LOW PHILIP (US)
CHANG YUN (US)
JUNG JUHYUNG (US)
WO2020198128A1 | 2020-10-01 |
US198162633987P | ||||
US7446190B2 | 2008-11-04 | |||
US20130071414A1 | 2013-03-21 | |||
US11077143B2 | 2021-08-03 | |||
US20160009813A1 | 2016-01-14 | |||
US11141434B2 | 2021-10-12 |
SUSANNE O BRIEN: "Induced Human Pluripotent Stem Cell - derived NK Cells as an Alternative Source of Lymphocytes for Anti-Cancer Immunotherapy", 28 January 2018 (2018-01-28), XP055712466, Retrieved from the Internet
ROHAAN ET AL.: "Adoptive cellular therapies: the current landscape", VIRCHOWS ARCHIV, vol. 474, 2019, pages 449 - 461, XP037492416, DOI: 10.1007/s00428-018-2484-0
HINRICHSROSENBERG: "Exploiting the curative potential of adoptive T-cell therapy for cancer", IMMUNOLOGICAL REVIEWS, vol. 257, no. 1, 2014, pages 56 - 71, XP055249662, DOI: 10.1111/imr.12132
FRONTIERS IMMUNOLOGY, vol. 7, 2016
ZHU ET AL.: "Metabolic Reprograming via Deletion of CISH in Human iPSC-Derived NK Cells Promotes In Vivo Persistence and Enhances Anti-tumor Activity", CELL STEM CELL, vol. 27, no. 2, 2020, pages 224 - 237, XP086239989, DOI: 10.1016/j.stem.2020.05.008
GOLDENSON ET AL.: "Umbilical Cord Blood and iPSC-Derived Natural Killer Cells Demonstrate Key Differences in Cytotoxic Activity and KIR Profiles", FRONTIERS IMMUNOLOGY, vol. 11, 2020
CICHOCKI ET AL.: "iPSC-derived NK cells maintain high cytotoxicity and enhance in vivo tumor control in concert with T cells and anti-PD-1 therapy", SCIENCE TRANSLATIONAL MEDICINE, vol. 12, no. 568, 2020
ZHU ET AL.: "Pluripotent stem cell-derived NK cells with high-affinity noncleavable CD16a mediate improved antitumor activity", BLOOD, vol. 135, no. 6, 2020, pages 399 - 410, XP055967123, DOI: 10.1182/blood.2019000621
CURRENT OPINIONS CHEMICAL ENGINEERING, vol. 30, 2020, pages 69 - 76
HANDGRETINGER ET AL.: "Exploitation of natural killer cells for the treatment of acute leukemia", BLOOD, vol. 127, no. 26, 2016, pages 3341 - 3349
ROMEE ET AL.: "Cytokine-induced memory-like natural killer cells exhibit enhanced responses against myeloid leukemia", SCIENCE TRANSLATIONAL MED, vol. 8, no. 357, 2016, XP055815100, DOI: 10.1126/scitranslmed.aaf2341
CERWENKALANIER: "Natural killer cell memory in infection, inflammation and cancer", NATURE REVIEWS IMMUNOLOGY, vol. 16, 2016, pages 112 - 123, XP037923260, DOI: 10.1038/nri.2015.9
PAUSTVON ANDRIAN: "Natural killer cell memory", NATURE IMMUNOLOGY, vol. 12, 2011, pages 500 - 508
O'SULLIVAN ET AL.: "Natural Killer Cell Memory", IMMUNITY, vol. 43, no. 4, 2015, pages 634 - 645
SUN ET AL.: "Adaptive immune features of natural killer cells", NATURE, vol. 457, 2009, pages 557 - 561, XP002639511, DOI: 10.1038/NATURE07665
BERRIEN-ELLIOTT ET AL.: "Human Cytokine-Induced Memory-Like Natural Killer Cells", J INNATE IMMUNOLOGY, vol. 7, no. 6, 2015, pages 563 - 671, XP055841904, DOI: 10.1159/000382019
COOPER ET AL.: "Cytokine-induced memory-like natural killer cells", PNAS USA, vol. 106, no. 6, 2009, pages 1915 - 1919, XP002639517, DOI: 10.1073/pnas.0813192106
MA ET AL.: "An oncolytic virus expressing ill5/ill5ra combined with off-the-shelf egfr-car nk cells targets glioblastoma", CANCER RESEARCH, vol. 81, no. 13, 2021, pages 3635 - 3648
LIU ET AL.: "Cord blood NK cells engineered to express IL-15 and a CD19-targeted CAR show long-term persistence and potent antitumor activity", LEUKEMIA, vol. 32, 2018, pages 520 - 531, XP055664776, DOI: 10.1038/leu.2017.226
MOLECULAR THERAPY - METHODS & CLINICAL DEVELOPMENT, vol. 23, 2021, pages 582 - 596
ROMEE ET AL.: "Cytokine activation induces human memory-like NK cells", BLOOD, vol. 120, no. 24, 2012, pages 4751 - 4760, XP055159210, DOI: 10.1182/blood-2012-04-419283
GANG ET AL.: "CAR-modified memory-like NK cells exhibit potent responses to NK-resistant lymphomas", BLOOD, vol. 136, no. 20, 2020, pages 2308 - 2318, XP093006223, DOI: 10.1182/blood.2020006619
LOPEZ-VERGES ET AL.: "CD57 defines a functionally distinct population of mature NK cells in the human CD56dimCD16+ NK-cell subset", BLOOD, vol. 116, no. 19, 2010, pages 3865 - 3874, XP055182675, DOI: 10.1182/blood-2010-04-282301
SKAK ET AL.: "Interleukin-21 activates human natural killer cells and modulates their surface receptor expression", IMMUNOLOGY, vol. 123, no. 4, 2008, pages 575 - 583, XP055020565, DOI: 10.1111/j.1365-2567.2007.02730.x
HEINZE ET AL.: "The Synergistic Use of IL-15 and IL-21 for the Generation of NK Cells From CD3/CD19-Depleted Grafts Improves Their ex vivo Expansion and Cytotoxic Potential Against Neuroblastoma: Perspective for Optimized Immunotherapy Post Haploidentical Stem Cell Transplantation", FRONTIERS IMMUNOLOGY, vol. 10, 2019
MA ET AL.: "Natural Killer (NK) and CAR-NK Cell Expansion Method using Membrane Bound-IL-21-Modified B Cell Line", JOVE J, 2022
MISHRA ET AL.: "Aberrant Overexpression of IL-15 Initiates Large Granular Lymphocyte Leukemia through Chromosomal Instability and DNA Hypermethylation", CANCER CELL, vol. 22, no. 5, 2012, pages 645 - 655
CHEN ET AL.: "Exosomal PD-L1 contributes to immunosuppression and is associated with anti-PD-1 response", NATURE, vol. 560, 2018, pages 382 - 386, XP036572849, DOI: 10.1038/s41586-018-0392-8
JIANG ET AL.: "Role of the tumor microenvironment in PD-L1/PD-1-mediated tumor immune escape", MOLECULAR CANCER, vol. 18, no. 10, 2019
LI ET AL.: "Human iPSC-Derived Natural Killer Cells Engineered with Chimeric Antigen Receptors Enhance Anti-tumor Activit", CELL STEM CELL, vol. 23, no. 2, 2018, pages 181 - 192, XP055700643, DOI: 10.1016/j.stem.2018.06.002
SEO ET AL.: "IL-21-mediated reversal of NK cell exhaustion facilitates anti-Tumour immunity in MHC class I-deficient tumours", NATURE COMMUNICATIONS, vol. 8, 2017, pages 15776
JUDGE ET AL.: "Characterizing the Dysfunctional NK Cell: Assessing the Clinical Relevance of Exhaustion, Anergy, and Senescence", FRONTIERS IN CELLULAR & INFECTION MICROBIOLOGY, vol. 10, 2020
LUO ET AL.: "Targeted Rejuvenation of Exhausted Chimeric Antigen Receptor T-cells Regresses Refractory Solid Tumors", MOLECULAR CANCER RESEARCH, vol. 20, no. 5, 2022, pages 823 - 833
TAMADA ET AL.: "Redirecting gene-modified T cells toward various cancer types using tagged antibodies", CLINICAL CANCER RESEARCH, vol. 18, no. 23, 2012, pages 6436 - 6445, XP055154500, DOI: 10.1158/1078-0432.CCR-12-1449
MA ET AL.: "Versatile strategy for controlling the specificity and activity of engineered T cells", PNAS USA, vol. 113, no. 4, 2016, pages E450 - E458, XP055678633, DOI: 10.1073/pnas.1524193113
LEE ET AL.: "Regulation of CAR T cell-mediated cytokine release syndrome-like toxicity using low molecular weight adapters", NATURE COMMUNICATIONS, vol. 10, 2019, pages 2681
LEE ET AL.: "Use of a single CAR T cell and several bispecific adapters facilitates eradication of multiple antigenically different solid tumors", CANCER RESEARCH, vol. 79, no. 2, 2019, pages 387 - 396, XP055814305, DOI: 10.1158/0008-5472.CAN-18-1834
ZHU ET AL.: "Concise Review: Human Pluripotent Stem Cells to Produce Cell-Based Cancer Immunotherapy", STEM CELLS, vol. 36, no. 2, 2018, pages 134 - 145
ROBBINS ET AL.: "Tumor control via targeting pd-11 with chimeric antigen receptor modified nk cells", ELIFE, 2020
ROEX ET AL.: "Two for one: targeting BCMA and CD19 in B-cell malignancies with off-the-shelf dual-CAR NK-92 cells", J TRANSLATIONAL MEDICINE, vol. 20, 2022, pages 124
INGEGNERE ET AL.: "Human CAR NK cells: A new non-viral method allowing high efficient transfection and strong tumor cell killing", FRONTIERS IN IMMUNOLOGY, vol. 10, 2019, XP055740362, DOI: 10.3389/fimmu.2019.00957
LIU ET AL.: "Use of CAR-Transduced Natural Killer Cells in CD19-Positive Lymphoid Tumors", NEW ENGLAND J MEDICINE, vol. 382, 2020, pages 545 - 553, XP055800844, DOI: 10.1056/NEJMoa1910607
SADELAIN ET AL.: "The Basic Principles of Chimeric Antigen Receptor Design", CANCER DISCOVERY OF1-11, 2013
AHMEN ET AL.: "HER2-specific T cells target primary glioblastoma stem cells and induce regression of autologous experimental tumors", CLINICAL CANCER RESEARCH, vol. 16, no. 2, 2010, pages 474 - 485
CHEKMASOVA ET AL.: "Successful eradication of established peritoneal ovarian tumors in SCID-Beige mice following adoptive transfer of T cells genetically targeted to the MUC16 antigen", CLINICAL CANCER RESEARCH, vol. 16, no. 14, 2011, pages 3594 - 3606, XP055344554, DOI: 10.1158/1078-0432.CCR-10-0192
ZHONG ET AL.: "Chimeric antigen receptors combining 4-1BB and CD28 signaling domains augment PI3kinase/AKT/Bcl-XL activation and CD8+ T cell-mediated tumor eradication", MOLECULAR THERAPY, vol. 18, no. 2, 2010, pages 413 - 420, XP055023623, DOI: 10.1038/mt.2009.210
BIEDERSTADTREZVANI: "Engineering the next generation of CAR-NK immunotherapies", INT. J. HEMATOL, 2021
ZHANG ET AL.: "Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade", CELL DISCOVERY, vol. 3, 2017, pages 17004, XP093027630, DOI: 10.1038/celldisc.2017.4
FABIAN ET AL.: "PD-L1 targeting high-affinity NK (t-haNK) cells induce direct antitumor effects and target suppressive MDSC populations", J IMMUNOTHERAPY CANCER, vol. 8, no. 1, 2020, XP055953974, DOI: 10.1136/jitc-2019-000450
REIGHARD ET AL.: "Therapeutic Targeting of Follicular T Cells with Chimeric Antigen Receptor-Expressing Natural Killer Cells", CELL REPORTS MEDICINE, vol. 1, no. 1, 2020, pages 100003, XP055781338, DOI: 10.1016/j.xcrm.2020.100003
KASAIAN ET AL.: "IL-21 limits NK cell responses and promotes antigen-specific T cell activation: A mediator of the transition from innate to adaptive immunity", IMMUNITY, vol. 16, no. 4, 2002, pages 559 - 569, XP002389123, DOI: 10.1016/S1074-7613(02)00295-9
VENKATASUBRAMANIAN ET AL.: "IL-21-dependent expansion of memory-like NK cells enhances protective immune responses against Mycobacterium tuberculosis", MUCOSAL IMMUNOLOGY, vol. 10, no. 4, 2017, pages 1031 - 1042
GRANZIN ET AL.: "Highly efficient IL-21 and feeder cell-driven ex vivo expansion of human NK cells with therapeutic activity in a xenograft mouse model of melanoma", ONCOIMMUNOLOGY, vol. 5, no. 9, 2016, pages e1219007, XP055887121, DOI: 10.1080/2162402X.2016.1219007
SAMBROOK ET AL.: "Molecular Cloning: A Laboratory Manual", 2012, COLD SPRING HARBOR LABORATORY PRESS
"Remington's Pharmaceutical Sciences", 1985
NATURE COMMUNICATIONS, vol. 10, 2019, pages 2681
CHANG ET AL.: "Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells", BIOTECHNOLOGY & BIOENGINEERING, vol. 117, no. 7, 2020, pages 2177 - 2186
MARTIN ET AL.: "Paucity of PD-L1 expression in prostate cancer: Innate and adaptive immune resistance", PROSTATE CANCER & PROSTATIC DISEASES, vol. 18, 2015, pages 325 - 332, XP036973371, DOI: 10.1038/pcan.2015.39
KAGOYA ET AL.: "A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects", NATURE MEDICINE, vol. 24, 2018, pages 352 - 359
KANDARIAN ET AL.: "A flow cytometry-based cytotoxicity assay for the assessment of human NK cell activity", JOVE: IMMUNOLOGY & INFECTION, 2017
