Background to the Invention The development of high through-put DNA sequencing technology, and sophisticated data-capture and computational analysis has resulted in the sequence determination of entire genomes including Drosophila melanogaster and Homo sapiens. This has identified novel"predicted"gene sequences but no associated biology ascribing function. Functional information is a prerequisite to delineate which genes may prove to be therapeutic targets for disease management and diagnosis in man.

The identification of individual gene function and the functional relationship of genes to disease states is now a pre-occupation of the Biotechnology and Pharmaceutical industry. The identification of disease related genes will allow the development of new drugs or targets for drug discovery, provide diagnostic or prognostic markers for disease and provide prescriptive guides for physicians. The latter of these will be particularly useful in diseases having complex genetics. Where genetic variation between patients can be measured, personalised medicine programs can be developed where defined patient responses to drug action are identified.

Many methods for identifying gene function are being applied, most with a dependency on the comparative analysis of gene structure and gene expression profiles in healthy and diseased states. The approach is expensive and time consuming, and the outcomes often subjective, lacking hard evidence relating a variation in gene expression to a functional disease related event in vivo.

A preferred method would be to generate a library of mutations throughout the genome and analyse the resultant phenotypes. Once a gene is disrupted, validation of that gene's function requires studies in animal model systems which directly relate cause (i. e. a mutation in a gene sequence, a deletion or an insertion) with a measurable effect (i. e. behavioural, developmental, metabolic etc. ) in the whole animal.

One method for obtaining mutations is through the introduction of exogenous DNA into the genome. For example, insertion events involving viruses or homologous recombination of DNA are known, and may be used to give rise to novel phenotypic variations in the cells, which can traced back to insertion events in the cell genome and hence the sequences or genes responsible for the phenotype when not normally active.

Insertions may have small phenotypic effects, for example resulting from the insertion of a few amino acids into the sequence of a polypeptide or decreased expression of the gene. Alternatively, the effects may be more pronounced, possibly including the complete inactivation of a gene. Insertion events may be detected by screening for the presence of the vector, probing for the nucleic acid sequence thereof.

Transposons are natural genetic elements capable of jumping or transposing from one position to another within the genome of a species. Mobilisation of a transposon is dependant on the expression of a tranposase enzyme which binds to sequences flanking the transposon DNA leading to the excision of DNA from one position in the genome and reinsertion elsewhere in the genome. Insertion into a gene sequence will lead to a change in gene function which may, in turn, result in a measurable phenotypic change in the whole organism.

Transposons or transposable elements can be divided into two classes. Class I are the retro-transposons that replicate through an RNA intermediate and utilize reverse transcriptase to produce a DNA molecule that is inserted into the host cell's genome.

The Class II transposons include all other mobile elements and include P, hobo, mariner, Minos, Tcl, and Ac elements (Berg & Howe, Mobile DNA, American Society for Microbiology, Washington, D. C. 1989). Members of this transposon class

have short inverted repeats at their termini and generate direct duplications of a host target sequence upon insertion.

Of the three"classical"model animals, the fly, the worm and the mouse, efficient transposon based insertion methodologies have been developed for D. melanogaster and for C. elegans. The introduction of P element mediated transgenesis and insertional mutagenesis in Drosophila (Spradling & Rubin (1982) Science 218,341- 347) transformed Drosophila genetics and formed the paradigm for developing equivalent methodologies in other eukaryotes.

However, use of the P element in generating insertional mutants has a number of disadvantages. First, the P element has a very restricted host range, and therefore other elements have been employed in the past decade as vectors for gene transfer and/or mutagenesis in a variety of complex eukaryotes, including nematodes, plants, mammals, fish e. g. zebrafish and birds. In addition, P element integration preference in Drosophila is strong for some genes (hotspots) but very low for others (coldspots).

Additionally, 5'UTRs are strong preferential intragenic targets for P element vectors.

To date, in Drosophila melanogaster, there are experimental data on less than 25% of all predicted genes. Many of these data come from P element based mutagenesis and enhancer trapping. Thus, alternative transposable elements would be required for saturating mutagenesis of Drosophila.

In a library of insertions it is desirable to hit as many genes as possible. Accordingly there is a need for a system of mutagenesis that allows a high efficiency of insertion as well as random insertion.

Summary of the Invention Transposons generally have a target nucleic acid sequence into which they insert. In the case of Minos, and a number of other Class II DNA transposable elements, the target sequence is a dinucleotide recognition site.

The present invention describes the use of a transposon which recognises a dinucleotide target site, in particular Minos, in the generation of a library of mutants.

The use of this system has a number of advantages over current methods of introducing random insertional mutations into genes. In particular the system based on dinucleotide, and specifically AT, recognition has a high rate of insertional efficiency and, surprisingly, has a high rate of targeting introns. When applied to Drosophila, this system allows generation of a different set of mutations to those obtained by P element insertion.

Accordingly, in a first aspect the present invention provides a method of producing a library of genetic mutations in a cell population by insertional mutagenesis comprising introducing a transposon which targets a dinucleotide recognition sequence into a cell, combining it with a transposase and identifying cells having a transposon integration event.

Suitably the dinucleotide recognition sequence is AT. Preferably, the transposon is Minos.

Minos, a type 2 transposon and member of the Tcl/mariner family of elements, was isolated from D. hydei and has been used for the germ line transformation of D. melanogaster, C. capitata, and Anopheles stephensi (Loukeris, T. G. et al (1995) Proc Natl Acad Sci U S A, 92,9485-9 ; Loukeris, T. G. et al (1995) Science, 270,2002-5, Catteruccia F. et al. (2000) Nature 405 959-962) and using transient mobilisation assays it has also been shown to be active in embryos of D. melanogaster, Aedes aegypti, Anopheles stephensi and Bombyx mori and in cell lines of D. melanogaster, Aedes aegypti, Anopheles gambiae and Spodoptera fRugiperda (Catteruccia, F. et al (2000) Proc Natl Acad Sci U S A, 97,2157-2162., Klinakis et al (2000) EMBO Reports 1: 416-421 ; Shimizu et al: Insect Mol Biol 2000 Jun; 9 (3): 277-81).

It contains 255bp long terminal inverted repeats flanking a transposase gene. The transposase catalyzes precise excision and integration of the element. Minos is active

in cultured cells and produces stable integrants in the germ line of several insect species, in mouse tissues and in human cells.

Accordingly, in one embodiment the cell population may be derived from mouse or other animal cells. In a preferred embodiment, the cell population is a population of Drosophila larvae.

In a preferred embodiment, the method is characterised by the resultant cell population having a high frequency of insertion of Minos into introns.

Suitably, the Minos transposon is used to generate single insertions into autosomes.

In one embodiment, the Minos transposition event is induced by heat shock.

As described herein, remobilisation of a single insertion of a Minos transposon into the X chromosome can generate progeny having a single insertion into the autosomes.

Accordingly in another aspect of the present invention, there is provided a method of generating a transgenic progeny having an autosomal transposition, comprising the steps of : (a) generating a female adult transgenic organism comprising within its genome one or more copies of a transposon; (b) generating a male adult transgenic organism comprising within its genome one or more copies of a gene encoding a transposase cognate for said transposon and/or an element capable of regulating expression of said gene encoding the transposase; (c) crossing the female adult transgenic organism with the male transgenic adult organism to provide a progeny which comprises, in the genome of one or more of its cells, both (i) one or more copies of the transposon and (ii) a gene encoding a transposase cognate for said transposon, wherein the gene encoding the transposase is under the control of one or more regulatory sequences which permit expression of the transposase; and

(d) inducing expression of said gene encoding the transposase in said progeny to cause mobilisation of said transposon within the germ line of said progeny; (e) selecting the male progeny and crossing with white females to generate progeny having at least one transposon insertion in an autosome.

Preferably, the copy of the transposon is labelled with a marker. In a particularly preferred embodiment, the transposon is operably linked to EGFP. Preferably, the transposon is from the construct MiPRl.

Suitably, the female adult in step (a) has a copy of the transposon on the X chromosome.

Suitably, the male adult in step (b) has a copy of the transposase on an autosome.

Suitably the transposase is under the control of a heat inducible promoter. Preferably, the heat inducible promoter is the promoter sequence of hsp70.

Suitably, the induction step (d) is treating the progeny with a heat shock.

In a preferred embodiment, the transgenic adults and transgenic progeny are Drosophila.

Preferably the progeny selected in step (c) are Drosophila jumpstart males. In a particularly preferred embodiment, the jumpstart males are from the cell line PhsILMiT2.4.

Alternatively expressed, the invention thus provides a method of generating a transgenic progeny by transposon mobilisation, comprising the steps of : (a) providing a progeny which comprises, in the genome of one or more of its cells, both (i) one or more copies of a transposon and (ii) one or more genes encoding a transposase cognate for said transposon, wherein the gene

encoding the transposase is under the control of one or more regulatory sequences which permit expression of the transposase, and (b) inducing expression of said transposase in said progeny to cause mobilisation of said transposon within the germ line.

Suitably, the female transgenic organism can be transgenic lines comprising stably integrated transposons in the X chromosome and comprising EGFP or another marker.

Suitably, the cell line is derived from the method set out in Figure 2. Such transgenic lines can be generated using standard germline transformation procedures. Preferably, the transposons are derived from the constructs set out in Figure 1.

Transposons can be induced to transpose through crossing with the male transgenic organism. Accordingly, the invention provides a method which can allow the rapid generation of thousands of mutant progeny.

By"progeny"is meant the result of reproduction between the first transgenic organism and the second transgenic organism.

Suitably the transgenic organism is Drosophila.

In a preferred embodiment, the one or more regulatory sequences which permit expression of the transposase are sequences which allow specific expression of the transposase after heat treatment. Suitably, the regulatory sequences are derived from a gene whose expression is increased in response to heat shock such as hsp70.

Figure 3 is a schematic diagram showing in vivo transposition in Drosophila with the female contributing the transposon, and the male the transposase. Remobilisation of the transposon takes place in heat shock.

Suitably, the progeny which have transposition events taking place in the germline are then mated to produce offspring in which the transposition events can be characterised.

