Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
UNDECAPRENYL PYROPHOSPHATE SYNTHASE FROM THE PLANT HEVEA BRASILIENSIS
Document Type and Number:
WIPO Patent Application WO/2012/148253
Kind Code:
A1
Abstract:
An isolated polypeptide for catalyzing the synthesis of undecaprenyl pyrophosphate in the plant of Hevea brasiliensis comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

Inventors:
MAQSUDUL Alam (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
MOHD Nazalan Mohd Najimudin (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
JENNIFER Ann Saito (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
GINCY Paily Thottathil (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
Application Number:
MY2012/000012
Publication Date:
November 01, 2012
Filing Date:
January 30, 2012
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIVERSITI SAINS MALAYSIA (11800 USM, Penang, MY)
MAQSUDUL Alam (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
MOHD Nazalan Mohd Najimudin (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
JENNIFER Ann Saito (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
GINCY Paily Thottathil (Centre for Chemical Biology, 1st Floor Block B, No. 1, Persiaran Bukit Jambul Bayan Lepas, 11900, MY)
International Classes:
C12N9/10; C12N15/29; C12N15/54; C12N15/82
Domestic Patent References:
2001-03-29
Other References:
DATABASE GENBANK 06 August 2009 Database accession no. XM002525589
DATABASE GENBANK 07 December 2006 Database accession no. DV445452
DATABASE GENBANK 06 August 2009 Database accession no. XM_002521666
Attorney, Agent or Firm:
LOK Choon Hong (Pintas IP Group SDN BHD, Suite 6.03.6th Floor Wisma Miram, Jalan Wisma Putra Kuala Lumpur, 50460, MY)
Download PDF:
Claims:
CLAIMS

1.An isolated polypeptide for catalyzing the synthesis of undecaprenyl pyrophosphate in the plant of Hevea brasiliensis comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

2. An isolated polypeptide according to claim 1, wherein the plant of Hevea brasiliensis is clone RRIM 600. 3. A method for producing undecaprenyl pyrophosphate to prime the biosynthesis of natural rubber in vitro from its precursors using an isolated polypeptide comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO r 4 for catalyzing the synthesis of undecaprenyl pyrophosphate. 4.An isolated polynucleotide encoding a polypeptide homologous to undecaprenyl pyrophosphate synthase from the plant of Hevea brasiliensis comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

5. An isolated polynucleotide according to claim 4, wherein the plant of Hevea brasiliensis is clone RRIM 600.

6. A recombinant gene construct comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the polynucleotide is expressible in a host cell to produce homologue of undecaprenyl pyrophosphate synthase in the plant of Hevea brasiliensis.

7. A recombinant gene construct according to claim 5 further comprising a promoter region operably-linked to enhance expression of the polynucleotide template. 8. A transformant comprising a recombinant gene construct capable of expressing a 1 polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 to produce homologue of undecaprenyl pyrophosphate synthase.

9. A method for inducing synthesis of undecaprenyl pyrophosphate synthase using a plasmid recovered from a cultured transformant comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2.

Description:
UNDECAPRENYL PYROPHOSPHATE SYNTHASE FROM THE

PLANT HEVEA BRASILIENSIS

FIELD OF INVENTION

The present invention relates to a transcriptome encoding plant enzyme homologous to undecaprenyl pyrophosphate synthase and a gene encoding this enzyme. More particularly, the present invention provides the undecaprenyl pyrophosphate synthase homologues and its application in the production of natural rubber in the plant of Hevea brasiliensis, as well as a transgenic H. brasiliensis plant thereof.

BACKGROUND OF THE INVENTION Natural rubber is a raw material of great importance in most of the industries. It is a high molecular mass polymer of isoprene units with cis configuration. It is naturally produced in over 200 species of plants. However, there are only two of these plants, H. brasiliensis and Parthenium argentatum, produce sufficiently high molecular weight rubber to be utilized for industrial purposes, of which H. brasiliensis is deemed the chief source of commercial rubber. It is known in the art that the world supply of natural rubber is barely keeping up with global demand for 12 million tons of natural rubber in year 2020. As there is an increasing global demand on rubber, further improvement of natural rubber production is necessary. Thus, there is a significant interest in studying rubber biosynthesis and exploring the molecular biology concept involved in this rubber biosynthesis.

Natural rubber is a polymer having isopentenyl diphosphate units condensed sequentially in cis configuration by the group of enzymes, cis-prenyl transferases. In the biosynthesis pathway of rubber or latex, an allylic diphosphate is also required as the priming co-substrate for the initiation of the subsequent extensive prenyl chain elongation. The initiator molecules themselves are derived from isoprene units through the action of distinct prenyl transferases. These include dimethylallyl diphosphate (DMAPP, C5), geranyl diphosphate (GPP, CIO), farnesyl diphosphate (FPP, CI 5) and geranylgeranyl diphosphate (GGPP, C20). Genes encoding the enzymes which synthesize these allylic terpenoid diphosphates have been cloned from a number of organisms, including plants, and all of these genes encode polypeptides with conserved regions of homology, according a report of McGarvey et al. in the Plant Cell, 1995 and a review of Chappell, J. in the Annual Review of Plant Physiology and Plant Molecular Biology, 1995. All of these gene products condense isoprene units in the trans configuration. Recent reports shows that bacterial undecaprenyl diphosphate (C55-UPP) can act as a very active allylic initiator for rubber synthesis. As disclosed by Rattanapittayaporn et al. in the Macromolecular Bioscience, 2004, comparisons of allylic UPP with other shorter initiator molecules, such as C15-FPP or C20-GGPP have shown that UPP was the most effective. C55-UPP can be synthesized by the consecutive condensation of 8 molecules of isopentenyl pyrophosphate (IPP) with farnesyl pyrophosphate (FPP) in cis configuration which is essential for the bacterial cell wall synthesis.

Undecaprenyl pyrophosphate synthase (UPPS) catalyzes the condensation of IPP units with FPP. However, there are not many characterization reports or existing technologies provided in the prior art relating to this enzyme, especially that from the plant origin. U.S. Patent No. 2007020743 has merely disclosed an undecaprenyl pyrophosphate synthase (UPPS) native crystalline structure and UPPS complex from Streptococcus pneumoniae. In another U.S. Patent No. 2004191271, the crystal structure of UPPS and its interaction with cofactors and ligands are disclosed. Apart from that, UPPS is reported from a variety of other bacteria, and very recently, some UPPS homologues have been reported from some plants as disclosed in U.S. Patent No. 7880058.