69890-02 WHAT IS CLAIMED IS: 1. A population of natural killer (NK) cells derived from human pluripotent stem cells (hPSCs) and engineered to: overexpress transcription factor ID2, NFIL3, and/or SPI1; and express an anti-programmed death ligand 1 (PD-L1) chimeric antigen receptor (CAR) and an anti-fluorescein isothiocyanate (FITC) CAR. 2. The population of NK cells of claim 1, wherein the NK cells are engineered to overexpress the transcription factor ID2. 3. The population of NK cells of claim 1, wherein the anti-PD-L1 CAR and/or anti- FITC CAR comprises a truncated cytoplasmic domain from interleukin-2 (IL-2) receptor β- chain, a STAT3-binding tyrosine-X-X-glutamine (YXXQ) motif, or both. 4. The population of NK cells of claim 1, wherein the anti-PD-L1 CAR and/or the anti-FITC CAR comprises NK cell-Fc receptor transmembrane and intracellular signaling domains. 5. The population of NK cells of claim 4, wherein the NK cell-Fc receptor transmembrane and intracellular signaling domains comprises a γ-chain from CD32a or a γ-chain from CD16. 6. The population of NK cells of claim 1, wherein the overexpression of the transcription factor(s) is inducible. 7. The population of NK cells of claim 6, wherein the majority of the NK cells are CD45+CD56+. 8. The population of NK cells of claim 1, which expresses at least one NK cell- specific marker. 9. The population of NK cells of claim 8, wherein the at least one NK cell-specific marker is NKp44, NKp46, KIR3DL1, NKG2D, or any combination thereof. 69890-02 10. The population of NK cells of any of claims 1-9, wherein the hPSCs comprise human embryonic stem cells (hESCs) and/or induced pluripotent stem cells (iPSCs). 11. A population of human pluripotent stem cells (hPSCs) engineered to express an anti-programmed death ligand 1 (PD-L1) chimeric antigen receptor (CAR) and an anti- fluorescein isothiocyanate (FITC) CAR. 12. The population of hPSCs of claim 11, further engineered to overexpress transcription factor ID2, NFIL3, and/or SPI1. 13. The population of hPSCs of claim 11 or 12, wherein the hPSCs comprise human embryonic stem cells (hESCs) and/or induced pluripotent stem cells (iPSCs). 14. The population of hPSCs of claim 11 or 12, wherein the hPSCs are engineered to overexpress transcription factor ID2. 15. The population of hPSCs of claim 11 or 12, wherein the anti-PD-L1 CAR and/or anti-FITC CAR comprises a truncated cytoplasmic domain from interleukin-2 (IL-2) receptor β- chain, a STAT3-binding tyrosine-X-X-glutamine (YXXQ) motif, or both. 16. The population of hPSCs of claim 11, wherein the anti-PD-L1 CAR and/or the anti-FITC CAR comprises NK cell-Fc receptor transmembrane and intracellular signaling domains. 17. The population of hPSCs of claim 16, wherein the NK cell-Fc receptor transmembrane and intracellular signaling domains comprises a γ-chain from CD32a or a γ-chain from CD16. 18. The population of hPSCs of claim 12, wherein the overexpression of the transcription factor(s) is inducible. 19. A chimeric antigen receptor (CAR) construct comprising one or more sequences that encode: an anti-FITC polypeptide or an anti-PD-L1 polypeptide; 69890-02 a NKG2d transmembrane domain; and a 2B4 co-stimulatory domain. 20. The CAR construct of claim 19, further comprising one or more sequences that encode a truncated cytoplasmic domain from interleukin-2 (IL-2) receptor β-chain, a STAT3- binding tyrosine-X-X-glutamine (YXXQ) motif, or both 21. The CAR construct of claim 19 or 20, further comprising one or more sequences that encode FcγRIII. 22. A population of universal natural killer (NK) cells derived from human pluripotent stem cells (hPSCs) and engineered to overexpress transcription factor ID2, NFIL3, and/or SPI1. 23. The population of universal NK cells of claim 22, wherein the expression of the transcription factor(s) is inducible. 24. The population of universal NK cells of claim 22 or 23, wherein the majority of the NK cells are CD45+CD56+. 25. The population of universal NK cells of claim 22, which express at least one NK cell-specific marker. 26. The population of universal NK cells of claim 25, wherein the at least one NK cell- specific marker is NKp44, NKp46, KIR3DL1, NKG2D, or any combination thereof. 27. A pharmaceutical composition comprising: the NK cells of any one of claims 1-10 or the universal NK cells of any one of claims 22- 26; and a pharmaceutically acceptable carrier and/or diluent. 28. The pharmaceutical composition of claim 27, further comprising a pharmaceutically acceptable excipient. 69890-02 29. A use of the NK cells of any one of claims 1-10, the construct of any one of claims 19-21, the universal NK cells of any one of claims 22-26, or a pharmaceutical composition of claim 27 or 28 in the manufacture of a medicament for the treatment of cancer in a subject. 30. A method of treating cancer in a subject comprising administering to the subject a first therapy comprising a therapeutically effective amount of: a population of the NK cells of any one of claims 1-10; a population NK cells expressing one or more constructs of any one of claims 19-21; a population of the universal NK cells of any one of claims 22-25; or the pharmaceutical composition of claim 27 or 28; whereupon the subject is treated for cancer. 31. The method of claim 30, further comprising administering to the subject a conjugate comprising FITC linked to a ligand that binds folate receptor α (FRα). 32. The method of claim 30, further comprising administering to the subject a conjugate comprising FITC linked to a ligand that binds prostate-specific membrane antigen (PSMA). 33. The method of claim 32, wherein the ligand that binds PSMA is DUPA. 34. The method of claim 30, further comprising administering to the subject a conjugate comprising FITC linked to a ligand that binds carbonic anhydrase IX (CAIX). 35. The method of claim 30, further comprising administering a second therapy to the subject. 36. The method of claim 35, wherein the second therapy comprises a therapeutically effective amount of chemotherapy. 37. The method of claim 35, wherein the second therapy comprises a therapeutically effective amount of radiotherapy. 69890-02 38. The method of claim 35, wherein the second therapy comprises surgical removal of cancerous cells from the subject. 39. The method of any one of claims 30-38, wherein administering the first therapy comprises a delivery route selected from the group consisting of intravenous, intraperitoneal, intramuscular, intradermal, subcutaneous, intrathecal, intraosseous, and a combination of any of the foregoing. 40. The method of claim 35, wherein the second therapy comprises a chemotherapy, radiotherapy, or both. 41. The method of claim 35, further comprising imaging a cancer in the subject prior to or during administering the first and/or second therapies. 42. The method of claim 35, wherein the first and second therapies are administered sequentially and/or alternatively. 43. A method of producing the population of natural killer (NK) cells, the method comprising differentiating a population of human pluripotent stem cells (hPSCs) to NK cells, the population of hPSCs engineered to overexpress transcription factor ID2, NFIL3, and/or SPI1. 44. The method of claim 43, wherein the population of hPSCs is engineered to express an anti-programmed death ligand 1 (PD-L1) chimeric antigen receptor (CAR) and an anti-fluorescein isothiocyanate (FITC) CAR. 45. The method of claim 43 or 44, wherein the hPSCs comprise human embryonic stem cells (hESCs) and/or induced pluripotent stem cells (iPSCs). 46. The method of claim 43 or 44, wherein the population of hPSCs is engineered to overexpress transcription factor ID2. 47. The method of claim 44, wherein the anti-PD-L1 CAR and/or anti-FITC CAR comprises a truncated cytoplasmic domain from interleukin-2 (IL-2) receptor β-chain, a STAT3- binding tyrosine-X-X-glutamine (YXXQ) motif, or both. 69890-02 48. The method of claim 44, wherein the anti-PD-L1 CAR and/or the anti-FITC CAR comprises NK cell-Fc receptor transmembrane and intracellular signaling domains. 49. The method of claim 48, wherein the NK cell-Fc receptor transmembrane and intracellular signaling domains comprises a γ-chain from CD32a or a γ-chain from CD16. 50. The method of any one of claims 43, 44, or 47-49, wherein the overexpression of the transcription factor(s) is inducible. |
69890-02 IX (CAIX). In certain embodiments, the conjugate has the following structure: , or is a accordance with methods known in the art. [0192] The method can further comprise administering to the subject a second therapy. The second therapy can comprise surgical removal of one or more cancerous cells from the subject, chemotherapy, and/or radiotherapy (e.g., a therapeutically effective amount thereof). In certain embodiments, the method further comprises administering to the subject a therapeutically effective amount of chemotherapy to the subject. In certain embodiments, the method further comprises administering to the subject a therapeutically effective amount of radiotherapy to the subject. In certain embodiments, the method further comprises administering to the subject a therapeutically effective amount of both chemotherapy and radiotherapy to the subject. [0193] The second therapy can alternatively or further comprise surgical removal of cancerous cells from the subject. [0194] The second therapy can additionally or alternatively comprise imaging a targeted location (e.g., a cancer (e.g., a tumor microenvironment)) in the subject prior to or during administering the first and/or second therapies. [0195] In some embodiments, the targeted location is additionally imaged prior to administration to the subject of the universal NK cells, the CAR-NK cells, or the NK cell composition. The cancer can be imaged during or after administration to assess metastasis, for example, and the efficacy of treatment. In some embodiments, imaging occurs by positron emission tomography (PET) imaging, magnetic resonance imaging (MRI), or single-photon-emission computed tomography (SPECT)/computed tomography (CT) imaging. The imaging method can be any suitable imaging method known in the art. 69890-02 [0196] In certain embodiments, the first and second therapies are administered sequentially and/or alternatively relative to each other. In some embodiments, the method further comprises imaging the cancer in the subject prior to or during administering of the universal NK cells, the CAR-NK cells, the composition comprising the NK cells, and/or the second therapy. [0197] The terms “treat,” “treating,” “treated,” and “treatment” (with respect to a disease or condition, such as cancer) are used to describe a method for obtaining beneficial or desired results, such as clinical results, which can include, but are not limited to, one or more of improving a condition associated with a disease, curing a disease, lessening severity of a disease, increasing the quality of life of one suffering from a disease, prolonging survival and/or a prophylactic treatment. In reference to cancer, in