I. FIELD OF THE INVENTION The present invention relates to improved methods, kits, and compositions for amplification and detection of target nucleic acids by releasing separated functional equivalents in a geometric manner thereby permitting specific detection of target nucleic acid sequences. Applications include but are not limited to areas of disease diagnostics, infection, or other medical conditions relevant to the field of human, animal and plant health.

II. BACKGROUND OF THE INVENTION Throughout this specification, reference is made to various patents and publications.

The disclosures of all such patents and publications in their entireties are expressly incorporated herein by reference.

DNA microarrays, in a form disclosed in U. S. Patent No. 5,800, 992 (Fodor, et al.), significantly improved measurements of gene transcript abundance. In an array experiment, gene-specific oligonucleotides or polynucleotides representing the unique portions of the RNA transcripts are individually arrayed on a single matrix. This matrix is then simultaneously probed with fluorescently labeled cDNA representative of total RNA pools from experiment and reference cells. This allows one to determine the relative amount of gene transcript present between 2 states under investigation based on the relative intensity of individual spots. A related approach disclosed in U. S. Patent No. 6,040, 138 (Lockhart, et al. ) addressed the quantitation of gene transcript abundance of a single pool of cells.

A clear limitation to microarray experiments with fluorescently labeled probes is the large amount of nucleic acid target required per hybridization. To achieve adequate fluorescence above background in RNA measurements, for example, the total RNA required per target, per array, is about 50-200 lg (2-5 pg are required when using poly (A) + RNA). For mRNA present as a single transcript per cell (approximately 1 out of 100,000 transcripts in a cell), applying target derived from 100 Rg of total RNA over an 800 mm2 hybridization area (approx. 1 inch by 1 inch) containing 200 um diameter probe spots will result in approximately 300 transcripts being sufficiently close to the probes to have a chance to hybridize (Duggan, D. et al, Expression profiling using cDNA microarrays, Nature Genetics Supplement, vol 21, Jan 1999). Thus, if the fluorescently labeled transcripts are, on average, 600 bp and have an average of 2 fluor tags per 100 bp and all of them hybridize to their probe, then approximately 12 fluors will be present in a 100 tlm2 scanned pixel from that probe (approx 10 um by 10 Am). Such low levels of signal are at the lower limit of fluorescence detection, and could easily be rendered undetectable by the assay noise in contemporary arrays. These considerations translate into approximately 3 to at most 4 orders of linear dynamic range for detection by microarray technology with fluorescently labeled probes and could easily miss potentially large numbers of targets fluctuating at ranges outside the detection limit.

To address this detection limit, target RNA can be amplified by polymerase chain reaction ("PCR"), as disclosed in U. S. Pat. No. 4,683, 195 (Mullis et al. , 1987). PCR comprises treating separate complementary strands of the selected nucleic acid molecule with a molar excess of 2 oligonucleotide primers. The primers permit formation of complementary primer extension products, which then act as templates for a next round of synthesis of the selected nucleic acid sequence. Therefore, the selected sequence is amplified and can be detected via many means. One of the variations to this method is the 5'-nuclease assay with a self-quenching fluorescent probe, as disclosed in U. S. Pat. No.

5,538, 848 (Livak, et al., 1996). This technology allows real time detection of the PCR amplification products and involves the use of an oligonucleotide probe that specifically anneals to a region of the target polynucleotide"downstream, "i. e. in the direction of extension, of primer binding sites. The probe contains a fluorescent"reporter"molecule and a"quencher"molecule such that whenever the reporter molecule is excited, the energy of the excited state non-radiatively transfers to the quencher molecule where it either dissipates non-radiatively or is emitted at a different emission frequency than that of the reporter molecule. During strand extension by a DNA polymerase, the probe anneals to the template where it is digested by the 5'->3'exonuclease activity of the polymerase. Upon digestion, the quencher molecule is no longer close enough to the reporter molecule to quench emissions by energy transfer. Thus, as more and more probes get digested during amplification, a stronger and stronger fluorescent signal is generated.

This technology has been commercialized and is currently available from many vendors including Applied Biosystems (Foster City, California). It is asserted that this gives 7 orders linear dynamic detection range. Furthermore, because of cycling between denaturing and extension temperatures, the technology synchronizes the synthesis of new amplicons and thus permits finer quantification of amplified products, which in turn serves to quantify the original target nucleic acids. While this is an improvement over the microarray technology mentioned above with a greater dynamic range and providing far superior quantitation, only a few assays can be carried out simultaneously because of the potential interaction among different PCR primers. The current paradigm for gene expression profiling is to use microarrays for an initial rough global screen of expression pattern changes followed by detailed characterization of genes of interest by, for example, 5'-nuclease assays.

In an alternative approach, U. S. Patents 4,876, 187 and 5,011, 769 (both to Duck et al.) disclose nucleotide sequences having scissile linkages that are useful for the detection of selected nucleic acid sequences. Both utilize an RNA-DNA duplex wherein the RNA is hydrolyzed by RNase H. U. S. Pat. No. 5,011, 769 specifically describes a RNA-DNA chimeric probe where the DNA is between 1 and about 20 bases. In addition, U. S. Pat. No.

6,135, 533 discloses cycling probe cleavage detection of nucleic acid sequences. In a further refinement of the cycling probe cleavage detection, U. S. Pat. No. 5, 731, 146 discloses compositions and methods for detecting target nucleic acid sequences utilizing adjacent sequence-enzyme molecules. U. S. Pat. No. 6,135, 533 discloses additives for use in cycling probe reactions such as ribosomal proteins to increase its cleavage efficiency thus improving overall detection limit.

The five patents in the above paragraph address linear amplification and detection of target nucleic acids. This method falls short of reaching the dynamic range afforded by PCR-based 5-nuclease assays. It is thus difficult to detect those genes expressed at lower abundance using this method.

III. SUMMARY OF THE INVENTION The invention described herein addresses the unmet needs for accurate amplification and detection of nucleic acid samples.

A number of embodiments are described immediately below, to convey various aspects of the invention. The description below is not intended to be a complete enumeration of all possible embodiments. A more complete description of the possible embodiments may be inferred and/or generated from the detailed specification of the invention as described in Section V.