In view of the fact that UPPS is a transcriptome encoding plant enzyme which could play an important role in the biosynthesis pathway of rubber, it is desirable for the industry to provide a genetic approach relating the biosynthesis of rubber in plant by exploring and utilizing the molecular biology and genetic information of UPPS. Besides, a species-specific approach is also preferable in order to yield a cost-effective result as the rubber biosynthesis pathway and genetic makeup of each species of plant are potentially varied among one another.

SUMMARY OF INVENTION

The primary object of the present invention is to provide a UPPS enzyme derived from the plant of H. brasiliensis and a method for utilizing thereof in the synthesis of UPP, which is one of the allylic initiator molecules in the rubber biosynthesis pathway.

Another object of the present invention is to provide the molecular biology and genetic information of UPPS to be exploited for improving the production of rubber in the plant of H. brasiliensis.

Still another object of the present invention is to provide a method for producing UPP in vitro from the precursors by utilizing the H. brasiliensis-deriYcd UPPS, thus help in priming the biosynthesis of rubber. Yet another object of the present invention is to obtain a transgenic plant of H. brasiliensis with increased latex production by regulating the biosynthesis pathway of rubber, especially the biosynthesis of UPP in the plant.

Still another object of the present invention is to provide isolated polynucleotides having specific nucleotide sequences, which is used to facilitate the performing of the disclosed method and acquiring of the transgenic H. brasiliensis plant.

Further object of the present invention is to provide a potential commercially feasible way to increase the production of rubber in order to keep up with the increasing global demand on rubber-based products. At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present invention describes an isolated polypeptide for catalyzing the synthesis of UPP in the plant of H. brasiliensis comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4.

According to one of the preferred embodiments of the present invention, the plant of H. brasiliensis applied is clone RRIM 600. Another embodiment of the present invention is a method for producing UPP to prime the biosynthesis of natural rubber in vitro from its precursors using an isolated polypeptide comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4 for catalyzing the synthesis of UPP. Still another embodiment of the present invention is an isolated polynucleotide encoding a polypeptide homologous to undecaprenyl pyrophosphate synthase from the plant of H. brasiliensis comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. Preferably, the plant of H. brasiliensis applied is clone RRIM 600. Yet another embodiment of the present invention discloses a recombinant gene construct comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2, wherein the polynucleotide is expressible in a host cell to produce homologue of UPPS in the plant of H. brasiliensis. Preferably, the recombinant gene construct further comprises a promoter region operably-linked to enhance expression of the polynucleotide template.

Further embodiment of the present invention is a transformant comprising a recombinant gene construct capable of expressing a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 to produce homologue of UPPS . In another further embodiment of the present invention, a method is disclosed for inducing synthesis of UPPS using a plasmid recovered from a cultured transformant comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The embodiments described herein are not intended as limitations on the scope of the invention.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of facilitating an understanding of the invention, there is illustrated in the accompanying drawing the preferred embodiments from an inspection of which when considered in connection with the following description, the invention, its construction and operation and many of its advantages would be readily understood and appreciated.

Figure 1 is the nucleotide sequence SEQ ID NO. 1 of the polynucleotide encoding the enzyme undecaprenyl pyrophosphate synthase (CPT1) of the plant H.

brasiliensis as described in one of the preferred embodiments of the present invention.

Figure 2 is the nucleotide sequence SEQ ID NO. 2 of the polynucleotide encoding the enzyme undecaprenyl pyrophosphate synthase (CPT6) of the plant H.

brasiliensis as described in one of the preferred embodiments of the present invention.

Figure 3 is the amino acid sequence SEQ ID NO. 3 of the polypeptide encoded by the

SEQ ID NO. 1 of Figure 1. Figure 4 is the amino acid sequence SEQ ID NO. 4 of the polypeptide encoded by the SEQ ID NO. 2 of Figure 2.

Figure 5 is the electrophoresed agarose gel image showing the polymerase chain

reaction (PCR) amplification result of CPTl, in which lane 1 is negative control, lanes 2 and 3 are samples of CPTl and lane 4 is lkbp DNA ladder marker.

Figure 6 is the electrophoresed agarose gel image showing the PCR amplification result of CPT6, in which lane 1 is negative control, lanes 2 and 3 are samples of

CPT6 and lane 4 is lkbp DNA ladder marker.

Figure 7 shows the restriction pattern of CPTl, in which lane 1 is the digestion mixture and lane 2 is lkbp DNA ladder marker.

Figure 8 shows the restriction pattern of CPT6, in which lane 1 is the digestion mixture and lane 2 is lkbp DNA ladder marker.

Figure 9 shows the sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS- PAGE) analysis of protein induction for CPTl under 25°C, in which lane 1 is uninduced control, lane 2 shows the protein induced with 0.5mM isopropyl β- D-l-thiogalactopyranoside (IPTG), lane 3 shows the protein induced with ImM IPTG, lane 4 shows the protein induced with 1.5mM IPTG and lane 5 is a protein marker.

Figure 10 shows the SDS-PAGE analysis of protein induction for CPT6 under 37°C, in which lane 1 is a protein marker, lane 2 shows the protein induced with ImM IPTG and lane 3 is uninduced control. Figure 11 shows the phylogenetic tree comparing SEQ ID NO. 1 (CPTl) and SEQ ID NO. 2 (CPT6) along with other nucleotide sequences which encode the enzymes of cis-prenyl transferases.

DETAILED DESCRIPTION OF THE INVENTION

The present invention relates to a transcriptome encoding plant enzyme homologous to undecaprenyl pyrophosphate synthase, and a functional polynucleotide encoding this enzyme. More particularly, the present invention provides the undecaprenyl pyrophosphate synthase homologues and its application in the production of natural rubber in the plant of Hevea brasiliensis, as well as a transgenic H. brasiliensis plant thereof.

Hereinafter, the invention shall be described according to the preferred embodiments of the present invention and by referring to the accompanying description and drawings. However, it is to be understood that limiting the description to the preferred embodiments of the invention and to the drawings is merely to facilitate discussion of the present invention and it is envisioned that those skilled in the art may devise various modifications without departing from the scope of the appended claim. The following terms used throughout the specification have the indicated meanings unless expressly indicated to have a different meaning.

