the SGs, plasma samples and SG protein extracts were obtained from mice at 20 weeks (10 weeks post cannulation) and cytokine levels were measured by ELISA, and in the SG by immunohistochemical stainings. Overall a shift in pro -inflammatory to anti-inflammatory cytokine profile was observed locally in the SG.

Since the number of plasma cells were decreased in SGs we investigated the effect on IgG, IgM and IgA levels in serum and SG homogenates by ELISA. For all three subclasses differences in expression in SG and serum were observed between the treated and control group. In SG this was confirmed by immunohistochemical stainings using specific antibodies to IgA, IgM and Ig. In addition, sera from SS patients contain a number of identifiable autoantibodies directed against nuclear, cytoplasmic and cell surface components. Autoantibodies have also been reported to occur in NOD mice. Therefore, we compared autoantibody levels in plasma samples and SG homogenates from treated and non-treated mice. The autoantibodies anti-SSB and anti-Ro did show a decrease after treatment with AAV161 in serum and SG homogenates.

DISCUSSION

Downregulation of the epithelial expression of BAFF by interfering with the splicing of BAFF mRNA resulted in decreased dryness and salivary gland lymphocytic infiltrates in a mouse model of Sjogren's syndrome. The present results add new evidence to the pathogenic role of BAFF in autoimmune dryness and suggest the interest of exon skipping therapy in autoimmune diseases.

The rationale of targeting BAFF in autoimmunity is grounded on the numerous studies demonstrating the increase of BAFF in blood and target organs of patients with various autoimmune diseases (pSS, SLE, RA, juvenile arthritis, vasculitis, myositis, notably). Inhibition of BAFF was recently evaluated in patients with RA and SLE, with significant efficacy. In addition, BAFF transgenic mice develop arthritis, dryness and SLE-like glomerular lesions. Backcross of BAFF transgenic mice with TNF-alpha knock-out results in a marked increase of lymphomas, as observed in patients with pSS who have a 16-18 fold increased risk, with a marginal-zone phenotype, the most prominent /frequent histological subset in pSS patients. Of note, the effect on dryness of BAFF inhibition has never been evaluated to date, neither in BAFF transgenic mice nor in SLE mice models with SS-like manifestations like mrl/lpr or NZB/NZW mice. In some animal models, BAFF drives only partially the autoimmune process (AR Stohl 2010). However, phase II trials are ongoing to evaluate the effect of BAFF inhibition in patients with pSS, without any preclinical trials in mice. We hypothesized that specific targeting of BAFF in epithelial cells could play a therapeutic role in SS. The role of epithelial cells has been evidenced for a long time in SS, also called an "autoimmune epithelitis". Abnormalities of epithelial cells are observed in NOD/scid mice despite the absence of lymphocytes, or several weeks before lymphocytic infiltrates occur in NZB/ NZW mice stimulated with poly I:C. In SS, as well as in other autoimmune diseases like RA, BAFF is not only expressed by monocytes, dendritic cells, neutrophils, macrophages but also by T, B lymphocytes and epithelial cells. In salivary gland epithelial cells, epithelial production is greatly enhanced after stimulation of innate immunity, by viruses or synthetic agonists of TLRs. However, the pathogenic contribution of the epithelial secretion of BAFF with regards to the secretion of other cell populations is not known. To address this question, classical antagonists of BAFF could not be used, since monoclonal antibodies or soluble receptors, even expressed under salivary-specific promoter, may exert a systemic inhibition on membrane-bound BAFF on myeloid and lymphoid cells, and on soluble BAFF expressed by non epithelial cells. Interfering with BAFF mRNA splicing BAFF secretion affects only transduced cells, i.e epithelial cells. Moreover, delta-

BAFF is not secreted, its presence at cell surface is discussed, and does not bind to any known receptors. We therefore privileged a different therapeutic approach, using an exon-skipping strategy, to be capable to investigate in vivo the role of BAFF epithelial expression. This selective targeting of epithelial cells was demonstrated by the absence of any impact on serum cytokines, including BAFF, in the present study.