particular, the terms “treat,” “treating,” “treated,” or “treatment” can additionally mean reducing the size of a tumor, completely or partially removing the tumor (e.g., a complete or partial response), stabilizing a disease, preventing progression of the cancer (e.g., progression-free survival), or any other effect on the cancer that would be considered by a physician to be a therapeutic or prophylactic treatment of the cancer. More particularly, curative treatment refers to any of the alleviation, amelioration and/or elimination, reduction and/or stabilization (e.g., failure to progress to more advanced stages) of a sign/symptom, as well as delay in progression of a sign/symptom of a particular disorder. Prophylactic treatment refers to any of the following: halting the onset, reducing the risk of development, reducing the incidence, delaying the onset, reducing the development, and increasing the time to onset of symptoms of a particular disorder. Desirable effects of treatment can include, but are not limited to, preventing occurrence or recurrence of a disease, alleviation of symptoms, diminishment of any direct or indirect pathological consequences of the disease, preventing metastasis, decreasing the rate of disease progression, amelioration or palliation of the disease state, and remission or improved prognosis. In some embodiments, compositions are used to delay development of a disease and/or tumor, or to slow (or even halt) the progression of a disease and/or tumor growth. [0198] The term “patient” or “subject” includes human and non-human animals, such as companion animals (dogs and cats and the like) and livestock animals. Livestock animals are animals raised for food production. The subject to be treated is preferably a mammal, in particular a human being. [0199] In various embodiments, the universal NK cells and/or CAR-NK cells hereof (collectively referred to herein as the “NK cells hereof”) and pharmaceutical compositions hereof can be administered to the subject via any suitable route, such as parenteral administration, e.g., intradermally, subcutaneously, intramuscularly, intraperitoneally, intravenously, or intrathecally. 69890-02 As used herein, the term “administering” includes all means of introducing the NK cells hereof or pharmaceutical compositions comprising same to the patient. Examples include, but are not limited to, oral (po), parenteral, systemic/intravenous (iv), intramuscular (im), subcutaneous (sc), transdermal, intrasternal, intraarterial, intraperitoneal, epidural, intraurethral, intranasal, buccal, ocular, sublingual, vaginal, rectal, and the like. Routes of administration to the brain include, but are not limited to, intraparenchymal, intraventricular, intracranial, and the like. [0200] The formulation of compositions suitable for administration of NK cells hereof, including compositions suitable for administration by intravenous and intratumoral routes, is within the ordinary skill in the art. [0201] Illustrative means of parenteral administration include needle (including microneedle) injectors, needle-free injectors and infusion techniques, as well as any other means of parenteral administration recognized in the art. Parenteral formulations are typically aqueous solutions, which may contain excipients, such as salts, carbohydrates and buffering agents (preferably at a pH in the range from about 3 to about 9). The preparation of parenteral formulations under sterile conditions may readily be accomplished using standard pharmaceutical techniques well-known to those skilled in the art. [0202] The NK cells hereof can be formulated as pharmaceutical compositions and administered to a mammalian host, such as a human patient, in a variety of forms adapted to the chosen route of administration. For example, the pharmaceutical composition can be formulated for and administered via oral or parenteral, intravenous, intraarterial, intraperitoneal, intrathecal, epidural, intracerebroventricular, intraurethral, intrasternal, intracranial, intratumoral, intramuscular, topical, inhalation and/or subcutaneous routes. Indeed, the NK cells hereof, or composition comprising the NK cells hereof, can be administered directly into the blood stream, into muscle, or into an internal organ. [0203] The NK cells hereof and related compositions can be administered via infusion or injection (e.g., using needle (including microneedle) injectors and/or needle-free injectors). Solutions of the composition can be aqueous, optionally mixed with a nontoxic surfactant and/or can contain carriers or excipients such as salts, carbohydrates and buffering agents (preferably at a pH of from 3 to 9). [0204] The percentage of the NK cells hereof in the compositions and preparations can vary and can be between about 1 to about 99% weight of the active ingredient(s) and a binder, excipients, a disintegrating agent, a lubricant, and/or a sweetening agent (as are known in the art). The amount of the NK cells hereof in such therapeutically useful compositions is such that an effective dosage level will be obtained. The the total number of NK cells hereof, and the concentration of the cells, 69890-02 in the composition administered to the patient can vary depending on a number of factors including, without limitation, the binding specificity of the CAR (where applicable), the identity of the cancer, the location of the cancer in the patient, the means used to administer the compositions to the patient, and the health, age and weight of the patient being treated. In various embodiments, suitable compositions comprising engineered cells include those having a volume of about 0.1 ml to about 200 ml and about 0.1 ml to about 125 ml. [0205] The term “therapeutically effective amount” as used herein, refers to that amount of the NK cells hereof that elicits the biological or medicinal response in a tissue system, animal or human that is being sought by a researcher, veterinarian, medical doctor or other clinician (e.g., a desired therapeutic effect), which includes alleviation of the symptoms of the cancer being treated. In one aspect, the therapeutically effective amount is that which can treat or alleviate the cancer or symptoms thereof at a reasonable benefit/risk ratio applicable to any medical treatment. However, it is to be understood that the total daily usage of the NK cells hereof can be decided by the attending physician within the scope of sound medical judgment. In the treatment of cancer, a desired therapeutic effect can range from inhibiting the progression of cancer, e.g., proliferation of cancerous cells and/or the metastasis thereof. Desirably, the administration of a therapeutically effective amount kills cancerous cells, such that the number of cancerous cells decreases, desirably to the point of eradication. [0206] The exact amount of the NK cells hereof required will vary from one subject to the next, depending on factors including the type of cancer being treated and the state/severity of the cancer; the specific composition employed; the age, body weight, general health, gender and diet of the patient; the time and route of administration; the duration of the treatment; drugs and/or other therapies used in combination or coincidentally with the NK cells hereof; and like factors well- known to the researcher, veterinarian, medical doctor or other clinician of ordinary skill. By way of example, a dose of the NK cells hereof can range from 10 5 to 10 12 per m 2 of the patient’s body surface area or per kg of the patient’s weight. In certain embodiments, the therapeutically sufficient amount is at or about 10 7 cells/kg of the patient’s weight (such as, 10 7 cells/kg). Thus, the absolute amount of the NK cells hereof included in a given unit dosage form can vary widely, and depends upon factors such as the age, weight and physical condition of the subject, as well as the method of administration. [0207] Depending upon the route of administration, a wide range of permissible dosages are contemplated herein. The dosages may be single or divided and may administered according to a wide variety of protocols, including q.d. (once a day), b.i.d. (twice a day), t.i.d. (three times a day), or even every other day, once a week, once a month, once a quarter, and the like. In each of these 69890-02 cases it is understood that the therapeutically effective amounts described herein correspond to the instance of administration, or alternatively to the total daily, weekly, month, or quarterly dose, as determined by the dosing protocol. [0208] Multiple infusions may be required to treat a subject effectively. For example, 2, 3, 4, 5, 6 or more separate infusions may be administered to a patient at intervals of from about 24 hours to about 48 hours, or every 3, 4, 5, 6, or 7 days. Infusions may be administered weekly, biweekly, or monthly. Monthly administrations can be repeated from 2-6 months or longer, such as 9 months to year. [0209] Administered dosages for the NK cells hereof for treating cancer are in accordance with dosages and scheduling regimens practiced by those of skill in the art. Typically, doses > 10 9 cells/patient are administered to patients receiving adoptive cell transfer therapy. Determining an effective amount or dose is well within the capability of those skilled in the art, especially in light of the detailed disclosure provided herein. [0210] The NK cells hereof administered to a subject can comprise about 1 X 10 5 to about 1 X 10 15 or 1 X 10 6 to about 1 X 10 15 transduced cells, for example. In various embodiments about 1 X 10 5 to about 1 X 10 10 , about 1 X 10 6 to about 1 X 10 10 , about 1 X 10 6 to about 1 X 10 9 , about 1 X 10 6 to about 1 X 10 8 , about 1 X 10 6 to about 2 X 10 7 , about 1 X 10 6 to about 3 X 10 7 , about 1 X 10 6 to about 1.5 X 10 7 , about 1 X 10 6 to about 1 X 10 7 , about 1 X 10 6 to about 9 X 10 6 , about 1 X 10 6 to about 8 X 10 6 , about 1 X 10 6 to about 7 X 10 6 , about 1 X 10 6 to about 6 X 10 6 , about 1 X 10 6 to about 5 X 10 6 , about 1 X 10 6 to about 4 X 10 6 , about 1 X 10 6 to about 3 X 10 6 , about 1 X 10 6 to about 2 X 10 6 , about 2 X 10 6 to about 6 X 10 6 , about 2 X 10 6 to about 5 X 10 6 , about 3 X 10 6 to about 6 X 10 6 , about 4 X 10 6 to about 6 X 10 6 , about 4 X 10 6 to about 1 X 10 7 , about 1 X 10 6 to about 1 X 10 7 , about 1 X 10 6 to about 1.5 X 10 7 , about 1 X 10 6 to about 2 X 10 7 , about 0.2 X 10 6 to about 1 X 10 7 , about 0.2 X 10 6 to about 1.5 X 10 7 , about 0.2 X 10 6 to about 2 X 10 7 , or about 5 X 10 6 cells. [0211] The NK cells hereof administered to a subject can comprise about 1 million, about 2 million, about 3 million, about 4 million, about 5 million, about 6 million, about 7 million, about 8 million, about 9 million, about 10 million, about 11 million, about 12 million, about 12.5 million, about 13 million, about 14 million, or about 15 million cells. The cells can be administered as a single dose or multiple doses. The NK cells hereof can be administered in numbers of NK cells per kg of subject body weight. 