WO2008136730A1 | 2008-11-13 | |||
WO2011138310A2 | 2011-11-10 | |||
WO2011138310A2 | 2011-11-10 |
EP1405641A2 | 2004-04-07 | |||
US8053223B2 | 2011-11-08 | |||
JPS6222558B2 | 1987-05-19 | |||
KR830001681A | 1983-05-18 | |||
KR20100125747A | 2010-12-01 | |||
EP1135020A2 | 2001-09-26 |
MUDRONOVA DAGMAR ET AL: "Lactobacillus sp as a potential probiotic for the prevention of Paenibacillus larvae infection in honey bees", JOURNAL OF APICULTURAL RESEARCH, INTERNATIONAL BEE RESEARCH ASSOCIATION, CARDIFF, GB, vol. 50, no. 4, 1 January 2011 (2011-01-01), pages 323 - 324, XP009162786, ISSN: 0021-8839
DATABASE WPI Week 201138, Derwent World Patents Index; AN 2010-Q50453, XP002724595
EVANS JAY D ET AL: "Bacterial Probiotics induce an immune response in the honey bee (Hymenoptera: Apidae)", JOURNAL OF ECONOMIC ENTOMOLOGY, vol. 97, no. 3, June 2004 (2004-06-01), pages 752 - 756, XP003023503, ISSN: 0022-0493
ALEJANDRA VÁSQUEZ ET AL: "Symbionts as Major Modulators of Insect Health: Lactic Acid Bacteria and Honeybees", PLOS ONE, vol. 7, no. 3, 1 January 2012 (2012-01-01), pages e33188, XP055039097, ISSN: 1932-6203, DOI: 10.1371/journal.pone.0033188
KIMOTO-NIRA HIROMI ET AL: "Survival of a Lactococcus lactis strain varies with its carbohydrate preference under in vitro conditions simulated gastrointestinal tract.", INTERNATIONAL JOURNAL OF FOOD MICROBIOLOGY 15 OCT 2010, vol. 143, no. 3, 15 October 2010 (2010-10-15), pages 226 - 229, XP027376894, ISSN: 1879-3460
LHB KANGA ET AL., JOURNAL OF INVERTEBRATE PATHOLOGY, vol. 81, 2002, pages 175 - 184
MARTIN-HERNANDEZ R. ET AL.: "Outcome of colonization of Apis mellifera by Nosema ceranae", APPL ENVIRON MICROBIOL, vol. 73, 2007, pages 633 - 8
N. APIS; N. CERANAE, JOURNAL OF INVERTEBRATE PATHOLOGY, vol. 103, pages 53 - 58
BLANCHARD ET AL.: "Evaluation of a real-time two- step RT -PCR assay for quantitation of Chronic bee paralysis virus ( CBPV ) genomic in experimentally -infected bee tissues and in life stages of a symptomatic colony", JOURNAL OF VIROLOGICAL METHODS, vol. 141, 2007, pages 7 - 13, XP005896659, DOI: doi:10.1016/j.jviromet.2006.11.021
RIBIERE ET AL.: "Molecular diagnosis of chronic bee paralysis virus infection", APIDOLOGIE, vol. 33, 2002, pages 339 - 351
CLAIMS 1. A composition for the use in the biological control of the wellness of the bees, the prophylaxis and the treatment of pathological disorders of various etiology of the bees, characterized in that it comprises an association of microorganisms comprising: Lactobacillus paracasei ssp. , Bifidobacterium bifidum, Lactobacillus acidophilus, Lactococcus lactis, Bifidobacterium animalis, Lactobacillus thermophilus, Bacillus clausii in 5% sucrose solution. 2. Composition of microorganisms in 5% sucrose solution according to claim 1 wherein each bacterial strain is initially present in variable amount between 12 to 16% of the total volume, preferably each bacterial strain is present on account of 14% of the total volume. 3. Composition of microorganisms according to claim 1 and 2 for the use in the treatment of viral infection of bees caused by chronic bee paralysis virus or CBPV. 4. Composition of microorganisms according to claim 1 and 2 for the use in the treatment of infection caused by Nosema ceranae. 5. Method for the biological control of the wellness of the bees, for the prophylaxis and treatment of pathological disorders of various etiology of the bees, characterized by the fact of using the association of microorganisms of claim 1 and 2 by dispensing it inside the hive. 6. Method for the treatment of viral infection of bees caused by the chronic bee paralysis virus or CBPV, characterized in that it uses the association of microorganisms of claim 1 and 2 by dispensing it inside the hive. 7. Method for the treatment of infection caused by Nosema ceranae, characterized in that it uses the association of microorganisms of claim 1 and 2 by dispensing it inside the hive. 8. Method according to claims 5 and 6 characterized in that the dispensing takes place by applying the composition directly on each hive frame, after opening the roof of the hive without extracting the hive frame itself, wetting bees and broods therein, preferably the composition is sprayed also on the hatch door of the hive such that to wet the surface being crossed by bees . |
DESCRIPTION
Scope and Motivation
In its most general aspect, the present invention is about the area of the compositions and methods for the biological control of the state of health of the bees in a hive and the prevention of the most common diseases of the bees and various etiological origins, for example , bacteria, fungus, viruses, protozoics and parasites that infest the colony of bees and the hive. The compositions and the methods, according to the present invention are useful for the care-taking of the health of the bees and for the prophylaxis of pathologies due to infestations of the ecto parasitas bee Varroa destructor (varroamite disease ), and relative conditions, such as viruses, nosema, American foulbrood, European foulbrood and fungus.
