SHAHNAZ BEGUM (KR)
MD HOSSAIN JAMIL (KR)
MIN HYUN SU (KR)
LIM YU NA (KR)
US20160193140A1 | 2016-07-07 |
YOSHIDA YUZO; SOMA TSUTOMU; KISHIMOTO JIRO: "Characterization of human dermal sheath cells reveals CD36-expressing perivascular cells associated with capillary blood vessel formation in hair follicles", BIOCHEMICAL AND BIOPHYSICAL RESEARCH COMMUNICATIONS, vol. 516, no. 3, 2 July 2019 (2019-07-02), Amsterdam NL , pages 945 - 950, XP085743363, ISSN: 0006-291X, DOI: 10.1016/j.bbrc.2019.06.146
AKSENENKO MARIYA, PALKINA NADEZHDA, KOMINA ANNA, RUKSHA TATIANA: "MiR-92a-1-5p and miR-328-3p Are Up-Regulated in Skin of Female Pattern Hair Loss Patients", ANNALS OF DERMATOLOGY, vol. 31, no. 2, 1 January 2019 (2019-01-01), KR , pages 256 - 259, XP055946602, ISSN: 1013-9087, DOI: 10.5021/ad.2019.31.2.256
KOH HAN SEOK, JANG HANNAH, TAE SOOKIL, LEE MI-SUN, MIN JAE-WOONG, MUN HUI JIN, LEE JI NA, LEE HYO JIN, KIM DAE HOON, CHO HYUN-JEON: "Reducing miR485-3p ameliorates Alzheimer`s disease pathology by regulation of amyloid beta and neuro-inflammation", RESEARCH SQUARE, 26 March 2020 (2020-03-26), pages 1 - 56, XP055897461, DOI: 10.21203/rs.3.rs-19583/v1
WHAT IS CLAIMED IS: 1. A method of inducing hair growth in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 2. A method of increasing the hair density in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 3. A method of increasing the follicular density in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 4. A method of increasing the hair shaft thickness in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 5. A method of increasing the hair length in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 6. A method for preventing hair loss in a subject at risk of hair loss comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 7. A method for reducing hair loss in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 8. A method of upregulating CD36 protein in a dermal sheath of hair follicle in a subject in need thereof comprising administering to the subject a compound that inhibits miR-485 ("miRNA inhibitor"). 9. The method of any one of claims 1 to 8, wherein the subject has one or more disorders selected from the group consisting of alopecia greata, androgenic alopecia, alopecia areata, alopecia universalis, involutional alopecia, trichotillomania, telogen effluvium, anagen effluvium, cicatricial, alopecia, scarring alopecia, scalp thinning, hair shaft abnormalities, infectious hair disorders, genetic disorders, and hair loss due to chemotherapy, hormonal imbalance, fungal infection, medication intake, chemical hair treatment, or aging. 10. The method any one of claims 1 to 8, wherein the subject is a human. 11. The method of any one of claims 1 to 10, wherein the miRNA inhibitor induces autophagy and/or treats or prevents inflammation. 12. The method of any one of claims 1 to 11, wherein the miRNA inhibitor induces phagocytosis. 13. The method of any one of claims 1 to 12, wherein the miRNA inhibitor inhibits miR485- 3p. 14. The method of claim 13, wherein the miR485-3p comprises 5'-gucauacacggcucuccucucu- 3' (SEQ ID NO: 1). 15. The method of any one of claims 1 to 14, wherein the miRNA inhibitor comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the miRNA inhibitor comprises about 6 to about 30 nucleotides in length. 16. The method of any one of claims 1 to 15, wherein the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence. 17. The method of any one of claims 1 to 16, wherein the miRNA inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. 18. The method of any one of claims 1 to 13 and 16 to 17, wherein the miRNA inhibitor has a sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'- GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'-CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'-AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'-AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'- GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'-AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC- 3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), or 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29). 19. The method of any one of claims 1 to 13 and 16 to 17, wherein the miRNA inhibitor has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 30), 5'- GTGTATGA-3' (SEQ ID NO: 51), 5'-CGTGTATGA-3' (SEQ ID NO: 52), 5'-CCGTGTATGA-3' (SEQ ID NO: 53), 5'-GCCGTGTATGA-3' (SEQ ID NO: 54), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 55), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 35), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 56), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 57), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 58), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 59), 5'- GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 60), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 61), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 62); 5'-TGTATGAC-3' (SEQ ID NO: 63), 5'-GTGTATGAC-3' (SEQ ID NO: 64), 5'-CGTGTATGAC-3' (SEQ ID NO: 65), 5'-CCGTGTATGAC-3' (SEQ ID NO: 66), 5'-GCCGTGTATGAC-3' (SEQ ID NO: 67), 5'- AGCCGTGTATGAC-3' (SEQ ID NO: 68), 5'-GAGCCGTGTATGAC-3' (SEQ ID NO: 69), 5'- AGAGCCGTGTATGAC-3' (SEQ ID NO: 70), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 71), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 72), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 73), 5'-GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 74), 5'- AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 75), and 5'- GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 76). 20. The method of any one of claims 1 to 18, wherein the sequence of the miRNA inhibitor is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). 21. The method of claim 19, wherein the miRNA inhibitor has a sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). 22. The method of any one of claims 1 to 20, wherein the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77) with one substitution or two substitutions. 23. The method of any one of claims 1 to 21, wherein the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). 24. The method of claim 23, wherein the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28). 25. The method of any one of claims 1 to 22, wherein the miRNA inhibitor comprises at least one modified nucleotide. 26. The method of claim 25, wherein the at least one modified nucleotide is a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA). 27. The method of any one of claims 1 to 26, wherein the miRNA inhibitor comprises a backbone modification. 28. The method of claim 27, wherein the backbone modification is a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. 29. The method of any one of claims 1 to 28, wherein the miRNA inhibitor is delivered in a delivery agent. 30. The method of claim 29, wherein the delivery agent is a micelle, an exosome, a lipid nanoparticle, an extracellular vesicle, or a synthetic vesicle. 31. The method of any one of claims 1 to 30, wherein the miRNA inhibitor is delivered by a viral vector. 32. The method of claim 31, wherein the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus. 33. The method of claim 32, wherein the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof. 34. The method of any one claims 1 to 33, wherein the miRNA inhibitor is delivered with a delivery agent. 35. The method of claim 34, wherein the delivery agent comprises a micelle, an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a conjugate, a viral vector, or combinations thereof. 36. The method of claim 34 or 35, wherein the delivery agent comprises a cationic carrier unit comprising: [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle. 37. The method of claim 36, wherein the miRNA inhibitor interacts with the cationic carrier unit via an ionic bond. 38. The method of claim 36 or 37, wherein the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(α- hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof. 39. The method of any one of claims 36 to 38, wherein the water-soluble polymer comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). 40. The method of any one of claims 36 to 39, wherein the water-soluble polymer comprises: wherein n is 1-1000. 41. The method of claim 40, wherein the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. 42. The method of claim 40, wherein the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160. 43. The method of any one of claims 36 to 42, wherein the water-soluble polymer is linear, branched, or dendritic. 44. The method of any one of claims 36 to 43, wherein the cationic carrier moiety comprises one or more basic amino acids. 45. The method of claim 44, wherein the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids. 46. The method of claim 45, wherein the cationic carrier moiety comprises about 30 to about 50 basic amino acids. 47. The method of claim 45 or 46, wherein the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. 48. The method of any one of claims 36 to 47, wherein the cationic carrier moiety comprises about 40 lysine monomers. 49. The method of any one of claims 36 to 48, wherein the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment. 50. The method of any one of claims 36 to 49 wherein the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof. 51. The method of claim 50, wherein the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10. 52. The method of claim 50, wherein the adjuvant moiety comprises nitroimidazole. 