The present invention concerns a process for expressing recombinant polypeptides.

The manufacture of polypeptides by recombinant technology has proven to be an effective and versatile method, especially when the host organism is E. coli. However, cells which express the gene encoding the desired recombinant polypeptide have an additional metabolic burden compared with cells which do not express that gene. This means that the desired recombinant cells are at a competitive disadvantage, and unless steps are taken to redress this, are rapidly eliminated from the culture, thus rendering the production process ineffective. One common method of providing cells containing the gene encoding the desired polypeptide with a selective advantage is to include a gene conferring antibiotic resistance on the same vector. In the presence of the appropriate antibiotic, such as kanamycin or tetracycline, only those cells having the antibiotic resistance gene, and therefore capable of expressing the desired polypeptide, can survive.

Recently, there have been concerns about the excessive use of antibiotics. Examples of non-antibiotic selection markers include auxotrophic markers, such as proline or glycine-auxotrophy systems, see for example Fiedler et al, Gene, 2001 , 274:1 11-8 and Vidal et al, J Biotechnol, 2008, 134:127-36, and the use of complementary essential genes on vectors in strains where the essential gene has been made defective, such as dapD-gene systems, see for example Degryse E et al, J Biotechnol, 1991 , 18:29-39 and Cranenburgh et al Nucleic Acids Res, 2001 , 29Έ26, and infA gene systems, see for example Hagg et al, J Biotechnol 2004, 111 :17-30. Other non-antibiotic systems include heavy metal resistance such as cadmium and copper resistance, although the applicability of such systems is limited by the possible presence of traces of such metals. It is therefore desirable to identify stable protein expression processes which do not require the use of antibiotics.

According to one aspect of the present invention, there is provided a process for the production of a target polypeptide which comprises expressing an expression cassette for the target recombinant polypeptide comprised in a vector in a non-mammalian host, wherein the host is auxotrophic for methionine and lacks the ability to express functional chromosomal Vitamin B 2 independent homocysteine methyltransferase, the vector comprises an expression cassette for functional Vitamin B12 independent homocysteine methyltransferase and the host is cultured in a growth medium lacking methionine.

Non-mammalian host cells which can be employed in the present invention include eukarytotic cells such as plant, insect and yeast cells, but are preferably prokaryotic cells, particularly bacterial cells, and especially Gram negative bacterial cells. In many embodiments, the host cell is E. coli, such as an E. coli B host cell, such as B834 or an E. coli K12 host cell, such as W3110. In some embodiments, the host lacks the ability to express functional ompT protease, and preferably is a host which has had the ompT gene deleted, most preferably an E. coli host, and especially an E. coli W31 10 AompT strain.

The host cell employed lacks the ability to express functional chromosomal Vitamin B12 independent homocysteine methyltransferase, such as the Vitamin B12 independent homocysteine methyltransferase MetE, particularly where an E. coli host cell is employed. The inability to express functional Vitamin B12 independent homocysteine methyltransferase may derive from a mutation in the chromosomal copy of the host cell's Vitamin B12 independent homocysteine methyltransferase gene which may either cause the Vitamin B12 independent homocysteine methyltransferase expressed by the gene to be non-functional, or cause the gene to be incapable of expression (so-called Vitamin B12 independent homocysteine methyltransferase(-) hosts). In certain embodiments, the chromosomal copy of the Vitamin B12 independent homocysteine methyltransferase gene has been deleted from the host cell (so called Δ Vitamin B12 independent homocysteine methyltransferase hosts).

In certain embodiments, the host cell employed also lacks the ability to express functional chromosomal Vitamin B12 dependent methionine synthase, especially MetH where an E. coli host cell is employed, wherein the host cell may be Vitamin B12 dependent methionine synthase (-) or Δ Vitamin B12 dependent methionine synthase. However, in preferred embodiments, the host cell employed is Vitamin B12 dependent methionine synthase(+), and is especially an E. coli host cell which is MetH(+).

In the process of the present invention, the host cell is cultivated in a growth medium which is free from methionine. In embodiments where the host cell has a functional Vitamin B12 dependent methionine synthase gene, the host cell is cultivated in a medium that also lacks vitamin B12. In certain preferred embodiments, the host cell is grown in a medium which comprises homocysteine.