A progeny having germline transposition can be mated to a normal mate or to a mate which, itself comprises a mutation. Where the transgenic organisms are Drosophila, suitably the progeny are crossed to a white mutant which is a genetic background which enables the labelled transposon to be detected more easily.

"Embryo"or"larvae"as herein described should be understood to refer to the structure developing from a single fertilised egg or zygote to the time of birth or hatching in the case of vertebrates or invertebrates or germination in the case of plants. Thus, in the context of the present invention, "embryo"should be understood to also encompass a mammalian fetus.

The likelihood of achieving transposition in particular regions of the genome may be increased further by the use of chromatin opening domains, for example ubiquitously- acting chromatin opening elements (UCOEs) (PCT/GB99/02357 (WO 0005393)), locus control regions (LCRs) (Fraser, P. & Grosveld, F. (1998). Curr. Opin. Cell Biol. 10,361-365), CpG islands or insulators to control expression of the transposon and/or the gene encoding the transposase.

In a preferred embodiment, the transposon and the gene encoding the transposase may be provided as a single construct such that the gene encoding the transposase is disrupted when the transposon mobilises, thus limiting further mobilisation of the transposon. This may be achieved by placing one of the inverted repeats of the transposon in an intron which interrupts the transposase gene in such orientation that the transposase gene is disrupted when the transposon is mobilised. This vector enables a single cross step to be used to generate a transgenic organism that contains regulator, transposase gene and transposon. Further, transposition leads to complete inactivation of the transposase source, resulting in stability of the new insertion even in the presence of inducer.

The incorporation of Cre/lox functions (details of which are reviewed in Sauer, Methods of Enzymology; 1993, Vol. 225,890-900) and different transposon/transposase combinations may also be used to eliminate primary

transposase function. In further embodiments of the invention, however, the transposase gene is not destroyed on transposition, thus allowing further transposon mobilisation on, for example, administration of inducer.

In methods of the invention, transposition may be induced using any system known to the skilled person. Transposition may be induced by induction of transposase gene expression via application of an endogenous substance or via operation of an endogenous signal.

The one or more regulatory sequences of which the gene encoding the transposase is under the control may be inducible regulatory sequences. For example, suitable induction systems include tet based systems, the lac operator-repressor system, ecdysone based systems and oestrogen based systems, details of which are provided infra. Exogenous inducers may be provided in any convenient fashion, e. g. by injection to the maternal animal or embryo or as an additive to the food or water supply to the maternal animal. Transposition may be induced at one or more times during embryo development. Thus inducers may be administered only once or repeatedly during one or more stages of development.

The generation of genetic mutations in transgenic organisms as a result of transposon insertion according to the invention may give rise to novel phenotypic variations in the organisms. The precise nature of the insertional event will determine whether it will influence functional gene expression in some or all embryonic and adult tissues. Thus, gene expression patterns of modified genes can be monitored during embryo development and in adult cells and tissues.

Where the transposition event is lethal to a cell, the cells will not survive. If the insertional event is present in all cells from which a particular tissue or organ is composed, that tissue or organ may not function or develop and the embryo may not be viable. Alternatively, the transposition event may have non-lethal phenotypic consequences. For example, the transposition event may have the effect of modulating the function of an enzyme in the affected cells, resulting in a relative change in

metabolism compared to the unaffected cells. Phenotypic variations in cells, tissues or organs of the transgenic organisms may be traced back to transposition events in the genome of those cells, tissues or organs.

In another aspect there is provided a construct comprising a Minos transposon for use in germline transformation.

Suitably said construct comprises sequences derived from Minos operably linked to a reporter gene. In one embodiment, the construct is a plasmid rescue construct. In another embodiment, the construct is an enhancer trap construct. Suitably, the construct further comprises an origin of replication and a selectable marker.

In a preferred embodiment, the reporter gene is a derivative of Green Fluorescent Protein (GFP). In a particularly preferred embodiment, the reporter gene is enhanced GFP (EGFP) in a 3xP3-EGFP construct.

In another aspect there is provided a construct comprising a transposase for use in conjunction with a transposon-containing construct in accordance with the invention.

Preferably said construct comprises a transposase under the control of an inducible promoter. Suitably said inducible promoter is derived from a heat shock protein and is inducible under heat shock conditions. In a particularly preferred embodiment, the transposase is operably linked to the hsp70 promoter.

In a particularly preferred embodiment, there is provided a construct according to any one of the constructs in Figure 1 and as described in the Examples section herein.

Figure 1 schematically illustrates Minos plasmid rescue, Minos enhancer trap and Minos helper constructs which may be used in the present invention.

In another aspect, there is provided the use of a construct as described herein and shown in Figure 1 in a method of generating a library of genetic mutations in a cell population.

/ Suitably the cell population is Drosophila.

In another aspect there is provided a transgenic Drosophila line capable of remobilising a single insertion of a transposon on the X chromosome to the autosomes.

Suitably the transgenic Drosophila line is PhsILMiT2.4. Preferably, the single insertion of a transposon on the X chromosome is an insertion of the transposon MiPRl on the X chromosome, X: 8F3 or an insertion of the transposon MiETl on the X chromosome, X: 17D3.

The methods of the invention may advantageously be used in the generation of a library of genetically modified organisms having a genetic modification produced by transposon mobilisation.

Accordingly, in another aspect there is provided a library of mutants comprising a Minos integration event. Suitably, said library is generated using at least one of the constructs in accordance with the invention.

Said library of mutants may be a library of mutant cells derived from mice or other animals or may be a library of cells from insects, such as Drosophila.

In a preferred embodiment, the library of mutants is generated using at least one of the constructs as set out in Figure 1 and described in the examples herein.

Preferably, the library of mutants is a library of Drosophila mutants comprising a Minos integration event in the Drosophila genome.

Suitably, a library of mutants in accordance with this aspect of the invention will have the characteristic of having greater than 10%, greater than 20%, greater than 25% and, most preferably, greater than 30% of insertions being in introns.

Preferably the library will be characterised in that, apart from the absolute requirement for the target TA sequence, the Minos insertion sites do not have any preference for

sequence or structural requirements. Thus, the library in accordance with the invention has a random integration of exogenous sequences.

In another aspect of the invention there is provided a Drosophila mutant having a Minos integration event in the Drosophila genome wherein the integration is into any one of the genes as set out in Table 1.

In another aspect there is provided a transformation system for making transgenic organisms comprising anyone of the constructs set out in Figure 1 and described in the examples herein.

In preferred embodiments of any aspect of the invention, the transposon may be a natural transposon. Preferably, it is a type 2 transposon, such as Minos. Most advantageously, it is Minos.

Modified transposons, which incorporate one or more heterologous coding sequences and/or expression control sequences may also be used in the invention. Such coding sequences may include selectable and/or unselectable marker genes, which may facilitate the identification of transposons in the genome and cloning of the loci into which the transposons have been integrated. Suitable markers include fluorescent and/or luminescent polypeptides, such as GFP and derivatives thereof, luciferase, galactosidase, or chloramphenicol acetyl transferase (CAT). Other suitable markers include that encoded by the 3xP3-EGFP construct.

Such markers may be used in in vivo enhancer or silencer traps and exon traps, by, for example inserting transposons which comprise marker genes which are modulated in their expression levels by proximity with enhancers or exons. Constructs for use in exon and enhancer traps are described in EP 0955364. Using the methods of the invention, the plurality of cells or tissues homogeneous for a transposition event may display modulation of expression of marker gene (s), thus enabling efficient trapping of enhancers and/or silencers and/or exons. Moreover, in embodiments where only a proportion of cells or tissues of a particular type are homogeneous for the transposition

event, modulation of the expression of a marker gene may be identified by comparison with cells or tissues of the same type in the same transgenic animal which does not display such modulation.

In one embodiment, transposons may be used to upregulate the expression of genes.

For example, a transposon may be modified to include an enhancer or other transcriptional activation element. Mobilisation and insertion of such a transposon in the vicinity of a gene upregulates expression of the gene or gene locus. This embodiment has particular advantage in the isolation of oncogenes, which may be identified in clonal tumours by localisation of the transposon.

The present invention may thus be used in the identification of novel targets for molecular intervention, including targets for disease therapy in humans, plants or animals, development of insecticides, herbicides, antifungal agents and antibacterial agents. One further application is the discovery of genes responsible for pathogenesis (for example, in mouse disease models).

The transposon may be inserted into a gene. Preferably, the transposon is inserted into a transcribed gene, resulting in the localisation of said transposon in open chromatin.

The transposon may be flanked by chromatin opening domain elements, such as locus control regions which provide tissue specific expression (Fraser, P. & Grosveld, F.

(1998). Curr. Opin. Cell Biol. 10,361-365) or ubiquitously-acting chromatin opening elements- (UCOEs), which enable non-tissue specific expression (for example see WO 0005393). Other chromatin opening domains which may be used in methods of the invention include CpG rich islands, which may normally be associated with housekeeping genes or tissue specific genes, or insulators.

Moreover, the transposon may itself comprise, between the transposon ends, chromatin opening domains. This will cause activation of the chromatin structure into which the transposon integrates, facilitating access of the inducible transposase in a cell or tissue specific manner thereto.

Similarly the transposase construct may comprise or be flanked by chromatin opening domain elements.

Detailed Description of the Invention Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art (e. g. , in cell culture, molecular genetics, nucleic acid chemistry, hybridisation techniques and biochemistry). Standard techniques are used for molecular, genetic and biochemical methods. See, generally, Sambrook et al., Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. and Ausubel et al., Short Protocols in Molecular Biology (1999) 4'Ed, John Wiley & Sons, Inc. ; as well as Guthrie et al., Guide to Yeast Genetics and Molecular Biology, Methods in Enzymology, Vol. 194, Academic Press, Inc. , (1991), PCR Protocols: A Guide to Methods and Applications (Innis, et al. 1990. Academic Press, San Diego, Calif.), McPherson et al. , PCR Volume 1, Oxford University Press, (1991), Culture of Animal Cells: A Manual of Basic Technique, 2nd Ed. (R. I. Freshney. 1987. Liss, Inc.