69890-02 [0212] General [0213] All patents, patent application publications, journal articles, textbooks, and other publications mentioned in the specification are indicative of the level of skill of those in the art to which the disclosure pertains. [0214] In the above description, numerous specific details are set forth to provide a thorough understanding of the present disclosure. Particular examples may be implemented without some or all of these specific details and it is to be understood that this disclosure is not limited to particular biological systems, particular cancers, or particular organs or tissues, which can, of course, vary but remain applicable in view of the data provided herein. [0215] Additionally, various techniques and mechanisms of the present disclosure sometimes describe a connection or link between two components. Words such as attached, linked, coupled, connected, and similar terms with their inflectional morphemes are used interchangeably, unless the difference is noted or made otherwise clear from the context. These words and expressions do not necessarily signify direct connections but include connections through mediate components. It should be noted that a connection between two components does not necessarily mean a direct, unimpeded connection, as a variety of other components may reside between the two components of note. Consequently, a connection does not necessarily mean a direct, unimpeded connection unless otherwise noted. [0216] Further, will be understood that the disclosure is presented in this manner merely for explanatory purposes and the principles and embodiments described herein may be applied to compounds and/or composition components that have configurations other than as specifically described herein. Indeed, it is expressly contemplated that the components of the composition and compounds of the present disclosure may be tailored in furtherance of the desired application thereof. [0217] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of skill in the chemical and biological arts. The terms and expressions which are employed, are used as terms of description and not of limitation. In this regard, where certain terms are defined, described, or discussed elsewhere in the "Detailed Description," all such definitions, descriptions, and discussions are intended to be attributed to such terms. There also is no intention in the use of such terms and expressions of excluding any equivalents of the features shown and described or portions thereof. Furthermore, while subheadings, e.g., "Certain Definitions," are used in the "Detailed Description," such use is solely for ease of reference and is not intended to limit any disclosure made in one section to that section 69890-02 only; rather, any disclosure made under one subheading is intended to constitute a disclosure under each and every other subheading. [0218] Although any methods and materials similar to or equivalent to those described herein can be used in the practice or testing of the subject of the present application, the preferred methods and materials are described herein. [0219] When ranges are used herein for physical properties, such as molecular weight, or chemical properties, such as chemical formulae, all combinations and sub-combinations of ranges and specific embodiments therein are intended to be included. [0220] It is recognized that various modifications are possible within the scope of the disclosure. Thus, although the present disclosure has been specifically disclosed in the context of preferred embodiments and optional features, those skilled in the art may resort to modifications and variations of the concepts disclosed herein. Such modifications and variations are considered to be within the scope of the disclosure as claimed herein. [0221] It is therefore intended that this description and the appended claims will encompass all modifications and changes apparent to those of ordinary skill in the art based on this disclosure. For example, where a method of treatment or therapy comprises administering more than one treatment, compound, or composition to a subject, it will be understood that the order, timing, number, concentration, and volume of the administration is limited only by the medical requirements and limitations of the treatment (i.e., two treatments can be administered to the subject, e.g., simultaneously, consecutively, sequentially, alternatively, or according to any other regimen). [0222] Additionally, in describing representative embodiments, the disclosure may have presented a method and/or process as a particular sequence of steps. To the extent that the method or process does not rely on the particular order of steps set forth herein, the method or process should not be limited to the particular sequence of steps described. As one of ordinary skill in the art would appreciate, other sequences of steps may be possible. Therefore, the particular order of the steps disclosed herein should not be construed as limitations on the claims. In addition, the claims directed to a method and/or process should not be limited to the performance of their steps in the order written, and one skilled in the art can readily appreciate that the sequences may be varied and still remain within the spirit and scope of the present disclosure. [0223] While the present disclosure has been made with reference to humans and human cells and genes, it is contemplated that hPSCs and NK cells can be generated from other species, such as other species of mammals, using cells and genes from that species. Such hPSCs and NK cells then can be used to treat members of that species in accordance with the teachings provided herein. 69890-02 [0224] Certain Definitions [0225] The term “about,” when referring to a number or a numerical value or range (including, for example, whole numbers, fractions, and percentages), means that the number or numerical range referred to is an approximation within experimental variability (or within statistical experimental error), and thus the numerical value or range can vary between 1% and 15% of the stated number or numerical range (e.g., +/- 5 % to 15% of the recited value), provided that one of ordinary skill in the art would consider equivalent to the recited value (e.g., having the same function or result). [0226] The disclosure may be suitably practiced in the absence of any element(s) or limitation(s), which is/are not specifically disclosed herein. Thus, for example, each instance herein of any of the terms “comprising,” “consisting essentially of,” and “consisting of” (and related terms such as “comprise” or “comprises” or “having” or “including”) can be replaced with the other mentioned terms. Likewise, the singular forms “a,” “an,” and “the” include plural references unless the context clearly dictates otherwise. Thus, for example, references to “the method” include one or more methods and/or steps of the type, which are described and/or which will become apparent to those ordinarily skilled in the art upon reading the disclosure. The term “substantially” can allow for a degree of variability in a value or range, for example, within 90%, within 95%, or within 99% of a stated value or of a stated limit of a range. [0227] The term “receptor” refers to a chemical structure in biological systems that receives and transmits signals. [0228] As used herein, the term “encoding” refers to the inherent property of specific sequences of nucleotides in a polynucleotide, such as a gene, a cDNA, or a mRNA, to serve as templates for synthesis of other polymers and macromolecules in biological processes having either a defined sequence of nucleotides (i.e., rRNA, tRNA and mRNA) or a defined sequence of amino acids and the biological properties resulting therefrom. Thus, a gene encodes a protein if transcription and translation of mRNA corresponding to that gene produces the protein in a cell or other biological system. Both the coding strand, the nucleotide sequence of which is identical to the mRNA sequence and is usually provided in sequence listings, and the non-coding strand, used as the template for transcription of a gene or cDNA, can be referred to as encoding the protein or other product of that gene or cDNA. [0229] As used herein, “integration” means that one or more nucleotides of a construct is stably inserted into the cellular genome, i.e., covalently linked to the nucleic acid sequence within the cell's chromosomal DNA. The term “integration” as used herein further refers to a process involving insertion of one or more exogenous sequences or nucleotides of the construct, with or 69890-02 without deletion of an endogenous sequence or nucleotide at the integration site. In the case, where there is a deletion at the insertion site, “integration” can further comprise replacement of the endogenous sequence or a nucleotide that is deleted with the one or more inserted nucleotides. [0230] As used herein, the term “exogenous” means that the referenced molecule or the referenced activity is introduced into the host cell. The molecule can be introduced, for example, by introduction of an encoding nucleic acid into the host genetic material such as by integration into a host chromosome or as non-chromosomal genetic material such as a plasmid. Therefore, the term as it is used in reference to expression of an encoding nucleic acid refers to introduction of the encoding nucleic acid in an expressible form into the cell. The term “endogenous” refers to a referenced molecule or activity that is present in the host cell. Similarly, when used in reference to expression of an encoding nucleic acid, the term refers to expression of an encoding nucleic acid contained within the cell and not exogenously introduced. [0231] As used herein, the term “peptide,” “polypeptide,” and “protein” are used interchangeably and refer to a molecule having amino acid residues covalently linked by peptide bonds. A polypeptide must contain at least two amino acids, and no limitation is placed on the maximum number of amino acids of a polypeptide. As used herein, the terms refer to both short chains, which are also commonly referred to in the art as peptides, oligopeptides and oligomers, for example, and to longer chains, which generally are referred to in the art as polypeptides or proteins. “Polypeptides” include, for example, biologically active fragments, substantially homologous polypeptides, oligopeptides, homodimers, heterodimers, variants of polypeptides, modified polypeptides, derivatives, analogs, fusion proteins, among others. The polypeptides include natural polypeptides, recombinant polypeptides, synthetic polypeptides, or a combination thereof. EXAMPLES [0232] The following examples serve to illustrate the present disclosure so as to provide those of ordinary skill in the art with a complete disclosure and description of how to make and use the embodiments hereof. The examples are not intended to limit the scope of the claimed invention in any way, nor are they intended to represent that the experiments below are all or the only experiments performed. Efforts have been made to ensure accuracy with respect to the numbers used (e.g., amounts, temperature, etc.), but some experimental errors and deviations should be accounted for. Unless otherwise indicated, parts are parts by weights, molecular weight is weight average molecular weight, temperature is in degrees Centigrade, and pressure is at or near atmospheric. 