USE OF INHIBITION OF EXONUCLEASE 1 IN METHODS FOR THERAPY AND DIAGNOSTIC OF

NEURODEGENERATIVE DISEASES, EYE DISEASES, AND MITOCHONDRIAL DISORDERS

CROSS REFERENCED APPLICATION

[0001] This application claims the benefit under 35 U. S. C. 119(e) of U.S. Provisional

Application Serial No: 60/936,624 filed on June 21, 2007, the contents of which are incorporated herein by reference.

FIELD OF THE INVENTION

[0002] The present invention relates generally to methods for the diagnosis and treatment and/or prevention of neurodegenerative diseases and mitochondrial disorders, and more particularly to the treatment and/or prevention of neurodegenerative diseases or retinal or mitochondrial disorders using agents that inhibit the expression and/or activity of EXOl protein.

BACKGROUND OF THE INVENTION

Mitochondrial disorders and neurological diseases.

[0003] Both neurodegenerative disorders and mitochondrial diseases are typically progressive, often with a delayed-onset. It has been suggested that these diseases may both have a predisposing cellular condition, perhaps caused by a heritable or somatic mutation, and an age-related factor. Mitochondrial disease caused by mutations in mitochondrial DNA is very prevalent in the human population, with an estimated incidence of 1/3500 to 1/5000

(Taylor RW, Turnbull DM, 2005; Nat Rev Genet 6:389-402). Furthermore, late-onset neurodegenerative disorders, including Parkinson's disease and Alzheimer's disease, have been associated with various aspects of mitochondrial dysfunction.

[0004] In most sporadic mitochondrial disorders, for example encephalomyopathies including

Kearns-Sayre or Pearson syndrome maternally inherited endocrine, there is generally an involvement of the nervous system including the visual and auditory systems, and often cardiac and/or skeletal muscle (hence the term "encephalomyopathy"; see Mitochondrial

Disorders, www.neuro.wustl.edu/neuromuscular/mitosyn.html), as well as kidney and liver function.

[0005] DNA damage and neurodegeneration.

[0006] DNA repair is clearly necessary for the developing CNS as seen by loss of neurons in mice defective for repair of double strand breaks due to mutations in the non-homologous end joining or homologous recombination repair (Abner CW, McKinnon PJ. 2004; DNA Repair 3:1141-1147). However, degeneration of postmitotic neurons also occurs when genes involved in single strand break repair, excision repair, and helicases (Caldecott, 2003; Rolig and McKinnon, 2000) are disrupted, demonstrating that DNA repair is also fundamental for the survival of terminally differentiated neurons (Caldecott, 2003, Cell 112:7-10; Rolig, McKinnon, 2000, Trends Neurosci 23:417-424).

[0007] The role of DNA repair in the survival of post-mitotic neurons in mitochondrial disease or under oxidative stress conditions is far less clear. Several reports have described increases in the most frequent lesion observed in reactive oxygen species (ROS)-exposed DNA, the modified guanine, 8-oxo-7,8-dihydroguanine (8-OHdG, also called 8-oxoguanine or 8-oxoG) in diseased neurons in postmortem brains from patients with Alzheimer's disease (AD) or other neurodegenerative disorders (Gabbita SP, Lovell MA, Markesbery WR. 1998, J Neurochem 71:2034-2040; Lyras L, Cairns NJ, Jenner A, Jenner P, Halliwell B, 1997, J Neurochem 68:2061-2069; Mecocci P, MacGarvey U, Beal MF. 1994, Ann Neurol 36:747- 751; Wang J, Xiong S, Xie C, Markesbery WR, Lovell MA. 2005, J Neurochem 93:953-962). [0008] ROS can damage DNA directly, causing oxidative damage to both bases and the sugar-phosphate backbone. It can also cause single-strand and double-strand breaks, apurininic/apyrimidinic sites, DNA cross-links, and base modifications (Barzilai and Yamamoto, 2004). In dividing cells, the base excision repair system appears to be the main pathway for repairing of ROS-induced DNA lesions. Short-patch base excision repairs small base modifications including 8-OHdG, AP sites, and single stranded breaks (Barzilai A, Yamamoto K, 2004, DNA Repair 3:1109-1115; Caldecott KW, 2003, Biochem Soc Trans 31:247-251). Base excision repair of oxidized bases is initiated by a DNA glycosylase with specificity for a limited number of damaged bases. This enzyme hydrolyzes the N-glycosyl bond, generating an abasic (AP) site. The glycosylases involved in removing oxidized bases also appear to have lyase activity and cleave the DNA backbone at the 3' side of the abasic site. APEl, an AP-endonuclease enzyme, nicks the phosphodiester backbone at the 5' portion and removes the abasic lesion leaving a strand break. In short patch base excision repair where one base is repaired, DNA Polβ removes the 5' abasic site via its lyase activity and subsequently fills in the DNA gap leaving a 5'phosphorylated DNA strand. The nick in the

DNA backbone is then ligated by either DNA ligase I (Ligl), or a combination of XRCCl and LigIIL

[0009] If abasic (AP) sites are reduced or oxidized, the lyase activity of polymerase B (Polβ) is insufficient to efficiently remove the 5'deoxyribose phosphate intermediate, and the long- patch base excision repair pathway is deployed. In this alternative pathway, DNA strand displacement occurs by either DNA Polβ or Polδ/ε, creating a flap-like structure that is removed by flap endonuclease 1 (FENl). In addition to repairing of bases that have undergone in situ oxidation, oxidized bases are also removed from the nucleotide pools, preventing their incorporation into DNA.

[0010] EXOl is a mammalian member of the yeast RAD2 nuclease family with 5'— >3' and 3'— >5' exonuclease activity as well as flap structure- specific endonuclease activities. Exol has been described for it is roles in DNA repair, recombination, replication, and telomere integrity (Lee and Wilson III, 1999; Lee and Alani, 2006; Tran et al., 2004). In addition to its role for DNA repair it is also described to play a role during cancer, and especially for genetic instability.

[0011] EXOl is localized in the nucleus and mitochondria in non-pathological tissue. The function of EXOl has been investigated using the gene targeting technology in mouse (Bardwell, 2004; Wei et al., 2003). Mice homozygous for a targeted mutation in EXOl were discovered to have mismatch repair protein defects as shown by micro satellite instability at mononucleotide (but not dinucleotide) stretches, indicating EXOl is important in repairing single base-pair insertion/deletion mismatches rather than larger looped mismatches. Further, these studies also show EXOl plays a role in mutation avoidance and tumor suppression. [0012] The inactivation of EXOl predisposes mice to the development of tumors late in life and specifically increases the risk of lymphoma. However, Exol -defective mice have a longer lifespan and showed a tumor spectrum different than that reported for either MIh 1 or Msh2 deficient mice. Specifically, EXOl-null mice are most susceptible to lymphomas and less susceptible to gastrointestinal tumors, e.g. adenomas and adenocarcinomas. The milder mutator phenotype and lesser cancer proneness of EXOl-null mice corresponds to the situation in yeast, where Exol deletion causes a mild mutator phenotype but has little if any effect on mismatch repair protein-mediated mutation avoidance. A role of EXOl in repair of oxidized DNA has not been reported.

- A -

SUMMARY

[0013] The present invention relates to the discovery that inhibition of the DNA repair gene EXOl attenuates neurodegeneration and mitochondrial damage, nuclear damage, and oxidative stress. The present invention also relates to methods for diagnosis and treatment and/or prevention of a neurodegenerative diseases, mitochondrial disorders, eye disorders and diseases associated with oxidative stress by inhibition of EXOl.

[0014] The inventors have discovered, using genetic fate mapping that animals that have reduced expression or lack the EXOl gene do not develop ataxia, retinal defects and neurodegeneration as compared to animals with normal expression of EXOl or comprising the gene encoding EXOl. Accordingly, in one embodiment of the present invention, methods to prevent or treat a subject with a neurodegenerative disease and/or mitochondrial disorder are provided by inhibition of EXOl protein activity or inhibition of EXOl expression. [0015] In one embodiment, the methods as described herein comprise administering to a subject in need of treatment and/or prevention of a neurodegenerative disease or mitochondrial disorder a pharmaceutical composition comprising an agent which inhibits EXOl, for example an agent which inhibits the expression of EXOl and/or the activity of EXOl protein. It is not intended that the present invention be limited to any particular stage of the disease (e.g. early or advanced) neurodegenerative disease or mitochondrial disorder. [0016] In one embodiment, methods and compositions for treating and/or preventing a neurodegenerative disease or a mitochondrial disorder in a subject are provided, the method comprising identifying a subject with, or at risk of developing a neurodegenerative disease, retinal or a mitochondrial disorder and administering to the subject in need thereof a pharmaceutical composition comprising an agent that inhibits the activity and/or expression of EXOl protein. In such embodiments, the neurodegenerative disease is selected from, but not limited to the group consisting of Alzheimer' s Disease, Parkinson's disease, ataxias, hereditary ataxia, hereditary spastic paraplegia (HSP), amyotrophic lateral sclerosis (ALS). In alternative embodiments, the mitochondrial disorder is selected from, but is not limited to the group consisting of encaphalomyopathis, Kearns-Sayre syndrome (KSS), Pearson syndrome, maternally inherited endocrine, chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP) or Leigh syndrome (LS) or like syndromes. In further

embodiments, the neurodegenerative disease is retinal degeneration, retinopathy, glaucoma or results in retinal defects or eye disorders, or diseases affecting the optic nerve. [0017] In some embodiments the EXOl is human EXOl and is encoded by human transcript 1, 2 or 3 or a homologue or variants thereof.

[0018] In some embodiments, the agent is a small molecule, nucleic acid, nucleic acid analogue, protein, antibody, peptide, aptamer, or variants or fragments thereof, for example a nucleic acid agent is RNA, such as but not limited to an RNAi agent. RNAi agents include, but are not limited to siRNA, mRNA, tRNA, shRNA, miRNA, dsRNA, stRNA, or ribozyme or analogues or variants thereof. In some embodiments, the nucleic is DNA or a nucleic acid analogue, for example but not limited to antisense nucleic acids, oligonucleic acids, peptide nucleic acid (PNA), pseudo-complementary PNA (pcPNA), locked nucleic acid (LNA), or derivatives or analogues thereof. In alternative embodiments, the agent is a protein, for example an antibody or a non-immunoglobulin antigen-binding scaffold, or fragment thereof. [0019] In an alternative embodiment, a pharmaceutical composition comprising an agent that inhibits the activity and/or expression of EXOl protein further comprises a pharmaceutical acceptable carrier, for example a liposome or polymeric nanoparticle. In further embodiments, the agent can be conjugated with a targeting agent, such that the agent is targeted to a specific cell and/or organelle, for example mitochondria and/or neurons. [0020] In some embodiments, a subject is administered a pharmaceutical composition comprising an agent that inhibits the activity and/or expression of EXOl protein and is administered additional therapeutic agents, for example therapeutic agents for the treatment and/or prevention of neurodegenerative disease or mitochondrial disease or retinal disorders. Such additional therapeutic agents include, for example recombinant proteins, growth factors, certain small molecules, pro-drugs etc. for AD or PD etc, radiotherapeutics, immunotoxins, imaging agents, radiation therapy etc.

[0021] In some embodiments, the subject administered a pharmaceutical composition comprising an agent that inhibits the activity and/or expression of EXOl protein is a mammal, for example a mammal is a human or a domestic mammal, for example a companion animal. In some embodiments, the subject has increased reactive oxygen species (ROS) in neurons. In further embodiments, the reactive oxygen species results in oxidative DNA damage, for example the presence of the oxidized base guanine, 8-oxo-7,8,-dihydroguanine (8-OHdG, 8- oxoguanine or 8-oxoG) or a modified version thereof in the nucleus. In some embodiment, the

subject has other oxidized DNA damage in neurons, for example the presence of 8-0HdG, AP sites or single stranded DNA breaks.

[0022] In some embodiments, the pharmaceutical composition is administered by subcutaneous, intravenous, intranasal, parenteral, transdermal, intratracheal, intravenous, intramuscular, intracranial, intrathecal, intra-cerebroventricular, perispinal or oral administration. In some embodiments, administration is via intravitreal injection, occular injection, eye drops, pessary and the like.

[0023] Another aspect of the method and compositions as disclosed herein relates to the use of an agent which inhibits the expression and/or activity of EXOl for the preparation of a medicant for the treatment and/or prevention of a neurodegenerative disease and/or mitochondrial disorder. In an alternative embodiment, an agent which inhibits the expression and/or activity of EXOl is used for the treatment and/or prevention of a neurodegenerative disease and/or mitochondrial disorder.

[0024] Another aspect of the method and compositions as disclosed herein relates to a method of identifying a subject having a risk of developing a neurodegenerative disease and/or mitochondrial disorder, the method comprising; (a) measuring the level of EXOl gene product in a test biological sample obtained from a subject; (b) comparing the level of EXOl gene product in the test biological sample with the level of EXOl gene product in a reference biological sample; and if the level of EXOl gene product is higher in the test biological sample as compared with the reference biological sample, one can identify a that the subject is at risk of developing a neurodegenerative disease and/or metabolic disorder. [0025] In an alternative embodiment, a method to monitor the effect of an agent that inhibits the activity and/or expression of EXOl protein for the treatment of a neurodegenerative disease and/or metabolic disorder is disclosed, the method comprising; (a) measuring the level of EXOl gene product in a test biological sample obtained from a subject at a first time point; (b) measuring the level of EXOl gene product in a test biological sample obtained from a subject at a second time point; and (c) comparing the level of EXOl gene product in the test biological samples from the first time point with the level of EXOl gene product in a test biological sample from the second time point; and if a lower level of EXOl gene product in the test biological sample is detected in the second time point as compared to the level of EXOl gene product from the first time point, it indicates the treatment is likely to be effective.

[0026] In some embodiments, the biological sample is serum, plasma, blood, saliva, and/or tissue sample, for example a biopsy tissue sample such as a brain biopsy tissue sample, for example an ex vivo cultivated biopsy tissue sample. Alternatively, the biological sample can be, but is not limited to, selected from a group consisting of blood, serum, plasma, urine, stool, spinal fluid, pleural fluid, sputum, nipple aspirates, lymph fluid, the external secretions of the skin, respiratory, intestinal, and genitourinary tracts, bile, tears, sweat, saliva, milk, cells, tumors, organs, and also samples of in vitro cell culture constituent.

BRIEF DESCRIPTION OF FIGURES

[0027] Figures IA- 1C shows B ALB/cByJ-derived Chromosome 1 rescues NMF205-mediated granule cell death. Shown in Figs 1A-1C are histological sections from the hippocampus from

3 different mouse lines (B6.NMF205-/-; B6.C-NMF205 -/- (congenic B6 NMF205 -/-) and

WT = wild type). Figure IA shows loss of granule cells and hippocampal neurons of 2 months old NMF205 mice without the M205 modifier region (B6.NMF205 ^~ ' ^~ ) as compared to wild type (WT) sections of 2 months old C57BL/6J mice as shown in Figure 1C, whereas in Figure

IB NMF205 -/- mice that contain the M205 modifier region from BALB/cByJ mice (B6.C-

NMF205 ^~ ' ^~ ) do not show loss of granule cells and hippocampal neurons.

[0028] Figure 2 shows genes within the M205 critical region. The location of the CH28-

135J21 BAC used for transgenic production is as indicated. This region of chromosome Iq43 contains 5 genes within this region and parts of two other genes.

[0029] Figure 3 shows semi-quantitative RT-PCR analysis of Exol mRNA level in the cerebellum of four different mouse lines. Figure 3 A shows the Exol expression by RT-PCR in different mouse lines using Exol primers and Figure 3B shows GAPDH RT-PCR bands using

GAPDH primers as a loading control.

[0030] Figure 4 shows Western blot analysis of EXOl protein expression in NMF205 ^~ ' ^~ and wild type (WT) tissues. Western blotting of tissues from 3- week old NMF205 ^"7" and wild type littermates. BtubIII was used as a loading control. In NMF205 ^"7" mutant tissues increased levels of Exol is detectable as compared to WT mice. In the retina an alternative splice form is detectable.

[0031] Figures 5A to 5C show HE staining of cerebellum from wild type (WT; C57BL6/J);

NMF205 ^~/~ x Exo+/+, and NMF205 ^~/~ x Exo ^"7" mice. Figure 5A shows granular cells from WT

mice, which are lost in NMF205 ^~/~ x Exo+/+ mice (shown in Fig 5B) as compared to WT and NMF205 ^~/~ x Exo-/- mice as shown in figure 5C.

[0032] Figures 6A to 6C show sections of retina from eight week old mice stained with Hemotoxylin-eosin (HE). The genotypes, all on C57BL/6J background, were wild type (WT); NMF205-/-X Exo+/+, and NMF205-/-X Exo-/-. The histology of the normal wild type (WT) retina is shown in Figure 6A. Figure 6B shows a loss of the ganglion cell layer and reduced nuclear layers in the NMF205 mutant that contains the EXOl gene (NMF205-/-X Exo+/+). Figure 6C shows a complete rescue when backcrossed to the EXOl -deficient mouse

[0033] Figure 7 A and 7B show Western blot analysis of EXOl in the hippocampus of wild type (WT) and NMF205 mutant mice. Figures 7A and 7B show EXOl expression in whole cell extracts (Figure 7A and 7B) or purified mitochondrial fraction (Figure 7C) from hippocampus of 3 weeks of age. A commercially available mouse monoclonal antibody to EXOl (EXOl Ab-4, NeoMarkers; 1:1000) was used in Figures 7A and 7C, which is compared to the expression profile of the rabbit polyclonal antibody (polyExolA) (1:1000) generated by the inventors herein, shown in Figure 7B. Figure 7B shows the rabbit polyclonal antibody generated by the inventors is specific to the EXOl protein and has the same expression profile as a commercially available antibody (which is shown in Figure 7A). Figure 7C shows that Exol is expressed in the mitochondrial fraction of the hippocampus. [0034] Figure 8 A and 8B shows immunohistochemistry of EXOl on hippocampus of P49 mice. Figure 8 A shows the immuno staining with the rabbit anti-EXOl polyclonal antibody (polyEXOlB) generated by the inventors (used at 1:200 dilution) in wild type (WT) mice. The same sections counterstained with Hoechst33342 to visualize nuclei (data not shown). Figures 8B shows absence of EXOl staining in the hippocampus of EXOl -/- mice. Figure 8 A shows strong immunoreactivity of Exol in the hippocampus CA2 pyramidal neurons of WT (C57BL/6J) in the cytoplasm, as compared to no staining EXOl deficient mice (shown in Figure 8B).

[0035] Figure 9A-9B shows a glutathione assay as a measure of oxidative stress in the brains of 3 week old wild type (WT) or NMF205 mutant (Mut) mice. Brains from 3 week old C57BL/6J (WT) and NMF205 mutant (Mut) mice were isolated and cerebellum and cortex were dissected. The tissues were homogenized according to manufactures instructions (Cayman Chemicals Cat. no. 703002). Cayman's GSH assay kit utilizes an enzymatic

recycling method, using the enzyme glutathione reductase for the quantification of GSH. Total glutathione (GSH) concentration was determined graphed in relation to total wet tissue. Figure 9A shows that the NMF205 mutant has lower glutathione levels in the cerebellum as compared to WT mice. Figure 9B shows that the NMF205 mutant has lower glutathione levels in the cortex brain region as compared to WT mice, indicating increased oxidative stress in the brain of NMF205 mutant (Mut) mice as compared to wild type mice. [0036] Figures 10A- 1OB show increased oxidative stress in the brain of NMF205 mutant mice. Brain sections from 3-week old NMF205 and C57BL/6J wildtype (WT) mice were immunostained for the presence of 8-oxo-7,8-dihydroguanine (8-OHdG, also called 8- oxoguanine or 8-oxoG), a marker for oxidative stress and was visualized by immunofluorescence. Antibodies for 8-OHdG are available for example from Oxis Research (cat. no. 24326) and as secondary antibody alexa fluor 488-labelled donkey antibody was used as secondary antibody for visualization. The sections were counterstained with Hoechst 33342 to visualize nuclei (data not shown). Figure 1OA shows 8-OHDG immunoreactivity in the dentate gyrus region of 44 day old (P44) wild type (WT) and NF205 mice. Figure 1OB shows 8-OHDG immunoreactivity in the cerebellum of 60 day old (P60) wild type (WT) and NMF205 mice. Both 1OA and 1OB show that in NMF205 mice, there is greatly increased OHdG staining in the cytoplasm as compared to normal, C57BL/6J wild type tissue.

DETAILED DESCRIPTION OF THE INVENTION

[0037] The present invention relates to the discovery that inhibition of the DNA repair gene EXOl attenuates neurodegeneration and mitochondrial damage, nuclear damage, and oxidative stress. The present invention also relates to methods for diagnosis and treatment and/or prevention of a neurodegenerative diseases, mitochondrial disorders and diseases associated with oxidative stress by inhibition of EXOl.

[0038] The inventors have discovered, using genetic fate mapping that animals with reduced levels of EXOl expression or lacking the EXOl gene do not develop ataxia and neurodegeneration and retinal defects as compared to animals comprising the C57BL/6 gene encoding EXOl. In particular, by genetically breeding the mutant mouse termed NMF205 (which was generated by ENU mutagenesis, also known in the art as C57BL/6J-nmf205/J; and is available from The Jackson Laboratory with stock number 004823), which develop ataxia and have neuronal degeneration of cerebellar granule cells, retinal cells, hippocampal

neurons and dopaminergic neurons, into mice with different genetic backgrounds, the inventors discovered that NMF205 transgenic mice which carry a modifier region called M205 did not develop ataxia and also did not have degeneration of cerebellar granule cells, retinal cells, hippocampal neurons and dopaminergic neurons. The inventors further characterized the M205 modifier region and discovered this region contains the EXOl gene, and further discovered that the lack of the EXOl gene or reduced expression of the EXOl gene, and corresponding lack or reduced levels of EXOl mRNA and/or EXOl protein expression prevented the NMF205 mice from developing ataxia as well as prevented the neuronal degeneration of the cerebellar granule cells, retinal cells, hippocampal neurons and dopaminergic neurons. Accordingly, in one embodiment of the present invention, methods to prevent or treat a subject with a neurodegenerative disease or mitochondrial disorder are provided by inhibition of EXOl protein activity or inhibition of EXOl expression.

Definitions:

[0039] For convenience, certain terms employed in the entire application (including the specification, examples, and appended claims) are collected here. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs.

[0040] By "Exol" or "EXOl" is meant a polypeptide having an amino acid sequence at least about 60%, or at least about 70%, or at least about 80%, or at least about 90%, or at least about 95%, or at least about 96%, or at least about 97%, or at least about 98%, or at least about 99% identical to any of SEQ ID NOs: 1 to 3 or SEQ ID NO: 5.

[0041] The term "neurodegenerative disease" as used herein refers to a varied assortment of central nervous system disorders characterized by gradual and progressive loss of neural tissue and/or neural tissue function. A neurodegenerative disease is a class of neurological disorder or disease. In some cases, the neurological disease is characterized by a gradual and progressive loss of neural tissue, and/or altered neurological function (i.e. typically reduced neurological function) as a result of a gradual and progressive loss of neural tissue. The neurodegenerative diseases amenable to prevention and/or treatment using the methods as described herein are neurodegenerative diseases whereby there is DNA damage, for example, oxidative DNA damage.

[0042]

[0043] Examples of neurodegenerative diseases amenable to treatment by the methods and compositions as disclosed herein include for example, but are not limited to Alzheimer's Disease, Huntington's Disease, Parkinson's Disease, ataxia, Multiple sclerosis (Soon et al., 2007); De Vivo disease, also known as GLUTl deficiency syndrome, Neuromyelitis optica, (also known as Devic's disease); Stroke; lacunar stroke (Wardlaw et al., 2008); focal cerebral ischemia (Nagaraja et al., 2008); Epilepsy (Diler et al., 2007); Brain tumors; ALS (Nature Neuroscience); Creutzfeldt-Jakob disease (CJD) (Bartels et al.), AMD (age-related macular degeneration); Diabetic retinopathy and the like. Neurodegenerative diseases amenable to treatment by the methods and compositions as disclosed herein also include diseases where there is a pearmeable blood-brain barrier (BBB), or defective BBB. Such diseases are commonly known in the art and are disclosed herein.

[0044] The term "disease" or "disorder" is used interchangeably herein, and refers to any alteration in state of the body or of some of the organs, interrupting or disturbing the performance of the functions and/or causing symptoms such as discomfort, dysfunction, distress, or even death to the person afflicted or those in contact with a person. A disease or disorder can also relate to a distemper, ailing, ailment, malady, disorder, sickness, illness, complaint, indisposition or affectation.

[0045] The term "agent" refers to any entity which is normally not present or not present at the levels being administered in the cell. Agent can be selected from a group comprising: chemicals; small molecules; nucleic acid sequences; nucleic acid analogues; proteins; peptides; aptamers; antibodies; or fragments thereof. A nucleic acid sequence can be RNA or DNA, and can be single or double stranded, and can be selected from a group comprising; nucleic acid encoding a protein of interest, oligonucleotides, nucleic acid analogues, for example peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), locked nucleic acid (LNA) etc. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins, for example that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc. A protein and/or peptide or fragment thereof can be any protein of interest, for example, but are not limited to; mutated proteins; therapeutic proteins and truncated proteins, wherein the protein is normally absent or expressed at lower levels in the cell. Proteins can also be mutated proteins, genetically engineered proteins, peptides, synthetic peptides, recombinant

proteins, chimeric proteins, antibodies, midibodies, minibodies, triabodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof. Alternatively, the agent can be intracellular as a result of introduction of a nucleic acid sequence into the cell and its transcription resulting in the production of the nucleic acid and/or protein inhibitor of EXOl within the cell. In certain embodiments the agent is a small molecule having a chemical moiety. For example, chemical moieties included unsubstituted or substituted alkyl, aromatic, or heterocyclyl moieties including macrolides, leptomycins and related natural products or analogues thereof. Agents can be known to have a desired activity and/or property, or can be selected from a library of diverse compounds. [0046] By a "decrease" or "inhibition" used in the context of the level of expression or activity of a gene refers to a reduction in protein or nucleic acid level or activity in a cell, a cell extract, or a cell supernatant. For example, such a decrease may be due to reduced RNA stability, transcription, or translation, increased protein degradation, or RNA interference. For example, the term "inhibiting" as used herein means that the expression or activity of EXOl protein or variants or homologues thereof is reduced to an extent, and/or for a time, sufficient to produce the desired effect, which is discussed in more detail below. In some embodiments, inhibition of EXOl refers to a decrease in the expression and/or activity (such as exonuclease activity of EXOl) by about by at least about 5%, about at least 10%, about at least 20%, about at least 30%, about at least 40%, about at least 50%, about at least 60%, about at least 70%, about at least 80%, about at least 90%, about at least 95%, about at least 99%, about 100% as compared to the level of EXOl expression or activity under control conditions (i.e. in the absence of the inhibitor agent).

[0047] The reduction in activity can be due to affecting one or more characteristics of EXOl including direct inhibition such as decreasing its catalytic activity, such as for example, decreasing its nuclease or exonuclease activity, or alternatively by indirect inhibition, such as inhibition of a co-factor of EXO lor by binding to EXOl with a degree of avidity that is such that the outcome is that of treating or preventing a neurodegenerative disease or mitochondrial disorder. In particular, inhibition of EXOl can be determined using an assay for EXOl inhibition, for example by determining presence of protein or transcript expression of EXOl by immunoblot analysis or RT-PCR respectively.

[0048] As used herein, "gene silencing" in reference to an activity of an RNAi molecule, for example a siRNA or miRNA refers to a decrease in the mRNA level in a cell for a target gene

by at least about 5%, about at least 10%, about at least 20%, about at least 30%, about at least 40%, about at least 50%, about at least 60%, about at least 70%, about at least 80%, about at least 90%, about at least 95%, about at least 99%, about at least 100% of the mRNA level found in the cell without the presence of the RNAi molecule, for example siRNA or miRNA. In one preferred embodiment, the mRNA levels are decreased by at least about 70%, about at least 80%, about at least 90%, about at least 95%, about at least 99%, about at least 100% (i.e. absent EXOl mRNA expression). The level of gene silencing can be readily determined by one of ordinary skill in the art, for example by using quantitative RT-PCR and the like. [0049] As used herein, the term "RNAi" refers to any type of interfering RNA, including but not limited to, siRNAi, shRNAi, endogenous microRNA and artificial microRNA, shRNA, stRNA. For instance, it includes sequences previously identified as siRNA, regardless of the mechanism of down-stream processing of the RNA (i.e. although siRNAs are believed to have a specific method of in vivo processing resulting in the cleavage of mRNA, such sequences can be incorporated into the vectors in the context of the flanking sequences described herein). [0050] As used herein an "siRNA" refers to a nucleic acid that forms a double stranded RNA, which double stranded RNA has the ability to reduce or inhibit expression of a gene or target gene when the siRNA is present or expressed in the same cell as the target gene, for example EXOl. The double stranded RNA can be formed by the complementary strands. In one embodiment, a siRNA refers to a nucleic acid that can form a double stranded siRNA. The sequence of the siRNA can correspond to the full length target gene, or a subsequence thereof. Typically, the siRNA is at least about 15-50 nucleotides in length (e.g., each complementary sequence of the double stranded siRNA is about 15-50 nucleotides in length, and the double stranded siRNA is about 15-50 base pairs in length, preferably about 19-30 base nucleotides, preferably about 20-25 nucleotides in length, e.g., 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length).

[0051] As used herein "shRNA" or "small hairpin RNA" (also called stem loop) is a type of siRNA. In one embodiment, these shRNAs are composed of a short, e.g. about 19 to about 25 nucleotide, antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand can precede the nucleotide loop structure and the antisense strand can follow.

