FIELD OF THE INVENTION

The deiodinases (DI, D2, and D3) are a family of selenocystein-containing enzymes with a key role in thyroid hormone (TH) activation and inactivation and impact on energy metabolism, development, cell differentiation, and a number of other physiological processes. The three deiodinases isoenzymes constitute sensitive rate-limiting components within the TH axis, able to rapidly control TH action during physiological or disease states. Notably, several human diseases are characterized by apparent deiodinase dysregulation (e.g., inflammation, osteoporosis, metabolic syndrome, muscle wasting, cancer and the low T3 syndrome in critical illness). Consequently, these enzymes are targets of interest for the development of pharmacological compounds with modulatory activities. However, until now, the portfolio of inhibitors for these enzymes is limited for the low specificity of the known inhibitor compounds. The present invention relates to the discovery of a novel D2 specific inhibitor, the antibiotic Cefuroxime, among the FDA approved drugs dataset. Cefuroxime belongs to the family of the Cephalosporins and is an antibiotic approved for the treatment of infections. As proof-of-concept, we measured the enzymatic activity of D2 in in vivo and in vitro settings, and demonstrated that Cefuroxime acts as a specific inhibitor of D2 activity, without altering the enzymatic activity of DI and D3, thus representing a valuable compound to counteract the expression of D2 in the most advanced cancer stages and in a number of human pathologies.

BACKGROUND

Thyroid Hormones, D2 and cancer metastasis

Thyroid Hormones (THs, T3 and T4) have a wide range of effects. In adult mammals they affect nearly all organs, cell metabolism and basal metabolic rate as well as cell differentiation. In humans, excess or deficiency of circulating TH causes clinical conditions known as hyper- and hypo-thyroidism. Thyrotoxicosis and clinical conditions of enhanced systemic TH levels such as Grave’s disease or toxic nodular goitre produce an acceleration of heart beat with associated heart failure, cardiac arrhythmias, osteoporosis, muscle loss and psychiatric abnormalities [1],

Systemic hyperthyroidism is the consequence of over production of THs that in healthy subjects is avoided by the central regulation of TH synthesis operated by the Hypoyhalamous- Pitituary-Thyroid Axis (HPT axis) which reduces the stimulation of the thyroid gland when the THs in the circulation exceed the physiological levels. Beside the central control of THs homeostasis, a group of three selenoenzymes, the iodothyronine deiodinases, operate a potent control of THs action at tissue level. The diodinases (DI, D2 and D3) are three selenocysteine-containing enzymes, which catalyze the removal of one iodine moiety from THs, thus converting T4 into T3 (catalyzed by DI and D2) or T3 and T4 into the inactive metabolites rT3 and T2 (catalyzed by D3). The three deiodinases share many similarities in their amino acid sequence and have a high homology grade in the active site [2], Thus, compounds able to interfere with the deiodinases have low specificity of action.

While DI is in charge for modulating systemic TH levels, D2 and D3 finely control TH activation/inactivation in target tissues. Indeed, intracellular TH signaling is adapted within target cells via the action of the deiodinase enzymes D2 and D3. In detail, D2 confers on cells the capacity to increase T3 production thereby enhancing TH signaling, whereas D3 has the opposite effect [2], The authors of the present invention recently demonstrated that the TH activating enzyme, D2, is potently up-regulated in the late stages of SCC tumor progression in mice and in humans and its expression in humans is positively associated with a low survival rate and higher risk of relapse [3], The above studies demonstrated that the D2-produced thyroid hormone affects cancer formation, growth and progression. Indeed, THs accelerated tumor metastasis, while THs attenuation reduced metastatic formation. In detail, in cancer cells D2 activates THs, which in turns enhances the expression of ZEB-1 (the master regulator of EMT and cancer invasiveness), thus promoting higher invasiveness and metastatic evolution of human cancers. Moreover, in human samples, D2 was associated with increased risk of postsurgical relapse and with malignant grading of a large cohort of tumors.

Consequently, the data obtained point at D2 as a novel “metastatic promoter” and indicate D2 as target of interest for developing pharmacological compounds with inhibitory activities. Indeed, our data in in vitro and in vivo models of SCC tumorigenesis demonstrated that inhibition of D2 by using the rT3 (which is a competitive, non specific inhibitor of D2 activity) potently reduces the number of metastasis by 60%, thereby proving that our approach is successful.

Thyroid Hormones, D2 and Atrophy-related Syndromes

Skeletal muscle wasting is a devastating complication of many chronic diseases including cancer, diabetes, chronic heart failure and cystic fibrosis. Despite its medical importance, there is, as yet, no effective means to treat this condition. Therefore, an urgent challenge is to discover treatments able to prevent its onset and/or progression. THs are a major determinants of muscle functions, and thyroid dysfunctions are leading causes of many myopathies. Muscle wasting results from the combined effects of muscle atrophy as well as muscle cell death, which lead to an overall loss of muscle mass and a decrease in muscle strength. In catabolic conditions, protein breakdown is enhanced and exceeds protein synthesis thereby resulting in myofiber atrophy. Preliminary data indicate that: (1) The TH- activating enzyme (D2) is sharply up-regulated during several atrophic processes, namely, cachexia, denervation and starvation. Accordingly, D2-null mice are partially protected against muscle wasting; (2) FoxO3, the master regulator gene of muscle atrophy [4], is a novel downstream target of TH in muscle; and (3) Excessive intracellular TH induces massive apoptosis of activated muscle stem cells by increasing the production of reactive oxygen species (ROS), which is a process indicative of massive myofiber loss in thyrotoxic states. Therefore, the above data indicate that, by regulating muscle fiber growth and metabolism, THs control a major catabolic route within a cellular network that maintains the balance between protein synthesis and degradation. Accordingly, compounds with the potential of TH action attenuation and D2 protein inhibition are candidate therapeutics for the treatment of muscle atrophy.