Technical Note Over the past decade various health problems have occurred in the beekeeping sector in various countries around the world . Particularly in the past few years, there have been an increased mortality of bees. This has increased the concern in the sector for the important environmental and economic consequences.
The health of the bees depends on many factors, such as protection from different kinds of diseases ( bacterial, viral, parasitic , etc. ..) , the availability of an adequate treatment , the presence of invasive species and environmental changes.
People interested in Beekeeping both amateurs and professionals , have come across at least once in their experience , the Varroa . Unfortunately every year most of the Beehives are infested. So its regularly necessary to take preventive or therapeutic measures, to cope with an un coopable problem .
The cause of the disease known as varroa or varroamite disease is Varroa destructor , a tiny dust-mite that feeds it self on the bee's hemolinpha, by piercing and sucking through the cuticle . Varroa determines an action that depauperates the resources of the insect , but what even more serious is, the transmission of other viral diseases through the wounds , its exactly this the cause of the great number of mortality within the hive, infesting with diseases such as Virus that Deforme Wings or the Virus of the Chronic Paralysis ( CBPV ).
Bees with heavy infestation of Varroa are condemned to death , because they become vulnerable to other diseases. A large infestation of these mites leads the bee colony to death , this usually happenes between late autumn and early spring . The parasite , not only weaken the adult bees , but also attacks the larvae , causing birth of wingless or deformed bees. The varroa mite is the main cause of the economic impact on the beekeeping industry . It's impossible eUminating completely the mites, but a series of preventive measures and treatments allow you to contain mortality and avoid risky losses.
The syndrome caused by the parasitic varroa , and the eventual diseases are endemic in all hives where this parasite is present it does not allow any efficacy on the cure to take place , its difficult to eradicate the insects from every single family, because of the fast phenomenon of re-infestation .
Add to the varroa and the cronical infection of bee paralysis virus (CBPV) , endemic in most of the apiaries , the virus multiplies in the tissues of bees, causing two types of syndromes. In the first type of syndrom, the bee gets an abnormal shiver of the wings and the body. Unable to fly they often crawl on the ground or on the stems of plants. The wings are partially spread or dislocated. The effected bees could be present in large numbers in the hive, where they tend to mix up together on the top or on the top bars of the hive. They may have a swelling abdomen due to distension of the bladder melaria .
Bees suffering from the second type of syndrome caused by CBPV are able to fly, but their body becomes almost completely hairless. They appear dark or black and look smaller . They, too, have a relatively large abdomen . A few days after the infection, they beginto shiver and stop flying then they die shortly after.
Both syndromes may occur in the same colony, but usually one type predominates . The CBPV may be the final cause of the collapse of the colonies, as a result of the illness of the adult bees , all the same there's no known effective treatments against this type of infection .
Another pathology related with the bees and varroa is Nosemiasi , it's due to two different species of unicellular fungus ( microsporidia ) : Nosema apis and Nosema ceranae . The bees become infected through oral feeding of spores of Nosema . The latter, when in the intestine, invade the cells of the mucous and multiply until it destroys the cells causing a malabsorption phenomena . The infected bee will eUminate the spores in the feces making it possible to transmit the disease to other bees through direct contact or through feeding with nectar , pollen, honey , or other infectious materials. While N. apis causes gastroenteritis, characterized by forms of diarrhea , easily recognizable by the beekeeper .
N. ceranae is a pathogen which was recently isolated on Apis mellifera, causer of a disease characterized by a long latency period where the only symptom is of beehives , also, hardly recognizable by beekeepers , It is identifiable only with a slow and gradual depopulation ofthe bee families, where the birth of new beees aren't enough to compensate for the number of adult bees that die .