[0052] The terms "microRNA" or "miRNA" are used interchangeably herein and are endogenous RNAs, some of which are known to regulate the expression of protein-coding

genes at the posttranscriptional level. Endogenous microRNA are small RNAs naturally present in the genome, which are capable of modulating the productive utilization of mRNA. The term artificial microRNA includes any type of RNA sequence, other than endogenous microRNA, which is capable of modulating the productive utilization of mRNA. MicroRNA sequences have been described in publications such as Lim, et al., Genes & Development, 17, p. 991-1008 (2003), Lim et al Science 299, 1540 (2003), Lee and Ambros Science, 294, 862 (2001), Lau et al., Science 294, 858-861 (2001), Lagos-Quintana et al, Current Biology, 12, 735-739 (2002), Lagos Quintana et al, Science 294, 853-857 (2001), and Lagos-Quintana et al, RNA, 9, 175-179 (2003), which are incorporated herein by reference. Multiple microRNAs can also be incorporated into a precursor molecule. Furthermore, miRNA-like stem-loops can be expressed in cells as a vehicle to deliver artificial miRNAs and short interfering RNAs (siRNAs) for the purpose of modulating the expression of endogenous genes through the miRNA and or RNAi pathways.

[0053] As used herein, "double stranded RNA" or "dsRNA" refers to RNA molecules that are comprised of two strands. Double- stranded molecules include those comprised of a single RNA molecule that doubles back on itself to form a two-stranded structure. For example, the stem loop structure of the progenitor molecules from which the single-stranded miRNA is derived, called the pre-miRNA (B artel et al. 2004. Cell 116:281-297), comprises a dsRNA molecule.

[0054] The terms "subject", "patient" and "individual" are used interchangeably herein, and refer to an animal, particularly a human, to whom treatment including prophylaxis treatment is provided. The term "subject" as used herein refers to both human and non-human animals. The term "non-human animals" and "non-human mammals" are used interchangeably herein and includes all vertebrates, e.g., mammals, such as non-human primates particularly higher primates, companion animals and domestic animals, such as dogs, cats, horses, guinea pigs, sheep, rodent (e.g. mouse or rat), goat, pig, cat, rabbits, cows, and non-mammals such as chickens, amphibians, reptiles etc. In one embodiment, the subject is human. In another embodiment, the subject is an experimental animal or animal substitute as a disease model. [0055] The term "gene" used herein can be a genomic gene comprising transcriptional and/or translational regulatory sequences and/or a coding region and/or non-translated sequences (e.g., introns, 5'- and 3'- untranslated sequences and regulatory sequences). The coding region of a gene can be a nucleotide sequence coding for an amino acid sequence or a functional

RNA, such as tRNA, rRNA, catalytic RNA, siRNA, miRNA and antisense RNA. A gene can also be an mRNA or cDNA corresponding to the coding regions (e.g. exons and miRNA) optionally comprising 5'- or 3' untranslated sequences linked thereto. A gene can also be an amplified nucleic acid molecule produced in vitro comprising all or a part of the coding region and/or 5'- or 3'- untranslated sequences linked thereto.

[0056] The term "nucleic acid" or "oligonucleotide" or "polynucleotide" used herein can mean at least two nucleotides covalently linked together. As will be appreciated by those in the art, the depiction of a single strand also defines the sequence of the complementary strand. Thus, a nucleic acid also encompasses the complementary strand of a depicted single strand. As will also be appreciated by those in the art, many variants of a nucleic acid can be used for the same purpose as a given nucleic acid. Thus, a nucleic acid also encompasses substantially identical nucleic acids and complements thereof. As will also be appreciated by those in the art, a single strand provides a probe for a probe that can hybridize to the target sequence under stringent hybridization conditions. Thus, a nucleic acid also encompasses a probe that hybridizes under stringent hybridization conditions.

[0057] Nucleic acids can be single stranded or double stranded, or can contain portions of both double stranded and single stranded sequence. The nucleic acid can be DNA, both genomic and cDNA, RNA, or a hybrid, where the nucleic acid can contain combinations of deoxyribo- and ribo- nucleotides, and combinations of bases including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine and isoguanine. Nucleic acids can be obtained by chemical synthesis methods or by recombinant methods. [0058] A nucleic acid will generally contain phosphodiester bonds, although nucleic acid analogs can be included that can have at least one different linkage, e.g., phosphoramidate, phosphorothioate, phosphorodithioate, or O-methylphosphoroamidite linkages and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5, 235,033 and 5, 034,506, which are incorporated herein by reference. Nucleic acids containing one or more non-naturally occurring or modified nucleotides are also included within one definition of nucleic acids. The modified nucleotide analog can be located for example at the 5'-end and/or the 3'-end of the nucleic acid molecule. Representative examples of nucleotide analogs can be selected from sugar- or backbone-modified ribonucleotides. It should be noted, however, that also nucleobase- modified ribonucleotides,

i.e. ribonucleotides, containing a non naturally occurring nucleobase instead of a naturally occurring nucleobase such as uridines or cytidines modified at the 5-position, e.g. 5-(2- amino)propyl uridine, 5-bromo uridine; adenosines and guanosines modified at the 8-position, e.g. 8- bromo guanosine; deaza nucleotides, e. g. 7 deaza-adenosine; O- and N- alkylated nucleotides, e.g. N6-methyl adenosine are suitable. The 2' OH- group can be replaced by a group selected from H. OR, R. halo, SH, SR, NH ₂ , NHR, NR ₂ or CN, wherein R is C- C6 alkyl, alkenyl or alkynyl and halo is F. Cl, Br or I. Modifications of the ribose-phosphate backbone can be done for a variety of reasons, e.g., to increase the stability and half- life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and analogs can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs can be made. [0059] As used herein, "variant" with reference to a polynucleotide or polypeptide, refers to a polynucleotide or polypeptide that can vary in primary, secondary, or tertiary structure, as compared to a reference polynucleotide or polypeptide, respectively (e.g., as compared to a wild- type polynucleotide or polypeptide). A "variant" of an EXOl peptide is meant to refer to a molecule substantially similar in structure and function, i.e. ability to repair DNA to either the entire molecule, or to a fragment thereof. A molecule is said to be "substantially similar" to another molecule if both molecules have substantially similar structures or if both molecules possess a similar biological activity. Thus, provided that two molecules possess a similar activity, they are considered variants as that term is used herein even if the structure of one of the molecules not found in the other, or if the sequence of amino acid residues is not identical.

[0060] The terms "functional derivative" and "mimetic" are used interchangeably, and refer to a compound which possess a biological activity (either functional or structural) that is substantially similar to a biological activity of the entity or molecule is a functional derivative of. The term functional derivative is intended to include the fragments, variants, analogues or chemical derivatives of a molecule.

[0061] As used herein, "homologous", when used to describe a polynucleotide, indicates that two polynucleotides, or designated sequences thereof, when optimally aligned and compared, are identical, with appropriate nucleotide insertions or deletions, in at least 70% of the nucleotides, usually from about 75% to 99%, and preferably at least about 98 to 99% of the nucleotides. The term "homolog" or "homologous" as used herein also refers to homology

with respect to structure and/or function. With respect to sequence homology, sequences are homologs if they are at least 50%, at least 60% at least 70%, at least 80%, at least 90%, at least 95% identical, at least 97% identical, or at least 99% identical. The term "substantially homologous" refers to sequences that are at least 90%, at least 95% identical, at least 97% identical or at least 99% identical. Homologous sequences can be the same functional gene in different species.

[0062] As used herein, the term "substantial similarity" in the context of polypeptide sequences, indicates that the polypeptide comprises a sequence with at least 60% sequence identity to a reference sequence, or 70%, or 80%, or 85% sequence identity to the reference sequence, or preferably 90% identity over a comparison window of about 10-20 amino acid residues. In the context of amino acid sequences, "substantial similarity" further includes conservative substitutions of amino acids. Thus, a polypeptide is substantially similar to a second polypeptide, for example, where the two peptides differ by one or more conservative substitutions.

[0063] The term "substantial identity" means that two peptide sequences, when optimally aligned, such as by the programs GAP or BESTFIT, or BLAST (version 2.2.14) with default parameters for an alignment, share at least 65 percent sequence identity, preferably at least 80 or 90 percent sequence identity, more preferably at least 95 percent sequence identity or more (e.g., 99 percent sequence identity or higher). Preferably, residue positions which are not identical differ by conservative amino acid substitutions.

[0064] Determination of homologs of the genes or peptides of the present invention can be easily ascertained by the skilled artisan. The terms "homology" or "identity" or "similarity" are used interchangeably herein and refer to sequence similarity between two peptides or between two nucleic acid molecules. Homology and identity can each be determined by comparing a position in each sequence which can be aligned for purposes of comparison. When an equivalent position in the compared sequences is occupied by the same base or amino acid, then the molecules are identical at that position; when the equivalent site occupied by the same or a similar amino acid residue (e.g. , similar in steric and/or electronic nature), then the molecules can be referred to as homologous (similar) at that position. Expression as a percentage of homology/similarity or identity refers to a function of the number of identical or similar amino acids at positions shared by the compared sequences. A sequence which is

"unrelated" or "non-homologous" shares less than 40% identity, though preferably less than 25% identity with a sequence of the present application.

[0065] For sequence comparison, typically one sequence acts as a reference sequence, to which test sequences are compared. When using a sequence comparison algorithm, test and reference sequences are input into a computer, subsequence coordinates are designated, if necessary, and sequence algorithm program parameters are designated. The sequence comparison algorithm then calculates the percent sequence identity for the test sequence(s) relative to the reference sequence, based on the designated program parameters. [0066] Optimal alignment of sequences for comparison can be conducted, for example, by the local homology algorithm of Smith and Waterman (Adv. Appl. Math. 2:482 (1981), which is incorporated by reference herein), by the homology alignment algorithm of Needleman and Wunsch (J. MoI. Biol. 48:443-53 (1970), which is incorporated by reference herein), by the search for similarity method of Pearson and Lipman (Proc. Natl. Acad. Sci. USA 85:2444-48 (1988), which is incorporated by reference herein), by computerized implementations of these algorithms (e.g., GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, Wis.), or by visual inspection. (See generally Ausubel et al. (eds.), Current Protocols in Molecular Biology, 4th ed., John Wiley and Sons, New York (1999)).

[0067] One example of a useful algorithm is PILEUP. PILEUP creates a multiple sequence alignment from a group of related sequences using progressive, pairwise alignments to show the percent sequence identity. It also plots a tree or dendogram showing the clustering relationships used to create the alignment. PILEUP uses a simplification of the progressive alignment method of Feng and Doolittle (J. MoI. Evol. 25:351-60 (1987), which is incorporated by reference herein). The method used is similar to the method described by Higgins and Sharp (Comput. Appl. Biosci. 5:151-53 (1989), which is incorporated by reference herein). The program can align up to 300 sequences, each of a maximum length of 5,000 nucleotides or amino acids. The multiple alignment procedure begins with the pairwise alignment of the two most similar sequences, producing a cluster of two aligned sequences. This cluster is then aligned to the next most related sequence or cluster of aligned sequences. Two clusters of sequences are aligned by a simple extension of the pairwise alignment of two individual sequences. The final alignment is achieved by a series of progressive, pairwise alignments. The program is run by designating specific sequences and their amino acid or

nucleotide coordinates for regions of sequence comparison and by designating the program parameters. For example, a reference sequence can be compared to other test sequences to determine the percent sequence identity relationship using the following parameters: default gap weight (3.00), default gap length weight (0.10), and weighted end gaps. [0068] Another example of an algorithm that is suitable for determining percent sequence identity and sequence similarity is the BLAST algorithm, which is described by Altschul et al. (J. MoI. Biol. 215:403-410 (1990), which is incorporated by reference herein). (See also Zhang et al., Nucleic Acid Res. 26:3986-90 (1998); Altschul et al., Nucleic Acid Res. 25:3389-402 (1997), which are incorporated by reference herein). Software for performing BLAST analyses is publicly available through the National Center for Biotechnology Information internet web site. This algorithm involves first identifying high scoring sequence pairs (HSPs) by identifying short words of length W in the query sequence, which either match or satisfy some positive- valued threshold score T when aligned with a word of the same length in a database sequence. T is referred to as the neighborhood word score threshold (Altschul et al. (1990), supra). These initial neighborhood word hits act as seeds for initiating searches to find longer HSPs containing them. The word hits are then extended in both directions along each sequence for as far as the cumulative alignment score can be increased. Extension of the word hits in each direction is halted when: the cumulative alignment score falls off by the quantity X from its maximum achieved value; the cumulative score goes to zero or below, due to the accumulation of one or more negative-scoring residue alignments; or the end of either sequence is reached. The BLAST algorithm parameters W, T, and X determine the sensitivity and speed of the alignment. The BLAST program uses as defaults a word length (W) of 11, the BLOSUM62 scoring matrix (see Henikoff and Henikoff, Proc. Natl. Acad. Sci. USA 89:10915-9 (1992), which is incorporated by reference herein) alignments (B) of 50, expectation (E) of 10, M=5, N=-4, and a comparison of both strands. [0069] In addition to calculating percent sequence identity, the BLAST algorithm also performs a statistical analysis of the similarity between two sequences (see, e.g., Karlin and Altschul, Proc. Natl. Acad. Sci. USA 90:5873-77 (1993), which is incorporated by reference herein). One measure of similarity provided by the BLAST algorithm is the smallest sum probability (P(N)), which provides an indication of the probability by which a match between two nucleotide or amino acid sequences would occur by chance. For example, an amino acid sequence is considered similar to a reference amino acid sequence if the smallest sum

probability in a comparison of the test amino acid to the reference amino acid is less than about 0.1, more typically less than about 0.01, and most typically less than about 0.001. [0070] The term "fragment" of a peptide or molecule as used herein refers to any contiguous polypeptide subset of the molecule. Fragments of a EXOl protein, for example inhibitory fragments of SEQ ID NOs: 1-3 useful in the methods as disclosed herein inhibit the full- length EXOl protein by at least 30%. Stated another way, a fragment of EXOl protein that functions as an inhibitor of EXOl is a fragment of any of SEQ ID NOs: 1,2 or 3 which inhibits the full-length EXOl protein of SEQ ID NOs: 1,2 or 3 by at least 30%, or alternatively leads to a decrease in oxidative stress by at least 10%, which can be determined using the oxidative marker expression (8-oxD) or an increase in glutathione levels by at least 10% as disclosed herein. Fragments useful in the present invention include soluble fragments (i.e. not membrane bound), and in some embodiments, fragments can be bound to a first fusion partner, such as Fc etc. A "fragment" can be at least about 6, at least about 9, at least about 15, at least about 20, at least about 30, least about 40, at least about 50, at least about 100, at least about 250, at least about 500 nucleic or amino acids, and all integers in between. Exemplary fragments include C-terminal truncations, N-terminal truncations, or truncations of both C- and N-terminals (e.g., deletions of, for example, at least 1, at least 2, at least 3, at least 4, at least 5, at least 8, at least 10, at least 15, at least 20, at least 25, at least 40, at least 50, at least 75, at least 100 or more amino acids deleted from the N-termini, the C-termini, or both). One of ordinary skill in the art can create such fragments by simple deletion analysis. Such a fragment of SEQ ID NOs: 1 to 3 can be, for example, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 amino acids or more than 10 amino acids, such as 15, 30, 50, 100 or more than 100 amino acids deleted from the N- terminal and/or C-terminal of SEQ ID NOs: 1 to 3, respectively. Persons of ordinary skill in the art can easily identify the minimal peptide fragment of SEQ ID NOs: 1 to 3 useful in the methods as disclosed herein, by sequentially deleting N- and/or C-terminal amino acids from SEQ ID NOs: 1 to 3 and assessing the function of the resulting peptide fragment on decreasing oxidative stress. One can create inhibitory fragments with multiple smaller fragments. These can be attached by bridging peptide linkers. One can readily select linkers to maintain wild type conformation. One of ordinary skill in the art can easily assess the function of the inhibitory EXOl fragment to decrease oxidative stress when administered to a mouse in vivo (as disclosed in the Examples and Figs 9 and 10) as compared to in the absence of such inhibitory EXOl fragment.

[0071] As used herein, the term "treating" includes reducing or alleviating at least one adverse effect or symptom of a condition, disease or disorder associated with a neurodegenerative disease or mitochondrial disorder. As used herein, the term treating is used to refer to the reduction of a symptom and/or a biochemical marker of a neurodegenerative disease or mitochondrial disorder by at least 10%. Some non-limiting examples include a reduction in a biochemical marker of oxidative DNA damage, for example a reduction in the presence of oxidized bases such as 8-OHdG by at least 10% would be considered effective treatments by the methods as disclosed herein, or an increase in glutathione levels by at least 10% would be considered effective treatment by the methods as disclosed herein. As alternative examples, a reduction in a symptom, for example, a reduction in a symptom of a neurodegenerative disease would be considered an effective treatment by the methods as disclosed herein. As an illustrative example only, a slowing of the rate of memory loss by 10% or a cessation of the rate memory decline, or a reduction in memory loss by at least 10% or an improvement in memory by at least 10% would also be considered as effective treatments for the treatment of a neurodegenerative disease such as Alzheimer's disease by the methods as disclosed herein. Another example would be the imaging of the retina in the case of retinal degeneration. [0072] The term "effective amount" as used herein refers to the amount of a therapeutic agent or pharmaceutical composition necessary to reduce or inhibit at least one symptom of a neurodegenerative disease or mitochondrial disorder, for example a symptom or disorder of a mitochondrial disorder. For example, an effective amount using the methods as disclosed herein would be considered as the amount sufficient to reduce a symptom of the disease or disorder, for example a mitochondrial disorder by at least 10%. An effective amount as used herein would also include an amount sufficient to prevent or delay the development of a symptom of the disease, alter the course of a symptom disease (for example but not limited to, slow the progression of a symptom of the disease), or reverse a symptom of the disease. [0073] As used herein, the terms "administering," and "introducing" are used interchangeably and refer to the placement of the agents that inhibit EXOl as disclosed herein into a subject by a method or route which results in at least partial localization of the agents at a desired site. The compounds of the present invention can be administered by any appropriate route which results in an effective treatment in the subject.

[0074] The term "vector" used herein refers to a nucleic acid sequence containing an origin of replication. A vector can be a plasmid, bacteriophage, bacterial artificial chromosome or yeast

artificial chromosome. A vector can be a DNA or RNA vector. A vector can be either a self replicating extrachromosomal vector or a vector which integrate into a host genome. [0075] The term "vectors" is used interchangeably with "plasmid" to refer to a nucleic acid molecule capable of transporting another nucleic acid to which it has been linked. Vectors capable of directing the expression of genes and/or nucleic acid sequence to which they are operatively linked are referred to herein as "expression vectors". In general, expression vectors of utility in recombinant DNA techniques are often in the form of "plasmids" which refer to circular double stranded DNA loops which, in their vector form are not bound to the chromosome. Other expression vectors can be used in different embodiments of the invention, for example, but are not limited to, plasmids, episomes, bacteriophages or viral vectors, and such vectors can integrate into the host's genome or replicate autonomously in the particular cell. Other forms of expression vectors known by those skilled in the art which serve the equivalent functions can also be used. Expression vectors comprise expression vectors for stable or transient expression encoding the DNA.

[0076] The articles "a" and "an" are used herein to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article. By way of example, "an element" means one element or more than one element.

[0077] Other than in the operating examples, or where otherwise indicated, all numbers expressing quantities of ingredients or reaction conditions used herein should be understood as modified in all instances by the term "about." The term "about" when used in connection with percentages can mean +1%. The present invention is further explained in detail by the following examples, but the scope of the invention should not be limited thereto.

EXOl: General Information

[0078] EXOl is also referred to in the art as aliases Exol, HEXl or hExoI. EXOl is encoded by three different nucleic acid transcripts; EXOl transcript variant 1 is provided at, for example, GenBank Accession Nos. NM_006027 which corresponds to SEQ ID NO:1 herein. Human EXOl transcript variant 2 is provided at, for example, GenBank Accession Nos. NM_130398 or AF042282 which corresponds to SEQ ID NO:2 herein. Human EXOl transcript variant 3 is provided at, for example, GenBank Accession Nos. NM_003686 which corresponds to SEQ ID NO:3 herein. EXOl nucleic acid transcripts 1, 2, and 3 are disclosed in U.S. Patent Applications 20070054278, 20070037165, 20030165924, 200330104426,

20030165924 and U.S. Patents; 7,171,311 and 6,812,339 which are specifically incorporated herein in their entirety by reference.

[0079] EXOl is also known as HEXl in human (Wilson III et al., 1998). HEXl/hExol is expressed at low levels in many fetal and adult tissues, but at higher levels in fetal liver and adult bone marrow suggesting a role in hematopoiesis (Ladd et al., 2003). [0080] HEXl/hExol single nucleotide polymorphisms (SNPs) have been described. Gene polymorphisms of HEXl/hExol at T439M and P757L may be associated with colorectal cancer risk. The T439M polymorphisms are located in the MLHl interaction domain and P757L is located within the region required for interaction with MLHl. It is described that mutations in MLHl and MSH2 are associated with hereditary non-polyposis colorectal cancer (HNPCC) (Wu et al., 2001; Yamamoto et al., 2005).

[0081] Further it has been proposed that the Exol enzyme can be administered as a drug to treat or prevent for example, cancer, arteriosclerosis, osteoarthritis, bacterial or viral infections and others, where Exol removes senescent cells, as disclosed in International Patent Application: WO2006/018632 (incorporated herein in its entirety by reference). [0082] As shown in the Examples, the inventors have discovered that animals prone to disorders characterized by ataxia have been found to exhibit reduced signs of ataxia when EXOl protein or transcript is reduced or absent. Animals that lack the EXOl gene showed (i) decreased oxidized DNA in neurons (i.e. reduced 8-OHdG staining in cerebella granule neurons), (ii) decreased loss of granular cerebella neurons, (iii) decreased loss of retinal cells (outer layer neurons) as compared to animals that carry the EXOl gene. Therefore, lack of EXOl and/or inhibition of EXOl can be used to treat and/or prevent diseases and disorders with oxidative DNA damage, for example but not limited to neurodegenerative diseases and/or mitochondrial disorders.

Agents that inhibit EXOl

[0083] In some embodiments, the present invention relates to the inhibition of EXOl. In some embodiments, inhibition of EXOl is achieved by inhibition of nucleic acid transcripts encoding EXOl, for example inhibition of messenger RNA (mRNA). In alternative embodiments, inhibition of EXOl is achieved by inhibition of the expression and/or inhibition of activity of the gene product of EXOl, for example the polypeptide or protein of EXOl, or isoforms thereof. As used herein, the term "gene product" refers to RNA transcribed from a

gene or a polypeptide encoded by a gene or translated from RNA. A gene product can also be a fragment of RNA or polypeptide encoded by the EXOl gene.

[0084] In some embodiments, inhibition of EXOl is by an agent. One can use any agent, such as the following non-limiting examples: nucleic acids, nucleic acid analogues, peptides, phage, phagemids, polypeptides, peptidomimetics, ribosomes, aptamers, antibodies, small or large organic or inorganic molecules, or any combination thereof. In some embodiments, agents useful in methods of the present invention include agents that function as inhibitors of EXOl expression, for example inhibitors of mRNA encoding EXOl.

[0085] Agents useful in the methods as disclosed herein can also inhibit gene expression (i.e. suppress and/or repress the expression of the gene). Such agents are referred to in the art as "gene silencers" and are commonly known to those of ordinary skill in the art. Examples include, but are not limited to a nucleic acid sequence, for an RNA, DNA or nucleic acid analogue, and can be single or double stranded, and can be selected from a group comprising nucleic acid encoding a protein of interest, oligonucleotides, nucleic acids, nucleic acid analogues, for example but are not limited to peptide nucleic acid (PNA), pseudo- complementary PNA (pc-PNA), locked nucleic acids (LNA) and derivatives thereof etc. Nucleic acid agents also include, for example, but are not limited to nucleic acid sequences encoding proteins that act as transcriptional repressors, endogenous inhibitors of EXOl, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, which include for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (miRNA), antisense oligonucleotides, etc.

[0086] As used herein, agents useful in the method as disclosed herein for use as inhibitors of EXOl expression and/or inhibition of EXOl protein function can be any type of entity, which include for example but not limited to; chemicals, nucleic acid sequences, nucleic acid analogues, proteins, antibodies, peptides (such as inhibitory peptides) or fragments thereof. In some embodiments, the agent is any chemical, entity or moiety, including without limitation, synthetic and naturally-occurring non-proteinaceous entities. In some embodiments, an agent useful in the methods and compositions as disclosed herein inhibits the phosphorylation of EXOl. In alternative embodiments, an inhibitor of EXOl useful in the methods and compositions as disclosed herein can promote (i.e. increase) the phosphorylation of EXOl. In certain embodiments the agent is a small molecule having a chemical moiety. In some

embodiments, an inhibitor of EXOl inhibits the nuclease activity of EXOl, such as a chemical entity which inhibits the nuclease activity of EXOl.

[0087] In alternative embodiments, agents useful in the methods as disclosed herein are proteins and/or peptides or fragment thereof, which inhibit the gene expression of EXOl or the function of the EXOl protein. Such agents include, for example but are not limited to protein variants, mutated proteins, therapeutic proteins, truncated proteins and protein fragments. Protein agents can also be selected from a group comprising mutated proteins, genetically engineered proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins, antibodies, midibodies, minibodies, triabodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof. In some embodiments, the antibodies useful in the methods and compositions as disclosed herein are inhibitory antibodies. In one embodiment, the inhibitory antibody useful in the methods and compositions as disclosed herein is the polyEXOlA and polyEXOlB rabbit polyclonal antibody. In alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein is generated using the peptide of SEQ ID NO: 4; the peptide used generate the polyEXOlB rabbit polyclonal antibody disclosed herein. In alternative embodiments, the inhibitory antibody useful in the methods and compositions as disclosed herein is generated using the peptide which corresponds to the region on the EXOl gene which is important for the nuclease activity of EXOl. For example, the amino acid residues D78, E109, D173, L410 and D225 are essential for nuclease activity. Mutageneses of any, or at least one of amino acid residues D78, E109, D 173, L410 and D225 abrogates nuclease activity, (see Lee et al 2002 and Lee et al 1999 which describes the RAD2 nuclease domain, which is incorporated herein by reference). In some embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein can block at least one any of the following amino acids; D78, El 09, D173, L410 and D225 or alternatively, at least 3 amino acids within the region of amino acid 78 to 410, or in alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein can block the whole region from amino acid 78 to 410. In alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein can block at least 3 amino acid residues within the N-terminal domain of EXOl, which is from amino acid 1-99. In alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein can block at least 3 amino acid residues within the DNA Binding domains which is

amino acid residues 120 -to 387 for MSH3 (SEQ ID NO: 3), 600 to 846 for MSH2 (SEQ ID NO: 2), 787 to 846 for MLHl (SEQ ID NO: 1). In alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein can block at least one of the phosphorylation sites, for example an inhibitory antibody can block at least one or both of serine residues 398 and 714. In some embodiments, agents which inhibit EXOl are known antibodies which bind to EXOl, for example but not limited to the following antibodies; Monoclonal antibody to full-length EXOl (Ab-4, clone 266) from NeoMarkers (Fremont, CA, USA); an antibody to phosphorylated S714 in hEXOl which was raised using the peptide CNIKLLDpSQSDQT (SEQ ID NO: 6), where pS represents phospho-Serine (Eurogentec, Seraing, Belgium) (See El-Shemerly et al 2008, which is incorporated herein in its entirety by reference). Alternatively, a polyclonal antibody F- 15 (against specific for the splice variant Exolb) (El-Shemerly et al., 2005 which is incorporated herein in its entirety by reference) is also useful as an inhibitor agent of EXOl for use in the methods and compositions as disclosed herein.

[0088] In some embodiments, the agent can be a binding protein of EXOl. In some embodiments, one such binding protein of EXOl is for example a non-immunoglobulin antigen -binding scaffold of EXOl. In such embodiments such a scaffold is selected from the group consisting of: an antibody substructure, minibody, adnectin, anticalin, affibody, affilin, avibody, knottin, glubody, C-type lectin-like domain protein, designed ankyrin-repeate proteins (DARPin), domain antibodies, maxybodies, versabodies, fynomer, phylomer, SMIP, tetranectin, kunitz domain protein, thioredoxin, cytochrome b562, zinc finger scaffold, Staphylococcal nuclease scaffold, fibronectin or fibronectin dimer, tenascin, N-cadherin, E- cadherin, ICAM, titin, GCSF-receptor, cytokine receptor, glycosidase inhibitor, antibiotic chromoprotein, myelin membrane adhesion molecule PO, CD8, CD4, CD2, class I MHC, T- cell antigen receptor, CDl, C2 and I- set domains of VC AM- 1,1 -set immunoglobulin domain of myosin-binding protein C, 1-set immunoglobulin domain of myosin-binding protein H, I- set immunoglobulin domain of telokin, NCAM, twitchin, neuroglian, growth hormone receptor, erythropoietin receptor, prolactin receptor, interferon-gamma receptor, β- galactosidase/glucuronidase, β-glucuronidase, transglutaminase, T-cell antigen receptor, superoxide dismutase, tissue factor domain, cytochrome F, green fluorescent protein, GroEL, and thaumatin). The non-immunoglobulin antigen-binding scaffolds can be used in a similar

way as antibodies (for example see Zahnd et al. J. Biol. Chem. 2006, Vol. 281, Issue 46,

35167-35175).

Nucleic acid inhibitors of EXOl

[0089] In some embodiments, agents that inhibit EXOl are nucleic acids. Nucleic acid inhibitors of EXOl are, for example, but not are limited to, RNA interference-inducing molecules, for example but are not limited to siRNA, dsRNA, stRNA, shRNA and modified versions thereof, where the RNA interference (RNAi) molecule silences the gene expression of EXOl. In some embodiments, the nucleic acid inhibitor can silence an activator of EXOl and/or a co-factor of EXOl. In some embodiments, the nucleic acid inhibitor of EXOl is an anti-sense oligonucleic acid, or a nucleic acid analogue, for example but are not limited to DNA, RNA, peptide-nucleic acid (PNA), pseudo-complementary PNA (pc-PNA), or locked nucleic acid (LNA) and the like. In alternative embodiments, the nucleic acid is DNA or RNA, and nucleic acid analogues, for example PNA, pcPNA and LNA. A nucleic acid can be single or double stranded, and can be selected from a group comprising nucleic acid encoding a protein of interest, oligonucleotides, PNA, etc. Such nucleic acid sequences include, for example, but are not limited to, nucleic acid sequence encoding proteins that act as transcriptional repressors, antisense molecules, ribozymes, small inhibitory nucleic acid sequences, for example but are not limited to RNAi, shRNAi, siRNA, micro RNAi (mRNAi), antisense oligonucleotides etc.