53. The method of claim 50, wherein the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. 54. The method of any one of claims 36 to 50, wherein the adjuvant moiety comprises an amino acid. 55. The method of claim 54, wherein the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH. 56. The method of any one of claims 36 to 50, wherein the adjuvant moiety comprises a vitamin. 57. The method of claim 56, wherein the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group. 58. The method of claim 57, wherein the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2. 59. The method of any one of claims 56 to 58, wherein the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. 60. The method of any one of claims 56 to 59, wherein the vitamin is vitamin B3. 61. The method of any one of claims 56 to 60, wherein the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3. 62. The method of claim 61, wherein the adjuvant moiety comprises about 10 vitamin B3. 63. The method of any one of claims 56 to 62, wherein the delivery agent comprises about a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. 64. The method of any one of claims 56 to 63, wherein the delivery agent is associated with the miRNA inhibitor, thereby forming a micelle. 65. The method of claim 64, wherein the association is a covalent bond, a non-covalent bond, or an ionic bond. 66. The method of claim 64 or 65, wherein the cationic carrier unit and the miRNA inhibitor in the micelle is mixed in a solution so that the ionic ratio of the positive charges of the cationic carrier unit and the negative charges of the miRNA inhibitor is about 1: 1. 67. The method of any one of claims 64 to 66, wherein the cationic carrier unit is capable of protecting the miRNA inhibitor from enzymatic degradation. 68. The method of any one of claims 1 to 67, wherein the miRNA inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, topically, or any combination thereof. 69. The method of any one of claims 1 to 68, wherein the miRNA inhibitor is administered to a skin area where promoting hair growth is needed by spread, spray, steam, or injection. 70. The method of any one of claims 1 to 68, wherein the miRNA inhibitor is administered topically to a skin area where promoting hair growth is needed. 71. The method any one of claims 1 to 68, wherein the miRNA inhibitor is formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse. 72. The method of any one of claims 1 to 68, wherein the administering step is performed by soaking or bathing the subject in the miRNA inhibitor formulated in a form selected from the group consisting of an ointment, a shampoo, a conditioner, a lotion, a tonic, a gel, and a mousse. |
[0195] As used herein, the term "PGC1-α" includes any variants or isoforms of PGC1-α which are naturally expressed by cells. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 1. In some aspects, a miR- 485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 1. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 2. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 3. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 4. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 5. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 6. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 7. In some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 8. Accordingly, in some aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 9. In further aspects, a miR-485 inhibitor disclosed herein can increase the expression of PGC1-α isoform 1, isoform 2, isoform 3, isoform 4, isoform 5, isoform 6, isoform 7, isoform 8, and isoform 9. Unless indicated otherwise, both isoform 1 and isoform 2 are collectively referred to herein as "PGC1-α." [0196] In some aspects, contacting a cell with a miR-485 inhibitor increases the expression and/or activity of PGC1-α protein and/or PGC1-α gene in the cell by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 60-fold, at least about 70-fold, at least about 80-fold, at least about 90-fold, or at least about 100-fold or more, compared to the expression and/or activity in a reference cell (e.g., corresponding cell that has not been contacted with the miR-485 inhibitor). [0197] Not to be bound by any one theory, in some aspects, a miR-485 inhibitor disclosed herein increases the expression of PGC1-α protein and/or PGC1-α gene by reducing the expression and/or activity of miR-485, e.g., miR-485-3p. III. miRNA-485 Inhibitors Useful for the Present Disclosure [0198] Disclosed herein are compounds that can inhibit miR-485 activity (miR-485 inhibitor). In some aspects, a miR-485 inhibitor of the present disclosure comprises a nucleotide sequence encoding or comprising a nucleotide molecule that comprises at least one miR-485 binding site, wherein the nucleotide molecule does not encode a protein. As described herein, in some aspects, the miR-485 binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485), such that the miR-485 inhibitor hybridizes to the miR-485 nucleic acid sequence. [0199] In some aspects, the miR-485 binding site of a miR inhibitor disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485, e.g., miR- 485-3p. In certain aspects, the miR-485 binding site is fully complementary to the nucleic acid sequence of a miR-485, e.g., miR-485-3p. [0200] The miR-485 hairpin precursor can generate both miR-485-5p and miR-485-3p. In the context of the present disclosure "miR-485" encompasses both miR-485-5p and miR-485- 3p unless specified otherwise. The human mature miR-485-3p has the sequence 5'- GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1; miRBase Acc. No. MIMAT0002176). A 5' terminal subsequence of miR-485-3p 5'-UCAUACA-3' (SEQ ID NO: 49) is the seed sequence. The human mature miR-485-5p has the sequence 5'- AGAGGCUGGCCGUGAUGAAUUC-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0002175). A 5' terminal subsequence of miR-485-5p 5'-GAGGCUG-3' (SEQ ID NO: 50) is the seed sequence. [0201] As will be apparent to those in the art, the human mature miR-485-3p has significant sequence similarity to that of other species. For instance, the mouse mature miR- 485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A" at the 5'-end and missing "C" at the 3'-end). The mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; underlined portion corresponds to overlap to human mature miR-485-3p). The sequence for the mouse mature miR-485-5p is identical to that of the human: 5'-agaggcuggccgugaugaauuc-3' (SEQ ID NO: 33; miRBase Acc. No. MIMAT0003128). In certain aspects, a miR-485 inhibitor disclosed herein is capable of binding to miR-485-3p and/or miR-485-5p from both human and mouse. [0202] In some aspects, the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-3p (or a subsequence thereof). In some aspects, the miR-485-3p subsequence comprises the seed sequence. Accordingly, in certain aspects, the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49. In certain aspects, the miR-485 binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. In further aspects, the miR-485 binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1. [0203] In some aspects, the miR-485 binding site is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a miR-485-5p (or a subsequence thereof). In some aspects, the miR-485-5p subsequence comprises the seed sequence. In certain aspects, the miR-485 binding site has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 50. In certain aspects, the miR-485 binding site is complementary to miR-485-5p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. [0204] The seed region of a miRNA forms a tight duplex with the target mRNA. Most miRNAs imperfectly base-pair with the 3' untranslated region (UTR) of target mRNAs, and the 5' proximal "seed" region of miRNAs provides most of the pairing specificity. Without being bound to any theory, it is believed that the first nine miRNA nucleotides (encompassing the seed sequence) provide greater specificity whereas the miRNA ribonucleotides 3' of this region allow for lower sequence specificity and thus tolerate a higher degree of mismatched base pairing, with positions 2-7 being the most important. Accordingly, in specific aspects of the present disclosure, the miR-485 binding site comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of miR-485. [0205] miRNA sequences and miRNA binding sequences (inhibitors) that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs. Any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name are contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA sequence or complementary sequence thereof. [0206] In some aspects, miRNA binding sequences of the present disclosure can include additional nucleotides at the 5′, 3′, or both 5′ and 3′ ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to miR-485. In some aspects, miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequences in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to miR-485. [0207] It is also specifically contemplated that any methods and compositions discussed herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules. It is also understood that the disclosures related to RNA sequences in the present disclosure are equally applicable to corresponding DNA sequences. [0208] In some aspects, a miRNA-485 inhibitor of the present disclosure comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence. In some aspects, a miRNA-485 inhibitor comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. [0209] In some aspects, a miR-485 inhibitor disclosed herein is about 6 to about 