New York, N. Y. ), and Gene Transfer and Expression Protocols, pp. 109-128, ed. E. J.<BR> <P>Murray, The Humana Press Inc. , Clifton, N. J. ). These documents are incorporated herein by reference.

Transposons Transposons have a target nucleotide sequence. A number of known transposons have complex recognition sites which favour controlled transposition events e. g in gene therapy applications.

Of the Class II DNA transposable elements, PiggyBac (previously described as IFP2) (Finnegan, Curr. Opin, Cell Bio. , Volume 2,471-477 1990) and tagalong elements always target and duplicate the tetranucleotide, TTAA, upon insertion in Baculovirus-

infected cells (Cary et al., Virology, Volume 172,156-169, 1989). The specificity for TTAA target sites is exhibited by other Lepidopteran transposon-like insertions as well (Beames & Summers, Virology, Volume 162,206-220 1988; Beames & Summers, Virology, Volume 174,354-363 1990; Carstens, Virology, Volume 161,8-17, 1987; Oellig et al. , J. Virology, Volume 61,3048-3057, 1987; Schetter, Oellig & Doerfler, J.

Virology, Volume 64,1844-1850, 1990). Transposon-based genetic transformation systems are being developed.

Other transposons including hobo, hermes, Ac and Tam3 (Calvi et al. , Cell, Volume 66,465-471, 1991) generate 8 bp target site duplications (Warren et al., Genet.

Research, Volume 64,87-97, 1994).

Preferably, the transposon for use in the invention has a simple recognition site. Most preferably that simple site comprises a dinucleotide sequence and, preferably, AT. It has been demonstrated herein that the use of a transposon having a recognition site which occurs with high frequency in intron sequences allows introns to be targeted.

In a particularly preferred embodiment, the transposon for use in the invention is Minos. Minos is advantageously employed with its natural cognate transposase, although the use of modified and/or improved transposases is envisaged. Minos transposons, and their cognate transposase, are described in detail in US patent 5,840, 865 and European patent application EP 0955364.

The transposon preferably comprises a nucleic acid sequence encoding a heterologous polypeptide. This sequence will be integrated, together with the transposon, into the genome of the cell on transposon integration. Moreover, it will be excised, together with the transposon, when the latter excises on remobilisation. In a preferred embodiment, the heterologous polypeptide is a selectable marker. This allows cells having integrated transposons to be identified and the site of integration to be accurately mapped.

A'transposition event"or"transposon integration"is a change in genomic sequence caused by transposon mobilisation and includes insertion events, integration events excision events or chromosomal breaks.

Other transposons are known. For example, the hobo element of Drosophila melanogaster has been described by Gelbart WM, Blackman RK, Prog Nucleic Acid Res Mol Biol (1989) ; 3 6 : 3 7-46. Salmonid type transposons such as the Sleeping Beauty (SB) transposon, a Tcl/mariner-like transposable element reconstructed from fish have been described by Ivics et al (1997) Cell 91, 501-510 and Horie et al (2001), Proc. Natl. Acad. Sci. USA, Vol. 98, Issue 16,9191-9196. Mariner is a transposon originally isolated from Drosophila mauritiana, but since discovered in several invertebrate and vertebrate species. The use of mariner to transform organisms is described in International patent application WO99/09817. Hermes is derived from the common housefly. Its use in creating transgenic insects is described in US patent 5,614, 398, incorporated herein by reference in its entirety. PiggyBac is a transposon derived from the baculovirus host Trichplusia ni. Its use for germ-line transformation of Medfly has been described by Handler et al., (1998) PNAS (USA) 95: 7520-5 and US patent 6,218, 185.

Marker Genes Preferred marker genes include genes which encode fluorescent polypeptides. For example, green fluorescent proteins ("GFPs") of cnidarians, which act as their energy- transfer acceptors in bioluminescence, can be used in the invention. A green fluorescent protein, as used herein, is a protein that fluoresces green light, and a blue fluorescent protein is a protein that fluoresces blue light. GFPs have been isolated from the Pacific Northwest jellyfish, Aequorea victoria, from the sea pansy, Renilla reniformis, and from Phialidium gregarium. (Ward et al., 1982, Photochem.

Photobiol. , 35: 803-808; Levine et al., 1982, Comp. Biochem. Physio., 72B: 77-85).

Fluorescent proteins have also been isolated recently from Anthoza species (accession nos. AF168419, AF168420, AF168421, AF168422, AF168423 and AF168424).

A variety of Aequorea-related GFPs having useful excitation and emission spectra have been engineered by modifying the amino acid sequence of a naturally occurring GFP from Aequorea victoria (Prasher et al., 1992, Gene, 111: 229-233; Heim et al., <BR> <BR> 1994, Proc. Natl. Acad. Sci. U. S. A. , 91: 12501-12504; PCT/US95/14692). Aequorea- related fluorescent proteins include, for example, wild-type (native) Aequorea victoria GFP, whose nucleotide and deduced amino acid sequences are presented in Genbank Accession Nos. L29345, M62654, M62653 and others Aequorea-related engineered versions of Green Fluorescent Protein, of which some are listed above. Several of <BR> <BR> these, i. e. , P4, P4-3, W7 and W2 fluoresce at a distinctly shorter wavelength than wild type. Another useful GFP derivative is EGFP.

Particularly preferred is the marker gene encoded by the construct 3xP3-EGFP.

Examples of other marker genes which may be used include selectable marker genes such as genes encoding neomycin, puromycin or hygromycin or counter-selection genes such as the genes for cytosine deaminase or nitroreductase.

Those skilled in the art are aware of a multitude of marker genes which may be used.

Any suitable marker gene may be used and it should be appreciated that no particular choice is essential to the present invention.

Identification of insertion and excision events.

Transposons, and sites from which transposons have been excised, may be identified by sequence analysis. For example, Minos typically integrates at a TA base pair, and on excision leaves behind a duplication of the target TA sequence, flanking the four terminal nucleotides of the transposon. The presence of this sequence, or related sequences, may be detected by techniques such as sequencing, PCR and/or hybridisation.

Inserted transposons may be identified by similar techniques, for example using PCR primers complementary to the terminal repeat sequences.

The identification of a transposon insertion event provides a method for detecting a genetic mutation in a transgenic organism. This mutation can then be characterised.

For example, a transposon insertion may be detected by identifying a plurality of cells displaying a variant phenotype and the position of one or more transposon transposition events in the genome of one or more of said cells may be detected by sequencing and/or PCR as described above.

A correlation of the position of the transposition events with the observed variant phenotype can be made where the position of the transposition events is indicative of the location of one or more genetic loci associated with the observed variant phenotype.

Detecting the position of a transposon transposition event further allows cloning of the genetic loci comprising the insertion and thus the identification of a gene whose mutation is correlated with a specific phenotype. The locus of the modification may be identified precisely by locating the transposon insertion. Sequencing of flanking regions allows identification of the locus in databases, potentially without the need to sequence the locus.

Transpositions can be"tagged"allowing positional changes within complex genomes to be rapidly determined and flanking genes determined by sequence analysis. This allows an immediate link between cause (i. e. an insertional event in a specific gene or regulatory element) and effect (i. e. a phenotypic of measurable change).

Transposases Effective transposon mobilisation depends on both efficient delivery of the transposable element itself to the host cell and the presence of an effective cognate transposase in the cell in order to catalyse transposon jumping. A"cognate"

transposase, as referred to herein, is any transposase which is effective to activate transposition of the transposon, including excision of the transposon from a first integration site and/or integration of the transposon at a second integration site.

Preferably, the cognate transposase is the transposase which is naturally associated with the transposon in its in vivo situation in nature. However, the invention also encompasses modified transposases, which may have advantageously improved activities within the scope of the invention. For example, the sequence of the gene encoding the transposase may be modified to optimise codon usage and thus increase transposition frequencies. Optimisation of codon usage is a method well known in the art to increase the expression levels of a given gene. Alternatively the transposase may comprise one or more insertions, substitutions or deletions of amino acids to provide enhanced activity in the host organism.

The gene encoding the transposase may be provided in the genome of a second organism which is crossed with a first organism comprising, in its genome, the transposon to produce an embryo for use in the methods of the invention. In an alternative embodiment, one or more copies of both the transposon and the gene encoding the cognate transposase are provided in the genome of a first organism, which may be crossed with a second organism comprising one or more copies of regulatory elements necessary to permit inducible transposase expression to produce an embryo.

A number of methods are known in the art for introduction of a gene into the genome of a host cell, and may be employed in the context of the present invention. For example, transposase genes may be inserted into the host cell genome by transgenic techniques. Such methods are discussed further below.

The standard methodology for transposable element mediated transformation is by co- injecting into pre-blastoderm embryos a mixture of two plasmids: one expressing transposase (Helper) but unable to transpose, and one carrying the gene of interest flanked by the inverted terminal repeats of the element (Donor). Transformed progeny of injected animals are detected by the expression of dominant marker genes.

WO 01/71019 describes the generation of transgenic animals using transposable elements. According to this method, the transposase function is provided by crossing of transgenic organisms, one of which provides a transposon function and the other providing a transposase function in order to produce organisms containing both transposon and transposase in the required cells or tissues. The use of tissue specific chromatin opening domains directs transposase activity in a tissue specific manner and gives rise to multiple independent transposition events in somatic tissues (see Zagoraiou et al (2001) P. N. A. S. 98 11474-11478).

Transgenic animals, where described, have the transposase provided in cis or trans, for example by cotransformation with transposase genes.

Regulation of Transposase Expression Coding sequences encoding the transposase may be operatively linked to regulatory sequences which modulate transposase expression as desired. Control sequences operably linked to sequences encoding the transposase include promoters/enhancers and other expression regulation signals. These control sequences may be selected to be compatible with the host organism in which the expression of the transposase is required. The term promoter is well known in the art and encompasses nucleic acid regions ranging in size and complexity from minimal promoters to promoters including upstream elements and enhancers.