In the expression cassette for functional Vitamin B12 independent homocysteine methyltransferase, a Vitamin B12 independent homocysteine methyltransferase gene is operably linked to a promoter. The promoter is selected to be effective in the chosen host cell. Promoters employed may be inducible, but in many embodiments the promoter employed is constitutive. In many embodiments, the strength of the promoter and copy number of the vector comprising the functional Vitamin B12 independent homocysteine methyltransferase gene are selected to produce sufficient Vitamin B12 independent homocysteine methyltransferase to confer a competitive advantage for hosts comprising such a vector, but not to generate an excess of Vitamin B12 independent homocysteine methyltransferase such that the ability of the cell to express the target polypeptide is impaired, and/or the ability to purify the target polypeptide from the Vitamin B12 independent homocysteine methyltransferase is impaired. In certain embodiments, the promoter is selected to give expression of Vitamin B12 independent homocysteine methyltransferase equivalent to the level that would have been achieved by a chromosomal copy of the Vitamin B12 independent homocysteine methyltransferase gene. In such embodiments, the promoter is selected to have a strength relative to the native Vitamin B12 independent homocysteine methyltransferase gene promoter of 1/n x Q, wherein n is the copy number of the vector comprising the functional Vitamin B12 independent homocysteine methyltransferase gene, and Q is the strength of the native Vitamin B12 independent homocysteine methyltransferase gene promoter. Copy numbers for vectors may be from 1 per cell to 100 per cell or more, with copy numbers of from 30 to 90 being preferred, and most preferably copy numbers of from 40 to 70, for example from 40 to 60, per cell.

The promoter operably linked to the Vitamin B12 independent homocysteine methyltransferase gene is preferably a weak promoter, for example a promoter having a strength relative to P _b i _a , measured by the method of Deuschle et al, The EMBO Journal, 1986, Vol 5, no. 11 , pp2987-2994, incorporated herein by reference, of less than 10, such as less than 7, preferably less than 5 and most preferably less than 2. In certain highly preferred embodiments, the promoter employed is P _b i _a .

In many embodiments, the expression cassette for functional Vitamin B12 independent homocysteine methyltransferase is located in a different reading frame from the expression cassette for the polypeptide of interest.

The expression cassette for functional Vitamin B 2 independent homocysteine methyltransferase preferably comprises a transcription terminator, such as a T4 terminator, located downstream of the gene for Vitamin B12 independent homocysteine methyltransferase.

A DNA construct, preferably a vector, comprising an expression cassette for a target recombinant polypeptide and a Vitamin B 2 independent homocysteine methyltransferase expression cassette, and a host cell comprising such a DNA construct form further aspects of the present invention.

The vector may be integrated into the host cell genome, but is preferably comprised within an extrachromosomal element such as a plasmid. Alternatively, the vector may be incorporated into phage or viral vectors and these used to deliver the expression system into the host cell system. The vector can be assembled by methods known in the art.

The vector of the present invention is commonly employed in the form of a plasmid. The plasmids may be autonomously replicating plasmids or integrative plasmids. When an autonomously replicating plasmid is employed, the plasmid may be a single copy plasmid, but is preferably a multicopy plasmid. Multicopy plasmids may be present at levels of from 2 per cell to 100 per cell or more, with levels from 30 to 90 being preferred, and most preferably levels of from 40 to 70, for example from 40 to 60, per cell.

The expression cassette for the target polypeptide may comprise a constitutive promoter or preferably an inducible promoter, operably linked to a polynucleotide encoding the target polypeptide. Inducible promoters which may be employed comprise a promoter region having a binding site for an RNA polymerase and which promotes transcription of a polynucleotide and one or more control elements, which regulates transcription in response to a given set of conditions. Examples of promoter regions are well known in the art and include phage RNA polymerase promoter regions, such as T7 RNA polymerase; mutated or derivatives of phage RNA polymerase promoters, such as those described by Esvelt et al Nature 2011 April 28; 472(7344): pp499-503; and host RNA polymerase promoter regions. Host RNA polymerase regions comprise a -35 box and a -10 box (also known as a Pribnow box). It will be recognised that whilst in many host polymerase promoter regions, the boxes are spaced at -10 and -35, different spacings may be employed. Host RNA polymerase promoter regions are preferred for use in the present invention.

Control elements that can be employed in inducible promoters are well known in the art, and include system such as catabolite repressor proteins, and especially operators.