69890-02 Materials and Methods [0233] Donor plasmid construction. To construct adeno-associated virus site 1 (AAVS1)-Puro XLone-NFIL3, spi-1 proto-oncogene (SPI1), and inducible inhibitor of DNA binding 2 (ID2) plasmids, fragments of human nuclear factor, interleukin 3 regulated (NFIL3), SPI1 and ID2 genes were amplified from Addgene plasmids (#82985, 97039, and 98394, respectively) and used to replace enhanced green fluorescent protein (eGFP) in the AAVS1-Puro XLone-eGFP donor plasmid (Addgene #136936). [0234] Maintenance and differentiation of hPSCs. H9 human pluripotent stem cells (hPSCs) were obtained from WiCell and maintained on Matrigel- or iMatrix-511-coated plates in mTeSR plus or E8 medium. (WiCell Research Institute, Inc., Madison, WI). For natural killer (NK) cell differentiation, hPSCs were dissociated with 0.5 mM ethylenediaminetetraacetic acid (EDTA) and seeded onto iMatrix-511-coated 24-well plate at a cell density between 10,000 and 80,000 cell/cm 2 in mTeSR plus medium with 5 μM Y27632 for 24 hours (day -1). Afterwards, NK cell differentiation was performed according to a previous report with modification as shown in FIGS. 2A and 3A. Romee et al. (2016), supra. [0235] Briefly, 6 μM CHIR99021 was used to induce mesoderm differentiation from day 0 to day 2 in LaSR basal medium, followed by 10 μM SB431542, 50 ng/mL stem cell factor (SCF) and vascular endothelial growth factor (VEGF) treatment from day 2 to day 4. Tamada et al. (2012), supra. To induce hematopoiesis, 50 ng/mL SCF and FMS-like tyrosine kinase 3 ligand (FLT3L) were used in Stemline-II medium from day 4 to day 12. Ma et al., Versatile strategy for controlling the specificity and activity of engineered T cells, PNAS USA 113(4): E450-458 (2016). Floating day 12 hematopoietic stem and progenitor cells (HSPCs) were collected and treated with 50 ng/mL SCF, FLT3L, interleukin 3 (IL-3), interleukin 7 (IL-7), and interleukin 15 (IL-15) from day 15 to day 23. From day 23 to day 30, differentiated cultures were treated with 50 ng/mL SCF, FLT3L, IL-7, and IL-15 as well as 5 μg/mL heparin. For feeder layer-based NK cell differentiation, day 12 HSPCs were collected and transferred on OP9 stromal feeder cells, which were cultured in the α-MEM medium containing 20% fetal bovine serum (FBS), 10 ng/mL SCF, 10 ng/mL FLT3L, 5 ng/mL IL-7, and 10 ng/mL IL-15. Ma et al. (2021), supra. After co-culturing for 7 days, differentiated cells were collected and transferred on fresh OP9 feeder cells, and NK cell differentiation was continued for 4 weeks under the same conditions. [0236] hPSC-NK cell purification. hPSC-derived NK cells were purified using EasySep TM FITC Positive Selection Kit (StemCell Technologies, Vancouver, Canada) according to the manufacturer’s instructions. Briefly, differentiated NK cells were centrifuged at 200 xg for 5 minutes, washed twice with 10 mL of PBS -/- solution containing 1% bovine serum albumin 69890-02 (BSA) (FlowBuffer-1), and then pelleted by centrifugation. After aspirating the supernatant, the cell pellet was resuspended in 100 μL FlowBuffer-1 at a cell concentration of 1 ×10 8 cells/mL with 1:50 CD56-FITC antibody and incubated in the dark at room temperature for 30 minutes. Afterwards, cell and antibody mixtures were washed once with 2 mL of FlowBuffer-1 and incubated with 10 μL EasySep TM FITC Selection Cocktail in 100 μL FlowBuffer-1 at room temperature for 15 minutes. Five (5) μL of well-mixed magnetic nanoparticles were then added to the 100 μL cell mixture, and the mixture was incubated at room temperature for another 10 minutes. The resulting cell suspension was then brought to a total volume of 2.5 mL FlowBuffer- 1 in a flow tube, and the tube was placed into the magnet without a cap for 5 minutes. The magnet was then inverted in one continuous motion to pour off the supernatant and then returned to an upright position. The flow tube was moved from the magnet and washed with 2.5 mL FlowBuffer- 1 to resuspend the cells on the flow tube wall by gently pipetting up and down two to three times. The magnet treatment was repeated two to three times, and the enriched NK cells were then resuspended in an appropriate amount of desired medium for further application. [0237] Nucleofection and genotyping of hPSCs. To increase cell viability, hPSCs were treated with 10 μM Y27632 3–4 hours before nucleofection or overnight. Singularized hPSCs (1- 2.5 × 10 6 ) were nucleofected with 6 μg AAVS1 XLone donor plasmids along with 6 μg SpCas9 AAVS1 gRNA T2 (Addgene; #79888) in 100 μl human stem cell nucleofection solution (Lonza; #VAPH‐5012) using program B-016 in a Nucleofector 2b. Nucleofected hPSCs were then plated into one well of a Matrigel-coated 6-well plate in 3 ml pre-warmed mTeSR plus with 10 μM Y27632. Twenty-four hours later, the medium was changed with mTeSR plus containing 5 μM Y27632, followed by a daily medium change. When cells reached about 80% confluency, 1 μg/ml puromycin (Puro) was applied for drug selection for about 1 week. Individual clones were then picked and expanded for 2–5 days in each well of a Matrigel-coated 96-well plate, followed by PCR genotyping using QuickExtract TM DNA Extraction Solution (Epicentre; #QE09050) and 2×GoTaq Green Master Mix (Promega; #7123). For positive genotyping, the following primer pair was used: CTGTTTCCCCTTCCCAGGCAGGTCC (SEQ ID NO: 1) and TCGTCGCGGGTGGCGAGGCGCACCG (SEQ ID NO: 2) (T m =65°C). For homozygous genotyping, the following set of primer sequences was used: CGGTTAATGTGGCTCTGGTT (SEQ ID NO: 3) and GAGAGAGATGGCTCCAGGAA (SEQ ID NO: 4) (Tm=60 °C). [0238] Tumor cell line culture. U87MG, A549, LNCaP, and MDA-MB-231 tumor cells were kindly provided and cultured by the laboratories of Drs. Sandro Matosevic, Chang-Deng Hu and Philip Low at Purdue University. U87MG, A549, LNCaP, and MDA-MB-231 cells were cultured in Eagle’s Minimum Essential Medium (EMEM) (containing 10% FBS, 100 units mL -1 penicillin 69890-02 and 100 mg mL -1 streptomycin), Kaighn’s Modification of Ham’s F-12 Medium (F-12K) (containing 10% FBS, 100 units mL -1 penicillin and 100 mg mL -1 streptomycin), RPMI-1640 Medium (containing 10% FBS, 100 units mL -1 penicillin and 100 mg mL -1 streptomycin), and Leibovitz’s L-15 Medium (containing 10% FBS, 100 units mL -1 penicillin and 100 mg mL -1 streptomycin), respectively. All tumor cell lines were incubated at 37 o C in a humidified 5% CO2 atmosphere. The medium was changed every two days, and cells were passaged at 70%-80% confluency. [0239] Expansion of NK cells. Peripheral blood mononuclear cells (PBMCs) were isolated by Lymphoperp TM (StemCell Technology, 07851) gradient centrifugation in SepMate TM (StemCell Technology, 85450) tubes. Primary human cells were isolated from PBMCs by magnetic bead CD3 depletion (Miltenyi Biotec, 130-050-101), followed by CD56 (Miltenyi Biotec, 130-111- 553) isolation. Purified NK cells were cultured in AIM-V (Invitrogen) medium with 500 U/mL IL-2 (PEPROTECH, 200-02), 2 ng/mL IL-15 (PEPROTECH, 200-15), and 100 ng/mL OKT3 (Ortho Pharmaceuticals, Raritan, NJ) at the concentration of 1×10 6 cells/mL for 24 hours at 37 o C in a humidified 5% CO 2 atmosphere. The cells were cultured in AIM-V medium supplemented with interleukin 2 (IL-2) and IL-15 at 37 o C in a humidified 5% CO2 atmosphere for further analysis. [0240] Flow cytometry analysis. Differentiated cells were gently pipetted and filtered through a 70 or 100 μm strainer sitting on a 50 mL tube. The cells were then pelleted by centrifugation and washed twice with PBS -/- solution containing 1% BSA. The cells were stained with appropriate conjugated antibodies (Table 1) for 25 minutes at room temperature in the dark and analyzed in an Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ) after washing with BSA-containing PBS -/- solution. FlowJo software was used to process the flow data. Table 1 Antibody Source/Isotype/clone/cat. no. Concentration CD45-PE BD Biosciences /Mouse IgG1/HI30/555483 1:50 CD56-APC BioLegend/ Mouse IgG1/5.1H11/362503 1:50 CD56-FITC BioLegend/ Mouse IgG1/5.1H11/362546 1:50 SSEA-4 Santa Cruz/Mouse IgG3/ sc-21704 1:100 OCT-3/4 Santa Cruz/Mouse IgG2b/sc-5279 1:100 CD16-FITC BD Biosciences/Mouse IgG1/3G8/555406 1:50 KIR3DL1-PE BD Biosciences/Mouse IgG1/DX9/555964 1:50 NKp46-PE BD Biosciences/Mouse IgG1/9E2/557991 1:50 NKp44-PE BD Biosciences/Mouse IgG1/p44-8/558563 1:50 NKG2D-PE BD Biosciences/Mouse IgG1/1D11/557940 1:50 CD107a-APC BD Biosciences/Mouse IgG1/H4A3/560664 1:50 IFNγ-PE BD Biosciences/Mouse IgG1/B27/554701 1:50 Actin-stain TM 488 Cytoskeleton/PHDG1 1:1000 Secondary Alexa 488 Goat anti-Ms IgG1/A-21121 1:1,000 Antibody 69890-02 Secondary Alexa 488 Goat anti-Rb IgG/A-11008 1:1,000 Antibody Secondary Alexa 594 Goat anti-Ms IgG2b/A-21145 1:1,000 Antibody Secondary Alexa 594 Goat anti-Ms IgG/A-21145 1:1,000 Antibody Secondary Alexa 594 Goat anti-Rb IgG/A-11012 1:1,000 Antibody [0241] Transwell migration analysis. For transwell assays, 600 μL of serum-free medium were placed in the lower chamber of a 24-well transwell plate (Corning Incorporated, Corning, NY). NK cells (2.5×10 5 ) were added in 100 of serum-free medium to the upper chamber (5 μm pore size), and the plate was incubated at 37 o C with 5% CO 2 for 5 hours. The number of NK cells that migrated to the lower chamber was determined by flow analysis (Accuri C6 plus cytometer; Beckton Dickinson, Franklin Lakes, NJ). Data are presented as percentage of migration based on total cell input. [0242] NK cell-mediated in vitro cytotoxicity assay. The cell viability was analyzed by flow cytometry according to a previous protocol set forth in Lee et al., Regulation of CAR T cell- mediated cytokine release syndrome-like toxicity using low molecular weight adapters, Nature Communications 10: 2681 (2019). Briefly, tumor cells were stained with 2 μM Calcein-AM in MEM medium at 37 o C for 10 minutes in the dark, followed by 10% FBS treatment for 10 minutes in the dark at room temperature. Labeled tumor cells were pelleted at 300 x g for 7 minutes and resuspended in culture medium with 10% FBS at a density of 50,000 cells/mL. Tumor cells (100 μL) were then mixed with 100 μL of 150,000, 250,000, and 500,000 cells/mL NK cells in 96 well plates and incubated at 37 o C, 5% CO2 for 12 hours. [0243] To harvest all the cells, cell-containing media were transferred into a new round-bottom 96-well plate, and 50 μL of trypsin-EDTA were added to the empty wells to dissociate attached cells. After five minutes of incubation at 37 o C, dissociated cells were transferred into the same wells of round-bottom 96-well plate with floating cells. All cells were pelleted by centrifuging (300 x g, 4 o C, 5 minutes) and washed with 200 μL of PBS -/- solution containing 0.5% BSA. The pelleted cells were stained with propidium iodide (PI) for 15 minutes at room temperature and analyzed in the Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ). [0244] Conjugate formation assay. To visualize immunological synapses, 100 μL of tumor cells (50,000 cells/mL) were seeded onto wells of 96-well plate and incubated at 37 o C for 12 hours, allowing them to attach. NK cells (100 μL; 500,000 cells/mL) were then added onto the target tumor cells and incubated for six hours before fixing with 4% paraformaldehyde (in PBS). 