The promoter is typically selected from promoters which are functional in cell types homologous to the organism in question, or the genus, family, order, kingdom or other classification to which that organism belongs, although heterologous promoters may function-e. g. some prokaryotic promoters are functional in eukaryotic cells. The promoter may be derived from promoter sequences of viral or eukaryotic genes. For example, it may be a promoter derived from the genome of a cell in which expression is to occur. With respect to eukaryotic promoters, they may be promoters that function

in a ubiquitous manner (such as promoters of a-actin, 0-action, tubulin) or, alternatively, a tissue-specific manner (such as promoters of the genes for pyruvate kinase). In the generation of germline transposition events, the promoters may be derived from genes whose expression is induced during gametogenesis, either oogenesis or spermatogenesis. Alternatively, for developmentally regulated transposition events such as transposition during zygote development, the promoters may be derived from genes whose expression is developmentally regulated. For expression in the early zygote, promoters from maternal effect genes may be used.

They may also be promoters that respond to specific stimuli, for example promoters that bind steroid hormone receptors. Viral promoters may also be used, for example the Moloney murine leukaemia virus long terminal repeat (MMLV LTR) promoter, the rous sarcoma virus (RSV) LTR promoter or the human cytomegalovirus (CMV) IE promoter.

According to the invention, the gene encoding the transposase is under the control of one or more regulatory sequences, meaning that the levels of expression obtained using e. g. a promoter can be regulated. For example the regulatory sequence may be an inducible regulatory sequence. Inducible systems for gene expression are known in the art, and include tetracycline, ecdysone and estrogen-inducible systems or the lac operator-repressor system.

Other suitable inducible systems include the heat shock promoter and use of heat <BR> <BR> shock in inducing transcription form that promoter. 'Heat shock proteins'or HSP is a group of proteins first found in cells that were exposed to high temperatures. Heat shock proteins are also being synthesized under different kind of stress conditions, like inflammation, infection, ischemia and exposure of the cell to toxins or malignant transformation.

Heat shock proteins act as molecular chaperones for protein molecules. Usually they are cytoplasmic proteins and they function in various intra-cellular processes. They play an important role in protein-protein interactions, including folding and assisting in establishing of proper protein conformation, and prevention of inappropriate protein

aggregation. Heat shock proteins have been named according to their molecular weights.

Heat shock proteins are found ubiquitously in bacteria through to plants, insects and mammals. The HSP70 family is comprised of multiple members and it may be the most abundant HSP induced in cell response to stress-up to 20% of the total cellular protein after appropriate stimulation. HSP70 is localized in the cytosol, mitochondria and endoplasmic reticulum and exhibit constitutive and inducible regulation. HSP70 is not typically expressed in all kind of cells, but it is expressed at high levels in stress conditions. HSP70 participates in translation, protein translocation, proteolysis and protein folding, suppressing aggregation and reactivating denatured proteins. The activity of HSP70 appears to be regulated by co-factor chaperones.

The promoter sequence of hsp70 may be isolated and used to allow inducible expression of a specific construct when treated with heat or other inducing conditions.

Accordingly, particularly preferred inducible systems may be based on using a promoter derived from hsp70.

A widely used system of this kind in mammalian cells is the tetO promoter-operator, combined with the tetracycline/doxycycline-repressible transcriptional activator tTA, also called Tet-Off gene expression system (Gossen, M. & Bujard, H. (1992) Tight control of gene expression in mammalian cells by tetracycline responsive promoters.

Proc. Natl. Acad. Sci. USA 89: 5547-5551), or the doxycycline-inducible rtTA transcriptional activator, also called Tet-On system (Gossen, M. , Freundlieb, S.,<BR> Bender, G. , Muller, G. , Hillen, W. & Bujard, H. (1995) Transcriptional activation by tetracycline in mammalian cells. Science 268: 1766-1769).

In the Tet-Off system, gene expression is turned on when tetracycline (Tc) or doxycycline (Dox; a Tc derivative) is removed from the culture medium. In contrast, expression is turned on in the Tet-On system by the addition of Dox. Procedures for establishing cell lines carrying the transcriptional activator gene and the Tet- regulatable gene stably integrated in its chromosomes have been described. For

example see http://www. clontech. com/techinfo/manuals/PDF/PT3001-l. pdf. For example, the Tet-On system may be employed for tetracycline-inducible expression of Minos transposase in a transgenic animal.

Alternative inducible systems include tamoxifen inducible transposase [a modified oestrogen receptor domain (Indra et al., Nucl Acid Res. 27,4324-27, 1999) coupled to the transposase which retains it in the cytoplasm until tamoxifen is given to the culture], an RU418 inducible transposase (operating under the same principle with the glucocorticoid receptor; see Tsujita et al. , J. Neuroscience, 19,10318-23, 1999), or an ecdysone-inducible system.

The ecdysone-inducible system is based on the heterodimeric ecdysone receptor of Drosophila, which is induced by the insect hormone, ecdysone and its derivatives.

During metamorphosis of Drosophila melanogaster, a cascade of morphological changes is triggered by the steroid hormone 20-OH ecdysone, generally referred to as "ecdysone", via the ecdysone receptor. Ecdysone responsiveness may be transferred to mammalian cells by the stable expression of a modified ecdysone receptor that regulates an optimized ecdysone responsive promoter. Transgenic, organisms, e. g. mice expressing the modified ecdysone receptor can activate an integrated ecdysone responsive promoter upon administration of hormone or its derivatives e. g. Once the receptor binds ecdysone or muristerone, an analog of ecdysone, the receptor activates the ecdysone-responsive promoter to give controlled expression of the gene of interest.

Ecdysone-based inducible systems are reported to exhibit lower basal activity and higher inducibility than tetracycline based systems. Further details of ecdysone based inducible systems can be found, for example, in US 6,245, 531 and in No D, Yao TP, Evans RM Ecdysone-inducible gene expression in mammalian cells and transgenic mice, Proc Natl Acad Sci U S A 1996 Apr 93: 3346-51, the contents of each of which are herein incorporated by reference.

The lac operator-repressor system has recently been shown to be functional in mammals, in particular the mouse. Cronin et al, Genes and Development, 15,1506- 1517 (2001), the contents of which are herein incorporated by reference, describes the

use of a lac repressor transgene that resembles a typical mammalian gene both in codon usage and structure and that expresses functional lac repressor protein ubiquitously in mice to control the expression of a reporter gene under the control of the lac promoter. Expression of the reporter gene is reversible using the lactose analog IPTG provided in the drinking water of the mouse or mother of the embryo or nursing pup. The lac operator-repressor system may thus be adapted for use to regulate expression of transposase by placing the transposase gene under the control of a lac promoter.

In addition, any of these promoters may be modified by the addition of further regulatory sequences, for example enhancer sequences. Chimeric promoters may also be used comprising sequence elements from two or more different promoters described above.

The use of locus control regions (LCRs) is also envisaged. LCRs are capable of conferring tightly-regulated tissue specific control on transgenes, and to greatly increase the fidelity of transgene expression. A number of LCRs are known in the art.

These include the (3-globin LCR (Grosveld et al., (1987) Cell 51: 975-985) ; a-globin (Hatton et al., (1990) Blood 76: 221-227 ; and CD2 (Festenstein et al., (1996) Science 271: 1123-1125) the T cell specific CD4 (Boyer et al J Immunol 1997,159 : 3383- 3390), and TCR loci (Diaz P, et al Immunity 1994,1 : 207-217 ; Ortiz et al EMBO J 1997,16 : 5037-5045 ; Hong et al Mol Cell Biol 1997,17 : 2151-2157. ) the B-cell-specific MHC class II Ea (Carson et al Nucleic Acids Res 1993,21 : 2065-2072), the macrophage-specific lysozyme gene (Bonifer et al EMBO J 1990,9 : 2843-2848), the neuron-specific S100 gene (Friend et al J Neurosci 1992,12 : 4337-4346), the liver- specific LAP gene (Talbot et al Nucleic Acids Res 1994,22 : 756-766), the human growth hormone locus (Jones et al Mol Cell Biol 1995,15 : 7010-7021), plus immunoglobulins, muscle tissue, and the like. Further details on LCRs are provided in Fraser, P. & Grosveld, F. (1998). Curr. Opin. Cell Biol. 10,361-365 and Li, Q., Harju, S. & Peterson, K. R. (1999). Trends Genet. 15 : 403-408.

Alternatively, gene domains that need to be open and switched-on in all cells of the body; i. e. gene domains whose proteins (such as enzymes for generating energy from sugars), are needed by all cells for survival and which are therefore ubiquitously expressed may be exploited to enable expression of the transposon and/or transposase in any tissue. Examples of such ubiquitously-acting chromatin opening elements- (UCOEs) include the human genes known as TBP and hnRNPA2. Further details of the use of such UCOEs may be found in Antoniou, M. and Grosveld, F. (1999).

(Genetic approaches to therapy for the haemoglobinopathies. in: Blood Cell Biochemistry, Volume 8: Hematopoiesis and Gene Therapy Fairbairn and Testa eds.

Kluwer Academic/Plenum Publishers, New York. pp 219-242) and in PCT/GB99/02357 (WO 0005393), the contents of both of which are herein incorporated by reference.

Maximising efficiency of transposition As described above and for example, in WO 01/71019 and WO 02/062991, transposition is achieved by the action of the transposase enzyme on the terminal repeat sequences of the integrated transposon, resulting in excision of the transposon from its original position in the"host"genome and reinsertion of the transposon at a different position in the genome.

As with most biochemical processes, this process can be made to be more efficient by simply improving the concentration of substrates, high levels of the terminal repeats sequences, i. e. an increase in copy number and high levels of the transposase enzyme.

An increase in copy number can be achieved by generating multiple copy arrays at the original insertion site. For example, 10 to 100 copies can be generated through standard transgenesis or using a PAC vector. Alternatively, multiple copies can be generated by the presence of multiple insertions at different sites in the genome.

The sequence of the transposase may be modified to optimise codon usage and thus, increase transposition frequencies. Optimisation of codon usage is a method well known in the art to increase the expression levels of a given gene.

Thus, the efficiency of the fly transposase in mammalian cells or animals may be increased by increasing its concentration as a result of a more efficient translation from mRNA by replacing the fly codon usage to mammalian codon usage.