We chose to assess BAFF inhibition in the NOD model because of the pathogenic similarities of this model with pSS, which mimicks more closely the pathogenesis of the disease than BAFF transgenic mice, in which the pathogenesis is driven only by BAFF. Conversely, pathogenesis of SS in NOD mice is dependent on many pathogenic pathways, as it may be the case in patients with pSS. Last, a recent study demonstrated a decreased insulitis after systemic inhibition of BAFF. The first result of the study was the demonstration of BAFF decrease, in vitro using cell lines and in vivo. This decrease of BAFF was related to the increase of delta-BAFF, which results in BAFF decrease through intracellular compartmentalization and membrane shedding. This decrease was evidenced at the mR A and protein level. As expected, the decrease in vitro using myeolomonocytic or lymphoma cells was more pronounced than in vivo. This may be related to the vector used, to a higher number of cells infected in vitro than in vivo, and to the fact that these cells are high producers of BAFF and may be more sensitive to BAFF targeting. Thus, the decrease of BAFF could be demonstrated by classical PCR in cell lines but only using qPCR in vivo. Likewise, the increase of delta-BAFF mRNA level could only be evidenced using classical PCR in cell lines, probably for the same reasons, and due to difficulties to design qPCR specific primers for delta-BAFF (waiting for sequencing results).

However, even though the inhibition of BAFF secretion was probably incomplete, these X-fold differences in BAFF levels converted in a decrease of BAFF and increase of delta-BAFF proteins (to be checked!). Moreover, this ~2-fold decrease of BAFF can have profound effects on B cells. This is illustrated by the A/WySnJ Bcmd mouse strain with a hypoactive BAFF-R allele, in which only slightly reduced BAFF signaling significantly reduced B cell life span (ref 20,22 Nemazee JBC). In addition, increasing delta-BAFF also affects BAFF bioactivity independently of BAFF level, since heteromultitrimers of BAFF and delta-BAFF bind poorly to receptors compared to homomultimers of BAFF.

The second result of the study was the demonstration decreasing BAFF resulted in a marked improvement of dryness. The relatively large amount of mice and the blinded assessment of dryness certainly counterbalance the variability of the dryness in NOD mice.

Although the instillation of a null vector may contribute to increased inflammation and dryness in the NOD model through the stimulation of innate immunity, the effect of decreasing BAFF was significant not only compared to that control group but also compared to a non-instilled, "natural history", group of mice.

The mechanisms underlying BAFF-decreased related improvement of dryness may be numerous and difficult to dissect given that the pathogenesis of dryness remains uncertain in SS and since the fine analysis of lymphocyte subpopulations and cytokines that can be performed in the periphery is more difficult to achieve in salivary glands. Dryness in SS is envisioned as the result of epithe litis, activation of B-cells, autoantibodies, cytokine storm, matrix disorganization rather than the result of tissular damage due to lymphocytic infiltrates. Of note, B-cell targeting in one controlled trial using rituximab demonstrated a significant effect on dryness. Likewise, an open study of another drug targeting B cells, eprastuzumab (anti-CD22 antibody). In the present study, a significant decrease of B cells and plasma cells was observed in treated mice. The decrease of plasma cells, which is not reported in peripheral blood or spleen after systemic BAFF inhibition, might be related to prevention of the local activation of B cells by epithelial cells (Xu, et al) and formation of germinal- center like structures in salivary glands. It could thus be hypothesized that decreased activation and survival of B lymphocytes, including auto-reactive B cells may improve salivary flow through the decrease of T-cell activation, of B-cell proinflammatory cytokines, such as IL-6. One important pathogenic contribution of B cells to dryness could of course be the secretion of autoantibodies, including anti-M3 muscarinic receptors. The role of a decreased activation of effector T cells by epithelial cells cannot be ruled out, although B cells might play a more prominent role than effector T cells in BAFF-driven autoimmunity. The expansion of regulatory T cells, demonstrated in the pancreas concomitantly to the improvement of insulitis after systemic inhibition of BAFF, could also play a role and should be investigated.

The pathogenic role of APRIL, which shares two receptors with BAFF, was not addressed in the present study and little information is available in literature. Of interest, in the same laboratory and at the same time, dual inhibition of BAFF and APRIL using TACI-Fc resulted in decreased lymphocytic infiltrates but not in improvement of dryness (manuscript submitted). This might be related to a different mechanism of inhibition by a soluble receptor, having less or no impact on the intracellular processing of BAFF and epithelial activation, conversely to the present exon skipping strategy. Alternatively, APRIL may play a rather unexpected protective role in dryness.

This study illustrates the potential therapeutic interest of the modulation of mRNA in autoimmunity by exon skipping. This strategy, currently evaluated in clinical trials in monogenic muscular diseases, has tremendous advantages over classical "gene" therapy.