The term "gene" is defined as the genomic sequence of the plant H. brasilliensis particularly polynucleotide sequences encoding polypeptide sequence of the enzyme UPPS.

The term "polynucleotide", as used herein, is a nucleic acid chain containing a sequence greater than 100 nucleotides in length.

The term "polypeptide", as used herein, is a single linear chain of amino acids bonded together by peptide bonds, and having a sequence greater than 100 amino acids in length. The term "oligonucleotide", as used herein, is a short polynucleotide or a portion of polynucleotide which preferably comprises 10 to 100, most preferably 12 to 50 nucleotides in length. In respect to the embodiment of the present invention, nucleotides contained within the oligonucleotides can be analogs or derivatives of naturally occurring nucleotides.

The term "primer", as used herein, is an oligonucleotide capable of binding to a target nucleic acid sequence and priming the nucleic acid synthesis. An amplification oligonucleotide as defined herein will preferably be 10 to 50, most preferably 15 to 25 nucleotides in length. While the amplification oligonucleotides of the present invention may be chemically synthesized and such oligonucleotides are not naturally-occurring nucleic acids.

The term "host cell", as used herein, refers to a cell capable of receiving foreign or heterogeneous genes and expressing those genes to produce an active gene product. Suitable host cell includes bacteria, fungi or plant cells.

The term "operably-linked", as used herein, refers to association of nucleic acid sequence on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter can be operably-linked with a coding sequence when it affects the expression of that coding sequence, i.e. that the coding sequence is under the transcriptional control of the promoter.

The term "m vitro", as used herein, refers to a biological reaction occurs in an artificial environment outside a living organism, which is usually conducted in a laboratory using components of an organism that have been isolated from their usual biological context in order to permit a more detailed or more convenient analysis to be performed.

The abbreviation used throughout the specification to refer to nucleic acids comprising nucleotide sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless otherwise specified, the nucleic acid sequences presented herein in the 5 '→3 ' direction.

The present invention discloses an isolated polypeptide for catalyzing the synthesis of UPP in the plant of H. brasiliensis comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4. The amino acid sequence of SEQ ID NO: 3 and SEQ ID NO: 4 are respectively shown in Figure 3 and 4. According to the preferred embodiment of the present invention, SEQ ID NO: 3 refers to the polypeptide sequence of the H. brasiliensis-derived UPPS homologue 1, which is named herein as CPT1 ; whereas SEQ ID NO: 4 refers to the polypeptide sequence the H. brasiliensis-denved UPPS homologue 2, which is named herein as CPT6. Both these CPT1 and CPT6 enzymes are present in the biosynthesis pathway of rubber in the plant of H. brasiliensis for catalyzing the synthesis of UPP which can act as one of the allylic initiator molecules for priming the biosynthesis of rubber in the plant. According to the preferred embodiment, the plant of H. brasiliensis applied in the present invention is clone RRIM 600. This rubber tree clone is preferably used for the production of natural rubber as it gives higher yield, more adaptable to the environment and known to be less susceptible to climatic variations. In another embodiment of the present invention, a method for producing UPP to prime the biosynthesis of natural rubber in vitro from its precursors is disclosed. These precursors include the IPP units and FPP which can be commercially obtained. As the enzymes of CPT1 and CPT6 can be utilized for catalyzing the condensation reaction between the IPP units and FPP, an isolated polypeptide comprising amino acid sequence set forth in SEQ ID NO: 3 or SEQ ID NO: 4 is potentially useful for the synthesis of UPP, thus priming the synthesis of natural rubber in vitro.

The present invention also provides a gene sequence encoding the UPPS homologues CPT1 and CPT6. In still another embodiment of the present invention, an isolated polynucleotide encoding a polypeptide comprising nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 is provided. As illustrated in Figure 1 and 2, SEQ ID NO: 1 refers to the polynucleotide sequence of CPTl; whereas SEQ ID NO: 2 refers to the polynucleotide sequence of CPT6. In accordance with the preferred embodiment of the present invention, the isolated polynucleotides of CPTl and CPT6 can be obtained by PCR amplification of the conserved region of these genes using total RNA isolated from the plant of H. brasiliensis. As set forth in the preceding description, the plant of H. brasiliensis applied is clone RRIM 600. In yet another embodiment of the present invention, a recombinant gene construct comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2 is disclosed, wherein the polynucleotide is expressible in a host cell, and is translatable to produce homologue of UPPS in the plant of H. brasiliensis. Preferably, the recombinant gene construct further comprises a promoter region operably-linked to enhance expression of the polynucleotide template. Under the transcriptional control of the specific promoter, the expression of the coding region within the recombinant gene constructs containing polynucleotide of CPTl and CPT6, respectively, can then be enhanced, leading to higher yield of the CPTl and CPT6 enzymes. Accordingly, the recombinant gene construct containing the gene or partial sequence of CPTl and CPT6 can be transformed into a host cell. Preferably, the host cell is a bacterial cell which can be commercially obtained. In accordance with a further embodiment of the present invention, a transformant, which is the transformed host cell comprising a recombinant gene construct capable of expressing the polynucleotide therewithin to produce homologue of UPPS is also provided. The procedure for amplifying, cloning and sequencing the CPTl and CPT6 from the plant of H. brasiliensis is further detailed in Example 1. Apart from that, a method of sequence analysis for the UPPS-encoding polynucleotides is also shown in Example 2. A protein induction process can be applied for generating large quantity of an enzyme or peptide. In another further embodiment of the present invention, a method is disclosed for inducing synthesis of UPPS using a plasmid recovered from a cultured transformant comprising a polynucleotide having nucleotide sequence set forth in SEQ ID NO: 1 or SEQ ID NO: 2. As detailed in Example 3, plasmids containing the full genes of CPTl and CPT6 can be recovered from the respective cultured transformant and demonstrated by a restriction digestion using suitable restriction enzymes. Accordingly, the synthesis of the protein products, which are the enzyme or peptide of CPTl and CPT6, respectively, can be induced, purified and demonstrated by SDS-PAGE. By applying the technologies provided by the present invention, an engineered polypeptide homologous to the UPPS can then be obtained. An example of the homology modeling process of the UPPS enzymes is provided in Example 4. The pathway construction of rubber biosynthesis is shown in Example 5. The present disclosure includes as contained in the appended claims, as well as that of the foregoing description. Although this invention has been described in its preferred form with a degree of particularity, it is understood that the present disclosure of the preferred form has been made only by way of example and that numerous changes in the details of construction and the combination and arrangements of parts may be resorted to without departing from the scope of the invention.