Assays for determining transposase efficiency can include a standard transposition assay as described, for example, by Klinakis et al. ; Insect Molecular Biology, 9 (3), 269-275,2000.

The concentration of transposase mRNA can also be increased by including in the transposase mRNA sequence 5'and 3'sequences found in abundant stable mRNAs such as those encoding growth hormone, globin, actin or albumin.

Transgenic Organisms Methods of the invention may employ one or more transgenic organisms having integrated in the genome the transposon, a gene encoding the cognate transposase or both.

The introduction of the transposon or gene encoding the transposase may be accomplished by any available technique, including transformation/transfection, delivery by viral or non-viral vectors and microinjection. Each of these techniques is known in the art. The transposon and the gene encoding the transposase may be inserted using the same or different methods. For example, the Drosophila P-element may be used to introduce a Minos transposase construct into Drosophila.

In a preferred embodiment, the transposon or gene encoding the transposase may be inserted into the host cell genome by transgenic techniques, for example to produce a transgenic animal comprising a transposon, a gene encoding a cognate transposase or both. Where the transgenic animal comprises both the transposon and the gene encoding the transposase, both constructs can be inserted using the same or different methods. Where delivery of the construct is by viral vector, a composite vector comprising both the transposon and the gene encoding the transposase under the

control of a control sequence such as the Tet operator may be used. Alternatively, separate vectors may be used.

Any suitable transgenic animal may be used in the present invention. Animals include animals of the phyla cnidaria, ctenophora, platyhelminthes, nematoda, annelida, mollusca, chelicerata, uniramia, crustacea and chordata. Uniramians include the subphylum hexapoda that includes insects such as the winged insects. Chordates include vertebrate groups such as mammals, birds, fish, reptiles and amphibians.

Particular examples of mammals include non-human primates, cats, dogs, ungulates such as cows, goats, pigs, sheep and horses and rodents such as mice, rats, gerbils and hamsters.

Techniques for producing transgenic animals which may be used in the method of the invention are well known in the art. A useful general textbook on this subject is Houdebine, Transgenic animals-Generation and Use (Harwood Academic, 1997)- an extensive review of the techniques used to generate transgenic animals.

In a preferred embodiment, the animal is an insect. Most preferably, the insect is Drosophila. Methods for producing transgenic insects which may be used in the method of the invention are well known (see for example Loukeris et al (1995), Science 270 2002-2005). Briefly, a transposable element carrying the gene of interest is inserted into a preblastoderm embryo using e. g. microinjection. Preferably, the new genetic material is placed at the polar plasm, which is the section of egg destined to become the still nascent insect's own egg or sperm cells. After many divisions of the nuclear material, most of it segregates to the periphery where it will become the nuclei of the insect's body. A small number of nuclei migrate to the pole to become egg cells on maturity. If these cells incorporate the transgene, progeny will be transgenic.

Further details of producing transgenic insects are provided in Loukeris et al (1995), Science 270 2002-2005 and O'Brochta and Atkinson (1998) Scientific American 279 60-65.

European Patent Application 0955364 (Savakis et al., the disclosure of which is incorporated herein by reference) describes the use of Minos to transform cells, plants and animals. The generation of transgenic mice comprising one or more Minos insertions is also described.

Accordingly, in another preferred embodiment, the animal is preferably a mammal.

Advances in technologies for embryo micromanipulation now permit introduction of heterologous DNA into, for example, fertilised mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, retroviral infection or other means, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In a highly preferred method, developing embryos are infected with a retrovirus containing the desired DNA, and transgenic animals produced from the infected embryo. In a most preferred method, however, the appropriate DNAs are coinjected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals. Those techniques as well known (see reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian fertilised ova, including Hogan et al., Manipulating the Mouse Embryo, (Cold Spring Harbor Press 1986); Krimpenfort et al., Bio/Technology 9: 844 (1991); Palmiter et al., Cell, 41: 343 (1985); Kraemer et al., Genetic manipulation of the Mammalian Embryo, (Cold Spring Harbor Laboratory Press 1985) ; Hammer et al., Nature, 315: 680 (1985); Wagner et al., U. S. Pat. No. 5,175, 385; Krimpenfort et al., U. S. Pat. No. 5,175, 384, the respective contents of which are incorporated herein by reference.).

Another method used to produce a transgenic animal involves microinjecting a nucleic acid into pro-nuclear stage eggs by standard methods. Injected eggs are then cultured before transfer into the oviducts of pseudopregnant recipients.

Transgenic animals may also be produced by nuclear transfer technology as described in Schnieke, A. E. et al., 1997, Science, 278: 2130 and Cibelli, J. B. et al., 1998,

Science, 280: 1256. Using this method, fibroblasts from donor animals are stably transfected with a plasmid incorporating the coding sequences for a polypeptide of interest under the control of regulatory sequences. Stable transfectants are then fused to enucleated oocytes, cultured and transferred into female recipients.

Analysis of animals which may contain transgenic sequences would typically be performed by either PCR or Southern blot analysis following standard methods.

By way of a specific example for the construction of transgenic mammals, such as cows, nucleotide constructs comprising a sequence encoding a DNA binding molecule are microinjected using, for example, the technique described in U. S. Pat. No.

4,873, 191, into oocytes which are obtained from ovaries freshly removed from the mammal. The oocytes are aspirated from the follicles and allowed to settle before fertilisation with thawed frozen sperm capacitated with heparin and prefractionated by Percoll gradient to isolate the motile fraction.

The fertilised oocytes are centrifuged, for example, for eight minutes at 15,000 g to visualise the pronuclei for injection and then cultured from the zygote to morula or blastocyst stage in oviduct tissue-conditioned medium. This medium is prepared by using luminal tissues scraped from oviducts and diluted in culture medium. The zygotes must be placed in the culture medium within two hours following microinjection.

Oestrous is then synchronized in the intended recipient mammals, such as cattle, by administering coprostanol. Oestrous is produced within two days and the embryos are transferred to the recipients 5-7 days after oestrous. Successful transfer can be evaluated in the offspring by Southern blot.

Alternatively, the desired constructs can be introduced into embryonic stem cells (ES cells) and the cells cultured to ensure modification by the transgene. The modified cells are then injected into the blastula embryonic stage and the blastulas replaced into pseudopregnant hosts. The resulting offspring are chimeric with respect to the ES and

host cells, and nonchimeric strains which exclusively comprise the ES progeny can be obtained using conventional cross-breeding. This technique is described, for example, in W091/10741.

Alternative methods for delivery and stable integration of transposons and/or genes encoding transposases into the genome of host animals include the use of viral vectors, such as adenoviral vectors, retroviral vectors, baculoviral vectors and herpesviral vectors. Such techniques have moreover been described in the art, for example by Zhang et al. (Nucl. Ac. Res. , 1998,26 : 3687-3693).

Suitable viral vectors may be retroviral vectors, and may be derived from or may be derivable from any suitable retrovirus. A large number of different retroviruses have been identified. Examples include: murine leukaemia virus (MLV), human immunodeficiency virus (HIV), simian immunodeficiency virus, human T-cell leukaemia virus (HTLV). equine infectious anaemia virus (EIAV), mouse mammary tumour virus (MMTV), Rous sarcoma virus (RSV), Fujinami sarcoma virus (FuSV), Moloney murine leukaemia virus (Mo-MLV), FBR murine osteosarcoma virus (FBR MSV), Moloney murine sarcoma virus (Mo-MSV), Abelson murine leukaemia virus (A-MLV), Avian myelocytomatosis virus-29 (MC29), and Avian erythroblastosis virus (AEV). A detailed list of retroviruses may be found in Coffin et al. , 1997, "retroviruses", Cold Spring Harbour Laboratory Press Eds: JM Coffin, SM Hughes, HE Varmus pp 758-763.

Details on the genomic structure of some retroviruses may be found in the art. By way of example, details on HIV and Mo-MLV may be found from the NCBI GenBank (Genome Accession Nos. AF033819 and AF033811, respectively). <BR> <BR> <P>Retroviruses may be broadly divided into two categories: namely, "simple"and "complex". Retroviruses may even be further divided into seven groups. Five of these groups represent retroviruses with oncogenic potential. The remaining two groups are the lentiviruses and the spumaviruses. A review of these retroviruses is presented in Coffin et al., 1997 (ibid).

Host range and tissue tropism varies between different retroviruses. In some cases, this specificity may restrict the transduction potential of a recombinant retroviral vector. For this reason, many gene therapy experiments have used MLV. A particular MLV that has an envelope protein called 4070A is known as an amphotropic virus, and this can also infect human cells because its envelope protein"docks"with a phosphate transport protein that is conserved between man and mouse. This transporter is ubiquitous and so these viruses are capable of infecting many cell types.

Replication-defective retroviral vectors are typically propagated, for example to prepare suitable titres of the retroviral vector for subsequent transduction, by using a combination of a packaging or helper cell line and the recombinant vector. That is to say, that the three packaging proteins can be provided in trans.

A"packaging cell line"contains one or more of the retroviral gag, pol and env genes.

The packaging cell line produces the proteins required for packaging retroviral DNA but it cannot bring about encapsidation due to the lack of a psi region. The helper proteins can package a psi-positive recombinant vector to produce the recombinant virus stock. This virus stock can be used to transduce cells to introduce the vector into the genome of the target cells. A summary of the available packaging lines is presented in Coffin et al. , 1997 (ibid).