Examples of promoter regions that can be employed include single T7 promoter regions, including those disclosed by Studier and Moffat, J. Mol. Biol. 189:113-130 (1986), incorporated herein by reference, especially a T7 gene 10 promoter region. Preferred promoter regions include the host polymerase promoter regions T7A1 , T7A2, T7A3, λρΙ_, λpR, lac, lacUV5,ara, trp, tac, trc, phoA and rrnB, and most preferably T7A3, tac and λρΙ,.

When a T7 RNA-polymerase dependent promoter region is employed, it will be recognised that a source of T7 RNA polymerase is required, which is provided by methods known in the art, and commonly by inserting a λϋΕ3 prophage expressing the required phage polymerase into the host strain to create lysogenic host strains. The T7 RNA polymerase can also be delivered to the cell by infection with a specialised λ transducing phage that carries the gene for the T7 RNA polymerase.

Operator sequences which may be employed include lac, gal, deo and gin. One or more perfect palindrome operator sequences, especially perfect palindrome lac operator sequences, most preferably having the sequences GGAATTGTGAGCGCTCACAATTCC (SEQ ID NO. 1) or AATTGTGAGCGCTCACAATT (SEQ ID NO. 2), may be employed. When more than one operator sequence is employed, the sequence are preferably the same. In many preferred embodiments, two perfect palindrome operator sequences are employed, especially operators of SEQ ID NO. 1 or SEQ ID NO. 2, most advantageously one operator sequence being located downstream of the promoter, and one operator sequence being located upstream of the promoter. When two operator systems are employed, the operator sequences are preferably spaced to maximise control of the promoter. In many embodiments, the spacing is from 85 to 150 base pairs apart, preferably from 90 to 126 base pairs apart, and most preferably 91 or 92 base pairs apart. In certain embodiments, an operator sequence, especially a perfect palindrome operator sequence, most preferably an operator of SEQ ID NO. 1 or SEQ ID NO. 2 overlaps with the transcriptional start point. It will be recognised that the operator system is commonly employed with an appropriate repressor sequence. Repressor sequences produce repressor protein, for example lacl gene sequence when using the lac operators. Other lac repressor sequences may also be used, for example the lacl ^Q sequence can be used to increase the level of lac repressor protein. The repressor sequence may also be provided by the host cell genome or by using an additional compatible plasmid.

In many embodiments of the present invention, the Vitamin B12 independent homocysteine methyltransferase expression cassette comprises a constitutive promoter.

Constitutive promoters that can be employed in the present invention include promoters having the promoter regions described above for the first expression cassette, but lacking control elements. In many embodiments, it is preferred that the constitutive promoter is a host RNA polymerase promoter.

In preferred embodiments, the promoter of the Vitamin B12 independent homocysteine methyltransferase expression cassette is selected to be weaker than the promoter of the expression cassette for the target polypeptide.

The relative strength of promoters is well known in the art, see for example the method of determining the strength of promoters disclosed by Deuschle et al, The EMBO Journal, 1986, Vol 5, no. 1 1 , pp2987-2994. In many embodiments, the promoter selected for the expression cassette for the target polypeptide is at least five times stronger, commonly at least ten time stronger and preferably at least fifteen times stronger than the promoter selected for the expression cassette for functional Vitamin B12 independent homocysteine methyltransferase, as measured by the method of Deuschle et al. In certain preferred embodiments, the promoter selected for the expression cassette for the target polypeptide is from twenty to fifty times stronger than the promoter selected for the expression cassette for functional Vitamin 312 independent homocysteine

methyltransferase, as measured by the method of Deuschle et al.

Polypeptides which can be expressed by the process of the present invention include therapeutic proteins and peptides, including cytokines, growth factors, antibodies, antibody fragments, immunoglobulin like polypeptides, enzyme, vaccines, peptide hormones, chemokines, receptors, receptor fragments, kinases, phosphatases, isomerases, hydrolyases, transcription factors and fusion polypeptides. The polypeptides are preferably heterologous to the host cell employed.

Antibodies which can be expressed include monoclonal antibodies, polyclonal antibodies and antibody fragments having biological activity, including multivalent and/or multispecific forms of any of the foregoing.