In accordance with one of the objects of the present invention, there is provided a method of detecting a target nucleic acid comprising the steps of : (a) Providing a first composition comprising a nucleic acid target; (b) Providing a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zl-Nl, wherein Zz contains one or more scissile linkages and wherein a portion of Zl is complementary to a portion of said nucleic acid target; (c) Providing a third composition comprising a set of probes, at least one of which contains a single stranded sequence structure Z2-N2, wherein Z2 contains one or more scissile linkages and wherein a portion of Z2 is complementary to Nl and wherein a portion of N2 is complementary to a portion of Z I- (d) Providing a fourth composition comprising one or more agents capable of cleaving chemical bonds at the scissile linkages of Zl and Z2; (e) Allowing said first and fourth compositions to contact said second and third compositions under conditions such that (i) the fourth composition cleaves the scissile linkage in Z, only after either said nucleic acid target or a free portion of N2 hybridizes to a portion of Zi, and (ii) the fourth composition cleaves the scissile linkage in Z2 only after a free portion of N, hybridizes to a portion of Z2 ; (f) Detecting one or more portions of the second or third compositions and thereby detecting said nucleic acid target.

In accordance with one of the objects of the present invention, there is provided a method of detecting a target nucleic acid comprising the steps of : (a) Providing a first composition comprising a nucleic acid target; (b) Providing a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Z,-N1, wherein Z1 contains one or more scissile linkages and wherein a portion of Zl is complementary to a portion of said nucleic acid target; (c) Providing a third composition comprising multiple sets of probes, at least one probe in each set containing a single stranded sequence structure Zn-Nn, wherein n is an integer greater than 1, and wherein Zn contains one or more scissile linkages and wherein a portion of Zn is complementary to a portion of Nn-1, and wherein a portion of Nn is complementary to a portion of Z"and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zi-Ni, wherein i is an integer greater than 1 and less than n, and wherein Z ; contains one or more scissile linkages, and wherein a portion of Zi is complementary Ni l.

(d) Providing a fourth composition comprising one or more agents capable of cleaving chemical bonds at the scissile linkages of each Zl, Zi and Zn ; (e) Allowing said first and fourth compositions to contact said second and third compositions under conditions such that (i) the fourth composition cleaves the scissile linkage in Z1 only after either said nucleic acid target or a free portion of hybridizes to a portion of Zi, and (ii) the fourth composition cleaves the scissile linkage in each Zi only after a free portion of Ni l hybridizes to a portion of Zi, and (iii) the fourth composition cleaves the scissile linkage in each Zn only after a free portion of N"_1 hybridizes to a portion ofen.

(f) Detecting one or more portions of the second or third compositions and thereby detecting said nucleic acid target.

In accordance with one of the objects of the present invention, there is provided a method of providing multiple functional equivalents of a target nucleic acid comprising the steps of : (a) Providing a first composition comprising a nucleic acid target; (b) Providing a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zi-N1, wherein Z contains one or more scissile linkages and wherein a portion of Z, is complementary to a portion of said nucleic acid target ; (c) Providing a third composition comprising a set of probes, at least one of which contains a single stranded sequence structure Z2-N2, wherein Z2 contains one or more scissile linkages and wherein a portion of Z2 is complementary to Nl and wherein a portion of N2 is complementary to a portion of ZI ; (d) Providing a fourth composition comprising one or more agents capable of cleaving chemical bonds at the scissile linkages of Zl and Z2; (e) Allowing said first and fourth compositions to contact said second and third compositions under conditions such that (i) the fourth composition cleaves the scissile linkage in Zl only after either said nucleic acid target or a free portion of N2 hybridizes to a portion of Zi, and (ii) the fourth composition cleaves the scissile linkage in Z2 only after a free portion of Nl hybridizes to a portion of Z2 ; (f) Creating one or more portions of the third compositions and thereby creating multiple functional equivalents of said nucleic acid target.

In accordance with one of the objects of the present invention, there is provided a method of providing multiple functional equivalents a target nucleic acid comprising the steps of : (a) Providing a first composition comprising a nucleic acid target; (b) Providing a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zi-N1, wherein Z1 contains one or more scissile linkages and wherein a portion of Z, is complementary to a portion of said nucleic acid target ; (c) Providing a third composition comprising multiple sets of probes, at least one probe in each set containing a single stranded sequence structure Zn-Nn, wherein n is an integer greater than 1, and wherein Zn contains one or more scissile linkages and wherein a portion of is complementary to a portion of Nn-1, and wherein a portion of Nn is complementary to a portion of Zl, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zi-Ni, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Zi is complementary Ni l.

(d) Providing a fourth composition comprising one or more agents capable of cleaving chemical bonds at the scissile linkages of each Zl, Zi and Zn ; (e) Allowing said first and fourth compositions to contact said second and third compositions under conditions such that (i) the fourth composition cleaves the scissile linkage in Zl only after either said nucleic acid target or a free portion of hybridizes to a portion of Zi, and (ii) the fourth composition cleaves the scissile linkage in each Zi only after a free portion of Nj l hybridizes to a portion of Zi, and (iii) the fourth composition cleaves the scissile linkage in each Zn only after a free portion of Nn l hybridizes to a portion of n.

(f) Creating one or more portions of the third compositions and thereby creating multiple functional equivalents of said nucleic acid target.

In accordance with one of the objects of the present invention, there is claimed a composition consisting of probes that can hybridize to a target nucleic acid comprising: (a) a first composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zl-Nl, wherein Z1 contains one or more scissile linkages and wherein a portion of Zl is complementary to a portion of a nucleic acid target; (b) a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zn-Nn, wherein n is an integer greater than 1, and wherein Zn contains one or more scissile linkages and wherein a portion of is complementary Nn-1, and wherein a portion of N. is complementary to a portion of Zi, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zi-Nj, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Zi is complementary Nj l.

In accordance with one of the objects of the present invention, there is claimed a kit consisting of a one or more solid supports comprising: (a) a first composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zl-N1, wherein Z1 contains one or more scissile linkages and wherein a portion of Zl is complementary to a portion of a nucleic acid target ; (b) a second composition comprising a set of probes, at least one of which contains a single stranded sequence structure Zn-Nn, wherein n is an integer greater than 1, and wherein Zn contains one or more scissile linkages and wherein a portion of is complementary Nn l, and wherein a portion of is complementary to a portion of Zi, and, if n is greater than 2, one or more additional sets of probes, at least one probe in each set containing a single stranded sequence structure Zi-Nj, wherein i is an integer greater than 1 and less than n, and wherein Zi contains one or more scissile linkages, and wherein a portion of Zi is complementary Ni. ;.