30 nucleotides in length. In certain aspects, a miR-485 inhibitor disclosed herein is 7 nucleotides in length. In further aspects, a miR-485 inhibitor disclosed herein is 8 nucleotides in length. In some aspects, a miR-485 inhibitor is 9 nucleotides in length. In some aspects, a miR-485 inhibitor of the present disclosure is 10 nucleotides in length. In certain aspects, a miR-485 inhibitor is 11 nucleotides in length. In further aspects, a miR-485 inhibitor is 12 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 13 nucleotides in length. In certain aspects, a miR-485 inhibitor disclosed herein is 14 nucleotides in length. In some aspects, a miR-485 inhibitor disclosed herein is 15 nucleotides in length. In further aspects, a miR-485 inhibitor is 16 nucleotides in length. In certain aspects, a miR-485 inhibitor of the present disclosure is 17 nucleotides in length. In some aspects, a miR-485 inhibitor is 18 nucleotides in length. In some aspects, a miR-485 inhibitor is 19 nucleotides in length. In certain aspects, a miR-485 inhibitor is 20 nucleotides in length. In further aspects, a miR-485 inhibitor of the present disclosure is 21 nucleotides in length. In some aspects, a miR-485 inhibitor is 22 nucleotides in length. [0210] In some aspects, a miR-485 inhibitor disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30. In certain aspects, a miR-485 inhibitor comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. [0211] In some aspects, a miRNA inhibitor comprises 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), or 5'- GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15). [0212] In some aspects, the miRNA inhibitor has 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), or 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29). [0213] In some aspects, the miRNA inhibitor has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 30), 5'-GTGTATGA-3' (SEQ ID NO: 51), 5'- CGTGTATGA-3' (SEQ ID NO: 52), 5'-CCGTGTATGA-3' (SEQ ID NO: 53), 5'- GCCGTGTATGA-3' (SEQ ID NO: 54), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 55), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 35), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 56), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 57), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 58), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 59), 5'- GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 60), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 61), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 62); 5'- TGTATGAC-3' (SEQ ID NO: 63), 5'-GTGTATGAC-3' (SEQ ID NO: 64), 5'- CGTGTATGAC-3' (SEQ ID NO: 65), 5'-CCGTGTATGAC-3' (SEQ ID NO: 66), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 67), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 68), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 69), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 70), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 71), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 72), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 73), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 74), 5'-AGAGGAGAGCCGTGTATGAC- 3' (SEQ ID NO: 75), and 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 76). [0214] In some aspects, a miRNA inhibitor disclosed herein (i.e., miR-485 inhibitor) comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In some aspects, the miRNA inhibitor comprises a nucleotide sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In some aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77) with one substitution or two substitutions. In certain aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 77). In certain aspects, the miRNA inhibitor comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28). [0215] In some aspects, a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and at least one, at least two, at least three, at least four or at least five additional nucleic acids at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acids at the C terminus, or both. In some aspects, a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus. In some aspects, a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus. In some aspects, a miR-485 inhibitor of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus. In some aspects, a miR-485 inhibitor comprises 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29). [0216] In some aspects, a miR-485 inhibitor of the present disclosure comprises one miR- 485 binding site. In further aspects, a miR-485 inhibitor disclosed herein comprises at least two miR-485 binding sites. In certain aspects, a miR-485 inhibitor comprises three miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises four miR-485 binding sites. In some aspects, a miR-485 inhibitor comprises five miR-485 binding sites. In certain aspects, a miR-485 inhibitor comprises six or more miR-485 binding sites. In some aspects, all the miR- 485 binding sites are identical. In some aspects, all the miR-485 binding sites are different. In some aspects, at least one of the miR-485 binding sites is different. In some aspects, all the miR-485 binding sites are miR-485-3p binding sites. In other aspects, all the miR-485 binding sites are miR-485-5p binding sites. In further aspects, a miR-485 inhibitor comprises at least one miR-485-3p binding site and at least one miR-485-5p binding site. III.a. Chemically Modified Polynucleotides [0217] In some aspects, a miR-485 inhibitor disclosed herein comprises a polynucleotide which includes at least one chemically modified nucleoside and/or nucleotide. When the polynucleotides of the present disclosure are chemically modified the polynucleotides can be referred to as "modified polynucleotides." [0218] A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A "nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. [0219] Polynucleotides can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the polynucleotides would comprise regions of nucleotides. [0220] The modified polynucleotides disclosed herein can comprise various distinct modifications. In some aspects, the modified polynucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some aspects, a modified polynucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified polynucleotide. [0221] In some aspects, a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) is chemically modified. As used herein, in reference to a polynucleotide, the terms "chemical modification" or, as appropriate, "chemically modified" refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof. [0222] In some aspects, a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation In further aspects, the polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) can have a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire polynucleotide (such as all uridines and/or all cytidines, etc. are modified in the same way). [0223] Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non-standard base structures. One example of such non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker can be incorporated into polynucleotides of the present disclosure. [0224] The skilled artisan will appreciate that, except where otherwise noted, polynucleotide sequences set forth in the instant application will recite "T"s in a representative DNA sequence but where the sequence represents RNA, the "T"s would be substituted for "U"s. For example, TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units. [0225] In some aspects, the polynucleotide (e.g., a miR-485 inhibitor) includes a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases. [0226] In some aspects, the nucleobases, sugar, backbone linkages, or any combination thereof in a polynucleotide are modified by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100%. (i) Base Modification [0227] In certain aspects, the chemical modification is at nucleobases in a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor). In some aspects, the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (ψ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g, 1- methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2-methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl-guanosine (m1G)), or a combination thereof. [0228] In some aspects, the polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, a polynucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the polynucleotide sequence are replaced with 5-methyl-cytidine (m5C). Similarly, a polynucleotide can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above. [0229] In some aspects, the polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) includes a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases. In some aspects, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of a type of nucleobases in a polynucleotide of the present disclosure (e.g., a miR-485 inhibitor) are modified nucleobases. (ii) Backbone modifications [0230] In some aspects, the polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can include any useful linkage between the nucleosides. Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O-N(CH 3 )-CH 2 -, -CH 2 -N(CH 3 )-N(CH 3 )-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH 3 )-CH 2 - CH 2 -, oligonucleosides with heteroatom internucleoside linkage, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioates, phosphotriesters, PNA, siloxane backbones, sulfamate backbones, sulfide sulfoxide and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters, and thionophosphoramidates.