The lentivirus group can be into"primate"and"non-primate". Examples of primate lentiviruses include human immunodeficiency virus (HIV), and simian immunodeficiency virus (SIV). The non-primate lentiviral group includes the prototype"slow virus"visna/maedi virus (VMV), as well as the related caprine arthritis-encephalitis virus (CAEV), equine infectious anaemia virus (EIAV) and the more recently described feline immunodeficiency virus (FIV) and bovine immunodeficiency virus (BIV). See, for example, Rovira et al., Blood. 2000; 96: 4111- 4117; Reiser et al., J Virol. 2000 Nov; 74 (Mulder, M. P et al. (1995). Hum Genet 96 (2): 133-141): 10589; Lai et al., Proc Natl Acad Sci U S A 2000 Oct 10 ; 97 (Southern,

E. M. (1975). J. Mol. Biol 98, 503-517): 11297-302 ; and Saulnier et al., J Gene Med 2000 Sep-Oct ; 2 (5): 317-25.

A distinction between the lentivirus family and other types of retroviruses is that lentiviruses have the capability to infect both dividing and non-dividing cells. In contrast, other retroviruses-such as MLV-are unable to infect non-dividing cells such as those that make up, for example, muscle, brain, lung and liver tissue A number of vectors have been developed based on various members of the lentivirus sub-family of the retroviridae and a number of these are the subject of patent applications (WO-A-98/18815; WO-A-97/12622). Preferred lentiviral vectors are based on HIV, SIV or EIAV. The simplest vectors constructed from HIV-1 have the complete HIV genome except for a deletion of part of the env coding region or replacement of the nef coding region. Notably these vectors express gag/pol and all of the accessory genes hence require only an envelope to produce infectious virus particles. Of the accessory genes vif, vpr, vpu and nef are non-essential.

One preferred general format for HIV-based lentiviral vectors is, HIV 5'LTR and leader, some gag coding region sequences (to supply packaging functions), a reporter cassette, the rev response element (RRE) and the 3'LTR. In these vectors gag/pol, accessory gene products and envelope functions are supplied either from a single plasmid or from two or more co-transfected plasmids, or by co-infection of vector containing cells with HIV.

The adenovirus is a double-stranded, linear DNA virus that does not go through an RNA intermediate. There are over 50 different human serotypes of adenovirus divided into 6 subgroups based on the genetic sequence homology all of which exhibit comparable genetic organisation. Human adenovirus group C serotypes 2 and 5 (with 95% sequence homology) are most commonly used in adenoviral vector systems and are normally associated with upper respiratory tract infections in the young.

Adenoviruses/adenoviral vectors which may be used in the invention may be of human or animal origin. As regards the adenoviruses of human origin, preferred adenoviruses are those classified in group C, in particular the adenoviruses of type 2 (Ad2), 5 (Ad5), 7 (Ad7) or 12 (Adl2). Among the various adenoviruses of animal origin, canine adenovirus, mouse adenovirus or an avian adenovirus such as CELO virus (Cotton et al. , 1993, J Virol 67: 3777-3785) may be used.

HSV vectors may be derived from, for example, HSV1 or HSV2 strains, or derivatives thereof. Attenuated strains may be used for example strain 1716 (MacLean et al., 1991, J Gen Virol 72: 632-639), strains R3616 and R4009 (Chou and Roizman, 1992, PNAS 89: 3266-3270) and R930 (Chou et al. , 1994, J. Virol 68: 8304-8311) all of which have mutations in ICP34.5, and d27-1 (Rice and Knipe, 1990, J. Virol 64: 1704-1715) which has a deletion in ICP27. Alternatively strains deleted for ICP4, ICPO, ICP22, ICP6, ICP47, vhs or gH, with an inactivating mutation in VMW65, or with any combination of the above may also be used to produce HSV strains of the invention.

The terminology used in describing the various HSV genes is as found in Coffin and Latchman, 1996. Herpes simplex virus-based vectors. In : Latchman DS (ed). Genetic manipulation of the nervous system. Academic Press: London, pp 99-114.

Baculovirus vectors may moreover be employed in the invention. The baculovirus Autographa californica multiple nuclear polyhedrosis virus (AcMNPV) is a DNA virus which can replicate only in cells of certain lepidopteran insects and has been used widely for expression of recombinant proteins in insect cells. Baculoviruses such as AcMNPV have been used recently for introducing heterologous DNA with high efficiency in a variety of mammalian cells, such as a hepatoma cell line and primary liver cells, and endothelial cells (Boyce FM, Bucher NL (1996) Baculovirus-mediated gene transfer into mammalian cells. Proc Natl Acad Sci U S A 93, 2348-52 ; Airenne KJ, Hiltunen MO, Turunen MP, Turunen AM, Laitinen OH, Kulomaa MS, Yla- Herttuala S (2000) Baculovirus-mediated periadventitial gene transfer to rabbit carotid artery. Gene Ther 7,1499-1504). Moreover, baculovirus vectors for gene transfer, methods for introducing heterologous DNA into their genome and procedures

for recombinant virus production in insect cell cultures are available commercially ; furthermore, baculoviruses cannot normally replicate in mammalian cells, so there is no need to engineer them for this use.

Construction of vectors for use in methods of the invention may employ conventional ligation techniques. Isolated viral vectors, plasmids or DNA fragments are cleaved, tailored, and religated in the form desired to generate the plasmids required. If desired, analysis to confirm correct sequences in the constructed vectors is performed in a known fashion. Transposon presence and/or mobilisation may be measured in a cell directly, for example, by conventional Southern blotting, dot blotting, PCR or in situ hybridisation, using an appropriately labelled probe which may be based on a sequence present in the transposon. Those skilled in the art will readily envisage how these methods may be modified, if desired. Vectors useful in the present invention are advantageously provided with marker genes to facilitate transposon identification and localisation as described above.

Uses of the Invention The methods of the present invention enables the generation of transgenic embryos and organisms comprising one or more clonal populations of cells homogeneous for one or more individual mutations.

The invention allows functional mapping of a genome by permitting an improved method of generating mutants with random insertion and targeting of introns.

The invention, in an advantageous embodiment, allows genes to be marked for functional genetic analysis in a group of cells or tissues, or knocked out, by transposon insertion and then specifically identified through the transposon"tag"without requiring costly and time-consuming genetic analyses, and frequently without significant amounts of sequencing.

A further embodiment of the invention provides for the generation of libraries of transgenic organisms, such as transgenic mice. Target genes may be identified phenotypically according to the phenotype of one or more cells, tissues or organs, and identified genetically by determination of the transposon insertion site. Inducible expression systems, as described above, may be used to regulate the switch between partial and antisense-induced complete knockout of a gene. Somatic cells carrying transposon insertions can be immortalized, for example by deriving immortal cell lines by standard methodologies, or by generating transgenic animal lines by nuclear implantation methodologies.

Such libraries can be used for phenotypic analysis and identification of gene associations. The present methods allow advantages over the current methods.

Sequence analysis of DNA flanking new transposition events will then identify new candidate disease causing genes which contribute to the onset of the severe phenotype.

Candidate disease genes can then become the focus of further studies to determine their precise role in animal models, and validation of a disease related role in man Target validation in man will utilise existing clinical and genetic databases, containing DNA and clinical information on relevant patient and control groups.

Phenotypic analysis of the transgenic organisms created can be through simple and rapid measurements including changes in a metabolite, protein (e. g. insulin), lipid or carbohydrate (e. g. when measuring glucose tolerance) present in urine, blood, spinal fluid or tissue. Measurements in body fluids can be made by any one of a number of techniques known to those skilled in the art including measurement by NMR, Elisa, GMS and so forth.

Other phenotypic characteristics can be analysed by measuring behavioural patterns or responses to external stimuli by using tests such as light, sound, memory and stress tests.

Other measurable phenotypic characteristics include growth and ageing parameters, tumour growth, obesity and so forth which can be measured by assessing, for example, weight, fat content and growth rate. Furthermore changes in other measurable features such as blood pressure, heart rate, lung function and so forth can be assessed.

In an alternative embodiment, the methods of the invention may be used to"mark" genes whose expression is modulated by external stimuli. Thus, an embryo, organism, or tissue or cell derived from either, which has been exposed to transposon mobilisation with a marked transposon is subjected to treatment with an external stimulus, such as a candidate drug or other test agent, and modulation of the expression of the marker observed. Cells in which the marker is over or under- expressed are likely to have the transposon inserted in or near a gene which is upregulated or downregulated in response to the stimulus. The invention may thus be used to provide in vivo enhancer trap and exon trap functions, by inserting transposons which comprise marker genes which are modulated in their expression levels by the proximity with enhancers or exons.

This approach is useful for the study of gene modulation by drugs in drug discovery approaches, toxicology studies and the like. Moreover, it is applicable to study of gene modulation in response to natural stimuli, such as hormones, cytokines and growth factors, and the identification of novel targets for molecular intervention, including targets for disease therapy in humans, plants or animals, development of insecticides, herbicides, antifungal agents and antibacterial agents.

Brief Description of the Figures Figure 1 shows a schematic for the constucts described in the Examples. Two Minos transposon constructs (MiPR1 ; 4kb (plasmid rescue) and MiETl ; 7.3kb (Enhancer <BR> <BR> Trap) ) and one Minos helper vector construct (PhsILMiT; 7.4kb) are shown. The transposon vectors carry, in addition to a dominant marker (3xp3 EGFP), a bacterial

origin of replication (ori) and an antibiotic resistance gene (kanR). One of the transposons carries additionally the gene encoding GAL4 activator under the control of a minimal promoter (the promoter of the Minos element itself). The helper vector is based on P and carries the intronless transposase gene under the control of a Drosophila heat shock promoter (hsp70p) + hsp70term and the Drosophila white gene as a dominant marker.

Figure 2 illustrates schematically the introduction of Minos transposon and transposase source into pre-blastoderm embryos in a method of germline transformation.

Figure 3 illustrates schematically the generation of jumpstart males and progeny having an autosomal transposition event.

Figure 4 shows SeqLogo analysis of the Minos primary insertion sites. 79 insertion sites were aligned and their informational content plotted with the SeqLogo program.

Maximal informational content for DNA is 2 bits per base. As a comparison, the profile for insertion of Sleeping Beauty is given.

Figure 5 shows HbondView analysis of 80 Minos insertion sites. The program plots the hydrogen bonding properties of base pairs. Six positions for each base pair are colour-coded according to being a potential hydrogen acceptor (red), a donor (blue) or inert (gray). A graph of the average colour intensity in every position is created. As comparison, graphs for Sleeping Beauty in human DNA (Vigdal et al. ) and the P-<BR> element in Drosophila (Liao et al. ) are given.