EXAMPLE Examples are provided below to illustrate different aspects and embodiments of the present invention. These examples are not intended in any way to limit the disclosed invention, which is limited only by the claims.

Example 1

An example of the amplification, cloning and sequencing processes of CPT 1 and CPT 6 from H. brasiliensis RRIM 600 is provided herein. Initially, total RNA was isolated from young leaves of H. brasiliensis RRIM 600 using QIAGEN-RNeasy Mini Kit according to the manufacturer's instructions. The quality as well as quantity of the RNA were checked by agarose gel electrophoresis and Thermo Scientific Nano Drop 2000. Accordingly, the cDNA first strand was synthesized using Superscript® VILO™ cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. The targeted gene was then amplified from the cDNA by PCR using primers CPT IF and CPT 1R for CPT 1, and CPT 6F and CPT 6R for CPT 6, as listed in the following Table 1. The PCR reaction mixture (50 μΐ,) contained 1 μΐ, of cDNA, 20 pmoles of each primer, 5 μΕ of 10X Pfu Buffer, 5 μί of 2.5 mM dNTP mix and 2.5 units of PfuTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions: initial denaturation for 5 min at 94°C; followed by 35 cycles of denaturation at 94°C for 30 sec; annealing at 45°C for 30 sec; and extension at 72°C for 1 min for CPT 1, while 1.15 min for CPT 6; with a final extension at 72°C for 7 min. After that, the PCR product with the amplicon was analyzed by 1% agarose gel and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. The purified PCR product was ligated into pCR® 4 Blunt TOPO® Vector (Invitrogen) and transformed into One Shot® Machl™-T1R chemically competent E. coli cells (Invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manufacturer's instructions. The presence of the insert was checked by digesting with EcoRI (NEB) and positive plasmids were subjected to sequencing.

Table 1

I ECPT 6 R 5'-ACCTCGAGTTACAACTGATGCTTTTTC-3

Figure 5 and 6 respectively shows the sequenced PCR products of CPTl and CPT6 obtained by the CPT primers as listed in Table 1, which includes CPT IF and CPT 1R for the amplification of CPTl, and CPR 6F and CPR 6R for the amplification of CPT6.

Example 2

An analysis of the nucleotide sequences and the amino acid sequences were conducted by BLASTN and BLASTP programmes respectively. The obtained sequences along with the UPPS sequences reported from other plants as well as microbes were also aligned with Clustal W programme. Phylogenetic analysis was carried out using the Neighbour Joining (NJ) method implemented in the MEGA 4 programme. A few examples of sequence comparison are provided herein. The sequence analysis of the present invention shows that sequence of CPTl and CPT6 are much different from the UPPS enzymes from H. brasiliensis reported in the prior art. As shown in the phylogenetic tree of Figure 11, these sequences shows more similarity to those UPPS derived from Ricinus communis sequences than those reported from H. brasiliensis. Therefore, the sequences of CPTl and CPT6 shows significant variations from other reported sequences and it is unique.

CPT 1 Comparison with other sequences ref I XM_002525589.1 [ Ricinus communis undecaprenyl pyrophosphate

synthetase, putative,

mRNA

Length=1153

GENE ID: 8286444 RCOM_0612090 | undecaprenyl pyrophosphate synthetase, putative

[Ricinus communis]

Score = 688 bits (762), Expect = 0.0

Identities . = 587/724 (81%), Gaps = 0/724 (0%)

. Strand=Plus/Plus COVERAGE 77%

Query 191 CTGAACCTTTGCCGGAGGGGCTCCGGAGAGAGTTGATGCCACGGCATGTCGCCGTGATCA 250

I I I I I I I I ί I I I I I I I I .I I. I ' 1 1/ I I I I I I I I I I I I I I I I I I I I I I I I l I Sbj ct 197 CTGAGCCTTTGCCGGATGGGCTCCTTTTAGAGTTGATGCCACGTCATGTGGCGGTTATTA 256

Query 251 TGGACGGCAATGGGAGGTGGGCCCAGCAGCGAGGTCAGATGGCATCGATGGGTCATGAGG 310

I I I I I I I I I I I I I I I I I I I I I I I I I I I I i I II I I I I I I I I I I

Sbj ct 257 TGGATGGAAACGGAAGGTGGGCCAAGCAGCAAGGGTGGCCACCGTCCAAAGGCCATGAGG 316

Query 311 CTGGTGCACGGTCTTTGCTGGAGATCGTGCAGATTTCTTGTCAATGGGGGATTAAAGTTC 370 I I I I I I I I I I I I I I I I I M I M l I I I I 1 I I I I I I I I II I I I I I I M

Sbj ct 317 CTGGCGTACGCTCATTGATGGAGATTATGAACCTTTGTGGTCACTGGGGGATTAAAGTTC 376

Query 371 TTACCGTTTTTGCGTTTTCTTGCGATAATTGGACTAGGCCCAAAGTGGAGATTGATTTCT 430

I I I I I I I I I I I I I I I I II I I II I I I I I I I I I I I I I I II I I I I I I I 1 I I HI

Sbj ct 377 TTACAGTTTTTGCCTTTTCTTGTGAGAATTGGACTAGGCCTAAGGTGGAGATCGACTTCT "436

' Query ' 431 TGATGAGTTTGTTCGAAAGCGTGTTAAAGTCAGAGATGGATAAATTTGTGAGGGAAGGTA 490

I I I I I M I I I I I I I I I I I .1 I I I I I I I I I I M l II II M I I II I II I I II I

Sbjct 437 TGATGAGTTTGTTTGAAAGAGTGTTAAAGTCTGAATTAGAAAATCTTTTGAGGGAAGGTA

496

Query 491 TTCGAATCTCTGTGATCGGGGACTCATCAAGGCTTCCACAGTCTTTGCAAAGATTAATAA 550

I II I II I I I I I I I I I I I I II I I I I I I I I I I II M I I I I I I

Sbj ct 497 TCCGGGTGTCCATTATTGGAGACGTATCGAAGCTCCCAGAGTCCCTGCAGAGATTGATTA 556

Query 551 ATGAAGTGGAGGAGACCACCAGAAATTTCTCGAAACTGCACCTTCTAGTGGCGGTTAGCT 610 -

I I I I I I I I I I II II I I I I I I I I M M I I I I M II I MM! M I M II Sbjct 557 GAGAAGTAGAGGACACAACTAAAGACTACTCGAAACTTCACCTTCTGGTGGCAGTTAGCT 616