[0231] In some aspects, the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of a polynucleotide of the present disclosure (i.e., miR- 485 inhibitor). [0232] In some aspects, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% of the backbone linkages in a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) are modified (e.g., all of them are phosphorothioate). [0233] In some aspects, a backbone modification that can be included in a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) comprises phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. (iii) Sugar modifications [0234] The modified nucleosides and nucleotides which can be incorporated into a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can be modified on the sugar of the nucleic acid. In some aspects, the sugar modification increases the affinity of the binding of a miR-485 inhibitor to a miR-485 nucleic acid sequence. Incorporating affinity- enhancing nucleotide analogues in the miR-485 inhibitor, such as LNA or 2'-substituted sugars, can allow the length and/or the size of the miR-485 inhibitor to be reduced. [0235] In some aspects, at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or about 100% of the nucleotides in a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) contain sugar modifications (e.g., LNA). [0236] In some aspects, at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotide units in a polynucleotide of the present disclosure are sugar modified (e.g., LNA). [0237] Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α-L-threofuranosyl-(3′→2′)) , and peptide nucleic acid (PNA, where 2-amino-ethyl- glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, a polynucleotide molecule can include nucleotides containing, e.g., arabinose, as the sugar. [0238] The 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl-C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); "locked" nucleic acids (LNA) in which the 2′-hydroxyl is connected by a C 1-6 alkylene or C 1-6 heteroalkylene bridge to the 4'-carbon of the same ribose sugar, where exemplary bridges include methylene, propylene, ether, amino bridges, aminoalkyl, aminoalkoxy, amino, and amino acid. [0239] In some aspects, nucleotide analogues present in a polynucleotide of the present disclosure (i.e., mir-485 inhibitor) comprise, e.g., 2'-O-alkyl-RNA units, 2'-OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof. In some aspects, the LNA is, e.g., oxy-LNA (such as beta- D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino-LNA or alpha-L- amino-LNA), thio-LNA (such as beta-D-thio0-LNA or alpha-L-thio-LNA), ENA (such a beta-D-ENA or alpha-L-ENA), or any combination thereof. In further aspects, nucleotide analogues that can be included in a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA). [0240] In some aspects, a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can comprise both modified RNA nucleotide analogues (e.g., LNA) and DNA units. In some aspects, a miR-485 inhibitor is a gapmer. See, e.g., U.S. Pat. Nos. 8,404,649; 8,580,756; 8,163,708; 9,034,837; all of which are herein incorporated by reference in their entireties. In some aspects, a miR-485 inhibitor is a micromir. See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety. [0241] In some aspects, a polynucleotide of the present disclosure (i.e., miR-485 inhibitor) can include modifications to prevent rapid degradation by endo- and exo-nucleases. Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. IV. Vectors and Delivery Systems [0242] In some aspects, the miR-485 inhibitors of the present disclosure can be administered, e.g., to a subject at risk of hair loss, using any relevant delivery system known in the art. In certain aspects, the delivery system is a vector. Accordingly, in some aspects, the present disclosure provides a vector comprising a miR-485 inhibitor of the present disclosure. [0243] In some aspects, the vector is a viral vector. In some aspects, the viral vector is an adenoviral vector or an adenoassociated viral vector. In certain aspects, the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof. In some aspects, the adenoviral vector is a third generation adenoviral vector. ADEASY™ is by far the most popular method for creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI. This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASY™. PADEASY™ is a ∼33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production. The shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled PADEASY™ and the shuttle vector, but this method results in a higher background of non- recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs. 293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later. In addition to this method, other methods for creating adenoviral vector constructs known in the art at the time the present application was filed can be used to practice the methods disclosed herein. [0244] In some aspects, the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector). Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include the transfer vector plasmid (portions of the HIV provirus), the packaging plasmid or construct, and a plasmid with the heterologous envelop gene (env) of a different virus. The three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell. The virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system. Current third generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of a replication-competent virus. In fourth generation lentiviral vectors, the retroviral genome has been further reduced (see, e.g., TAKARA® LENTI-X™ fourth-generation packaging systems). [0245] Any AAV vector known in the art can be used in the methods disclosed herein. The AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof. In some aspects, the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, bovine AAV, shrimp AVV, snake AVV, and any combination thereof. [0246] In some aspects, the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof. [0247] In some aspects, the AAV vector is a chimeric vector derived from at least two AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof. [0248] In certain aspects, the AAV vector comprises regions of at least two different AAV vectors known in the art. [0249] In some aspects, the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, or any derivative thereof). [0250] In some aspects, the AVV vector comprises a portion of an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AVV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AVV9, AVV10, AVV11, AVV12, AVV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AVV, primate AAV, non-primate AAV, ovine AAV, shrimp AVV, snake AVV, and any combination thereof. In some aspects, the AAV vector comprises AAV2. [0251] In some aspects, the AVV vector comprises a splice acceptor site. In some aspects, the AVV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure. In some aspects, the promoter is an RNA Pol III promoter. In some aspects, the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof. In some aspects, the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EF1a promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter. In a specific aspect, the promoter comprises the U6 promoter. [0252] In some aspects, the AAV vector comprises a constitutively active promoter (constitutive promoter). In some aspects, the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus. [0253] In some aspects, the promoter is an inducible promoter. In some aspects, the inducible promoter is a tissue specific promoter. In certain aspects, the tissue specific promoter drives transcription of the coding region of the AVV vector in a neuron, a glial cell, or in both a neuron and a glial cell. [0254] In some aspects, the AVV vector comprises one or more enhancers. In some aspects, the one or more enhancer is present in the AAV alone or