IV. BRIEF DESCRIPTION OF THE DRAWINGS Figure 1: An example geometric amplification cycle using the two-probe case.

Figure 2. Example arrangement of two sets of probes on a slide.

Figure 3. Example sandwich arrangement of two sets of probes between two slides.

Figure 4. Concentrations of the various compounds as a function of time in seconds during TCR.

Figure 5. Time required to convert half the probes as function of sample concentration.

Figure 6. Similarity between experiment and simulation V. DETAILED DESCRIPTION OF THE INVENTION Problems in prior art such as the detection of nucleic acid samples in extremely low dilutions are solved by our invention involving methods, kits and compositions. The present invention builds on the cycling probe technology concepts while offering a mechanism that promotes a geometric release of functional equivalents of the sample via cleavage of probes. In one embodiment the invention operates isothermally with amplification power that approximates PCR. Optionally, cycling between denaturing and cleavage temperatures offers the same quantification advantage enjoyed by the 5'-nuclease assays.

The technology is dubbed Tsunami Chain Reaction (TCR) to reflect the high amplification that is achievable. In a preferred embodiment, TCR can be deployed in an array format to offer massively parallel assays for many genes with fluorescent detection just like regular microarrays but without for example dual dye-based comparisons. On the other hand, TCR can be made to be a homogeneous assay and with greater precision in quantification just like the 5'-nuclease assay. TCR on arrays is thus efficient for carrying out gene expression profiling.

Our invention allows detection of extremely small concentrations of target DNA, down to a single molecule in a test volume. Consider a target nucleic acid of interest, for example, the cDNA synthesized from the viral RNA genome derived from viruses present in the serum of HIV infected patients. A practical example would involve detection of extremely low concentration of viruses, such as 50 HIV viral particles in one milliliter of serum. Since most of array-based experiments can only handle about 20-microliter volumes, this small volume corresponds to being able to detect a single cDNA molecule without concentrating the serum. Because of the geometric amplification offered by TCR, it is possible to detect a single copy cDNA molecule.

There are three terms to describe linkages in double stranded DNA that need clarification in this patent: Scissile, nickable, and cleavable. A scissile linkage usually describes some modification to the DNA structure to make a particular nucleotide- nucleotide bond more susceptible to hydrolysis than other nucleotide-nucleotide bonds. A nickable linkage is a bond between nucleotides on a single strand that can be hydrolyzed by some nicking agent. A cleavable linkage refers to bonds between nucleotides close to each other on both strands that can be hydrolyzed by some cleaving agent. In the usual sense of the word, a scissile linkage on a single strand is a subset of a nickable linkage, because only one strand usually contains the modified bond. However, this patent will use a broader definition of the term scissile so that it is interchangeable with nicking. This is straightforward when a DNA bond has been modified, for example, by exchanging one of the bases on one of the strands to RNA. However, it is different when we consider nicking enzymes. In this case, and for the purposes of this patent, the scissile linkage will be associated with the particular DNA sequence allowing the nicking agent to hydrolyze the nucleotide bonds on only one strand. For example, consider the nicking enzyme N. BbvC IA from New England Biolabs. Operating on double stranded DNA, it recognizes the sequence GC'TGAGG and cuts only one strand between the C and T. This patent will consider the C-T bond in GCTGAGG as a scissile linkage because only a single strand is cut. Furthermore, a restriction enzyme cutting only one strand of double-stranded DNA (because, for example, the other side is intentionally already cut) will be considered to act on a scissile linkage, namely the restriction site on the un-cut strand. However, a restriction enzyme acting to cleave double stranded DNA by hydrolyzing both strands will not be considered acting on a scissile linkage because more than a single bond is cut.

Figure 1 is discussed in Example 1. It is provided as a simple example TCR cycle to generate 2,4, 8, and in general, 2k functional equivalents, where k is the number of iterations, in a simple case where there are only two probe sets. The terminology "functional equivalent"is used instead of"identical"due the following: A target nucleic acid could be quite long, say 100 kilobases, but only, for example, 30 contiguous bases of it might hybridize to a probe. In this case, a functional equivalent might be this sequence of 30 deoxyribonucleic bases in the overall target sequence, or it could of course be a longer sequence up to the full 100 kilobase sequence even though only 30 bases are needed for interaction with the probe. It is the interaction of the functional equivalents with the probes that results in the TCR cycle. The elements of the invention are clarified below.

In order to start the array chain reaction, single stranded nucleic acid is hybridized to the first probe. Creating single stranded nucleic acid is well known to those skilled in the art. For example, cDNA made from mRNA used in gene expression analysis is already single stranded, as is the cDNA constructed from retroviruses such as HIV. Genomic or mitochondrial DNA can be made single stranded using asymmetric PCR, or, for example, fragmenting it into smaller pieces and loading a small concentration into the reaction volume, following with denaturation. DNA at low concentrations takes several hours to hybridize to their complementary partners, longer than the time needed to hybridize to a probe. Regardless of the particular means for obtaining the single stranded nucleic acid, our focus is on single strands of nucleic acid as used in this array chain reaction.

The TCR mechanism works by using properties of certain enzymes to"nick", i. e., hydrolyze the phosphodiester bond, of one strand of a nucleotide duplex without cleaving the other strand. This property can be used to release tags from probes which in turn hybridize to other nickable probes to release additional tags functionally equivalent to the original target DNA, thereby causing a geometric growth in the number of copies of the target DNA. The nickable probes are physically separated prior to nicking, to avoid non- target initiated reactions that would result in a false positive detection. As just one example of physically separating the probes, they can be attached to a solid support, such as a glass slide, such that the complementary portion of different probe sets do not hybridize to each other.

The melting temperature of oligonucleotides increases as the length of the oligonucleotides increases. In simple systems where a single oligonucleotide hybridizes to its complement, the melting temperature of the oligo-complement complex defines two temperature regions: 1) a temperature well below the melting temperature, where we expect to find all oligos bound to their complement; and 2) a temperature well above the melting temperature, where we expect to find all oligos separated from their complements.

In contrast, our invention defines three temperature regions because there are two different lengths of bound oligonucleotides: the length before nicking, and significantly shorter lengths after nicking. The three regions are: 1) a temperature well below the melting temperature of the nicked oligos; 2) a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos; and 3) a temperature well above the melting temperature of the unnicked oligos.