[0090] In some embodiments single-stranded RNA (ssRNA), a form of RNA endogenously found in eukaryotic cells can be used as an RNAi molecule. Cellular ssRNA molecules include messenger RNAs (and the progenitor pre-messenger RNAs), small nuclear RNAs, small nucleolar RNAs, transfer RNAs and ribosomal RNAs. Double- stranded RNA (dsRNA) induces a size-dependent immune response such that dsRNA larger than 30bp activates the interferon response, while shorter dsRNAs feed into the cell's endogenous RNA interference machinery downstream of the Dicer enzyme.

[0091] In some embodiments, EXOl can be reduced by inhibition of the expression of EXOl polypeptide or by "gene silencing" methods commonly known by persons of ordinary skill in the art.

[0092] RNA interference (RNAi) provides a powerful approach for inhibiting the expression of selected target polypeptides. RNAi uses small interfering RNA (siRNA) duplexes that

target the messenger RNA encoding the target polypeptide for selective degradation. siRNA- dependent post-transcriptional silencing of gene expression involves cutting the target messenger RNA molecule at a site guided by the siRNA.

[0093] RNA interference (RNAi) is an evolutionally conserved process whereby the expression or introduction of RNA of a sequence that is identical or highly similar to a target gene results in the sequence specific degradation or specific post-transcriptional gene silencing (PTGS) of messenger RNA (mRNA) transcribed from that targeted gene (see Coburn, G. and Cullen, B. (2002) /. of Virology 76(18):9225), thereby inhibiting expression of the target gene. In one embodiment, the RNA is double stranded RNA (dsRNA). This process has been described in plants, invertebrates, and mammalian cells. In nature, RNAi is initiated by the dsRN A- specific endonuclease Dicer, which promotes processive cleavage of long dsRNA into double- stranded fragments termed siRNAs. siRNAs are incorporated into a protein complex (termed "RNA induced silencing complex," or "RISC") that recognizes and cleaves target mRNAs. RNAi can also be initiated by introducing nucleic acid molecules, e.g., synthetic siRNAs or RNA interfering agents, to inhibit or silence the expression of target genes. As used herein, "inhibition of target gene expression" includes any decrease in expression or protein activity or level of the target gene or protein encoded by the target gene as compared to a situation wherein no RNA interference has been induced. The decrease can be of at least 30%, 40%, 50%, 60%, 70%, 80%, 90%, 95% or 99% or more as compared to the expression of a target gene or the activity or level of the protein encoded by a target gene which has not been targeted by an RNA interfering agent.

[0094] The term "Short interfering RNA" (siRNA), also referred to herein as "small interfering RNA" is defined as an agent which functions to inhibit expression of a target gene, e.g., by RNAi. An siRNA can be chemically synthesized, can be produced by in vitro transcription, or can be produced within a host cell. In one embodiment, siRNA is a double stranded RNA (dsRNA) molecule of about 15 to about 40 nucleotides in length, preferably about 15 to about 28 nucleotides, more preferably about 19 to about 25 nucleotides in length, and more preferably about 19, 20, 21, 22, or 23 nucleotides in length, and can contain a 3' and/or 5' overhang on each strand having a length of about 0, 1, 2, 3, 4, or 5 nucleotides. The length of the overhang is independent between the two strands, i.e., the length of the overhang on one strand is not dependent on the length of the overhang on the second strand. Preferably

the siRNA is capable of promoting RNA interference through degradation or specific post- transcriptional gene silencing (PTGS) of the target messenger RNA (mRNA). [0095] siRNAs also include small hairpin (also called stem loop) RNAs (shRNAs). In one embodiment, these shRNAs are composed of a short (e.g., about 19 to about 25 nucleotide) antisense strand, followed by a nucleotide loop of about 5 to about 9 nucleotides, and the analogous sense strand. Alternatively, the sense strand can precede the nucleotide loop structure and the antisense strand can follow. These shRNAs can be contained in plasmids, retroviruses, and lentiviruses and expressed from, for example, the pol III U6 promoter, or another promoter (see, e.g., Stewart, et al. (2003) RNA Apr;9(4):493-501, incorporated by reference herein in its entirety).

[0096] The target gene or sequence of the RNA interfering agent can be a cellular gene or genomic sequence, e.g. the EXOl sequence. An siRNA can be substantially homologous to the target gene or genomic sequence, or a fragment thereof. As used in this context, the term "homologous" is defined as being substantially identical, sufficiently complementary, or similar to the target mRNA, or a fragment thereof, to effect RNA interference of the target. In addition to native RNA molecules, RNA suitable for inhibiting or interfering with the expression of a target sequence include RNA derivatives and analogs. Preferably, the siRNA is identical to its target.

[0097] The siRNA preferably targets only one sequence. Each of the RNA interfering agents, such as siRNAs, can be screened for potential off-target effects by, for example, expression profiling. Such methods are known to one skilled in the art and are described, for example, in Jackson et al, Nature Biotechnology 6:635-637, 2003. In addition to expression profiling, one can also screen the potential target sequences for similar sequences in the sequence databases to identify potential sequences which can have off-target effects. For example, according to Jackson et al. (Id.) 15, or perhaps as few as 11 contiguous nucleotides of sequence identity are sufficient to direct silencing of non-targeted transcripts. Therefore, one can initially screen the proposed siRNAs to avoid potential off-target silencing using the sequence identity analysis by any known sequence comparison methods, such as BLAST. [0098] siRNA molecules need not be limited to those molecules containing only RNA, but, for example, further encompasses chemically modified nucleotides and non-nucleotides, and also include molecules wherein a ribose sugar molecule is substituted for another sugar molecule or a molecule which performs a similar function. Moreover, a non-natural linkage

between nucleotide residues can be used, such as a phosphorothioate linkage. For example, siRNA containing D-arabinofuranosyl structures in place of the naturally-occurring D- ribonucleosides found in RNA can be used in RNAi molecules according to the present invention (U.S. Pat. No. 5,177,196). Other examples include RNA molecules containing the o-linkage between the sugar and the heterocyclic base of the nucleoside, which confers nuclease resistance and tight complementary strand binding to the oligonucleotidesmolecules similar to the oligonucleotides containing 2'-O-methyl ribose, arabinose and particularly D- arabinose (U.S. Pat. No. 5,177,196, which is incorporated herein in its entirety by reference) . [0099] The RNA strand can be derivatized with a reactive functional group of a reporter group, such as a fluorophore. Particularly useful derivatives are modified at a terminus or termini of an RNA strand, typically the 3' terminus of the sense strand. For example, the T- hydroxyl at the 3' terminus can be readily and selectively derivatized with a variety of groups. [00100] Other useful RNA derivatives incorporate nucleotides having modified carbohydrate moieties, such as 2'O-alkylated residues or 2'-O-methyl ribosyl derivatives and 2'-O-fluoro ribosyl derivatives. The RNA bases can also be modified. Any modified base useful for inhibiting or interfering with the expression of a target sequence can be used. For example, halogenated bases, such as 5-bromouracil and 5-iodouracil can be incorporated. The bases can also be alkylated, for example, 7-methylguanosine can be incorporated in place of a guanosine residue. Non-natural bases that yield successful inhibition can also be incorporated. [00101] Another siRNA modification includes 2'-deoxy-2'-fluorouridine or locked nucleic acid (LNA) nucleotides and RNA duplexes containing either phosphodiester or varying numbers of phosphorothioate linkages. Such modifications are known to one skilled in the art and are described, for example, in Braasch et al., Biochemistry, 42: 7967-7975, 2003. Most of the useful modifications to the siRNA molecules can be introduced using chemistries established for antisense oligonucleotide technology. Preferably, the modifications involve minimal 2'-O-methyl modification, preferably excluding such modification. Modifications also preferably exclude modifications of the free 5'-hydroxyl groups of the siRNA. [00102] siRNA and miRNA molecules having various "tails" covalently attached to either their 3'- or to their 5'-ends, or to both, are also known in the art and can be used to stabilize the siRNA and miRNA molecules delivered using the methods of the present invention. Generally speaking, intercalating groups, various kinds of reporter groups and lipophilic groups attached to the 3' or 5' ends of the RNA molecules are well known to one skilled in the art and are

useful according to the methods of the present invention. Descriptions of syntheses of 3'- cholesterol or 3'-acridine modified oligonucleotides applicable to preparation of modified RNA molecules useful according to the present invention can be found, for example, in the articles: Gamper, H. B., Reed, M. W., Cox, T., Virosco, J. S., Adams, A. D., Gall, A., Scholler, J. K., and Meyer, R. B. (1993) Facile Preparation and Exonuclease Stability of 3'- Modified Oligodeoxynucleotides. Nucleic Acids Res. 21 145-150; and Reed, M. W., Adams, A. D., Nelson, J. S., and Meyer, R. B. Jr. (1991) Acridine and Cholesterol-Derivatized Solid Supports for Improved Synthesis of 3'-Modified Oligonucleotides. Bioconjugate Chem. 2 217-225 (1993).

[00103] Other siRNAs useful for targeting EXOl expression can be readily designed and tested. Accordingly, siRNAs useful for the methods described herein include siRNA molecules of about 15 to about 40 or about 15 to about 28 nucleotides in length, which are homologous to an EXOl gene. Preferably, the EXOl targeting siRNA molecules have a length of about 19 to about 25 nucleotides. In some embodiments, the EXOl targeting siRNA molecules have a length of about 19, 20, 21, or 22 nucleotides. The EXOl targeting siRNA molecules can also comprise a 3' hydroxyl group. The EXOl targeting siRNA molecules can be single-stranded or double stranded; such molecules can be blunt ended or comprise overhanging ends (e.g., 5', 3'). In specific embodiments, the RNA molecule is double stranded and either blunt ended or comprises overhanging ends.

[00104] In one embodiment, at least one strand of the EXOl targeting RNA molecule has a 3' overhang from about 0 to about 6 nucleotides (e.g., pyrimidine nucleotides, purine nucleotides) in length. In other embodiments, the 3' overhang is from about 1 to about 5 nucleotides, from about 1 to about 3 nucleotides and from about 2 to about 4 nucleotides in length. In one embodiment the EXOl targeting RNAi molecule is double stranded - one strand has a 3' overhang and the other strand can be blunt-ended or have an overhang. In the embodiment in which the EXOl targeting RNAi molecule is double stranded and both strands comprise an overhang, the length of the overhangs can be the same or different for each strand. In a particular embodiment, the RNAi agent useful in the methods of the present invention comprises about 19, 20, 21, or 22 nucleotides which are paired and which have overhangs of from about 1 to about 3, particularly about 2, nucleotides on both 3' ends of the RNAi molecule. In one embodiment, the 3' overhangs can be stabilized against degradation. In a preferred embodiment, the RNAi molecule is stabilized by including purine nucleotides,

such as adenosine or guanosine nucleotides. Alternatively, substitution of pyrimidine nucleotides by modified analogues, e.g., substitution of uridine 2 nucleotide 3' overhangs by 2'-deoxythymidine is tolerated and does not affect the efficiency of RNAi. The absence of a 2' hydroxyl significantly enhances the nuclease resistance of the overhang in tissue culture medium.

[00105] EXOl mRNA can be successfully targeted using siRNAs and such siRNA or vectors for preparing them are commercially available, for example from Invitrogen and Sigma- Aldrich, and Origene. In some embodiments, assessment of the expression and/or knock down of EXOl protein using such EXOl siRNAs can be determined by methods commonly known by one of ordinary skill in the art, such as Western blot analysis, immuno staining, RT-PCR, quantitative or real-time RT-PCR, Northern blot analysis, microarrays, Luminex expression platform, microfluid expression platforms (e.g. Fluidigm) and using commercially available kits, for example but are not limited to commercially available EXOl Elisa kits from Abeam. Others can be readily prepared by those of skill in the art based on the known sequence of the target mRNA. To avoid doubt, the sequence of a human EXOl transcript variant 1 is provided at, for example, GenBank Accession Nos. NM_006027 which corresponds to SEQ ID NO:1 herein. Human EXOl transcript variant 2 is provided at, for example, GenBank Accession Nos. NM_130398 or AF042282 which corresponds to SEQ ID NO:2 herein. Human EXOl transcript variant 3 is provided at, for example, GenBank Accession Nos. NM_003686 which corresponds to SEQ ID NO:3 herein. The sequence at NM_006027 (human transcript 1) is the following (SEQ ID NO:1):

CCGTGTTCTGCGTTGCCGGCCGTGGGTGCTCTGGCCACAGTGAGTTAGGGGCGTCGG AGCGGG TTTCTCCAACCGCAATCGGCTCCGCTCAAGGGGAGGAGGAGAGTCCCTTCTCGGAAGGCC TAA GGAAACGTGTCGTCTGGAATGGGCTTGGGGGCCACGCCTGCACATCTCCGCGAGACAGAG GGA TAAAGTGAAGATGGTGCTGTTATTGTTACCTCGAGTGCCACATGCGACCTCTGAGATATG TAC ACAGTCATTCTTACTATCGCACTCAGCCATTCTTACTACGCTAAAGAAGAAATAATTATT CGA GGATATTTGCCTGGCCCAGAAGAAACTTATGTAAATTTCATGAACTATTATATCCGTTTT CCT CGGAGTGAGAGAAAACTCTTTTTAGATATCATCTGAGAGGTAGTTAATTTGGCACCATGG GGA TACAGGGATTGCTACAATTTATCAAAGAAGCTTCAGAACCCATCCATGTGAGGAAGTATA AAG GGCAGGTAGTAGCTGTGGATACATATTGCTGGCTTCACAAAGGAGCTATTGCTTGTGCTG AAA AACTAGCCAAAGGTGAACCTACTGATAGGTATGTAGGATTTTGTATGAAATTTGTAAATA TGT TACTATCTCATGGGATCAAGCCTATTCTCGTATTTGATGGATGTACTTTACCTTCTAAAA AGG AAGTAGAGAGATCTAGAAGAGAAAGACGACAAGCCAATCTTCTTAAGGGAAAGCAACTTC TTC GTGAGGGGAAAGTCTCGGAAGCTCGAGAGTGTTTCACCCGGTCTATCAATATCACACATG CCA TGGCCCACAAAGTAATTAAAGCTGCCCGGTCTCAGGGGGTAGATTGCCTCGTGGCTCCCT ATG AAGCTGATGCGCAGTTGGCCTATCTTAACAAAGCGGGAATTGTGCAAGCCATAATTACAG AGG ACTCGGATCTCCTAGCTTTTGGCTGTAAAAAGGTAATTTTAAAGATGGACCAGTTTGGAA ATG

GACTTGAAATTGATCAAGCTCGGCTAGGAATGTGCAGACAGCTTGGGGATGTATTCA CGGAAG

AGAAGTTTCGTTACATGTGTATTCTTTCAGGTTGTGACTACCTGTCATCACTGCGTG GGATTG

GATTAGCAAAGGCATGCAAAGTCCTAAGACTAGCCAATAATCCAGATATAGTAAAGG TTATCA

AGAAAATTGGACATTATCTCAAGATGAATATCACGGTACCAGAGGATTACATCAACG GGTTTA

TTCGGGCCAACAATACCTTCCTCTATCAGCTAGTTTTTGATCCCATCAAAAGGAAAC TTATTC

CTCTGAACGCCTATGAAGATGATGTTGATCCTGAAACACTAAGCTACGCTGGGCAAT ATGTTG

ATGATTCCATAGCTCTTCAAATAGCACTTGGAAATAAAGATATAAATACTTTTGAAC AGATCG

ATGACTACAATCCAGACACTGCTATGCCTGCCCATTCAAGAAGTCATAGTTGGGATG ACAAAA

CATGTCAAAAGTCAGCTAATGTTAGCAGCATTTGGCATAGGAATTACTCTCCCAGAC CAGAGT

CGGGTACTGTTTCAGATGCCCCACAATTGAAGGAAAATCCAAGTACTGTGGGAGTGG AACGAG

TGATTAGTACTAAAGGGTTAAATCTCCCAAGGAAATCATCCATTGTGAAAAGACCAA GAAGTG

CAGAGCTGTCAGAAGATGACCTGTTGAGTCAGTATTCTCTTTCATTTACGAAGAAGA CCAAGA

AAAATAGCTCTGAAGGCAATAAATCATTGAGCTTTTCTGAAGTGTTTGTGCCTGACC TGGTAA

ATGGACCTACTAACAAAAAGAGTGTAAGCACTCCACCTAGGACGAGAAATAAATTTG CAACAT

TTTTACAAAGGAAAAATGAAGAAAGTGGTGCAGTTGTGGTTCCAGGGACCAGAAGCA GGTTTT

TTTGCAGTTCAGATTCTACTGACTGTGTATCAAACAAAGTGAGCATCCAGCCTCTGG ATGAAA

CTGCTGTCACAGATAAAGAGAACAATCTGCATGAATCAGAGTATGGAGACCAAGAAG GCAAGA

GACTGGTTGACACAGATGTAGCACGTAATTCAAGTGATGACATTCCGAATAATCATA TTCCAG

GTGATCATATTCCAGACAAGGCAACAGTGTTTACAGATGAAGAGTCCTACTCTTTTG AGAGCA

GCAAATTTACAAGGACCATTTCACCACCCACTTTGGGAACACTAAGAAGTTGTTTTA GTTGGT

CTGGAGGTCTTGGAGATTTTTCAAGAACGCCGAGCCCCTCTCCAAGCACAGCATTGC AGCAGT

TCCGAAGAAAGAGCGATTCCCCCACCTCTTTGCCTGAGAATAATATGTCTGATGTGT CGCAGT

TAAAGAGCGAGGAGTCCAGTGACGATGAGTCTCATCCCTTACGAGAAGGGGCATGTT CTTCAC

AGTCCCAGGAAAGTGGAGAATTCTCACTGCAGAGTTCAAATGCATCAAAGCTTTCTC AGTGCT

CTAGTAAGGACTCTGATTCAGAGGAATCTGATTGCAATATTAAGTTACTTGACAGTC AAAGTG

ACCAGACCTCCAAGCTATGTTTATCTCATTTCTCAAAAAAAGACACACCTCTAAGGA ACAAGG

TTCCTGGGCTATATAAGTCCAGTTCTGCAGACTCTCTTTCTACAACCAAGATCAAAC CTCTAG

GACCTGCCAGAGCCAGTGGGCTGAGCAAGAAGCCGGCAAGCATCCAGAAGAGAAAGC ATCATA

ATGCCGAGAACAAGCCGGGGTTACAGATCAAACTCAATGAGCTCTGGAAAAACTTTG GATTTA

AAAAAGATTCTGAAAAGCTTCCTCCTTGTAAGAAACCCCTGTCCCCAGTCAGAGATA ACATCC

AACTAACTCCAGAAGCGGAAGAGGATATATTTAACAAACCTGAATGTGGCCGTGTTC AAAGAG

CAATATTCCAGTAAATGCAGACTGCTGCAAAGCTTTTGCCTGCAAGAGAATCTGATC AATTTG

AAGTCCCTGTTTGGGAATGAGGCACTTATCAGCATGAAGAATTTTTTCTCATTCTGT GCCATT

TTAAAAATAGAATACATTTTGTATATTAACTTTAAAAAAAAAAAAAAAAAAA

[00106] The sequence of human EXOl transcript variant 2 (GenBank Accession Nos.

NM_130398 or AF042282) which corresponds to SEQ ID NO:2 is as follows:

CCCGTGTTCTGCGTTGCCGGCCGTGGGTGCTCTGGCCACAGTGAGTTAGGGGCGTCG GAGCGG GTTTCTCCAACCGCAATCGGCTCCGCTCAAGGGGAGGAGGAGAGTCCCTTCTCGGAAGGC CTA AGGAAACGTGTCGTCTGGAATGGGCTTGGGGGCCACGCCTGCACATCTCCGCGAGACAGA GGG ATAAAGTGAAGATGGTGCTGTTATTGTTACCTCGAGTGCCACATGCGACCTCTGAGATAT GTA CACAGTCATTCTTACTATCGCACTCAGCCATTCTTACTACGCTAAAGAAGAAATAATTAT TCG AGGATATTTGCCTGGCCCAGAAGAAACTTATGTAAATTTCATGAACTATTATATCCGTTT TCC TCGGAGTGAGAGAAAACTCTTTTTAGATATCATCTGAGAGAACTAGTGAATCCCAGTCAC TGA GTGGAGTTGAGAGTCTAAGAACCTCTGAAATTTGAGAACTGCTGGACCAGAGCCTTTAGA GCT CTGATAAGGTGTCAACAGGGTAGTTAATTTGGCACCATGGGGATACAGGGATTGCTACAA TTT ATCAAAGAAGCTTCAGAACCCATCCATGTGAGGAAGTATAAAGGGCAGGTAGTAGCTGTG GAT ACATATTGCTGGCTTCACAAAGGAGCTATTGCTTGTGCTGAAAAACTAGCCAAAGGTGAA CCT

ACTGATAGGTATGTAGGATTTTGTATGAAATTTGTAAATATGTTACTATCTCATGGG ATCAAG

CCTATTCTCGTATTTGATGGATGTACTTTACCTTCTAAAAAGGAAGTAGAGAGATCT AGAAGA

GAAAGACGACAAGCCAATCTTCTTAAGGGAAAGCAACTTCTTCGTGAGGGGAAAGTC TCGGAA

GCTCGAGAGTGTTTCACCCGGTCTATCAATATCACACATGCCATGGCCCACAAAGTA ATTAAA

GCTGCCCGGTCTCAGGGGGTAGATTGCCTCGTGGCTCCCTATGAAGCTGATGCGCAG TTGGCC

TATCTTAACAAAGCGGGAATTGTGCAAGCCATAATTACAGAGGACTCGGATCTCCTA GCTTTT

GGCTGTAAAAAGGTAATTTTAAAGATGGACCAGTTTGGAAATGGACTTGAAATTGAT CAAGCT

CGGCTAGGAATGTGCAGACAGCTTGGGGATGTATTCACGGAAGAGAAGTTTCGTTAC ATGTGT

ATTCTTTCAGGTTGTGACTACCTGTCATCACTGCGTGGGATTGGATTAGCAAAGGCA TGCAAA

GTCCTAAGACTAGCCAATAATCCAGATATAGTAAAGGTTATCAAGAAAATTGGACAT TATCTC

AAGATGAATATCACGGTACCAGAGGATTACATCAACGGGTTTATTCGGGCCAACAAT ACCTTC

CTCTATCAGCTAGTTTTTGATCCCATCAAAAGGAAACTTATTCCTCTGAACGCCTAT GAAGAT

GATGTTGATCCTGAAACACTAAGCTACGCTGGGCAATATGTTGATGATTCCATAGCT CTTCAA

ATAGCACTTGGAAATAAAGATATAAATACTTTTGAACAGATCGATGACTACAATCCA GACACT

GCTATGCCTGCCCATTCAAGAAGTCATAGTTGGGATGACAAAACATGTCAAAAGTCA GCTAAT

GTTAGCAGCATTTGGCATAGGAATTACTCTCCCAGACCAGAGTCGGGTACTGTTTCA GATGCC

CCACAATTGAAGGAAAATCCAAGTACTGTGGGAGTGGAACGAGTGATTAGTACTAAA GGGTTA

AATCTCCCAAGGAAATCATCCATTGTGAAAAGACCAAGAAGTGCAGAGCTGTCAGAA GATGAC

CTGTTGAGTCAGTATTCTCTTTCATTTACGAAGAAGACCAAGAAAAATAGCTCTGAA GGCAAT

AAATCATTGAGCTTTTCTGAAGTGTTTGTGCCTGACCTGGTAAATGGACCTACTAAC AAAAAG

AGTGTAAGCACTCCACCTAGGACGAGAAATAAATTTGCAACATTTTTACAAAGGAAA AATGAA

GAAAGTGGTGCAGTTGTGGTTCCAGGGACCAGAAGCAGGTTTTTTTGCAGTTCAGAT TCTACT

GACTGTGTATCAAACAAAGTGAGCATCCAGCCTCTGGATGAAACTGCTGTCACAGAT AAAGAG

AACAATCTGCATGAATCAGAGTATGGAGACCAAGAAGGCAAGAGACTGGTTGACACA GATGTA

GCACGTAATTCAAGTGATGACATTCCGAATAATCATATTCCAGGTGATCATATTCCA GACAAG

GCAACAGTGTTTACAGATGAAGAGTCCTACTCTTTTGAGAGCAGCAAATTTACAAGG ACCATT

TCACCACCCACTTTGGGAACACTAAGAAGTTGTTTTAGTTGGTCTGGAGGTCTTGGA GATTTT

TCAAGAACGCCGAGCCCCTCTCCAAGCACAGCATTGCAGCAGTTCCGAAGAAAGAGC GATTCC

CCCACCTCTTTGCCTGAGAATAATATGTCTGATGTGTCGCAGTTAAAGAGCGAGGAG TCCAGT

GACGATGAGTCTCATCCCTTACGAGAAGGGGCATGTTCTTCACAGTCCCAGGAAAGT GGAGAA

TTCTCACTGCAGAGTTCAAATGCATCAAAGCTTTCTCAGTGCTCTAGTAAGGACTCT GATTCA

GAGGAATCTGATTGCAATATTAAGTTACTTGACAGTCAAAGTGACCAGACCTCCAAG CTATGT

TTATCTCATTTCTCAAAAAAAGACACACCTCTAAGGAACAAGGTTCCTGGGCTATAT AAGTCC

AGTTCTGCAGACTCTCTTTCTACAACCAAGATCAAACCTCTAGGACCTGCCAGAGCC AGTGGG

CTGAGCAAGAAGCCGGCAAGCATCCAGAAGAGAAAGCATCATAATGCCGAGAACAAG CCGGGG

TTACAGATCAAACTCAATGAGCTCTGGAAAAACTTTGGATTTAAAAAAGATTCTGAA AAGCTT

CCTCCTTGTAAGAAACCCCTGTCCCCAGTCAGAGATAACATCCAACTAACTCCAGAA GCGGAA

GAGGATATATTTAACAAACCTGAATGTGGCCGTGTTCAAAGAGCAATATTCCAGTAA ATGCAG

ACTGCTGCAAAGCTTTTGCCTGCAAGAGAATCTGATCAATTTGAAGTCCCTGTTTGG GAATGA

GGCACTTATCAGCATGAAGAATTTTTTCTCATTCTGTGCCATTTTAAAAATAGAATA CATTTT

GTATATTAACTTTAAAAAAAAAAAAAAAAAAA

[00107] The sequence of human EXOl transcript variant 3 (GenBank Accession No.

