THE USE OF INHIBITORS OF CALCIUM-ACTIVATED CHLORIDE CHANNELS TO PREVENT AND TREAT PRETERM LABOR, ALONE OR IN COMBINATION

WITH OTHER TOCOLYTIC AGENTS STATEMENT OF GOVERNMENT SUPPORT

This invention was made with government support under grant number GM-093137, awarded by the National Institutes of Health. The government may have certain rights in this invention. CROSS-REFERENCE TO RELATED APPLICATIONS

The present application claims priority to U.S. provisional patent application serial no. 62/309,558 filed March 17, 2016, which is hereby incorporated by reference.

FIELD OF THE INVENTION

The invention relates generally to blocking calcium-activated channels in uterine tissue which in turn inhibits or blocks uterine contractions leading to preterm labor. This invention is useful for developing effective new tocolytic agents, and for treating and/or preventing preterm labor, alone or in combination with known tocolytic agents. In particular, agents that block calcium- activated chloride channels have a synergistic effect on inhibiting or blocking uterine contractions when combined with known tocolytic agents such as magnesium sulfate and nifedipine.

BACKGROUND OF THE INVENTION

Preterm birth ("PTB") is an enormous and growing global health care challenge. In 2006, preterm birth accounted for almost 13% of births in the developed world, with an incidence increasing 20% from 1990 (Muglia and Katz (2010); Tita and Rouse (2009)). In the United States, this amounts to greater than 520,000 preterm births occurring each year, many with substantial morbidity. The Center for Disease Control estimates that preterm birth- related morbidity results in $26 billion in annual healthcare expenditures in the United States alone (Centers for Disease Control (2013)).

Among all causes of premature birth, idiopathic preterm labor ("PTL") ranks the highest (Goldenberg et al. (2008)). While some advancement has been made in the management of preterm labor (Tita and Rouse (2009)), current tocolytic interventions remain largely inefficacious (Haas et al. (2012)). For example, while tocolytics can delay labor up to 48 hours, they are ineffective as primary treatment and solely utilized as a means to delay birth long enough to allow for corticosteroid-mediated lung maturity. Mechanistic limitations of current tocolytics include tachyphylaxis of G-protein receptors ( 2-adrenoceptor) and blockade of only limited components of procontractile calcium releasing mechanisms (i.e. calcium channel blockers only attenuate extracellular calcium entry). Given the magnitude of this health care challenge and the lack of definitive treatments for PTL it is clear that novel therapeutic options are sorely needed.

While PTL is a complex process that can originate from distinct pathogenic etiologies, premature uterine contractions remain a fundamental component of this disease. The organization of phasic uterine contractions is classically thought to depend on two processes: an initial intracellular calcium wave caused by membrane depolarization leading to an action potential (AP), and propagation of this action potential facilitated by intercellular calcium spread (Young (2000)). While the role of calcium in promoting myometrial contractility has been well established, the ionic contributions leading up to AP generation and ionic modulation of intracellular calcium dynamics is not completely understood (Sanborn (2000)).

The current understanding of myometrial AP generation rests on interplay between several ionic channels and their ability to alter uterine smooth muscle resting membrane potential (see Figure 1) (Berridge (2008)). Classically, AP requires raising the resting membrane potential of uterine smooth muscle (USM) cells from a relatively negative potential to a more positive threshold capable of triggering activation of voltage gated calcium (VGCC) and sodium channels (VGNaC) to facilitate the massive depolarization required for an AP (see #2 of Figure 1). While the channels involved in AP recovery have been identified (eg. BKCa, SK3) (Smith et al. (2007); Khan et al. (2001)), the molecular identity of the channel responsible for generating the depolarizing current that shifts USM resting membrane potential toward the AP threshold (see #1 of Figure 1) has remained an enigma and is surrounded in controversy (Brainard et al. (2007)). Electrophysiology studies of human myometrium demonstrate plateau potentials at approximately -30 mV for the duration of a phasic contraction, which typically lasts for 45-100 seconds (Young (2007)). The mechanisms that underpin the stability of the plateau potential are not well understood but, in the balance between K+ efflux and Ca2+ influx, chloride ions may provide an important damping mechanism. Since -30mV overlaps with the threshold window required for significant transmembrane calcium flux to occur through VGCCs, chloride channels are ideal candidates for modulation of membrane potential to maximize voltage gated calcium entry (Shmygol et al. (2007)). More recent work, suggests that this phenomenon may be a dynamic interaction between two channels: KIR7.1 (promoting relaxation via a hyperpolarizing current) and a yet to be identified calcium- activated chloride channel (CaCC) that promotes contraction (via depolarizing current) (McCloskey et al. (2014)). Indeed, another publication examining the transcriptomes of late gestation human myometrium reveals ample expression of a CaCC (known as ANOl) making this particular molecular target an attractive candidate (Chan et al. (2014)).

The results herein show ANOl to be an attractive target for the treatment and prevention of preterm labor. In particular, the data show ANOl to be involved in all three mechanisms of intracellular calcium elevation in the uterus, reducing calcium release from both extracellular and sarcoplasmic stores. Thus, an ANOl blockade would result in a complete arrest of calcium handling in a USM cell and since calcium is a critical mediator of USM contractility, blocking ANOl would result in a more efficient tocolytic agent than the ones presently available.

Additionally the results herein show that the combination of an agent that blocks

ANOl with other known tocolytic agents is superior to preventing and/or treating preterm labor than the use of the known tocolytic agents alone.

SUMMARY OF THE INVENTION

In certain embodiments, the present invention relates to a method for preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins {e.g., tannic acid), benzofuran {e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid {e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA), digallic acid, CaCC _inh - A01, T16Ai _nh -A01, and combinations thereof.

In certain embodiments, the present invention relates to a method for preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents. As shown herein, the administration of the combination of the two types of agents has a synergistic effect in preventing and/or treating preterm labor. Thus, further embodiments of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC _inh - A01 , T16Ain _h -A01, and combinations thereof.

In certain embodiments, the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.

In certain embodiments, the present invention relates to a method for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1

(ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid (e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCCin _h - A01 , T16Ain _h -A01, and combinations thereof.

In certain embodiments, the present invention relates to a method for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents. As shown herein, the combination of the two types of agents has a synergistic effect in decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle. Thus, further embodiments of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium- activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC _inh - A01, T16Ai _nh -A01, and combinations thereof.

In certain embodiments, the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.

In certain embodiments, the present invention relates to a method for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid (B25) ), anthranilic acid (e.g. , N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC _inh - A01, T16Ai _nh -A01, and combinations thereof. In certain embodiments, the present invention relates to a method for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents. As shown herein, the combination of the two types of agents has a synergistic effect in preventing and/or treating preterm labor. Thus, further embodiments of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of one or more agents that block or inhibit a calcium-activated chloride channel in the uterus in combination with a therapeutically effective amount of one or more other tocolytic agents, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

In a preferred embodiment, the calcium- activated chloride channel is anoctamin 1 (ANOl). In another preferred embodiment, the calcium-activated channel is anoctamin 2 (AN02).

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g. , tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid(B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid (MONNA)), digallic acid, CaCC _inh - A01, T16Ai _nh -A01, and combinations thereof.

In certain embodiments, the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.

The preferred methods of administration of the agents are chosen from the group consisting of oral, parental, and transvaginal, with transvaginal being most preferred.

The present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of contractions of the uterus and preterm labor.

BRIEF DESCRIPTION OF THE DRAWINGS

For the purpose of illustrating the invention, there are depicted in drawings certain embodiments of the invention. However, the invention is not limited to the precise arrangements and instrumentalities of the embodiments depicted in the drawings.

Abbreviations may be used in the figures as follows: USM= uterine smooth muscle; BB= benzbromarone; MN=MONNA. Figure 1 is a schematic of uterine tissue action potential.

Figure 2 are representative images from intact late gestation pregnant human uterine smooth muscle sections. Confocai microscopy images employing single, double, and triple staining with immunofluorescence labeling of antibodies directed against ANOl TMEMl 6 A (left hand panel), smooth muscle actin (SMA) (second from left hand panel), and/or the nuclear counterstain DAPI (right hand panel). Calibration bars represent 60 μπι,

Figure 3 are representative gel image of polymerase chain reaction performed with ten members of the ANO (TMEM16) family in cells and tissue including immortal human nonpregnant uterine smooth muscle cells, primary human non-pregnant uterine smooth muscle cells, human pregnant uterine smooth muscle tissue, human liver (positive control), and water (negative control). All negative water controls demonstrated no expression and all members were detected in positive control (human liver).

Figure 4A is a graph of ANO modulation of membrane potential (fluorescence versus time). Figure 4B is a graph of the relative depolarizing shift in fluorescence of the USM cells treated with the listed agent.

Figures 5A and 5B are representative force tracings of contractions and inhibition of contractions of human USM with tannic acid versus vehicle (Figure 5A) and benzbromarone versus vehicle (Figure 5B). Figure 5C are representative force tracings of contractions of human USM over time, under conditions of ANOl blockade using tannic acid (lower panel) and vehicle treated control (upper panel). Figure 5D are graphs of pacing frequency of contractions in controls and USM treated with tannic acid, and integrated muscle force in controls and USM treated with tannic acid. ***p<0.001 and *p<0.05 respectively, n= 6 / groups from 3 different patients.

Figure 6A is a sigmoidal dose-response curve demonstrating the percent reduction in integral force (g*sec) at different log concentrations of benzbromarone. EC5 ₀ of benzbromarone on the force of oxytocin-induced contraction of human USM is 63 μΜ. Figure 6B is a graph showing that benzbromarone significantly decreased percent integral force of oxytocin-induced human USM at 25 μΜ (*p<0.05, ***p<0.001, n.s. not significant). Figure 6C is a graph of a representative tracing demonstrating that frequency (as measured at two 30 minute time intervals) was decreased by benzbromarone in a concentration dependent manner (0 to 500 μΜ). Figure 6D show the slopes of tracings from Figure 6C were calculated and compiled, demonstrating that benzbromarone 50 μΜ decreases oxytocin- induced USM frequency of contraction. Figure 7 are representative tracings of fura-2 ratiometric changes in calcium fluorescence induced by ΙμΜ oxytocin in primary cultured human uterine smooth muscle cells. Figure 7A shows the ratio of fura-2 over time, in vehicle and tannic acid treated cells. Figure 7B shows the shows the ratio of fura-2 over time (total influx of calcium over time) in the presence or absence of external calcium. Figure 7C shows the ratio of fura-2 over time, in cells treated with DMSO (vehicle) and various amounts of benzbromarone.

Figure 8 is a graph showing the proof of concept of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels. Bold lines represent cells that received thapsigargin and thinner lines represent cells that received vehicle.

Figure 9 is a graph of the results of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels. Thick black lines represent cells that received BB.

Figure 10 are graphs of the results of the technique utilizing simultaneous recordings of calcium fluorescence using two distinct indicators: mag-fluo-4 to measure SR calcium levels (top panel) and fura 2 (bottom panel) to measure cytosolic calcium levels and treating cell with varying amounts of benzbromarone, DMSO, or DMSO and vehicle.

Figure 11 is a graph of cytosolic calcium in time following the sarcoplasmic depletion of calcium with thapsigargin, reintroduction of calcium, and subsequent treatment with a vehicle, or benzbromarone.

Figure 12A is a representative image of human USM cells showing f-actin (red) and calcium (green) indicators. Figure 12B shows simultaneous tracings of fluorescence of calcium via FITC and f-actin via TRITC.

Figure 13 shows that siRNA targeted reduction of ANOl contributes to reduced myosin light chain 20 (MLC20) phosphorylation following oxytocin stimulation in uterine smooth muscle (USM) cells. Figure 13A is a representative immunoblot demonstrating ANOl siRNA knockdown results in reduced ANOl protein expression. Figure 13B is a graph of the quantification of ANOl siRNA knockdown demonstrating a 49 ± 0.5% decrease in protein expression (n=5, *p<0.05). Figure 13C is a representative immunoblot demonstrating increased expression of p-MLC20 after oxytocin stimulation and decreased expression of p- MLC20 after ANOl siRNA knockdown. Figure 13D is a graph of the quantification of p- MLC20 as a percent of control. Oxytocin stimulation increased p-MLC20 expression by 283 ± 45%, while USM cells pretreated with ANOl siRNA only increased by 131 ± 34%.

Figure 14 is a graph of results of RhoA activation in cells induced by a Kir7.1 blocker Vu590, and treated with benzbromarone (BB) or MONNA.