In one embodiment of this invention, the temperature is held constant in the 2nd temperature region, namely, at a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos. In this temperature region, the unnicked oligos will hybridize and the nicked oligos will quickly separate. In another aspect of this invention, the temperature is cycled between two temperature values.

In this embodiment, the temperature is cycled between the 15t temperature region, namely, a temperature well below the melting temperature of the nicked oligos, and the 3rd temperature region, namely, a temperature well above the melting temperature of the unnicked oligos. In another embodiment, for example, the temperature is cycled between the 2nd temperature region, namely, a temperature between the melting temperature of the nicked oligos and the melting temperature of the unnicked oligos, and the 3rd temperature region, namely, a temperature well above the melting temperature of the unnicked oligos.

Cycling the temperature between well-defined temperature regions can improve quantitation by allowing the freed probes adequate time to diffuse to different probes before the next temperature cycle begins.

The nicking agent is any agent or method that hydrolyzes, i. e. , interrupts or cleaves one DNA strand but not the other. For example, it could be a restriction endonuclease.

Usually, organisms that make restriction enzymes also make a companion modification enzyme (DNA methyltransferase) that protects their own DNA from cleavage. These enzymes recognize the same DNA sequence as the restriction enzyme they accompany, but instead of cleaving the sequence, they disguise it by methylating one of the bases in each DNA strand. Together, a restriction enzyme and its"cognate"modification methyltransferase form a restriction-modification (R-M) system.

At least four different kinds of R-M systems exist, distinguished by the subunit compositions of the enzymes, the kinds of sequences recognized and the cofactors needed for activity. Most characterized enzymes (93%) belong to the Type II class; together with the Type IIS class (5%) they comprise the commercially available restriction enzymes used for DNA analysis and manipulation. Type 1 (1%) and Type III enzymes (<1%) are relatively uncommon and a few additional enzymes fit none of the classes.

The Type II enzymes are the simplest: they recognize symmetric DNA sequences and cleave within the sequences, leaving a 3'-hydroxyl on one side of the cut and a 5'- phosphate on the other. They require only magnesium for activity and their corresponding modification enzymes require only S-adenosyl-methionine. The variety of sequences recognized is virtually unlimited, though few contain less than four or more than eight specific bases. This limited size range probably reflects a balance between the benefit of recognizing frequent sequences in foreign DNA molecules and the cost of protecting those same sequences in the cell's DNA.

They generally act as homodimers, proteins composed of two identical subunits bound to each other in opposite orientations. Such proteins necessarily interact with sequences that are inverted repeats, and hence symmetric, because each subunit recognizes the same pattern of bases on opposite strands of the DNA.

Type II modification enzymes, in contrast, generally act as monomers, with a single protein recognizing the entire DNA sequence. The rationale for why they act as monomers when restriction enzymes act as dimers probably lies in the different substrates they attend to in vivo. The substrates for restriction enzymes are completely unmethylated duplexes, both strands of which must be cleaved. In contrast, the substrates for modification enzymes are newly replicated duplexes, only one strand of which requires modification because the other, parental strand is already modified.

Type IIS enzymes have similar cofactor requirements to Type II enzymes, but their recognition sequences are asymmetric and uninterrupted, 4-7 base pairs in length. They cleave at a defined distance, up to 20 base pairs, to one side of their recognition sequence.

Modification is usually carried out by two methyltransferases, one for each strand, and in some systems, different bases are methylated on each strand. The only currently known restriction endonuclease that nicks only one strand is a Type IIS enzyme called N. BstNB 1.

It is desirable to increase the concentration of the nicking agent to decrease the time taken to produce functional equivalents. Since the probes are physically separated by binding them, for example, to a solid support, the concentration of the nicking agent needs to increase only in the location of the probes, not necessarily in the volume of the fluid.

Our invention includes the optional attachment of the nicking agent to the solid support in such a fashion to avoid steric hindrance and maintain good activity. One embodiment is the use of linker arms of more than 6 carbon atoms. Another embodiment constructs fused proteins of the active nicking agent and streptavidin, a technique commonly used by those skilled in the art. The streptavidin is captured by biotin attached to the solid support.

Our invention encompasses the use of several sets of probes. One embodiment is the use of two probe sets as shown in Figure 1. Here, the cycle shown in steps 1 to 9 is repeated numerous times, resulting in geometric replication of a functional equivalent of the target. The probes in this embodiment are chimeric in that they contain an RNA portion flanked by DNA sequences. Such probes can be purchased from, for example, Biosource International, with an amine group attached at the 3'end and a fluorescent dye attached at the 5'end. They can be covalently attached to a glass slide or other substrate prepared in ways known to those skilled in the art. For example, glass slides can be coated with 3-aminopropyltriethoxy silane and then reacted with 1,4 phenylene diisothiocyanate.

This and other well known techniques are described in Lindroos, K. et al, Minisequencing on oligonucleotide microarrays: comparison of immobilization chemistries, Nucleic Acids Res., 2001, Vol. 29, No 13.

Each probe has a scissile linkage, i. e., one or more bonds that can be easily cleaved under the proper conditions. The proper conditions in this invention involve the specific hybridization of a complementary strand of DNA that does not contain a scissile linkage.

The scissile linkages in each probe can be ; for example, RNA, and the associated cleaving agent can be RNaseH. In another embodiment, the scissile linkages can be a specific DNA sequence and the scissile properties can be provided by asymmetric restriction endonucleases, such as N. BstNB 1. This enzyme is a type II s restriction endonuclease that recognizes the non palindromic sequence 5'CTCAG 3', and hydrolyzes only one of the DNA strands 4 bases from the 3'end.

However, since the CTCAG sequence may not be contained in the target nucleic acid, it must be added to the target nucleic acid. There are several ways of doing this known to those skilled in the art. In one embodiment, the target nucleic acid is prepared in a separate reaction. In this reaction, probes containing scissile linkages are added in free solution and hybridized to the target nucleic acid. T4 DNA polymerase is added to remove the 3'overhang from the probe-target duplex. RNaseH is added to remove the probes. T4 Ligase is added to ligate blunt end probes containing CTCAG. In another embodiment, instead of ligating probes containing CTCAG to the sample, the probes are added before hybridization to the array or other solid support as described above. The probes containing CTCAG hybridize with the target nucleic acid to the first attached probe and are optionally ligated to the target nucleic acid.