NM_003686) which corresponds to SEQ ID NO:3 is as follows:

[00108] CCCGTGTTCTGCGTTGCCGGCCGTGGGTGCTCTGGCCACAGTGAGTTAGGGGCGTCG GAGCGGGTTTCTCCAACCGCAATCGGCTCCGCTCAAGGGGAGGAGGAGAGTCCCTTCTCG GAA GGCCTAAGGAAACGTGTCGTCTGGAATGGGCTTGGGGGCCACGCCTGCACATCTCCGCGA GAC AGAGGGATAAAGTGAAGATGGTGCTGTTATTGTTACCTCGAGTGCCACATGCGACCTCTG AGA

TATGTACACAGTCATTCTTACTATCGCACTCAGCCATTCTTACTACGCTAAAGAAGA AATAAT

TATTCGAGGATATTTGCCTGGCCCAGAAGAAACTTATGTAAATTTCATGAACTATTA TATCCG

TTTTCCTCGGAGTGAGAGAAAACTCTTTTTAGATATCATCTGAGAGGTAGTTAATTT GGCACC

ATGGGGATACAGGGATTGCTACAATTTATCAAAGAAGCTTCAGAACCCATCCATGTG AGGAAG

TATAAAGGGCAGGTAGTAGCTGTGGATACATATTGCTGGCTTCACAAAGGAGCTATT GCTTGT

GCTGAAAAACTAGCCAAAGGTGAACCTACTGATAGGTATGTAGGATTTTGTATGAAA TTTGTA

AATATGTTACTATCTCATGGGATCAAGCCTATTCTCGTATTTGATGGATGTACTTTA CCTTCT

AAAAAGGAAGTAGAGAGATCTAGAAGAGAAAGACGACAAGCCAATCTTCTTAAGGGA AAGCAA

CTTCTTCGTGAGGGGAAAGTCTCGGAAGCTCGAGAGTGTTTCACCCGGTCTATCAAT ATCACA

CATGCCATGGCCCACAAAGTAATTAAAGCTGCCCGGTCTCAGGGGGTAGATTGCCTC GTGGCT

CCCTATGAAGCTGATGCGCAGTTGGCCTATCTTAACAAAGCGGGAATTGTGCAAGCC ATAATT

ACAGAGGACTCGGATCTCCTAGCTTTTGGCTGTAAAAAGGTAATTTTAAAGATGGAC CAGTTT

GGAAATGGACTTGAAATTGATCAAGCTCGGCTAGGAATGTGCAGACAGCTTGGGGAT GTATTC

ACGGAAGAGAAGTTTCGTTACATGTGTATTCTTTCAGGTTGTGACTACCTGTCATCA CTGCGT

GGGATTGGATTAGCAAAGGCATGCAAAGTCCTAAGACTAGCCAATAATCCAGATATA GTAAAG

GTTATCAAGAAAATTGGACATTATCTCAAGATGAATATCACGGTACCAGAGGATTAC ATCAAC

GGGTTTATTCGGGCCAACAATACCTTCCTCTATCAGCTAGTTTTTGATCCCATCAAA AGGAAA

CTTATTCCTCTGAACGCCTATGAAGATGATGTTGATCCTGAAACACTAAGCTACGCT GGGCAA

TATGTTGATGATTCCATAGCTCTTCAAATAGCACTTGGAAATAAAGATATAAATACT TTTGAA

CAGATCGATGACTACAATCCAGACACTGCTATGCCTGCCCATTCAAGAAGTCATAGT TGGGAT

GACAAAACATGTCAAAAGTCAGCTAATGTTAGCAGCATTTGGCATAGGAATTACTCT CCCAGA

CCAGAGTCGGGTACTGTTTCAGATGCCCCACAATTGAAGGAAAATCCAAGTACTGTG GGAGTG

GAACGAGTGATTAGTACTAAAGGGTTAAATCTCCCAAGGAAATCATCCATTGTGAAA AGACCA

AGAAGTGCAGAGCTGTCAGAAGATGACCTGTTGAGTCAGTATTCTCTTTCATTTACG AAGAAG

ACCAAGAAAAATAGCTCTGAAGGCAATAAATCATTGAGCTTTTCTGAAGTGTTTGTG CCTGAC

CTGGTAAATGGACCTACTAACAAAAAGAGTGTAAGCACTCCACCTAGGACGAGAAAT AAATTT

GCAACATTTTTACAAAGGAAAAATGAAGAAAGTGGTGCAGTTGTGGTTCCAGGGACC AGAAGC

AGGTTTTTTTGCAGTTCAGATTCTACTGACTGTGTATCAAACAAAGTGAGCATCCAG CCTCTG

GATGAAACTGCTGTCACAGATAAAGAGAACAATCTGCATGAATCAGAGTATGGAGAC CAAGAA

GGCAAGAGACTGGTTGACACAGATGTAGCACGTAATTCAAGTGATGACATTCCGAAT AATCAT

ATTCCAGGTGATCATATTCCAGACAAGGCAACAGTGTTTACAGATGAAGAGTCCTAC TCTTTT

GAGAGCAGCAAATTTACAAGGACCATTTCACCACCCACTTTGGGAACACTAAGAAGT TGTTTT

AGTTGGTCTGGAGGTCTTGGAGATTTTTCAAGAACGCCGAGCCCCTCTCCAAGCACA GCATTG

CAGCAGTTCCGAAGAAAGAGCGATTCCCCCACCTCTTTGCCTGAGAATAATATGTCT GATGTG

TCGCAGTTAAAGAGCGAGGAGTCCAGTGACGATGAGTCTCATCCCTTACGAGAAGGG GCATGT

TCTTCACAGTCCCAGGAAAGTGGAGAATTCTCACTGCAGAGTTCAAATGCATCAAAG CTTTCT

CAGTGCTCTAGTAAGGACTCTGATTCAGAGGAATCTGATTGCAATATTAAGTTACTT GACAGT

CAAAGTGACCAGACCTCCAAGCTATGTTTATCTCATTTCTCAAAAAAAGACACACCT CTAAGG

AACAAGGTTCCTGGGCTATATAAGTCCAGTTCTGCAGACTCTCTTTCTACAACCAAG ATCAAA

CCTCTAGGACCTGCCAGAGCCAGTGGGCTGAGCAAGAAGCCGGCAAGCATCCAGAAG AGAAAG

CATCATAATGCCGAGAACAAGCCGGGGTTACAGATCAAACTCAATGAGCTCTGGAAA AACTTT

GGATTTAAAAAATTCTGAAAAGCTTCCTCCTTGTAAGAAACCCCTGTCCCCAGTCAG AGATAA

CATCCAACTAACTCCAGAAGCGGAAGAGGATATATTTAACAAACCTGAATGTGGCCG TGTTCA

AAGAGCAATATTCCAGTAAATGCAGACTGCTGCAAAGCTTTTGCCTGCAAGAGAATC TGATCA

ATTTGAAGTCCCTGTTTGGGAATGAGGCACTTATCAGCATGAAGAATTTTTTCTCAT TCTGTG

CCATTTTAAAAATAGAATACATTTTGTATATTAACTTTAAAAAAAAAAAAAAAAAAA

[00109] siRNA sequences are chosen to maximize the uptake of the antisense (guide) strand of the siRNA into RISC and thereby maximize the ability of RISC to target human EXOl

mRNA for degradation. This can be accomplished by scanning for sequences that have the lowest free energy of binding at the 5 '-terminus of the antisense strand. The lower free energy leads to an enhancement of the unwinding of the 5'- end of the antisense strand of the siRNA duplex, thereby ensuring that the antisense strand will be taken up by RISC and direct the sequence- specific cleavage of the human EXOl mRNA.

[00110] In some embodiments, the siRNA can also be coupled to other molecules, such as polypeptides, antibodies or other agents, for example for optimal delivery. In alternative embodiments, the siRNA can also be formulated and/or coupled to other molecules, such as polypeptides, antibodies or other agents for prodrug approaches as discussed in more detail herein.

[00111] In one embodiment, the siRNA or modified siRNA is delivered in a pharmaceutically acceptable carrier. Additional carrier agents, such as liposomes, can be added to the pharmaceutically acceptable carrier. In some embodiments, carriers include colloidal dispersion systems, which include, but are not limited to, liposomal or polymeric nanoparticles such as liposomes, proteins, and non-protein polymers, macromolecule complexes, nanocapsules, microspheres, beads and lipid-based systems including oil-in-water emulsions, micelles, mixed micelles, liposomes and lipid:oligonucleotide complexes of uncharacterized structure. Liposomes are microscopic spheres having an aqueous core surrounded by one or more outer layers made up of lipids arranged in a bilayer configuration (see, generally, Chonn et al., Current Op. Biotech. 1995, 6, 698-708). Other carrier particles are cellular uptake or membrane-disruption moieties, for example polyamines, e.g. spermidine or spermine groups, or polylysines; lipids and lipophilic groups; polymyxin or polymyxin- derived peptides; octapeptin; membrane pore-forming peptides; ionophores; protamine; aminoglycosides; polyenes; and the like. Other potentially useful functional groups include intercalating agents; radical generators; alkylating agents; detectable labels; chelators; or the like.

[00112] One can use other carriers, for example lipid particle or vesicle, such as a liposome or microcrystal, which may be suitable for parenteral administration. Carrier particles may be of any suitable structure, such as unilamellar or plurilamellar, so long as the antisense oligonucleotide is contained therein. Positively charged lipids such as N-[I- (2,3dioleoyloxi)propyll-N,N,N-trimethyl- anunoniummethylsulfate, or "DOTAP," are particularly preferred for such particles and vesicles. The preparation of such lipid particles is

well known. See, e.g., U.S. Patents Nos. 4,880,635; 4,906,477; 4,911,928; 4,917,951; 4,920,016; and 4,921,757 which are incorporated herein by reference. Other non-toxic lipid based vehicle components may likewise be utilized to facilitate uptake of the antisense compound by the cell.

[00113] In some embodiments, a carrier is a liposome. The outer surface of the liposomes can be modified with a long-circulating agent, e.g., PEG, e.g., hyaluronic acid (HA). The liposomes can be modified with a cryoprotectant, e.g., a sugar, such as trehalose, sucrose, mannose or glucose, e.g., HA. In one embodiment, a liposome is coated with HA. HA acts as both a long-circulating agent and a cryoprotectant. The liposome is modified by attachment of the targeting moiety. In another embodiment, the targeting moiety is covalently attached to HA, which is bound to the liposome surface. Alternatively, the carrier particle is a micelle. Alternatively, the micelle is modified with a cryoprotectant, e.g., HA, PEG. [00114] Liposomes useful in the methods and compositions as disclosed herein can be produced from combinations of lipid materials well known and routinely utilized in the art to produce liposomes. Lipids can include relatively rigid varieties, such as sphingomyelin, or fluid types, such as phospholipids having unsaturated acyl chains. "Phospholipid" refers to any one phospholipid or combination of phospholipids capable of forming liposomes. Phosphatidylcholines (PC), including those obtained from egg, soy beans or other plant sources or those that are partially or wholly synthetic, or of variable lipid chain length and unsaturation are suitable for use in the present invention. Synthetic, semisynthetic and natural product phosphatidylcholines including, but not limited to, distearoylphosphatidylcholine (DSPC), hydrogenated soy phosphatidylcholine (HSPC), soy phosphatidylcholine (soy PC), egg phosphatidylcholine (egg PC), hydrogenated egg phosphatidylcholine (HEPC), dipalmitoylphosphatidylcholine (DPPC) and dimyristoylphosphatidylcholine (DMPC) are suitable phosphatidylcholines for use in this invention. All of these phospholipids are commercially available. Further, phosphatidylglycerols (PG) and phosphatic acid (PA) are also suitable phospholipids for use in the present invention and include, but are not limited to, dimyristoylphosphatidylglycerol (DMPG), dilaurylphosphatidylglycerol (DLPG), dipalmitoylphosphatidylglycerol (DPPG), distearoylphosphatidylglycerol (DSPG) dimyristoylphosphatidic acid (DMPA), distearoylphosphatidic acid (DSPA), dilaurylphosphatidic acid (DLPA), and dipalmitoylphosphatidic acid (DPPA). Distearoylphosphatidylglycerol (DSPG) is the preferred negatively charged lipid when used in

foπnulations. Other suitable phospholipids include phosphatidylethanolamines, phosphatidylinositols, sphingomyelins, and phosphatidic acids containing lauric, myristic, stearoyl, and palmitic acid chains. For the purpose of stabilizing the lipid membrane, it is preferred to add an additional lipid component, such as cholesterol. Preferred lipids for producing liposomes according to the invention include phosphatidylethanolamine (PE) and phosphatidylcholine (PC) in further combination with cholesterol (CH). According to one embodiment of the invention, a combination of lipids and cholesterol for producing the liposomes of the invention comprise a PE:PC:Chol molar ratio of 3:1:1. Further, incorporation of polyethylene glycol (PEG) containing phospholipids is also contemplated by the present invention.

[00115] Liposomes useful in the methods and compositions as disclosed herein can be obtained by any method known to the skilled artisan. For example, the liposome preparation of the present invention can be produced by reverse phase evaporation (REV) method (see U.S. Pat. No. 4,235,871), infusion procedures, or detergent dilution. A review of these and other methods for producing liposomes can be found in the text Liposomes, Marc Ostro, ed., Marcel Dekker, Inc., New York, 1983, Chapter 1. See also Szoka Jr. et al., (1980, Ann. Rev. Biophys. Bioeng., 9:467). A method for forming ULVs is described in Cullis et al., PCT Publication No. 87/00238, Jan. 16, 1986, entitled "Extrusion Technique for Producing Unilamellar Vesicles". Multilamellar liposomes (MLV) can be prepared by the lipid-film method, wherein the lipids are dissolved in a chloroform- methanol solution (3:1, vol/vol), evaporated to dryness under reduced pressure and hydrated by a swelling solution. Then, the solution is subjected to extensive agitation and incubation, e.g., 2 hour, e.g., at 37 ⁰ C. After incubation, unilamellar liposomes (ULV) are obtained by extrusion. The extrusion step modifies liposomes by reducing the size of the liposomes to a preferred average diameter. Alternatively, liposomes of the desired size can be selected using techniques such as filtration or other size selection techniques. While the size-selected liposomes of the invention should have an average diameter of less than about 300 nm, it is preferred that they are selected to have an average diameter of less than about 200 nm with an average diameter of less than about 100 nm being particularly preferred. When the liposome of the present invention is a unilamellar liposome, it preferably is selected to have an average diameter of less than about 200 nm. The most preferred unilamellar liposomes of the invention have an average diameter of less than about 100 nm. It is understood, however, that multivesicular liposomes of the

invention derived from smaller unilamellar liposomes will generally be larger and can have an average diameter of about less than 1000 nm. Preferred multivesicular liposomes of the invention have an average diameter of less than about 800 nm, and less than about 500 nm while most preferred multivesicular liposomes of the invention have an average diameter of less than about 300 nm.

[00116] In another embodiment, the siRNA is delivered by delivering a vector encoding small hairpin RNA (shRNA) in a pharmaceutically acceptable carrier to the cells in an organ of an individual. The shRNA is converted by the cells after transcription into siRNA capable of targeting, for example, EXOl. In one embodiment, the vector can be a regulatable vector, such as tetracycline inducible vector or tamoxifen inducible vector.

[00117] In one embodiment, the RNA interfering agents used in the methods described herein are taken up actively by cells in vivo following intravenous injection, e.g., hydrodynamic injection, without the use of a vector, illustrating efficient in vivo delivery of the RNA interfering agents, e.g., the siRNAs used in the methods of the invention. [00118] Other strategies for delivery of the RNA interfering agents, e.g., the siRNAs or shRNAs used in the methods of the invention, can also be employed, such as, for example, delivery by a vector, e.g., a plasmid or viral vector, e.g., a lentiviral vector. Such vectors can be used as described, for example, in Xiao-Feng Qin et al. Proc. Natl. Acad. Sci. U.S.A., 100: 183-188. Other delivery methods include delivery of the RNA interfering agents, e.g., the siRNAs or shRNAs of the invention, using a basic peptide by conjugating or mixing the RNA interfering agent with a basic peptide, e.g., a fragment of a TAT peptide, mixing with cationic lipids or formulating into particles.

[00119] As noted, the dsRNA, such as siRNA or shRNA can be delivered using an inducible vector, such as a tetracycline inducible vector. Methods described, for example, in Wang et al. Proc. Natl. Acad. Sci. 100: 5103-5106, using pTet-On vectors (BD Biosciences Clontech, Palo Alto, CA) can be used. In some embodiments, a vector can be a plasmid vector, a viral vector, or any other suitable vehicle adapted for the insertion and foreign sequence and for the introduction into eukaryotic cells. The vector can be an expression vector capable of directing the transcription of the DNA sequence of the agonist or antagonist nucleic acid molecules into RNA. Viral expression vectors can be selected from a group comprising, for example, retero viruses, lentiviruses, Epstein Barr virus-, bovine papilloma virus, adenovirus- and adeno-associated-based vectors or hybrid virus of any of the above. In one embodiment, the

vector is episomal. The use of a suitable episomal vector provides a means of maintaining the antagonist nucleic acid molecule in the subject in high copy number extra chromosomal DNA thereby eliminating potential effects of chromosomal integration.

[00120] RNA interference molecules and nucleic acid inhibitors useful in the methods as disclosed herein can be produced using any known techniques such as direct chemical synthesis, through processing of longer double stranded RNAs by exposure to recombinant Dicer protein or Drosophila embryo lysates, through an in vitro system derived from S2 cells, using phage RNA polymerase, RNA-dependant RNA polymerase, and DNA based vectors. Use of cell lysates or in vitro processing can further involve the subsequent isolation of the short, for example, about 21-23 nucleotide, siRNAs from the lysate, etc. Chemical synthesis usually proceeds by making two single stranded RNA-oligomers followed by the annealing of the two single stranded oligomers into a double stranded RNA. Other examples include methods disclosed in WO 99/32619 and WO 01/68836 that teach chemical and enzymatic synthesis of siRNA. Moreover, numerous commercial services are available for designing and manufacturing specific siRNAs (see, e.g., QIAGEN Inc., Valencia, CA and AMBION Inc., Austin, TX)

[00121] In some embodiments, an agent is protein or polypeptide or RNAi agent that inhibits expression of EXOl and/or activity of the EXOl protein. In such embodiments cells can be modified (e.g., by homologous recombination) to provide increased expression of such an agent, for example by replacing, in whole or in part, the naturally occurring promoter with all or part of a heterologous promoter so that the cells express the natural inhibitor agent of EXOl, for example protein or miRNA inhibitor of EXOl at higher levels. The heterologous promoter is inserted in such a manner that it is operatively linked to the desired nucleic acid encoding the agent. See, for example, PCT International Publication No. WO 94/12650 by Transkaryotic Therapies, Inc., PCT International Publication No. WO 92/20808 by Cell Genesys, Inc., and PCT International Publication No. WO 91/09955 by Applied Research Systems. Cells also can be engineered to express an endogenous gene comprising the agent under the control of inducible regulatory elements, in which case the regulatory sequences of the endogenous gene can be replaced by homologous recombination. Gene activation techniques are described in U.S. Patent No. 5,272,071 to Chappel; U.S. Patent No. 5,578,461 to Sherwin et al.; PCT/US92/09627 (W093/09222) by Selden et al. , which is incorporated herein in its entirety by reference; and PCT/US 90/06436 (WO91/06667) by Skoultchi et al ,

which is incorporated herein in its entirety by reference. The agent can be prepared by culturing transformed host cells under culture conditions suitable to express the miRNA. The resulting expressed agent can then be purified from such culture (i.e., from culture medium or cell extracts) using known purification processes, such as gel filtration and ion exchange chromatography. The purification of the peptide or nucleic acid agent inhibitor of EXOl can also include an affinity column containing agents which will bind to the protein; one or more column steps over such affinity resins as concanavalin A-agarose, HEP ARIN- TOYOPEARL™ or Cibacrom blue 3GA Sepharose; one or more steps involving hydrophobic interaction chromatography using such resins as phenyl ether, butyl ether, or propyl ether; immunoaffnity chromatography, or complementary cDNA affinity chromatography. [00122] In one embodiment, the nucleic acid inhibitors of EXOl can be obtained synthetically, for example, by chemically synthesizing a nucleic acid by any method of synthesis known to the skilled artisan. The synthesized nucleic acid inhibitors of EXOl can then be purified by any method known in the art. Methods for chemical synthesis of nucleic acids include, but are not limited to, in vitro chemical synthesis using phosphotriester, phosphate or phosphor amidite chemistry and solid phase techniques, or via deoxynucleoside H-phosphonate intermediates (see U.S. Patent No. 5,705,629 to Bhongle, which is incorporated herein in its entirety by reference).

[00123] In some circumstances, for example, where increased nuclease stability is desired, nucleic acids having nucleic acid analogs and/or modified internucleoside linkages can be preferred. Nucleic acids containing modified internucleoside linkages can also be synthesized using reagents and methods that are well known in the art. For example, methods of synthesizing nucleic acids containing phosphonate phosphorothioate, phosphorodithioate, phosphor amidate methoxyethyl phosphoramidate, formacetal, thioformacetal, diisopropylsilyl, acetamidate, carbamate, dimethylene- sulfide (-CH ₂ -S-CH ₂ ), diinethylene- sulfoxide (-CH ₂ -SO-CH ₂ ), dimethylene- sulfone (-CH ₂ -SO ₂ -CH ₂ ), 2'-O-alkyl, and 2'-deoxy-2'- fluoro ' phosphorothioate internucleoside linkages are well known in the art (see Uhlmann et al., 1990, Chem. Rev. 90:543-584; Schneider et al., 1990, Tetrahedron Lett. 31:335 and references cited therein). U.S. Patent Nos. 5,614,617 and 5,223,618 to Cook, et al., 5,714, 606 to Acevedo, et al, 5,378,825 to Cook, et al., 5,672,697 and 5,466, 786 to Buhr, et al., 5, 777,092 to Cook, et al., 5,602,240 to De Mesmacker, et al., 5,610,289 to Cook, et al. and

5,858,988 to Wang, which are all incorporated herein in their entirety by reference, which describe nucleic acid analogs for enhanced nuclease stability and cellular uptake. [00124] Synthetic siRNA molecules, including shRNA molecules, can be obtained using a number of techniques known to those of skill in the art. For example, the siRNA molecule can be chemically synthesized or recombinantly produced using methods known in the art, such as using appropriately protected ribonucleoside phosphoramidites and a conventional DNA/RNA synthesizer (see, e.g., Elbashir, S.M. et al. (2001) Nature 411:494-498; Elbashir, S.M., W. Lendeckel and T. Tuschl (2001) Genes & Development 15:188-200; Harborth, J. et al. (2001) /. Cell Science 114:4557-4565; Masters, J.R. et al. (2001) Proc. Natl. Acad. ScL, USA 98:8012-8017; and Tuschl, T. et al. (1999) Genes & Development 13:3191-3197). Alternatively, several commercial RNA synthesis suppliers are available including, but are not limited to, Proligo (Hamburg, Germany), Dharmacon Research (Lafayette, CO, USA), Pierce Chemical (part of Perbio Science, Rockford, IL , USA), Glen Research (Sterling, VA, USA), ChemGenes (Ashland, MA, USA), and Cruachem (Glasgow, UK). As such, siRNA molecules are not overly difficult to synthesize and are readily provided in a quality suitable for RNAi. In addition, dsRNAs can be expressed as stem loop structures encoded by plasmid vectors, retroviruses and lentiviruses (Paddison, PJ. et al. (2002) Genes Dev. 16:948-958; McManus, M.T. et al. (2002) RNA 8:842-850; Paul, CP. et al. (2002) Nat. Biotechnol. 20:505-508; Miyagishi, M. et al. (2002) Nat. Biotechnol. 20:497-500; Sui, G. et al. (2002) Proc. Natl. Acad. ScL, USA 99:5515-5520; Brummelkamp, T. et al. (2002) Cancer Cell 2:243; Lee, N.S., et al. (2002) Nat. Biotechnol. 20:500-505; Yu, J.Y., et al. (2002) Proc. Natl. Acad. ScL, USA 99:6047-6052; Zeng, Y., et al. (2002) MoI. Cell 9:1327-1333; Rubinson, D.A., et al. (2003) Nat. Genet. 33:401-406; Stewart, S.A., et al. (2003) RNA 9:493-501). These vectors generally have apolIII promoter upstream of the dsRNA and can express sense and antisense RNA strands separately and/or as a hairpin structures. Within cells, Dicer processes the short hairpin RNA (shRNA) into effective siRNA.

[00125] The targeted region of the siRNA molecule of the present invention can be selected from a given target gene sequence, e.g., a EXOl coding sequence, beginning from about 25 to 50 nucleotides, from about 50 to 75 nucleotides, or from about 75 to 100 nucleotides downstream of the start codon. Nucleotide sequences can contain 5' or 3' UTRs and regions nearby the start codon. One method of designing a siRNA molecule of the present invention involves identifying the 23 nucleotide sequence motif AA(N19)TT (where N can be any

nucleotide), and selecting hits with at least 25%, 30%, 35%, 40%, 45%, 50%, 55%, 60%, 65%, 70% or 75% G/C content. The "TT" portion of the sequence is optional. Alternatively, if no such sequence is found, the search can be extended using the motif NA(N21), where N can be any nucleotide. In this situation, the 3' end of the sense siRNA can be converted to TT to allow for the generation of a symmetric duplex with respect to the sequence composition of the sense and antisense 3' overhangs. The antisense siRNA molecule can then be synthesized as the complement to nucleotide positions 1 to 21 of the 23 nucleotide sequence motif. The use of symmetric 3' TT overhangs can be advantageous to ensure that the small interfering ribonucleoprotein particles (siRNPs) are formed with approximately equal ratios of sense and antisense target RNA-cleaving siRNPs (Elbashir et al. (2001) supra and Elbashir et al. 2001 supra). Analysis of sequence databases, including but not limited to the NCBI, BLAST, Derwent and GenSeq as well as commercially available oligosynthesis software such as OLIGOENGINE ^® , can also be used to select siRNA sequences against EST libraries to ensure that only one gene is targeted.

[00126] Delivery of RNA Interfering Agents: Methods of delivering RNA interfering agents, e.g., an siRNA, or vectors containing an RNA interfering agent, to target cells ( e.g., cells of the brain or other desired target cells, for cells in the central and peripheral nervous systems), can include, for example (i) injection of a composition containing the RNA interfering agent, e.g., an siRNA, or (ii) directly contacting the cell, e.g., a cell of the brain, with a composition comprising an RNA interfering agent, e.g., an siRNA. In another embodiment, RNA interfering agents, e.g., an siRNA can be injected directly into any blood vessel, such as vein, artery, venule or arteriole, via, e.g., hydrodynamic injection or catheterization. In some embodiments EXOl agents such as EXOl siRNA can delivered to specific organs, for example the liver, bone marrow or systemic administration.

[00127] Administration can be by a single injection or by two or more injections. The RNA interfering agent is delivered in a pharmaceutically acceptable carrier. One or more RNA interfering agents can be used simultaneously. The RNA interfering agents, e.g., the siRNAs targeting EXOl mRNA, can be delivered singly, or in combination with other RNA interfering agents, e.g., siRNAs, such as, for example siRNAs directed to other cellular genes. EXOl siRNAs can also be administered in combination with other pharmaceutical agents which are used to treat or prevent neurodegenerative diseases or disorders.

[00128] In one embodiment, specific cells are targeted with RNA interference, limiting potential side effects of RNA interference caused by non-specific targeting of RNA interference. The method can use, for example, a complex or a fusion molecule comprising a cell targeting moiety and an RNA interference binding moiety that is used to deliver RNA interference effectively into cells. For example, an antibody-protamine fusion protein when mixed with an siRNA, binds siRNA and selectively delivers the siRNA into cells expressing an antigen recognized by the antibody, resulting in silencing of gene expression only in those cells that express the antigen. The siRNA or RNA interference-inducing molecule binding moiety is a protein or a nucleic acid binding domain or fragment of a protein, and the binding moiety is fused to a portion of the targeting moiety. The location of the targeting moiety can be either in the carboxyl-terminal or amino-terminal end of the construct or in the middle of the fusion protein.

[00129] A viral-mediated delivery mechanism can also be employed to deliver siRNAs to cells in vitro and in vivo as described in Xia, H. et al. (2002) Nat Biotechnol 20(10): 1006). Plasmid- or viral-mediated delivery mechanisms of shRNA can also be employed to deliver shRNAs to cells in vitro and in vivo as described in Rubinson, D. A., et al. ((2003) Nat. Genet. 33:401-406) and Stewart, S.A., et al. ((2003) RNA 9:493-501).

[00130] RNAi agents, for e.g., a siRNA, can also be introduced into cells via the vascular or extravascular circulation, the blood or lymph system, and the cerebrospinal fluid. [00131] The dose of the particular RNA interfering agent will be in an amount necessary to effect RNA interference, e.g., post translational gene silencing (PTGS), of the particular target gene, thereby leading to inhibition of target gene expression or inhibition of activity or level of the protein encoded by the target gene.

[00132] It is also known that RNAi molecules do not have to match perfectly to their target sequence. Preferably, however, the 5' and middle part of the antisense (guide) strand of the siRNA is perfectly complementary to the target nucleic acid sequence. [00133] Accordingly, the RNAi molecules functioning as nucleic acid inhibitors of EXOl in the present invention are for example, but are not limited to, unmodified and modified double stranded (ds) RNA molecules including short-temporal RNA (stRNA), small interfering RNA (siRNA), short-hairpin RNA (shRNA), microRNA (miRNA), double- stranded RNA (dsRNA), (see, e.g. Baulcombe, Science 297:2002-2003, 2002). The dsRNA molecules, e.g. siRNA can also contain 3' overhangs, preferably 3'UU or 3'TT overhangs. In one

embodiment, the siRNA molecules of the present invention do not include RNA molecules that comprise ssRNA greater than about 30-40 bases, about 40-50 bases, about 50 bases or more. In one embodiment, the siRNA molecules of the present invention are double stranded for more than about 25%, more than about 50%, more than about 60%, more than about 70%, more than about 80%, more than about 90% of their length. In some embodiments, a nucleic acid inhibitor of EXOl is any agent which binds to and inhibits the expression of EXOl mRNA, where the expression of EXOl mRNA or a product of transcription of nucleic acid encoded by SEQ ID NO: 1, 2 or 3 is inhibited.

[00134] In another embodiment of the invention, agents inhibiting EXOl are catalytic nucleic acid constructs, such as, for example ribosomes, which are capable of cleaving RNA transcripts and thereby preventing the production of wildtype protein. Ribosomes are targeted to and anneal with a particular sequence by virtue of two regions of sequence complementary to the target flanking the ribosome catalytic site. After binding, the ribosome cleaves the target in a site specific manner. The design and testing of ribosomes which specifically recognize and cleave sequences of the gene products described herein, for example for cleavage of EXOl or homologues or variants thereof can be achieved by techniques well known to those skilled in the art (for example Lleber and Strauss, (1995) MoI Cell Biol 15:540.551, the disclosure of which is incorporated herein by reference). [00135] In some embodiments, the agent that inhibits EXOl is an antigomir. Antigomirs are oligonucleotides, for example synthetic oligonucleotides capable of gene silencing endogenous miRNAs.

Other agent inhibitors of EXOl; chemical, protein and peptide inhibitors of EXOl [00136] In one embodiment, an agent that inhibit EXOl can be a protein and/or a peptide inhibitor or fragment of an inhibitor of EXOl. Examples of such inhibitors include, but are not limited to; mutated proteins; therapeutic proteins and recombinant proteins. Protein and peptide inhibitors can also include for example mutated proteins, genetically modified proteins, peptides, synthetic peptides, recombinant proteins, chimeric proteins, antibodies, humanized proteins, humanized antibodies, chimeric antibodies, modified proteins and fragments thereof.

[00137] In some embodiments, the agents that inhibit EXOl are dominant negative variants of EXOl, for example a non-functional variant of EXOl.

[00138] In some embodiments, an agent that inhibits EXOl which is useful in the methods and compositions as disclosed herein includes, for example, a known agent which decreases the transcript expression and/or protein expression of EXOl. An exemplary example is hydroxyurea, which has been shown to lower EXOl protein (Dover, 2005; Hankins et al., 2005; Villella, 2005, which are incorporated herein by reference). In such an embodiment, one can administer a subject an effective dose of hydroxyurea to lower EXOl protein levels, for example, but not limited to a dose of about at least 10mg/kg/day, or at least 25 mg/kg/d, or at least 30 mg/kg/d, or at least 40 mg/kg/d. In some embodiments, the dose of hydroxyurea used is sufficient to lower EXOl protein levels, and can be less than 10mg/kg/day, for example, at least about 2mg/kg/day, or at least about 4mg/kg/day, or at least about 6mg/kg/day, or at least about 8mg/kg/day. In alternative embodiments, the dose can be greater than 40 mg/kg/d, for example at least about 50mg/kg/day, at least about 60mg/kg/day, at least about 70mg/kg/day, at least about 80mg/kg/day or greater. In some embodiments, hydroxyura can be combined with at least one other EXOl inhibitor which is disclosed herein, for example, a nucleic acid inhibitor of EXOl, or an antibody based inhibitor of EXOl or a peptide or other inhibitor of EXOl, such as a nuclease inhibitor of EXOl.