At present one of the methods of treatment for the control of diseases of the hives, is the using of chemical and biological methods.
The Chemical methods ,widely used, are those creating major risks to human health , to the environment and also causes major damages to other insects and animals that are not under treatment .
Among the synthetic chemicals commonly used " there are the Pyrethroids ( Fluvalinate ) and organophosphates ( Coumaphons ) . Both , effective only with block breeding , there is also a great problem of the contamination of the wax and honey; therefore there is a tendency to prefer using chemical formulations of natural origins based on:
• oxalic acid- dripped , sprayed or vaporized ;
• formic acid- evaporated ;
• lactic acid- sprayed ,
• essential oils- such as thymol . As another disadvantage of chemical control against pathogens hive, the use of biopesticides, and in particular the entomopathogenic fungus have been introduced . In Europe, preparations of Bacillus thuringiensis are used against the larvae of Galleria mellonella , also called Moth honey .
Some kinds of entomopathogenic fungus , among which Beauveria bassiana have a characteristic that can infect the Varroa mite and therefore are used for the biological control of the parasite hive. The American patent U.S. 8,053,223 has an innovative formula based on a pure culture of a new stump , identified and isolated for the first time , from the fungus Beauveria bassiana which , in addition to a vehicle usable in agriculture , and particularly useful in pest control of Vanoa destructor.
Other species of pathogenic fungi such as Hirsutella thompsonii Fisher and Metarhizium anisopliae can act as agents of a biological control of Varroa mite , in fact, it's been demonstrated to be an efficacious solution on the density of mites in honebee colonies ( LHB Kanga et al. 2002 Journal of Invertebrate Pathology , 81, 175-184 ) .
Recently the use of microorganisms has been introduced in beekeeping . These microorganisms , or in particular a variety of microorganisms, has been made able to exert a beneficial effect in agriculture and in the breeding of animals ,also to clean up natural environments and to increase the immune defense of human beings and also in beekeeping .
The Japanese patent JP62022558 describes a method to help the metabolism of bees, promote physiological activation and further oviposition of the queen bee, and the growth of the bee larva, obtained by mixing a product of acid fermentation of grain ( such as rice , wheat, barley, corn ) or beans with a microorganism food for beekeeping. The product of the acid fermentation is added to the normal bee's diet 's in a Minimum quantity equal to 3% . The application of the Korean patent KR830001681 , describes a food substitute for honey bees composed by 2 % skimmed milk powder, 0.1 % of powdered egg without fat , O, 8 % of bean powder, 0.6 % sweet potato powder, 0.05% methionine, 0.05 % lysine , 0.05% yeast powder, 0.05% calcium lactate , 0.09 % of active lactobacillus , 93.02 % of sugar. This food helps the health of the the bees as demonstrated by the increase in their weight which reach up to the 12, 5 % of the original one.
The practicing of microorganisms for the apiculture sector is also the reason for the application of the patent that describes the Korean KR20100125747, of its nutritional composition containing an active concentrated liquid , and the method of production. The composition is useful to eliminate the necessity of antibiotics and also to promote the process of egg laying. The manufacturing method includes a mixing of : Saccharomyces cerevisiae , albumin powder, fermented soybeans, pollen, propolis , and minerals with a sugary liquid, and fermentation period of 6 months. In turn, the sugary liquid is obtained by mixing the active and concentrated liquid with a lactobacillus and SiOs.
The European patent EP1135020 instead exploits the properties of one or more inoculate properties of microorganisms which produces one or more active antibiotics against one or more pathogens of bees. Among the antibiotics described there are ones against the Melissococcus pluton and/or Paenibacillus larvae , which is the causative agent of the American foulbrood of hives . The reason of the request of the patent is also related to the method of the treatment or the prophylaxis of disease of the bee hive which foresee the inoculum in order to establish the microbial flora for reparation and/or protection .
Even the international patent application WO 2011/138310 concern a probiotic blend useful for the protection of the health of the bees, and specifically to protect bees against bacterial diseases such as those caused by Paenihacillus larvae .
It must be said that the application of combinations of non-pathogenic bacteria farming is particularly stable , reproduceable and effective ,its a biological method to control pests and diseases of bees which seriously affect the health of the hive , especially interesting for beekeepers , as they represent the economical side and especially respect for the environment than the chemicals and the commonly used biopesticides, based on types of organisms such as viruses, nematodes, and fungus, and pathogenic bacteria .