Figure 15 A shows representative spontaneous transient inward currents (STIC) showing reversal of current at the chloride equilibrium potential. Figure 15B shows in the upper panel representative whole cell STIC membrane recording illustrating oxytocin- induced current enhancement was suppressed by tannic acid. The graph in the lower panel shows the amplitude of the currents in cells treated with various agents. Figure 15C shows in the upper panel representative whole cell STIC membrane recording illustrating the blockade of STIC activity in cells exposed to the anti-ANO antibody as compared to vehicle. The graph in Figure 15C shows the amplitude of currents in the cells treated with vehicle and exposed to the antibody (n=27 cells as compared to n=25 vehicle treated cells from single patient). **=p<0.01.

Figure 16 are representative whole cell patch clamp tracings of cells treated with terbutaline (Figure 16A) and Sp-8-pCPT-2'0-Me-cAMPs (Figure 16B).

Figure 17 are various graphs showing the differences in calcium fluorescence induced by oxytocin in human uterine smooth muscle cells treated with an ANOl inhibitor alone (MONNA or benzbromarone), another tocolytic agent alone (nifedipine), a combination of agents, or no drug treatment control (DMSO). (*** p<0.001). Figure 17A shows the results in terms of fura 2 ratio and Figure 17B shows the results in terms of percent of vehicle.

Figure 18 shows the results of experiments performed with pregnant human USM, treated with increasing doses of benzbromarone, tannic acid, MONNA (1μΜ-500μΜ) or vehicle control (0.1% DMSO) following contractile stimulation with oxytocin. Figure 18A are representative force tracing showing the differential potency (BB>MN>TA) of benzbromarone (tracing second from top), tannic acid (tracing second from bottom) and MONNA (bottom tracing) on contractive frequency and force compared to vehicle control (top tracing). *BB=benzbromarone, TA=tannic acid, MN=MONNA. Figure 18B is a graph showing the determination of IC5 ₀ . Percent reduction in integral force (g*sec) calculated from baseline oxytocin contractility was plotted using a variable slope sigmoidal dose-response curve [Y=Bottom + (Top-Bottom)/(l+10 ^A ((LogEC50-X)*HillSlope))]. Figure 18C is a graph showing the determination of contraction frequency. Baseline contraction frequency was assessed following 0.5 μΜ oxytocin over 60 minutes. Subsequent contraction frequency was measured after varying doses of benzbromarone, tannic acid, MONNA (1 μΜ-500 μΜ) or vehicle control (0.1% DMSO) over 60 minute time intervals. The data is expressed as % changes from baseline frequency/hour and analyzed using one way ANOVA and Bonferroni's Multiple Comparison Test to detect statistical significance from the vehicle control.

Figure 19A show graphs of the initial dose-response experiments performed to assess significant reductions in contractility mediated by nifedipine and benzbromarone demonstrated non-statistical reductions in force at 0.01 uM and 1 uM respectively. These subthreshold drug doses were then used in subsequent organ bath experiments utilizing mUSM (n=7 different mice) to assess for potentiation of relaxation when combining the ANOl antagonist benzbromarone with nifedipine. Figure 19B is representative force tracings showing the enhanced potency of combining low dose nifedipine and benzbromarone (bottom tracing) on both frequency and force of TEA-induced contractions compared to single low dose treatments (middle tracings) or vehicle control (top tracing). *BB=benzbromarone, NIF=nifedipine. Figure 19C shows a graph of the compiled data illustrating the percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility between treatment groups, BB alone, NIF alone and BB + NIF. Figure 19D is a graph showing the initial dose-response experiments performed to assess significant reductions in contractility mediated by nifedipine and benzbromarone. Figure 19E are graphs showing the results of the percent change of force of TEA-induced contractions when NIF was used alone and in combination with BB. Results were normalized to the control and reported as mean ± SEM. One way ANOVA and Bonferroni's Multiple Comparison Test was used to analyze statistical differences.

Figure 20 shows a graph of the compiled data illustrating the percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility between treatment groups, BB alone, NIF alone, MN alone, BB +MN, and BB + NIF using human USM cells. Results were normalized to the control and reported as mean ± SEM. One way ANOVA and Bonferroni's Multiple Comparison Test was used to analyze statistical differences.

DETAILED DESCRIPTION OF THE INVENTION

Definitions

The terms used in this specification generally have their ordinary meanings in the art, within the context of this invention and the specific context where each term is used. Certain terms are discussed below, or elsewhere in the specification, to provide additional guidance to the practitioner in describing the methods of the invention and how to use them. Moreover, it will be appreciated that the same thing can be said in more than one way. Consequently, alternative language and synonyms may be used for any one or more of the terms discussed herein, nor is any special significance to be placed upon whether or not a term is elaborated or discussed herein. Synonyms for certain terms are provided. A recital of one or more synonyms does not exclude the use of the other synonyms. The use of examples anywhere in the specification, including examples of any terms discussed herein, is illustrative only, and in no way limits the scope and meaning of the invention or any exemplified term. Likewise, the invention is not limited to its preferred embodiments.

The term "subject" as used in this application means mammals. Mammals include canines, felines, rodents, bovine, equines, porcines, ovines, and primates. Thus, the invention can be used in veterinary medicine, e.g., to treat companion animals, farm animals, laboratory animals in zoological parks, and animals in the wild. The invention is particularly desirable for human medical applications

The term "patient" as used in this application means a human subject. In some embodiments of the present invention, the "patient" is known or suspected of having or being at risk of developing preterm labor.

"Preterm labor" is defined as contractions of the uterus that begin at weeks 20- 36 of a human pregnancy.

The phrases "therapeutically effective amount" or "therapeutically effective dose" or "therapeutically effective dosage" as used herein to mean an amount sufficient to cause an improvement in a clinically significant condition in the subject, or delays or minimizes or mitigates one or more symptoms associated with the disease or disorder, or results in a desired beneficial change of physiology in the subject. In some embodiments, the clinically significant condition is preterm labor, and the symptom is contractions of the uterine smooth muscle.

The terms "treat", "treatment", and the like refer to a means to slow down, relieve, ameliorate or alleviate at least one of the symptoms of the disease or disorder, or reverse the disease or disorder after its onset.

The terms "prevent", "prevention", and the like refer to acting prior to overt disease or disorder onset, to prevent the disease or disorder from developing or minimize the extent of the disease or disorder, or slow its course of development.

The term "in need thereof would be a subject known or suspected of having or being at risk of developing preterm labor. The term "agent" as used herein means a substance that produces or is capable of producing an effect and would include, but is not limited to, chemicals, pharmaceuticals, biologies, small organic molecules, antibodies, nucleic acids, peptides, and proteins.

The terms "screen" and "screening" and the like as used herein means to test an agent to determine if it has a particular action or efficacy.

The terms "identification", "identify", "identifying" and the like as used herein means to test agents and their ability to have a particular action or efficacy.

As used herein, the term "physiologically functional derivative" refers to a compound (e.g, a drug precursor) that is transformed in vivo to yield a therapeutic agent. The transformation may occur by various mechanisms (e.g., by metabolic or chemical processes), such as, for example, through hydrolysis in blood. Prodrugs are such derivatives, and a discussion of the use of prodrugs is provided by T. Higuchi and W. Stella, "Pro-drugs as Novel Delivery Systems," Vol. 14 of the A.C.S. Symposium Series, and in Bioreversible Carriers in Drug Design, ed. Edward B. Roche, American Pharmaceutical Association and Pergamon Press, 1987.

As used herein "an adverse effect" is an unwanted reaction caused by the administration of a drug.

The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e. , the limitations of the measurement system, i.e., the degree of precision required for a particular purpose, such as a pharmaceutical formulation. For example, "about" can mean within 1 or more than 1 standard deviations, per the practice in the art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5-fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated, the term "about" meaning within an acceptable error range for the particular value should be assumed.

Mechanisms of ANOl Intracellular Calcium Elevation in Human Uterine Cells

Calcium-activated chloride channels or CaCCs are responsible for depolarizing spontaneous transient inward currents (STICs) in many cell types. They are activated by membrane depolarization and calcium, and allow egress of chloride ions down voltage gradient across the cell membrane.

In 2008, three laboratories independently discovered that a member of the TMEM16/Anoctamin family of proteins demonstrated electrophysiologic and pharmacologic characteristics typical of classic CaCCs (Yang et al. (2008); Caputo et al. (2008); Galietta (2009)). While this discovery has transformed CaCC studies in many cell types, their role in uterine physiology has not yet been well studied. In other smooth muscle beds, ANOl serves an integral role in mediating cell membrane depolarization, and smooth muscle contraction. Earlier work by the inventors has shown ANOl antagonism relaxes pre-contracted airway smooth muscle (Gallos et al. (2013)). In addition, ANOl is responsible for slow membrane depolarization waves in gastrointestinal smooth muscle and rhythmic contractile pacing in the gut (Hwang et al. (2009)).

Additional earlier work by the inventors showed the presence of anoctamin 1 and 2 (ANOl and 2) in human and murine uterine smooth muscle, and a lack of ANO expression on murine uterine blood vessels (similar to human USM). It was also found that antagonism of these channels promotes relaxation of spontaneous contractions in murine uterine smooth muscle. The paper also reported the blockade of ANOl and 2 inhibited both agonist-induced and spontaneous transient inward currents (STICs) and abolished G-protein coupled receptor (oxytocin) mediated elevations in intracellular calcium in mice. See Bernstein et al. (2014).

The evidence presented herein establishes the mRNA expression profile of the entire

Anoctamin family, and clearly illustrates that the CaCCs ANOl and 2 transcripts are present throughout gestation and are preserved in cultures of human uterine smooth muscle cells (Example 1) and that the blockade of ANOl inhibited oxytocin induced human pregnant term uterine contractions ex vivo (Example 3) and stopped oxytocin induced intracellular calcium elevations (Example 4). There is also evidence herein that ANOl -mediated chloride current is responsible for spontaneous transient inward currents (STICs) in human USM cells (Example 8).

Calcium elevation in myometrial cells can occur from three sources: 1. via cell membrane depolarization (raising the resting membrane potential of uterine smooth muscle (USM) cells from a relatively negative potential to a more positive threshold capable of triggering activation of voltage gated calcium (VGCC) and sodium channels (VGNaC) to facilitate the massive depolarization required for an AP); 2. calcium release from sarcoplasmic reticulum via G-protein coupled receptor agonism; and 3. store operated calcium refilling (SOCE) or repletion of SR calcium following depletion. Provided herein is evidence that activation of ANOl in USM promotes depolarization, and the blockade of these channels elicits potential hyperpolarization which would in turn mitigates AP generation (Example 2). There is also evidence provided herein that ANOl antagonism inhibits the release of calcium from the SR (Example 5), and impacts SOCE (Example 6). Thus, based upon the findings set forth herein, the pharmacologic targeting of ANOl represents a novel mechanistic target involved in all three mechanisms of intracellular calcium elevation in human myometrial cells, and targeting ANOl would reduce calcium release from both extracellular and sarcoplasmic stores. This multi-modal calcium blockade represents complete arrest of calcium handling in a USM cell and since calcium is a critical mediator of USM contractility, an agent targeting ANOl would be a more efficient tocolytic agent than any currently in use, having the ability to stop uterine contractions completely and for a longer period of time. Indeed, given this novel finding that ANOl is involved in all three mechanisms of calcium increase in uterine cells, there is the promise that ANOl blockers can be used over a longer period of time than is currently allowed by the tocolytic agents, in a person who is experiencing uterine contractions leading to preterm labor, or one who is at risk for preterm labor. Also, as will be discussed below, agents that are currently known to block ANOl are considered safe for the administration to pregnant subjects.

Also set forth herein is evidence of the effectiveness in selective ANOl blockers to inhibit all three of these mechanisms of action. The therapeutic agents exemplified herein include gallotannins (e.g., tannic acid), and benzofuran (e.g., benzbromarone), both which have been safely used in humans as anti-inflammatory agents, and anthranilic acid (e.g., N- ((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA) (Oh et al. (2013)). In addition to its high selectivity for ANOl, MONNA shares structural similarity with mefenamic acid, a compound from this same drug class that has been used safely in pregnant patients in the United Kingdom (Mital et al. (1992)). These agents have not previously been shown to block ANOl in uterine tissue or to decrease or inhibit contractions in uterine tissue.