69890-02 Cytoskeleton staining was then performed using an F-actin Visualization Biochem Kit (Cytoskeleton Inc., Denver, CO). [0245] Enzyme-linked immunosorbent assay (ELISA) analysis. To analyze the cytokine production by ELISA assay, 100 μL of tumor cells (50,000 cells/mL) were seeded onto wells of a 96-well plate and incubated at 37 o C for 12 hours, allowing them to attach. NK cells (100 μL; 500,000 cells/mL), with or without fluorescein isothiocyanate (FITC)-folate (10 nmol/L), were then added onto the target tumor cells and incubated for six hours. Afterwards, plates were centrifuged at 350 xg for 10 minutes to spin down the cell debris, and 10 μL of top supernatant were collected for measuring TNFα and IL-6 production using an ELISA kit (ThermoFisher Scientific, US). [0246] Statistical analysis. Three to five samples were analyzed for each group, and data are presented as mean ± standard deviation (SD). Statistical significance was determined by Student’s t-test (two-tail) between two groups, and three or more groups were analyzed by one-way analysis of variance (ANOVA). P<0.05 was considered statistically significant. Example 1 Targeted gene knock-in in hPSCs provided inducible expression of NFIL3, SPI1, and ID2 [0247] To temporally activate key transcription factors (TFs) in a manner representative of native NK cell development, an all-in-one, Tet-On 3G doxycycline-inducible expression system was employed, which contains two promoters, Tet-on 3G transactivator protein driven by the constitutive EF1α promoter, and a transgene of interest driven by the TRE3G promoter (FIGS. 1A and 5A). This all-in-one inducible system effectively expressed eGFP in H9 hPSCs under doxycycline (dox) treatment (FIGS. 5B-5C). eGFP was then replaced with NFIL3, SPI1, and ID2, and each of them was knocked into the endogenous AAVS1 safe harbor locus in H9 hPSCs via CRISPR/Cas9-mediated homology-directed repair (HDR) (FIG. 1B). After nucleofection, puromycin-resistant single cell-derived hPSC clones were isolated and subjected to PCR genotyping with a successful targeted knock-in efficiency of 87.5% (7 out of 8 clones), 87.5% (7 out of 8 clones), and 83.3% (10 out of 12 clones) (FIG. 1C) for NFIL3, SPI1, and ID2, respectively. The successfully targeted clones were then subjected to homozygosity assay, and 28.5% (2 out of 7 clones), 14.3% (1 out of 7 clones), and 40% (4 out of 10 clones) of NFIL3, SPI1, and ID2 knockin clones were homozygous (FIG. 1C). Heterozygous C7, C8, and C6 of NFIL3, SPI1, and ID2 knockin hPSCs were selected for NK cell differentiation. Genetically modified hPSCs displayed strong expression of the pluripotency markers stage-specific embryonic antigen- 4 (SSEA-4) and octamer-binding transcription factor-4 (OCT4) (FIG. 1D). Importantly, these 69890-02 hPSCs retained a normal karyotype after CRISPR/Cas9-mediated genome editing (FIG. 6). Similar to inducible eGFP expression, the resulting knockin hPSCs expressed high levels of NFIL3, SPI1, and ID2 in response to dox treatment (FIGS.1E and 7A-7C). Example 2 Overexpression of ID2 promoted NK cell differentiation from hPSCs [0248] To investigate the function of NFIL3, SPI1, and ID2 during in vitro NK cell development, a previous chemically-defined NK cell differentiation protocol was adapted and modified (FIG. 2A). Romee et al. (2016), supra. Under dox treatment during the whole differentiation, about 0.6%, 14.6%, 9.0%, and 65.1% CD45+CD56+ cells were generated for wild-type hPSCs, NFIL3- hPSCs, SPI1-hPSCs, and ID2-hPSCs, respectively (FIG.2B), suggesting that overexpression of NK-specific TFs improves in vitro NK cell differentiation from hPSCs. Notably, forced expression of ID2 yielded the highest percentage of CD45+CD56+ cells under the chemically- defined, feeder-free monolayer culture condition, consistent with enhanced ID2 expression during NK cell differentiation from hPSCs. Ma et al. (2022), supra; Mishra et al. (2012), supra. Collectively, the results support the use of forced TF expression in enhancing NK cell differentiation from hPSCs. [0249] ID2 plays stage-specific functions during NK cell development and maturation in vivo. Chen et al. (2018), supra; Jiang et al. (2019), supra; Li et al. (2018), supra. Thus, the stage-specific effects of forced ID2 expression in NK cell generation from hPSCs was investigated to develop an optimized differentiation protocol (FIG.3A). Temporal treatment of dox significantly affected the generation of CD45+CD56+ cells (FIGS.3B-3C), confirming the stage-specific roles of ID2 during NK cell development. Among all tested conditions, dox treatment from day 12 to day 22 (Group #2) yielded the highest percentage (~73.7%) of CD45+CD56+ cells (FIGS.3B-3C). The resulting cells from optimized condition were further characterized, and they displayed high levels of typical NK cell-surface markers, including CD16, KIR3DL1, NKp46, NKG2D, and NKp44 (FIG. 3D), consistent with previously reported hPSC-derived NK cells (FIG. 8). Romee et al. (2016), supra; Cerwenka & Lanier (2016), supra; Cooper et al (2009), supra; Liu et al. (2018), supra. Taken together, the results demonstrated stage-specific roles of ID2 overexpression in enhancing NK cell differentiation from hPSCs. 69890-02 Example 3 hPSC-derived NK cells displayed cytotoxicity against cancer cells [0250] The expansion and transmigration ability of hPSC-derived NK cells were investigated. A similar expansion fold was observed in hPSC-derived and primary NK cells (FIG. 4A) in the presence of IL-2, IL-15, and OKT3. Seo et al. (2017), supra. Furthermore, ID2 overexpression- induced hPSC-NK cells exhibited similar transmigration ability as wild-type hPSC-derived and primary NK cells (FIGS. 4B-4C). To further explore their potential in cancer immunotherapy, ID2 overexpression-induced NK cells were co-cultured with different cancer cells for tumor- killing analysis. Two hours following co-culture with U87MG glioblastoma cells, immunological synapses were formed between NK and tumor cells (FIG.4D), facilitating cytotoxicity activities of NK cells against tumor cells. As expected, hPSC-derived NK cells via ID2 overexpression or feeder layer co-culture expressed IFN-γ and CD107a in response to tumor cells (FIGS. 4E-4F), indicating cytotoxic granule release. The tumor-killing ability of hPSC-derived NK cells against different tumor cells, including LNCaP, A549, U87MG, and MDA-MB-231, was assessed and was similar to the tumor-killing ability of their counterparts in peripheral blood. hPSC-derived NK cells displayed a broad anti-tumor cytotoxicity at various effector-to-target ratios (FIGS.4G- 4I). Notably, hPSC-derived NK cells did not kill normal H9-derived somatic cells (FIG.9); such data support their safety in future clinical application. [0251] Adoptive NK cell-based immunotherapies hold great promise for clinical cancer treatment, given their unique innate tumor-killing ability and safety in allogeneic transplantation. In order to meet clinical needs (10 7 cells/kg for a patient), several human sources of NK cells, including peripheral blood (PB) and umbilical cord blood (UCB), have been investigated in cancer immunotherapy. Du et al. (2021), supra. Primary NK cells isolated from PB and UCB sources, however, were heterogeneous, and these cells were not sufficient to treat many patients. Id.; Judge et al. (2020), supra; Jiang et al. (2019), supra. In contrast, hPSCs can be expanded unlimitedly and differentiated into NK cells to meet the clinical needs, providing a realistic, universal cell source for various therapies, such as cancer immunotherapy (e.g., targeted cancer immunotherapy). Sun et al. (2009), supra; Ma et al. (2022), supra. [0252] A TF-mediated forward programming approach has been recently used to efficiently differentiate hPSCs into neural, glial, liver, skeletal and cardiac muscle cells. Luo et al. (2022), supra. However, such an approach has not yet been applied to NK cell induction. Here, hPSCs were genetically engineered with doxycycline-inducible expression of NFIL3, SPI1, and ID2, and TF-mediated forward programming enhanced NK cell differentiation, in which inducible ID2 expression yielded the highest percentage of CD45+ CD56+ NK cells. This result is consistent 69890-02 with enhanced ID2 expression during NK cell differentiation from hPSCs. Ma et al. (2022), supra; Mishra et al. (2012), supra. The resulting hPSC-derived NK cells also displayed NK-specific surface markers and cytotoxic activities against various tumor cells in vitro. [0253] In summary, the all-in-one inducible expression system can serve as a modular strategy to screen more transcription factors for robust NK or T cell induction from hPSCs. The engineered ID2-expressing hPSCs can be used to generate universal NK cells as potential standardized cellular products for clinical applications in cancer treatment. Example 4 Screening CAR structures with enhanced NK cell-mediated tumor-killing activities [0254] Based on previous CAR constructs used in T and NK cells, eight different CARs, which were optimized for antitumor cytotoxicity and proliferation in NK-92 cells, were designed and evaluated (FIG.2A). [0255] CAR plasmid construction. Generally, to construct anti-PD-L1 lentiviral vectors, a DNA sequence encoding CD8a signal peptide, anti-PD-L1 nanobody, CD28 extracellular domain, CD28 or NKG2D transmembrane domain, CD28 or 2B4 intracellular co-stimulatory domain, ΔIL- 2Rβ, and CD3ζ-YXXQ was directly synthesized and cloned into the lenti-luciferase-P2A-NeoR (Addgene #105621) backbone via NEBuilder HiFi DNA Assembly after Bam HI and Mlu I digestion. Zhang et al., Structural basis of a novel PD-L1 nanobody for immune checkpoint blockade, Cell Discovery 3: 17004 (2017). [0256] For lentivirus production generally, 293TN cells were incubated in DMEM medium containing 10% FBS, 1% sodium pyruvate, and 0.5% GlutaMAX until 95-100% confluence. 