[00139] In some embodiments, an agent that inhibits EXOl which is useful in the methods and compositions as disclosed herein includes, for example, a known agent which decreases or inhibits the nuclease activity of a protein. Such agents are commonly referred to in the art as "nuclease inhibitors" and are useful as EXOl inhibitors herein. Exemplary examples of nuclease inhibitors which can be used include for example, but are not limited to; oligovinylsulfonic acid (OVA), aurintricarboxylic acid (ATA), aflatoxin, 2-nitro-5- thiocyanobenzoic acid, iodoacetate, N-bromosuccinimide, p-chloromercuribenzoate, dinitrofluorobenzene, decanavanate, polyvinylsufonic acid, hydrobenzoinphosphate, phenyiphosphate, putrescine, haloacetate, dinitrofluorobenzene, phenyiglyoxal, bromopyruvic, 8-amino-5-(4'-hydroxy-biphenyl-4-ylazo)-naphthalene-2-sulfon ate, 6-hydroxy- 5-(2-hydroxy-3,5-dinitro-phenylazo)-naphthalene-2-sulfonate, 3,3'-dimethylbiphenyl-4,4'- bis(2-amino-naphthylazo-6-sulfonate), 4,4'-dicarboxy-3,3-bis(naphthylamido)- diphenylmethanone, 3,3'-dicarboxy-4,4'-bis(4-biphenylamido)diphenylmethane, 3,3'- dicarboxy-4,4'-bis(3-nitrophenylamido)diphenylmethane or NCI- 224131. One can use at least one nuclease inhibitor, or any combination of nuclease inhibitors (for example, at least any 2, at least any 3, at least any 4, at least any 5, at least any 6, at least any 7 or more, nuclease

inhibitors) in the methods and compositions as disclosed herein. In some embodiments, at least one or any combination of nuclease inhibitors can be combined with at least one other EXOl inhibitor which is disclosed herein, such as a nucleic acid inhibitor of EXOl, or an antibody based inhibitor of EXOl or a peptide or other inhibitor of EXOl, such as hydroxyurea inhibitor of EXOl.

Antibodies

[00140] In some embodiments, inhibitors of genes and/or gene products useful in the methods of the present invention include, for example, antibodies, including monoclonal, chimeric humanized, and recombinant antibodies and antigen-binding fragments thereof. In some embodiments, neutralizing antibodies can be used as inhibitors of the EXOl enzyme. Antibodies are readily raised in animals such as rabbits or mice by immunization with the antigen. Immunized mice are particularly useful for providing sources of B cells for the manufacture of hybridomas, which in turn are cultured to produce large quantities of monoclonal antibodies.

[00141] In one embodiment of this invention, the inhibitor to EXOl gene products as disclosed herein can be an antibody molecule or the epitope-binding moiety of an antibody molecule and the like.

[00142] In some embodiments, a EXOl inhibitor useful is an inhibitory antibody, or fragments thereof. In some embodiments, antibodies inhibit the nuclease activity of EXOl, for example, useful antibodies bind to the catalytic region of the EXOl protein to inhibit its exonuclease activity. Alternatively, antibodies can bind to any epitope on the EXOl protein which inhibits the nuclease activity of EXOl. In some embodiments, antibodies that recognize at least one of the amino acid residues D78, E109, D173, D225, S398, L410 or S714 are useful in the methods and compositions as disclosed herein. As exemplary examples only, one can use the following protein regions, or fragments of such regions, as antigens to produce antibodies: amino acid residues 78 to 410; amino acid residues 1 to 99; amino acid residues 120 to 387; 600 to 846; 787 to 846. In some embodiments, antigenic peptides useful to generate inhibitory anti-EXOl antibodies can have a length of about 15-25 amino acids. In alternative embodiments, one can use peptides of varying lengths for anti-EXOl antibody production, for example peptides from amino acid residues 52 to 82; 97 to 109; 138-169; 215 to 244; 306-326; 394 to 404; 395-411; 409-419; 504-527; 707 to 715; etc of SEQ ID NO: 1 or

SEQ ID NO: 2, or SEQ ID NO: 3 can be used in the methods and compositions as disclosed herein. Alternatively DNA may be used for antibody production.

[00143] In alternative embodiments, an inhibitory antibody useful in the methods and compositions as disclosed herein binds and recognizes a region of the EXOl protein which is phosphorylated. Phosphorylated regions of EXOl can be easily determined by one of skill in the art, and the inhibition of EXOl phosphorylation and/or increase of EXOl phosphorylation by an anti-EXOl antibody can be determined as discussed in El-Shamerly et al (Nucleic Acids Res, 2008; 36; 511-519, which is incorporated herein in its entirety by reference). The serine residues 398 and 714 of human EXOl (SEQ ID NO: 1 to 3) have been found to be phosphorylated. One antibody useful as an inhibitor of EXOl for use in the methods and compositions as disclosed herein are the polyEXOlA and polyEXOlB rabbit polyclonal antibodies, which can be humanized using standard methods known in the art. Alternatively, antibodies generated from the peptide corresponding to SEQ ID NO: 4, as disclosed herein are also useful in the methods and compositions as disclosed herein.

[00144] In some embodiments, agents which inhibit EXOl are known antibodies which bind to EXOl, for example but not limited to the following antibodies; Monoclonal antibody to full-length EXOl (Ab-4, clone 266) from NeoMarkers (Fremont, CA, USA); an antibody to phosphorylated S714 in hEXOl which was raised using the peptide CNIKLLDpSQSDQT (SEQ ID NO: 6), where pS represents phospho-Serine (Eurogentec, Seraing, Belgium) (See El-Shemerly et al 2008, which is incorporated herein in its entirety by reference). Alternatively, a polyclonal antibody F- 15 (against specific for the splice variant Exolb) (El- Shemerly et al., 2005 which is incorporated herein in its entirety by reference) is also useful as an inhibitor agent of EXOl for use in the methods and compositions as disclosed herein. [00145] In alternative embodiments, other antibodies useful in the methods are commercially available, for example from Neomarkers (such as anti-EXOl, antibody Ab-4), Invitrogen, Santa Cruz Biotechnology, Abnova, Acris or Abeam or as disclosed in the Examples herein, where anti-EXOl antibodies are commercially available from NeoMarkers (also called Lab Vision), also distributed by Thermoscientific.

[00146] Antibodies provide high binding avidity (i.e. functional binding efficiency) and unique specificity to a wide range of target antigens and haptens. Monoclonal antibodies useful in the practice of the present invention include whole antibody and fragments thereof

and are generated in accordance with conventional techniques, such as hybridoma synthesis, recombinant DNA techniques and protein synthesis.

[00147] Useful monoclonal antibodies and fragments can be derived from any species (including humans) or can be formed as chimeric proteins which employ sequences from more than one species. Human monoclonal antibodies or "humanized" murine antibody are also used in accordance with the present invention. For example, murine monoclonal antibody can be "humanized" by genetically recombining the nucleotide sequence encoding the murine Fv region (i.e., containing the antigen binding sites) or the complementarily determining regions thereof with the nucleotide sequence encoding a human constant domain region and an Fc region. Humanized targeting moieties are recognized to decrease the immunoreactivity of the antibody or polypeptide in the host recipient, permitting an increase in the half-life and a reduction the possibly of adverse immune reactions in a manner similar to that disclosed in European Patent Application No. 0,411,893 A2. The murine monoclonal antibodies should preferably be employed in humanized form. Antigen binding activity is determined by the sequences and conformation of the amino acids of the six complementarily determining regions (CDRs) that are located (three each) on the light and heavy chains of the variable portion (Fv) of the antibody. The 25-kDa single-chain Fv (scFv) molecule, composed of a variable region (V _L ) of the light chain and a variable region (V _H ) of the heavy chain joined via a short peptide spacer sequence, is the smallest antibody fragment developed to date. Techniques have been developed to display scFv molecules on the surface of filamentous phage that contain the gene for the scFv. scFv molecules with a broad range of antigenic- specificities can be present in a single large pool of scFv-phage library. Some examples of high affinity monoclonal antibodies and chimeric derivatives thereof, useful in the methods of the present invention, are described in the European Patent Application EP 186,833; PCT Patent Application WO 92/16553; and US Patent No. 6,090,923. Further, such antibody fragments can be domain antibodies (e.g. Domantis), camelid antibody fragments or llama antibody fragments,

[00148] Chimeric antibodies are immunoglobin molecules characterized by two or more segments or portions derived from different animal species. Generally, the variable region of the chimeric antibody is derived from a non-human mammalian antibody, such as murine monoclonal antibody, and the immunoglobin constant region is derived from a human

immunoglobin molecule. Preferably, both regions and the combination have low immunogenicity as routinely determined.

[00149] One limitation of scFv molecules is their monovalent interaction with a target antigen. One of the easiest methods of improving the binding of a scFv to its target antigen is to increase its functional affinity through the creation of a multimer. Association of identical scFv molecules to form diabodies, triabodies and tetrabodies can comprise a number of identical Fv modules. These reagents are therefore multivalent, but monospecific. The association of two different scFv molecules, each comprising a V _H and V _L domain derived from a different parent Ig will form a fully functional bispecific diabody. A unique application of bispecific scFvs is to bind two sites simultaneously on the same target molecule via two (adjacent) surface epitopes. These reagents gain a significant avidity advantage over a single scFv or Fab fragments. A number of multivalent scFv-based structures have been engineered, including for example, miniantibodies, dimeric miniantibodies, minibodies, (ScFv) ₂ , diabodies and triabodies. These molecules span a range of valence (two to four binding sites), size (50 to 120 kDa), flexibility and ease of production. Single chain Fv antibody fragments (scFvs) are predominantly monomeric when the V _H and V _L domains are joined by, polypeptide linkers of at least 12 residues. The monomer scFv is thermodynamically stable with linkers of 12 and 25 amino acids length under all conditions. The noncovalent diabody and triabody molecules are easy to engineer and are produced by shortening the peptide linker that connects the variable heavy and variable light chains of a single scFv molecule. The scFv dimers are joined by amphipathic helices that offer a high degree of flexibility and the miniantibody structure can be modified to create a dimeric bispecific (DiBi) miniantibody that contains two miniantibodies (four scFv molecules) connected via a double helix. Gene-fused or disulfide bonded scFv dimers provide an intermediate degree of flexibility and are generated by straightforward cloning techniques adding a C-terminal Gly4Cys sequence. scFv-CH3 minibodies are comprised of two scFv molecules joined to an IgG CH3 domain either directly (LD minibody) or via a very flexible hinge region (Flex minibody). With a molecular weight of approximately 80 kDa, these divalent constructs are capable of significant binding to antigens. The Flex minibody exhibits impressive tumor localization in mice. Bi- and tri- specific multimers can be formed by association of different scFv molecules. Increase in functional affinity can be reached when Fab or single chain Fv antibody fragments (scFv) fragments are complexed into dimers, trimers or larger aggregates. The most important

advantage of multivalent scFvs over monovalent scFv and Fab fragments is the gain in functional binding affinity (avidity) to target antigens. High avidity requires that scFv multimers are capable of binding simultaneously to separate target antigens. The gain in functional affinity for scFv diabodies compared to scFv monomers is significant and is seen primarily in reduced off-rates, which result from multiple binding to two or more target antigens and to rebinding when one Fv dissociates. When such scFv molecules associate into multimers, they can be designed with either high avidity to a single target antigen or with multiple specificities to different target antigens. Multiple binding to antigens is dependent on correct alignment and orientation in the Fv modules. For full avidity in multivalent scFvs target, the antigen binding sites must point towards the same direction. If multiple binding is not sterically possible then apparent gains in functional affinity are likely to be due the effect of increased rebinding, which is dependent on diffusion rates and antigen concentration. Antibodies conjugated with moieties that improve their properties are also contemplated for the instant invention. For example, antibody conjugates with PEG that increases their half-life in vivo can be used for the present invention. Immune libraries are prepared by subjecting the genes encoding variable antibody fragments from the B lymphocytes of naive or immunized animals or patients to PCR amplification. Combinations of oligonucleotides which are specific for immunoglobulin genes or for the immunoglobulin gene families are used. Immunoglobulin germ line genes can be used to prepare semisynthetic antibody repertoires, with the complementarity-determining region of the variable fragments being amplified by PCR using degenerate primers. These single-pot libraries have the advantage that antibody fragments against a large number of antigens can be isolated from one single library. The phage-display technique can be used to increase the affinity of antibody fragments, with new libraries being prepared from already existing antibody fragments by random, codon-based or site-directed mutagenesis, by shuffling the chains of individual domains with those of fragments from naive repertoires or by using bacterial mutator strains. [00150] Alternatively, a SCID-hu mouse, for example the model developed by Genpharm, can be used to produce antibodies, or fragments thereof. In one embodiment, a new type of high avidity binding molecule, termed peptabody, created by harnessing the effect of multivalent interaction is contemplated. A short peptide ligand was fused via a semirigid hinge region with the coiled-coil assembly domain of the cartilage oligomeric matrix protein, resulting in a pentameric multivalent binding molecule. In some embodiments of this

invention, ligands and/or chimeric inhibitors can be targeted to tissue- or tumor- specific targets by using bispecific antibodies, for example produced by chemical linkage of an anti- ligand antibody (Ab) and an Ab directed toward a specific target. To avoid the limitations of chemical conjugates, molecular conjugates of antibodies can be used for production of recombinant bispecific single-chain Abs directing ligands and/or chimeric inhibitors at cell surface molecules. Alternatively, two or more active agents and or inhibitors attached to targeting moieties can be administered, wherein each conjugate includes a targeting moiety, for example, a different antibody. Each antibody is reactive with a different target site epitope (associated with the same or a different target site antigen). The different antibodies with the agents attached accumulate additively at the desired target site. Antibody-based or non- antibody-based targeting moieties can be employed to deliver a ligand or the inhibitor to a target site. Preferably, a natural binding agent for an unregulated or disease associated antigen is used for this purpose.

[00151] In some embodiments, an agent which inhibits EXOl is a domain antibody or a non- immunoglobulin binding protein such as darpin, adnectin,or an avimer. Avimers are multi- domain proteins with binding and inhibiting properties and are comprised typically of multiple independent binding domains linked together, and as such creates avidity and improved affinity and specificity as compared to conventional single epitope binding proteins such as antibodies. In some embodiments, one can use an avimer that is a protein or polypeptide that can bind simultaneously to a single protein target and/or multiple protein targets, as known as multi-point attachment in the art. Avimers are useful as therapeutic agents which function on multiple drug targets simultaneously, for the inhibition of EXOl at the mitochondria and in neuronal cells, thus enabling the simultaneous treatment of neurodegenerative diseases and mitochondrial disorders.

Neurodegenerative diseases

[00152] In some embodiments, the methods and compositions as disclosed herein are useful for preventing and treating a subject having or at risk of developing a neurodegenerative disease or disorder. In particular, the methods and compositions as disclosed herein are useful for treatment of neurodegenerative diseases where there is oxidative stress, for example increase in reactive oxygen species (ROS). In other embodiments, the methods as disclosed herein are useful for treating a neurodegenerative disease that has oxidative DNA damage, for

example diseases where there is an increase in the oxidative damage to bases and sugar backbone in neurons such as single strand breaks, double strand breaks, apurininic, apyramidinic sites, DNA cross-linking and base modifications. One such method to identify a neurodegenerative disease amenable to treatment by the methods and compositions as disclosed herein includes identification of the presence of oxidized base modifications such as 8-OHdG in cells, for example in neurons, or a decrease in glutathione levels in brain and/or spinal cord, which can be measured by the assays as disclosed herein in the Examples. [00153] Examples of neurodegenerative diseases useful to be treated by the method and compositions as disclosed herein include but not limited to: amyotrophic lateral sclerosis (ALS), Parkinson's disease, Huntington's disease, Wilson's disease, multi-system atrophy, Alzheimer's disease, Pick's disease, Lewy- body disease, Hallervorden-Spatz disease, torsion dystonia, hereditary sensorimotor neuropathies (HMSN), Gerstmann-Skaussler-Schanker; disease, Creutzfeld-Jakob-disease, Machado-Joseph disease, Friedreich ataxia, Non- Friedreich ataxias, Gilles de Ia Tourette syndrome, familial tremors, olivopontocerebellar degenerations, paraneoplastic cerebral syndromes, hereditary spastic paraplegias (HSPs), hereditary optic neuropathy (Leber), retinitis pigmentosa, Stargardt disease, and Kearns-Sayre syndrome.

[00154] Further examples of neurodegenerative diseases useful to be treated by the method and compositions as disclosed herein include, for example: Alexander disease, Alper's disease, Ataxia telangiectasia, Batten disease, Bovine spongiform encephalopathy (BSE), Canavan disease, Cockayne syndrome, Corticobasal degeneration, Huntington disease, HIV- associated dementia, Kennedy's disease, Krabbe disease, Lewy body dementia, Multiple sclerosis, Multiple System Atrophy, Pelizaeus-Merzbacher Disease, Primary lateral sclerosis (PLS), Prion diseases, Refsum's disease, Sandhoff disease, Schilder's disease, Schizophrenia, Spielmeyer-Vogt-Sjogren-Batten disease, Spinocerebellar ataxia, Spinal muscular atrophy, Steele-Richardson-Olszewski disease, or Tabes dorsalis.

[00155] Further neurodegenerative disorders amenable to treatment using the methods and compositions as disclosed herein include, for example, stroke (including all form of ischemic stroke), traumatic brain injury (TBI), epilepsy, Alpers' disease, Autosomal Dominant Neurodegenerative Disorder, Cerebral calcinosis, corticobasal ganglionic degeneration, Dementia with Lewy Bodies, Lewy Body Variant, Multiple System Atrophy, Neuronal inkanuclear inclusion disease, Olivopontocerebellar Atrophy, peripheral neuropathy

Postpoliomyelitis Syndrome, Progressive Supranuclear Palsy, Rett Syndrome, Shy- Drager Syndrome, Tauopathies, Tri-nucleotide repeat diseases, and Tuberous Sclerosis. Further examples of neurodegenerative disorders, include for example cerebrovascular accidents (CVA), vascular-related dementia, peripheral disorders with a CNS component, such as septic shock, hepatic encephalopathy, (diabetic) hypertension, diabetic microangiopathy, sleeping sickness, Whipple disease, Duchenne muscular dystrophy (DMD) and (pre)eclampsia, neuropsychiatry disorders, such as depression, autism, anxiety attention deficit hyperactivity disorder (ADHD), bipolar disorder and other psychoses.

[00156] Parkinson's disease (which is classically characterized chiefly by depigmentation of the substantia nigra and by the presence of Lewy bodies) and Parkinsonian Syndromes (or Parkinsonian disorders) are useful to be treated by the method and compositions as disclosed herein. Parkinson's disease differs from other parkinsonian disorders based on clinicopathologic criteria. (Dauer and Przedborski (2003), Neuron, 39, 889-909). Examples of Parkinsonism syndromes include, but are not limited to; Parkinson's disease, Secondary Parkinsonism, a familial neurodegenerative disease or a Parkinsonism plus syndrome. Classification of Parkinsonism is briefly: Primary (idiopathic) Parkinsonism-Parkinson's disease (sporadic, familial), Secondary (acquired, symptomatic) Parkinsonism-infectious (postencephalitic, slow virus), drug-induced (dopamine antagonists and depletors), Hemiatrophy (hemiparkinsonism), Hydrocephalus (normal pressure hydrocephalus), hypoxia, infectious (postencephalistis), metabolic (parathyroid dysfunction), toxin (MPTP, CO, Mn, Hg. CS2, methanol, ethanol), Trauma (pugilistic encephalopathy), tumor, and vascular (multinfarct state), Heredodegenerative Parkinsonism-Huntington's disease, Wilson's disease, Hallervorden-Spatz disease, Olivopontocerebellar and spinocerebeller degenerations, neuroacanthocytosis, Lubag (X-linked dystonia-parkinsonism) , and mitochondrial cytopathies with stratial necrosis Multiple system degenerations (parkinsonism plus)-Cortical- basal ganglionic degeneration, Dementia syndromes (Alzheimer's diseases, diffuse Lewy body disease, frontotemporal dementia), Lytico-Bodig (Guamanian Parkinsonism-dementia- ALS), Multiple system atrophy syndromes (striatonigral degeneration, Shy- Drager syndrome, sporadic olivopontocerebellar degeneration (OPAC), motor neuron disease parkinsonism), Progressive pallidal atrophy, and progressive supranuclear palsy.

[00157] The methods and compositions as disclosed herein are also useful in the treatment of dementias, for example but not limited to, vascular dementia, dementia with Lewy bodies,

Downs syndrome, trisomy 13, frontotemporal dementia and Parkinsonism linked to chromosome 17, front and temporal dementias, progressive nuclear palsy, corticobasal degeneration, Huntington's disease, thalamic degeneration, Creutzfeldt-Jakob dementia, HIV dementia, schizophrenia with dementia, and Korsakoff s psychosis. [00158] Similarly, cognitive-related disorders, such as mild cognitive impairment, age- associated memory impairment, age-related cognitive decline, vascular cognitive impairment, attention deficit disorders (ADD), attention deficit hyperactivity disorders (ADHD), and memory disturbances in children with reaming disabilities can be treated using the methods and compositions as disclosed herein.

[00159] In some embodiments, the methods and compositions as disclosed herein are also useful in the treatment of pain and pain disorders. Pain includes, for example, nociceptive pain (pain as a result of injury to bodily tissues), including inflammatory pain, allodynia, hyperallodynia, and neuropathic (pain as a result of abnormalities to nerves, spinal cord and brain), including phantom limb pain, post-therapeutic neuralgia.

[00160] In further embodiments, the methods and compositions as disclosed herein are useful for treating disorders due to excitotoxic damage of neurons, or resulting from diseases or injuries that involve ischemia (inadequate blood flow, as occurs during a stroke or cardiac arrest) or hypoxia (inadequate oxygen supply, as occurs during drowning, carbon monoxide poisoning, etc.) or traumatic head injury.

[00161] In some embodiments, the methods and compositions as disclosed herein are also useful in treatment of neurological and psychiatric diseases associated with neural cell death include septic shock, intracerebral bleeding, subarachnoidal hemorrhage, multiinfarct dementia, inflammatory diseases (such as vasculitis, multiple sclerosis, and Guillain-Barre- syndrome), neurotrauma, peripheral neuropathies, polyneuropathies, epilepsies, schizophrenia, depression, metabolic encephalopathies, and infections of the central nervous system (viral, bacterial, fungal).

[00162] In yet another embodiment, the methods and compositions as disclosed herein are also useful to treat disorders where the tissue affected is in contact with neurons and/or the CNS, for example Anterior Horn Diseases including Poliomyelitis, Spinal Muscular Atrophy (e.g. Werding- Hoffman), Muscle Disorders, (e.g. Muscular Dystrophies including Duchene dystrophy, Becker dystrophy, Limb Girdle dystrophy, Congenital Dystrophy, Facioscapulohumeral dystrophy, Distal dystrophy, and Oculopharyngeal dystrophy,

Necrotizing Myopathies including Polymyositis, and Dermatomyositis, Metabolic Myopathies including Malignant Hyperthermia, Mitochondrial Myopathies, Myotonic Disorders, and Congenital Myopathies), diseases of the Neuromuscular Junction, (e.g. Myasthenia Gravis, and Eaton - Lambert Syndrome), diseases of the Peripheral Nerve, (e.g. Metabolic Neuropathies including Diabetes Mellitus, Vitamin deficiency, Uremia, and Porphyria, Toxic Neuropathies including alcohol, vincristine, isoniazid, arsenic, lead, hexane, hexachlorophene, acrylamide, and triethyltin, Vasculitic Neuropathies including Polyarteritis nodosa, Churg- Strauss Syndrome, and Rheumatoid artritis, Inflammatory Neuropathies including Guillain- Barre and Chronic Inflammatory demyelinating neuropathy, Hypertrophic Neuropathies including Charcot-Marie- Tooth Disease, Dejerine-Sottas Neuropathy, and Refsum's Disease, Genetic Neuropathies including the various forms of leukodystrophy, Ataxia-telangiectasia and Giant Axonal Neuropathy, Infectious Neuropathies including Herpes Zoster Neuritis, Herpes Simplex, and Leprosy, Diabetic Neuropathies including Distal symmetrical primarily sensory neuropathy, Autonomic Neuropathy, Proximal asymmetrical painful primary neuropathy, and Cranial mononeuropathy.

Identification of a subject with or at risk of a neurodegenerative disease or disorder. [00163] A clinician can diagnose a subject with a neurodegenerative disease using a variety of neurophysical exams, neurological tests, genetic testing or assessment of clinical symptoms, or tests for biomarkers. Clinical tests are used to support a diagnosis of a neurodegenerative disease. Typical tests used for diagnosis of a neurodegenerative disease include, but are not limited to, neuroimaging, neurophysiologic studies, Magnetic resonance spectroscopy and exercise testing.

[00164] In some embodiments, a subject amenable to treatment by the methods and compositions as disclosed herein are positive for markers of oxidative stress. Markers of oxidative stress are commonly known to persons of ordinary skill in the art and are encompassed for use in the methods herein, and include, for example without limitations lipid peroxidation (alondialdehyde (MDA)), lipid hydroperoxide, protein oxidation (protein carbonyl groups and glutamine synthetase activity), excitatory transmission, N-acetyl aspartate, JV-acetylaspartylglutamate in the CFS, oxidative DNA damage (8-hydroxy-2'- deoxyguanosine), superoxide dismutase, endogenous antioxidants (ascorbic acid, α- tocopherol, glutathione, ubiquinone, ubiquinol, and cysteine), and decreased glutathione

levels. The predominant oxidative stress markers are increases in MDA, ascorbic acid, glutathione, cysteine, and cystine. One can also assay the markers of oxidative stress in tissue homogenates and/or mitochondrial fractions of the liver or brain or muscle. One can detect a subject with oxidative stress according to the method as disclosed in U.S. Patent Application 20050100979, which is incorporated herein in its entirety by reference. Other markers of oxidative stress include urinary and plasma malondialdehyde (MDA), 8-Isoprostane (Kinnula et al., Eur Respiratory J, 2007; 29;51-55; Montuschi et al, Am J Respiratory Crit Care Med, 1999; 160;216-220). One can also determine a subject with oxidative stress using commercially available kits, for example from Oxis International Inc., such as the Bioxytech® Assay Kits from OxisResearch®.

[00165] Subjects amenable to treatment using the methods as disclosed herein include subjects at risk of a neurodegenerative disease, for example Alzheimer's Disease but not showing symptoms, as well as subjects showing symptoms of the neurodegenerative disease, for example subjects with symptoms of Alzheimer' s Disease.

[00166] Subjects can be screened for their likelihood of having or developing Alzheimer's Disease based on a number of biochemical and genetic markers.

[00167] One can also diagnose a subject with increased risk of developing Alzheimer's Disease using genetic markers for Alzheimer's Disease. Genetic abnormality in a few families has been traced to chromosome 21 (St. George-Hyslop et al., Science 235:885-890, 1987). One genetic marker is, for example mutations in the APP gene, particularly mutations at position 717 and positions 670 and 671 referred to as the Hardy and Swedish mutations respectively (see Hardy, TINS, supra). Other markers of risk are mutations in the presenilin genes, PSl and PS2, and ApoE4, family history of Alzheimer's Disease, hypercholesterolemia or atherosclerosis. Subjects with APP, PSl or PS2 mutations are highly likely to develop Alzheimer's disease. ApoE is a susceptibility gene, and subjects with the e4 isoform of ApoE (ApoE4 isoform) have an increased risk of developing Alzheimer's disease. Test for subjects with ApoE4 isoform are disclosed in U.S. Patent 6,027,896, which is incorporated in its entirety herein by reference. Other genetic links have been associated with increased risk of Alzheimer's disease, for example variances in the neuronal sortilin-related receptor SORLl may have increased likelihood of developing late-onset Alzheimer' s disease (Rogaeva at al, Nat Genet. 2007 Feb;39(2): 168-77). Other potential Alzheimer disease susceptibility genes, include, for example ACE, CHRNB2, CST3, ESRl, GAPDHS, IDE, MTHFR, NCSTN,

PRNP, PSENl, TF, TFAM and TNF and be used to identify subjects with increased risk of developing Alzheimer's disease (Bertram et al, Nat Genet. 2007 Jan;39(l):17-23), as well as variences in the alpha-T catenin (VR22) gene (Bertram et al, J Med Genet. 2007 Jan;44(l):e63) and Insulin-degrading enzyme (IDE) and Kim et al, J Biol Chem. 2007;282:7825-32).

[00168] One can also diagnose a subject with increased risk of developing Alzheimer 's disease on the basis of a simple eye test, where the presence of cataracts and/or Abeta in the lens identifies a subject with increased risk of developing Alzheimer's Disease. Methods to detect Alzheimer' s disease include using a quasi-elastic light scattering device (Goldstein et al., Lancet. 2003;12;361:1258-65) from Neuroptix, using Quasi-Elastic Light Scattering (QLS) and Fluorescent Ligand Scanning (FLS) and a Neuroptix™ QEL scanning device, to enable non-invasive quantitative measurements of amyloid aggregates in the eye, to examine and measure deposits in specific areas of the lens as an early diagnostic for Alzheimer's disease. Method to diagnose a subject at risk of developing Alzheimers disease using such a method of non-invasive eye test are disclosed in U.S. Patent 7,107,092, which is incorporated in its entirety herein by reference.

[00169] Individuals presently suffering from Alzheimer's disease can be recognized from characteristic dementia, as well as the presence of risk factors described above. In addition, a number of diagnostic tests are available for identifying individuals who have AD. These include measurement of CSF tau and Ax3b242 levels. Elevated tau and decreased Ax3b242 levels signify the presence of Alzheimer's Disease.

[00170] There are two alternative "criteria" which are utilized to clinically diagnose Alzheimer's Disease: the DSM-IIIR criteria and the NINCDS-ADRDA criteria (which is an acronym for National Institute of Neurological and Communicative Disorders and Stroke (NINCDS) and the Alzheimer's Disease and Related Disorders Association (ADRDA); see McKhann et al., Neurology 34:939-944, 1984). Briefly, the criteria for diagnosis of Alzheimer's Disease under DSM-IIIR include (1) dementia, (2) insidious onset with a generally progressive deteriorating course, and (3) exclusion of all other specific causes of dementia by history, physical examination, and laboratory tests. Within the context of the DSM-IIIR criteria, dementia is understood to involve "a multifaceted loss of intellectual abilities, such as memory, judgement, abstract thought, and other higher cortical functions, and changes in personality and behaviour." (DSM-IIR, 1987).