Studies are also set forth herein that show that ANOl antagonism potentiates the effects of other tocolytic agents, including those that block calcium channels, i.e, voltage gated calcium channels (VGCCs) and can thus be used in conjunction with such agents, including but not limited to nifedipine, terbutaline, and magnesium sulfate (Examples 9, 10, 12, and 13). Specifically, these studies showed significant relaxation of uterine muscle tissue at concentrations of these agents in combination, concentrations which elicited no response when the agents were used alone (Examples 12 and 13). Use of Calcium- Activated Channel Inhibitors for Prevention and/or Treatment of Preterm

Labor and Contractions of Uterine Muscle Tissue

In certain embodiments, the invention provides for a method of treating preterm labor, a method for preventing preterm labor, and a method of controlling the timing of parturition. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for treating and/or preventing preterm labor, for pharmaceutical compositions useful in the methods of treating and preventing preterm labor, and controlling the timing of parturition.

In certain embodiments, the invention relates to any one of the aforementioned methods, wherein delivery or parturition is delayed or prevented for at least about 2 days, at least about 3 days, at least about 4 days, at least about 5 days, at least about 6 days, at least about 7 days, at least about 8 days, at least about 9 days, or at least about 10 days. In certain embodiments, the invention relates to any one of the aforementioned methods, wherein delivery or parturition is delayed or prevented until the fetus is at about 40 weeks gestational age, about 39 weeks, about 38 weeks, or about 37 weeks gestational age.

In certain embodiments, the invention provides for a method of reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle and for pharmaceutical compositions useful in the methods of reducing, decreasing, inhibiting or stopping contractions of the uterine smooth muscle.

In certain embodiments, the invention provides for a method of relaxing the uterine smooth muscle. In certain embodiments, the invention provides for a method of manufacture of a medicament useful for relaxing the uterine smooth muscle and for pharmaceutical compositions useful in the methods of relaxing the uterine smooth muscle.

Any of the methods of the invention can be used for a subject, in particular a human subject, who is showing symptoms of preterm labor and/or contractions of the uterine smooth muscle in a pregnancy that is earlier than 37 weeks. Any of the methods of the invention can also be used on a subject who is at risk for preterm labor. Factors that could consider making a woman at risk for preterm labor, include but are not limited to, smoking prior to or during pregnancy, being overweight or underweight, drinking alcohol during pregnancy, illegal drug use during pregnancy, age (less than 17 years of age or greater than 35 years of age), limited access to prenatal care, carrying twins or other multiple pregnancies, and a personal or family history of preterm labor. Certain conditions may make a woman at risk for preterm labor include but are not limited to high blood pressure, preeclampsia, diabetes, a blood clotting disorder, placenta previa, placental abruption, cervical insufficiency, or an infection, such as chlamydia, gonorrhea, trichomoniasis, kidney infection, pneumonia, appendicitis, asymptomatic bacteriuria, or bacterial vaginosis.

As shown herein, the blockage or inhibition of calcium-activated chloride channels, in particular anoctamin 1 and 2, reduces, decreases, inhibits or stops contractions of, and relaxes, the uterine smooth muscle which in turn prevents and/or treats preterm labor. Thus, any agent that would block or inhibit these calcium-activated chloride channels could be used as a treatment and/or prevention of preterm labor and/or as a treatment and/or prevention of contractions of the uterine smooth muscle and/or the promotion of relaxation of the uterine smooth muscle tissue. Such agents include but are not limited to chemicals, phytochemicals, pharmaceuticals, biologies, small organic molecules, antibodies, nucleic acids, peptides, and proteins.

In certain embodiments, the agents are chosen from the group consisting of gallotannins (e.g., tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6- difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carboxylic acid) (B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA)), digallic acid, CaCCi _nh -AOl (Namkung et al. (2011)), T16A _inh -A01 (Namkung et al. (2011)), and combinations thereof.

A preferred agent is benzbromane. A further preferred agent is tannic acid. Yet a further preferred agent is MONNA.

In certain embodiments, the agents that block or inhibit ANOl or AN02 are administered in combination with other tocolytic agents. In certain embodiments, the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.

Inhibiting the CaCCs can also be effected using "decoy" molecules which mimic the region of a target molecule in the pathway, that another molecule, binds and activates. The activating molecule would bind to the decoy instead of the target, and activation could not occur.

Inhibition can also be effected by the use of a "dominantly interfering" molecule, or one in which the binding portion of activating molecule is retained but the molecule is truncated so that the activating domain is lacking. These molecules would bind to receptors in the pathway but be unproductive and block the receptors from binding to the activating molecule. Such decoy molecules and dominantly interfering molecule can be manufactured by methods known in the art. Inhibiting the CaCCs can also be effected using short RNA molecules. Among these are short interfering RNA (siRNA), small temporal RNAs (stRNAs), short hairpin RNA (shRNA), and micro- RNAs (miRNAs). Short interfering RNAs silence genes through an mRNA degradation pathway, while stRNAs and miRNAs are approximately 21 or 22 nt RNAs that are processed from endogenously encoded hairpin-structured precursors, and function to silence genes via translational repression. See, e.g., McManus et al. (2002). RNA 8(6):842-50; Morris et al. (2004). Science 305(5688): 1289-92; He and Hannon. (2004). Nat. Rev. Genet. 5(7):522-31.

"RNA interference, or RNAi" a form of post-transcriptional gene silencing ("PTGS"), describes effects that result from the introduction of double- stranded RNA into cells (reviewed in Fire. (1999). Trends Genet. 15:358-363; Sharp. (1999) Genes Dev. 13: 139- 141 ; Hunter. (1999). Curr. Biol. 9:R440-R442; Baulcombe. (1999). Curr. Biol. 9:R599-R601 ; Vaucheret et al. (1998). Plant J. 16:651-659). RNA interference, commonly referred to as RNAi, offers a way of specifically inactivating a cloned gene, and is a powerful tool for investigating gene function.

The active agent in RNAi is a long double-stranded (antiparallel duplex) RNA, with one of the strands corresponding or complementary to the RNA which is to be inhibited. The inhibited RNA is the target RNA. The long double stranded RNA is chopped into smaller duplexes of approximately 20 to 25 nucleotide pairs, after which the mechanism by which the smaller RNAs inhibit expression of the target is largely unknown at this time. While RNAi was shown initially to work well in lower eukaryotes, for mammalian cells, it was thought that RNAi might be suitable only for studies on the oocyte and the preimplantation embryo.

More recently, it was shown that RNAi would work in human cells if the RNA strands were provided as pre-sized duplexes of about 19 nucleotide pairs, and RNAi worked particularly well with small unpaired 3' extensions on the end of each strand (Elbashir et al. (2001). Nature 411 :494-498). In this report, "short interfering RNA" (siRNA, also referred to as small interfering RNA) were applied to cultured cells by transfection in oligofectamine micelles. These RNA duplexes were too short to elicit sequence-nonspecific responses like apoptosis, yet they efficiently initiated RNAi. Many laboratories then tested the use of siRNA to knock out target genes in mammalian cells. The results demonstrated that siRNA works quite well in most instances.

Software programs for predicting siRNA sequences to inhibit the expression of a target protein are commercially available and find use. One program, siDESIGN from Dharmacon, Inc. (Lafayette, Colo.), permits predicting siRNAs for any nucleic acid sequence, and is available on the internet at dharmacon.com. Programs for designing siRNAs are also available from others, including Genscript (available on the internet at genscript.com/ssl-bin/app/rnai) and, to academic and non-profit researchers, from the Whitehead Institute for Biomedical Research found on the worldwide web at "jura. wi.mit.edu/pubint/http://iona. wi.mit.edu/siRNAext/."

Alternatively, double-stranded (ds) RNA is a powerful way of interfering with gene expression in a range of organisms that has recently been shown to be successful in mammals (Wianny and Zernicka-Goetz. (2002)., Nat. Cell. Biol. 2:70-75).

Any suitable viral knockdown system could be utilized for decreasing ANO 1/2 mRNA levels including AAV, lentiviral vectors, or other suitable vectors.

Additionally, specifically targeted delivery of shRNA or other ANO 1/2 blocking molecule (nucleic acid, peptide, or small molecule) could be delivered by targeted liposome, nanoparticle or other suitable means.

MicroRNA can also be used to inhibit ANO 1/2. MicroRNAs are small non-coding RNAs averaging 22 nucleotides that regulate the expression of their target mRNA transcripts by binding. Binding of microRNAs to their targets is specified by complementary base pairing between positions 2-8 of the microRNA and the target 3' untranslated region (3' UTR), an mRNA component that influences translation, stability and localization. Additionally, this microRNA can also be modified for increasing other desirable properties, such as increased stability, decreased degradation in the body, and increased cellular uptake.

Antibodies or antibody fragments that recognize and inactivate ANOl or AN 02 can also be used in the present invention.

The terms "antibody" and "antibodies" include polyclonal antibodies, monoclonal antibodies, humanized or chimeric antibodies, single chain Fv antibody fragments, Fab fragments, and F(ab¾ fragments. Polyclonal antibodies are heterogeneous populations of antibody molecules that are specific for a particular antigen, while monoclonal antibodies are homogeneous populations of antibodies to a particular epitope contained within an antigen. Monoclonal antibodies are particularly useful in the present invention.

Antibody fragments that have specific binding affinity for a target of interest {i.e., ANOl) can be generated by known techniques. Such antibody fragments include, but are not limited to, F(ab')2 fragments that can be produced by pepsin digestion of an antibody molecule, and Fab fragments that can be generated by reducing the disulfide bridges of F(ab¾ fragments. Alternatively, Fab expression libraries can be constructed. See, for example, Huse et al. (1989). Single chain Fv antibody fragments are formed by linking the heavy and light chain fragments of the Fv region via an amino acid bridge (e.g., 15 to 18 amino acids), resulting in a single chain polypeptide. Single chain Fv antibody fragments recognizing a target of interest can be produced through standard techniques, such as those disclosed in U.S. Patent No. 4,946,778.

Once produced, antibodies or fragments thereof can be tested for recognition of the target of interest by standard immunoassay methods including, for example, enzyme-linked immunosorbent assay (EL1SA) or radioimmunoassay assay (RIA). See, Short Protocols in Molecular Biology, eds. Ausubel et al., Green Publishing Associates and John Wiley & Sons (1992).

As described herein, the present invention further provides a kit to treat and/or prevent preterm labor. The kit is an assemblage of materials or components, including at least one of the inventive compositions. Thus, in some embodiments the kit contains a composition including an agent that would block or inhibit calcium-activated chloride channels, in particular ANOl or AN02. In a further embodiment the kit would contain a composition chosen from the group consisting of gallotannins (e.g., tannic acid), benzofuran (e.g., benzbromarone; 5-[(2,6-difluorobenzyl)oxy]-2-(2-naphthyl)benzofuran-3-carbo xylic acid) (B25)), anthranilic acid (e.g., N-((4-methoxy)-2-naphthyl)-5-nitroanthranilic acid) (MONNA)), digallic acid, CaCC _inh -A01 (Namkung et al. (2011)), T16A _inh -A01 (Namkung et al. (2011)), and combinations thereof.

In certain embodiments, the kit would include other tocolytic agents. In certain embodiments, the other tocolytic agents are terbutaline, magnesium sulfate, and nifedipine.

Instructions for use may be included in the kit. "Instructions for use" typically include a tangible expression describing the technique to be employed in using the components of the kit to effect a desired outcome. Optionally, the kit also contains other useful components, such as, diluents, buffers, pharmaceutically acceptable carriers, syringes, catheters, applicators, pipetting or measuring tools, bandaging materials or other useful paraphernalia as will be readily recognized by those of skill in the art.

The materials or components assembled in the kit can be provided to the practitioner stored in any convenient and suitable ways that preserve their operability and utility. For example the components can be in dissolved, dehydrated, or lyophilized form; they can be provided at room, refrigerated or frozen temperatures. The components are typically contained in suitable packaging material(s). As employed herein, the phrase "packaging material" refers to one or more physical structures used to house the contents of the kit, such as inventive compositions and the like. The packaging material is constructed by well-known methods, preferably to provide a sterile, contaminant-free environment.

Synergistic Effect of Calcium- Activated Channel Inhibitors with Other Tocolytic Agents To date, there are no effective tocolytics that can be used for more than seven days due to maternal risk, and most are only used for a period of 24 to 48 hours in order to administer corticosteroids to reduce neonatal organ immaturity.

Current tocolytic agents include β agonists including terbutaline, Ca2+ channel blockers including nifedipine, and T-type calcium channel inhibitors including magnesium sulfate. All tocolytic agents have adverse side effects to mother and fetus and are not used for periods more than a week.

ANOl and AN02 inhibitors are more effective tocolytic agents than the current agents because they specifically target and block calcium- activated chloride channels, which are involved in all three mechanisms of calcium elevation in the uterus. Moreover, benzbromarone is a known anti-inflammatory with mild gastrointestinal side effects. Benzbromarone is administered safely to adults at a dose of about 50 to about 300 mg daily.