Naturally occurring antibodies typically comprise four polypeptide chains, two identical heavy (H) chains and two identical light (L) chains inter-connected by disulphide bonds. Each heavy chain comprises a variable region (V _H ) and a constant region (C _H ), the C _H region comprising in its native form three domains, C _H 1 , C _H 2 and C _H 3. Each light chain comprises a variable region (V _L ) and a constant region comprising one domain, C _L . The V _H and V _L regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each V _H and V _L is composed of three CDRs and four FRs, arranged from amino-terminus to carboxy-terminus in the following order: FR1 , CDR1 , FR2, CDR2, FR3, CDR3, FR4.

Antibody fragments which can be expressed comprise a portion of an intact antibody, said portion having a desired biological activity. Antibody fragments generally include at least one antigen binding site. Examples of antibody fragments include: (i) Fab fragments having V _L , C _L , V _H and C _H 1 domains; (ii) Fab derivatives, such as a Fab' fragment having one or more cysteine residues at the C-terminus of the C _H 1 domain, that can form bivalent fragments by disulphide bridging between two Fab derivatives; (iii) Fd fragment having V _H and C _H 1 domains; (iv) Fd derivatives, such as Fd derivatives having one or more cysteine residues at the C-terminus of the C _H 1 domain; (v) Fv fragments having the V _L and V _H domains of a single arm of an antibody; (vi) single chain antibody molecules such as single chain Fv (scFv) antibodies in which the V _L and V _H domains are covalently linked; (vii) V _H or V _L domain polypeptide without constant region domains linked to another variable domain (a V _H or V _L domain polypeptide) that is with or without constant region domains, (e.g., V _H -V _H , V _H -V _L , or V _L -V _L ) (viii) domain antibody fragments, such as fragments consisting of a V _H domain, or a V _L domain, and antigen-binding fragments of either V _H or V _L domains, such as isolated CDR regions; (ix) so-called "diabodies" comprising two antigen binding sites, for example a heavy chain variable domain (V _H ) connected to a light chain variable domain (V _L ), in the same polypeptide chain; and (x) so- called linear antibodies comprising a pair of tandem Fd segments which, together with complementary light chain polypeptides, form a pair of antigen binding regions.

Preferred antibody fragments that can be prepared are mammalian single variable domain antibodies, being an antibody fragment comprising a folded polypeptide domain which comprises sequences characteristic of immunoglobulin variable domains and which specifically binds an antigen (i.e., dissociation constant of 500 nM or less, such as 400 nM or less, preferably 250 nM or less, and most preferably 100 nM or less), and which binds antigen as a single variable domain; that is, without any complementary variable domain. Single variable domain antibodies include complete antibody variable domains as well as modified variable domains, for example in which one or more loops have been replaced by sequences which are not characteristic of antibody variable domains or antibody variable domains which have been truncated or comprise N- or C-terminal extensions, as well as folded fragments of variable domains. Preferred single variable domains which can be prepared are selected from the group of V _H and V _L , including Vkappa and Vlambda. Most preferably the single variable domains are human or camelid domains, including humanised camelid domains.

Where the target polypeptide comprises one or more chains to be secreted, particularly where the target polypeptide is a fragment antibody comprising two or more chains, each of the chains is attached to a secretion leader, and polynucleotides encoding such polypeptides are designed accordingly. The secretion leaders employed may be the same or different. Examples of secretion leaders are well known in the art, and include spA, phoA, ribose binding protein, pelB, ompA, ompT, dsbA, torA, torT, and tolT leaders in E. coli and eukaryotic leader sequences, such as those disclosed in WO 2009/147382.

In certain embodiments of the present invention, when the target polypeptide comprises two or more chains, such as antibody heavy and light chains, an expression cassette for the second chain is employed in addition to the first expression cassette. In many such embodiments, the same type of promoter is employed for both expression cassettes.

When an inducible promoter is employed, expression may be induced by the addition of an inducer appropriate to the inducible promoter employed in the first expression cassette, such as isopropyl- -D-1-thiogalactopyranoside (IPTG), analogues of IPTG such as isobutyl-C-galactoside (IBCG), lactose or melibiose. Other inducers may be used and are described more fully elsewhere (e.g. see The Operon, eds Miller and Renznikoff (1978)). Inducers may be used individually or in combination.

The target polypeptide may be recovered by methods known in the art, including one or more of cell lysis, filtration, centrifugation, diafiltration, ion-exchange

chromatography, affinity chromatography, such as Protein A affinity chromatography, Hydrophobic Interaction Chromatography (HIC), Gel Filtration and HPLC.