The aforementioned data indicate that the three deiodinases are critical regulators of the THs activation in peripheral tissues and also have important roles on the energy metabolism control, on embryonic development, on cellular differentiation and many other physiological processes [5], Moreover, the deiodinases are often deregulated in different human pathologies (as the inflammation, the osteoporosis, the metabolic syndrome, cancer and low-T3 syndrome). Consequently, these enzymes are targets of interest for the development of pharmacological compounds with modulatory activities. However, until now, the portfolio of inhibitors for these enzymes is limited for the low specificity of the known inhibitor compounds. In the clinics, PTU (propylthiouracil, which inhibits only DI, that, among the deiodinases regulates systemic TH levels) is in use for treatment of severe hyperthyroidism. Other well-known inhibitors (e.g., iopanoic acid or aurothioglucose) are nonselective and block all three isoenzymes.

SUMMARY OF THE INVENTION

It is an object of the invention Cefuroxime and derivatives thereof for use in the treatment of a condition or a disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase.

In a preferred embodiment of the invention the condition or disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase is selected from: epithelial tumors, preferably Squamous Cell Carcinoma (SCC), mesothelioma, prostate cancer, colorectal cancer, lung cancer; skeletal muscular atrophy, preferably resulting from chronic diseases including cancer, diabetes, chronic heart failure, cystic fibrosis

- thyrotoxicosis resulting from Grave's disease, thyroid goiter, hyperthyroidism; pulmonary emphysema and chronic inflammatory processes.

Even more preferably the condition or disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase is an epithelial tumor, preferably said epithelial tumor is selected from Squamous Cell Carcinoma (SCC), mesothelioma, prostate cancer, colorectal cancer, lung cancer.

Even more preferably the condition or disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase is skeletal muscular atrophy, preferably said skeletal muscular atrophy results from chronic diseases including cancer, diabetes, chronic heart failure, cystic fibrosis.

In a further preferred embodiment, the Cefuroxime derivative is Cefuroxime Sodium Salt or Acetoxyethyl Cefuroxime.

It is a further object of the invention a pharmaceutical composition comprising Cefuroxime and derivatives thereof and pharmaceutically acceptable excipients for use in the treatment of a condition or a disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase.

Preferably, said pharmaceutical composition is in a dosage form suitable for oral or parenteral administration. Still preferably, said pharmaceutical composition is for use in improving, treating or preventing by the selective inhibition of D2 deiodinase a condition or disease selected from: epithelial tumors, preferably Squamous Cell Carcinoma (SCC), mesothelioma, prostate cancer, colorectal cancer, lung cancer; and/or skeletal muscular atrophy, preferably resulting from chronic diseases including cancer, diabetes, chronic heart failure, cystic fibrosis; and/or

- thyrotoxicosis resulting from Grave's disease, thyroid goiter, hyperthyroidism; and/or pulmonary emphysema and/or chronic inflammatory processes.

Even more preferably, said pharmaceutical composition is for use in improving, treating or preventing an epithelial tumor, preferably said epithelial tumor is selected from Squamous Cell Carcinoma (SCC), mesothelioma, prostate cancer, colorectal cancer, lung cancer. Even more preferably, said pharmaceutical composition is for use in improving, treating or preventing skeletal muscular atrophy, preferably said skeletal muscular atrophy results from chronic diseases including cancer, diabetes, chronic heart failure, cystic fibrosis.

Preferably, in said pharmaceutical composition the Cefuroxime derivative is Cefuroxime Sodium Salt or Acetoxyethyl Cefuroxime.

In a further preferred embodiment the pharmaceutical composition comprises Cefuroxime in combination with at least one further active ingredient, preferably in combination with Clavulanic Acid, preferably wherein Cefuroxime and Clavulanic Acid are in 4: 1 (w/w) ratio.

DESCRIPTION OF THE INVENTION

The present invention is directed to the antibiotic Cefuroxime (Curoxim GlaxoSmithKline S.p.A GSK), belonging to the FDA-approved farms, for use as D2 inhibitor. Cefuroxime is a second-generation Cephalosporin antibiotic. It has broad spectrum activity and is commonly used for the treatment of both upper and lower respiratory tract infections, Lyme disease, and genitourinary tract infections. To test the ability of Cefuroxime to modify the D2 enzymatic activity, the authors of the present invention measured the T4-to-T3 conversion in a deiodination assay in vitro. Then, in vivo experiments were performed in mice and demonstrated that Cefuroxime acts as a specific inhibitor of D2 enzymatic activity without altering the activity of DI and D3 enzymes.

By performing mass spectrometry (LC-MS) studies, it was found that Cefuroxime significantly decreases the T4-to-T3 conversion in vitro and in vivo. The results obtained show that, apart its role as antibiotic and antistatic, Cefuroxime can be considered a novel anti-thyroid agent, able to interfere with D2 activity in a number of different diseases.