4.5 μg lentiviral CAR plasmid, 3.0 μg psPAX2, and 1.5 μg pMD2.G were added to 450 μL of Opti- MEM medium and incubated at room temperature for five minutes. FuGENE HD reagent (27 μL) was then added to the mixture and incubated at room temperature for another 15 minutes. The resulting 450 μL plasmid mixture was added to 3 mL of culture medium and evenly distributed to three wells of a 6-well plate with 293TN cells after aspirating the old medium. Eighteen hours after plasmid addition, the medium from each well was aspirated and replaced with 3 mL of fresh culture medium and incubated for another 24 hours. Virus-containing supernatant was then collected every day with fresh warm medium change for 2 to 3 days, transferred to a 50 mL conical tube, and stored at 4 o C. The resulting virus supernatant was then centrifuged at 2,000 g at 4 o C for 5 minutes or filtered through a 0.45 μm filter to remove cell debris. [0257] The resulting anti-PD-L1 plasmids were then sequenced and digested with Mlu I to incorporate further an IRES-NeoR or IRES-GFP sequence. The anti-FITC CAR plasmid with 69890-02 CD8a signal peptide, anti-fluorescein single-chain variable fragment (scFv), CD8a extracellular and intracellular domains, 4-1BB co-stimulatory domain and CD3ζ signaling domain was previously constructed by the present investigators and cloned into their AAVS1-Puro CAG FUCCI donor plasmid (Addgene #136934). Lee et al. (2019), supra; Chang et al., Fluorescent indicators for continuous and lineage-specific reporting of cell-cycle phases in human pluripotent stem cells, Biotechnology & Bioengineering 117(7): 2177-2186 (2020). [0258] The resulting AAVS1-Puro CAG anti-FITC-CAR plasmid was digested with Sgr DI and Mlu I and ligated to the lentiviral anti-PD-L1 CAR backbone to construct the lentiviral anti-FITC CAR vector. To make anti-FITC CAR plasmid with NKG2D transmembrane and 2B4 co- stimulatory domains, anti-FITC scFv sequence and a chimeric sequence of NKG2D, 2B4 and CD3ζ were PCR-amplified from lentiviral anti-FITC CAR vector and AAVS1-Puro CAG CLTX- NKG2D-2B4-CD3z CAR (Addgene #157744), respectively, and cloned into AAVS1-Puro CAG FUCCI plasmid via NEBuilder HiFi DNA Assembly to make AAVS1-Puro CAG anti-FITC- NKG2D-2B4-CD3z CAR, which was digested with Sgr DI and Mlu I, and ligated to the lentiviral anti-PD-L1 CAR backbone to construct the lentiviral anti-FITC-NKG2D-2B4-CD3z CAR. [0259] CARs #1 to #4 were single antigen-targeting CARs against either PD-L1 or FITC using NK or T cell-specific signaling domains, and CARs #5 to #8 were combinatory dual antigen- targeting CARs. For the switchable anti-FITC scFv CARs, CARs #1, #5, and #7 employed an NK-specific transmembrane domain NKG2D, a co-stimulatory domain 2B4 and an intracellular domain CD3ζ, whereas CARs #2, #6, and #8 differed in the transmembrane domain CD8 and co- stimulatory domain 4-1BB. For tumor microenvironment responsive anti-PD-L1 nanobody CARs, CARs #3, #5, and #7 used a NK-specific transmembrane domain NKG2D, a co-stimulatory domain 2B4, a truncated IL-2 receptor β-chain (Delta IL-2RB), an intracellular domain CD3ζ, and a STAT3-binding tyrosine-X-X-glutamine (YXXQ) motif, whereas CARs #4, #6, and #8 differ in the transmembrane domain CD28. [0260] These CAR constructs were first tested in NK-92 cells for their ability to enhance antitumor activities against FRα+ and PD-L1+ tumor cells. Human breast cancer MDA-MB-231 cells express high levels of FRα and PD-L1, whereas human prostate adenocarcinoma LNCaP cells express neither FRα nor PD-L1 (FIG. 16A). Martin et al., Paucity of PD-L1 expression in prostate cancer: Innate and adaptive immune resistance, Prostate Cancer & Prostatic Diseases 18: 325-332 (2015). These two tumor lines were used for antitumor cytotoxicity analysis of our engineered CAR NK-92 cells. [0261] Regarding the NK-92 cells and lentiviral transduction, generally, NK-92 cells were cultured in MyeloCult H5100 medium containing 100 units/mL human recombinant IL-2. For 69890-02 lentiviral transduction, NK-92 cells were first stimulated by IL-2 and IL-15. Briefly, the NK-92 cells were counted and resuspended in appropriate medium (RPMI 1640, 10% FBS, 2 nM L- glutamine, 20 ng/mL IL-2, 50 ng/mL IL-15, and 100 ng/mL IL-12) at 1×10 6 cells/mL. These NK- 92 cells were stimulated for two hours before lentiviral transduction. [0262] After cytokine stimulation, 1×10 5 NK-92 cells were plated in each well of a 12-well plate, and cells were treated with 1 mL virus supernatant and polybrene (8 μg/mL) overnight at 37 o C, 5% CO2. After 24 hours, viruses were removed by centrifuging at 360 xg for five minutes, and the resulting NK-92 cells were suspended in 1 mL MyeloCult H5100 medium with 100 units/mL human recombinant IL-2. After five days, transduced NK-92 cells were centrifuged at 360 xg for five minutes and resuspended in 1 mL MyeloCult H5100 medium containing 100 units/mL human recombinant IL-2 and 1 μg/mL puromycin or 100 μg/ml G418. At least 8-day drug screening is needed to enrich successfully transduced NK-92 cells. [0263] Regarding MDA-MB-231 and LNCaP cell maintenance, LNCaP tumor cells were kindly provided and cultured by the laboratory of Dr. Chang-Deng Hu at Purdue University. MDA-MB- 231 cells were cultured in Leibovitz’s L-15 medium (containing 10% FBS, 100 units mL -1 penicillin and 100 mg mL -1 streptomycin), and LNCaP cells were cultured in RPMI-1640 medium (containing 10% FBS, 100 units mL -1 penicillin and 100 mg mL -1 streptomycin). These two cell lines were incubated at 37 o C, 5% CO2. The culture medium was changed every two days and cells were passaged at 70-80% confluency. [0264] Bi-specific FITC-folate adapter was first synthesized with folic acid on the left side for binding FRα on breast tumor cells and fluorescein on the right side for anti-FITC CAR targeting (FIG.16B). Lee et al. (2019), supra. The binding affinity (K d ) of FITC-folate for MDA-MB-231 tumor cells was measured as 2.64 nM (FIG. 16C), and the binding affinity (Kd) of FITC-folate for various anti-FITC CAR NK-92 cells were about 10 nM (FIG. 16D). Considering that insufficient intracellular bridges will be formed at very low FITC-folate concentration, whereas at very high concentrations, intracellular bridging will be locked due to monovalent saturation of ligand binding sites on both cell types with excess FITC-folate adapters, 10 nM of FITC-folate was used in the following studies. [0265] The killing potency of various anti-FITC and/or anti-PD-L1 CAR NK-92 cells (FIG.16E) were then tested in MDA-MB-231 (FRα+ PD-L1+) and LNCaP cell (FRα- PD-L1-) cells. As expected, CAR-expressing NK-92 cells exhibited more potent cytotoxicity against MDA-MB-231 and more cytotoxic granule release than LNCaP cells (FIG. 11B and FIGS. 17A-17D). In the presence of bi-specific FITC-folate adapter, anti-MDA-MB-231 cytotoxicity of CAR NK-92 cells was significantly increased (FIG.11C), indicating the specificity of the anti-FITC CAR. Among 69890-02 these CARs, CARs #1, #5, and #6 displayed a much larger increase of anti-tumor activity in NK- 92 cells against FRα+ PD-L1+ breast cancer cells after bridging with the FITC-folate adapter (Fig. 11C), along with significantly enhanced IFNγ and TNFα release (cytotoxic granule) (FIGS.11D- 11E). As expected, these FITC-folate bridged NK-CARs (#1, #5, and #6) mediated higher killing potency in NK-92 cells than T cell-specific CARs (#2, #7, and #8). Example 5 Screening CAR structures with enhanced NK cell proliferation activity [0266] The capability of various CARs to promote antigen-specific NK cell proliferation after co- culturing with tumor cells was evaluated. Both truncated IL-2 receptor β-chain (ΔIL-2RB) and the STAT3-binding tyrosine-X-X-glutamine (YXXQ) motif in the anti-PD-L1 CARs were designed to enhance cell proliferation and persistence via activation of JAK, STAT3 and STAT5 signaling pathways. Kagoya et al., A novel chimeric antigen receptor containing a JAK-STAT signaling domain mediates superior antitumor effects, Nature Medicine 24: 352-359 (2018). [0267] Cell viability was analyzed by flow cytometry according to a previous protocol described in Kandarian et al., A flow cytometry-based cytotoxicity assay for the assessment of human NK cell activity, JoVE: Immunology & Infection 2017 (2017). Briefly, tumor cells were stained with 2 μM Calcein-AM in MEM medium at 37 o C for 10 minutes in the dark, followed by 10% FBS treatment for 10 minutes in the dark at room temperature. Labeled tumor cells were pelleted at 300 x g for 7 minutes and resuspended in culture medium with 10% FBS at a density of 50,000 cells/mL.100 μL of tumor cells were then mixed with 100 μL of 150,000, 250,000, and 500,000 cells/mL NK cells in 96-well plate with or without the antigen to be tested (e.g., FITC-folate (10 nmol/L)) and incubated at 37 o C, 5% CO2, for 12 hours. [0268] To harvest all the cells, cell-containing medium was firstly transferred into a new round- bottom 96-well plate, and 50 μL trypsin-EDTA were added to the empty wells to dissociate attached cells. After a five-minute incubation at 37 o C, dissociated cells were transferred into the same wells of round-bottom 96-well plate with floating cells. All cells were pelleted by centrifuging (300 x g, 4 o C, 5 minutes) and washed with 200 μL of PBS-/- solution containing 0.5% BSA. The pelleted cells were stained with propidium iodide (PI) for 15 minutes at room temperature and analyzed in the Accuri C6 plus cytometer (Beckton Dickinson, Franklin Lakes, NJ). [0269] Upon PD-L1+ MDA-MB-231 cell stimulation, CAR NK-92 cells exhibited upregulated levels of phosphorylated STAT3 (pSTAT3) and pSTAT5 (FIG. 11F), among which CARs #3, 69890-02 #5, and #7 displayed superior ability in upregulating pSTAT3 and pSTAT5 (FIGS. 18A-18B). As expected, CARs #3, #5, and #7 also promoted greatest proliferation in NK-92 cells (FIG.11G). [0270] A continuous in vitro tumor cell exposure model was constructed to investigate the persistence and memory-like phenotype of NK-92 cells after CAR-engineering (FIG. 11H). Consistent with previous observation, NK-92 cells engineered with CARs #1, #5 and #6 displayed superior tumor-killing ability against FRα+ PD-L1+ breast cancer cells under the initial antigen exposure at day 1 (FIG.11I). [0271] As the antigen exposure increased (days 8 and 15), a significant reduction of anti-tumor cytotoxicity was observed in NK-92 cells with anti-FITC CAR only (CAR #1), whereas dual anti- FITC and anti-PD-L1 CAR NK-92 cells (CAR #5 and #6) still exhibited excellent anti-tumor activities at day 15. Notably, dual anti-FITC and anti-PD-L1 CAR #5 with NK-specific transmembrane and co-stimulatory domains presented superior persistence as compared to all other CARs. The results support that dual CAR design can synergize multi-functions of NK cells under specific tumor antigen stimulation and achieve superior antitumor activities and persistence under a complex tumor microenvironment. Example 6 hPSC transduction [0272] hPSCs can be engineered to express CAR construct(s) using