As shown herein, surprisingly, when administered together, ANOl inhibitors and known tocolytic agents worked synergistically. Specifically, when nifedipine, a Ca2+ channel blocker, was used in conjunction with either benzbromarone or MONNA, calcium flux inhibition in human USM cells was enhanced by over 50% (Example 10).

Additionally, when administered together ANOl inhibitors and known tocolytic agents worked synergistically in reducing contractions of the uterine smooth muscle in both mice and humans, allowing a lesser therapeutically effective amount of both agents to be administered with significant effect on reducing muscle contractions. When benzbromarone or MONNA was used in conjunction with nifedipine, significant relaxation was seen in uterine smooth muscle at concentrations of the agents that did not elicit a response when used alone.

In humans, benzbromarone was shown to effectively reduce contractions at a minimum dose of about 25-50 μΜ and an IC5 ₀ of 34 μΜ. Similarly MONNA was shown to effectively reduce contractions at a minimum dose of 100 μΜ and an IC5 ₀ of 59 μΜ. When combined with nifedipine at a dose of 0.01 μΜ, benzobromarone was effective in reducing contractions at 5 μΜ, about one-fifth (1/5) to about one-tenth (1/10) of the minimum therapeutically effective amount when used alone. Similarly, MONNA, when used in conjunction with nifedipine, was effective at 25 μΜ, about one-quarter (1/4) of the minimum therapeutically effective amount. See Examples 11 and 13. Perhaps a more significant result was that a very low dose of nifedipine was effective in reducing uterine muscle contractions, one which elicited no response when used alone (Example 13).

Similarly, in mice, benzbromarone was shown to effectively reduce contractions at an IC5 ₀ of 10 μΜ. Nifedipine was shown to be effective at an IC5 ₀ of 47 nM. When combined, contractions were significantly reduced at dosages of 0.01 μΜ of nifedipine and 1 μΜ of benzobromarone (Example 12). Thus, benzbromarone, when combined with nifedipine was again effective at a minimum dose about one-tneth (1/10) of the minimum dose when used alone. The nifedipine was effective at a minimum dose about one-fifth (1/5) the minimum dose when used alone.

Thus, one embodiment of the present invention is a method of treating and/or preventing preterm labor by administering agents that block or inhibit calcium- activated chloride channels, in particular anoctamin 1 and 2, together or in conjunction with other tocolytic agents. As shown herein, when agents that block or inhibit calcium- activated chloride channels, in particular anoctamin 1 and 2, are administered in combination with other tocolytic agents, a lesser therapeutically effective amount of both agents can be administered to reduce, decrease, inhibit or stop contractions of uterine smooth muscle, i.e, relax uterine smooth muscle tissue.

In one preferred embodiment, nifedipine is used in combination with benzbromane. In a further preferred embodimeent, nifedipine is used in combination with MONNA.

In particular, when combined with an ANOl inhibitor, nifedipine can used at a significantly lower therapeutically effective dose and maintain effectiveness, ranging from about one -half to one-fifth from the standard therapeutically effective dose.

In a further preferred embodiment, magnesium sulfate is used in combination with benzbromane. In a further preferred embodimeent, magnesium sulfate is used in combination with MONNA.

In particular, when combined with an ANOl inhibitor, magnesium sulfate can used at a significantly lower therapeutically effective dose and maintain effectiveness, ranging from about one -half to one-fifth from the standard therapeutically effective dose.

Additionally, benzobromarone when combined with nifedipine or magnesium sulfate can be used at a therapeutically effective dose ranging from about one-fifth to one-tenth of the normal therapeutically effective dose needed to inhibit uterine muscle contractions. MONNA when combined with nifedipine or magnesium sulfate can be used at a therapeutically effective dose ranging from about one-half to one-quarter of the normal therapeutically effective dose needed to inhibit uterine muscle contractions when combined with nifedipine or magnesium sulfate.

Therapeutically Effective Dosages

Selection of a therapeutically effective dose will be determined by the skilled artisan considering several factors which will be known to one of ordinary skill in the art. Such factors include the particular form of the inhibitor, and its pharmacokinetic parameters such as bioavailability, metabolism, and half-life, which will have been established during the usual development procedures typically employed in obtaining regulatory approval for a pharmaceutical compound. Further factors in considering the dose include the condition or disease to be treated or the benefit to be achieved in a normal individual, the body mass of the patient, the route of administration, whether the administration is acute or chronic, concomitant medications, and other factors well known to affect the efficacy of administered pharmaceutical agents. Thus, the precise dose should be decided according to the judgment of the person of skill in the art, and each patient's circumstances, and according to standard clinical techniques.

In some embodiments, the administration of any agent to prevent and/or treat preterm labor is administered once and then the subject is monitored for improvement in the condition. If the preterm labor is persisting a subsequent administration of the agent can be administered.

Because the agents described herein that inhibit or block calcium-activated chloride channels, more particularly anoctamin 1 and 2 can be better tolerated than known tocolytics, these agents can be administered on a regular basis to a subject at risk for preterm labor. The administration of these agents can be once a day, twice a day, three times a day, four times a day, five times a day, up to six times a day, preferably at regular intervals. A subject can be monitored for improvement during the therapy and the dosages adjusted.

In some embodiments, an effective dose of the ANO 1 or ANO 2 inhibitor including but not limited to, benzbromarone or MONNA is about 0.5-1 mg/day, 1-5 mg/day, 5-10 mg/day, 10-15 mg/day, 15-20 mg/day, 20-25 mg/day, 25-30 mg/day, 30-35 mg/day, 35-40 mg/day, 40-45 mg/day, 45-50 mg/day, 50-55 mg/day, 55-60 mg/day, 60-65 mg/day, 65-70 mg/day, 70-75 mg/day, 75-80 mg/day, 80-85 mg/day, 85-90 mg/day, 90-95 mg/day or 95-100 mg/day, 100-200 mg/day, 200-300 mg/day, 300-400 mg/day, 400-500 mg/day, 500-600 mg/day, 600-700 mg/day, 700-800 mg/day, 800-900 mg/day, 900-1000 mg/day, 1000-1100 mg/day, 1100-1200 mg/day, 1200-1300 mg/day, 1300-1400 mg/day, 1400-1500 mg/day, 1500-1600 mg/day, 1600-1700 mg/day, 1700-1800 mg/day, 1800-1900 mg/day, 1900-2000 mg/day, 2000-2100 mg/day, 2100-2200 mg/day, 2200-2300 mg/day, 2300-2400 mg/day, 2400-2500 mg/day, 2500-2600 mg/day, 2600-2700 mg/day, 2700-2800 mg/day, 2800-2900 mg/day, 2900-3000 mg/day, 3000-3100 mg/day, 3100-3200 mg/day, 3200-3300 mg/day, 3300-3400 mg/day, 3400-3500 mg/day, 3500-3600 mg/day, 3600-3700 mg/day, 3700-3800 mg/day, 3800-3900 mg/day, 3900-4000 mg/day, 4000-4200 mg/day, 4200-4400 mg/day, 4400-4600 mg/day, 4600-4800 mg/day or 4800-5000 mg/day.

In some embodiments, a therapeutically effective dose of benzbromarone is about 50 to about 300 mg daily.

One aspect of the current invention, based upon the discovery of the synergistic effect of decreasing, inhibiting, preventing and/or treating contractions of the smooth uterine muscle, i.e., relaxing the smooth uterine muscle, is the co-administration of agents described herein that inhibit or block calcium- activated chloride channels, more particularly anoctamin 1 and 2, with known tocolytics, allowing about one-half (1/2), about one-quarter (1/4), about one-fifth (1/5), up to about one-tenth (1/10) of a standard or normal therapeutically effective amount or dose to be administered of both the ANOl/2 blockers and the known tocolytic to achieve the same effectiveness. Thus, it will be understood that when administered together, the dose of the ANO 1/2 inhibitors as well as the additional tocolytic agent can be from about 1/10 to 1/2 of the dosages set forth herein and/or other standard or routine dosages.

Magnesium sulfate is generally administered at a loading dose of about 4 to 6 grams over about 15 to 30 minutes and then a continuous infusion is given at about 1 to about 4 grams per hours. Generally magnesium sulfate is administered intravenously.

Terbutiline is generally given in a dosage of about 2.5 to 5.0 mg, orally 30 minutes, then every two to four hours thereafter to control contractions.

In most protocols, nifedipine is administered orally in a loading dose of 30 mg, followed by 20 mg given every four to eight hours for 24 hours, and then a maintenance dose of 10 mg every eight hours until desired time of delivery.

One embodiment of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

One embodiment of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

One embodiment of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of nifedipine, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

One embodiment of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods of preventing and/or treating preterm labor, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

One embodiment of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods for decreasing, inhibiting, preventing and/or treating contractions of uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

One embodiment of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of benzbromarone in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

Further embodiments of the present invention are methods for relaxing uterine smooth muscle, comprising administering to a subject in need thereof, a therapeutically effective amount of MONNA in combination with a therapeutically effective amount of magnesium sulfate, wherein the therapeutically effective amount of both agents is less than the therapeutically effective amount administered when the agents are used alone.

In the some of the foregoing embodiments, the dose of benzbromarone is from about

1/10 to 1/4 of a standard therapeutically effective dose. In some embodiments, the dose of benzbromarone is about 5 to 75 mg daily, about 10 to about 60 mg daily, or about 12.5 to about 30 mg daily. In some embodiments, the dose of MONNA is about 1/5 to 1/2 of a standard therapeutically effective dose. In some embodiments, the dose of MONNA ranges from about 0.1 mg/day to about 1000 mg/day. In some embodiments, dose of nifedipine is about 1/5 to about 1/2 of a standard therapeutically effective dose. In some embodiments, the initial loading dose of nifedipine is about 6 to about 15 mg, with about 2 to about 10 mg given thereafter. In some embodiments, the dose of magnesium sulfate is about 1/5 to about 1/2 of a standard therapeutically effective dose. In some embodiments, the initial loading dose of magnesium sulfate is about 0.8 grams to about 3 grams, followed by about 0.2 grams to 2 grams as needed.

The co- administration of the agents can be by any administration described herein. Moreover, it can be in one composition, or in more than one composition. The administration of the agents can be simultaneous, concurrently or sequentially.

Pharmaceutical Compositions and Methods of Administration

The present invention encompasses the administration of agents that inhibit or block calcium- activated chloride channels, more particularly anoctamin 1 and 2, alone and in combination with other tocolytic agents. Methods of administration of the agents include oral; mucosal, such as nasal, sublingual, vaginal, buccal, or rectal; parenteral, such as subcutaneous, intravenous, bolus injection, intramuscular, or intraarterial; or transdermal administration to a subject. Thus, the agent must be in the appropriate form for administration of choice. Preferred methods of administration are oral, parental and vaginal.

Such compositions for administration may comprise a therapeutically effective amount of the anoctamin 1 or 2 inhibitory agent and a pharmaceutically acceptable carrier. The phrase "pharmaceutically acceptable" refers to molecular entities and compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction, such as gastric upset, dizziness and the like, when administered to a human, and approved by a regulatory agency of the Federal or a state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans. "Carrier" refers to a diluent, adjuvant, excipient, or vehicle with which the therapeutic is administered. Such pharmaceutical carriers can be sterile liquids, such as saline solutions in water and oils, including those of petroleum, animal, vegetable, or synthetic origin, such as peanut oil, soybean oil, mineral oil, sesame oil, and the like. A saline solution is a preferred carrier when the pharmaceutical composition is administered intravenously. Saline solutions and aqueous dextrose and glycerol solutions can also be employed as liquid carriers, particularly for injectable solutions. Suitable pharmaceutical excipients include starch, glucose, lactose, sucrose, gelatin, malt, rice, flour, chalk, silica gel, sodium stearate, glycerol monostearate, talc, sodium chloride, dried skim milk, glycerol, propylene, glycol, water, ethanol, and the like. The composition, if desired, can also contain minor amounts of wetting or emulsifying agents, or pH buffering agents.

These compositions can take the form of solutions, suspensions, emulsions, tablets, pills, capsules, powders, sustained-release formulations, cachets, troches, lozenges, dispersions, suppositories, ointments, cataplasms (poultices), pastes, powders, dressings, creams, plasters, patches, aerosols, gels, liquid dosage forms suitable for parenteral administration to a patient, and sterile solids (e.g., crystalline or amorphous solids) that can be reconstituted to provide liquid dosage forms suitable for parenteral administration to a patient. Such compositions will contain a therapeutically effective amount of the compound, preferably in purified form, together with a suitable form of carrier so as to provide the form for proper administration to the patient. The formulation should suit the mode of administration.