The probe sets that are used need to be physically separated. The physical separation of the probe sets can be accomplished in many ways. For example, the probe sets can be attached to many different kinds of solid supports, such as linear or area arrays, or the walls of capillaries. The material of the solid support can be glass, silicon, polystyrene, plastics, or other materials known to those skilled in the art. The distance between the probe sets should be large enough so that unnicked dimers cannot form, and small enough so that diffusion of nicked primers is reasonably quick compared to the time needed to hybridize and nick. In some embodiments, the distance is 15 microns, 80 microns, or 200 microns.

Another example means to maintain the spatial separation between 2 or more probes involves using small particle to which the probes are attached. These small particles can be microspheres, microbeads, or macroscopic particles. They can be composed of any material that binds DNA, for example, glass, polystyrene, or other plastics. The particles are modified so that if they touch a particle containing the complementary probe then the strands of DNA cannot hybridize. Several methods for insuring physical separation are described in Example 5.

The probes are spotted onto the prepared glass slides or other substrate. Spot sizes and spot densities are not a limiting factor in the TCR mechanism. Example spot sizes used in the industry are 200 microns in diameter and with approximately 100, 000 probes per square micron. In one embodiment, the two sets of probes are arranged in a checkerboard pattern on a single slide as shown in Figure 2, where the TCR mechanism can operate between any pair of probe sets. Only a single pair of spots corresponding to two different probe sets is adequate for the TCR reaction to proceed. In another embodiment, another slide is placed on top of the first slide and separated from it by a small distance, for example 80 microns. One set of probes is spotted on the bottom slide, and another set of probes is spotted on the top slide as shown in Figure 3. For a slide area of 1 x 2.5 cm2, the volume between the slides is 20 microliters.

Our invention can be used to increase the number of functional equivalents in solution. It may also be used to measure the amount of DNA. In one embodiment, dye can be placed at the 3'end of the first probe, the second probe, or both. The nicked probes allow the dye to be washed away. The reduced signal indicates the amount of cleavage, and is a function of the starting concentration of the nucleic acid sample.

A wide range of dyes can be used for this invention, including fluorescent dyes such as fluorescenes and rhodamines. A variety of other dye types include quantum dots, phycobilisomes, microbead-hosted dyes or even metal barcodes..

In a preferred embodiment, the probes are attached to a two-dimensional array and contain closely spaced dyes with overlapping emission and absorbance spectra, also called Fluorescent Energy Resonance Transfer dyes, or FRET dyes. As long as the probes are intact the FRET dyes will quench. As soon as RNaseH nicks between the dyes fluorescence will increase. This has two advantages: 1) the released fragments do not need to be washed away, allowing construction of a homogeneous assay; and 2) the signal increases as the number nicked probes increases, providing higher accuracy than the previous method.

This invention requires that the probe sets are adequately attached to the substrate.

If any probes from one probe set become unattached during the chain reaction, for example due to poor attachment chemistry, they can diffuse to the other probe set, hybridize to these probes, and thus spuriously enhance the chain reaction. This probe"blow-off'effect thus competes with the main interactions associated with the chain reaction. Since there is always the potential for some blow-off, it is useful to assume a certain amount of random loss of probe, and to determine an upper bound on the amount of probe blow-off that can be tolerated as a function of the time constants associated with the Tsunami Chain Reaction proper. This issue is addressed in one of the examples. The needed attachment chemistries are available to keep this spurious effect at a negligible level. See for example Lindroos, K. et al, Minisequencing on oligonucliotide microarrays: comparison of immobilization chemistries, NucZeic Acids Res., 2001, Vol. 29, No 13.

In another aspect of this invention, a kit is provided that includes the compositions needed to employ the Tsunami Chain Reaction. The kit may also include the needed reagents and instructions to convert the time it takes for Tsunami to take place into an effective starting concentration of target nucleic acid.

Example 1. Figure 1 is an amplification cycle of 9 steps. It starts with a single strand of target nucleic acid and ends up with two functional equivalents of the same target nucleic acid. By functional equivalent we mean two molecules that hybridize to the same complementary strand and cause the scissile linkages on the probe to be hydrolyzed.

Step 1 shows introduction of single stranded nucleic acid into a solution. Step 2 shows the first probe set consisting of scissile linkages in black, and an approximately 30 base sequence of nucleotides in a striped pattern. Step 3 shows a nicking agent, such as RNase H when the scissile linkages are RNA, or a restriction endonuclease, such as N. Bsl. NB 1 when the scissile linkages are DNA. Step 4 shows the target nucleic acid hybridizing to the scissile portion of probe 1, and the probe hydrolyzing one of the scissile linkages at the location of the small vertical arrow. Step 5 shows the two portions of the probe separating from the target nucleic acid, the portion containing the DNA (striped pattern) now being free to interact with the second probe set shown in Step 6. Step 7 shows the nicking agent, and step 8 shows it interacting with the duplex formed by the scissile portion of probe two (striped pattern) and the striped DNA portion of probe 1. The white DNA portion of probe 2, designated target copy tail, is functionally equivalent to the target nucleic acid and is released in Step 9.

In going through the full cycle, a single target nucleic acid molecule results in this original molecule being freed to participate in a second cycle, and furthermore a functionally equivalent molecule"target copy tail"has also been created at the conclusion of the first full cycle. It is evident in Figure 1 that this Tsunami Chain Reaction cycle competes with a linear"inner"repeat cycle in which a freed target molecule, for example, interacts again with the first probe set rather than diffusing over to and interacting with the second probe set. Once the geometric Tsunami Chain Reaction gets underway, it of course overwhelms the linear cycle contributions.

One element of this invention that may not be obvious is why there cannot be a single probe set, such as a single probe with the form Z-N, where Z is complementary to a target nucleic acid, and Z contains scissile linkages, and N is a DNA sequence identical to a portion of the target nucleic acid. The reason is that Z and N would form a dimer, additional RNaseH would cut within Z, and the amplification would spontaneously proceed.