Thus, the present invention is directed to the novel use of Cefuroxime in the treatment of human diseases in which an increment of D2 activity leads to excessive T3 production and worsen the pathologic state.

Different human pathologies are potential target for the Cefuroxime-induced D2 inhibition:

• Epithelial tumors, such as the Squamous Cell Carcinoma (SCC). This therapeutic application can be extended to other tumor types with D2 elevation, as the Mesothelioma, the Prostate Cancer, the colorectal Cancer and the Lung Carcinoma.

• Muscle Atrophy-related syndromes induced by chronic pathologies as the cancer, the diabetes, the chronic cardiac insufficiency and the cystic fibrosis.

• Tireotoxicosis due to the Grave’s disease, the thyroid goiter and the hyperthyroidism, • The different pathological conditions characterized by increased D2 activity as the lung emphysema and chronic inflammation.

In a preferred embodiment the object of the present invention is Cefuroxime and derivatives thereof for use in the treatment of Squamous Cell Carcinoma.

Preferably the invention is directed to Cefuroxime, Cefuroxime sodium salt or Cefuroxime axetil for use in the treatment of Squamous Cell Carcinoma.

According to the invention, Cefuroxime and any of the above derivatives, preferably its sodium salt or the 1 -acetoxy ethyl ester, can be administered in combination with other active substances, as for example clavulanic acid. Cefuroxime, preferably as its sodium salt or 1- acetoxyethyl ester, is a broad-spectrum beta-lactam antibiotic, part of the second generation cephalosporins. The activity of Cefuroxime is prevalent in Gram negative bacteria but also acts on some Gram positive ones, its action is bactericidal.

Chemically, the compound is (6R,7R)-3-{[(aminocarbonyl)oxy]methyl}-7-{[(2Z)-2-(2- furanyl)-2-(methoxyimino)acetyl]amino}-8-oxo-5-thia-l-azabic yclo[4.2.0]oct-2-ene-2- carboxylic acid, having the following structure:

As herein used the term “Cefuroxime” includes also its pharmaceutically acceptable derivatives. The term “cefuroxime” as per present invention is used in broad sense to include not only “cefuroxime” per se but also its pharmaceutically acceptable derivatives thereof. Suitable pharmaceutically acceptable derivatives include pharmaceutically acceptable salts like the sodium salt, pharmaceutically acceptable solvates, pharmaceutically acceptable hydrates, pharmaceutically acceptable esters, polymorphs, pharmaceutically acceptable prodrugs, pharmaceutically acceptable complexes etc. As used herein “Cefuroxime derivatives” are: Cefuroxime salts, like the sodium salt, potassium salt, magnesium salt, amine salts; Cefuroxime esters, like the acetoxyethyl ester or the Cefuroxime pivoxetil (CAS Number 100680-33-9), the 2-(diethylamino)ethyl ester (CAS Number: 1208308-46-6); cefuroxime complexes, like the arginine complex. Preferably, Cefuroxime is Cefuroxime sodium salt (CAS Number: 56238-63-2) or Cefuroxime axetil, i.e. Cefuroxime 1 -acetoxy ethyl ester (CAS Number: 64544-07-6), having formula:

As used herein, the term “D2” refers to the Type II iodothyronine deiodinase, which is also indicated ad DIO2 or IOD2. The protein is responsible for the deiodination of T4 (3, 5,3', 5'- tetraiodothyronine) into T3 (3,5,3'-triiodothyronine).

It is a further object of the invention a method for thetreatment of a condition or a disease that can be improved, treated or prevented by the selective inhibition of D2 deiodinase comprising administering an effective amount of Cefuroxime or derivatives thereof to a subject in need thereof. Preferably it is an object of the invention a method of treating an epithelial tumor, selected from Squamous Cell Carcinoma (SCC), mesothelioma, prostate cancer, colorectal cancer, lung cancer deiodinase comprising administering an effective amount of Cefuroxime or derivatives thereof to a subject in need thereof.

Depending on the pathologic status of the patient, the age and other physiological parameters, a pharmaceutical composition comprising Cefuroxime may require specific dosages, route and protocols of administration. Preferably, Cefuroxime is administered at least once a day in a dosage range comprised from about 1 mg/kg/day to about 100 mg/kg/day. In some embodiments, Cefuroxime can be administered one, two, three or more times per day, for a period of one week, two weeks, four weeks, eight weeks, twelve weeks, sixteen weeks etc. In some cases, Cefuroxime can be administered for one to ten days, alternating with periods of interruption of administration.