Query 611 ACAGTGGAAAGTATGATGTTGTAAAAGCATGCAAAAGTATTGCTTGTCTGGTAAAGGATG 670

ϊ I II I I I I I M I II I III M M I I II I II I I I I I II I I I I II I I II II I

Sbjct 617 ACAGTGGGAAATATGATGTTGTAAAAGCATGTAGAAACATTGCTGGCCGAGTAAAGGAAG 676

Query 671 GTGTTATTGAACCAGAAGACATTAGCGAAAGCCTAATTGAGCAGGAGTTGGAAACAAATT 730

III II I I I I II I II I I II I I I I II I I I II I I I II II III I II I II II II I

Sbjct- 677 GTGCTATCGAACCGGAAGACATTAGCGAAGACCTAATCGAACAAGAGCTGGAAACAAACT 736

Query 731 GCTCCGAGTTTCCCTCCCCTGATTTATTAATCCGAACTAGTGGTGAACTTAGAATTAGCA 790

MM III I I I I I I I I II I I II M II II III I I II I I I I II I II I II I II I

Sbjct 737 GCTCTGAGCATCCCTCGCCTGACCTATTAATCCGAACCAGTGGGGAACTTAGAATCAGTA

796 Query 791 ACTTCTTGCTATGGCAGTTGGCCTACACTGAACTTTTCTTT ' GCGGAAGAACTCTGGCCTG 850

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I J I I I I M I I

Sbj ct 797 ACTTCTTGCTGTGGCAGTTGGCCTACACTGAACTTTACTTTGCAGAAGAACTGTGGCCTG 856

Query 851 ATTTTGGAAAAACTGGATTCATAGAGGCCTTAACTTCATACCAACAAAGGCAAAGACGCT 910

I I I I I I I III I I I I I I I I I I I I I I I I I I I I I I I I I I 1 I I I I I I II

Sbjct 857 ATTTTGGGAAAGATGGTTTTGTAGAGGCCTTAACTTCATTCCAACAAAGGCAGAGACGCT 916

Query 911 ATGG 914

I I I

Sbjct 917 ACGG 920 ref I XM_002313347.1 | Populus trichocarpa predicted protein, mRNA

Length=705

GENE ID: 7468564 POPTRDRAFT_804506 | hypothetical protein [Populus trichocarpa]

(10 or fewer Pub ed links)

Score = 558 bits (618), Expect = 2e-155

Identities = 544/699 (78%), Gaps = 5/699 (1%)

Strand=Plus/Plus COVERAGE 74%

Query 226 ATGCCACGGCATGTCGCCGTGATCATGGACGGCAATGGGAGGTGGGCCCAGCAGCGAGGT 285

M i l l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj ct 1 ATGCCCCGTCACGTGGCGGTGATAATGGATGGCAATGCGAGATGGGCCAGGCAGCGTGGG 60

Query 286 CAGATGGCAT CGATGGGTCATGAGGCTGGTGCACGGTCTTTGCTGGAGATCGTGCA

341

I I I I I I I I I I I I I ! I I. I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 61 TTTATAGCATTATCCGCTGGG-CATGAAGCTGGTGCACGGTCACTTAGGGAGCTTGTGGA 119

Query 342 GATTTCTTGTCAATGGGGGATTAAAGTTCTTACCGTTTTTGCGTTTTCTTGCGATAATTG 401 .

"I I I I I I I I M I N I i l l LI I I I I I I I I I I I I I I I I I I I I Sbjct 120 GTTGTGTTGTGACTGGGGGGTTAGAGTTCTCACTGTTTTTGCCTTCTCTTATGATAATTG 179

Query 402 GACTAGGCCCAAAGTGGAGATTGATTTCTTGATGAGTTTGTTCGAAAGCGTGTTAAAGTC 461

II i i I I I I II I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M i l l Sbjct 180 GATTAGGCCTAAGGTGGAGGTTGATTTCTTGATGAGTTTATTTGAAAGGATGTTGAAGTC 239

Query 462 AGAGATGGATAAATTTGTGAGGGAAGGTATTCGAATCTCTGTGATCGGGGACTCATCAAG 521 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I Sbj ct 240 CGAGTTGGATAATTTTGTCAGGCAGGGCGCTCGAGTCTCTACAATTGGAGACTCGTCCAG 299

Query 522 GCTTCCACAGTCTTTGCAAAGATTAATΑΆΑΤGAAGTGGAGG GACCACCAGΑΑΆ TTC C 581

I I I I I I ' l l I I I I I I M l I I I I I I I I I I I I M i l l I I I Sbjct 300 GCTCTCGGAATCTCTGAAGAAACTGATAAGTGACGTAGAGGAGAAGACGAAAGACAACTC 359

Query 582 GAAACTGCACCTTCTAGTGGCGGTTAGCTACAGTGGAAAGTATGATGTTGTAAAAGCATG 641

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I I I I I

S j ct 360 CAGACTTCATCTTATCGTGGCAGTCAGCTATAGTGGGAAATATGATGTTACACAGGCATG 419

Query 642 CAAAAGTATTGCTTGTCTGGTAAAGGATGGTGTTATTGAACCAGAAGACATTAGCGAAAG 701

M I N I I I I I I I I I I i I I I I M I 1 I I I I I . I I I I 1 ,1 I I I . M i l l Sbjct 420 CAAAAGCATTGCTCAAAAGGTAAAGGATGGTACTGTTC AC AGAAGACATCG TGAAAG 479

Query 702 CCTAATTGAGCAGGAGTTGGAAACAAATTGCTCCGAGTTTCCCTCCCCTGATTTATTAAT 761

. Ί I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I J I I I I I I I M i l J I I I I I I