In another aspect of the present invention, a method for cloning is provided, wherein a clone having the ability to express a target polypeptide is selected using the ability express functional Vitamin B12 independent homocysteine methyltransferase as a selection marker. In such methods, a vector comprising an expression cassette for the target polypeptide and an expression cassette for functional Vitamin B12 independent homocysteine methyltransferase are prepared, and transformed into a non-mammalian host, wherein the host is auxotrophic for methionine and lacks the ability to express functional chromosomal Vitamin B12 independent homocysteine methyltransferase, and positive clones are selected for the ability to grow on medium which lacks methionine. If the host cell employed is Vitamin B12 dependent methionine synthase(+), the medium employed also lacks vitamin B12.

The present invention is illustrated without limitation by the following examples.

Example 1

Generation of metE Vector pAVE789

The starting vector for the generation of pAVE789 was pAVEO1 , prepared as described in International patent application WO2007/088371. pAVE0 1 has a pAT153 vector backbone, cer stability sequence, tet A/R selection marker, a perfect palindrome lac operator sequence upstream and downstream of the promoter and a T4 transcription terminator upstream of the gene of interest. The £ coli metE gene under control of a P _b i _a promoter (SEQ ID No. 3 below, where the sequences in bold are the restriction enzyme sites) was cloned into plasmid pAVEO11 using synthetic genes by means of the EcoRI and PflMI restriction enzyme sites and transformed into a methionine auxotrophic E. coli host strain (B834, available from the Coli Genetic Stock Center as strain CGSC5612) by electroporation. Transformation cultures were plated onto defined Met- agar (see Table 1 below) and incubated at 37°C for 16 hrs to allow growth of individual colonies. Initial screening of transformants was by restriction digestion using EcoRI and EcoRV. The sequence was confirmed by sequencing. The resultant plasmid was named pAVE789 (P _b iameiE).

SEQ ID NO. 3 (P _bia metE)