As proposed in SLE, delta-BAFF might reveal a relevant marker of disease activity in pSS, which lacks such markers; this has to be confirmed in prospective cohorts.

According to the present results, increasing delta-BAFF, either directly like in the present study, or indirectly by interfering with still unknown regulating factors, can be a therapeutic perspective of interest.

To conclude, the present study gives some new insights into the pathogenesis of Sjogren's syndrome, a paradigm model of autoimmune diseases. It sheds new light on the central role of resident cells of autoimmunity, epithelial cells, in BAFF-driven local activation of adaptive immunity. In addition, this study demonstrates improvement of dryness after BAFF selective inhibition in one of the most relevant models of pSS, which adds rationale for evaluating BAFF antagonists in clinical trials. Last, this study also represents a proof of concept of the efficacy of modulating mRNA splicing in autoimmune diseases.

BAFF has crucial role on B-cell maturation and activation, and T-cell activation and dependence of BAFF is higher in auto- than allo-reactive B cells. BAFF also play a chemotactic role, which may contribute to the inflammatory infiltrates observed in target organs of autoimmune diseases, including pSS.

Sequence of vector of figure 12 (SEP ID NO: 13)

CTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAA C CCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGG GCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGA GCGCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTG CGCAGCCTGAATGGCGAATGGATTCCAGACGATTGAGCGTCAAAATGTAGGTATTTCC ATGAGCGTTTTTCCGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAA GGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGT ATTGCGACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTG ATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAAT CGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTC GTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTG GTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTT TCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGG GCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGAT TAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGA CGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAA CCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGG T AAAAAAT GAGC GAT T AAC AAAAAT T AACGCGAAT T T AAC AAAA AT TAACGT TTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATC AACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTT GTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGAGACCTCTCAAAAAT AGCTACCCTCTCCGGCATGAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGT GATTTGACTGTCTCCGGCCTTTCTCACCCGTTTGAATCTTTACCTACACATTACTCAG GCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAA GGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCT TTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATT TATTGGATGTTGGAATCGTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTAT TTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGC CAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGG CATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTC ACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAG GTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATG TGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCAT GAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATT CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTG CTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGT GGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCC GTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTT GGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAA TTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAA CGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAAC TCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTAC TTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGG ACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCC GTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACA GATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTAC TCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTG AGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGC GTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACC AAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCA CCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTC GGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGG CGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCC AGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAG CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGC GTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCT CGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCC CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGCGCGCT CGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCC CGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGG TTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGC CACATACGCGTTTCCTAGGAAACCAGAGAAGGATCAAAGCCCCTCTCACACACCGGGG AGCGGGGAAGAGAACTGTTTTGCTTTCATTGTAGACCAGTGAAATTGGGAGGGGTTTT CCGACCGAAGTCAGAAAACCTGCTCCAAAAATTTACTTTTCAGTCATTCAAGACTGTC TGCAGCTGATTGCAGTTGCGGAAGTGCGTCTGTAGCGAGCCAGGGAAGGACATCAACT CCACTTTCGATGAGGGTGAGATCAAGGTGCCATTTCCACACCCCTCCACTGATATGTG AATCACAAAGCACAGTTCCTTATTCGGTTCGATAAACAATATTCTAAAAGACTATTAA AACCGCTCGTTTCTTGAGTTTGTGACCGCTTGTAAAGGCTATGCAAATGAGTCAGTGC TGATTGGCTGAAAACAGCCAATCACAGCTCCTATGTTGTTAT

Sequence of vector of figure 13 (SEP ID NO: 14)