Sbj Ct 480 CCTACTTGAACAGGAATTGGAAACAAATTGTGCCGAGTATCCATGCCCTGATTTATTGAT 539

Query 762 CCGAACTAGTGGTGAACTTAGAATTAGCAACTTCTTGCTATGGCAGTTGGCCTACACTGA 821

I I I I I I I I I I I I I I I I I I I I I; I I I I I I I I I I I I I M I I I I I I.I II 1 1 1 I I M Sbjct 540 ACGAACCAGTGGAGAACTTAGAATCAGCAATTTCTTACTGTGGCAGCTGGCCTAC CTGA 599

Query 822 ACTTTTCTTTGCGGAAGAACTCTGGCCTGATTTTGGAAAAACTGGATTCATAGAGGCCTT 881-

I I . I I I I I I I.I I. I I I I Mi I M l I I I I I I I I I I I I I I I I I I I 1.1 I M I I M I Sbjct 600 ACTCTTCTTCGCAGAAGCACTCTGGCCTGATTTTGGAAAAGCTGAGTTTGTAGAGGCCTT -

659 .

Query 882 AACTTC TACCAACAAAGGCAAAGACGCTATGGTAGACG 920

I I I I I I I I I M i l l I I I I I I I I M I I I I I I I '

Sbjct 660 AACTTCGTACCAGCAAAGACAGAGACGCTATGGCGGACG 698

CPT6 Comparison with other sequences ref I XM_002521666.11 UdRicinus communis undecaprenyl diphosphate synthase, putative, '

mRNA

' Length=1146 GENE ID: 8268767 RCOM_0873970 i undecaprenyl diphosphate synthase, putative

[Ricinus communis]

Score = 969 bits (1074), Expect = 0.0

Identities = 851/1073 (79%), Gaps = 48/1073 (4%)

Strand=Plus/Plus coverage 95%

Query 7 AAACATAGCAGTAGTAGAGTGAGTGAGCTGTTTGGAAATTTGGGTAGTTTTATTAGAGCA 66

I I I .M i l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj Ct 7 AAAAATAGTGTTAGTAGAGTGACTGAGCTGTTCTGTAGTTTAGTTAGTTTTATGAGGATA 66

Query 67 TGCATATTTCGTGTTTTATCCATGGGACCCATCCCCAATCATTTTGCCTTCATAATGGAT 126

I I I I I I I I I I I I I I I 11 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I ΙΊ I I I Sb ct 67 TGCATGTTTCGTATTCTATCTGTGGGACCAATCCCCAATCATATTGCCTTCATTATGGAT 126

Query 127 GGAAACCGGAGGTATGCTAAGAAGGAGAACATGAAAAAGGGGGCTGGTCATAGGGCTGGA 186

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Ί I I i I I I I I I I 11 I I Sbj ct 1.27 GGAAATCGGAGGTACGCTAAGAAGGAGAACATGAAAGAAGGGGCTGGTCATAGAGCTGGA 186

Query 187 TTTTTAGCTCTTATATCCATACTTAAGTACTGCTATGAGTTGGGAGTTAAGTATGTAACT 246

I I 1 I I M I I I I I I I I I I I .1 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I J I I I Sbjct 187 TTTTCAGCTCTTATATCTATACTTAAGTACTGTTATGAATTGGGGGTAAAGTATGTAACT

246

Query 247 ATTTATGCCTTTAGCATTGATAATTTCAAAAGGAATCCTGATGAAGTTAAGGACCTGATG 306

I II I I I I I I I I I I I I I I I I I M I I I I ί I I I 1 I Ί I I I I I I I I I I I I M I I I

Sbjct 247 GTTTATGCCTTTAGCATTGATAATTTTAAAAGGCGGCCAGATGAGGTTCAGGACCTTATG 306

Query 307 GATCTGATGCTAGAAAAGATTGAGGAGCTGCTGAGGGACGAAAGCATTGTGAACCAATAT 366

I I I I I I I I I I I M II I I M 1 I I I 11 I I I I -I I I I I I I I I I I I I I I I I I I I I Sbjct 307 GATCTTATGCTAG AAAGATTGAAGAGTTGCTCAAAGAAG AAGTATTGTGAACCAATAT 366

■ Query 367 GGAATCAGAGTATATTTTATAGGTAATTTGAAACTTTTGAGTGAACCTGTGAGGATTGCA 426 '

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

Sbj ct 367 GGAATCAGAGTGTATTTTATAGGTAATTTGACACTGCTAAATGAGCCTGTCAGGATTGCA

426

Query 427 GCAGAAAAGGTTATGAGAGCTACTGCCAAAAACACCAATTGTACCCTTTTAATCTGCATA 486

I I I I I I I I I I I I I I I I ' I 111 I I 1 I f I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 427 GCCGAAAAGGTTATGAGGGCTACCGCCAATAACACAAAATGTACTTTTTTAATCTGCATT 486 Query 487 GCCTATACTTCACGTGATGAGATTGTACATGCTGTTCAAGGTTCTTGTAAAAATAAACGG 546

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M l I I I ~ Sbjct 487 GCCTATACTTC TGTGATGAGATTGTACATGCTGTTCAAGAATCATGTAAATTTAAGCGG 546

Query 547 GAGGATATTCTACCATTGAGCTTTTGTAAAGCTAATAATGGTGACATTGAAGAAGTAGAG 606

I M I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

Sbjct 547 CAGGAGTTTCAACCATTGACCTTTAGTCAGCATAGTAATGATGGCA

592

Query 607 GATGATAAGAAGGTTCATGGTGTCAGCCCATTTGTTTTTTCAGAATCCCAGAAAGATGAA 666

I I I I I I I 1 I I I I I I I I I I I I I I

Sbjct 593 TTGGTTTTCAAGAAACTCAAAAGGATGAA '

621

Query 667 GCAGGCGAATCTCAAGCAACAATAGCAAGTGTAACCTGCAGTTGTCTGGCTAGAGGAGTT 726

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I

Sbjct 622 TTTGATAAATCTCAAGAAATAAAGGCAAGTAAAACCAGCAATGGTCTGACCA GAGTT

678

Query 727 GAAGGGGGTGGCAACAAAAATAGCATGGTTGTTCGTGCTGTCCGAGGATCCTATGAAGAT 786

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I 1 11 I I Sbjct 679 GAAGGGGGTGGGAACAAAATTAGCATGGCTGTGCCTGCTGCACAAGGTTTGTGTGAAAAT 738