Pharmaceutical compositions can be selected based on treatment needs. Such compositions are prepared by mixing and can be administered for example in the form of tablets, capsules, oral preparations, powders, granules, pills, injectable or infusible liquid solutions, suspensions, suppositories, or inhalation preparations. Tablets and capsules for oral administration are usually presented in unit doses and contain conventional excipients such as binders, fillers (including cellulose, mannitol, lactose), diluents, tableting agents, lubricants (including magnesium stearate), detergents, disintegrants (e.g. polyvinylpyrrolidone and starch derivatives such as sodium starch glycollate), coloring agents, flavoring agents, and wetting agents (e.g. sodium lauryl sulfate). The solid oral compositions can be prepared by conventional mixing, filling or tableting methods. The mixing operation can be repeated to distribute the active ingredient in all compositions containing large quantities of fillers. These operations are conventional. Oral liquid preparations may come as aqueous or oily suspensions, solutions, emulsions, syrups or elixirs, or as a dry product to be reconstituted with water or a suitable vehicle before use. Such liquid preparations may contain conventional additives such as suspending agents, for example sorbitol, syrup, methylcellulose, gelatin, hydroxyethylcellulose, carboxymethylcellulose, aluminum stearate gel, or hydrogenated edible fats; emulsifying agents, such as lecithin, sorbitan monooleate, or acacia; non-aqueous vehicles (which may include edible oils) such as almond oil, fractionated coconut oil, oily esters such as glycerin esters, propylene glycol, or ethyl alcohol; preservatives, such as methyl or propyl p- hydroxybenzoate or sorbic acid, and conventional flavoring or coloring agents.

Oral formulations also include conventional slow-release formulations such as gastro-resistant tablets or granules. The pharmaceutical compositions administered by inhalation can be contained in an insufflator or in a pressurized nebulizer.

For parenteral administration, unit dosages of fluid may be prepared, containing the activator and a sterile vehicle. The activator can be either suspended or dissolved, depending on the composition of the vehicle and the concentration of the activator.

Parenteral solutions are normally prepared by dissolving the activator in a vehicle, subsequently sterilized by filtration, and finally suitable vials are filled and sealed.

Advantageously, adjuvants such as local anaesthetics, preservatives and buffering agents can be dissolved in the vehicle. To increase stability, the composition can be frozen after filling the vials and after removing the water in a vacuum. Parenteral suspensions are prepared in substantially the same manner, except that the activator may be suspended in the vehicle instead of being dissolved, and further sterilized by exposure to ethylene oxide prior to suspension in the sterile vehicle. A surfactant or wetting agent may be included in the composition to facilitate uniform distribution of the activator of the invention.

In order to increase bioavailability, cefuroxime can be pharmaceutically formulated in liposomes or nanoparticles. Acceptable liposomes can be neutral, negatively or positively charged, the charge being an indication of the liposome components and the pH of the liposomal solution. Liposomes can normally be prepared using a mixture of phospholipids and cholesterol. Suitable phospholipids include phosphatidylcholine, phosphatidylethanolamine, phosphatidic acid, phosphotidylglycerol, phosphatidylinositol. Polyethylene glycol can be added to improve the blood circulation time of liposomes. Acceptable nanoparticles include albumin nanoparticles and gold nanoparticles.

For buccal or sublingual administration the compositions may be tablets, lozenges, lozenges, or gels.

The composition of the invention can be formulated as suppositories or retention enemas, for example suppositories containing conventional bases such as cocoa butter, polyethylene glycol, or other glycerides, for rectal administration.

A further way of administering the composition of the invention concerns transdermal delivery. Topical transdermal formulations include conventional aqueous and non-aqueous carriers, such as creams, oils, lotions, or pastes, or may be in the form of medicated membranes or patches.

The formulations are known in the art [6], Cefuroxime or compositions comprising it according to the present invention may be employed for use in the treatment and/or prevention of the aforementioned conditions alone as sole therapy or in combination with other therapeutic agents, either through separate administrations or by including the two or more active ingredients in the same formulation. The compounds can be administered simultaneously or sequentially. In certain cases, the combination of cefuroxime and additional agent will exhibit a greater than additive effect (i.e., a synergistic effect). In other instance, the use of cefuroxime permits a reduced amount of the other agent to be administered, without a corresponding decrease in therapeutic efficiency.

The combination can be administered as separate compositions (simultaneous, sequential) of the individual treatment components or as a single dosage form containing all agents. When the active ingredient of this invention is in combination with other active ingredients, the active ingredients can be formulated separately into single ingredient preparations of one of the forms described above and then supplied as combined preparations, which are administered at the same time or several times, or they can be formulated together in a two or more ingredient preparation.

The following figures show the potential application of Cefuroxime.

Figure 1. Model of in silico interaction between murine D2 and Cefuroxime.

Figure 2. Measurement of the intracellular T3 production in a deiodination assay in the Brown Adipose tissue (BAT) by using the labeled T3 (T4- ¹³ C6) as D2 substrate.

The BAT expresses high amounts of D2 enzyme at basal levels, which can be further augmented by cold exposure. Briefly, extracts of BAT were incubated with T4- ¹³ C6 (an analogue of T4 presenting six ¹² C atoms replaced by ¹³ C isotopes). Deiodinase activity, expressed as amount of T3- ¹³ C6 produced, was assayed in the presence or in the absence of Cefuroxime. The use of the heavy T4 turned out to be mandatory for our assay to exclude high levels of endogenous T3 in our calculation. Cefuroxime inhibited D2 conversion of T4- ¹³ C6 into T3- ¹³ C6 with an IC50 of 3.7 M (logIC50 -5.50 ± 0.06). When treated with 20 nM T4- ¹³ C6, total extracts from cold-exposed BAT yielded 120 ± 26 T3- ¹³ C6 (fmol/h/0.1 mg total protein), while pre-treatment with Cefuroxime for one hour, drastically reduced the T3 production to only 10 ± 4 T3 (fmol/h/0.1 mg) (Figure 2A, B). Contrarily, rT3 (generated by the D3-dependent deiodination) levels were not reduced by Cefuroxime, demonstrating that it specifically acts as inhibitor of D2 activity, without any effect on D3 activity (Figure 2 A, C). Figure 3. A: HPLC-MS measurement of T3 and T4 levels in cell culture media of pTRE-D2 C2C12 cells in which D2 can be induced by doxycycline, treated or not with Cefuroxime and/or doxycycline for 48h. Strikingly, Cefuroxime potently reduced the T3 levels in both, non-treated cells and DOX-treated differentiated C2C12 cells, thus proving that Cefuroxime strongly inhibits endogenous and DOX-induced D2 activity. B: Measurement of the intracellular T3 in response to increasing concentration of Cefuroxime in C2C12 cells by LC- MS/MS. Cefuroxime inhibited D2 conversion of T4- ¹³ C6 into T3- ¹³ C6 with an IC50 of 3.7 pM (logIC50 -5.50 ± 0.06). DI and D3 activity was not modified by Cefuroxime.