This invention solves this problem by separating the complementary moieties. In Figure 1, Step 2, this is accomplished for example by attaching the scissile portion of probe set 1 (black band) to a solid support, and in Step 6 attaching the scissile portion of probe set 2 (striped band) to a solid support sufficiently far enough from probe 1 that no dimmers can form. Since the probes are quite short (a few Angstroms) compared to the distance between spots on microarrays (a few microns), placing the probe sets in different spots accomplishes the separation. An alternative embodiment places the different probe sets in the same spot, but insures that individual molecules are separated so that no dimers can form between unnicked probes.

Example 2. Design of probe sets containing RNA and example sequence of events In the following, RNA nucleotides are written in lower case letters, and DNA nucleotides are written in upper case letters. The first probe set is fabricated to detect the following 30 nucleotides from the HIV-1 target sequence ASE. SE8131 : 5'AGGTCAGCCAAAATTACCCTATAATGCAAA 3' The RNA sequence for probe set #1 is: 5'tttgcattatagggtaattttggctgacct 3' The DNA sequence for set #1 is: 5'AAAGGATTTAACACAGGATATTACGATATA 3' The entire first probe is: 5'Amine C6-spacer C18-spacer C18-Spacer tttgcattatagggtaattttggctgacct AAAGGATTTAACACAGGATATTACGATATA 3' The RNA sequence for probe set #2 is: 5'tatatcgtaatatcctgtgttaaatccttt 3' The DNA sequence for set #2 is: 5'AGGTCAGCCAAAATTACCCTATAATGCAAA 3' The entire second probe is: 5'Amine C6-spacer C18-spacer C18-Spacer tatatcgtaatatcctgtgttaaatccttt AGGTCAGCCAAAATTACCCTATAATGCAAA 3' The sequence of events for a Tsunami Chain Reaction is as follows: a) The HIV-1 sequence hybridizes to the RNA portion of probe 1. b) RNaseH hydrolyzes the phosphodiester bonds in the RNA portion of probe 1. c) The DNA portion of probe 1, possibly with some RNA attached, separates from the HIV-1 sequence, as do all remaining RNA fragments of probe 1. d) The DNA portion of probe 1 hybridizes to the RNA portion of probe 2. e) RNaseH hydrolyzes the phosphodiester bonds in the RNA portion of probe 2. f) The DNA portion of probe 2, possibly with some RNA attached, separates from the DNA portion of probe 1, as do all remaining RNA fragments of probe 2. g) The DNA portion of probe 2 is identical to the sequence of HIV-1. Starting with one strand of DNA, a functional equivalent has been created. h) Steps a-g are repeated creating 4, 8, 16, and in general 2k functional equivalents, where k is the number of iterations, or until all probes have been nicked.

Example 3. Design of probe sets containing DNA and example sequence of events Bromoacetamidosilane-coated slides are prepared by reacting microscope slides with a solution containing N, N-dimethylformamide, bromoacetic acid, 4- (dimethylamino)- pyridine, and 1, 3-dicyclohexycarbodiimide (Zhao X. , et al. Nuc. Acid. Res. 29 (4): 955-959, 2001).

The following TAMRA-labeled probe is the 1 st probe and contains a recognition site for N. BstNB I (#R0607S from New England Biolabs): 5'-psTTTTTTTCAGGAGTCAGTCAAGCAGGCACACTCAGACTCACT- TAMRA-3' ^ denotes where N. BstNB I cleaves. The superscript S denotes the position of the phosphorothioate in the sequence of oligonucleotides.

The following TAMRA labeled probe is the 2nd probe, which also contains a recognition site (5'-GAGTC) for N. BstNB I : 5'-pSTTTTTTTAGTGAGTCTGAGATGTGCCTGCTGACTGACTCCTG- TAMRA-3' ^ denotes where N. BstNB I cleaves. The superscript S denotes the position of the phosphorothioate in the sequence of oligonucleotides.

The 1 and 2 probes are dispensed onto bromoacetamidosilane-coated slides by a general purpose array spotter. The 5'end of the probes will attach to the surface of the slide.

The following oligonucleotide is the target nucleic acid to be detected: 5'-CTGCTGACTGACTCCTG-3' a) The target nucleic acid is prepared in a buffer solution compatible with N. BstNB I and supports the enzymatic activity ; b) The said buffer containing the target nucleic acid and appropriate amount of N. BstNB I is pipetted onto the slide containing I't and 2"d probe sets and is covered with a cover slip; c) The slide-cover slip. assembly is placed inside a hybridization chamber; d) The chamber is placed in a water batch at 55°C ; e) The target nucleic acid hybridizes to an appropriate portion of the Is, probe thus forming a duplex; f) The enzyme N. BstNB I binds to the recognition site on said duplex and cleaves the designated site on the 1St probe (see above in this section) but leaving the target nucleic acid intact; g) After cleavage of the 1 probe, the 3'portion of the 1 probe and the target nucleic acid come apart because the hybridization temperature (55°C) exceeds the Tm for the target nucleic acid and the 5'portion of the probe as well as the Tm for the target nucleic acid and the 3'portion of the probe; h) The intact target nucleic acid hybridizes to another intact probe and repeats steps (e) through (g); i) At the same time, the 3'portion of the probe in step (g) is released and hybridizes to an appropriate portion of the 2"probe thus forming a duplex ; j) The enzyme N. BstNB I binds to the recognition site on said duplex and cleaves the designated site on the 2"'* probe (see above in this section) but leaving the 3'portion of the I ; t probe intact ; k) After cleavage ofthe 2nd probe, the 3'portion of the 2"'* probe and 3'portion of the 1 probe come apart because the hybridization temperature (55°C) exceeds the Tm for the 3' portion of the I't probe and the 5'portion of the 2nd probe as well as the Tm for the 3' portion of the 1 st probe and the 3'portion of the 2d probe; 1) The intact 3'portion of the 15'probe hybridizes another intact 2"''probe and repeats steps (i) through (k); m) The 3'portion of the 2nd probe has a sequence in common with the target nucleic acid thus generating a functional equivalent of the target nucleic acid after the 15'cycle ; n) Allowing the reaction to proceed for an appropriate amount of time, one takes off the slide-cover slip assembly and washes away the hybridization buffer. After drying the slide, the fluorescence intensity of the spots on the slides representing the 15'probe and 2nd probe sets is measured by an array scanner; o) One performs the experiment described above several times, stopping the reaction at different time points; p) One estimates the starting concentration of target nucleic acid by identifying the time at which of either the Is'or 2"d probe was cleaved.