Query 787 AAATGGGATAACTATCAAGCAGTGATGGAAAATAGAACTGGCAGTGGTGTGACTCCATCC 846

I I I I i I I I i I I I I I I I I I . 1.1 I ' I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 739 AAATGGGATAAAGATCAAACACTGACTAAAAATAAAACTGAAAATGGTGTGCTTCCCTCT 798

Query 847 GAAGAGAACAAGAATATGCAGGGAGAGTGTTCTATTGTAAAGCTAGTAGACATTGAGAAA 906

I M I I I I I I I I I I I M l I I I I I I M I I I I I I I I I I I I I I I Ml I I I I I I I

Sbj ct 799 GAAGAGAGTGAGAAGATGCAGGGGGCATGTTCTCTTATAAAGCTGGTAGACATTGAGAGA 858

Query 907 CAGATGTACATGGCAGTAGCTCCTGAACCTGACATCCTTATTCGAAGTTCTGGAGAGTCC 966

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I

Sbj ct 859 AACATGTACATGGCTGTAGCTCCTGAGCCTGACATCCTGATCCGAAGTTCTGGAGAAACC 91-8

Query 967 CGCCTGAGTAATTTCTTACTTTGGCAGTCTAGTGAGTGCCTGTTATATTCTCCAGATGCA 1026

I I I I I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I

Sbjct 919 CGCTTAAGCAACTTCCTACTTTGGCAGGCTAGTGATTGCATGTTGTATTCTCCAGATGCA 978

Query 1027 TTGTGGCCGGAAATTGGTTTATGGCACTTGGTGTGGGCAGTATTAAACTTCCA 1079 Sbjct 979 TTGTGGCCAGAAATTGGTTTCCAGCACTTGGTGTGGGTAGTAATAAACTTCCA 1031

ref I XM_002532178.1 I LEJRicinus communis undecaprenyl diphosphate synthase, putative,

mRNA

Length=1092

GENE ID: 8289715 RCOM_0275090 | undecaprenyl diphosphate synthase, putative

[Ricinus communis]

Score = 601 bits (666), Expect = 3e-168

Identities = 793/1094 (72%), Gaps = 14/1094

Strand=Plus/Plus coverage 97%

Query 32 ' AGCTGTTTGGAAATTTGGGTAGTTTTATTAGAGCATGCATATTTCGTGTTTTATCCATGG 91

l l l i I I I I I I I I I I I I I I Ϊ I I I I I I M ' I I I I I I I I I I I I I I I I I I I Sbjct 8 AGCTGCTTGGACGTTTGGCGAGTTTTATGAGACAATCCATATTTCATGTTCTACGCATGG 67

Query 92 GACCCATCCCCAATCATTTTGCCTTCATAATGGATGGAAACCGGAGGTATGCTAAGAAGG 151

I I I I I I I I I I I I I I I I I I I I I I I I I Ί I I I I II I I I I I I I I I I I I I I I Ι Ί I.I Sbjct 68 GTCCCATTCCCAGTCATCTTTCGTTCATAATGGATGGAAATCGGAGGTTTACTAAGAAGG 127

Query 152 AGAACATGAAAAAGGGGGCTGGTCATAGGGCTGGATTTTTAGCTCTTATATCCATACTTA 211

Sbjct 128 AGAACCTGAAACCAGGGGCTGGTTATAGGGCTGGGTTTTTAGCTCTTATGTCCATGCTTA 187

Query 212 AGTACTGCTATGAGTTGGGAGTTAAGTATGTAACTATTTATGCCTTTAGCATTGATAATT 271

I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I N I I I I I

Sbjct 188 AGTACTGCTATGAGTTGGGGGTGAAGCATGTAACTATTTTTGCCTTTGGCAT.TGATAAT T 247

Query 272 TCAAAAGGAATCCTGATGAAGTTAAGGACCTGATGGATCTGATGCTAGAAAAGATTGAGG 331

I I I I I ! I I I I I 1 I I I I'M I I I I I I I I I I I I I I I 1 I- I I I I I I I Sbj ct 248 TTAAAAGGCGACCTGATGAGGTTCGGTTTATAATGGATCTGATACTGGAGAAGACTCTGG 307

Query 332 AGCTGCTGAGGGACGAAAGCATTGTGAACCAATATGGAATCAGAGTATATTTTATAGGTA 391

I I I I I I I I I M i l l I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj ct 308 GGTTGCTCAAGGAAGAAAGTATAGTCCATCAATAT-GGTATTAGAGTACATTTTATTGGT A 367

Query 392 ATTTGAAACTTTTGAGTGAACCTGTGAGGATTGCAGCAGAAAAGGTTATGAGAGCTACTG 451

M I I I I I I I I I I I I I I ■ I 111 I I I I I I I 1 I I I I I I I I I I I I I I I I I Sbj ct 368 ATTTGAAGCTTCTAGATGAGCCACTCAGGGTTGCAGCAGAAAAGGTTACGAGGACTACCT 427

Query 452 CCAAAAACACCAATTGTACCCTTTTAATCTGCATAGCCTATACT.TCACGTGATGAGATT G . 511

I I I I I I I I I I I I I I I I I I I I I I I I I I. I I I I I I I I I I I I I I I I Sbj ct '428 CCAGCAATACCAAGTTTGTTCTTTTGATTTGCGTAGCCTATTCATCAACTAATGAGATAA 487

Query 512 TACATGCTGTTCAAGGTTCTTGTAAAAATAAACGGGAGGATATTCTACCATTGAGCTTTT 571

I I I I I I I M I I I I I I I I I I I I I. I I I I I I I I II I I I I I I I Sbjct 488 CCCATGCTGTTCAACAATATTGTAAAGAGAAATGGAATGAAATTGAGCCTTCC ACTATG 547