Figure 6 illustrates the sequence of the parental and four different Minos insertions in the Mus musculus genome. Chromosomal sequences flanking the new inserted transposon are represented by capital letters, transposon sequence in small letters and the target site duplication in grey. The chromosomal locations of insertions and scaffold numbers from the Celera database are indicated.

Table 1 presents the results of the analysis of Minos transposon insertion into Drosophila progeny.

The invention is further described, for the purpose of illustration, in the following examples.

Examples A) TRANSPOSON INSERTION IN DROSOPHILA To test the potential of the Minos transposable element as a mutagenesis tool in Drosophila we have generated and analysed 96 Minos integration events into the Drosophila genome. Additionally, we have devised an efficient jurnpstarting scheme for generating single insertions in autosomes. Our results demonstrate that a Minos- based insertional mutagenesis system is now available for genetic screens in Drosophila.

Materials and Methods Plasmids construction: For the generation of pMiPRl, oligonucleotides containing the KpnI, SfiI, BglII, XbaI, StuI, EcoRV, Sacl, SspI restriction enzymes sites were cloned in the HindIII-Xmal sites of the vector pHSS6 (Seifert et al, 1986), resulting in pHSSK. The left Minos end together with the 5'UTR of Minos transposase and about 100bp sequence from Drosophila hydei was cloned in pHSSK as a Clal-Kpnl fragment from pMiLRtetR (Klinakis et al, 2000a) resulting in pMiLori. Two fragments from pMiLRtetR, an EcoRI-HindIII blunted fragment, contaning the tetracycline gene and its origin of replication and a Sacll-BstlVl blunted fragment, containing the right Minos end together with about 50bp sequence from Drosophila hydei and 59bp from Minos transposase 3'end were cloned in the STUI and Sspl sites of pMiLori, resulting in pMiLRoriT. The plasmid pSL-3xP3-EGFP was kindly provided by E. Wimmer

(C. Horn et al, 2000). The EGFP gene flanked by the 3xP3 promoter and the SV40polyA was cloned into EcoRI-SmaI digested pBlueScript KSII+ (Stratagene) as an EcoRI-FseI blunted fragment and it was recloned as an Xbal-XhoI fragment into pMiLRtetR vector, resulting in pMi3xP3-EGFP vector. An EcoRI-Notl fragment from pMi3xP3-EGFP was cloned into pMiLRoriT, resulting in the transposon homing plasmid pMiPR1.

The construction of the transposon MiET1 was based on the transposon MiPRl. The Gal4 coding sequence, followed by a hsp70 terminator, together with 75bp of upstream sequence from the vector pHSREM (lacking the heat shock consensus sequences) were taken from the vector pGATN (Brand and Perrimon, 1993) after PCR with proof reading Vent polymerase and were cloned as a blunt fragment into pBluescript SmaI site, after blue-white selection. The PCR product was flanked by two EcoRI sites, designed at the 5'ends of the primers. Gal4 was cloned into the unique EcoRI site of the vector pMiPRl, as a 3.3 kb EcoRI digested fragment, after the dephosphorylation of the vector. The orientation of the Gal4 sequence in the final vector was cleared out after a SpeI digest.

The plasmid pPhsILMiT was derived after the ligation of a 2.3kb NotI fragment from the vector pHSS6hsILMi20 (Klinakis et al, 2000), carrying the intronless Minos transposase gene under the hsp70 promoter, and a Notl digested P element vector pCasper4 (Thummel and Pirrotta, 1991).

Schematic diagrams of each of these 3 constructs are given in Figure 1.

Germline transformation: 1) Germline transformation experiments were performed by microinjection of DNA constructs into Drosophila melanogaster pre-blastoderm embryos of the strain yw 67c23 as previously described by Rubin and Spradling (1982). The embryos were co-

injected with 400 wgr/ml of transposon and 100 pgr/rnl of pHSS6hsMi2 helper plasmid (Loukeris et al, 1995a-b) or with 100 ygr/ml of Minos transposase rnRNA, produced by the vector pBS (SK) MimRNA (Pavlopoulos A.).

Individual male and female GO survivors were backcrossed each with four female and male flies, respectively. The progeny from these crosses was screened for the presence of green fluorescing eyes by epifluorescence microscopy. G1 individuals showing green eye fluorescence were used to establish transgenic fly lines that were grown at 25°C.

A schematic diagram showing this method of germline transformation is given in Figure 2.

2) For the production of single insertions in flies, we used a jumpstarting scheme (Cooley et al, 1988). For the production of flies producing Minos transposase, Drosophila melanogaster embryos of a strain carrying the CyO balancer were co- injected with the A2-3 helper plasmid (Laski et al, 1986) and the plasmid pPhsILMiT.

Those Gl progeny that both carried the CyO balancer and the white gene were crossed individually to y w flies. Six lines in which the balancer and the white marker gene were co-transmitted to the progeny were selected and were kept as stocks.

Six different lines of flies carrying the transposon PhsILMiT into a CyO balancer were checked for their ability to remobilise a single insertion of the transposon MiPRI on the X chromosome (X: 8F3) to the autosomes. The jumpstart males were heat shocked once by heating to 37°C during the larval developmental stages. Progeny expressing GFP contain insertions of the transposon. The best scores we obtained was 24% jumping efficiency from one transgenic line, named PhsILMiT2.4. Flies from this line were checked for their ability to mobilise a single insertion of the transposon MiET1 (X: 17D3) from the X chromosome to the autosomes. In this case, the jumpstart males

were daily heat shocked by heating to 37°C for one hour during the larval and pupal developmental stages and the jumping efficiency went up to 81%. It has to be mentioned that in the crosses that no jumping event to the autosomes was revealed, the number of the screened male offsprings was less than 30. This leads us to the assumption that the jumpstarting scheme that we have devised has a jumping efficiency of 100%, when a sufficient number of the male offsprings can be screened.

Furthermore, no remobilisation events were detected when the jumpstart males were grown continuously at 30°C, in the absence of heat shock.

A schematic diagram of this procedure is given in Figure 3.

Analysis of tranposon insertion Progeny from germ line transformation through injection of constructs and from the "jumpstarter"strategy were analysed. Fly strains containing single insertions of Minos were bred and 96 insertions were characterized by sequencing the DNA flanks of the Minos insertion, using standard plasmid rescue methodology to clone the Minos transposon and flanks from total fly DNA.

Plasmid rescue technique and mRNA production: For the purification of genomic DNA we followed the protocol of Holmes-Bonner (Holmes D. S. and Bonner J. , 1973) and the plasmid rescue technique was carried out according to Pirrotta protocols (Pirrotta, 1986). Genomic DNA was digested with BamHI, XbaI or a combination of Xbal and Spel. DHFSa competent cells were transformed with the ligates and the rescued plasmids were selected in kanamycin (25 llgr/ml) and nalidyxic acid (35 ggr/rni) rich mediums. For the sequencing reactions we used IMio2 primer, a 26 bp sequence from Minos right inverted repeat that is 50 bp distanced from Minos end (5' GATAATATAGTGTGTTAAACATTGCGC 3', Klinakis, A. G. , Zagoraiou, L., Vassilatis, D. K & Savakis, C. (2000) EMBO Reports 11,416-421.).

Minos transposase mRNA was produced with message machine T7 kit of Ambion.

The results are shown in Table 1.

Analysis of these results shows a statistically significant preference of Minos for introns versus exons (P<0. 05, x2 test). Overall, about 30% of all insertions (29/96) were found in introns.

This is an unexpected result. The preference of Minos to target introns differentiates this element as a mutagenesis tool from the P element, widely used by Drosophila geneticists, which shows a strong bias to hit 5'regions of the genes (Liao G et al.).

This makes Minos a more efficient tool for gene trapping mutagenesis than the P element.

Computational analysis: For the analysis of the physical properties of Minos elements insertion sites, we used the software that was made for the relative analysis for the P element (Liao G. et al, 2000). Seventy base pairs flanking upstream and downstream the TA target of Minos for eighty insertion sites were aligned and average values for the GC content, DNA bendability, A-philicity, B-DNA twist, Protein induced deformability were put in excell program in order to obtain the relative figures. The values were measured as previously described (Gorin A. et al, 1995, <BR> <BR> Ivanov V. I. et al, 1995, Brukner I. et al, 1995 and Olson W. , K. et al, 1998). The H- bond view analysis was performed as previously described (Liao G. et al, 2000). The profiles were compared to eighty randomly taken sequences from Drosophila melanogaster genome which were centered in a TA dinucleotide. All calculations were done using a three base-pair sliding window.

For the determination of the consensus sequence of Minos 10bp base pairs upstream and downstream of the TA insertion site were analysed with a Seqlogo analysis software (Vigdal T. J. , 2002).

Results of these computer analyses are shown in Figures 4 and 5. Figure 4 shows SeqLogo analysis while Figure 5 shows HbondView analysis.

These analyses of the sequences flanking Minos gave another unexpected result: Apart from the absolute requirement for the target TA sequence (a common feature of all Tcl/mariner transposable elements) the preferred Minos insertion sites do not have any other apparent sequence or structural requirements. This is not the case with P, or with the Tcl-related element Sleeping Beauty, for which similar analyses are available in the literature. Furthermore, PiggyBac transposon, which is being used more recently for large scale mutagenesis in Drosophila, has an absolute requirement for a target tetranucleotide (TTAA) for integration and there are no data about any possible additional sequence preferences in the flanking DNA.

This result suggests that, at least in Drosophila, Minos insertions should have a more random distribution compared to P element.

B) TRANSPOSON INSERTION IN MICE Materials and methods Plasmid construction The construction of the modified Minos transposon pMiCMVGFP was used for the generation of transgenic mice. In short, a 2.2 kb fragment, containing a humanised GFP gene driven by a CMV promoter and followed by an intervening sequence and an SV40 poly A signal, was positioned between Minos inverted repeats. A lox P site was included in front of the left inverted repeat for the generation of single copy transgenic animals if needed.