Pharmaceutical compositions adapted for vaginal administration may be provided as pessaries, tampons, creams, gels, pastes, foams or spray formulations.

Pharmaceutical compositions adapted for oral administration may be capsules, tablets, powders, granules, solutions, syrups, suspensions (in non-aqueous or aqueous liquids), or emulsions. Tablets or hard gelatin capsules may comprise lactose, starch or derivatives thereof, magnesium stearate, sodium saccharine, cellulose, magnesium carbonate, stearic acid or salts thereof. Soft gelatin capsules may comprise vegetable oils, waxes, fats, semi-solid, or liquid polyols. Solutions and syrups may comprise water, polyols, and sugars. An active agent intended for oral administration may be coated with or admixed with a material that delays disintegration and/or absorption of the active agent in the gastrointestinal tract. Thus, the sustained release may be achieved over many hours and if necessary, the active agent can be protected from degradation within the stomach. Pharmaceutical compositions for oral administration may be formulated to facilitate release of an active agent at a particular gastrointestinal location due to specific pH or enzymatic conditions.

Pharmaceutical compositions adapted for parenteral administration include aqueous and non-aqueous sterile injectable solutions or suspensions, which may contain anti-oxidants, buffers, baceriostats, and solutes that render the compositions substantially isotonic with the blood of the subject. Other components which may be present in such compositions include water, alcohols, polyols, glycerine, and vegetable oils. Compositions adapted for parental administration may be presented in unit-dose or multi-dose containers, such as sealed ampules and vials, and may be stored in a freeze-dried (lyophilized) condition requiring only the addition of a sterile carrier, immediately prior to use. Extemporaneous injection solutions and suspensions may be prepared from sterile powders, granules, and tablets. Suitable vehicles that can be used to provide parenteral dosage forms of the invention are well known to those skilled in the art. Examples include: Water for Injection USP; aqueous vehicles such as Sodium Chloride Injection, Ringer's Injection, Dextrose Injection, Dextrose and Sodium Chloride Injection, and Lactated Ringer's Injection; water-miscible vehicles such as ethyl alcohol, polyethylene glycol, and polypropylene glycol; and non-aqueous vehicles such as corn oil, cottonseed oil, peanut oil, sesame oil, ethyl oleate, isopropyl myristate, and benzyl benzoate.

Pharmaceutical compositions adapted for transdermal administration may be provided as discrete patches intended to remain in intimate contact with the epidermis of the recipient over a prolonged period of time.

Pharmaceutical compositions adapted for nasal and pulmonary administration may comprise solid carriers such as powders which can be administered by rapid inhalation through the nose. Compositions for nasal administration may comprise liquid carriers, such as sprays or drops. Alternatively, inhalation directly through into the lungs may be accomplished by inhalation deeply or installation through a mouthpiece. These compositions may comprise aqueous or oil solutions of the active ingredient. Compositions for inhalation may be supplied in specially adapted devices including, but not limited to, pressurized aerosols, nebulizers or insufflators, which can be constructed so as to provide predetermined dosages of the active ingredient.

Pharmaceutical compositions adapted for rectal administration may be provided as suppositories or enemas.

The pharmaceutical composition may be formulated, in an immediate release dosage form or a sustained release dosage form. In certain embodiments, the invention relates to immediate release dosage forms. An immediate release dosage form may be formulated as a tablet or multiparticulate which may be encapsulated. Other immediate release dosage forms known in the art can be employed. In certain embodiments, the therapeutic agent may be formulated to provide for an increased duration (sustained release) of therapeutic action. These formulations, at comparable daily dosages of conventional immediate release drug, are often associated with a lower incidence or severity of adverse drug reactions; and they can also be administered at a lower daily dose than conventional oral medication while maintaining therapeutic activity.

In certain embodiments, the pharmaceutical composition can be formulated to deliver the therapeutic agent on a predetermined time schedules. In certain embodiments, the therapeutic agent is administered via an oral solid dosage form that includes a sustained release carrier causing the sustained release of any one or more of the therapeutic agent(s) when the dosage form contacts gastrointestinal fluid. The sustained release dosage form may comprise a plurality of substrates which include the drugs. The substrates may comprise matrix spheroids or may comprise inert pharmaceutically acceptable beads which are coated with the drugs. The coated beads may then be overcoated with a sustained release coating comprising the sustained release carrier. The matrix spheroid may include the sustained release carrier in the matrix itself; or the matrix may comprise a normal release matrix containing the drugs, the matrix having a coating applied thereon which comprises the sustained release carrier. In other embodiments, the oral solid dosage form comprises a tablet core containing the drug within a normal release matrix, with the tablet core being coated with a sustained release coating comprising the sustained release carrier. In further embodiments, the tablet contains the drug within a sustained release matrix comprising the sustained release carrier. In additional embodiments, the tablet contains one or more therapeutic agent(s) within a sustained release matrix and remaining therapeutic agent(s) coated into the tablet as an immediate release layer,

The term '"sustained release" is defined for purposes of the invention as the release of the therapeutic agent from the formulation at such a rate that blood (e,g., plasma) concentrations (levels) are maintained, within the therapeutic range but below toxic levels over a period of time of about 12 hours or longer.

The therapeutic agents can be formulated as a controlled or sustained release oral formulation in any suitable tablet, coated tablet or multiparticulate formulation known to those skilled in the art. The sustained release dosage form may optionally include a sustained released carrier which is incorporated into a matrix along with the active agents, or which is applied as a sustained release coating.

The sustained release dosage form may include one or more therapeutic agent in sustained release form and the remaining therapeutic agent(s) in the sustained release form or in immediate release form. One or more therapeutic agents may be incorporated into the sustained release matrix along with another therapeutic agent, one or more therapeutic agent may be incorporated into the sustained release coating; incorporated as a separated sustained release layer or immediate release layer; or may be incorporated as a powder, granulation, etc., in a gelatin capsule with the substrates of the invention. Alternatively, the sustained release dosage form may have one or more therapeutic agent in the sustained release form and the remaining therapeutic agent(s) in the sustained release form or immediate release form. Drug Screening Assays and Research Tools

Because anoctamin has been identified herein as novel target that increases intracellular calcium and thus uterine contractions via three separate mechanisms, the present invention also provides for methods and tools for drug design, testing of agents, and tools for basic research into the causes and etiology of uterine contractions and preterm labor.

In one embodiment, ANOl and AN02 can be used in drug screening assays, free in solution, or affixed to a solid support. All of these forms can be used in binding assays to determine if agents being tested form complexes with the protein.

High throughput screening can be used to screen for therapeutic agents.

The present invention provides for methods and assays for screening agents for prevention and/or treatment of preterm labor, comprising contacting or incubating the test agent with ANOl or AN02 and detecting the presence of a complex between the ANOl or AN02 and the agent by methods known in the art.

Antibodies to ANOl and AN02 can also be used in competitive drug screening assays. The antibodies compete with the agent being tested for binding to the polypeptides. The antibodies can be used to find agents that have antigenic determinants on ANOl or AN02, which in turn can be used to develop monoclonal antibodies that target the active sites of the polypeptides.

The invention also provides for polypeptides to be used for rational drug design where structural analogs of ANOl or AN02 can be designed. Such analogs would interfere with the polypeptide in vivo, such as by non-productive binding to target. In this approach the three-dimensional structure of the protein is determined by any method known in the art including but not limited to x-ray crystallography, and computer modeling. Information can also be obtained using the structure of homologous proteins or target-specific antibodies.

Using these techniques, agents can be designed which act as inhibitors or antagonists of the ANOl or AN02, or act as decoys, binding to target molecules non-productively and blocking binding of the active polypeptide.

A further embodiment of the present invention is a method and/or assay for screening and/or identifying a test agent for the prevention and/or treatment of preterm labor comprising is contacting or incubating a test agent with a nucleotide encoding ANOl or AN02, and determining if the test agent binds to the nucleotide, wherein if the test agent binds to the nucleotide, the test agent is identified as a therapeutic or preventative agent for preterm labor. A further embodiment of the present invention is gene constructs comprising a nucleic acid encoding ANOl or AN02, and a vector. These gene construct can be used for testing of therapeutic agents as well as basic research regarding preterm labor. These gene constructs can also be used to transform host cells can be transformed by methods known in the art.

The resulting transformed cells can be used for testing for therapeutic agents as well as basic research regarding uterine contractions and preterm labor. Specifically, cells can be transformed with a nucleic acid encoding ANOl or AN02, and contacted with a test agent. The resulting expression of the transcript can be detected and compared to the expression of the transcript in the cell before contact with the agent.

The expression of the transcripts in host cells can be detected and measured by any method known in the art, including but not limited to, reporter gene assays.

These gene constructs as well as the host cells transformed with these gene constructs can also be the basis for transgenic animals for testing both as research tools and for therapeutic agents. Such animals would include but are not limited to, nude mice. Phenotypes can be correlated to the genes and looked at in order to determine the genes effect on the animals as well as the change in phenotype after administration or contact with a potential therapeutic agent.

EXAMPLES

The present invention may be better understood by reference to the following non- limiting examples, which are presented in order to more fully illustrate the preferred embodiments of the invention. They should in no way be construed to limit the broad scope of the invention. Example 1- mRNA of the ANO Family is Expressed in Human Uterine Smooth Muscle and ANOl Protein is Expressed in Pregnant Human Uterine Smooth Muscle Tissue

Materials and Methods

Human Uterine Smooth Muscle Specimens

In accordance with an IRB-approved protocol (#AAAD3001), de-identified fresh human uterine tissue was obtained from the superior margin of the uterine incision following elective cesarean delivery. Tissue was immediately placed in cold sterile HBSS and kept on ice. Portions of the tissue were processed to establish primary USM cell lines and generate strips for immunohistochemistry or functional organ bath studies. Cell Culture

Primary USM cell cultures were established by enzymatic dissociation of fresh human uterine specimens utilizing the Worthington Papain tissue dissociation kit, according to the manufacturer' s recommendations. Briefly, smooth muscle was bluntly dissected, minced, and enzymatically dissociated using papain and collagenase. Following an ovamucoid/albumin separation, isolated smooth muscle cells were seeded into a 75 cm culture flask. To maintain their primary phenotype, experiments were performed in these cells between 2-6 passages in culture. Contractile phenotype of the isolated cells was previously assessed by immunohistochemical staining for smooth muscle heavy chain and calcium release in response to contractile agonists (data not shown). HTERT immortalized human USM cells were also obtained as a gift from Dr. Darlene Dixon (Carney et al. (2002)). All USM cells were grown in SmBm2 medium with manufacturer's recommended additives (Lonza, Walkersville, MD).

Assessment of Anoctamin Family mRNA Expression

RNA extraction and reverse transcription

RNA was extracted and reverse transcribed as described previously (Gallos et al. (2013)). Briefly total RNA was extracted from human uterine cultured cells (immortal and primary) and grossly dissected myometrium using TRIzol (Ambion) according to the manufacturer's recommendations. Total RNA from human liver was purchased from Clontech and used as a positive control. Using the Super Script VILO cDNA synthesis kit (Invitrogen, Carlsbad, CA), 2 μg of RNA was reverse transcribed according to the manufacturer's recommendations.