Query 572 GTAAAGCTAATAATGGTGACATTGAAGAAGTAGAGGATGATAAGAAGGTTCATGGTGTCA 631

I I I I I I I I I I I I I I J ΙΊ I I I I ' I I I I I I I I I II . II I

Sbjct 548 ATAAAGTTTCCAA TGATCTAGTTAAAGTAGAAGTTGGTAAGAATATAGATAATGCCA

604

Query 632 GCCCATTTGTTTTTTCAGAATCCCAGAAAGATGAAGCAGGCGAATCTCAAGCAACAATAG 691

I I I I I I I I I I I I I I I I I I I I I I I I M i M l I I I I I I I Sbjct 605 TCATGTGTGGTGCTGGAGAGTCCTGCAAAGAGGAAGCAGATGAACTCCAAGCAGCGAAAG 664

Query 692 CAAGTGTAACCTGCAGTTGTCTGGCTAGAGGAGTTGAAGGGGGTGGCAACAAAAATAGCA 751

I I I I ' I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 665 CAAAGCCAGAGAGTAATGGTGTGACTAAAGGAGTTGAAGAGATTTTCAATGAACACAGTG 724 -

Query 752 TGGTTGTTCGTGCTGTCCGAGGATCCTATGAAGATAAATGGGATA ACTATCAAGCAG

808

I III ' II I I I I I I I I I .I I I I I I I I I I I

Sbjct 725 TCACTGTGAGTACTGTCCAAAGAGCTTTCGGAGGCAAA GATAGAGAAGGTCAAGCGC 781

Query 809 TGATGGA-AAATAGAACTGGCAGTGGTGTGACTCCATCCGAAGAGAACAAGAATATGCAG 867

I I I I I I I I I I I I I I I I I II I I I I I I I I II I I I I I I I I I I

Sbjct 782 TG-TGGAGTATTAGAACCGGCGACAGTGGGATTCGAGATGAAGAAAGGGAGAAAATGCA- 839

Query 868 GGAGAGTGTTCTATTGTAAAGCTAGTAGACATTGAGAAACAGATGTACATGGCAGTAGCT 927

I I I I I I I I I I I I I I I I I I I I I II I I I I I I I I I I I I I I I I I I I

Sbjct 840 --ATCTCATTCTATCATAAAGCAGGTAGATCTCGAGAAGCACATGCCCATGGCAGTAGCT 897

Query 928 CCTGAACCTGACATCCTTATTCGAAGTTCTGGAGAGTCCCGCCTGAGTAATTTCTTACTT 987 I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbj ct 898 CCTGATCCTGATATACTGATCCGAACATCAGGGGAGACCCGTCTGAGCAACTTCCTACTT 957

Query 988 TGGCAGTCTAGTGAGTGCCTGTTATATTCTCCAGATGCATTGTGGCCGGAAATTGGTTTA 1047

I I I I I I I I I I U I I I I I I I I M I I I I I I I I I I I I I I I I I I I I I I I- I

Sbjct 958 TGGCAGGCTGGTGACTGCCAAGGGTATTCTCCGGATGCATTGTGGCCAGACATTGTTCTG 1017

Query 1048 TGGCACTTGGTGTGGGCAGTATTAAACTTCCAGAGAAACCATTCTTATTTGGAAAGGAAA 1107

I I I I I I I I 1 I I I I I I I I I I J I I I I I I I I I I I I I I I I I I I I I I I I I I I I Sbjct 1018 CGACAGTTGGTGTGGGCAGTACTAAACTTCCAGTATAATTATGCTTATTTGGAGAAGAAA 1077

Query 1108 AAGCATCAGTTGTA 1121

I I I I I I I M I I

Sbjct 1078 AAGAAGCAGCTGTA 1091

Example 3

Expression of the protein is performed after the sequence analysis and phylogenetic study. Initially, full length gene was amplified from the positive clones by PCR using primers ECPT IF and ECPT 1R for CPT 1, and ECPT 6F and ECPT 6 R for CPT 6. These primers are listed in Table 1. The PCR reaction mixture (50 μΕ) contained 50 ng of the plasmid, 20 pmoles of each primer, 5 μΕ of 10X Pfu Buffer, 5 μΕ of 2.5 mM dNTP mix and 2.5 units of PfuTurbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions: initial denaturation for 5 min at 94°C; followed by 35 cycles of denaturation at 94°C for 30 sec; annealing at 55°C for 30 sec; and extension at 72°C for 1 min for CPT 1, while 1.15 min for CPT 6; with a final extension at 72°C for 7 min. The PCR product was then analyzed by 1% agarose gel and the amplicon was eluted from the gel using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. The purified PCR product was ligated into pCR® 4 Blunt TOPO® Vector (invitrogen) and transformed into One Shot® Machl™-T1R Chemically Competent E. coli cells (invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manufacturer's instructions. The insert was released from the plasmid by digesting with Nde 1 and Xho 1 (NEB). The insert was gel purified using GENECLEAN® TURBO Gel band elution kit (MP Biomedicals) according to the manufacturer's instructions and ligated into pET- 14b vector (Novagen) linearized with Nde 1 and Xhol (NEB). The ligation mixture was transformed into BL21 (DE3)pLysS chemically competent E.coli cells (Novagen). From the positive colonies, plasmids were isolated and the presence of the insert was confirmed by restriction digestion as well as sequencing. Figure 7 and 8 show the restriction patterns of the plasmids containing CPTl and CPT6 digested by Ndel and Xhol . The positive colonies were then used for protein induction which was done at 15, 20, 25 and 37°C with 0.5, land 1.5 mM of IPTG. Figure 9 demonstrates the induced protein of CPTl under 25°C; whereas Figure 10 demonstrates the induced protein of CPT6 under 37°C. CPTl can be optimally expressed at 25°C whereas CPT6 at 37°C in the present construct.

Example 4

Homology modeling can be conducted in which the models were built using Modeller 9v8. The structures have been modelled on the dimer, which was generated using the symmetry records in the deposited PDB file and UCSF Chimera. Thus, Modeller 9v8 was run using both the BLAST-guided PDB retrieved templates from PDB.

Example 5

Automatic metabolic pathway reconstruction showcasing role of CPTl and CPT6 in rubber biosynthesis was constructed by identifying orthologs for predicted rubber proteins in Arahidopsis genome and sequence orthologs. UPP catalyzed enzymatic reactions encoded within rubber genome were constructed out of 566 enzymatic reactions available in Resnet- Plant 3.0 database for Pathway Studio as well as from metabolic pathway databases (MPW).

I