The Minos transposase cDNA was cloned as a 1 kb ClaI/NotI fragment in the vector Pev3 (Clare Gooding, Biotechnology Dept, Zeneca, Macclesfield, UK; Pev3 is further described in Needham et al, Nucl. Acids Res. , 20,997-1003, 1992) A 3.8 kb ClaI/

Asp718 fragment from the resulting plasmid (containing the Minos transposase cDNA followed by an intron and a polyadenylation signal from the human P globin gene) was cloned in pBluescript SK + (Stratagene, La Jolla, Ca, USA) creating the plasmid pBlue/ILMi/3 ß. A 6.5 kb blunt Asp718 fragment from plasmid ZP3/6. 5Luc (Lira, S. et al (1990) Proc. Natl. Acad. Sci. USA 87,7215-7219.) containing the 5'flanking region and promoter of the zona pellucida 3 (ZP3) gene was cloned into the EcoRV site of pBlue/ILMi/3 resulting in plasmid ZP3/ILMi, which was used for the generation of transgenic mice expressing the transposase in developing eggs.

Generation of transgenic mice To generate Minos transposase expressing lines, a 10.3 kb SmaI/Asp718 fragment was excised from pZP3/ILMi, separated from plasmid sequences by gel electrophoresis (Sambrook, J et al. Molecular Cloning. A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY (1989) ), purified and concentrated using an ELUTIP-d column (Schleicher & Schuell GmbH, Dassel, Germany) and injected into fertilised oocytes (FVBxFVB) at a concentration of 4 ng/pl. Injected eggs were transferred into pseudopregnant mice and transgenic offspring was identified by Southern blot analysis of tail DNA (Southern, E. M. (1975). J. Mol. Biol 98, 503-517).

The transposon carrying (MCG) line was generated as described in Zagoraiou, L et al (2001) Proc. Natl. Acad. Sci. USA 98,11474-11478).

RT-PCR For RT-PCR analysis, total RNA was isolated from different organs of ZP3/ILMi transgenic mice using the Ultraspec RNA isolation system (Biotech Laboratories, Houston, TX, USA). From 1 ug of total RNA, cDNA was synthesised in a 20 pl reaction using Reverse Transcriptase (Super RT; HT Biotechnology, Cambridge, UK) and oligo (dT) primer. PCR reactions were performed in a volume of 50 ul PCR buffer (Life Technologies, Paisley, UK) containing 1 gel of the cDNA from the RT reaction, 1.5 mM MgCl2, 100 ng of each primer, 0.2 mM dNTPs and 2. 5 U Taq DNA polymerase (Pharmacia). A total number of 25 cycles were performed with

denaturation at 94° C for 45 seconds, annealing at 55° C for 30 seconds and extension at 72° C for 45 seconds. PCR products were visualised by electrophoresis on a 2% agarose gel. The Minos transposase specific primers Minosl : 5'- CAGCTTCGAAATGAGCCAC-3'and beta EX: 5'-TGGACAGCAAGAAAGCGAG- 3'were used. Primers specific for murine hypoxanthine phosphoribosyltransferase (HPRT) were: 5'CACAGGACTAGAACACCTGC-3'and 5'- GCTGGTGAAAAGGACCTCT-3'.

Breeding program Transposon carrying (MCG) females were bred with ZP3/ILMi line 15 males. Double positive females obtained from these crosses were bred with wild type (WT) males and their offspring analysed by Southern blot analysis for possible transposition events.

Genomic DNA was digested either with EcoRV or Bgm, separated on a 0.7 or 1% agarose gel (Sigma, Steinheim, Germany), blotted onto a nylon membrane (Hybond- N+, Amersham Pharmacia, Buckinghamshire England) and probed with a 32 P labelled 737 bp SacIlNotI GFP fragment from pMiCMVGFP.

DNA Fluorescent in Situ Hybridisation (FISH) analysis Mouse metaphase spreads were prepared according to routine procedures from peripheral white blood cells (Mulder, M. P et al. (1995). Hum Genet 96 (2): 133-141).

The 737-bp SacllNotI GFP fragment from the pMiCMVGFP construct was used as a probe. The probe was either labelled with biotin (Boehringer Mannheim) and immunochemically detected directly with FITC or a tyramide based step was included to improve signal detection (Raap, A. K. et al (1995) Human Molecular Genetics 4, 529-534). The DNA was counterstained with DAPI.

Cloning of the insertion sites Mouse DNA from animals with a new Minos insertion site was cut with EcoRV or BglII and resolved in a 0.7% agarose gel The gel regions containing transposition events were cut out and the DNA was isolated. Depending on the fragment size,

inverse PCR was performed either directly on self-ligated fragments using Minos primers IMiol (5'AAGAGAATAAAATTCTCTTTGAGACG 3') for the first PCR and IMio2 (5'GATAATATAGTGTGTTAAACATTGCGC 3') for the nested PCR <BR> <BR> (Klinakis, A. G. , Zagoraiou, L., Vassilatis, D. K & Savakis, C. (2000) EMBO Reports<BR> 11, 416-421. ), or the obtained EcoRV or BgIII fragments were further digested with AluI and then circularised. Inverse PCR was performed with Minos primers IMiol and IMiil (5'CAAAAATATGAGTAATTTATTCAAACGG3'), followed by nested PCR with primers IMio2 and IMii2 (5'GCTTAAGAGATAAGAAAAAAGTGACC 3') as <BR> <BR> previously described (Klinakis, A. G. , Zagoraiou, L. , Vassilatis, D. K & Savakis, C.

(2000) EMBO Reports 11,416-421). In this way, left and right flanks were amplified separately. The PCR fragments were either sequenced directly or after cloning into the pGEM T easy vector (Promega), or PCRII vector (lhvitrogen). With the sequences obtained, a BLAST search was performed against the mouse genome sequences available at the time in the Celera (www. celera. com) database.

Results The transposon carrying transgenic mouse line (MCG) was generated. It contains 6 copies of Minos transposon MiCMVGFP integrated in mouse chromosome 14. To investigate the structure of the insertions in the mouse genome, we cloned the flanking regions (as described in Materials and Methods) from five different transposition events. As is observed in Drosophila, the Minos ends were flanked by the diagnostic TA dinucleotide followed by sequences unrelated to the sequence that flanks the element in the founder mouse line MCG (Figure 6).

BLAST searches with the obtained sequences in the Celera mouse genome database showed that all five of the novel flanking sequences (in one case only one flanking sequence was obtained) correspond to widely scattered genomic locations (Figure 6).

Out of five transposition events analysed only one was on chromosome 14. It is a single copy of the transposon integrated into a centromeric region without the presence of a transposon concatamer on tip of chromosome 14. Thus this transposition event occurred into a different chromosome. 3 out of 4 sites are inside a gene

(Cpeb (mCT15486) ), or a predicted gene (mCT15093, mCT49930). This demonstrates that Minos preferentially inserts into genes when used in mouse mutation analysis.

References Brand AH, Perrimon N. (1993). Targeted gene expression as a means of altering cell fates and generating dominant phenotypes. Development. 1993 Jun; 118 (2) : 401-15.

Cooley L, Kelley R, Spradling A. (1988). Insertional mutagenesis of the Drosophila genome with single P elements. Science. 1988 Mar 4 ; 239 (4844): 1121-8. Review.

Holmes D. , S. and Bonner J. (1973). Preparation, molecular weight, base composition, and secondary structure of giant nuclear ribonucleic acid. Biochemistry Jun 5 ; 12 (12): 2330-8.

Horn, C, Jaunich, B, Wimmer, E. , A. (2000). Highly sensitive, fluorescent transformation marker for Drosophila transgenesis. Dev Genes Evol.

Dec ; 210 (12): 623-9 Klinakis, A. , G. , Loukeris, T. , G. , Pavlopoulos, A. and Savakis, C. (2000a). Mobility assays confirm the broad host range activity of the Minos transposable element and validate new transformation tools. Insect Mol. Biol., 9,269-275.

Laski FA, Rio DC, Rubin GM. (1986). Tissue specificity of Drosophila P element transposition is regulated at the level of mRNA splicing. Cell. 1986 Jan 17 ; 44 (1) : 7-19.

Liao GC, Rehm EJ, Rubin GM (2000). Insertion site preferences of the P transposable element in Drosophila melanogaster. Proc Natl Acad Sci U S A. Mar 28; 97 (7): 3347- 51.

Loukeris, T. , G., Arca, B. , Livadaras, I., Dialektaki, G. and Savakis, C. (1995a).

Introduction of the transposable element Minos into the germ line of Drosophila melanogaster. Proc. Natl Acad. Sci. USA, 92,9485-9489.

Loukeris, T. , G. , Livadaras, I., Arca, B. , Zabalou, S. and Savakis, C. (1995b). Gene transfer into the medfly, Ceratitis capitata, with a Drosophila hydei transposable element. Science, 270,2002-2005.

Pirrotta, V. (1986). Cloning Drosophila genes. In Drosophila, a practical approach.

(ed. D. B. Roberts), pp. 83-110. IRL Press, Oxford.

Rubin, G. , M. , Spradling, A. , C. (1982). Genetic transformation of Drosophila with transposable element vectors. Science. 218 (4570): 348-53.

Seifert, H. , S. , Chen E., Y. , So M. , and Heffrom F. (1986). Shuttle mutagenesis: A method of transposon mutagenesis for Saccharomyces cerevisiae. Proc. Natl. Acad.

Sci. USA 83: 735-739. <BR> <BR> <P>Vigdal T. J., Kaufinan C. D., Izvak Z. , Voytas D. F. and Ivics Z. (2002). Common physical properties of DNA affecting target site selection of Sleeping Beauty and other Tcl/mariner transposable elements. J. Mol. Biol. 323: 441-452 All publications mentioned in the above specification are herein incorporated by reference. Various modifications and variations of the described methods and system of the invention will be apparent to those skilled in the art without departing from the scope and spirit of the invention. Although the invention has been described in connection with specific preferred embodiments, it should be understood that the invention as claimed should not be unduly limited to such specific embodiments.

Indeed, various modifications of the described modes for carrying out the invention which are apparent to those skilled in molecular biology or related fields are intended to be within the scope of the following claims.