PCR

Newly synthesized cDNA (5 μΐ of original 20 μΐ reaction) was used in PCR with the Advantage 2 PCR Kit (Clontech) on a MJ Research PTC-200 Peltier thermal cycler (Bio- Rad, Hercules, CA) following the manufacturer's protocol. Sense (s) and antisense (as) primers specific for 10 members of the Anoctamin family (ANO 1-10) were utilized (Table 1) (Gallos et al. (2013)). All cDNA samples were initially denatured at 94°C for 30 seconds and optimal annealing temperatures for each primer set was established and utilized as described previously for each Anoctamin family member (Gallos et al. (2013)). 5-10 μΐ of each PCR product was electrophoresed on 10% polyacrylamide gels stained with ethidium bromide (Molecular Probes, Eugene, OR) and visualized by use of a gel imager and Visio works software (Biospectra UVP, Upland, CA). TABLE 1- PRIMERS USED IN PCR

Human Expected

Target Accession Sequence: 5'-to -3' PCR Base

Numbers Pair Size

s GAGCCGCCGTGGTCGGAAAA (SEQ ID NO: 1)

ANOl NM_018043 416 as GGGAGAGGGTGCCCATCGGT (SEQ ID NO: 2) s GAGCTGAGACGGCCGGATGC (SEQ ID NO: 3)

AN02 NM_020373 556 as CCCCACCTCCTGGGCTCCTC (SEQ ID NO: 4) s TGCCAGCCCGAGCAACTGAC (SEQ ID NO: 5)

AN03 NM_031418 290 as TTTGGAACTCCAGGGCGGGC (SEQ ID NO: 6) s TGGGGAGGGGGAGGACCAGT (SEQ ID NO: 7)

AN04 NM_178826 390 as CTGGGCGGCTTGCCACACTT (SEQ ID NO: 8)

AGTGAGCAGAGCCTGAGCAGC (SEQ ID NO:

9)

AN05 NM_213599 413 as GGAGTGTGCTTAGGGCGGGG (SEQ ID NO:

10)

CCCCTGAGCCCAAGCGACAC (SEQ ID NO:

AN06 NM_001025356 11) 755 as

ATGCGGCTTCTGGTGGCTGG (SEQ ID NO: 12)

AGTGGTGGGCACACTGGTGTT (SEQ ID NO:

13)

AN07 NM 001001891 141 as GCGCTGGAGAGCAGCCAGAAA (SEQ ID NO:

14)

GCCAAGCAGGGAGAAGCACTCCACAA (SEQ

ID NO: 15)

AN08 NM 020959 143

ACCCATGACTTCATGAGGCGGTTCAGAATA

(SEQ ID NO: 16)

AAGAAGACGTGGGCGCGGTG (SEQ ID NO:

17)

AN09 NM_001012302 597 as GGAGGCCAGGACGCGGTAGA (SEQ ID NO:

18)

GTGGAGCACGCACTCCTGGC (SEQ ID NO:

19)

ANO10 NM_018075 373 as CCGAGCCAAGCCACTGCGAA (SEQ ID NO:

20) Immunohistochemistrv (IHC)

Human myometrial smooth muscle strips were immediately fixed in 4% paraformaldehyde (4°C overnight), incubated in 30% sucrose in PBS for an additional 24 hours, then sectioned into 6 μπι frozen sections. Sections were washed in PBS, incubated with 0.1% Triton X-100 for 10 min, blocked with 15% goat serum and then incubated overnight at 4°C in primary antisera. The primary antibodies used were: 1) anti-TMEM16A anti-body (rabbit, monoclonal; Abeam No. ab64085, 1 : 100 dilution in PBS) and 2) Rhodamine Phalloidin (to stain for alpha-actin, 1: 100, Life Technologies, CA). The secondary for AN01/TMEM16A antibodies consisted of FITC-conjugated goat anti-rabbit IgG (green, 1 :400 dilution). Nuclear staining was achieved employing mounting medium pre-mixed with DAPI stain (Vector laboratories, #H-1500). Negative controls were performed on serial sections by omitting primary antibody. All immunofluorescence experiments were repeated at least 3 times. Samples were visualized with confocal microscopy (Nikon Eclipse, Japan) and images were acquired with NIS software version 4.10.

Results

Expression of mRNA encoding the ANO family in human USM tissue and cell culture

Human uterine smooth muscle (USM) tissue and cell culture models were first surveyed for expression of messenger RNA of different members of the Anoctamin (ANO) family (Figure 3). Messenger RNA encoding all members of the ANO family except AN07 was expressed in pregnant human USM tissue. AN07 was also not expressed in both immortalized and primary uterine smooth muscle cells (USMC) in culture. Primary USMC in culture expressed ANOl-6, 8 and 10, differing only from pregnant tissue by the lack of expression of AN09. Immortal USMC expressed ANOl-3, 5-6, 8 and 10, lacking AN04 when comparing to primary USMC.

ANOl protein is expressed in pregnant human USM tissue

As ANOl (or TMEM16A) has been shown to be an important component of smooth muscle contraction and relaxation in other types of smooth muscle (Huang et al. (2012)), the protein expression of ANOl in the human uterus was investigated. Immunofluorescence demonstrated the expression of ANOl (green) in late gestation human uterine smooth muscle (Figure 2). Tissue was also co-stained with alpha-actin (red) to verify tissue is smooth muscle. ANOl protein is expressed abundantly throughout the myometrium. Example 2- ANOl Plays a Role in Modulating USM Resting Membrane Potential

As illustrated in Figure 1 , a fundamental feature that enables human USM to emerge from its quiescent state and engage in the rhythmic contractions involves a change in resting membrane potential. By shifting to a more depolarized threshold at term gestation, USM is capable of reaching the voltage threshold required for action potential generation. To determine if ANOl modulation is capable of eliciting shifts in membrane potential commensurate with these considerations, fluorescent changes in human USM cells loaded with a membrane potentiometric dye were measured.

Materials and Methods

Human USM cells as described in Example 1 were loaded with a potentiometric dye

(FLIPR) following exposure to either: the ANOl agonist, 3,4,5-Trimethoxy-N-(2-methoxy- ethyl)-N-(4-phenyl-2-thiazolyl)benzamide (Eact) (50 μΜ); an ANOl antagonist, benzbromarone (50 μΜ); K-gluconate (400 mM) (positive control for depolarization); or NS- 1619 (10 μΜ) (positive control for hyperpolarization).

Results

As shown in Figures 4A and 4B, exposure to either K-gluconate or Eact resulted in a depolarizing shift in fluorescence (i.e., more polarized potentials), while vehicle control showed negligible changes in fluorescence. Treatment with either NS-1619 or benzbromarone led to hyperpolarization of the USM cells.

These results established that activation of USM ANO channels promotes depolarization and blockade of these channels elicits membrane potential hyperpolarization, findings consistent with their hypothesized role in changing membrane potential to allow for AP generation. Example 3- Establishing a Functional Role for ANOl Modulation on Rhythmic Contractions in Human Uterine Smooth Muscle Ex Vivo

Materials and Methods

Human pregnant uterine smooth muscle strips were harvested from consenting patients during elective cesarean sections at Columbia University. The strips were subjected to ex vivo organ bath studies. Briefly, freshly obtained late gestation myometrium was finely dissected into 4 x 6 mm strips and attached inferiorly to a fixed 10 tissue hook in a 16-ml bath (Radnoti Glass Technology, Monrovia, CA) and superiorly to a Grass FT03 force transducer (Grass Telefactor, West Warwick, RI) by silk thread. BioPac hardware and Acknowledge 3.7.3 software (Biopac Systems, Goleta, CA) continuously recorded muscle force. Uterine strips were equilibrated under lg of tension for 1 hour in a modified Krebs- Henseleit buffer continuously bubbled with 95% 02 and 5% C02, after which they were stimulated with oxytocin 1 μΜ. Following the development of regular phasic contractions, strips were treated with either a vehicle control or tannic acid, 200 μΜ or benzbromarone, 100 μΜ. Muscle-force assessments of intact human uterine strips were assessed in response to exogenous oxytocin and after treatment, with regard to pacing frequency and integrated force over 25 minutes.

In a second experiment, the strips were stimulated with oxytocin 0.5 μΜ. Following contractile stimulation with oxytocin, strips from 9 different patients were allowed to then equilibrate at increased baseline contractility for 30 minutes, after which they were treated with varying concentrations of benzbromarone from 1 to 500 μΜ. Force tracings were then analyzed for differences in force and frequency of contractions. The integral change in force was measured over 60 minutes and calculated as a percentage of reduction in integral force (g*sec) from baseline oxytocin-induced contractility (Figure 6B). Percent reduction in integral force was also plotted using a variable slope sigmoidal dose -response curve [Y=Bottom + (Top-Bottom)/(l+10 ^A ((Log EC50-X)*HillSlope))] (Figure 6A). Baseline contraction frequency was assessed following oxytocin over 30 minutes, and subsequent contraction frequency was measured after varying doses of benzbromarone (1 - 500μΜ) following two 30 minute time intervals. Percent frequency compared to baseline was plotted at each concentration of benzbromarone at 30 and 60 minutes (Figure 6C). Linear regression analysis and compiled slopes of plots were analyzed between groups using ANOVA (Figure 6D).

Results

As shown in Figure 5A, tannic acid significantly attenuated contractile frequency and total force generated over time. However, longer treatment times were needed (over 1.5 hours) before reductions in mean amplitude became evident. The figure also shows the recovery of contractile response to oxytocin after the wash out of the tannic acid. Figures 5C and 5D show the results of additional studies with tannic acid showing statistically significant reductions in contractile frequency and force/time. Treatment with tannic acid attenuated both the frequency (4.6 + 1.3 contractions/25 min; n=5) and integrated force (8446 + 1250 gm*sec/25 min; n=5) of oxytocin-induced human uterine contractions when compared to the frequency and force measured in vehicle controls (17.4 + 1.4 contractions/25 min; n=6; p=0.0001 and 18814 + 3010 gm*sec/25 min; n=4; p=0.01, respectively). Given the delay, the study was expanded to include benzbromarone, which is over ten times more potent than ubiquitous chloride channel blockers, which as shown in Figure 5B demonstrated potency at inhibiting frequency of oxytocin-induced USM contractions quickly followed by a more profound reduction in mean amplitude which transitions into complete uterine quiescence.

Dose response studies utilizing varying concentrations of benzbromarone (1 - 500μΜ) demonstrated a dose dependent reduction of force and frequency in human late gestation my ome trial strips pre-contracted with oxytocin (Figure 6). Percent reduction of integral force was plotted on a sigmoidal dose-response curve to calculate the EC5 ₀ of benzbromarone as 63 μΜ (Figure 6A). Additionally, a significant reduction was observed in the percent integral force starting at 25 μΜ benzbromarone (57.5 ± 13.5%, n=9, p<0.05). To determine benzbromarone' s effect on frequency of contraction, frequency was measured over two 30 minute time intervals and calculated as a percent of baseline frequency. Percent of baseline frequency was plotted at different concentrations of benzbromarone (Figure 6C). Slopes of regression lines were plotted, and a significant reduction in contraction frequency was seen at 50 μΜ (n=9, p<0.001) (Figure 6D).

Example 4- ANOl Antagonism Inhibits Normal Calcium Response to Exogenous Oxytocin Initial attempts at determining how ANOl antagonism facilitates USM relaxation were based on the membrane potential oscillation theory shown in Figure 1. Under this model, chloride efflux through ANOl channels serves as a driving force allowing for USM cells to depolarize and trigger VGCC activation and a commensurate intracellular calcium flux. Under contractile agonist mediated contractions (like oxytocin) intracellular flux of Ca++ is thought to result from BOTH the extracellular compartment as well as from within the SR. Since, ANOl antagonism results in a more hyperpolarized membrane potential it was anticipated ANOl blockade would suppress agonist- induced extracellular calcium entry by interference with voltage-gated mediated Ca++ entry.

Materials and Methods

Calcium flux experiments were performed on primary mouse USM cells by measuring fura-2 ratiometric changes in calcium fluorescence using the ratiometric fluorescent calcium indicator Fura-2 (Calbiochem, Billerica, MA) as previously described Bernstein et al. (2014). Cells were pretreated with an ANOl antagonist, 200 μΜ tannic acid or benzbromarone (10, 50, or 100 μΜ), or DMSO (vehicle negative control). After this incubation, cells were exposed to oxytocin to induce GPCR-mediated calcium release.

Cells were also exposed to oxytocin in the presence of 2 mM of calcium.

Fluorescence was measured in real time at 37°C using a Flex Station 3 (Molecular

Devices LLC, Sunnyvale, CA) using excitation wavelengths of 340 and 380, an emission wavelength of 510, and a cutoff filter of 495. Fluorescence values were reported as F/Fo according to the calculation:

AF = (340nm)f/ (380 nm)f- (340 nm) ₀ / (380 nm) ₀

Peak values obtained following drug or vehicle administration were then examined for group comparisons.

Results

Pretreatment with tannic acid resulted in greater than 90% suppression of the Ca++ response evoked by oxytocin (Figure 7A). The portion of total calcium flux derived from the extracellular space following oxytocin-induced calcium rise was typically about 35% of the entire Ca++ peak (Figure 7B), with the majority of oxytocin-induced calcium flux being derived from sarcoplasmic (SR) release. Therefore, the results suggest that ANOl antagonism is imparting dual blockade of calcium stores, an intriguing feature no other tocolytic drug class possesses.

Studies utilizing benzbromarone replicated this observation and demonstrate a dose- dependent attenuation of Ca++ release (Figure 7C), suggesting ANOl blockade inhibits internal calcium store (SR) release.