together with a promoter disclosed herein. In some aspects, the AAV vector comprises a 3'UTR poly(A) tail sequence. In some aspects, the 3'UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'UTR poly(A) tail sequence comprises bGH poly(A). [0255] In some aspects, a miR-485 inhibitor disclosed herein is administered with a delivery agent. Non-limiting examples of delivery agents that can be used include an exosome, a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, a viral vector, or a conjugate. [0256] Thus, in some aspects, the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) and a delivery agent. In some aspects, the delivery agent comprises a carrier unit, e.g., that can self- assemble into micelles or be incorporated into micelles. In some aspects, the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged (i.e., cationic) carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle. Accordingly, in some aspects, the miRNA inhibitor and the cationic carrier unit are capable of associating with each other (e.g., via a covalent bond or a non-valent bond) to form a micelle when mixed together. [0257] In some aspects, composition comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) interacts with the cationic carrier unit via an ionic bond. [0258] In some aspects, the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof. In some aspects, the water-soluble polymer comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). In some aspects, the water-soluble polymer comprises: (formula III), wherein n is 1-1000. [0259] In some aspects, the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some aspects, the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160. [0260] In some aspects, the water-soluble polymer is linear, branched, or dendritic. In some aspects, the cationic carrier moiety comprises one or more basic amino acids. In some aspects, the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 40 lysine monomers. [0261] In some aspects, the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment. In some aspects, the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof. In some aspects, the adjuvant moiety comprises: (formula IV), wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10. [0262] In some aspects, the adjuvant moiety comprises nitroimidazole. In some aspects, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. In some aspects, the adjuvant moiety comprises an amino acid. [0263] In some aspects, the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH. [0264] In some aspects, the adjuvant moiety comprises a vitamin. In some aspects, the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group. In some aspects, the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2. [0265] In some aspects, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some aspects, the vitamin is vitamin B3. [0266] In some aspects, the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3. [0267] In some aspects, the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. [0268] In some aspects, the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3). In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer. In some aspects, the thiol groups in the composition form disulfide bonds. [0269] In some aspects, the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miR485 inhibitor (e.g., SEQ ID NO: 28), wherein the miR485 inhibitor is encapsulated within the micelle. In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units. In some aspects, the thiol groups in the micelle form disulfide bonds. [0270] The present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other. [0271] In some aspects, the association is a covalent bond, a non-covalent bond, or an ionic bond. In some aspects, the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1. [0272] In some aspects, the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See PCT Publication No. WO2020/261227, which is herein incorporated by reference in its entirety. V. Pharmaceutical compositions [0273] In some aspects, the present disclosure also provides pharmaceutical compositions comprising a miR-485 inhibitor disclosed herein (e.g., a polynucleotide or a vector comprising the miR-485 inhibitor) that are suitable for administration to a subject. The pharmaceutical compositions generally comprise a miR-485 inhibitor described herein (e.g., a polynucleotide or a vector) and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject. Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. [0274] Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a miR-485 inhibitor of the present disclosure. (See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. VI. Kits [0275] The present disclosure also provides kits or products of manufacture, comprising a miRNA inhibitor of the present disclosure (e.g., a polynucleotide, vector, or pharmaceutical composition disclosed herein) and optionally instructions for use, e.g., instructions for use according to the methods disclosed herein. In some aspects, the kit or product of manufacture comprises a miR-485 inhibitor (e.g., vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) in one or more containers. In some aspects, the kit or product of manufacture comprises miR-485 inhibitor (e.g., a vector, e.g., an AAV vector, a polynucleotide, or a pharmaceutical composition of the present disclosure) and a brochure. One skilled in the art will readily recognize that miR-485 inhibitors disclosed herein (e.g., vectors, polynucleotides, and pharmaceutical compositions of the present disclosure, or combinations thereof) can be readily incorporated into one of the established kit formats which are well known in the art. [0276] The following examples are offered by way of illustration and not by way of limitation. Examples Example 1: Preparation of miR-485 inhibitor [0277] (a) Synthesis of alkyne modified tyrosine: An alkyne modified tyrosine was generated as an intermediate for the synthesis of a tissue specific targeting moiety (TM, see FIG. 1) of a cationic carrier unit to direct micelles of the present disclosure to the LAT1 transporter in the BBB. [0278] A mixture of N-(tert-butoxycarbonyl)-L-tyrosine methyl ester (Boc-Tyr-OMe) (0.5g, 1.69 mmol) and K 2 CO 3 (1.5 equiv., 2.54 mmol) in acetonitrile (4.0 ml) was added drop by drop to propargyl bromide (1.2 equiv., 2.03 mmol). The reaction mixture was heated at 60 °C overnight. After the reaction, the reaction mixture was extracted using water:ethyl acetate (EA). Then, the organic layer was washed using a brine solution. The crude material was purified by flash column (EA in hexane 10%). Next, the resulting product was dissolved in 1,4-dioxane (1.0 ml) and 6.0 M HCl (1.0 ml). The reaction mixture was heated at 100 °C overnight. Next, the dioxane was removed and extracted by EA. Aqueous NaOH (0.5 M) solution was added to the mixture until the pH value become 7. The reactant was concentrated by evaporator and centrifuged at 12,000 rpm at 0°C. The precipitate was washed with deionized water and lyophilized. [0279] (b) Synthesis of poly(ethylene glycol)-b-poly(L-lysine) (PEG-PLL): This synthesis step generated the water-soluble biopolymer (WP) and cationic carrier (CC) of a cationic carrier unit of the present disclosure (see FIG.1). [0280] Poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring opening polymerization of Lys(TFA)-NCA with monomethoxy PEG (MeO-PEG) as a macroinitiator. In brief, MeO-PEG (600 mg, 0.12 mmol) and Lys(TFA)-NCA (2574 mg, 9.6 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP). Lys(TFA)-NCA solution was dropped into the MeO-PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days. The reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether. Then it was filtered and white powder was obtained after drying in vacuo. For the deprotection of TFA group in PEG-PLL(TFA), the next step was