[00171] In contrast, the NINCDS-ADRDA criteria sets forth three categories of Alzheimer's Disease, including "probable," "possible," and "definite" Alzheimer's Disease. Clinical diagnosis of "possible" Alzheimer's Disease may be made on the basis of a dementia syndrome, in the absence of other neurologic, psychiatric or systemic disorders sufficient to cause dementia. Criteria for the clinical diagnosis of "probable" Alzheimer's Disease include (a) dementia established by clinical examination and documented by a test such as the Mini- Mental test (Foldstein et al., J. Psych. Res. 12:189-198, 1975); (b) deficits in two or more areas of cognition; (c) progressive worsening of memory and other cognitive functions; (d) no disturbance of consciousness; (e) onset between ages 40 and 90, most often after age 65; and (f) absence of systemic orders or other brain diseases that could account for the dementia. The criteria for definite diagnosis of Alzheimer's Disease include histopathologic evidence obtained from a biopsy, or after autopsy. Since confirmation of definite Alzheimer's Disease requires histological examination from a brain biopsy specimen (which is often difficult to obtain), it is rarely used for early diagnosis of Alzheimer's Disease. [00172] One can also use neuropathologic diagnosis of Alzheimer's Disease, where the numbers of plaques and tangles in the neurocortex (frontal, temporal, and parietal lobes), hippocampus and amygdala are analyzed (Khachaturian, Arch. Neurol. 42:1097-1105; Esiri, "Anatomical Criteria for the Biopsy diagnosis of Alzheimer's Disease," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 239-252, 1990). [00173] One can also use quantitative electroencephalographic analysis (EEG) to diagnose Alzheimer's Disease. This method employs Fourier analysis of the beta, alpha, theta, and delta bands (Riekkinen et al., "EEG in the Diagnosis of Early Alzheimer's Disease," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 159-167, 1990) for diagnosis of Alzheimer's Disease.

[00174] One can also diagnose Alzheimer's Disease by quantifying the degree of neural atrophy, since such atrophy is generally accepted as a consequence of Alzheimer's Disease. Examples of these methods include computed tomographic scanning (CT), and magnetic resonance imaging (MRI) (Leedom and Miller, "CT, MRI, and NMR Spectroscopy in Alzheimer's Disease," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 297-313, 1990).

[00175] One can also diagnose Alzheimer's Disease by assessing decreased cerebral blood flow or metabolism in the posterior temporoparietal cerebral cortex by measuring decreased

blood flow or metabolism by positron emission tomography (PET) (Parks and Becker, "Positron Emission Tomography and Neuropsychological Studies in Dementia," Alzheimer's Disease's, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 315-327, 1990), single photon emission computed tomography (SPECT) (Mena et al., "SPECT Studies in Alzheimer's Type Dementia Patients," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 339-355, 1990), and xenon inhalation methods (Jagust et al., Neurology 38:909-912; Prohovnik et al., Neurology 38:931-937; and Waldemar et al., Senile Dementias: II International Symposium, pp. 399407, 1988). [00176] One can also immunologically diagnose Alzheimer's disease (Wolozin, "Immunochemical Approaches to the Diagnosis of Alzheimer's Disease," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 217-235, 1990). Wolozin and coworkers (Wolozin et al., Science 232:648-650, 1986) produced a monoclonal antibody "Alz50," that reacts with a 68-kDa protein "A68," which is expressed in the plaques and neuron tangles of patients with Alzheimer's disease. Using the antibody Alz50 and Western blot analysis, A68 was detected in the cerebral spinal fluid (CSF) of some Alzheimer's patients and not in the CSF of normal elderly patients (Wolozin and Davies, Ann. Neurol. 22:521-526, 1987).

[00177] One can also diagnose Alzheimer's disease using neurochemical markers of Alzheimer's disease. Neurochemical markers which have been associated with Alzheimer's Disease include reduced levels of acetylcholinesterase (Giacobini and Sugaya, "Markers of Cholinergic Dysfunction in Alzheimer's Disease," Alzheimer's Disease, Current Research in Early Diagnosis, Becker and Giacobini (eds.), pp. 137-156, 1990), reduced somatostatin (Tamminga et al., Neurology 37:161-165, 1987), a negative relation between serotonin and 5- hydroxyindoleacetic acid (Volicer et al., Arch Neurol. 42:127-129, 1985), greater probenecid- induced rise in homovanyllic acid (Gibson et al., Arch. Neurol. 42:489-492, 1985) and reduced neuron- specific enolase (Cutler et al., Arch. Neurol. 43:153-154, 1986). [00178] In some embodiments, a subject amenable to treatment by the methods and compositions as disclosed herein are positive for markers of a neurodegenerative disease, such as for example, detection of beta amyloid plaques and peptides. Antibodies and methods of their use which recognize the presence of beta-amyloid proteins are well known in the art, such as US7179892: Humanized antibodies that recognize beta amyloid peptide; US7318923:

Humanized anti-β antibodies; US7179463: Treatment of Alzheimer's disease, which are incorporated herein by reference.

Mitochondrial disorders

[00179] In some embodiments, the methods and compositions as disclosed herein are useful for preventing and treating a subject having or at risk of developing a mitochondrial disease or disorder. Mitochondrial disorders are a group of disorders relating to mitochondria, the organelles that convert the energy of food molecules into the ATP that powers most cell functions.

[00180] Mitochondrial diseases are a clinically heterogeneous group of disorders that arise as a result of dysfunction of the mitochondrial respiratory chain. In some instances, they can be caused by mutations of nuclear or mitochondrial DNA (mtDNA). Some mitochondrial disorders only affect a single organ (such as the eye in Leber hereditary optic neuropathy [LHON]), but many involve multiple organ systems and often present with prominent neurologic and myopathic features.

[00181] Mitochondrial disorders comprise those disorders that in one way or another affect the function of the mitochondria and/or are due to mitochondrial DNA. Mitochondrial diseases take on unique characteristics both because of the way the diseases are often inherited and because mitochondria are so critical to cell function. The subclass of these diseases that have neuromuscular disease symptoms are often referred to as a mitochondrial myopathy. [00182] In particular, the methods and compositions as disclosed herein are useful for treatment of mitochondrial disorders where there is oxidative stress, for example increase in reactive oxygen species (ROS). In other embodiments, the methods as disclosed herein are useful for treating mitochondrial disorders that have oxidative DNA damage of mitochondrial DNA (mtDNA), for example diseases where there is an increase in the oxidative damage to bases and sugar backbone in neurons such as single strand breaks, double strand breaks, apurininic , apyramidinic sites, DNA cross-linking and base modifications. One such method to identify a mitochondrial disorders amenable to treatment by the methods and compositions as disclosed herein include identification of the presence of oxidized base modifications such as 8-OHdG in cells, for example in mitochondrial fraction of a tissue homogenate. [00183] Mitochondrial disorders may present at any age. In general terms, nuclear DNA mutations present in childhood and mtDNA mutations (primary or secondary to a nuclear

DNA abnormality) present in late childhood or adult life. Many affected individuals display a cluster of clinical features that fall into a discrete clinical syndrome, such as the Kearns-Sayre syndrome (KSS), chronic progressive external ophthalmoplegia (CPEO), mitochondrial encephalomyopathy with lactic acidosis and stroke-like episodes (MELAS), myoclonic epilepsy with ragged-red fibers (MERRF), neurogenic weakness with ataxia and retinitis pigmentosa (NARP), or Leigh syndrome (LS). However, considerable clinical variability exists and many individuals do not fit neatly into one particular category. Common clinical features of mitochondrial disease include ptosis, external ophthalmoplegia, proximal myopathy and exercise intolerance, cardiomyopathy, sensorineural deafness, optic atrophy, pigmentary retinopathy, and diabetes mellitus. The central nervous system findings are often fluctuating encephalopathy, seizures, dementia, migraine, stroke-like episodes, ataxia, and spasticity. A high incidence of mid- and late pregnancy loss is a common occurrence that often goes unrecognized.

[00184] As used herein, the term "mitochondrial myopathy" refers to myopathy associated with mitochondrial disease. Examples of mitochondrial myopathy include, for example but are not limited to, mitochondrial encephalomyopathy, lactic acidosis, and stroke-like syndrome (MELAS), varying degrees of cognitive impairment and dementia, lactic acidosis, stroke, transient ischemic attacks, hearing loss, dysmotility, weight loss, Myoclonic epilepsy and ragged-red fibers (MERRF), progressive myoclonic epilepsy, clumps of diseased mitochondria accumulate in the subsarcolemmal region of the muscle fiber and appear as "ragged-red fibers" when muscle is stained with modified Gomori trichrome stain, short stature, Kearns-Sayre syndrome (KSS), external ophthalmoplegia, cardiac conduction defects, sensory-neural hearing loss, Progressive external ophthalmoplegia (PEO), progressive ophthalmoparesis is the cardinal feature symptomatic overlap with many other mitochondrial myopathies.

[00185] Other mitochondrial diseases amenable to treatment using the methods as disclosed herein include, for example but are not limited to, Diabetes mellitus and deafness (DAD) which if both occur at an early age can be due to mitochondrial disease, Leber hereditary optic neuropathy (LHON), visual loss beginning in young adulthood, Wolff-Parkinson- White syndrome, multiple sclerosis-type disease, Leigh syndrome, subacute sclerosing encephalopathy after normal development the disease usually begins late in the first year of life, but the onset may occur in adulthood a rapid decline in function occurs and is marked by

seizures, altered states of consciousness, dementia, ventilatory failure, Neuropathy, ataxia, retinitis pigmentosa and ptosis (NARP), dementia, Myoneurogenic gastrointestinal encephalopathy (MNGIE), gastrointestinal pseudo-obstruction and neuropathy. [00186] Other mitochondrial diseases amenable to treatment using the methods as disclosed herein include, for example but are not limited to, Encephalomyopathies, Kearns-Sayre syndrome, Pearson syndrome, MNGIE (Myopathy and external ophthalmoplegia; Neuropathy; Gastro-Intestinal; Encephalopathy) syndrome, Leigh syndrome, Wolfram syndrome, MELAS (Mitochondrial Encephalomyopathy; Lactic Acidosis; Stroke) syndrome, MERRF (Myoclonic Epilepsy; Ragged Red Fibers) syndrome, NARP/MILS (Neuropathy; Ataxia; Retinitis Pigmentosa) syndrome, external ophthalmoplegia (PEO), Leber's optic neuropathy, Ocular Myopathy, Cardiomyopathy, Myositis, Myopathy, Rhabdomyolysis, Sensory neuropathy, Infantile myopathy, Ataxia, Leukodystrophy, Diabetes, Deafness, Diabetes-Deafness Syndrome, Maternally Inherited Deafness & Diabetes (MIDD), Mitochondrial Myopathies, Aging, Alpers syndrome, Barth syndrome, Carnitine Deficiency, mitochondrial complex I deficiency, mitochondrial complex II deficiency, mitochondrial complex III deficiency, mitochondrial complex IV deficiency, mitochondrial complex V deficiency, LCAD (acyl-coa dehydrogenase, long-chain) deficiency, liver disease, SCAD (acyl-coa dehydrogenase, short-chain) deficiency, HAD or SCHAD (3-@hydroxyacyl-coa dehydrogenase; HADH) deficiency, VLCAD (acyl-coa dehydrogenase, very long-chain) deficiency.

[00187] Mitochondrial disorders may be caused by defects of nuclear DNA or mtDNA. Nuclear gene defects may be inherited in an autosomal recessive manner or an autosomal dominant manner. Mitochondrial DNA defects are transmitted by maternal inheritance. Mitochondrial DNA deletions generally occur de novo and thus cause disease in one family member only, with no significant risk to other family members. Mitochondrial DNA point mutations and duplications may be transmitted down the maternal line. The father of a proband is not at risk of having the disease-causing mtDNA mutation, but the mother of a proband (usually) has the mitochondrial mutation and may or may not have symptoms (i.e. be asymptomatic). A male does not transmit the mtDNA mutation to his offspring. A female harboring a heteroplasmic mtDNA point mutation may transmit a variable amount of mutant mtDNA to her offspring, resulting in considerable clinical variability among sibs within the

same family. Prenatal genetic testing and interpretation of test results for mtDNA disorders are difficult because of mtDNA heteroplasmy.

[00188] Disorders of mitochondrial dysfunction. Mitochondrial dysfunction is also seen in a number of different genetic disorders, including dominant optic atrophy (mutations in OPAl) [Alexander et al 2000], Friedreich ataxia (FRDA) [Rotig et al 1997], hereditary spastic paraplegia (SPG7) [Casari et al 1998], and Wilson disease (ATP7B) [Lutsenko & Cooper 1998], and also as part of the aging process. Alpers-Huttenlocher syndrome is another disease characterized by mitochondrial dysfunction and characterized by hypotonia, seizures, liver failure and renal tubulopathy, is caused by mutations in POLGl. Inheritance is autosomal recessive.

[00189] The clinical symptoms of some mitochondrial disorders amenable to treatment using the methods as disclosed herein are listed in Table 1 below. It should be noted that this list is not extensive for the mitochondrial disorders amenable to treatment using the methods as disclosed herein.

[00190] Table 1. Disorder Primary Features Additional Features

• External

Chronic progressive ophthalmoplegia • Mild proximal myopathy external ophthaloplegia • Bilateral ptosis (CPEO)

• PEO onset before age 20 years ... , , . J? • Bilateral deafness • Pigmentary _λ , _it _ . , • Myopathy retinopathy _ , . „ K. ^J • Dysphagia

Kearns-Sayre syndrome • One of the _ r £ * _n . _r ,, . _{^n ^} • Diabetes mellitus

(KSS) following: CSF „ ., . .. ° , • Hypoparathyroidism protein greater than _T V • _{λ /τ} , ,, • Dementia lg/L, cerebellar ataxia, heart block

• Sideroblastic anemia of childhood • Pancytopenia • Renal tubular defects

Pearson syndrome • Exocrine pancreatic failure

Infantile myopathy and • Hypotonia in the • Fatal form may be

Disorder Primary Features Additional Features lactic acidosis (fatal and first year of life associated with a non-fatal forms) • Feeding and cardiomyopathy and/or the respiratory Toni-Fanconi-Debre difficulties syndrome

• Subacute relapsing _T , , ■,- , _{T 1 1} • Basal ganglia lucencies e _n ncep [h „alopath ,y • Materna il £ hi•s ,t,ory o _c f • Cerebellar and . . ..

Leigh Syndrome (LS) , . . neurologic disease or brain-stem signs _τ . , , _τ . .. ° Leigh syndrome • Infantile onset

• Late-childhood or adu .lt-.onse. t • _^ Basail gang ili-a i lucencies peripheral . . ,

Neurogenic weakness with . • Abnormal neuropathy . . ataxia and retinitis . . ^J electroretinogram pigmentosa (NARP) _. • Sensorimotor neuropathy • Pigmentary retinopathy

• Stroke-like episodes _ . . ... , . .^ • Diabetes mellitus b „ef .ore age 4 ,0 , years • C ^ard _J i-omyopa _λ th.y ( _r ini • _< t.i-a _n lly

Mitochondrial • Seizures and/or . . . ^ ₁ ,., ,, . . hypertrophic; later dilated) encephalomyopathy with dementia .5 , , . _ , , _, • Bilateral deafness lactic acidosis and stroke- • Ragged-red fibers _j P ₁ • Pigmentary retinopathy like episodes (MELAS) and/or lactic „ ^B _u .. \ . ^{F 3} . . . • Cerebellar ataxia acidosis

• Dementia • Myoclonus • Optic atrophy

Myoclonic epilepsy with • Seizures • Bilateral deafness ragged-red fibers • Cerebellar ataxia • Peripheral neuropathy (MERRF) • Myopathy • Spasticity • Multiple lipomata

• Subacute painless bilateral visual _ . .

T . Jl 1., 111 T ^* f^ • Dystonia

Leber hereditary optic , , , . , . ₁ • Cardiac pre-excitation • Males:females -4:1 , neuropathy (LHON) , , ,. , syndromes • Median age of onset

24 years

Identification of a subject with or at risk of developing a mitochondrial disorder. [00191] One can diagnose a subject with a mitochondrial disorders using genetic testing or assessment of clinical symptoms, or tests for biomarkers. Clinical tests are used to support a diagnosis of mitochondrial disease [Chinnery & Turnbull 1997]. Typical tests used for diagnosis of a mitochondrial disorder include, but are not limited to, neuroimaging, neurophysiologic studies, magnetic resonance spectroscopy and exercise testing, glucose tests, electrocardiography and echocardiography, measurement of blood lactate and muscle biopsy, and are well known by persons of ordinary skill in the art and are all encompassed for identifying a subject with a mitochondrial disorder and amenable to treatment using the methods and compositions as disclosed herein.

[00192] In one embodiment, one can diagnose a subject with a mitochondrial disorder by neuroimaging, for example subjects with suspected CNS disease. CT may show basal ganglia calcification and/or diffuse atrophy. MRI may show focal atrophy of the cortex or cerebellum, or high signal change on T2- weighted images, particularly in the occipital cortex [Scaglia et al 2005]. There may also be evidence of a generalized leukoencephalopathy [Barragan-Campos et al 2005]. Cerebellar atrophy is a prominent feature in pediatric cases [Scaglia et al 2005]. [00193] In one embodiment, one can diagnose a subject with a mitochondrial disorder by Neurophysiologic studies. Electroencephalography (EEG) is indicated in individuals with suspected encephalopathy or seizures. Encephalopathy may be associated with generalized slow wave activity on the EEG. Generalized or focal spike and wave discharges may be seen in individuals with seizures. Peripheral neurophysiologic studies are indicated in individuals with limb weakness, sensory symptoms, or areflexia. Electromyography (EMG) is often normal but may show myopathic features. Nerve conduction velocity (NCV) may be normal, or may show a predominantly axonal sensorimotor polyneuropathy. [00194] One can also diagnose a subject with a mitochondrial disorder using magnetic resonance spectroscopy and exercise testing (with measurement of blood concentration of lactate), to detect evidence of abnormal mitochondrial function in a non-invasive manner. [00195] One can also diagnose a subject with a mitochondrial disorder by measuring blood glucose levels. An elevated concentration of fasting blood glucose may indicate diabetes mellitus and possible mitochondrial dysfunction.

[00196] Both electrocardiography and echocardiography may indicate cardiac involvement (cardiomyopathy or atrioventricular conduction defects).

[00197] One can also diagnose a subject with a mitochondrial disorder by using magnetic resonance spectroscopy and exercise testing may also be of use to detect an elevated lactate level in brain or muscle at rest, or a delay in the recovery of the ATP peak in muscle after exercise.

[00198] One can also diagnose a subject with a mitochondrial disorder by measuring blood and CSF lactate/pyruvate levels. Measurement of blood lactate concentration is indicated in individuals with features of a myopathy or CNS disease. Fasting blood lactate concentrations above 3.0 mm/L support a diagnosis of mitochondrial disease. Measurement of CSF lactate concentration is indicated in individuals with suspected CNS disease. Fasting CSF lactate concentrations above 1.5 mm/L support a diagnosis of mitochondrial disease.

[00199] One can also diagnose a subject with a mitochondrial disorder by performing a muscle biopsy. Specific tests of mitochondrial disease include a muscle biopsy that is analyzed for histologic or histochemical evidence of mitochondrial disease. Respiratory chain complex studies are then usually carried out on skeletal muscle or skin fibroblasts [Thorburn et al 2004].

[00200] One can diagnose a subject with a mitochondrial disorder using genetic testing or assessment of clinical symptoms. In some individuals, the clinical picture is characteristic of a specific mitochondrial disorder (e.g., LHON, NARP, or maternally inherited LS), and in some embodiments, diagnosis can be confirmed by molecular genetic testing of DNA extracted from a blood sample.

[00201] Molecular genetic testing may be carried out on genomic DNA extracted from blood

(suspected nuclear DNA mutations and some mtDNA mutations), or genomic DNA extracted from muscle (suspected mtDNA mutations). Studies for mtDNA mutations are usually carried out on skeletal muscle DNA because a pathogenic mtDNA mutation may not be detected in

DNA extracted from blood. Southern blot analysis may reveal a pathogenic mtDNA rearrangement. The deletion or duplication breakpoint may then be mapped by mtDNA sequencing. Targeted mutation analysis of a panel of genes may be performed. If a recognized point mutation is not identified, the entire mitochondrial genome may be sequenced.

[00202] Diagnosis can also be determined by analysis of family history, blood and/or CSF lactate concentration, neuroimaging, cardiac evaluation, and muscle biopsy for histologic or histochemical evidence of mitochondrial disease, and molecular genetic testing for a mtDNA

mutation. In some individuals the clinical picture is characteristic of a specific mitochondrial disorder (e.g., LHON, NARP, or maternally inherited LS). Clinical tests are used to define the extent of the phenotype and the diagnosis can be confirmed by molecular genetic testing of DNA extracted from a blood sample. In many individuals this is not the case, and a more structured approach is needed.

[00203] In some embodiments, where subjects are identified to be at risk of developing a mitochondrial disorder on the basis of family history, diagnosis can be combined with molecular genetic testing. Many of the childhood-onset encephalomyopathies are single occurrences in a family and may be caused by recessive nuclear gene defects or mtDNA defects. A clear maternal inheritance pattern (no male transmissions) may indicate an underlying mtDNA defect. The range of clinical features of mtDNA disease is broad, and there may be many oligo symptomatic family members (for example, some with diabetes mellitus, or mild sensorineural deafness as the only feature). A clear autosomal dominant pattern of inheritance may be seen in individuals with PEO.

[00204] In many subjects, a mitochondrial dysfunction or a mitochondrial disorder should be considered in the differential diagnosis of any progressive multisystem disorder. As diagnosis is often challenging when only one symptom is present and easier when two or more seemingly unrelated symptoms are present, involving more than one organ system. The investigation can be relatively straightforward if a subject has a recognizable phenotype and if it is possible to identify a known pathogenic mtDNA mutation. The difficulty arises when no mtDNA defect can be found or when the clinical abnormalities are complex and not easily matched to those of more common mitochondrial disorders.

[00205] In some embodiments, subjects are identified as having a mitochondrial disorder on a full mitochondrial evaluation, which is recommended and warranted in children with a complex neurologic picture or a single neurologic symptom and other system involvement. When the presentation is classic for a maternally inherited mitochondrial syndrome, such as MELAS , MERRF , or Leber hereditary optic neuropathy , appropriate mtDNA studies should be obtained first.

[00206] When the clinical picture is classic for a nuclear DNA-inherited syndrome and the gene or linkage is known (such as mitochondrial neurogastrointestinal encephalomyopathy (MNGIE), autosomal PEO with multiple secondary deletions, or Alpers-Huttenlocher syndrome), the clinician should proceed with molecular genetic studies.

[00207] When the clinical picture is nonspecific but highly suggestive of a mitochondrial disorder, the clinician should start with measurement of plasma or CSF lactic acid concentration, ketone bodies, plasma acylcarnitines, and urinary organic acids. If these studies are abnormal, the clinician should proceed with muscle biopsy and assessment of the respiratory chain enzymes. Normal plasma or CSF lactic acid concentration does not exclude the presence of a mitochondrial disorder.

Retinal diseases.

[00208] In some embodiments, the methods and compositions as disclosed herein are useful for preventing and treating a subject having or at risk of developing a retinal disease or disorder. In particular, the methods and compositions as disclosed herein are useful for treatment of retinal diseases or disorders where there is oxidative stress, for example increase in reactive oxygen species (ROS). In other embodiments, the methods as disclosed herein are useful for treating retinal diseases or disorders that have oxidative DNA damage in retinal cells, for example diseases where there is an increase in the oxidative damage to bases and sugar backbone in neurons such as single strand breaks, double strand breaks, apurininic, apyramidinic sites, DNA cross-linking and base modifications. One such method to identify retinal diseases or disorders amenable to treatment by the methods and compositions as disclosed herein include identification of the presence of oxidized base modifications such as 8-OHdG in cells, for example in retinal cells. In some embodiments, the methods as disclosed herein are useful for treating retinal diseases or disorders where there is loss of ganglion cells and/or loss of inner nuclear cells and/or outer nuclear cells in the retina. [00209] Retinal diseases are a group of disorders relating to the eye. Eye diseases or retinal disorders include, for example, but are not limited to glaucoma, retinitis pigmentosa, retinoschisis, lattice degeneration, macular degeneration and age-related macula degeneration (AMD), retinal degeneration, retinopathy, diabetic retinopathy, Stargardt Disease, Endophthalmitis, Macular Pucker, optic neuritis, optic neuropathy, nyctalopia, central serous retinopathy.

In some embodiments, the methods and compositions as disclosed herein are useful for preventing and treating a subject having or at risk of developing a disease caused by defects in apoptosis. Such diseases include, for example but are not limited to cancer, inflammatory diseases, autoimmune diseases, immune diseases.

Assessment of inhibitors of EXOl on models of neurodegenerative diseases or mitochondrial disorders and/or oxidative DNA damage.

[00210] The suitability of an inhibitor of EXOl for the treatment of a neurodegenerative disease and/or mitochondrial disorder, and eye diseases can be assessed in any of a number of animal models for such disease.

[00211] In one embodiment for example, an inhibitor of EXOl can be assessed in the NMF205 mutant mouse (C57BL/6J-nmf205/J; available from The Jackson Laboratory with stock number 004823) as disclosed in the Examples herein. For example, an agent that functions to inhibit EXOl can be identified in the NMF205 mice as disclosed herein, where the mice are administered an inhibitor of EXOl and if the EXOl inhibitor reduces at least one symptom of ataxia and/or reduces the presence of oxidative DNA damage, for example 8- OHdG presence in cerebella granule neurons in the cerebellum and/or hippocampus, and/or increased glutathione level, and/or reduces loss or degeneration of neurons, cerebellar neurons, doperminergic neurons, retinal neurons, ganglion cells or cells in the inner or outer nuclear layer in the retina as compared to control NMF205 animals not treated with the EXOl inhibitor identifies an agent that inhibits EXOl suitable for the methods and compositions of the present invention. In alternative embodiments, cells from the NMF205 mouse can be used in an in vitro assay to identify the presence of an effective inhibitor of EXOl, where a reduction of nuclear 8-0HdG as compared to non-treated cells identifies an agent that is an effective EXOl inhibitor. Alternatively, glutathione levels in a tissue can be measured using an assay as disclosed herein in the Examples, or any other means to measure glutathione levels which is commonly known by a person of ordinary skill in the art, and if an increased level of glutathione level is detected in the presence of an agent (as compared to non-treated tissue or in the absence of such agent) it identifies the agent as an effective EXOl inhibitor. [00212] In alternative embodiments, other models of neurodegenerative diseases can be used, for example, mice transgenic for an expanded polyglutamine repeat mutant of ataxin-1 develop ataxia typical of spinocerebellar ataxia type 1 (SCA- 1) are known (Burright et al., 1995, Cell 82: 937-948; Lorenzetti et al., 2000, Hum. MoI. Genet. 9: 779-785; Watase, 2002, Neuron 34: 905- 919), and can be used to determine the efficacy of an agent inhibitor of EXOl for the treatment or prevention of neurodegenerative disease. Additional animal models, for example, for Huntington's disease (see, e.g., Mangiarini et al., 1996, Cell 87: 493-

506, Lin et al., 2001, Hum. MoI. Genet. 10: 137- 144), Alzheimer's disease (Hsiao, 1998, Exp. Gerontol, 33: 883-889; Hsiao et al., 1996, Science 274: 99-102), Parkinson's disease (Kim et al., 2002, Nature 418: 50-56), amyotrophic lateral sclerosis (Zhu et al., 2002, Nature 417: 74- 78), Pick's disease (Lee & Trojanowski, 2001, Neurology 56 (Suppl. 4): S26-S30, and spongiform encephalopathies (He et al., 2003, Science 299: 710-712) can be used to evaluate the efficacy of the agents that inhibit EXOl as disclosed herein in a similar manner. [00213] Animal models are not limited to mammalian models. For example, Drosophila strains provide accepted models for a number of neurodegenerative disorders (reviewed in Fortini & IBonini, 2000, Trends Genet. 16: 161-167; Zoghbi & Botas, 2002, Trends Genet. 18: 463-471). These models include not only flies bearing mutated fly genes, but also flies bearing human transgenes, optionally with targeted mutations. Among the Drosophila models available are, for example, spinocerebellar ataxias (e.g., SCA-I (see, e.g., WO 02/058626), SCA-3 (Warrick et al., 1998, Cell 93: 939-949)), Huntington's disease (Kazemi-Esfarjani & Benzer, 2000, Science 287: 1837-1840), Parkinson's disease (Feany et al, 2000, Nature 404: 394-398; Auluck et al. , 2002, Science 295: 809-8 10), age-dependent neurodegeneration (Genetics, 2002,161:4208), Alzheimer's disease (Selkoe et al., 1998, Trends Cell Biol. 8: 447- 453; Ye et al., 1999, J. Cell Biol. 146: 1351- 1364), amyotrophic lateral sclerosis (Parkes et al., 1998, Nature Genet. 19: 171-174), and adrenoleukodystrophy.

[00214] The use of Drosophila as a model organism has proven to be an important tool in the elucidation of human neurodegenerative pathways, as the Drosophila genome contains many relevant human orthologs that are extremely well conserved in function (Rubin, G.M., et al., Science 287: 2204-2215 (2000)). For example, Drosophila melanogaster carries a gene that is homologous to human APP which is involved in nervous system function. The gene, APP- like (APPL), is approximately 40% identical to APP695, the neuronal isoform (Rosen et al., Proc. Natl. Acad. Sci. U.S.A. 86:2478-2482 (1988)), and like human APP695 is exclusively expressed in the nervous system. Flies deficient for the APPL gene show behavioral defects which can be rescued by the human APP gene, suggesting that the two genes have similar functions in the two organisms (Luo et al., Neuron 9:595-605 (1992)). Drosophila models for Alzheimer's disease are disclosed in U.S. Patent Applications 2004/0244064, 2005/0132425, 2005/0132424, 2005/0132423, 2005/0132422, 200/50132421, 2005/0108779, 2004/0255342, 2004/0255341, 2004/0250302 which are incorporated herein in their entirety by reference.