CTAGAGCATGGCTACGTAGATAAGTAGCATGGCGGGTTAATCATTAACTACAAGGAA C CCCTAGTGATGGAGTTGGCCACTCCCTCTCTGCGCGCTCGCTCGCTCACTGAGGCCGG GCGACCAAAGGTCGCCCGACGCCCGGGCTTTGCCCGGGCGGCCTCAGTGAGCGAGCGA GCGCGCCAGCTGGCGTAATAGCGAAGAGGCCCGCACCGATCGCCCTTCCCAACAGTTG CGCAGCCTGAATGGCGAATGGATTCCAGACGATTGAGCGTCAAAATGTAGGTATTTCC ATGAGCGTTTTTCCGTTGCAATGGCTGGCGGTAATATTGTTCTGGATATTACCAGCAA GGCCGATAGTTTGAGTTCTTCTACTCAGGCAAGTGATGTTATTACTAATCAAAGAAGT ATTGCGACAACGGTTAATTTGCGTGATGGACAGACTCTTTTACTCGGTGGCCTCACTG ATTATAAAAACACTTCTCAGGATTCTGGCGTACCGTTCCTGTCTAAAATCCCTTTAAT CGGCCTCCTGTTTAGCTCCCGCTCTGATTCTAACGAGGAAAGCACGTTATACGTGCTC GTCAAAGCAACCATAGTACGCGCCCTGTAGCGGCGCATTAAGCGCGGCGGGTGTGGTG GTTACGCGCAGCGTGACCGCTACACTTGCCAGCGCCCTAGCGCCCGCTCCTTTCGCTT TCTTCCCTTCCTTTCTCGCCACGTTCGCCGGCTTTCCCCGTCAAGCTCTAAATCGGGG GCTCCCTTTAGGGTTCCGATTTAGTGCTTTACGGCACCTCGACCCCAAAAAACTTGAT TAGGGTGATGGTTCACGTAGTGGGCCATCGCCCTGATAGACGGTTTTTCGCCCTTTGA CGTTGGAGTCCACGTTCTTTAATAGTGGACTCTTGTTCCAAACTGGAACAACACTCAA CCCTATCTCGGTCTATTCTTTTGATTTATAAGGGATTTTGCCGATTTCGGCCTATTGG T AAAAAAT GAGC GAT T AAC AAAAAT T AACGCGAAT T T AAC AAAA AT TAACGT TTACAATTTAAATATTTGCTTATACAATCTTCCTGTTTTTGGGGCTTTTCTGATTATC AACCGGGGTACATATGATTGACATGCTAGTTTTACGATTACCGTTCATCGATTCTCTT GTTTGCTCCAGACTCTCAGGCAATGACCTGATAGCCTTTGTAGAGACCTCTCAAAAAT AGCTACCCTCTCCGGCATGAATTTATCAGCTAGAACGGTTGAATATCATATTGATGGT GATTTGACTGTCTCCGGCCTTTCTCACCCGTTTGAATCTTTACCTACACATTACTCAG GCATTGCATTTAAAATATATGAGGGTTCTAAAAATTTTTATCCTTGCGTTGAAATAAA GGCTTCTCCCGCAAAAGTATTACAGGGTCATAATGTTTTTGGTACAACCGATTTAGCT TTATGCTCTGAGGCTTTATTGCTTAATTTTGCTAATTCTTTGCCTTGCCTGTATGATT TATTGGATGTTGGAATCGTCCTGATGCGGTATTTTCTCCTTACGCATCTGTGCGGTAT TTCACACCGCATATGGTGCACTCTCAGTACAATCTGCTCTGATGCCGCATAGTTAAGC CAGCCCCGACACCCGCCAACACCCGCTGACGCGCCCTGACGGGCTTGTCTGCTCCCGG CATCCGCTTACAGACAAGCTGTGACCGTCTCCGGGAGCTGCATGTGTCAGAGGTTTTC ACCGTCATCACCGAAACGCGCGAGACGAAAGGGCCTCGTGATACGCCTATTTTTATAG GTTAATGTCATGATAATAATGGTTTCTTAGACGTCAGGTGGCACTTTTCGGGGAAATG TGCGCGGAACCCCTATTTGTTTATTTTTCTAAATACATTCAAATATGTATCCGCTCAT GAGACAATAACCCTGATAAATGCTTCAATAATATTGAAAAAGGAAGAGTATGAGTATT CAACATTTCCGTGTCGCCCTTATTCCCTTTTTTGCGGCATTTTGCCTTCCTGTTTTTG CTCACCCAGAAACGCTGGTGAAAGTAAAAGATGCTGAAGATCAGTTGGGTGCACGAGT GGGTTACATCGAACTGGATCTCAACAGCGGTAAGATCCTTGAGAGTTTTCGCCCCGAA GAACGTTTTCCAATGATGAGCACTTTTAAAGTTCTGCTATGTGGCGCGGTATTATCCC