Figure 4. Cefuroxime inhibits the T3 activation in D2-expressing tissues. The drug was injected i.p. in wild type 10 weeks-old mice daily for 2 weeks prior the overnight cold exposure before the sacrifice. When exposed to cold, mice undergo adaptive thermogenesis by the up-regulation of the uncoupled protein UCP-1 in the BAT that in turn converts the energy derived from oxidative metabolism to heat production. The increased BAT activity upon cold exposure in control group was evident by the denser appearance and enlargement of interscapular BAT in mice kept at 4°C. Importantly, the treatment with Cefuroxime reduced the cold-induced BAT stimulation. Additionally, considering that the up-regulation of UCP-1 levels is dependent on D2-mediated TH production in the cold exposed BAT, the downstream effects of Cefuroxime on this process was investigated evaluating UCP-1 mRNA levels. Cold exposed control mice showed up-regulation of UCP-1, while this effect was significantly reduced in mice treated with Cefuroxime

MATERIALS AND METHODS

Cell Cultures

C2C12 cells were obtained from ATCC (ATCC® Cat. No. CRL-1772™) and cultured in Dulbecco's modified Eagle Medium (DMEM) supplemented with 10% FBS (Microgem), 2 mM glutamine, 50 i.u. penicillin, and 50 pg/ml streptomycin (proliferating medium). C2C12 TET-ON D2 cells were cultured in DMEM supplemented with 10% tetracycline-free Fetal Bovine Serum (FBS) (Clontech, Mountain View, CA, USA), lOO pg/ml geneticin (Biowest, Nuaille, France) and 0.8 pg/ml puromycin (Invitrogen, Carlsbad, CA, USA). For studies in proliferative conditions (PROL), C2C12 cells were grown at 40-50% confluence and treated with the indicated amounts of doxycycline (DOX) for 16, 24 or 48 h. D2 expression was turned on by 2 pg/ml doxycycline (Clontech, Mountain View, CA, USA). In experiments in which THs were removed from the serum, TH-deprivation was achieved by FBS Charcoal absorption.

Conditional expression of D2 in C2C12 cells

Transfection of D2 was performed in C2C12 cells, as previously described, in order to up- regulate the D2 expression [7], Two different clones showed the maximal D2 expression upon DOX treatment and were thus used for the following experiments.

Real-Time qPCR

Cells and tissues were lysed in Trizol (Life Technologies Ltd.) according to the manufacturer’s protocol. 1 pg of total RNA was used to reverse transcribe cDNA using Vilo reverse transcriptase (Life Technologies Ltd.), followed by real-time qPCR using iQ5 Multicolor Real Time Detector System (BioRad) with the fluorescent double-stranded DNA- binding dye SYBR Green (Biorad).

Specific primers for each gene were designed to generate products of comparable sizes (about 200 bp for each amplification). Primer combinations were positioned whenever possible to span an exon-exon junction and the RNA was digested with DNAse to avoid genomic DNA interference. For each reaction, standard curves for reference genes were constructed based on six four-fold serial dilutions of cDNA. All experiments were run in triplicate.

The gene expression levels were normalized to cyclophilin A and calculated as follows: N *target = 2(DCt sample-DCt calibrator).

Table 1

>

Primers used in real-time PCR analysis

Gene Forward primer (5' — > 3') Reverse primer (5' — > 3')

„ _/z . CGCCACTGTCGCTTTTCG AACTTTGTCTGCAAACAGCTC

Cyclophilin A (CypA) „ > , . , _Qpn „ >

GTCGGTCCTTCCTTGGTGTA GGGCCCTTGTAAACAACAAA

Ucpl (SEQ ID No 3) (SEQ ID No 4) Construction of DIO2 model, drugs dataset and ligand preparation The NCBI GenBank was used to obtain human DIO2 sequences [NP 001311391], The sequences file was used to generate a 3D model of the protein using the software I-Tasser from zhanglab (https://zhanglab.dcmb.med.umich.edu/I-TASSER/).

The protein preparation module in Maestro software package (Schrodinger LLC, NY, USA) was used to optimize the protein structure for docking. The protein was protonated to add polar hydrogens, the structure was optimized at cellular pH conditions, and the structure energy minimized using OPLS2005 force field. FDA approved drugs dataset was retrieved from Selleckchem Inc. (WA, USA). All compounds were imported to Ligprep software, desalted and 3D optimized using OPLS2005 force field. The docking grid was generated by using the predicted glutathione binding site and setting a center for docking box of 20 A size. The output results were ordered by docking score. In this set, compound C (Cefuroxime) was found to be a strong inhibitor of DIO2. The measured ICso was 3.7 pM.