Example 5- ANOl Antagonism Inhibits Release of Calcium From SR

Materials and Methods

USM cells were loaded (6 hours) with a Ca++ indicator with preferential SR uptake (mag-fluo4), followed by loading (30 minutes) with a cytosolic specific Ca++ indicator (Fura-2). This allows for simultaneously detection of calcium flux from the two cellular compartments. This method has been utilized to detect USM SR calcium release and allows for resolution between elevations in Fura-2 fluorescence (indicating a rise in cytosolic calcium) and a commensurate fall in mag-fluo-4 (indicating SR calcium efflux) (Schmigol et al (2001)).

Cells were treated with varying amounts of benzbromarone from 10 μΜ to 100 μΜ. Results

Figure 8 shows the assay worked using this proof of concept. Blue lines show cells receiving thapsigargin, and red lines are cells that received vehicle. Top is SR, bottom is cytosol.

To show proficiency using this method, preliminary studies recapitulating this response to bradykinin-induced Ca++ release were performed (Figure 9). Consistent with the hypothesis for dual Ca++ blockade, there was no fall in mag-fluo-4 fluorescence under conditions of ANOl blockade with benzbromarone (Figure 10). Example 6- ANOl Antagonism Impacts Store Operated Calcium Entry (SOCE)

While much of the focus has centered on illustrating the novel capacity of ANO antagonists to inhibit SR release of calcium, the true mechanistic strength of the data is based on the observation that ANO-antagonists actually inhibit both extracellular and intracellular calcium flux. This is especially true in USM where extracellular calcium is essential for maintaining spontaneous and agonist-induced contractile activity in human myometrium at term and during labor. It is assumed that VGCC's were the predominant calcium entry pathway. However, increasing evidence suggests a distinct store operated calcium entry (SOCE) is fundamental to calcium handling and contractile maintenance in normal human myometrium (Noble et al. (2009)), as well as in PTL models (Tribe et al. (2003)).

Materials and Methods

To assess the impact of ANOl blockade on SOCE sarcoplasmic calcium depletion studies on primary human USM cells loaded with fura-2 were performed.

Thapsigargin (SR calcium- ATPase) (1 μΜ) was added to deplete the SR of calcium under zero external calcium conditions. Calcium flux was recorded upon re-introduction of 2.5mM calcium into the external buffer. Vehicle or 100 μΜ of benzbromarone was added.

Results

Following sarcoplasmic calcium depletion of calcium with thapsigargin, reintroduction of calcium yielded a robust SOCE. The addition of the benzbromarone completely blocked SOCE. No thapsigargin served as a control. See Figure 11.

Example 7- Functional Correlation between Cellular Calcium Dynamics and Signaling

To illustrate a functional impact of ANOl blockade beyond mere calcium suppression, experiments utilizing real-time confocal microscopy using live, whole cell volumetric imaging of calcium-actin dynamics were performed. Since a critical downstream step in smooth muscle contraction involves filamentous actin (f-actin) formation, ANOl antagonism alteration of downstream contractile fiber formation was assessed.

Materials and Methods

Primary human myometrial cells (HuUSM) were grown to 70% confluence on sterile coated coverslips and transfected with a red fluorescent indicator (pCMVLifeAct-TagRFP) of f-actin formation according to manufacturer's recommendations (Ibidi®). Subsequent live cell imaging utilizing confocal microscopy (Nikon Eclipse Ti) allowed for real-time quantitative measurement of changes in f-actin (555/584 nm (Exmax/Emmax)) and Ca++ fluorescence evoked by contractile agonist (oxytocin luM) in the presence or absence (vehicle controls) of the ANOl antagonist benzbromarone (lOOuM).

In a parallel study to assess the potential relationship of ANOl -mediated effects on human USM calcium handling/contractility and subsequent contractile pathways, changes in myosin light chain phosphorylation (p-MLC) were examined under 3 conditions; normal unstimulated control, and oxytocin-induced stimulation of p-MLC in the presence or absence of siRNA directed against ANOl or non-targeting control siRNA. ON-TARGET plus SMART pool Human ANOl (TMEM16A) siRNAs (anoctamin-1, NM_018043.5 mRNA; NP- 060513.5 for protein) was purchased from Thermo Scientific (Pittsburgh PA) and DharmaFECTl was purchased from Dharmacon (Lafayette, CO). Transfection of siRNAs was performed at a concentration ΙΟΟηΜ with DharmaFECTl according to the manufacturer's instructions. Control cells were treated with non-targeting control siRNA. Forty-eight hours after transfection, immortalized human USM cells cultured in 6 well plates were harvested for protein. Cells were then homogenized in ice-cold modified RIPA cell lysis buffer (50mM Tris, 250mM NaCl, 5 mM EDTA, 50mM NaF ImM Na ₃ V0 ₄ , 1% Nonide P40 and 0.02 % NaN). Following centrifugation (5000 x g, 5min, 4°C) of the whole cell lysate, supernatants were saved and protein concentrations were determined. Aliquots of the supernatants were solubilized by heating at 95 °C for 5 min in sample buffer. The supernatants of solubilized whole cell lysates were then electrophoresed through a 4 - 15% Mini-PROTEAN TGX gel (Bio-Rad) and transferred to PVDF and probed with AN01/TMEM16A antibody (pre-diluted rabbit polyclonal was further diluted to 1 :4, No. ab53213; Abeam, Cambridge, MA) and anti-phosphor-Myosin light chain pSer20 (rabbit antibody, 1 :5000, Thermo Scientific). Equivalent loading was confirmed by commensurate probing with β-actin (mouse monoclonal diluted to 1 :10,000, Millipore). Primary antibodies were detected by horseradish peroxidase-conjugated goat anti-rabbit antibodies (1 :3,000 for AN01/TMEM16A and MLC-p); and goat anti-mouse antibodies (1 : 10,000 for β-actin). Immuno-reactive bands were detected by enhanced chemiluminescence (SuperSignal West Femto; Thermo Scientific, no.34095, Rockford, IL) according to the manufacturer's recommendations. The protein band of interest was detected by UVP visualization system (UVP, LLC, CA) and Vision Works LS was utilized to quantitate densitometries.

Data was compiled and analyzed by ANOVA or student t-test (where appropriate), and p<0.05 was taken as significant.

Results

Figure 12A show the human USM cells showing f-actin (red) and calcium (green) indicators.

Benzbromarone (lOOuM) suppressed oxytocin mediated elevations in f-actin fluorescence [TRITC] by 95.1% + 6.3% (p < 0.001, N=7) compared to vehicle controls (N=5). ANOl antagonism showed suppression in both calcium and f-actin fluorescence when compared to vehicle controls thereby linking ANO modulation to two inter-related and functionally relevant molecular events (Figure 12B).

Given the inherent challenge of demonstrating specificity of ANOl targeting with pharmacological agents, studies were expanded to include siRNA knockdown of ANOl in human USM cells and measure its effect on downstream contractile signaling events. First measured was the ability of ANOl (TMEM16A) siRNA treatment to reduce ANOl protein expression in primary HUSM cells. A representative immunoblot demonstrates decreased ANOl protein expression after ANOl siRNA treatment compared to USM cells treated with scrambled siRNA (siRNA control) (Figure 13 A). Compiled results of five different experiments revealed that siRNA ANOl knockdown reduced ANOl protein expression to 49 ± 0.5% compared to cells treated with non-specific scrambled siRNA (n=5, *p<0.05, Fig 4B).

Given that contraction of uterine smooth muscle is regulated by the phosphorylation of MLC20 by myosin light chain kinase (MLCK) (Word et al. (1993)), the effect of ANOl knockdown on MLC20 phoshorylation in human USM cells stimulated by oxytocin was measured. Consistent with prior results showing pharmacologic ANOl antagonism leads to reductions in contractile force and frequency, it was also observed siRNA-mediated reduction in ANOl significantly reduced downstream phosphorylation of myosin-light chain 20 (MLC20) following stimulation with exogenous oxytocin. (Figure 13C and 13D). Oxytocin stimulation caused an increase in MLC20 phosphorylation in cells treated with scrambled siRNA (283+45%, n=5, **p<0.01). However, primary HUSM cells pretreated with ANOl siRNA demonstrated a significant reduction in oxytocin-induced phosphorylation of myosin- light chain when compared to scrambled siRNA control (283+45% vs 131+34% (n=5, *p<0.05)).

In addition, to include experiments that differentiate between ANOl and other channels that impact electrical activity, studies employing the Kir7.1 blocker Vu590 were performed. Antagonism of this K-channel has recently been shown to enhance USM contractile frequency and force (McCloskey et al (2014)). The evidence supported that its pro-contractile effect may be in part due to unopposed ANOl activity, since 2 different ANOl blockers significantly attenuate Vu590-mediated activation of RhoA (Figure 14). Example 8- ANOl is the Plasma Membrane Channel Responsible for Human USM Calcium- activated Chloride Currents

CaCC currents have been recognized in many smooth muscle beds to be important to electro-mechanical coupling at the cell membrane (Zhu et al. (2009); Hwang et al. (2009)). Although the majority of these findings were outside the uterus, there are some studies in rodents (none in human USM) that substantiate an important pro-contractile role for CaCC's.

As shown herein the staining of ANOl is consistent with robust cell membrane expression of these proteins in human USM (Figure 2). Additionally, this laboratory recently published findings that ANOl -mediated chloride current is responsible for spontaneous transient inward currents (STICs) in airway smooth muscle (Gallos et al. (2013)) and demonstrated that ANO-blockade (using a highly selective functional antibody as well as pharmacological antagonists) attenuates STICs in murine USM cells (Bernstein et al. (2014)). Since STICs represent depolarizing membrane currents that are linked to contractility in many other smooth muscle tissues whole cell recordings on human USM cells were performed to determine whether STICs exist and if agonist-induced calcium release enhances these currents. Preliminary electrophysiology recordings in whole cell configuration detected robust STICs in human USM cells.

Materials and Methods

Human USM cells (less than 90μΜ) were impaled with glass electrodes (filled pipette resistance ~3MOhms), undergo compensation for junction potential, and screened for adequate membrane seal formation (0.8-1. IGOhm). Following suction-mediated membrane rupture cells were held in whole-cell voltage-clamp configuration. Application of depolarizing voltage steps were then performed at holding potentials of -60 mV to +40 mV in 1020mV increments. Currents were filtered at 1 kHz and pCLAMP 10.0 software was used to digitally deliver protocols and capture recordings. STIC activity was assessed in the presence or absence of tannic acid (40uM, anoctamin-l/TMEM16A antagonist) and/or oxytocin (1 uM), as well as with exposure to an anti-ANO antibody.

Results

As shown in Figure 15 A, using this methodology, under voltage ramping (-60 to +40mV) these currents reversed directionality at the equilibrium potential for chloride (proving they represent chloride flux). In addition, (at a -60mV holding potential) both baseline STICs and STICs enhanced by oxytocin- stimulated calcium release were reduced under conditions of ANOl antagonism (Figure 15B). Tannic acid blocked both basal STICS and oxytocin enhanced STICs.

As further proof that STICs are indeed ANOl -mediated currents, complete abrogation of STICs following exposure to a known functional antibody against ANOl was shown (Figure 15C).

Example 9- ANOl Antagonism Potentiates Other Tocolytic Drugs

Limitations of current tocolytics in use are due to systemic side effects prohibiting sufficient steady- state concentrations of these drugs or reductions in efficacy from desensitization (i.e., tachyphylaxis). An approach to mitigate both of these concerns is to employ combinational therapy with drugs that share complimentary but distinct mechanistic actions. There are several characteristics that suggest ANO antagonists would work synergistically with nifedipine and/or terbutaline. For example, nifedipine-mediated reductions in intracellular calcium (by blocking VGCC's) lead to less calcium available to "activate" ANOl channels. Inversely, ANOl antagonism leads to hyperpolarization of the USM cell which interferes with VGCC activation. Similarly, terbutaline exerts its relaxant effects via β2 adrenoceptor signaling leading to PKA-mediated activation of BK channels (a mechanistically distinct but complementary way to promote USM hyperpolarization). The potential for amplified drug effects is further enhanced since structure/function analysis of the ANOl protein reveals a PKA phosphorylation motif. These considerations led to studies examining the effect of PKA- activation on constitutive ANOl currents in primary human uterine smooth muscle cells to establish mechanistic support for functional potentiation between ANO antagonism and β2 agonism.

Material and Methods

Whole cell electrophysiology was performed by assessing pro-contractile chloride currents in primary cultured human uterine smooth muscle cells. I/V relationships and STIC activity was assessed in the presence or absence of tannic acid (40uM, anoctamin- 1/TMEM16A antagonist) and/or oxytocin (5uM).