lentiviral transduction strategies for functional CAR-NK cell production. For hPSC transduction, hPSCs were dissociated with 0.5 mM EDTA and seeded onto iMatrix 511-coated 6-well plate at a cell density between 10,000 and 80,000 cells/cm 2 in mTesR plus medium with 5 μM Y27632. Twenty-four hours later, the stem cell culture medium was aspirated and replaced with 1 mL of mTesR plus medium with 5 μM Y27632 and 1 mL of virus supernatant, which were removed and replaced with 2 mL of fresh mTeSR plus after 24 hours. Two to three days after transduction, 100 μg/ml G418 or 1 μg/mL puromycin was applied to select successfully transduced hPSCs. To further enrich desired cells, transduced hPSCs were dissociated and transferred to 96-well plate at a cell density of 10 cells/mL. After a 4-day culture, hPSCs were continuously treated with 100 μg/ml G418 or 1 μg/mL puromycin for 8 more days. Example 7 Engineering hPSC-derived NK cells with dual CARs for enhanced function [0273] Given its superior anti-tumor activity and persistence in NK-92 cells, dual anti-FITC, and PD-L1 CAR #5 was selected for CAR engineering of hPSC-derived NK cells. Single antigen- 69890-02 targeting anti-FITC CAR #1 and anti-PD-L1 CAR #3 were used as controls for anti-tumor cytotoxicity and cell proliferation, respectively. To provide a potentially universal source of CAR- expressing NK cells, hPSCs were engineered with these three CARs. [0274] Briefly, the H9 hPSC line was obtained from WiCell and maintained on Matrigel-coated plates in mTeSR plus medium. For NK cell differentiation, hPSCs were dissociated with 0.5 mM EDTA and seeded onto iMatrix 511-coated 24-well plate at a cell density between 10,000 and 80,000 cells/cm 2 in mTesR plus medium with 5 μM Y27632 for 24 hours (day -1). At day zero, cells were treated with 6 μM CHIR99021 (CHIR) in Dulbecco’s Modified Eagle’s Medium (DMEM) medium supplemented with 100 μg/mL ascorbic acid (DMEM/Vc), followed by a medium change with LaSR basal medium from day one to day four. VEGF (50 ng/mL) was added to the medium from day two to day four. At day four, medium was replaced by Stemline Ⅱ medium (Sigma-Aldrich, St. Louis, MO) supplemented with 10 μM SB431542, 25 ng/mL SCF and FLT3L. On day six, SB431542-containing medium was aspirated, and cells were maintained in Stemline Ⅱ medium with 50 ng/mL SCF and FLT3L. At day nine and day 12, the top half of the medium was aspirated and replaced with 0.5 mL of fresh Stemline Ⅱ medium containing 50 ng/mL SCF and FLT3L. At day 15, floating cells were gently harvested, filtered with a cell strainer, and co- cultured on OP9-DLL4 (kindly provided by Dr. Igor Slukvin) monolayer (2 ×10 4 cells/mL) in NK cell differentiation medium: α-MEM medium supplemented with 20% FBS, 5 ng/mL IL-7, 5 ng/mL FTL3L, 25 ng/mL SCF, 5 ng/mL IL-15, and 35 nM UM171. NK cell differentiation medium was changed every three days, and floating cells were transferred onto fresh OP9-DLL4 monolayer every 6 days. [0275] The universal anti-FITC CAR was knocked into the AAVS1 safe harbor locus via CRISPR/Cas9-mediated homologous recombination (FIGS. 19A-19B) and led to robust CAR- expressing hPSCs (FIG. 19C). Notably, engineered hPSCs retained high level expression of pluripotency markers, including stage-specific embryonic antigen-4 (SSEA-4) and octamer- binding transcription factor 4 (OCT-4) (Fig.19C). To determine the effect of CAR expression on NK cell differentiation, genetically modified hPSCs were subjected to hematopoietic and NK cell differentiation using stage-specific morphogens (FIG. 20A). High purity of CD45+CD43+ hematopoietic stem and progenitor cells (HSPCs) (FIG.20B) and CD56+ CD45+ NK cells (FIG. 20C) were successfully generated from wild-type or CAR-expressing hPSCs. The resulting hPSC-derived NK cells also expressed high levels of typical NK cell surface markers, including CD16, KID3DL1, NKp46, NKG2D, and NKp44 (FIG.12A). [0276] To determine their antitumor cytotoxicity, CAR-expressing hPSC-derived NK cells were co-cultured with MDA-MB-231 cells in the presence of 10 nM FITC-folate. As compared to 69890-02 wild-type hPSC-NK cells, more immunological synapses were formed between CAR-engineered NK cells within two hours (FIG. 12B), and dual CAR-NK cells formed most immunological synapses with tumor cells (FIG. 12C), whereas all hPSC-derived NK cells showed similar and less immunological synapse formation ability against FRα-PD L1- LNCaP prostate cancer cells (FIG.21A), demonstrating the high specificity of these CARs to the targeted tumor antigens. In response to MDA-MB-231 tumor cells, CAR-NK cells expressed more IFNγ and CD107a (FIG. 12D) and released more cytotoxic granule TNFα and IFNγ (FIGS.12E-12F). As expected, dual CAR-NK cells expressed most IFNγ and CD107a, and released the most cytotoxic granules, whereas all tested NK cells expressed low levels of IFNγ and CD107a and released low amounts of cytotoxic granules upon FRα-PD-L1- LNCaP cell stimulation (FIGS. 21B-21D). The tumor- killing ability of different hPSC-NK cells was assessed and demonstrated that dual CAR-NK cells displayed superior anti-MDA-MB-231 cytotoxicity as compared to wild-ype, anti-FITC CAR, and anti-PD-L1 CAR NK cells (FIG.12G), whereas all hPSC-derived NK cells displayed similar and low cytotoxicity against LNCaP tumor cells (FIG.21E). [0277] The antigen-responsive proliferation ability of various hPSC-NK cells was investigated. Upon PD-L1+ MDA-MB-231 cell stimulation, hPSC-derived CAR-NK cells upregulated expression levels of phosphorylated STAT3 (pSTAT3) and pSTAT5 (FIG.22A). Single antigen- targeting anti-PD-L1 and dual CAR-NK cells exhibited highest expression levels of pSTAT3 and pSTAT5 (FIG.12H) and achieved highest cell expansion (FIG.12I). The antitumor cytotoxicity and persistence of CAR-NK cells in a continuous antigen exposure model was investigated. While similar strong initial anti-MDA-MB-231 cytotoxicity was observed in anti-FITC and dual CAR NK cells at day 1 (FIG.12J), anti-FITC CAR-NK cells significantly reduced tumor-killing ability as antigen exposure time increase (day 8 and 15), whereas dual CAR-NK cells still exhibited excellent anti-tumor ability and persistence at day 15. Importantly, all CAR-expressing hPSC- derived NK cells did not kill normal H9 hPSCs and hPSCs-derived somatic cells (FIG. 22B), demonstrating their safety in future clinical applications. Example 8 Dual CAR-hPSC-NK cells have improved antigen-responsive persistence in vivo [0278] Systemic administration or ectopic expression of interleukin-15 (IL-15) has been used to improve in vivo persistence of CAR-NK cells, although it may lead to abnormal cell proliferation or even leukemia transformation. Ma et al. (2021), supra; Liu et al. (2018), supra; Du et al. (2021), supra; Mishra et al. (2012), supra. To determine the effect of anti-PD-L1 CAR on the proliferation and persistence of hPSC-NK cells, NRG mice engrafted with 5×10 5 PD-L1-expressing MDA-MB- 69890-02 231 breast cancer cells or PD-L1-rare LNCaP cells (FIGS. 13A and 23) were treated with intravenous infusion of 5×10 6 different hPSC-derived NK cells or PBS 7 days after tumor cell injection. Host blood was collected at day 6, 14, 21, and 28 for NK cell analysis, and significantly higher NK cell numbers were detected in the anti-PD-L1 and dual CAR NK groups in the MDA- MB-231 mouse xenograft tumor model than in other groups (FIGS.13B-13C). As expected, low NK cells were detected in all experimental groups of LNCaP mouse xenograft model (FIGS.23A- 23B), highlighting the specificity of anti-PD-L1 CAR and its capacity to enhance persistence of NK cells in vivo. [0279] The biocompatibility of hPSC-derived CAR-NK cells was also evaluated by monitoring the body weight of host mice, and there was no significant body weight loss across all tested experimental groups (FIGS. 13D and 23C), indicating the minimal systemic toxicity and high biocompatibility of hPSC-derived NK cells. Histological analysis of major organs sliced from host mice at day 30 showed that adoptive NK cells did not cause any observable abnormality or damage in heart, liver, spleen, lung, and kidney (FIG. 13E), confirming the biocompatibility of the hPSC-derived NK cells. Example 9 Dual CAR-hPSC-NK cells have improved antitumor activities in tumor rechallenge models [0280] To evaluate antitumor activities of different hPSC-NK cells in vivo, the cytotoxicity of MDA-MB-231 cells was tested in a mouse xenograft model. All the mouse experiments were approved by the Purdue Animal Care and Use Committee (PACUC). Briefly, the immunodeficient NOD.Cg-RAG 1tm1Mom IL2rg tm1Wjl /SzJ (NRG) mice were bred and maintained by the Biological Evaluation Core at the Purdue University Center for Cancer Research. MDA-MB-231 cells (5×10 5 tumor cells/per mouse) were implanted subcutaneously. When the tumor size reached ~100 mm 3 , NK cells and FITC-folate were intravenously injected (single injection of 1 × 10 7 NK cells seven days after tumor inoculation (FIG. 14A)). Mice were maintained on a folic acid- deficient diet (TD.95247, Envigo RMS, LLC, Indianapolis, IN) to reduce the level of folic acid in mice to a physiological level found in humans. [0281] Tumors were measured every five days with calipers, and the tumor volume was calculated according to the equation: tumor volume=L×W 2 ×1/2, where L is the longest axis of the tumor and W is the axis perpendicular to L. Mouse blood was also collected for NK cell and cytokine release (TNFα and IL-6) analysis, and systemic toxicity was monitored by measuring body weight loss of experimental mice. 69890-02 [0282] As compared to the tumor-bearing mice treated with PBS, administration of hPSC-NK cells significantly reduced tumor burden (FIGS. 14B-14C). As expected, dual CAR hPSC-NK cells displayed higher anti-tumor cytotoxicity than wild-type or other CAR-expressing NK cells. We next measured human cytokine production release in the plasma of different experimental mouse groups, including TNFα and IL-6. All non-PBS experimental groups released detectable TNFα and IL-6 in the plasma from day 14 to day 28, and dual CAR hPSC-NK cells maintained highest levels of both cytokines (FIGS.14D-14E), which were eventually decreased in host mice, indicating a reduced risk of cytokine release syndrome. [0283] Given the promising in vivo performance of our hPSC-derived NK cells, MDA-MB-231 tumor cells were re-inoculated to construct a tumor rechallenge model for the investigation of their memory-like behavior (FIG. 15A). Compared with other experimental groups, dual CAR hPSC-NK cells significantly reduced tumor burden (FIGS.15B-15C) and prolonged the survival of tumor-bearing mice (FIG. 15D). The data indicate that the combination of tumor microenvironment responsive anti-PD-L1 and programmable anti-FITC CARs significantly enhances in vivo persistence and antitumor activities of hPSC-derived NK cells, endowing them with a memory-like capacity for improved immunotherapy.