HPLC-MS measurement of T3 and T4

Standard stock solutions of all target analytes (3,3',5,5'-Tetraiodo-L-thyronine (L-thyroxine (T4) and 3,3',5-triiodothyroxine (T3)) were prepared in methanol. Dilutions of each standard were prepared in methanol/water (v/v, 50/50). 10 milliliters of cell media were deproteinated using 9 volumes of cold acetone and then centrifuged at 14.000 rpm. The supernatants were reduced to 200 pL under N2 for instrumental analysis. The HPLC system Jasco Extrema LC- 4000 system (Jasco Inc., Ithaca, NY) was coupled to an Advion Expression mass spectrometer (Advion Inc., Ithaca, NY) equipped with an ESI (Electrospray ionization) source. 10 mM ammonia acetate in deionized water was used as the aqueous mobile phase, and 0.1% acetic acid in methanol was used as the organic mobile phase. The analyses were performed in the positive ESI mode. Six replicates were run for each sample.

Deiodinase Assay

Proteins were precipitated in acetonitrile and supernatant evaporated to dryness at 37 °C in a rotavapor. The dried extract were reconstituted with 30pL of a 95:5 methanol :NHs solution and centrifuged at 13.000 rpm for 10 min. Samples (5 pL) were injected on a Raptor Biphenyl 2.7 pm, 100 mm x 2.1 mm (cat. 9309A12) using as Mobile Phase A 0.1% Formic acid in water and as Mobile phase B 0.1% Formic acid in methanol. Calibration curves (1 to 40 pM) were prepared dissolving pure T4, T3 and T4- ¹³ C6 in 95:5 methanokNHs solution. The activity of DIO2 was deduced by measuring the amount of T3- ¹³ C6 produced from T4- ¹³ C6. The analyte MRMs were for T ₃ - ¹³ C6 (658.07>612.1>514.1); T3 (652.07>606.1>508.1); T4 (778.0>731.9>323.9); T4-13C6 (784.1>738.04). D2 activity was measured in triplicate.

RESULTS

1. Identification of Novel D2-inhibiting Compounds among Drug-Approved Libraries

With the aim to identify new potential interactor proteins for D2, we performed a prediction of the 3D structure of D2 by using the software I-Tasser from zhanglab (Figure 1). Subsequently, the protein was protonated to add polar hydrogens, the structure was optimized at cellular pH conditions, and the structure energy minimized using OPLS2005 force field. Potential D2 inhibitors were then searched among the FDA approved drugs by analyzing the dataset Selleckchem Inc. (WA, USA). All compounds were imported to Ligprep software, desalted and 3D optimized using OPLS2005 force field. This analysis yielded a list of 23 potential molecules capable of D2-interaction. Among them, the inventors focalized their attention on the first 10 compounds and further on the Cefuroxime, which belongs to the family of the Cephalosporins and is approved as antibiotic, used to treat and prevent a number of bacterial infections, including pneumonia, meningitis, otitis media, sepsis, urinary tract infections, and Lyme disease. It is normally used by mouth or by injection into a vein or muscle. Described side effects include nausea, diarrhea, allergic reactions, and pain at the site of injection. Use in pregnancy and breastfeeding is believed to be safe. It is a second- generation cephalosporin and works by interfering with a bacteria's ability to make a cell wall resulting in its death.

Cefuroxime was patented in 1971, and approved for medical use in 1977. It is on the World Health Organization's List of Essential Medicines (World Health Organization model list of essential medicines: 21st list 2019. Geneva: World Health Organization, hdl: 10665/325771. WHO/MVP/EMP/IAU/2019.06. License: CC BY-NC-SA 3.0 IGO). In 2017, it was the 342nd most commonly prescribed medication in the United States, with more than 800 thousand prescriptions.

2. Identification of Cefuroxime as Novel D2-inhibitor

To test the ability of Cefuroxime to modify the D2 enzymatic activity, the inventors first measured the T4-to-T3 conversion in a deiodination assay using a deuterated-T4 (T4- ¹³ C6) as the enzymatic substrate for D2 activity. This assay is highly specific and can discriminate between endogenous and exogenous T4 deiodination due to the presence of the deuterium deiodination assay was firstly measured in total extracts from Brown Adipose Tissue (BAT), which express high amounts of D2 enzyme at basal levels, that are further up-regulated by the cold exposure. When treated with 2 nM T4- ¹³ C6, total lysates from cold-exposed BAT yielded 120+/-26 T3 (fmol/h/0.1 mg), while BAT lysates pre-incubated with Cefuroxime yielded only 10 +/- 4 T3 (Figure 2). Contrarily, rT3 levels (which are generated by the D3-dependent deiodination) were not reduced by Cefuroxime, which demonstrates the Cefuroxime acts specifically as inhibitor of D2 activity (Figure 2). To further validate Cefuroxime as D2 inhibitor, we measured T3 and T4 by LC-MS in a different setting, namely, the muscle C2C12 cells characterized by basal low D2 expression. Specifically, we used a modified version of C2C12 cells that were recently generated in our lab, in which the D2 enzyme can be up- regulated by the addition of Doxycyclin in the culture medium (the C2C12 Tet-ON cells). Strikingly, Cefuroxime potently inhibited the T3 levels in control cells, and in Dox-treated C2C12 cells, thus proving that Cefuroxime potently inhibits the activity of exogenous and Dox-induced D2 (Figure 3). Finally, to determine the potency and dose-specificity of Cefuroxime, dilution series of the compound were tested in the deiodinase assay (Figure 3). The IC50 of Cefuroxime was found to be 30 pM. DI and D3 activities were not blocked by Cefuroxime even in the highest concentrations tested.