CCATTCGATGGTGTCATGCAGGTCGACGGATCTATCTCATCTGCGCAAGGCAGAAC

GTGAAGACGGCCGCCCTGGACCTCGCCCGCGAGCGCCAGGCGCACGAGGCCGGC

GCGCGGACCCGCGCCACGGCCCACGAGCGGACGCCGCAGCAGGAGCGCCAGAAG

GCCGCCAGAGAGGCCGAGCGCGGCCGTGAGGCTTGGACGCTAGGGCAGGGCATG

AAAAAGCCCGTAGCGGGCTGCTACGGGCGTCTGACGCGGTGGAAAGGGGGAGGGG

ATGTTGTCTACATGGCTCTGCTGTAGTGAGTGGGTTGCGCTCCGGCAGCGGTCCTG

ATTTTTCTAAATACATTCAAATATGTATCCGCTCATGAGACAATAACCCTGATAAAT GC

TTCAATAATATTGAAAAAGGAAGAGTATGACAATATTGAATCACACCCTCGGTTTCC C

TCGCGTTGGCCTGCGTCGCGAGCTGAAAAAAGCGCAAGAAAGTTATTGGGCGGGGA

ACTCCACGCGTGAAGAACTGCTGGCGGTAGGGCGTGAATTACGTGCTCGTCACTGG

GATCAACAAAAGCAAGCGGGTATCGACCTGCTGCCGGTGGGCGATTTTGCCTGGTA

CGATCATGTACTGACCACCAGTCTGCTGCTGGGTAATGTTCCGCCACGTCATCAGAA

CAAAGATGGTTCGGTAGATATCGACACCCTGTTCCGTATTGGTCGTGGACGTGCACC

GACTGGCGAACCTGCGGCGGCAGCGGAAATGACCAAATGGTTTAACACCAACTATC

ACTACATGGTGCCGGAGTTCGTTAAAGGCCAACAGTTCAAACTGACCTGGACGCAGC

TGCTGGAGGAAGTGGACGAGGCGCTGGCGCTGGGCCACAAGGTGAAACCTGTGCT

GCTGGGGCCGGTTACCTGGCTGTGGCTGGGGAAAGTGAAAGGTGAACAGTTTGATC

GCCTGAGCCTGCTGAACGACATTCTGCCGGTTTATCAGCAAGTGCTGGCAGAACTG

GCGAAACGCGGCATCGAGTGGGTACAGATTGATGAACCCGCGCTGGTACTGGAACT

GCCGCAGGCGTGGCTGGACGCATACAAACCCGCTTACGACGCGCTCCAGGGACAG

GTGAAACTGCTGCTGACCACCTATTTTGAAGGCGTAACGCCAAACCTCGACACGATT

ACTGCGCTGCCTGTTCAGGGTCTGCATGTCGATCTCGTACATGGTAAAGATGACGTT

GCTGAACTGCACAAGCGTCTGCCTTCTGACTGGCTGCTGTCTGTGGGTCTGATCAAT

GGTCGTAACGTCTGGCGCGCCGATCTTACCGAGAAATATGCGCAAATTAAGGACATT

GTCGGCAAACGTGATTTGTGGGTGGCATCTTCCTGCTCACTGCTGCACAGCCCCATC

GACCTGAGCGTGGAAACGCGTCTTGATGCAGAAGTGAAAAGCTGGTTTGCCTTCGC

CCTGCAAAAATGTCATGAACTGGCATTGCTGCGCGATGCGTTGAACAGTGGTGATAC GGCAGCTCTGGCAGAGTGGAGCGCTCCGATTCAGGCGCGTCGTCACTCTACTCGTG

TACATAATCCGGCAGTAGAAAAGCGTCTGGCGGCGATCACCGCTCAGGACAGTCAG

CGTGCGAATGTCTATGAAGTGCGTGCTGAAGCCCAGCGTGCGCGTTTTAAACTGCCC

GCGTGGCCGACCACCACGATTGGTTCCTTCCCGCAAACCACGGAGATTCGTACCCT

GCGTCTGGATTTCAAAAAGGGTAATCTCGACGCCAACAACTACCGCACAGGCATTGC

GGAACATATCAAGCAGGCCATTGTTGAGCAGGAACGTTTGGGACTGGATGTGCTGG

TACATGGCGAGGCCGAGCGTAATGACATGGTGGAATACTTTGGCGAGCATCTGGAT

GGCTTTGTCTTTACGCAAAACGGTTGGGTACAGAGCTACGGTTCCCGCTGCGTGAAG

CCACCGATTGTTATTGGTGACGTTAGCCGCCCGGCACCGATTACCGTGGAGTGGGC

AAAATATGCGCAATCCCTGACTGATAAACCGGTGAAAGGGATGTTGACCGGCCCGGT

GACTATTCTCTGCTGGTCGTTCCCGCGTGAAGATGTCAGCCGTGAAACCATCGCCAA

ACAAATTGCGCTGGCGCTGCGTGATGAAGTGGCCGATCTGGAAGCCGCTGGAATTG

GCATCATCCAGATTGACGAACCGGCGCTGCGCGAAGGTTTACCGCTGCGTCGTAGC

GACTGGGATGCGTATCTCCAGTGGGGC3TAGAGGCCTTCCGTATCAACGCCGCCGT

GGCGAAAGATGACACACAAATCCACAC1CACATGTGTTATTGCGAGTTCAACGACAT

CATGGATTCGATTGCGGCGCTGGACGCAGACGTCATCACCATCGAAACCTCGCGTT

CCGACATGGAGTTGCTGGAGTCGTTCGAAGAGTTTGATTATCCAAATGAAATCGGTC

CTGGCGTCTATGACATTCACTCGCCAAACGTACCGAGCGTGGAATGGATTGAAGCCT

TGCTGAAGAAAGCGGCAAAACGCATTCCGGCAGAGCGTCTGTGGGTCAACCCGGAC

TGTGGCCTGAAAACGCGCGGCTGGCCAGAAACCCGCGCGGCACTGGCGAACATGG

TGCAGGCGGCGCAGAATTTGCGTCGGGGATGATCGTGGAAACGATAGGCCTATTAT

ATTACTAATTAATTGGGGACCCTAGAGGTCCCC I I I I I I ATTTTAAAACCATGTGGGAA

TTGTGAGCGCTCACAATTCCAAGAACAATCCTGCACGAATTC

Generation of expression strains CLD950 and CLD951

A gene encoding G-CSF was cloned into plasmid pAVE789 in E. coli stain B834 as described above as an Ndel/Xhol fragment to generate plasmid pAVE810, with the resulting strain called CLD950. A gene encoding hGH was cloned into plasmid pAVE789 in E. coli stain B834 as described above as an Ndel/Xhol fragment to generate plasmid pAVE81 1 as described above with the resulting strain called CLD951.