Example 4. An example of the three-pad case, including extensions to use of n pads Our invention can work with 2 probe sets, or more than two probe sets. We describe here the use of 3 probe sets. Each probe set is physically separated from the others to avoid formation of dimers by unnicked probes. In one embodiment, the three sets of probes are attached to a glass slide via a 5'linker in spots 200 microns in diameter and spaced 80 microns apart. Each probe contains two active portions, which we call Z and N.

The 5'portion Z contains at least one and possibly multiple scissile linkages, and hybridizes to the target nucleic acid. The portion called N contains only nucleic acids, which in turn will hybridize to another probe. The three probes can be referred to as: Z,- N1, Z2-N2, and Z3-N3. The first step is to cause a single stranded target nucleic acid to hybridize to Zi. A nicking agent hydrolyzes the phosphodiester linkages within Zl thereby releasing N, from the target nucleic acid. Z2 is constructed to be complementary to N1, Z3 is constructed to be complementary to N2, and N3 is constructed to be complementary to Z,. Consequently, we have constructed N3 to be a functional equivalent of the original target nucleic acid. This cycle is repeated over and over again, creating a geometric increase in the number of free functional equivalents. The free functional equivalents can be detected in many ways known by those skilled in the art. In one embodiment, the nicked fragments can be detected by measuring the decrease in fluorescence of a 3'dye attached to the probes. In another embodiment, one can measure the increase of fluorescence of a FRET dye pair connected to the scissile portion of the probes.

The number of probe sets can be 4,5, 6, or any number desired. In general, our invention embodies n probe sets, each with the structure Z ;-N ;, wherein Zi contains one or more scissile linkages, and i is an integer between 1 and n representing one particular set of single-stranded probes. We construct a portion of Z, to be complementary to a portion of the original target nucleic acid, we construct a portion of N, to be complementary of a portion of Z2, we construct a portion of N2 to be complementary to a portion of Z3, and, in general, we construct a portion of Ni to complementary to a portion of Zi, l where i is between 1 and n-1, and we construct a portion of Nn to be complementary to a portion of Z. Once the target nucleic acid is hybridized to Z1 in the presence of a nicking agent, we produce a functional equivalent Nn and continue this process producing a geometric increase in the number of free functional equivalents.

Example 5. Maintaining physical separation of complementary probes using small particles, such as microbeads.

The physical separation of the complementary probes can be maintained using small particles. In this example, we discuss the use of microbeads with rough surfaces. A rough surface is one that has a plurality of groves and valleys that are deeper than the length of the DNA probes. The DNA is attached to the microbead in ways that are standard to those skilled in the art. Some of the DNA is attached near the bottom of the groves and valleys, and some is attached near the surface. The beads are then manually tumbled against each other to wear down the outside surface, thereby removing any DNA that is near the surface, or shearing any DNA that extends beyond the surface. The resulting beads contain DNA that can never extend beyond the surface of the particle, and therefore can never interact with complementary beads prepared in a similar way.

Beads containing DNA probes and beads containing their complement are placed in a small tube, such as one tube in a 96,384, or 1536 well tray. The Tsunami reaction is detected using probes, for example, containing two FRET dyes that fluoresce only when cleaved. Many beads can be placed in the tubes, thereby increasing the sensitivity of the reaction by increasing the concentration of probes.

A single DNA molecule plus a complement pair of probes can be placed in a tube.

In addition, other DNA molecules plus complement pairs can be added. They can be detected using the same FRET dyes if the following question is asked: Are any of a number of DNA sequences present in the sample? Alternatively, FRET dyes with different emission spectra can be used if a different question is asked: Which of a number a DNA sequences is present in the sample? In addition to the method described above to eliminate DNA from the surface of a microbead, other techniques are well known to those skilled in the art. For example, certain latex paints are extremely porous. A small coating a porous paint will isolate one bead from the next to a distance greater than the length of oligonucleotide probes, but will easily let buffer and DNA molecules pass through the coating.

Example 6. Simulation of the Tsunami Chain Reaction (TCR) The kinetics of Tsunami are readily investigated using a kinetic model based upon the standard enzyme equation: A + En < A # En En + Products, where A is the substrate and En is the enzyme. (Segel, Irwin H., Enzyme Kinetics, Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems, Wiley, 1975; Kittel, Charles, Thermal Physics, Wiley, 1969). The rate of change in the concentration of any constituent is dependent upon the concentration of a subset of constituents. For example, di kon [A] [En] +k [A. En] dt The first order differential equation can be approximated [PC 1] as a finite difference equation by letting the differential dt assume some small but finite value At, and solving for the change in concentration A [A]: [A] = At (-kon [A] [En] + koff [A#En]) The changes in concentration as a function of time are calculated by iterating the finite difference equation many times (Press, William H., et. al, Numerical Recipes in C, The Art of Scienfific Computing, 2nd Edition, Cambridge University Press, 1992).

Six reactions describe the Tsunami process: Probe + Sample Probe1#Sample + En <-> Probel SampleEn Sample + En + Ping Probe2 + Ping Probe2*Ping + En Probe2mPingEn <-> Sample + En + Ping Probe, is deposited in a pad geometrically separated from Probe2 by a few microns.

Probe contains an oligonucleotide complementary to the Sample. Upon hybridization, Probe, is nicked and separates from the Sample, releasing an oligonucleotide complementary to Probe2. Here, we call this second oligonucleotide Ping. Ping diffuses to Probe2, hybridizes to it, and releases an oligonucleotide that is functionally equivalent to the Sample.