[00215] In addition, Drosophila models of polyglutamine repeat diseases (Jackson, G. R., et al., Neuron 21:633- 642 (1998); Kazemi-Esfarani, P. and Benzer, S., Science 287:1837-1840 (2000); Fernandez-Funez et al., Nature 408:101-6 (2000)), Parkinson's disease (Feany, M.B. and Bender, W.W., Nature 404:394-398 (2000)) and other diseases have been established which closely mimic the disease state in humans at the cellular and physiological levels, and have been successfully employed in identifying other genes that can be involved in these diseases. The transgenic flies exhibit progressive neurodegeneration which can lead to a variety of altered phenotypes including locomotor phenotypes, behavioral phenotypes (e.g., appetite, mating behavior, and/or life span), and morphological phenotypes (e.g., shape, size, or location of a cell, organ, or appendage; or size, shape, or growth rate of the fly). [00216] Animals administered the compounds are evaluated for a symptom relative to animals not administered the compounds. A measurable change in the severity a symptom (i.e., a decrease in at least one symptom, i.e. 10% or greater decrease), or a delay in the onset of a symptom, in animals treated with an inhibitor of EXOl versus untreated animals is indicative of therapeutic efficacy.

[00217] One can assess the animals for locomotor skills and gait analysis by performing behavioral testing. One can use any behavioral test for gait analysis commonly known by a person of ordinary skill in the art, for example but not limited to; rotarod or treadmill test or grip strength tests for rodents. One can also perform memory and learning behavioral tests, for example the Morris water maze test for rodent animal models. A measurable increase in the ability to perform the behavior test, for example rotarod or Morris water maze test in animals administered an EXOl inhibitor versus untreated animals is indicative of therapeutic efficacy. A test specifically designed for ataxia is the parallel rod floor test (Kamens and Crabbe, 2007). In the case of ataxia, the level of tremor can be measured with electrophysiological methods known in the art. Further parameters to investigate are hindlimb paralysis and lifespan.

[00218] The suitability of an inhibitor of EXOl for the treatment of a neurodegenerative disease or mitochondrial disorder can be assessed in any of a number of animal models where oxidative DNA damage occurs. One method that can be used is to assess the ability of an EXOl inhibitor to reduce oxidative DNA damage is, for example is an in vitro assay where cells (e.g. neuronal cells) are incubated with an agent causing oxidative damage, e.g. the neurotoxin l-methyl-4-phenylpyridinium (MPP), leading to cell death. Such a cell assay can

be used to screen for agents capable to reduce the oxidative stress and their effect on EXOl expression or activity (also see (Zeng et al., 2006)). A similar cell assay can be performed with brain slice cultures (see Muller et al 2001 D. Muller, N. Toni, P.A. Buchs, L. Parisi and L. Stoppini, Interface organotypic hippocampal slice cultures. In: S. Fedoroff and A. Richardson, Editors, Protocols for neural cell culture, Humana Press Inc, Totowa, NJ (2001), pp. 13-2 or retinal cell cultures (Romano and Hicks, 2007). One can also assess the effect of an agent that inhibits EXOl on reducing the presence of biomarkers for oxidative stress in cells in vitro or in vivo. Examples of biomarkers for oxidative stress are commonly known by persons of ordinary skill in the art, and include, for example but are not limited to lipid peroxidation (alondialdehyde (MDA)), lipid hydroperoxide, protein oxidation (protein carbonyl groups and glutamine synthetase activity), superoxide dismutase, markers for excitatory neurotransmission, including JV-acetylaspartate (NAA), JV-acetylaspartylglutamate, aspartate, and glutamate in the CSF, oxidative DNA damage (8-hydroxy-2'-deoxyguanosine), superoxide dismutase, endogenous antioxidants (ascorbic acid, α-tocopherol, glutathione, ubiquinone, ubiquinol, and cysteine). The predominant oxidative stress markers are increases in MDA, ascorbic acid, glutathione, cysteine, and cystine. One can also assay the markers of oxidative stress in tissue homogenates and/or mitochondrial fractions of the liver or brain or muscle. One can detect if an agent inhibitor of EXOl reduces oxidative stress by using the methods as disclosed in U.S. Patent Application 20050100979 and International Patent Application WO/2005/052575, which are incorporated herein in their entirety by reference. Other markers of oxidative stress include urinary and plasma malondialdehyde (MDA), 8- Isoprostane (Kinnula et al., Eur Respiratory J, 2007; 29;51-55; Montuschi et al, Am J Respiratory Crit Care Med, 1999; 160;216-220). One can also determine if an agent inhibitor of EXOl reduces oxidative stress using commercially available kits, for example from Oxis International Inc., such as the BIOXYTECH® Assay Kits from OXISRESEARCH® or Oxidative Lipid Biomarkers kits, Oxidative/Nitrosative Protein Biomarker kits and Antioxidant Biomarker kits from Northwest Life Science Specialties, LLC.

Formulations of compositions

[00219] Compounds, for example agents inhibiting EXOl as disclosed herein, can be used as a medicament or used to formulate a pharmaceutical composition with one or more of the utilities disclosed herein. They can be administered in vitro to cells in culture, in vivo to cells

in the body, or ex vivo to cells outside of an individual that can later be returned to the body of the same individual or another. Such cells can be disaggregated or provided as solid tissue. [00220] Compounds, for example agents inhibiting EXOl as disclosed herein can be used to produce a medicament or other pharmaceutical compositions. Use of agents inhibiting EXOl which further comprise a pharmaceutically acceptable carrier and compositions which further comprise components useful for delivering the composition to an individual are known in the art. Addition of such carriers and other components to the agents as disclosed herein is well within the level of skill in this art.

[00221] Alternatively, pharmaceutical compositions can be added to the culture medium of cells ex vivo. In addition to the active compound, such compositions can contain pharmaceutically-acceptable carriers and other ingredients known to facilitate administration and/or enhance uptake (e.g., saline, dimethyl sulfoxide, lipid, polymer, affinity-based cell specific-targeting systems). The composition can be incorporated in a gel, sponge, or other permeable matrix (e.g., formed as pellets or a disk) and placed in proximity to the endothelium for sustained, local release. The composition can be administered in a single dose or in multiple doses which are administered at different times.

[00222] Pharmaceutical compositions can be administered by any known route. By way of example, the composition can be administered by a mucosal, pulmonary, topical, or other localized or systemic route (e.g., topical, enteral and parenteral). The phrases "parenteral administration" and "administered parenterally" as used herein means modes of administration other than enteral and topical administration, usually by injection, and includes, without limitation, intravenous, intranasal, intramuscular, intraarterial, intravitreal, intra-occular, intra- cerebroventricular, intracerebral intrathecal, intraventricular, intracapsular, intraorbital, intracardiac, intradermal, intraperitoneal, perispinal, transcranial, transtracheal, subcutaneous, subcuticular, intraarticular, sub capsular, subarachnoid, intraspinal, intracerebro spinal, and intrasternal injection, infusion and other injection or infusion techniques, without limitation. The phrases "systemic administration," "administered systemically", "peripheral administration" and "administered peripherally" as used herein mean the administration of the agents as disclosed herein such that it enters the animal's system and, thus, is subject to metabolism and other like processes, for example, subcutaneous administration. [00223] The phrase "pharmaceutically acceptable" is employed herein to refer to those compounds, materials, compositions, and/or dosage forms which are, within the scope of

sound medical judgment, suitable for use in contact with the tissues of human beings and animals without excessive toxicity, irritation, allergic response, or other problem or complication, commensurate with a reasonable benefit/risk ratio. [00224] The phrase "pharmaceutically acceptable carrier" as used herein means a pharmaceutically acceptable material, composition or vehicle, such as a liquid or solid filler, diluent, excipient, solvent or encapsulating material, involved in carrying or transporting the subject agents from one organ, or portion of the body, to another organ, or portion of the body. Each carrier must be "acceptable" in the sense of being compatible with the other ingredients of the formulation, for example the carrier does not decrease the impact of the agent on the treatment. In other words, a carrier is pharmaceutically inert. [00225] Suitable choices in amounts and timing of doses, formulation, and routes of administration can be made with the goal of achieving a favorable response in the subject with vascular dementia, for example a subject with Alzheimer's disease or a risk thereof (i.e., efficacy), or avoiding undue toxicity or other harm thereto (i.e., safety). Therefore, "effective" refers to such choices that involve routine manipulation of conditions to achieve a desired effect.

[00226] A bolus of the formulation administered to an individual over a short time once a day is a convenient dosing schedule. Alternatively, the effective daily dose can be divided into multiple doses for purposes of administration, for example, two to twelve doses per day. Dosage levels of active ingredients in a pharmaceutical composition can also be varied so as to achieve a transient or sustained concentration of the compound or derivative thereof in an individual, especially in and around vascular endothelium of the brain, and to result in the desired therapeutic response or protection. But it is also within the skill of the art to start doses at levels lower than required to achieve the desired therapeutic effect and to gradually increase the dosage until the desired effect is achieved.

[00227] The amount of agents inhibiting EXOl administered is dependent upon factors known to a person skilled in the art such as bioactivity and bioavailability of the compound (e.g., half-life in the body, stability, and metabolism); chemical properties of the compound (e.g., molecular weight, hydrophobicity, and solubility); route and scheduling of administration, and the like. It will also be understood that the specific dose level to be achieved for any particular individual can depend on a variety of factors, including age,

gender, health, medical history, weight, combination with one or more other drugs, and severity of disease.

[00228] The term "treatment", with respect to treatment of a neurodegenerative disease or mitochondrial disorder, or disease with oxidative DNA damage refers to, inter alia, preventing the development of the disease, or altering the course of the disease (for example, but not limited to, slowing the progression of the disease), or reversing a symptom of the disease or reducing one or more symptoms and/or one or more biochemical markers in a subject, preventing one or more symptoms from worsening or progressing, promoting recovery or improving prognosis, and/or preventing disease in a subject who is free therefrom as well as slowing or reducing progression of existing disease. For a given subject, improvement in a symptom, its worsening, regression, or progression can be determined by an objective or subjective measure. Modification of one or more biochemical markers, for example presence of 8-OHdG in the for example can be measured.

[00229] In some embodiments, efficacy of treatment can be measured as an improvement in morbidity or mortality (e.g., lengthening of survival curve for a selected population). Prophylactic methods (e.g., preventing or reducing the incidence of relapse) are also considered treatment.

[00230] In some embodiments, treatment can also involve combination with other existing modes of treatment, for example existing agents. As an illustrative example only, other agents for the treatment of Alzheimer' s disease, include for example but are not limited to ARICEPT® or donepezil, COGNEX® or tacrine, EXELON® or rivastigmine, REMINYL® or galantamine, antiamyloid vaccine, A beta-lowering therapies (such as antibodies used to decrease beta-amyloid plaques such as disclosed in; US7179892: Humanized antibodies that recognize beta amyloid peptide; US7318923: Humanized anti-β antibodies; US7179463: Treatment of Alzheimer's disease, which are incorporated herein by reference), mental exercise or stimulation; see for review Zlokovic, Adv. Drug Deliv. Rev. 54:1533-1660, 2002). [00231] In some embodiments, agents that inhibit EXOl as disclosed herein can be combined with other agent, for example therapeutic agent to prevent and/or treat neurodegenerative diseases. Such agents can be any agent currently in use or being developed for the treatment and/or prevention of a neurodegenerative disease or disorder, where the agent can have a prophylactic and/or a curative effect and/or reduce a symptom of a neurodegenerative disorder or disease.

[00232] In embodiments where inhibitor agents of EXOl as disclosed herein are used for the prevention and/or treatment of a neurodegenerative disease or mitochondrial disorder, the inhibitor agents of EXOl as disclosed herein can be used in combination with medicaments commonly known by person of ordinary skill in the art that are claimed to be useful as symptomatic treatments of neurodegeneration or mitochondria disorders. Examples of such medicaments include, but are not limited to, agents known to modify cholinergic transmission such as Ml muscarinic receptor agonists or allosteric modulators, M2 muscarinic antagonists, acetylcholinesterase inhibitors (such as tetrahydroaminoacridine, donepezil, galantamine and rivastigmine), nicotinic receptor agonists or allosteric modulators (such as ₇ -nAChR agonists or allosteric modulators or ₄ b ₂ -nAChR agonists or allosteric modulators), peroxisome proliferator- activated receptors (PPAR) agonists (such as PPAR gamma agonists), 5-HT4 receptor partial agonists, histamine H3 antagonists and inverse agonists, 5-HT6 receptor antagonists or 5HT1A receptor antagonists, AMPA positive modulators (alpha-amino-3- hydroxy-5-methylisoxazole-4-propionate, a glutamate receptor subtype) and N-methyl-D- aspartic acid (NMDA) receptor antagonists or modulators (such as memantine). [00233] In some embodiments, where the inhibitor agents of EXOl as disclosed herein are used for the treatment of neurodegenerative disease or mitochondrial disorders, the inhibitor agents of EXOl as disclosed herein can be used in combination with those medicaments mentioned above that are claimed to be useful as symptomatic treatments of neurodegenerative diseases or mitochondrial disorders and/or disease-modifying agents. Disease modifying agents include, for example but are not limited to, gamma secretase inhibitors and modulators, and human beta-secretase (BACE) inhibitors. Disease modifying agents also are, for example but not limited to gamma secretase inhibitors and modulators, beta-secretase (BACE) inhibitors and any other anti-amyloid approaches including active and passive immunization, for example agents identified by the methods as disclosed in U.S. Patent Application 2005/0170359, as well as agents as disclosed in International Patent Applications WO05/07277, WO03/104466 and WO07/028133, and U.S. Patent 6,866,849, 6,913,745, which are incorporated in their entirety herein by reference. [00234] Thus, combination treatment with one or more agents that inhibit EXOl with one or more other medical procedures can be practiced. In addition, treatment can also comprise multiple agents to inhibit EXOl expression or activity, such as nuclease inhibitors as disclosed in US Patent 7,264,932, which is incorporated herein in its entirety by reference. In

alternative embodiments, other examples of nuclease inhibitors which can be combined with the EXOl inhibitor agents as disclosed herein include, but are not limited to, oligovinylsulfonic acid (OVA), aurintricarboxylic acid (ATA), aflatoxin, 2-nitro-5- thiocyanobenzoic acid, iodoacetate, N-bromosuccinimide, p-chloromercuribenzoate, dinitrofluorobenzene, decanavanate, polyvinylsufonic acid, hydrobenzoinphosphate, phenyiphosphate, putrescine, haloacetate, dinitrofluorobenzene, phenyiglyoxal, bromopyruvic, 8-amino-5-(4'-hydroxy-biphenyl-4-ylazo)-naphthalene-2-sulfon ate, 6-hydroxy- 5-(2-hydroxy-3,5-dinitro-phenylazo)-naphthalene-2-sulfonate, 3,3'-dimethylbiphenyl-4,4'- bis(2-amino-naphthylazo-6-sulfonate), 4,4'-dicarboxy-3,3-bis(naphthylamido)- diphenylmethanone, 3,3'-dicarboxy-4,4'-bis(4-biphenylamido)diphenylmethane, 3,3'- dicarboxy-4,4'-bis(3-nitrophenylamido)diphenylmethane or NCI- 224131. [00235] The amount which is administered to a subject is preferably an amount that does not induce toxic effects which outweigh the advantages which result from its administration. Further objectives are to reduce in number, diminish in severity, and/or otherwise relieve suffering from the symptoms of the disease in the individual in comparison to recognized standards of care.

[00236] Production of compounds according to present regulations will be regulated for good laboratory practices (GLP) and good manufacturing practices (GMP) by governmental agencies (e.g., U.S. Food and Drug Administration). This requires accurate and complete record keeping, as well as monitoring of QA/QC. Oversight of patient protocols by agencies and institutional panels is also envisioned to ensure that informed consent is obtained; safety, bioactivity, appropriate dosage, and efficacy of products are studied in phases; results are statistically significant; and ethical guidelines are followed. Similar oversight of protocols using animal models, as well as the use of toxic chemicals, and compliance with regulations is required.

[00237] Dosages, formulations, dosage volumes, regimens, and methods for analyzing results aimed at inhibiting EXOl expression and/or activity can vary. Thus, minimum and maximum effective dosages vary depending on the method of administration. Suppression of the clinical and histological changes associated neurodegenerative disease or mitochondrial disorder can occur within a specific dosage range, which, however, varies depending on the organism receiving the dosage, the route of administration, whether agents that inhibit EXOl are administered in conjunction with other co-stimulatory molecules, and the specific regimen of

inhibitor of EXOl administration. For example, in general, nasal administration requires a smaller dosage than oral, enteral, rectal, or vaginal administration. [00238] Pharmaceutical compositions can be administered as a formulation adapted for passage through the blood-brain barrier or direct contact with the endothelium. In some embodiments, the compositions may be administered as a formulation adapted for systemic delivery. In some embodiments, the compositions may be administered as a formulation adapted for delivery to specific organs, for example but not limited to the brain, liver, bone marrow, or systemic delivery.

[00239] In some embodiments where the inhibitor of EXOl is a protein, for example an inhibitory antibody of EXOl, the inhibitor of EXOl can be formulated for optimal passage through the blood brain barrier. In some instances where the disease to be treated is a neurological disease, the blood brain barrier (BBB) can be already impaired (i.e. leaky) allowing passage of proteins through the BBB. Such neurological diseases with impaired BBB include, for example but are no limited to Alzheimer's disease(Jancso et al., 1998), ALS, Parkinson's disease (Bartels et al.); Multiple sclerosis (Soon et al., 2007); De Vivo disease, also known as GLUTl deficiency syndrome); Neuromyelitis optica, also known as Devic's disease; Stroke; lacunar stroke (Wardlaw et al., 2008); focal cerebral ischemia (Nagaraja et al., 2008); Epilepsy (Diler et al., 2007); Brain tumors; ALS (Nature Neuroscience p 2008); Creutzfeldt-Jakob disease (CJD) (Bartels et al.), AMD and diabetic retinopathy etc. [00240] Antibodies can be formulated to pass through the BBB according to the methods disclosed in US7179892: Humanized antibodies that recognize beta amyloid peptide; US7318923: Humanized anti-β antibodies; US7179463: Treatment of Alzheimer's disease, which are incorporated herein by reference. Alternatively, Neuwelt et al., (Cancer Res, 48; 4725-4729, 1998); Tyson et al (Expert Review Anti-Cancer Therapy 3:97-112, 2006); Bard, et al., (Nature Med., vol. 6, No. 8, pp. 916-919, 2000); and Schenk, et al., (Letters to Nature, 400:173-177 (1999) (which are incorporated herein in their entirety by reference) discuss methods to deliver antibodies through the BBB for treatment of neurological disorders, such as Alzheimer's disease. In addition, Ruben et al (Biotechnology and Bioengineering 100, 387- 396) discusses a method of delivery of a GDNF fusion protein across the human blood-brain barrier which can be used to deliver EXOl inhibitors as disclosed herein across the BBB. [00241] In alternative embodiments, other methods to deliver proteins across the BBB known by a person of ordinary skill in the art can be used to deliver the EXOl inhibitors as disclosed

herein to the brain and spinal cord. For example, US5124146 (which is incorporated herein by reference in its entirety) discusses a method for differential delivery of therapeutic agents across the blood brain barrier. Alternatively, one can use other methods to deliver proteins and EXOl inhibitor agents as disclosed herein across the BBB. For example, such methods include, (a) use of Cargo proteins and molecular Trojan horses to deliver the EXOl inhibitor proteins across the BBB, such as use of the insulin or transferring receptor (transcytosis) (Pardridge, 2007b), use of vasoactive substances, such as bradykinin, and use of endogenous transport systems, including carrier-mediated transporters such as glucose and amino acid carriers fusion protein, e.g. with antibody against insulin receptor or transferrin receptor fusion protein with insulin, transferring or Fc domain of antibodies, or other peptides to deliver the EXOl inhibitor agents across the BBB (Teixido and Giralt, 2008). In alternative embodiments, one can use (b) pegylation to deliver the EXOl inhibitor agents across the BBB, such as poly(ethyleneglycol)-poly(ε-caprolactone) (PEG-PCL) polymersomes (Pang et al., 2008), or biotin-PEG-polyethylenimine. In alternative embodiments, one can use (c) nanoparticles or nanoconjugates to deliver the EXOl inhibitor agents across the BBB, such as magnetic or conjugated nanoparticles (Tosi et al., 2008); Lipid nanocapsules (Beduneau et al., 2008) or liposomes.

[00242] In some embodiments, one can also (d) deliver the EXOl inhibitor as disclosed herein across the BBB as a pro-drug, which can be converted into an active EXOl inhibitor by a secondary agent, as discussed in for example to Rautio et al., 2008 (which is incorporated herein in its entirety by reference).

[00243] In alternative embodiments, one can use BBB disruption as a means to deliver the EXOl inhibitors as disclosed herein across the BBB and to regions of the brain and spinal cord. One can use any method for BBB commonly known by persons of ordinary skill in the art, such as for example; intra-carotid arterial infusion of hyperosmotic solutions or intra- carotid arterial infusion of noxious agents such as vasoactive compounds and local ultrasonic irradiation of the brain. Alternatively, one can use other strategies, such as antibody strategies, to disrupt the BBB and deliver agents across the BBB, such as discussed in Neuwelt et al., (Neurosurg. 17:419-423 (1985)); Neuwelt et al.,( Neurosurgery 20:885-895 (1987)) and in US20070196375A1 and US7214658 (which are incorporated herein in their entirety by reference).

[00244] One can use any method to deliver the EXOl inhibitors as disclosed herein. Common methods to deliver such agents for delivery to the brain and spinal cord include, for example, trans-nasal or intranasal delivery or trans-cranial delivery. In some embodiments, where transcranial delivery methods are desired, one can use any method commonly known by a person of ordinary skill in the art, such as for example convection-enhanced delivery, also called convection-enhanced diffusion (CED), intra-cerebroventricular (ICV) injection and intra -cerebral (IC) implantation. In some embodiments, where intrathecal delivery methods are desired, one can use any method commonly known by a person of ordinary skill in the art, such as for example as used by Medtronic, Inc, as well as methods discussed in Aebischer et al., 1996 which uses cells expressing CNTF protein (Aebischer et al., 1996, which is incorporated herein by reference). Alternatively, delivery can be performed by a bolus injection administration. In some embodiments, one can also directly administer the EXOl inhibitors as disclosed herein into the perispinal space, where perispinal administration is defined as administration of the molecule into the anatomic area within 10 cm of the spine (Pardridge, 2007a, which is incorporated herein in its entirety by reference). [00245] In some embodiments, the EXOl inhibitors as disclosed herein can be administered via intracellular delivery by any means known by a person of ordinary skill in the art. For example, methods of intracellular delivery include, for example, use of CPP peptides (Ferguson et al., 2007), use of carrier proteins, use of nanoparticles, use of liposomes and use of fusion proteins.

[00246] In some embodiments where it is desired to deliver the EXOl inhibitors as disclosed herein to the retina, for example for the treatment of diseases of the eye, such as for example, AMD, one can combine the EXOl inhibitor with a Fc fragment, such as used in a VEGF-trap (see Holash J et al), which describes a VEGF trap which is a fusion protein of the FC portion of antibody and the soluble form of the VEGFRl receptor (see Holash et al., Proc Natl Acad Sci U S A 2002; 99:11393-8., which is incorporated herein in its entirety by reference). Such a method has been demonstrated to be useful to deliver inhibitors of VEGF by i.v. injections to treat neovascular age-related macular degeneration (AMD). (Nguyen et al., 2006, which is incorporated by reference herein in its entirety). In alternative embodiments, EXOl inhibitors can be delivered to the retina using other means commonly know in the art, such as intravitreal injections (e.g. Lucentis, Macugen), intraocular injections, implants, subconjunctival administration or eye drops.

[00247] For oral or enteral formulations for use with the present invention, tablets can be formulated in accordance with conventional procedures employing solid carriers well-known in the art. Capsules employed for oral formulations to be used with the methods of the present invention can be made from any pharmaceutically acceptable material, such as gelatin or cellulose derivatives. Sustained release oral delivery systems and/or enteric coatings for orally administered dosage forms are also contemplated, such as those described in U.S. Pat. No. 4,704,295, "Enteric Film-Coating Compositions," issued Nov. 3, 1987; U.S. Pat. No. 4, 556,552, "Enteric Film- Coating Compositions," issued Dec. 3, 1985; U.S. Pat. No. 4,309,404, "Sustained Release Pharmaceutical Compositions," issued Jan. 5, 1982; and U.S. Pat. No. 4,309,406, "Sustained Release Pharmaceutical Compositions," issued Jan. 5, 1982 (which are incorporated herein in their entirety by reference). Examples of solid carriers include starch, sugar, bentonite, silica, and other commonly used carriers. Further non-limiting examples of carriers and diluents which can be used in the formulations of the present invention include saline, syrup, dextrose, and water.

[00248] In some embodiments, one particularly useful embodiment is a tablet formulation comprising the EXOl inhibitor as disclosed herein is a tablet with an enteric polymer casing. An example of such a preparation can be found in WO2005/021002 which is incorporated herein in its entirety by reference. The active material in the core can be present in a micronised or solubilized form. In addition to active materials the core can contain additives conventional to the art of compressed tablets. Appropriate additives in such a tablet can comprise diluents such as anhydrous lactose, lactose monohydrate, calcium carbonate, magnesium carbonate, dicalcium phosphate or mixtures thereof; binders such as microcrystalline cellulose, hydroxypropylmethylcellulose, hydroxypropyl-cellulose, polyvinylpyrrolidone, pre-gelatinised starch or gum acacia or mixtures thereof; disintegrants such as microcrystalline cellulose (fulfilling both binder and disintegrant functions) cross- linked polyvinylpyrrolidone, sodium starch glycollate, croscarmellose sodium or mixtures thereof; lubricants, such as magnesium stearate or stearic acid, glidants or flow aids, such as colloidal silica, talc or starch, and stabilizers such as desiccating amorphous silica, coloring agents, flavors etc. Preferably the tablet comprises lactose as diluent. When a binder is present, it is preferably hydroxypropylmethyl cellulose. Preferably, the tablet comprises magnesium stearate as lubricant. Preferably the tablet comprises croscarmellose sodium as disintegrant. Preferably, the tablet comprises microcrystalline cellulose.

[00249] The diluent can be present in a range of 10 - 80% by weight of the core. The lubricant can be present in a range of 0.25 - 2% by weight of the core. The disintegrant can be present in a range of 1 - 10% by weight of the core. Microcrystalline cellulose, if present, can be present in a range of 10 - 80% by weight of the core.

[00250] The active ingredient preferably comprises between 10 and 50% of the weight of the core, more preferably between 15 and 35% of the weight of the core, (calculated as free base equivalent). The core can contain any therapeutically suitable dosage level of the active ingredient, but preferably contains up to 150 mg as free base of the active ingredient. Particularly preferably, the core contains 20, 30, 40, 50, 60, 80 or 100 mg as free base of the active ingredient. The active ingredient can be present as the free base, or as any pharmaceutically acceptable salt. If the active ingredient is present as a salt, the weight is adjusted such that the tablet contains the desired amount of active ingredient, calculated as free base of the salt. Preferably, the active ingredient is present as a hydrochloride salt. [00251] The core can be made from a compacted mixture of its components. The components can be directly compressed, or can be granulated before compression. Such granules can be formed by a conventional granulating process as known in the art. In an alternative embodiment, the granules can be individually coated with an enteric casing, and then enclosed in a standard capsule casing.

[00252] The core is surrounded by a casing which comprises an enteric polymer. Examples of enteric polymers are cellulose acetate phthalate, cellulose acetate succinate, methylcellulose phthalate, ethylhydroxycellulose phthalate, polyvinylacetate pthalate, polyvinylbutyrate acetate, vinyl acetate-maleic anhydride copolymer, styrene-maleic mono-ester copolymer, methyl acrylate-methacrylic acid copolymer or methacrylate-methacrylic acid-octyl acrylate copolymer. These can be used either alone or in combination, or together with other polymers than those mentioned above. The casing can also include insoluble substances which are neither decomposed nor solubilised in living bodies, such as alkyl cellulose derivatives such as ethyl cellulose, crosslinked polymers such as styrene-divinylbenzene copolymer, polysaccharides having hydroxyl groups such as dextran, cellulose derivatives which are treated with bifunctional crosslinking agents such as epichlorohydrin, dichlorohydrin or 1, 2-, 3, 4-diepoxybutane. The casing can also include starch and/or dextrin. [00253] Preferred enteric coating materials are the commercially available EUDRAGIT ® enteric polymers such as EUDRAGIT® L, EUDRAGIT® S and EUDRAGIT ® NE used

alone or with a plasticiser. Such coatings are normally applied using a liquid medium, and the nature of the plasticiser depends upon whether the medium is aqueous or non-aqueous. Plasticisers for use with aqueous medium include propylene glycol, triethyl citrate, acetyl triethyl citrate or CITROFLEX® or CITROFLEX® A2. Non-aqueous plasticisers include these, and also diethyl and dibutyl phthalate and dibutyl sebacate. A preferred plasticiser is Triethyl citrate. The quantity of plasticiser included will be apparent to those skilled in the art.

[00254] The casing can also include an anti-tack agent such as talc, silica or glyceryl monostearate. Preferably the anti-tack agent is glyceryl monostearate. Typically, the casing can include around 5 - 25 wt% Plasticiser and up to around 50 wt % of anti tack agent, preferably 1-10 wt % of anti-tack agent.

[00255] If desired, a surfactant can be included to aid with forming an aqueous suspension of the polymer. Many examples of possible surfactants are known to the person skilled in the art. Preferred examples of surfactants are polysorbate 80, polysorbate 20, or sodium lauryl sulphate. If present, a surfactant can form 0.1 - 10% of the casing, preferably 0.2 - 5% and particularly preferably 0.5 - 2%

[00256] In one embodiment, there is a seal coat included between the core and the enteric coating. A seal coat is a coating material which can be used to protect the enteric casing from possible chemical attack by any alkaline ingredients in the core. The seal coat can also provide a smoother surface, thereby allowing easier attachment of the enteric casing. A person skilled in the art would be aware of suitable coatings. Preferably the seal coat is made of an Opadry coating, and particularly preferably it is Opadry White OY-S-28876. [00257] Examples of solid carriers include starch, sugar, bentonite, silica, and other commonly used carriers. Further non-limiting examples of carriers and diluents which can be used in the formulations of the present invention include saline, syrup, dextrose, and water. [00258] In one embodiment, the therapeutic administration of an EXOl inhibitor can be used to monitor prognosis and/or efficacy of treatment. For example, diagnosis according to disclosure herein can be practiced with other diagnostic procedures. For example, endothelium of the vascular system, brain, or spinal cord (e.g., blood or leptomeningeal vessels) can be assayed for a change in gene expression profiles using disease- specific molecular diagnostics kits (e.g., custom made arrays, multiplex QPCR, multiplex proteomic arrays). In addition, a noninvasive diagnostic procedure (e.g., CAT, MRI, SPECT, or PET)

can be used in combination to improve the accuracy and/or sensitivity of diagnosis. Early and reliable diagnosis is especially useful to for treatment of neurodegenerative diseases, of example for mild to moderate Alzheimer's disease or to delay neurodegenerative disease progression.