followed. [0281] MeO-PEG-PLL(TFA) (500 mg) was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of PEG-PLL was obtained after lyophilization. [0282] (b) Synthesis of azido-poly(ethylene glycol)-b-poly(L-lysine) (N 3 -PEG-PLL): This synthesis step generated the water-soluble biopolymer (WP) and cationic carrier (CC) of a cationic carrier unit of the present disclosure (see FIG.1). [0283] Azido-poly(ethylene glycol)-b-poly(L-lysine) was synthesized by ring opening polymerization of Lys(TFA)-NCA with azido- PEG (N 3 -PEG). In brief, N 3 -PEG (300 mg, 0.06 mmol) and Lys(TFA)-NCA (1287 mg, 4.8 mmol) were separately dissolved in DMF containing 1M thiourea and DMF(or NMP). Lys(TFA)-NCA solution was dropped into the N 3 -PEG solution by micro syringe and the reaction mixture was stirred at 37 °C for 4 days. The reaction bottles were purged with argon and vacuum. All reactions were conducted in argon atmosphere. After the reaction, the mixture was precipitated into an excess amount of diethyl ether. The precipitate was re-dissolved in methanol and precipitated again into cold diethyl ether. Then it was filtered and white powder was obtained after drying in vacuo. For the deprotection of TFA group in PEG-PLL(TFA), the next step was followed. [0284] N 3 -PEG-PLL (500 mg) was dissolved in methanol (60 mL) and 1N NaOH (6 mL) was dropped into the polymer solution with stirring. The mixture was maintained for 1 day with stirring at 37°C. The reaction mixture was dialyzed against 10 mM HEPES for 4 times and distilled water. White powder of N 3 -PEG-PLL was obtained after lyophilization. [0285] (c) Synthesis of (methoxy or) azido-poly(ethylene glycol)-b-poly(L- lysine/nicotinamide/mercaptopropanamide) (N 3 -PEG-PLL(Nic/SH)): In this step, the tissue-specific adjuvant moieties (AM, see FIG. 1) were attached to the WP-CC component of a cationic carrier unit of the present disclosure. The tissue-specific adjuvant moiety (AM) used in the cationic carrier unit was nicotinamide (vitamin B3). This step would yield the WP-CC-AM components of the cationic carrier unit depicted in FIG.1. [0286] Azido-poly(ethylene glycol)-b-poly(L-lysine/nicotinamide/mercaptopropanamide) (N 3 -PEG-PLL(Nic/SH)) was synthesized by chemical modification of N 3 -PEG-PLL and nicotinic acid in the presence of EDC/NHS. N 3 -PEG-PLL (372 mg, 25.8 μmol) and nicotinic acid (556.7 mg, 1.02 equiv. to NH2 of PEG-PLL) were separately dissolved in mixture of deionized water and methanol (1:1). EDC•HCl (556.7 mg, 1.5 equiv. to NH 2 of N 3 -PEG-PLL) was added into nicotinic acid solution and NHS (334.2 mg, 1.5 equiv. to NH2 of PEG-PLL) stepwise added into the mixture. [0287] The reaction mixture was added into the N 3 -PEG-PLL solution. The reaction mixture was maintained at 37 °C for 16 hours with stirring. After 16 hours, 3,3’- dithiodiproponic acid (36.8 mg, 0.1 equiv.) was dissolved in methanol, EDC•HCl (40.3 mg, 0.15 equiv.), and NHS (24.2 mg, 0.15 equiv.) were dissolved each in deionized water. Then, NHS and EDC•HCl were added sequentially into 3,3’-dithiodiproponic acid solution. The mixture solution was stirred for 4 hours at 37 °C after adding crude N 3 -PEG-PLL(Nic) solution. [0288] For purification, the mixture was dialyzed against methanol for 2 hours, added DL- dithiothreitol (DTT, 40.6 mg, 0.15 equiv.), then activated for 30 min. [0289] For removing the DTT, the mixture was dialyzed sequentially methanol, 50 % methanol in deionized water, deionized water [0290] (d) Synthesis of Phenyl alanine-poly(ethylene glycol)-b-poly(L- lysine/nicotinamide/mercaptopropanamide) (Phe-PEG-PLL(Nic/SH)): In this step, the tissue-specific targeting moiety (TM) was attached to the WP-CC-AM component synthesized in the previous step. The TM component (phenyl alanine) was generated by reaction of the intermediate generated in step (a) with the product of step (c). [0291] To target brain endothelial tissue in blood vessels, as a LAT1 targeting amino acid, phenyl alanine was introduced by click reaction between N 3 -PEG-PLL(Nic/SH) and alkyne modified tyrosine in the presence of copper catalyst. In brief, N 3 -PEG-PLL(Nic/SH) (130 mg, 6.5 µmol) and alkyne modified phenyl alanine (5.7 mg, 4.0 equiv.) were dissolved in deionized water (or 50 mM sodium phosphate buffer). Then, CuSO4•H2O (0.4 mg, 25 mol%) and Tris(3-hydroxypropyltriazolylmethyl)amine (THPTA, 3.4 mg, 1.2 equiv.) were dissolved deionized water and added N 3 -PEG-PLL(Nic/SH) solution. Then, sodium ascorbate (3.2 mg, 2.5 equiv.) were added into the mixture solution. The reaction mixture was maintained with stirring for 16 hours at room temperature. After the reaction, the mixture was transferred into dialysis membranes (MWCO = 7,000) and dialyzed against deionized water for 1 day. The final product was obtained after lyophilization. [0292] (e) Polyion Complex (PIC) micelle preparation - Once the cationic carrier units of the present disclosure were generated as described above, micelles were produced. The micelles described in the present example comprised cationic carrier units combined with an antisense oligonucleotide payload. [0293] Nano sized PIC micelles were prepared by mixing MeO- or Phe-PEG-PLL(Nic) and miRNA. PEG-PLL(Nic) was dissolved in HEPES buffer (10 mM) at 0.5 mg/mL concentration. Then a miRNA solution (22.5 μM) in RNAase free water was mixed with the polymer solution at 2:1 (v/v) ratio of miRNA inhibitor (SEQ ID NO: 28) (485 ASO-001) to polymer. [0294] The mixing ratio of polymer to anti-miRNA was determined by optimizing micelle forming conditions, i.e., ratio between amine in polymer (carrier of the present disclosure) to phosphate in anti-miRNA (payload). The mixture of polymer (carrier) and anti- miRNA (payload) was vigorously mixed for 90 seconds by multi-vortex at 3000 rpm, and kept at room temperature for 30 min to stabilize the micelles. [0295] Micelles (10 μM of Anti-miRNA concentration) were stored at 4 ºC prior to use. MeO- or Phe- micelles were prepared using the same method, and different amounts of Phe- containing micelles (25% ~75%) were also prepared by mixing both polymers during micelle preparation. Example 2: Materials and Methods [0296] Unless provided otherwise, the Examples described below use one or more of the following materials and methods: Assay for in vivo hair growth in C57BL/6J mice [0297] C57BL/6J mice were obtained from DBL Co. Ltd. animal laboratory at 6 weeks of age and allowed to adapt to their new environment for one week. To observe the synchronized telogen phase, hair was removed from each mouse by using electric clipper and were shaved dorsally by depilatory cream in telogen. Intramuscular (IM) injection of vehicle control (PBS), unless otherwise indicated or twice on (PD PD0 and PD7) Intramuscular (IM) injection of miR-485 inhibitor-485 ASO-001 (0.3 mpk and 0.6 mpk). Appearance of skin pigmentation and hair growth were monitored and documented by digital photomicrograph, with the experimenter(s) being blind to the treatment conditions. Progression was also assigned a value from 0 to 6 based on pigmentation levels and hair shaft density, with 0 indicating no hair growth (and no pigmentation) and higher number corresponding to darker skin and larger areas of dense hair growth. Scoring was done blindly. Images representing different scores are presented in hair regrowth quantification scale (0-6), where grade 0= skin pink, no pigmentation; grade 1= <30% skin area showing the darkening, but no visible hair; grade 2= 30%-70% skin area showing the darkening, no visible hair; grade 3= >70% skin area showing the darkening, or 30% hair visible; grade 4= >70% skin area showing the darkening, and 30% -70% hair visible; grade 5= >70% skin area showing the darkening, and >70% hair visible; and grade 6= >90% skin area showing darkening, >90% and hair visible. Tissue staining, measurement of histological structure of skin and hair