3. Cefuroxime significantly reduces the cold-induced BAT activation

One of the best known physiological role of D2 is the stimulation of adaptive thermogenesis in BAT, in collaboration with the parasympathetic action of norepinephrine. When exposed to cold, mice undergo adaptive thermogenesis by the up-regulation of the uncoupled protein UCP-1 in the BAT that in turn converts the energy deriving from oxidative metabolism to heat production [8], This effect is dependent on D2-mediated TH production in the BAT that results in transcriptional induction of UCP-1. The inventors tested the ability of Cefuroxime to interfere with UCP-1 induction in mice exposed to cold. Indeed, they observed that while cold exposed control mice showed enlargement of the BAT and up-regulation of UCP-1 expression, such effect was drastically reduced in mice treated with Cefuroxime for 2 weeks (Figure 4). Thus, these in vivo data confirm that Cefuroxime is a potent inhibitor of D2 activity in animal models.

DISCUSSION

This invention relates to the use of a novel inhibitor of the D2 enzyme for the treatment of advanced stages of tumorigenesis and the muscle wasting disease. By searching for novel drugs with ability to interfere with the D2 activity, the inventors identified a novel action of the Cephalosporin Compound C as inhibitor of the D2 enzyme. By using a new developed HPLC method for deioination determination, we demonstrated that the Compound C has the remarkably ability to inhibit D2 enzymatic activity without perturbing DI and D3 enzymatic activity. Differently from the drugs that affect THs production by the thyroid gland (Methimazole and Perchlorate), Compound C inhibits the enzymatic activity of D2 in target tissues and for the doses used in our hands, does not alter the systemic THs levels. This represents a great advantage, since THs alterations in the blood could cause serious deleterious effects such as cardiac failure, osteoporosis, muscle wasting and altered renal and hepatic metabolism.

Use of Cephalosporin in the treatment of Squamous Cell Carcinomas

Non-melanoma skin cancer (NMSC) is the most common cancer in humans and it includes two main types of tumors: Basal Cell Carcinoma (BCC) and Squamous Cell Carcinoma (SCC) [9], BCC is the most predominant form but it is predominantly a benign tumor with rare metastatic conversion. Cutaneous Squamous Cell Carcinoma (cSCC) can metastasize primarily to lymph nodes and then to liver and lungs, accounting for -20% of annual skin cancer-associated mortalities. Both BCC and cSCC are primarily induced by sunlight exposure and a combination of environmental, genetic and phenotypic factors [10], NMSC are increasing but there isn’t accurate data of the symptoms and mortality evolution. Due to the lack of accurate data, the true burden of NMSC is not completely known and therefore it is likely underestimated. The population in Europe, however, is highly affected by NMSCs having an incidence rate of 98 per 100,000 persons during the period 2006-2012 [10], Due to its high risk of metastasis, SCC is considered the main cause of death in NMSCs. Whereas cancer survival rate has been improved over the years, due to early diagnosis and cancer growth inhibition, limited progress has been made in the treatment or in slowing NMSC cancer metastasis. The molecular pathways involved in the metastatic process and the biochemical events underlying the crosstalk between tumor cells and their microenvironment may represent potential targets for metastasis prevention and inhibition. Based on recent demonstration that high D2 expression correlates with poor prognosis and high rate of post- surgical relapse of SCC [3], molecules targeting D2 activity have the potential to be considered valid therapeutic options for the cure of SCC and its metastatic prevention.

Use of Cephalosporin in the Attenuation of Muscle wasting syndromes

Skeletal muscle atrophy is a chronic condition that slowly develops during aging (sarcopenia) as well as after prolonged inactivity, or rapidly appears in a variety of pathologies such as cancer (cachexia), chronic kidney disease, heart failure, chronic obstructive pulmonary disease. In general, the loss of muscle mass results in a deterioration of the patient's physical conditions ranging from postural instability to impaired respiratory and cardiac capacity [11], Since muscle function is essential for breathing, movements, chewing, and swallowing, reduced muscle mass and function is associated with a higher morbidity and mortality as well as reduced quality of life. Up to date, there are no effective drugs available for improving muscle mass and function, which are proven to be able to interfere with the pathophysiological mechanisms.

Current therapies for cachexia-sarcopenia are based on three different classes of drugs: ghrelin receptor agonists (anamorelin); monoclonal antibodies directed against inflammatory mediators responsible for cachexia and muscle wasting (e.g. Abs versus IL-1, IL-6, TNF- alpha, myostatin); and selective non-steroidal androgen receptor modulators (SARMs, e.g. enobosarm). The above-mentioned drugs have been tested in phase 2 and phase 3 clinical trials (Becker C. et al., Lancet Diabetes Endocrinol. 2015 3(12):948-57 2015; Temel et al., Lancet Oncol. 2016; 17: 519-531), which all showed drug preventive effects on muscle loss and body mass gain. However, so far, no clinical data have shown the ability of tested drugs to increase muscle strength and improve physical-mechanical function of the muscle. There is therefore a strong need of providing new effective therapeutic strategies aiming at delaying or preventing the progression of diseases involving muscle wasting, particularly age-related muscle degeneration as well as muscular atrophy conditions secondary to pathologies.