The reactions are numbered as follows: Probe + Sample X Probe, *Sample + En Probele SamplerEn Sample + En + Ping 1 2 3 Probe2 + Ping Probe2*Ping + En Probe2mPingrEn X Sample + En + Ping 4 5 6 The rates of reaction are labeled as + going to the right, and-going the left. The following equations are used to create the simulation : d [Probe, Sample] d [Probe] d [Sample] dut dut dt = k+ [Probel] [Sample] =- dut dut dt d [Probel Sample En] d [Probe, Sample] d [En] dt-k2+ Probe, Sample] [En] _-dt dt d [Probe, Sample][En] d [Probe, Sample] d [En] dt-'k2-Probe, Sample En] _-dt dt d [Probe,]-d [Sample]-d [En) d [Probel Sample En] dt dt dl-k3+ Probe, Sample En] _- dt d [Probe,] d [Sample] d [En]-d [Probe, Sample En] di di dt dt du dt dt dt dt-k4+ tprobe2] [Ping] _-- dt dt d [Probe2 Ping] d [Probe2] _ d [Ping] dt di dt 5. L 2 6JL J d [Probe2 o Ping 9 En] = k5+ [Probe2 o Ping] [En]-d [Probe2 9 Ping] _ d [En] du dt dt d [Probe2 Ping En] d [Probe2 Ping] d [En] dt dt dt d [Probe2l d [Ping] d [En] d [Probe2 o Ping o En] n dt dt dt-ks+ Lprobez Ping En] _-dt d [Probe2 J _ d [Ping]-d [En]-d [Probez Sample En] dt di dt dt dt The following values were used for the rates of reactions: Rate Value Units constant k1+ 107 M-sec-} k1- 0. 1 sec-' k2+ 107 M-1 sec-1 k2 0. 001 sec- k3+ 0.1 sec-1 k3- 0 M-2 sec-1 k4+ 107 M-1 sec-1 k4- 0. 0. 1 sec-1 k5+ 107 M-1 sec-1 k5- 0.001 sec-1 k6+ 0.1 sec- k6- 0 M-2 sec-1 k3 and kc are zero in accordance with standard enzymology principals (Segel, Irwin H. , Enzyme Kinetics, Behavior and Analysis of Rapid Equilibrium and Steady-State Enzyme Systems, Wiley, 1975). The time step At is chosen as 1 sec to avoid nonphysical behavior such as period doubling and chaos. The values of the starting concentrations are all zero except for the following: [Sample] = 1. 0 10-18 Molar [Probe,] = 6. 64 10 9 Molar (equivalent to 200 100 micron pads) [Probe2] = 6.64 10-9 Molar (equivalent to 200 100 micron pads) [En] = 5 10-9 Molar (equivalent to 10 x normal concentration) The time to diffuse between pads spaced 80 microns apart is calculated as follows (Grossman, Paul, et al, Capillary Electrophoresis, Academic Press, 1992) : D = 2 10''° m2 sec' (Diffusivity of free solution single stranded oligonucleotide) #x = (2 D t)/' t = #x2 / (2 D) = (75 10-6)2/(2 x 2 10-10) = 16 seconds The diffusion is modeled by calculating the changes in Sample or Ping concentration from concentrations present 16 seconds earlier.

The results of the calculations using these particular time constants are shown in Figure 4. Starting from the upper left and moving toward the right, the graphs in Figure 4 are described below: Graph 1: The concentration of Sample increases as a function of the number of seconds since the start of hybridization. Appreciable increase occurs after 40 minutes of hybridization.

Graph 2: The concentration of Probel decreases as the concentration of both Sample and Ping increase.

Graph 3: The concentration of Probe2 decreases as the concentration of both Sample and Ping increase.

Graph 4: The concentration of Enzyme momentarily reduces as it forms multiple complexes Probes* Sample, Probel Sample'En, Probe2 Sample, Probe2 SampleEn.

Graph 5: The concentration of Ping increases at the same rate as the concentration of Sample.

Graphs 6-9 : The concentrations of Enzyme binding complexes (Probe* Sample, Probel Sample'En, Probe2* Sample, Probe2 SamplerEn) momentarily increase, peak, and then decline as the concentration of free Enzyme momentarily decreases.

Example 7: Relationship between development time and sample concentration The simulation in Example 6 was run at several concentrations of sample to determine the time at which half of the probes had been cleaved. The results are listed in the following table. The concentrations are, for convenience, also converted to the number of molecules present in a 50 ßl hybridization volume.

Seconds Molecules Conc 2250 30 1. 00E-1 2183 60 2. 00E-1 2116 120 4. 00E-1 2050 241 8. 00E-1 1983 482 1.60E-1 1916 963 3.20E-1 1850 1926 6.40E-1 1783 3853 1.28E-1 1716 7706 2.56E-1 1650 1.54E+04 5.12E-1 1583 3.08E+04 1.02E-1 1516 6.16E+04 2.05E-1 1450 1.23E+05 4. 10E-1 1383 2.47E+05 8.19E-1 1316 4.93E+05 1.64E-1 1250 9.86E+05 3.28E-1 1183 1.97E+06 6.55E-1 1116 3.95E+06 1. 31 E-1 1050 7.89E+06 2.62E-1 983 1.58E+07 5.24E-1 916 3.16E+07 1.05E-1 582 1. 01 E+09 3.36E-1 237 3. 23E+10 1. 07E-0 A graph of the time vs. the logarithm of the concentration is shown in Figure 5.

The data in this region fits a the linear relationship: Time (seconds) =-1746-222 Logic ( [Sample]) Example 8: Example of the effect of probe blow-off Blow-off is the phenomenon that, during long hybridizations, the covalent bond between Si02 and some of the probes is hydrolyzed at biological pHs. This phenomenon is much less prevalent with other materials (e. g.: polypropylene), but is significant with glass slides. We simulated the effect of blow-off by increasing the concentration of Sample and Ping (see definitions in Example 6 above) according to the following blow-off rates during a 10 hour hybridization:. 01%,. 001%, and. 0001%. These rates correspond to good manufacturing practice, whereas many manufacturers unknowingly have much higher blow-off rates.

The simulations showed the following times to cleave half the probes: Blow Off % Seconds 0.01 1471 0.001 1693 0.000 1914 This table fits well to the following linear relationship: Time (seconds) = 1028-221.5 Logic ([Blow_Off °/O]) Example 9. Experimental validation of simulation Epoxy coated Dynal beads were used as a solid support. SH-terminated oligos were synthesized by IDT and attached to the beads. Each oligo contained a recognition sequence for a nickase (3'-CTCAG-5'for N. BstNB 1, NEB). The two probes, Ping and Pong in Example 6, were mixed into the same well of a 96 well tray. Quenching dyes were attached on both sides of the nickase recognition sequence so if cleavage occurred the fluorescence would change. Fluorescent intensity was measured as a function of time using an ABI 7700. Also, under identical reagent concentrations, the time course of the measured flourescence was simulated using the model described in Example 6. The result is shown in Figure 6. The scattered data is the result of many measurements of fluorescent amplitude (y axis, arbitrary units) over time (x axis, arbitrary units). The solid line shows the results predicted by the simulation.