Terbutaline (50 μΜ and 100 μΜ) and Sp- 8-pCPT-2' O-Me-cAMPS (SP8: direct PKA- activator) were added to the cells.

Results

As shown in Figure 16, under conditions of BK blockade, terbutaline and Sp8 reduced spontaneous membrane chloride currents. There was a dose-dependent reduction in ANOl chloride currents to terbutaline. The direct PKA-activator mimicked the effects of terbutaline suggesting PKA-mediated cross-talk.

Example 10- Synergy of Calcium Flux Inhibition by ANOl Antagonists and Other Tocolytic Agents

To further show the potentiation between ANO antagonistic agents and other tocolytic agents, measurements of calcium flux inhibition was made in human uterine smooth muscle cells.

Materials and Methods

The materials and methods of Example 4 were used, except that human USM cells form Lonza and NIH were used and were pretreated with either nifedipine (0.01 μΜ) (a tocolytic agent and calcium blocker), MONNA (25 μΜ), benzbromarone (5 μΜ) or combinations of nifedipine with MONNA or benzbromane or DMSO (vehicle negative control). Cells were then treated with 10 μΜ oxytocin.

Results

As shown in Figure 17, there is enhanced calcium flux inhibition when cells were treated with the combination of ANOl antagonist and another tocolytic agent.

Example 11- Quantifying the Efficacy of Selective ANOl Antagonists to Attenuate Contractions in Human USM

Materials and Methods

With IRB approval (#AAAL4005), ex vivo organ bath experiments were performed utilizing strips of late gestation human USM (n=5 patients). Samples were pre-contracted with oxytocin (0.5 μΜ), equilibrated for 60 minutes, and treated with sequentially increasing doses of an ANO-1 antagonist (benzbromarone, tannic acid and MONNA; 1 μΜ - 500 μΜ) or vehicle control (0.1% DMSO final). Resulting changes in force/time were processed as an integral measured over 60 minutes, processed as a percentage of reduction in integral force (g*sec) from baseline contractility, and compiled then plotted (mean + SEM) using a variable slope sigmoidal dose-response curve to determine IC50 and Imax values. Statistical analysis utilized ANOVA with Bonferroni's Multiple Comparison Test (p<0.05 was taken as significant). Percent reduction in contraction frequency (contractions/hr) was also plotted using a variable slope sigmoidal dose-response curve and ANOVA analysis.

Results

Figure 18A shows representative force tracings showing the differential potency of benzbromarone, tannic acid and MONNA.

The IC5 ₀ of benzbromarone, tannic acid and MONNA on oxytocin- induced contractility of human USM is 34 μΜ, 45 μΜ and 59 μΜ respectively (Figure 18B). The threshold concentration to achieve Imax for benzbromarone, tannic acid and MONNA on oxytocin-induced contractility is 50 μΜ, 100 μΜ or 100 μΜ respectively. ANO-1 antagonism mediated by benzbromarone at 1 μΜ (***p<0.001), tannic acid at 10 μΜ (***p<0.001) or MONNA at 10 μΜ (***p<0.001) was observed and allowed for statistically significant reductions in frequency (Figure 18C).

Example 12- Combinational Potentiation of L type Calcium Channel Antagonism with Calcium-Activated Chloride Channel Anoctamin 1 Antagonism in Murine Uterine Smooth Muscle

Materials and Methods

With IACUC approval (#AC-AAAQ4423), ex vivo organ bath experiments were performed utilizing strips of non-pregnant mUSM (n=5 different mice). Samples were precontracted with TEA (10 mM), equilibrated for 20 minutes, and treated with sequentially

-10 -3

increasing doses of benzbromarone (BB) or nifedipine (NIF) (10 ^" M-10 ^" M) or vehicle control (0.1% DMSO final). Integral change in force was then measured over 20 minutes and processed as a percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility.

Other organ bath experiments were performed with non-pregnant murine USM (n=7 different mice) to assess for synergy when combining BB with NIF. Following contractile stimulation with TEA (10 mM), strips were allowed to equilibrate at an increased baseline of contractility for 60 minutes, after which each bath was treated with one dose of vehicle (0.1% DMSO final), BB (1 μΜ) or NIF (0.01 μΜ) either alone or in combination.

Integral change in force was then measured over 60 minutes and processed as a percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility. Additional organ bath experiments were conducted as described above using nifedipine alone with an EC ₅₀ of about 2.8 X 10 8 ° M to 3.9 x 10 8 ° M or a combination of nifedipine and benzbromarone at an 4.6 X 10 - ^" 9 M to 1.5 X 10 - ^" 8

EC5 ₀ of about M (Figure 19D). Integral change in force was then measured over eight days and processed as a percentage of reduction in integral force (g*sec) from baseline TEA-induced contractility.

Results were compiled and reported as mean + SEM. Data was compiled and analyzed by One way ANOVA with Bonferroni's Multiple Comparison Test, and p<0.05 was taken as significant.

Results

Figure 19A show graphs of the initial dose-response experiments performed to assess significant reductions in contractility mediated by nifedipine and benzbromarone. This experiment demonstrated non-statistical reductions in force at 0.01 uM and 1 uM respectively. These subthreshold drug doses were then used in subsequent organ bath experiments utilizing mUSM (n=7 different mice) to assess for potentiation of relaxation when combining the ANOl antagonist benzbromarone with nifedipine. Figure 19B is representative force tracings showing the enhanced potency of combining low dose nifedipine and benzbromarone (bottom tracing) on both frequency and force of TEA-induced contractions compared to single low dose treatments (middle tracings) or vehicle control (top tracing).

The IC5 ₀ of BB or NIF on TEA-induced contractility of mUSM (controlled for time decay) are 10 μΜ or 47 nM respectively. Statistically non-significant reductions were observed in percent integral force following by NIF at 0.01 μΜ and by BB at 1 μΜ. Statistically significant potentiation of relaxation was observed with low dose NIF and BB versus the BB alone or NIF alone groups (***p <0.001) (Figure 19C).

Figure 19E is a graph showing the results of the percent change of force of TEA- induced contractions. The combination of NIF and BB in the lower panel showed reductions of contractions at lower dosages at all time points than when NIF was used alone.

Example 13- Combinational Potentiation of L type Calcium Channel Antagonism with Calcium-Activated Chloride Channel Anoctamin 1 Antagonism in Human Uterine Smooth Muscle

Materials and Methods

Using the materials and methods of Example 3, the strips were stimulated with oxytocin 0.5 μΜ. Following contractile stimulation with oxytocin strips were allowed to then equilibrate at increased baseline contractility for 30 minutes, after which they were treated with benzbromarone at 5 μΜ. MONNA at 25 μΜ, and nifedipine at 0.01 μΜ, either alone or in combinations of BB and NIF and MN and NIF.

Results

Statistically non- significant reductions were observed in percent integral force following by NIF at 0.01 μΜ and by BB at 5 μΜ and by MN at 25 μΜ as well as a statistically significant potentiation of relaxation with low dose NIF and BB versus the BB alone or NIF alone groups and with a low dose of NIF and MN versus the MN alone or the NIF alone (***p <0.001) (Figure20).

REFERENCES

Bernstein et al. (2014) Calcium-activated chloride channels anoctamin 1 and 2 promote murine uterine smooth muscle contractility. Am. J. Obstet. Gynecol. 211(6):688

Berridge (2008) Smooth muscle cell calcium activation mechanisms. The Journal of Physiology 586(Pt 21): 5047-5061

Brainard et al. (2007) Potassium channels and uterine function. Semin Cell Dev Biol. 18(3):

332-339

Bru-Mercier et al. (2012) Characterization of the tissue-level Ca2+ signals in spontaneously contracting human myometrium. /. Cell. Mol Med. 16(12):2990-3000

Caputo et al. (2008) TMEM16A, a membrane protein associated with calcium dependent chloride channel activity. Science. 322(5901): 590-594

Carney et al. (2002) Immortalization of human uterine leiomyoma and myometrial cell lines after induction of telomerase activity: molecular and phenotypic characteristics. Lab.

Invest. 82(6): p. 719-28

Centers for Disease Control and Prevention. (2013). Preterm Birth. Atlanta, GA, www.cdc.gov/reproductivehealth/maternalinfanthealth/pretermb irth

Chan et al. (2014) Assessment of myometrial transcriptome changes associated with spontaneous human labour by high-throughput RNA-seq. Exp. Physiol. 99(3):510-24 Gallos et al. (2013) Functional expression of the TMEM16 family of calcium-activated chloride channels in airway smooth muscle. American Journal of Physiology. Lung

Cellular and Molecular Physiology 305(9): p. L625-34

Galietta (2009) The TMEM16 protein family: a new class of chloride channels? Biophysical

Journal 97(12): 3047-3053

Goldenberg et al. (2008) Epidemiology and causes of preterm birth. Lancet 371(9606): 75-84 Haas et al. (2012) Tocolytic therapy for preterm delivery: systematic review and network meta-analysis. S / 345:e6226

Huang et al. (2012) Calcium-activated chloride channel TMEM16A modulates mucin secretion and airway smooth muscle contraction. Proceedings of the National Academy of Sciences of the United States of America. 109(40): 16354-16359

Huang et al. (2010) Spontaneous Rhythmic Inward Currents Recorded in Interstitial Cells of

Rabbit Portal Vein. Cell. Biochem. Biophys. 57:77-85

Hwang et al. (2009) Expression of anoctamin 1/TMEM16A by interstitial cells of Cajal is fundamental for slow wave activity in gastrointestinal muscles. The Journal of Physiology 587(Pt 20):4887-4904

Khan et al. (2001) Potassium channels in the human myometrium. Experimental Physiology, 86(2):255-264

McCloskey et al. (2014) The inwardly rectifying K+ channel KIR7.1 controls uterine excitability throughout pregnancy. EMBO Mol. Med. 6(9): 1161-74

Muglia and Katz. (2010) The enigma of spontaneous preterm birth. The New England Journal of Medicine, 362(6): 529-535

Mital et al. (1992) Mefenamic acid in prevention of premature labour. Journal of the Royal

Society of Health. 112(5):214-6

Namkung et al. (2011) Small-molecule activators of TMEM16A, a calcium- activated chloride channel, stimulate epithelial chloride secretion and intestinal contraction. FASEB. 25(11): 4048-4062

Noble et al. (2009) A review of recent insights into the role of the sarcoplasmic reticulum and Ca entry in uterine smooth muscle. Eur. J. Obstet. Gynecol. Reprod. Biol. 144(l):Sl l-9

Oh et al. (2013) MONNA, a Potent and Selective Blocker for Transmembrane Protein with Unknown Function 16/ Anoctamin- 1. Mol. Pharmacol. 84:726-735

Rock et al. (2008) The transmembrane protein TMEM16A is required for normal development of the murine trachea. Dev. Biol. 321(1): 141-9

Sanborn (2000) Relationship of ion channel activity to control of myometrial calcium. Journal of the Society for Gynecologic Investigation. 1 (1):4-11

Shmigol et al. (2001) Simultaneous measurements of changes in sarcoplasmic reticulum and cytosolic calcium. /. Physiol. 531 :707-13. Shmygol et al. (2007) Control of uterine Ca2+ by membrane voltage: toward understanding the excitation-contraction coupling in human myometrium. Annals of the New York

Academy of Sciences. 1101 :97- 109

Smith et al. (2007) The role of voltage-gated potassium channels in the reg-ulation of mouse uterine contractility. Reproductive Biology and Endocrinology 5:41

Tita and Rouse (2009) Progesterone for preterm birth prevention: an evolving intervention.

American Journal of Obstetrics and Gynecology 200(3):219-224

Tribe et al., (2003) Interleukin-ΐβ Induces Calcium Transients and Enhances Basal and Store

Operated Calcium Entry in Human Myometrial Smooth Muscle. Biology of Reproduction. 68 (5): 1842- 1849.

Word et al. (1993) Contractile elements and myosin light chain phosphorylation in myometrial tissue from nonpregnant and pregnant women. /. Clin. Invest. 92(1): 29-37 Yang et al. (2008) TMEM16A confers receptor- activated calcium-dependent chloride conductance. Nature 455(7217): 1210-1215

Young (2000) Tissue-level signaling and control of uterine contractility: the action potential calcium wave hypothesis. Journal of the Society for Gynecologic Investigation 7(3): 146- 152.

Young (2007) Myocytes, myometrium, and uterine contractions. Annals of the New York Academy of Sciences 1101 : 72-84

Zhu et al. (2009) A Ca2+- activated CI- conductance in interstitial cells of Cajal linked to slow wave currents and pacemaker activity. /. Physiol. 587(20) :4905-4918