Shake Flask Evaluation

Vials of CLD950 and CLD951 were removed from storage at -80°C and allowed to thaw. 5 μΙ of the thawed glycerol stock was inoculated into 5 ml defined Met- media

(composition as described in Table 1 ). This was incubated at 37°C in an orbital shaker for 16 hrs. 1 ml (CLD950) and 500 μΙ (CLD951 ) of this culture was then used to inoculate 250 ml Erlenmeyer flasks containing 50 ml of defined Met- media (composition as described in Table 1). The flasks were incubated at 37°C, at 200rpm in an orbital shaker. Growth was monitored until OD ₆₀ o=0.4-0.6. At this point flasks were induced with IPTG to a final concentration 1 mM. The incubation was continued, under the conditions described above, during which samples were taken for measurement of growth, accumulation of G- CSF and hGH within the bacterial cells and plasmid retention. Significant accumulation of both G-CSF and hGH was observed.

Table 1 : Defined Met- media.

Measurement of Plasmid retention

At 24 hrs post induction 10 μΙ of a 10 ^"4 dilution of CLD950 and CLD951 was plated onto LB agar and incubated at 37°C for 16 hrs to allow growth of individual colonies. 40 colonies were replica plated onto LB agar and defined Met- agar and incubated at 37°C for 16 hrs to allow for growth. 100% of colonies screened were positive for plasmid.

Example 2

Generation of strain CLD1134 (W3110 ΔοιτιρΤ AmetE)

The ompT gene was deleted from an £ co// W31 0 strain (available from the Coli Genetic Stock Center as strain CGSC4474) by the method of Link et al, J Bact, 997, vol. 179, no. 20 p. 6228-6237. The metE coding region of this strain was then deleted from the chromosome, also by the method described by Link et al, J Bact, 1997, vol. 179, no. 20 p. 6228-6237 to give strain CLD 134. Generation of expression strains CLD1147 and CLD1148

Electroporation was used to transform the pAVE810 plasmid into CLD1 134 with the resulting strain called CLD 147 and the pAVE81 1 plasmid into CLD1134 with the resulting strain called CLD 148.

Shake Flask Evaluation

Strains CLD1147 and CLD 1148 are investigated by the shake-flask methods of

Example! Significant accumulation of both G-CSF and hGH and good plasmid retention is observed.

Example 3

Fermentation inocula for the strains CLD950 and CLD951 were raised by adding 450 μΙ of glycerol stock to a 2.0 L baffled shake flask containing 450 mL of Luria Broth (LB) containing 5 g/L yeast extract, 10 g/L peptone, 10 g/L sodium chloride and 0 g/L glucose. Inocula were grown for 23 hrs (CLD950) or 13 hrs (CLD951 ) at 37°C in a shaker-incubator with an agitation of 200 rpm. 20 ml of shake flask inoculum was used to inoculate a 5 L working volume fermenter containing 4 L of minimal glycerol batch growth medium supplemented with yeast extract. The fermentation was carried out under the operating conditions described below. Temperature was controlled at a constant temperature of 37°C. pH was controlled at 6.7 ± 0.2 by automatic addition of 25% (w/v) ammonium hydroxide and 8.5% (v/v) ortho-phosphoric acid. The dissolved oxygen tension (dOT) set point was 30% of air saturation and was controlled by automatic adjustment of the fermenter stirrer speed, from a minimum of 250 rpm up to a maximum of 1500 rpm, and supplementation of oxygen to the inlet gas stream. Airflow to the fermenter vessel was 1.0 v/v/min throughout.

Fermentations were performed in batch mode until depletion of the carbon source (i.e. glycerol) which was characterized by a sharp rise in dOT. Fed-batch fermentation was initiated at the point of carbon source exhaustion by the addition of a glycerol/ammonium sulphate feed. Induction was carried out by addition of IPTG to a final concentration of 0.5 mM once the biomass level in the fermentation reached OD600 = 45-55. The fed-batch phase was continued for 34.2 hrs post induction (CLD950) or 30.1 hrs post induction (CLD951). Samples were taken throughout for accumulation of G-CSF and hGH within the bacterial cells where significant accumulation of both G-CSF and hGH was observed by SDS-PAGE. Measurement of plasmid retention by the method given in Example 1 showed 100% retention through the fermentation for both strains.