Data from the research group of inventors have demonstrated that D2 enzyme is sharply up- regulated in three different models of muscle atrophy (i.e. following muscle denervation, during cancer cachexia and in the first phases of fasting) (Figure 5). This rise in D2 mRNA expression is paralleled by increased levels of T3 production in skeletal muscle, without affecting the circulating levels of T3 and T4. Notably, genetic depletion of D2 in D2K0 mice resulted in marked attenuated muscle loss after denervation and cancer cachexia, thus demonstrating the functional relevance of D2 and the consequent T3 production for the catabolic mechanisms leading to muscle wasting. Based on these data, molecules able to reduce D2 activity, such as Cephalosporin, find use as anti-catabolic drugs during muscle wasting conditions.

BIBLIOGRAPHY

[1] D.S. Ross, R.M. Neer, E.C. Ridgway, G.H. Daniels, Subclinical hyperthyroidism and reduced bone density as a possible result of prolonged suppression of the pituitary-thyroid axis with L-thyroxine, Am J Med, 82 (1987) 1167-1170. [2] C. Luongo, M. Dentice, D. Salvatore, Deiodinases and their intricate role in thyroid hormone homeostasis, Nat Rev Endocrinol, 15 (2019) 479-488.

[3] C. Miro, E. Di Cicco, R. Ambrosio, G. Mancino, D. Di Girolamo, A.G. Cicatiello, S. Sagliocchi, A. Nappi, M.A. De Stefano, C. Luongo, D. Antonini, F. Visconte, S. Varricchio, G. Ilardi, L. Del Vecchio, S. Staibano, A. Boelen, C. Blanpain, C. Missero, D. Salvatore, M. Dentice, Thyroid hormone induces progression and invasiveness of squamous cell carcinomas by promoting a ZEB-l/E-cadherin switch, Nat Commun, 10 (2019) 5410. [4] M. Sandri, C. Sandri, A. Gilbert, C. Skurk, E. Calabria, A. Picard, K. Walsh, S. Schiaffino, S.H. Lecker, A.L. Goldberg, Foxo transcription factors induce the atrophy-related ubiquitin ligase atrogin-1 and cause skeletal muscle atrophy, Cell, 117 (2004) 399-412.

[5] A.G. Cicatiello, D. Di Girolamo, M. Dentice, Metabolic Effects of the Intracellular Regulation of Thyroid Hormone: Old Players, New Concepts, Front Endocrinol (Lausanne), 9 (2018) 474.

[6] Remington Remington “The Science e Practice of Pharmacy”, Lippincott Williams & Wilkins, 2000.

[7] S. Sagliocchi, A.G. Cicatiello, E. Di Cicco, R. Ambrosio, C. Miro, D. Di Girolamo, A. Nappi, G. Mancino, M.A. De Stefano, C. Luongo, M. Raia, A.N. Ogawa-Wong, A.M. Zavacki, S. Paladino, D. Salvatore, M. Dentice, The thyroid hormone activating enzyme, type 2 deiodinase, induces myogenic differentiation by regulating mitochondrial metabolism and reducing oxidative stress, Redox Biol, 24 (2019) 101228.

[8] A.C. Bianco, E.A. McAninch, The role of thyroid hormone and brown adipose tissue in energy homoeostasis, Lancet Diabetes Endocrinol, 1 (2013) 250-258.

[9] P. Boukamp, Non-melanoma skin cancer: what drives tumor development and progression?, Carcinogenesis, 26 (2005) 1657-1667.

[10] E.H. Epstein, Basal cell carcinomas: attack of the hedgehog, Nat Rev Cancer, 8 (2008) 743-754.

[11] J.M. Argiles, S. Busquets, A. Felipe, F.J. Lopez-Soriano, Molecular mechanisms involved in muscle wasting in cancer and ageing: cachexia versus sarcopenia, Int J Biochem Cell Biol, 37 (2005) 1084-1104.

[12] C. Becker, S.R. Lord, S.A. Studenski, S.J. Warden, R.A. Fielding, C.P. Recknor, M.C. Hochberg, S.L. Ferrari, H. Blain, E.F. Binder, Y. Rolland, S. Poiraudeau, C.T. Benson, S.L. Myers, L. Hu, Q.I. Ahmad, K.R. Pacuch, E.V. Gomez, O. Benichou, S. Group, Myostatin antibody (LY2495655) in older weak fallers: a proof-of-concept, randomised, phase 2 trial, Lancet Diabetes Endocrinol, 3 (2015) 948-957. [13] J.S. Temel, A.P. Abernethy, D.C. Currow, J. Friend, E.M. Duus, Y. Yan, K.C. Fearon, Anamorelin in patients with non-small-cell lung cancer and cachexia (ROMANA 1 and ROMANA 2): results from two randomised, double-blind, phase 3 trials, Lancet Oncol, 17 (2016) 519-531.