follicle [0298] The dorsal skin of all the groups was fixed in 4% PFA on PD10 and PD16 and assessed with hematoxylin and eosin (H&E) staining. The number of HFs were counted (cross-section) in dermis and subcutis. Thickness of dermis and subcutis was taken from the visible microscopic field (3 fields) with at-least 7 measurements. The length of hair follicle and diameter of hair bulb were measured from longitudinal and transverse section of dorsal skin by analyzing the images by Motic images plus 2.0 ML. Real time PCR [0299] Total RNA was isolated using the Isolation of small and large RNA kit (Macherey Nagel, Dren). The concentration of the collected RNA was measured with a nucleic acid quantification system (Nanodrop. Thermo Scientific Inc.). cDNA was synthesized using miScript II RT Kit (Qiagen, Hilden, Germany). For analysis the expression of miR-485-3p was performed by TaqMan miRNA analysis using TOPREAL™ qPCR 2X PreMIX (Enzynomics, Korea) on CFX connect system (Bio-Rad). The real-time PCR measurement of individual cDNAs was performed using Taq man probe to measure duplex DNA formation with the Bio-Rad real-time PCR system. Primers were as follows: [0300] Probe:FAM-CGAGGTCGACTTCCTAGA-NFQ.miR-4853p forward:5′CATACACGGCTCTCCTCTCTAAA-3′. The relative gene expression was analyzed by the 2 −ΔΔC T. Western blotting [0301] Skin samples were harvested and on day 10 and 16 post depilation. Mouse skin tissue lysate was prepared by homogenization in ice-cold RIPA buffer (iNtRON Biotechnology) containing protease/phosphatase inhibitor cocktail (Cell Signaling Technology, Cat#5872). Tissue debris was removed by centrifugation at 13,000 rpm for 15 min at 4 °C, and supernatants were collected. Lysate was boiled for 5 min in 1 x SDS (Fisher Scientific) loading buffer containing 5% β-mercaptoethanol (Fisher Scientific). Samples were then subjected to SDS–PAGE on PAGE 8%, 12% Bis-Tris gels (Invitrogen) in MOPS SDS Running Buffer (Invitrogen) and transferred to PVDF membranes and incubated with the following primary antibodies: rabbit anti-CD36 (Abcam, Cat# ab80080, 1:1000), rabbit anti- VEGF-A (Abcam, Cat# ab51745, 1:1000), rabbit anti-Wnt3a (IBL,Cat#11088, 1:1000), rabbit anti-β-actin (Abcam, Cat#ab1997, 1:100), anti-actin (Santa Cruz, Cat#sc-47778). The results were visualized using an enhanced chemiluminescence system, and quantified by densitometric analysis (Image J software, NIH). All experiments were performed independently at least three times. Immunofluorescent staining [0302] C57BL/6J mice skin tissue was embedded in a frozen tissue-embedding agent (OTC Compound, Sakura Finetek Japan Co., Ltd.), and frozen section slides were prepared with a frozen section production system (Cryostat, Leica Camera AG). After fixing for 15 minutes with 4% PFA, the tissue was washed with PBS and allowed to react for 1 hour using a blocking solution obtained by adding 5% skim milk, 1% donkey serum and 0.1% TritonX- 100 to PBS. Next, the tissue was allowed to react for 1 hour at room temperature or overnight at 4°C using primary antibody solution obtained by diluting CD36 antibody solution (Invitrogen Cat# PA1-16813) 50-fold, with the blocking solution. After washing 3 time with PBS, the tissue was allowed to react for 1 hour at room temperature using a secondary antibody solution obtained by diluting FITC-labeled anti-mouse IgG antibody (Invitrogen Corp.) 200-fold each with blocking solution. After reacting with DAPI solution, the tissue was washed 3 times with PBS and sealed with an anti-fade reagent (Prolong Gold Antifade Reagent) and a cover glass. The tissue was observed using a fluorescence microscope (Olympus Corp.). Example 3. Analysis of Dose Dependent Hair Growth Promotion Effect of miR-485 Inhibitor [0303] To begin evaluating the hair regrowth effect of the miR-485 inhibitor (485 ASO- 001) (prepared as shown in Example 1) on depilated mice, six-week-old C57BL/6J mice were purchased and allowed to adapt to their new environment for one week. To observe the synchronized telogen phase, hair was removed from each mouse by using depilatory cream. Animals were then divided into five groups (n = 6) to evaluate the hair regrowth effect of the miR-485 inhibitor (485 ASO-001). Negative control (PBS) and 485 ASO-001 (0.1 mpk, 0.3 mpk, and 0.6 mpk) were administered by a one-time intramuscular injection. The digital photographs of mice were taken post-depilation (pd.) on days 5 (FIG. 2A), 7 (FIG. 2B), 9 (FIG.2C), 12 (FIG.2D), 14 (FIG.2E), and 16 (FIG.2F) after treatment, and the hair growth area was analyzed via morphological observation by a score of 0-6 (FIG.2G). [0304] As shown in FIG. 2G, there was a significant increase observed in hair growth score on days 7 and 12 in 485 ASO-001 (0.3 mpk and 0.6 mpk) treated mice groups compared to the PBS-treated control group. Furthermore, 485 ASO-001 (0.6 mpk) treated mice group showed more hair regrowth compared to 485 ASO-001 (0.1 mpk and 0.3 mpk) treated mice groups (FIG.2G). [0305] Furthermore, C57BL/6J Mice were divided into five groups (n = 5) to evaluate the hair regrowth effect of the miR-485 inhibitor (485 ASO-001). Negative control (PBS), and positive control (2% Minoxidil), and 485 ASO-001 (0.3 mpk, and 0.6 mpk) were administered by twice (PD0 and PD7) intramuscular injection. The digital photographs of mice were taken post-depilation (pd.) on days 5 (FIG. 4D), 7 (FIG. 4E), 10 (FIG. 4F), 12 (FIG. 4G), 14 (FIG. 4H), and 16 (FIG. 4I) after treatment, and the hair growth area was analyzed via morphological observation by a score of 0-6 (FIG. 4J). There was a significant increase observed in hair growth score on days 7, 10, 12, 14, and 16 in 485 ASO-001 two times repeat intramuscular injection (0.3 mpk and 0.6 mpk) treated mice groups as compared to the PBS-treated control group and positive control Minoxidil treatment group (FIG. 4J). Furthermore, 485 ASO-001 (0.6 mpk-twice) treated mice group showed more hair regrowth compared to 485 ASO-001 (0.3 mpk-twice) treated mice group (FIG.4J). [0306] The above results demonstrate the dose-dependent efficacy of the miR-485 inhibitor (485 ASO-001) in inducing hair growth. For example, results showed that the miR- 485 inhibitor (485 ASO-001) enhanced early indication of anagen hair growth in telegenic mice (see e.g., Figures 4D-4J). In particular, miR-485 inhibitor (485 ASO-001) (0.6 mpk- twice) treated mice group showed strongly activated and maintain anagen hair growth (Figures 4D-4J) as compared to PBS-treated control group and Minoxidil treatment group. These results suggest that miR-485 inhibitor (485 ASO-001), activated the transition from telogen to anagen phase, and therefore promoted hair growth. Example 4: Analysis of Dose Dependent Effect of miR-485 Inhibitor on Hair Density [0307] To further assess the hair regrowth effect of the miR-485 inhibitor (485 ASO- 001) prepared as shown in Example 1 on depilated mice treated with PBS and 485 ASO-001, as described in Example 1, the hair density after treatment with 485 ASO-001 (0.1 mpk, 0.3 mpk, 0.6 mpk) was compared to the PBS-treated control group. Dermoscopic images of each mouse were acquired in the same region (3.6 mm 2 ) of interscapular skin on days 12 (FIG. 3A) and 16 (FIG. 3B) using Kong, Bom-Viewer Plus software (Bomtech Electronics Co., Ltd., Seoul, Korea). Hair density was evaluated by analyzing the images (x200 magnification; actual area, 3.6 mm 2 ). [0308] As shown in FIG.3C, there was a significant increase observed in the hair density on days 12 and 16 in 485 ASO-001 (0.6 mpk) treated mice groups compared to the PBS- treated control group. 