GTATTGACGCCGGGCAAGAGCAACTCGGTCGCCGCATACACTATTCTCAGAATGACTT GGTTGAGTACTCACCAGTCACAGAAAAGCATCTTACGGATGGCATGACAGTAAGAGAA TTATGCAGTGCTGCCATAACCATGAGTGATAACACTGCGGCCAACTTACTTCTGACAA CGATCGGAGGACCGAAGGAGCTAACCGCTTTTTTGCACAACATGGGGGATCATGTAAC TCGCCTTGATCGTTGGGAACCGGAGCTGAATGAAGCCATACCAAACGACGAGCGTGAC ACCACGATGCCTGTAGCAATGGCAACAACGTTGCGCAAACTATTAACTGGCGAACTAC TTACTCTAGCTTCCCGGCAACAATTAATAGACTGGATGGAGGCGGATAAAGTTGCAGG ACCACTTCTGCGCTCGGCCCTTCCGGCTGGCTGGTTTATTGCTGATAAATCTGGAGCC GGTGAGCGTGGGTCTCGCGGTATCATTGCAGCACTGGGGCCAGATGGTAAGCCCTCCC GTATCGTAGTTATCTACACGACGGGGAGTCAGGCAACTATGGATGAACGAAATAGACA GATCGCTGAGATAGGTGCCTCACTGATTAAGCATTGGTAACTGTCAGACCAAGTTTAC TCATATATACTTTAGATTGATTTAAAACTTCATTTTTAATTTAAAAGGATCTAGGTGA AGATCCTTTTTGATAATCTCATGACCAAAATCCCTTAACGTGAGTTTTCGTTCCACTG AGCGTCAGACCCCGTAGAAAAGATCAAAGGATCTTCTTGAGATCCTTTTTTTCTGCGC GTAATCTGCTGCTTGCAAACAAAAAAACCACCGCTACCAGCGGTGGTTTGTTTGCCGG ATCAAGAGCTACCAACTCTTTTTCCGAAGGTAACTGGCTTCAGCAGAGCGCAGATACC AAATACTGTCCTTCTAGTGTAGCCGTAGTTAGGCCACCACTTCAAGAACTCTGTAGCA CCGCCTACATACCTCGCTCTGCTAATCCTGTTACCAGTGGCTGCTGCCAGTGGCGATA AGTCGTGTCTTACCGGGTTGGACTCAAGACGATAGTTACCGGATAAGGCGCAGCGGTC GGGCTGAACGGGGGGTTCGTGCACACAGCCCAGCTTGGAGCGAACGACCTACACCGAA CTGAGATACCTACAGCGTGAGCTATGAGAAAGCGCCACGCTTCCCGAAGGGAGAAAGG CGGACAGGTATCCGGTAAGCGGCAGGGTCGGAACAGGAGAGCGCACGAGGGAGCTTCC AGGGGGAAACGCCTGGTATCTTTATAGTCCTGTCGGGTTTCGCCACCTCTGACTTGAG CGTCGATTTTTGTGATGCTCGTCAGGGGGGCGGAGCCTATGGAAAAACGCCAGCAACG CGGCCTTTTTACGGTTCCTGGCCTTTTGCTGGCCTTTTGCTCACATGTTCTTTCCTGC GTTATCCCCTGATTCTGTGGATAACCGTATTACCGCCTTTGAGTGAGCTGATACCGCT CGCCGCAGCCGAACGACCGAGCGCAGCGAGTCAGTGAGCGAGGAAGCGGAAGAGCGCC CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGCTGCGCGCT CGCTCGCTCACTGAGGCCGCCCGGGCAAAGCCCGGGCGTCGGGCGACCTTTGGTCGCC CGGCCTCAGTGAGCGAGCGAGCGCGCAGAGAGGGAGTGGCCAACTCCATCACTAGGGG TTCCTTGTAGTTAATGATTAACCCGCCATGCTACTTATCTACGTAGCCATGCTCTAGA TAACAACATAGGAGCTGTGATTGGCTGTTTTCAGCCAATCAGCACTGACTCATTTGCA TAGCCTTTACAAGCGGTCACAAACTCAAGAAACGAGCGGTTTTAATAGTCTTTTAGAA TATTGTTTATCGAACCGAATAAGGAACTGTGCTTTGTGATTCACATATCAGTGGAGGG GTGTGGAAATGGCACCTTGATCTCACCCTCATCGAAAGTGGAGTTGATGTCCTTCCCT GGCTCGCTACAGACGCACTTCCGCAATATAGTCGGCGTGTCGCTGTCTGCAATCAGCT GCAGACAGAATTTTTGGAGCAGGTTTTCTGACTTCGGTCGGAAAACCCCTCCCAATTT CACTGGTCTACAATGAAAGCAAAACAGTTCTCTTCCCCGCTCCCCGGTGTGTGAGAGG GGCTTTGATCCTTCTCTGGTTTCCTAGGAAACGCGTATGTGG