[00259] In some embodiments, a subject can be monitored for the level of EXOl expression in a tissue. This can be used as a prognostic for therapeutic efficacy or to adjust the treatment regime, or as a diagnostic for identifying a subject at increased risk of developing a neurodegenerative disease or mitochondrial disorder. In one such an embodiment, a subject can be identified as having an increased risk of developing a neurodegenerative disease or mitochondrial disorder as a subject with a higher level of EXOl protein and/or EXOl transcript (for example mRNA) as compared to a reference biological sample. In some embodiments, the reference sample is from a subject not affected with a neurodegenerative disease or mitochondrial disorder. In alternative embodiments, one can measure the level of the EXOl protein and/or an EXOl transcript in a biological sample at two different timepoints from the same subject, for example a first biological sample is taken before administration of an agent that inhibits EXOl and a second biological sample is taken after administration of EXOl (i.e. administration of an EXOl inhibitor for any period of time) comparing the level of the EXOl protein and/or an EXOl transcript in the first biological sample with the second, and if the level of the EXOl protein and/or an EXOl transcript in the first biological sample is higher than the second indicates the subject has a improved prognosis as compared to the time when the first biological sample was taken. Such an embodiment can be used to tailor the dose of the inhibitor of EXOl agent administered to the subject, as if there is no change in the level of the EXOl protein and/or an EXOl transcript in the biological samples taken at the first and second time points then one can alter the dose of the EXOl inhibitor, for example increase the dose and/or frequency and/or route of administration, or type of agent inhibitor of EXOl (for example but without limitation, alteration from a nucleic acid inhibitor of EXOl to a neutralizing antibody of EXOl). Accordingly, the methods as disclosed herein provide methods to follow disease progression and/or the effect of the agent inhibitor of EXOl on the expression of EXOl protein and/or an EXOl transcript over a specified time period.

EXAMPLES

[00260] The examples presented herein relate to the methods and compositions for the diagnosis and prevention and/or treatment of neurodegenerative diseases and mitochondrial disorders by inhibition of EXOl. Throughout this application, various publications are referenced. The disclosures of all of the publications and those references cited within those publications in their entireties are hereby incorporated by reference into this application in order to more fully describe the state of the art to which this invention pertains. The following examples are not intended to limit the scope of the claims to the invention, but are rather intended to be exemplary of certain embodiments. Any variations in the exemplified methods which occur to the skilled artisan are intended to fall within the scope of the present invention.

METHODS

[00261] Generation of Mutant mice: Mlhl knockout mice have an replication error phenotype and homozygous males have no mature sperm. Female homozygous mice are fertile (Edelmann et al., 1996). Mice lacking Msh2 are characterized by increased tumor development after 2 months of age, and develop sarcomas, lymphomas, skin neoplasms and intestinal tumors (Baker et al., 1996; De Wind et al., 1995). NMF205 mutant mice were generated by ENU mutagenesis (The Jackson Laboratory, Stock number 004823; jaxmice.jax.org/strain/004823.html). Mice lacking Exol show reduced survival, increased susceptibility to the development of lymphomas and the females are sterile (Wei et al. 2003). [00262] Western Blot analysis: Western immunoblot analysis is carried out using well known methods. For example, cells or tissues were solubilized or homogenized in RIPA buffer at 4 ⁰ C for 20min. The supernatants are collected after centrifugation at 13,000xg for 10 min at 4 ⁰ C. Protein concentration is determined using a bicinchoninic acid (BCA) protein assay kit (Sigma). Samples of equal amount of protein were mixed with Laemmli's sample buffer, fractionated by 7.5 -15% SDS-polyacrylamide gels under reducing condition, and transferred to nitrocellulose membrane. The membrane is probed with specific antibodies. The blots are developed using an enhanced chemiluminescence system (Amersham). [00263] Glutathione Assay: The brains from 3 week old C57BL/6 (WT) and NMF205 mutant (Mut) mice were isolated and the cerebellum and cortex dissected. The tissues were homogenized according to manufactures instructions (Cayman Chemicals Cat. no. 703002). Cayman's GSH assay kit utilizes an enzymatic recycling method, using the enzyme glutathione reductase for the quantification of GSH. Total glutathione (GSH) concentration

was determined graphed in relation to total wet tissue. The graph shows that the NMF205 mutant has lower glutathione levels, indicating increased oxidative stress in the NMF205 mutant (Mut) mice.

EXAMPLE 1

[00264] Exol was identified as a modifier gene attenuating the pathology ofNMF205 mutant mice.

[00265] The NMF205 mouse strain was generated by ENU mutagenesis displaying a pathology overlapping to the spontaneous mouse mutant Harlequin (Hq), which display ataxia. This pathology also overlaps with the neuropathology observed in human mitochondrial disorders. Hq mice are characterized by progressive degeneration of terminally differentiated cerebellar and retinal neurons (Klein et al., Nature 2002, VoI 419, 367). The Hq mutant mouse provides the first in vivo model for studying the role of oxidative stress on aberrant cell cycle re-entry and subsequent apoptosis.

[00266] In the NMF205 mutant both cerebellar and retinal neurons degenerate, although their loss is much accelerated compared to neuron loss in Hq mutant mice. In NMF205 mice additional neurons, including those in the hippocampus, degenerate. NMF205 mice have loss of cerebellar granule cells, retinal, hippocampal, and dopaminergic neurons. The mutation of NMF205 mice has been mapped to Chromosome 17 and a splice site mutation in the Gtpbp2 (GTP-binding protein 2) gene has been identified. Gtpbp2 is localized in mitochondria and is structurally homologous to the EF-Tu peptide elongation factor. Using a forward genetics approach, by intercrossing NMF205 with a number of mouse strains, a dominantly acting locus has been identified in the BALB/cByJ-derived intercrosses greatly attenuating NMF205-mediated DNA damage and neurodegeneration. [00267] During mapping of the NMF205 mutation on the BALB/cBYJ intercross, the inventors observed dramatic variability in the onset of ataxia in mice that were homozygous for the NMF205 critical region derived from C57BL/6 (B6). Approximately 25% of these mice developed overt ataxia at 30 days concomitant with granule cell death, and they died at 2 months of age. However, the vast majority of mice of F2 NMF205-/- mice on the BALB/cBYJ intercross were not ataxic even at 3 months (when animals were sacrificed) and very little granule cell death was noted in these mice.

[00268] Genetic analysis of F2 animals demonstrated that a locus between DlMit399 and DlMit291 on distal Chromosome 1, which are called M205 (for Modifer of NMF205) herein, segregated with the severity of the NMF205 ^"7" phenotype. Severely affected F2 mice were always C57BL/6/C57BL/6 (abbreviated as B6/B6) through this region, whereas mice with a late-onset phenotype carry one or two copies of BALB/cBYJ alleles in this region. The 3:1 ratio of late-onset vs. early-onset phenotypes suggested that this region of Chromosome 1 from the BALB/cBYJ genome contains a dominantly acting suppressor gene, which attenuates cell death and prolongs survival in NMF205 mutant animals. To test this hypothesis, the inventors generated B6.BALB congenic animals by selecting this region of Chromosome 1 from BALB/cBYJ. After 5 generations of backcrossing (when 93.8% of unlinked genes should be B6 in origin) these mice were crossed to the B6-NMF205 ^+/~ mutant line to obtain NMF205 ^"7" mice, with and without the putative BALB-derived modifier region on Chromosome 1. Several NMF205-/- mice that are also heterozygous for the BALB-derived region on Chromosome 1 show at the age of 5 months no signs of ataxia. Furthermore, histological analysis of mice of the same genotype at 3 months revealed a dramatic decrease in granule cell and hippocampal neuron loss compared to 2 month old B6-NMF205 ^"7" mice (Figure 1).

[00269] The inventors performed a survey of a small number of strains to determine whether additional strains also carried the protective allele of M205 (Table T). Analysis of the available haplotype data for SNPs within and just outside of the critical region, suggested that this region of Chromosome 1 in 129Sl/SvlmJ and NOD/LtJ mice shared genetic ancestry with BALB/cBYJ, whereas this same chromosomal region in A/J, AKR/J, and DBA/2J is highly related to that of B6. NMF205 ^~/~ ovaries were transplanted from affected B6 mice and recipients were mated to mice from these different inbred strains. Fl mice were then intercrossed and the resulting F2 mice were genotyped using polymorphic micro satellite markers to identify NMF205 ^"7" mice (recombinants were excluded from the analysis). All crosses yielded close to the expected number of NMF 205 ^~A mice, suggesting these backgrounds did not increase severity of the NMF205 mutant phenotype. NMF205 ^~/~ mice were then genotyped for Chromosome 1 and those that were not recombinant in the modifier region were examined at 6 weeks of age for signs of ataxia. In all crosses the ratio of ataxic (affected) to non-ataxic (unaffected) mice was approximately 3:1. Furthermore, unaffected mice were always either heterozygous or homozygous for the non-B6 strain in the M205

region on Chromosome 1. Conversely, mice that were noticeably ataxic in these crosses were always B6/B6 in the Chromosome 1 modifier region. These results demonstrate that these strains contain a dominant modifier gene that attenuates the development of ataxia in NMF205 ^"7" mice. As seen in F2 B6/ BALB/cBYJ NMF205 ^"7" mice, histological analysis of F2 mice from these crosses revealed that ataxia in mice that are B6/B6 on Chromosome 1 is accompanied by granule cell death and that the presence of the Chromosome 1 modifier gene protects against this cell death (or B6 mice have a unique, recessive susceptibility allele at the M205 locus). [00270] Table 2: F2 intercrossed to different mouse strains.

[00271] Table 2 summarizes that a rescue of the ataxia phenotype of the NMF205 mutation occurs also after intercrossing to 1291Sv/J, A/J, AKR/J, DBA/2J and NodLt/J being heterozygous or homozygous for the M205 locus on chromosome 1.

[00272] Fine mapping of the M205 locus.

[00273] To fine map the M205 locus, the inventors analyzed 1121 F2 mice from the

NMF205 B6/ BALB/cBYJ mapping cross and localized it to a 0.25 cM region between the micro satellite marker DlMit403 and the SNP mCV2461950. Analysis of the public sequence databases for this region and the homologous region on human Chromosome Iq43 revealed that 5 genes, and a portion of two other genes, reside within this region (as shown in Figure

2).

EXAMPLE 2

[00274] M205 suppresses 8-OHdG incorporation in NMF205 mutant cerebellar DNA.

[00275] To investigate whether the presence of the protective allele of M205 may have an affect on levels of DNA damage in NMF205-/- neurons, the inventors immunostained wild type, B6-NMF205-/-, and F2 NMF205 ^"7" mice heterozygous for the 1291Sv/J allele of M205, with an antibody to the oxidized base, 8-OHdG (from Oxis research) and visualized with alexa fluor 488-labelled donkey as secondary antibody. The inventors also discovered that many NMF205 ^"7" nuclei were immunoreactive (data not shown), demonstrating that truncation of GTPB P2 causes an increase in ROS. Interestingly, 8-OHdG staining in mutant mice with the M205 modifier was at the near background levels observed in the wild type cerebellum (data not shown), demonstrating that M205 functions to decrease ROS-induced DNA damage in the NMF205 ^~/~ neurons, thus prolonging their survival.

[00276] Analysis ofExol RNA level in 4 week old mice. RNA was prepared from the cerebellum of 4- week old B6 (Ch.1 B6), B6.BALB/cBYJ Chromosome 1 (BaIb Ch. 1), NMF205 ^"7" (Ch.l B6), and NMF205 ^"7" ; Bό.Balb Ch.l mice. While Exol expression is detectable in all samples, a slight increase in Exol transcripts in NMF205 ^~/~ mice on the B6 background relative to GAPDH mRNA levels can be observed, as shown by figure 3. [00277] Figure 4 shows protein expression of Exol was analyzed by Western blotting using antibodies from NeoMarkers (also called Labvision), also distributed by Thermo scientific (Exol Ab-4, clone 266) of tissues from 3- week old NMF205 ^~/~ and wild type littermates. BtubIII was used as a loading control. In mutant tissues increased levels of Exol is detectable.

[00278] Analysis of Exol expression in NMF205-/- tissues. Frozen sections of retina and brain from four week old mice (wild type (WT) and NMF205-/-) were prepared and stained with a fluorescent labeled EXOl antibody. To highlight the nuclei sections were counterstained with Hoechst 33342 nuclear dye. In the NMF205 ^~/~ tissues an increase expression of EXOl can be detected (as shown in figures 4 and 7).

EXAMPLE 3

[00279] Loss of Exol prevents granule cell loss in NMF205 mutant mice.

[00280] NMF205 ^~ ' ^~ mice on the C57BL/6 background were intercrossed to Exo-null mice on the C57BL/6 background. The original Exo knockout was described by Edelmann (Wei et al., 2003). By intercrossing NMF205 ^'1' mice with Exo-null mice the various genotypes were established. C57BL/6 mice were called wild type (WT).

[00281] The cerebellum of two (2) month old mice with the genotypes being wild type

(WT); NMF205 ^~ ' ^~ x Exo+/+, and NMF205 ^~ ' ^~ x Exo ^v~ was isolated, fixed, sections and stained with Hemotoxylin-eosin (HE). As shown in Figure 5, the inventors discovered that the granule cells are normal in the NMF205 ^~ ' ^~ x Exo ^v~ cerebellum, demonstrating that the loss of EXOl rescues the granule cell degeneration which occurs in NMF205 ^"7" mice. [00282] Overexpression of EXOl in NIH3T3 cells. An expression construct containing

FLAG-tagged EXOl was transiently transfected into NIH3T3 cells. Cells were immunostained with anti-FLAG antibody and anti-pyruvate dehydrogenase (PDH) to visualize the mitochondria and counterstained with Hoechst 33342 nuclear dye. The inventors discovered that overexpressed EXOl is localized to both nucleus and mitochondria, and demonstrated that EXOl localization using EXOl-FLAG transfected NIH3T3 cells co- localizes with the mitochondrial marker anti-pyruvate dehydrogenase (PDH; from Mitosciences) (data not shown).

EXAMPLE 4

[00283] Retinal Rescue in NMF205 mutant mice.

[00284] Sections of retina from eight week old mice were isolated, fixed, sections and stained with Hemotoxylin-eosin (HE). The genotypes, all on C57BL/6 background, were wild type (WT); NMF205-/-X Exo+/+, and NMF205-/-X Exo-λ. The histology shown in Figure 6 shows the normal retina histology in wild type (WT, shown in 6A), a loss of the ganglion cell layer and reduced nuclear layers in the NMF205 mutant (NMF205-/-X Exo+/+; 6B) and a complete rescue when backcrossed to the Exo-deficient mouse (NMF205-/-X Exo-/-; fig 6C), demonstrating an increase in the outer and inner nuclear layer as shown in Figure 6C as shows that the inner and compared to WT mice (Figure 6A).

EXAMPLE 5

[00285] Exol is expressed in the mitochondrial fraction of the brain hippocampus region of NMF205 mutant mice.

[00286] The inventors generated polyclonal antibodies against EXOl to characterize the expression in NMF205 mutant mice. Amino acids 437 to 837 (SEQ ID NO: 4) (i.e. 400 aa at the C-terminus) of the Exol gene (Genbank BC006671; SEQ ID NO: 5) were amplified by PCR and cloned into the bacterial GST fusion expression vector pGEX-4T (GE Healthcare Life Sciences). Purified protein was used to immunize two rabbits and each rabbit was

boosted 4 times. Antisera were purified over a GST column to remove GST-specific antibodies. One antisera recognizes Exol by Western blot analysis (polyExolA) and the other by immunocytochemistry analysis (polyExolB). The specificity of the polyclonal antibodies was confirmed using tissues from the EXOl deficient mouse (EXOl -/-). [00287] The antisera reactivity was tested by Western blot and immunohistochemical analysis of brain extracts, cell lysates and mitochondrial tissue extracts (see Figure 7 for Western blot for C57BL/6J and NMF205 mutant). Two polyclonal antibodies with specificity to EXOl were obtained. Whole cell extracts or mitochondrial fractions were isolated. To isolate mictochondria a kit from ThermoScientific (Pierce: cat. no. 89801; Mitochondria Isolation Kit for Tissue) was applied according to manufacturer recommendations. For Western blot analysis protein samples run on a 10% SDS-PAGE and transferred onto a nitrocellulose filter. After blocking with 5% non-fat dry milk powder, the membranes were processed through sequential incubations with primary antibody followed by secondary antibody. Immunoreactive proteins on the filter were visualized using a chemiluminescent detection kit (SuperSignal West PICO, Pierce, USA). As shown in Figures 7B, the anti-EXOl antibody generated by the inventors, herein termed "polyExolA" shows a comparable immunoreactivity of EXOl expression in the hippocampus of wild type and NMF205 mutant mice to a commercially available mouse monoclonal antibody to EXOl (EXOl Ab-4, NeoMarkers). This polyclonal rabbit polyExolA antibody generated by the inventors detects both the phosphorylated and non-phosphorylated EXOl protein (data not shown). Exol expression was detected in the mitochondrial fraction of the hippocampus in NMF205 mice and wild-type mice, which has an increased level in the mitochondria in the NMF205 mice as compared to the wild type mice (see Figure 7C).

[00288] EXOl expression was also detected in the hippocampus of P49 (49 days old) wild- type mice as shown in Figure 8 A, but not in EXOl -/- mice (see Figure 8B). The expression of Exol in wild type mice was detected in hippocampus CA2 pyramidal neurons of WT (C57BL/6J) in the cytoplasm using the other polyclonal EXOl antibody, herein termed "polyExolB". The inventors demonstrated, using co-immunostaining of Exol with a mitochondrial marker pyruvate dehydrogenase (PDH; the antibody was purchase from Mitocsciences), that Exol is detectable in the cytoplasmic and mitochondrial localization of CA2 pyramidal neurons (data not shown).

EXAMPLE 6

[00289] NMF205 mutant mice have increased oxidative stress in the brain.

[00290] The inventors assessed the level of oxidative stress in the NMF205 mutant mice as compared to wild type mice. As shown in Figure 9, the inventors discovered that NMF205 mutant mice had decreased glutathione levels in the cerebellum and cortex as compared to wild type mice, which indicates an increase in oxidative stress in the cerebellum and cortex brain regions in NMF205 mice as compared to wild type mice. In addition, the inventors discovered increased oxidative stress in NMF205 mice as compared to wild type mice, which was detected by increased immunostaining of 8-oxo-7,8-dihydroguanine (8- OHdG, also called 8-oxoguanine or 8-oxoG), a marker for oxidative stress, in the dentate gyrus and cerebellum of NMF205 mice as compared to wild type mice (as shown in Figures 1OA and 10B).

[00291] The inventors herein have demonstrated that loss of EXOl attenuates DNA damage and neurodegeneration, retinal degeneration, mitochondrial diseases, eye diseases, defects in apoptosis and also prevents oxidative stress (as shown by reduced 8-OHdG incorporation in cerebellar neuron DNA) and that inhibition of EXOl is useful as therapy for mitochondrial degenerative disease, neurodegeneration, retinal degeneration, eye diseases and mitochondrial disorders.

REFERENCES

[00292] The references cited herein and throughout the application are incorporated herein by reference.

[00293] Aebischer, P., Schluep, M., Deglon, N., Joseph, J.-M., Hirt, L., Heyd, B.,

Goddard, M., Hammang, J.P., Zurn, A.D., Kato, A.C., et al. (1996). Intrathecal delivery of CNTF using encapsulated genetically modified xenogeneic cells in amyotrophic lateral sclerosis patients. Nat Med 2, 696-699.

[00294] Baker, S.M., Plug, A.W., Prolla, T.A., Bronner, C.E., Harris, A.C., Yao, X.,

Christie, D. M., Monell, C, Arnheim, N., Bradley, A., et al. (1996). Involvement of mouse Mlhl in DNA mismatch repair and meiotic crossing over. Nature Genetics 13, 336-342. [00295] Bard, F, et al., "Peripherally administered antibodies against amyloid beta- peptide enter the central nervous system and reduce pathology in a mouse model of Alzheimer disease," Nature Med., vol. 6, No. 8, pp. 916-919, 2000.

[00296] Bardwell, et al, (2004). Altered somatic hypermutation and reduced class- switch recombination in exonuclease 1-mutant mice. Nature Immunology, 5; 224-229. [00297] Bartels, A., Willemsen, A., Kortekaas, R., de Jong, B., de Vries, R., de Klerk,

O., van Oostrom, J., Portman, A., and Leenders, K. Decreased blood-brain barrier P- glycoprotein function in the progression of Parkinson's disease, PSP and MSA. Journal of Neural Transmission.

[00298] Barzilai, A., and Yamamoto, K. (2004). DNA damage responses to oxidative stress. DNA Repair (Amst) 3, 1109-1115.

[00299] Beduneau, A., Hindre, F., Clavreul, A., Leroux, J.C., Saulnier, P., and Benoit,

J.P. (2008). Brain targeting using novel lipid nanovectors. Journal of Controlled Release 126, 44-49.

[00300] Caldecott, K.W. (2003). DNA single-strand break repair and spinocerebellar ataxia. Cell 112, 7-10.

[00301] De Wind, N., Dekker, M., Berns, A., Radman, M., and Te Riele, H. (1995).

Inactivation of the mouse Msh2 gene results in mismatch repair deficiency, methylation tolerance, hyperrecombination, and predisposition to cancer. Cell 82, 321-330. [00302] Diler, A. S., et al (2007). Sex differences in modulating blood brain barrier permeability by NO in pentylenetetrazol-induced epileptic seizures. Life Sciences 80, 1274- 1281.

[00303] Dover, G.J. (2005). Hydroxyurea therapy in SS children. Blood 106, 2228-.

[00304] Edelmann, W., Cohen, P.E., Kane, M., Lau, K., Morrow, B., Bennett, S.,

Umar, A., Kunkel, T., Cattoretti, G., Chaganti, R., et al. (1996). Meiotic pachytene arrest in MLHl -deficient mice. Cell 85, 1125-1134.

[00305] El-Shemerly, M., Hess, D., Pyakurel, A.K., Moselhy, S., and Ferrari, S. (2008).

ATR-dependent pathways control hEXOl stability in response to stalled forks. Nucl Acids Res 36, 511-519.

[00306] El-Shemerly, M., Janscak, P., Hess, D., Jiricny, J., and Ferrari, S. (2005).

Degradation of human exonuclease Ib upon DNA synthesis inhibition. Cancer Research 65, 3604-3609.

[00307] Ferguson, S. D., Foster, K., and Yamini, B. (2007). Convection-enhanced delivery for treatment of brain tumors. Expert Review of Anticancer Therapy 7.

[00308] Hankins, J.S., Ware, R.E., Rogers, Z.R., Wynn, L.W., Lane, P.A., Scott, J.P., and Wang, W.C. (2005). Long-term hydroxyurea therapy for infants with sickle cell anemia: the HUSOFT extension study. Blood 106, 2269-2275.

[00309] Jancso, G., Domoki, F., S*ntha, P., Varga, J., Fischer, J.n., Orosz, K., Penke,

B., Becskei, A., Dux, M.r., and TUth, L. (1998). [beta] -Amyloid (1-42) peptide impairs blood- brain barrier function after intracarotid infusion in rats. Neuroscience Letters 253, 139-141. [00310] Kamens, H.M., and Crabbe, J.C. (2007). The parallel rod floor test: a measure of ataxia in mice. Nat Protocols 2, 277-281.

[00311] Ladd, P.D., Wilson III, D.M., Kelley, M.R., and Skalnik, D.G. (2003).

Identification of the human HEXl/hExol gene promoter and characterization of elements responsible for promoter activity. DNA Repair 2, 187-198.

[00312] Lee, B.I., and Wilson III, D.M. (1999). The RAD2 domain of human exonuclease 1 exhibits 5' to 3' exonuclease and flap structure- specific endonuclease activities. Journal of Biological Chemistry 274, 37763-37769.

[00313] Lee, S. D., and Alani, E. (2006). Analysis of interactions between mismatch repair initiation factors and the replication processivity factor PCNA. Journal of Molecular Biology 355, 175-184.

[00314] Nagaraja, T.N., Keenan, K.A., Fenstermacher, J.D., and Knight, R.A. (2008).

Acute leakage patterns of fluorescent plasma flow markers after transient focal cerebral ischemia suggest large openings in blood-brain barrier. Microcirculation 15, 1-14. [00315] Nguyen, Q.D., Shah, S.M., Hafiz, G., Quinlan, E., Sung, J., Chu, K.,

Cedarbaum, J.M., and Campochiaro, P.A. (2006). A Phase I Trial of an IV-Administered Vascular Endothelial Growth Factor Trap for Treatment in Patients with Choroidal Neovascularization due to Age-Related Macular Degeneration. Ophthalmology 113, 1522.el521-1522.el514.

[00316] Pang, Z., Lu, W., Gao, H., Hu, K., Chen, J., Zhang, C, Gao, X., Jiang, X., and

Zhu, C. (2008). Preparation and brain delivery property of biodegradable polymersomes conjugated with 0X26. Journal of Controlled Release 128, 120-127.

[00317] Pardridge, W.M. (2007a). Blood-brain barrier delivery. Drug Discovery Today

12, 54-61.

[00318] Pardridge, W.M. (2007b). Blood-brain barrier delivery of protein and non-viral gene therapeutics with molecular Trojan horses. Journal of Controlled Release 122, 345-348.

[00319] Rautio, J., Laine, K., Gynther, M., and Savolainen, J. (2008). Prodrug

Approaches for CNS Delivery. The AAPS Journal 10, 92-102.

[00320] Rolig, R.L., and McKinnon, PJ. (2000). Linking DNA damage and neurodegeneration. Trends Neurosci 23, 417-424.

[00321] Romano, C, and Hicks, D. (2007). Adult retinal neuronal cell culture. Progress in Retinal and Eye Research 26, 379-397.

[00322] Ruben J. Boado, Y.Z.Y.Z.Y.W.W.M.P. (2008). GDNF fusion protein for targeted-drug delivery across the human blood-brain barrier. Biotechnology and

Bioengineering 100, 387-396.

[00323] Schenk, et al., Immunization with amyloid-β attenuates Alzheimer-disease-like pathology in the PDAPP, Letters to Nature, 400:173-177 (JuI. 8, 1999)

[00324] Soon, D., Altmann, D., Fernando, K., Giovannoni, G., Barkhof, F., Polman, C,

O'Connor, P., Gray, B., Panzara, M., and Miller, D. (2007). A study of subtle blood brain barrier disruption in a placebo-controlled trial of natalizumab in relapsing remitting multiple sclerosis. Journal of Neurology 254, 306-314.

[00325] Tosi, G., Costantino, L., Ruozi, B., Forni, F., and Vandelli, M.A. (2008).

Polymeric nanoparticles for the drug delivery to the central nervous system. Expert Opinion on Drug Delivery 5, 155-174.

[00326] Tran, P.T., Erdeniz, N., Symington, L.S., and Liskay, R.M. (2004). EXOl-A multi-tasking eukaryotic nuclease. DNA Repair 3, 1549-1559.

[00327] Tyson RM, Kraemer DF, Hunt MA, Orbay P, Muldoon LL, Steeg PS, Neuwelt

EA. Chemotherapy with or without trastuzumab, a monoclonal antibody, and blood-brain barrier disruption for breast cancer brain metastases. Expert Review Anti-Cancer Therapy

3:97-112, 2006.

[00328] Villella, A.D. (2005). Mortality in Sickle Cell Patients on Hydroxyurea

Therapy. AAP Grand Rounds 14, 14-15.

[00329] Wardlaw, J.M., Farrall, A., Armitage, P.A., Carpenter, T., Chappell, F.,

Doubal, F., Chowdhury, D., Cvoro, V., and Dennis, M.S. (2008). Changes in Background

Blood-Brain Barrier Integrity Between Lacunar and Cortical Ischemic Stroke Subtypes.

Stroke 39, 1327-1332.

[00330] Wei, K., Clark, A.B., Wong, E., Kane, M.F., Mazur, D.J., Parris, T., Kolas,

N. K., Russell, R., Hou Jr, H., Kneitz, B., et al. (2003). Inactivation of exonuclease I in mice

results in DNA mismatch repair defects, increased cancer susceptibility, and male and female sterility. Genes and Development 17, 603-614.

[00331] Wilson III, D.M., Carney, J.P., Coleman, M.A., Adamson, A.W., Christensen,

M., and Lamerdin, J.E. (1998). Hexl: A new human Rad2 nuclease family member with homology to yeast exonuclease 1. Nucleic Acids Research 26, 3762-3768.

[00332] Wu, Y., Berends, M.J.W., Post, J.G., Mensink, R.G.J., Verlind, E., Van der

Sluis, T., Kempinga, C, Sijmons, R.H., Van der Zee, A.G.J., Hollema, H., et al. (2001).

Germline mutations of EXOl gene in patients with hereditary non-polyposis colorectal cancer

(HNPCC) and atypical HNPCC forms. Gastroenterology 120, 1580-1587.

[00333] Yamamoto, H., Hanafusa, H., Ouchida, M., Yano, M., Suzuki, H., Murakami,

M., Aoe, M., Shimizu, N., Nakachi, K., and Shimizu, K. (2005). Single nucleotide polymorphisms in the EXOl gene and risk of colorectal cancer in a Japanese population.

Carcinogenesis 26, 411-416.

[00334] Zeng, X., Chen, J., Deng, X., Liu, Y., Rao, M.S., Cadet, J.-L., and Freed, WJ.

(2006). An In Vitro Model of Human Dopaminergic Neurons Derived from Embryonic Stem

Cells: MPP+ Toxicity and GDNF Neuroprotection. Neuropsychopharmacology 31, 2708-

2715.