485 ASO-001 (0.6 mpk) treated mice group showed increased hair density compared to 485 ASO-001 (0.1 mpk) and 485 ASO-001 (0.3 mpk) treated mice groups. [0309] The above results demonstrate the dose-dependent efficacy of the miR-485 inhibitor (485 ASO-001) in increasing the hair density. Example 5: Analysis of Dose Dependent Effect of miR-485 Inhibitor on Hair Length [0310] To further assess the hair regrowth effect of the miR-485 inhibitor (485 ASO-001) as prepared in Example 1 on depilated mice treated with PBS and 485 ASO-001, as described in Example 1, the hair length after treatment with 485 ASO-001 (0.1 mpk, 0.3 mpk, 0.6 mpk) was compared to the PBS-treated control group. After treatment hairs were plucked from representative areas in the depilated dorsal interscapular region of the back at days 16 (FIG. 4A) and 21 (FIG.4B) and the average hair length from 30 hairs per mouse was calculated. [0311] As shown in FIG. 4C, there was a significant increase observed in the hair length on day 16 in 485 ASO-001 (0.3 mpk and 0.6 mpk) treated mice groups compared to the PBS- treated control group. [0312] The above results demonstrate the dose-dependent efficacy of the miR-485 inhibitor (485 ASO-001) in increasing the hair length. Example 6: Expression of miR‐485‐3p During Skin Development and Hair Follicle Cycling [0313] To test the effect of miR-485 inhibitor (485 ASO-001) on the miR‐485‐3p (FW7_mimic) expression level, tissue samples were obtained pd10 (FIG.5A) and pd16 (FIG. 5B) of the murine hair cycle from an early anagen to the late anagen. miRNA expressions were decreased during the late anagen growth phase of the adult hair cycle, as compared with early anagen. There was a significant decreased of miRNA expressions observed miR-485 inhibitor (485 ASO-001) (0.6 mpk-twice) treated mice group on pd10 (p=0.01) and pd16 (p=0.03) as compared to (485 ASO-001) (0.3 mpk-twice) and PBS-treated control groups. The above results demonstrate the dose-dependent down regulation of expression of miR‐ 485‐3p by the miR-485 inhibitor (485 ASO-001). Example 7: Assessment of Dose Dependent Effect of miR-485 Inhibitor on Skin and Hair Follicle Density [0314] The effect of miR-485 inhibitor (485 ASO-001) (0.3 mpk and 0.6 mpk) on hair growth was further assessed by H&E staining (FIG. 6A, FIG. 6B, FIG. 7A, FIG. 7B). There was a significant increase observed in the dermis (p=0.03) (FIG. 6C), subcutis (p=0.0001) (FIG.6D), hair follicle diameter (p=0.001) (FIG.6E), hair bulb diameter (p=0.01) (FIG.6F), hair follicle density in dermis (p<0.0009) (FIG. 6G), and hair follicle density in subcutis (p<0.0009) (FIG.6H) on day 10 pd. There was a significant increase observed in the subcutis (p=0.0003) (FIG. 7C), hair follicle diameter (p=0.008) (FIG. 7F), hair follicle density in dermis (p<0.0001) (FIG. 7G), and hair follicle density in subcutis (p<0.0001) (FIG. 7H) in 485 ASO-001 (0.6 mpk-twice) treated mice groups compared to the PBS-treated control treated group. 485 ASO-001 (0.6 mpk) treated mice group showed increased number of hair follicle in subcutis (p<0.001) (FIG.6H) on day 10 pd and on day 16 pd increased number of hair follicle in dermis (p=0.004) (FIG. 7G) compared to minoxidil-treated mice groups. Treatment with miR-485 inhibitor (485 ASO-001) (0.3 mpk and 0.6 mpk) (p < 0.001) increased the hair follicle number in a dose-dependent manner compared to control (Figure FIG.6G, FIG.6H, FIG.7G, FIG.7H). Even though, minoxidil treatment also significantly (p < 0.01) increased the hair follicle number as compared to the negative control, this increase was lower than that with miR-485 inhibitor (485 ASO-001) (0.6 mpk) treatment (Figure FIG. 6G, FIG. 6H). miR-485 inhibitor (485 ASO-001) (0.6 mpk) and minoxidil treatments significantly increased thickness of dermis (p < 0.03 and p < 0.04) as compared to the control group, but the minoxidil treatment increase in dermis and subcutis thickness was lower than that with miR-485 inhibitor (485 ASO-001) (0.6 mpk) (p < 0.001) treatment (Figure FIG.6C, FIG. 6D). miR-485 inhibitor (485 ASO-001) (0.6 mpk) treatment significantly increased diameter of hair bulb (p < 0.01) compared to the control and minoxidil treatments group on day 10 pd. On day 16 pd, the treatment with miR-485 inhibitor (485 ASO-001) (0.3 mpk and 0.6 mpk) (p < 0.001 and 0.0003) increased the thickness of subcutis in a dose-dependent manner compared to control. Example 8: miR-485 Inhibitor Increased the Wnt and β-catenin Protein Expression [0315] The effect of miR-485 inhibitor (485 ASO-001) on Wnt3a and β-catenin protein expression was assessed by Western blotting. The Wnt/β-catenin signaling is specifically involved in hair follicle morphogenesis, regeneration, and growth. Wnt3a induces hair growth due to the ability to activate the Wnt/β-catenin signaling pathway in dermal papilla (DP) cells. β-catenin is expressed in the dermal papilla and promotes anagen induction and duration, as well as keratinocyte regulation and differentiation. miR-485 inhibitor (485 ASO- 001) (0.6 mpk) up regulated the expression of Wnt3a (FIG. 9B) and β-catenin (FIG. 9C). β- Catenin, which has been implicated in skin and hair follicle development, is an essential molecule in the Wnt signaling pathway. The above results demonstrate that miR-485 inhibitor (485 ASO-001) (0.6 mpk) significantly promotes the elongation of the hair shafts and the differentiation. Example 9: miR-485 Inhibitor Increased CD36 and VEGF-A Protein Expression [0316] The effect of miR-485 inhibitor-485 ASO-001 on CD36 and vascular endothelial growth factor-A (VEGF-A) protein expression was assessed by Western blotting. Treatment with miR-485 inhibitor-485 ASO-001 (0.6 mpk) up regulated the protein expression level of CD36 (FIG. 8B) and VEGF-A (FIG. 8C) in compared to the PBS control group. VEGF-A is the most potent and specific vascular growth factor and a key regulator in physiological and pathological angiogenesis (blood capillary formation). VEGF-A levels are regulated through transcriptional control and mRNA stability. [0317] Mesenchyme of the murine pelage follicle is comprised of a follicle-lining smooth muscle known as the dermal sheath (DS). DS modulates blood capillaries in hair follicles in association with hair cycling. An immunofluorescence experiment was conducted to assess the effect of miR-485 inhibitor (485 ASO-001) (0.6 mpk) on the expression of CD36 in DS affected angiogenesis. Immunofluorescence results (FIG.10B) showed that CD36 expressing cells increase in DS in miR-485 inhibitor (485 ASO-001) treated hair follicles. This can be associated with angiogenesis, particularly at anagen hair follicles. *** [0318] It is to be appreciated that the Detailed Description section, and not the Summary and Abstract sections, is intended to be used to interpret the claims. The Summary and Abstract sections can set forth one or more but not all exemplary aspects of the present disclosure as contemplated by the inventor(s), and thus, are not intended to limit the present disclosure and the appended claims in any way. [0319] The present disclosure has been described above with the aid of functional building blocks illustrating the implementation of specified functions and relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternate boundaries can be defined so long as the specified functions and relationships thereof are appropriately performed. [0320] The foregoing description of the specific aspects will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific aspects, without undue experimentation, without departing from the general concept of the present disclosure. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed aspects, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance. [0321] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects, but should be defined only in accordance with the following claims and their equivalents. [0322] The contents of all cited references (including literature references, patents, patent applications, and websites) that can be cited throughout this application are hereby expressly incorporated by reference in their entirety for any purpose, as are the references cited therein.