Despite various forms of biological control of diseases of the hives and the welfare of the colonies are available, there is however a srong feeling in the beekeeping sector an urge to look for additional products and methods based on the particular combination of microorganisms , where products induce a positive metabolical effect on the conditions of the bee colony , help to prevent the uprising of pathological conditions affecting the colony itself and are able to reduce the presence of pathogens in the bee colony especially those of primary determinants of infectious endemic diseases of which effective treatments aren't currently available , especially CBPV, for example doesn't leave any residue in the hive.
Summary of the invention
The aim of the present invention is to provide a new composition useful for the wellbeing of the bee colony and prophylaxis against various pathological conditions which includes the association of more kinds of bacterial microorganisms and the method of transfering it into the hive , establishing the corrected microflora and/or protection. The aim of the invention therefore is the combination where the microorganisms of whose metabolic activity, produces substances that induce a positive effect on the conditions of the bee colony , capable of treating and preventing pathological disorders of the bees. The association which includes the micro-organisms are the following species: Lactobacillus paracasei ssp. , Bifidobacterium bifidum , Lactobacillus acidophilus, Lactococcus lactis , Bifidobacterium animalis , Lactobacillus thermophilus , Bacillus clausii . The above mentioned association of micro-organisms is equipped in a sucrose solution of 5%
Another point of the invention is to provide a method to practice the biological control of the general well-being and diseases of bees in the hive or various causes that infest the hive and the bees in the colony, applying the effective amount, the composition of microorganisms consist of Lactobacillus paracasei ssp. , Bifidobacterium bifidum , Lactobacillus acidophilus, Lactococcus lactis , Bifidobacterium animalis , Lactobacillus thermophilus , Bacillus clausii .
Included are further characteristics and advantages of the invention pointed out by drawings which summarizes , only as examples , as the results obtained during the experimental period .
Brief Descriptions of the Diagrams
Diagram n. 1 shows the percentage change in the number of adult bees in the hives, treated with the composition of microorganisms according to the invention obtained by the estimate of the sixth period of experiment .
Diagram n. 2 shows the percentage change in the number of capped brood in the hives treated with the composition of microorganisms according to the invention obtained by the estimation of the sixth period of the experiment . Diagram n.3 shows the percentage change in the number of broods in the hives non operculated treated with the composition of microorganisms according to the invention obtained by the estimation of the sixth period of the experiment .
Diagram n. 4 shows the percentage change in the number of eggs in the hives treated with the composition of microorganisms according to the invention obtained by the estimation of the sixth period of the experiment .
Diagram n. 5 shows the graphic illustrating the change in the viral load of CBPV expressed in a function of the number of viral RNA molecules identified in bee samples before and after treatment with the composition of microorganisms obtained by the method Real- time PCR.
Diagram n. 6 shows the graphic that illustrates the change in the scale of infection of Nosema Cer nae expressed in function of the numbers of RNA molecules of the pathogen identified in bee samples before and after treatment with the composition of microorganisms obtained by Real-time PCR method .
Detailed description of the invention
The invention proposes an association of microorganisms which has a metabolic activity that is able to induce a positive effect on the health conditions of a colony of bees , capable of treating and preventing pathological disorders of the bees , which comprises of the following microorganisms Lactobacillus paracasei ssp. , Bifidobacterium bifidum , Lactobacillus acidophilus, Lactococcus lactis , Bifidobacterium animalis , Lactobacillus thermophilus , Bacillus clausii .
The mentioned association of microorganisms is provided in a sucrose solution at 5%. The microbial species which form the composition according to the invention include a non- spore-forming bacteria Gram-positivi and bacilli which produce endospores .
The non-spore-forming Gram-positive bacteria are normal inhabitants of the digestive tract of humans and animals, although their presence and the extent of colonization depends largely by the characteristics of the host. In addition, some species of Gram- positive are commonly used for their role in food fermentation and therefore used in the preparation of human and and animal food . These microorganisms are deliberately introduced in food as breeding primer , food additives (eg , probiotics) and source of additives ( for example , enzymes and amino acids )
The composition according to the present invention is included amongst Gram -positive non- spore forming as follow : Bifidobacterium , Lactobacillus and Lactococcus .
The Bifidobacteria are part of the normal intestinal flora of adult humans and are also one of the first genres to colonize the intestines of children, they also live normally in the intestines of animals. Only a limited number of species of bifidobacteria is used in dairy products , in particular acids , such as yogurt and fermented milk drinks . Bifidobacteria belong to the branch of the phylum Actinomycetes Firmicutes . They are non mooving , non-spore forming , and have avariable aspect, usually like curved stick , and often has a branch shape as Y and V. Normally they are strictly anaerobic , although some species and strains tolerate oxygen. The type species is Bifidobacterium bifidum.T e Bifidobacteri are saccharolytic organisms and have the ability to ferment glucose , galactose and fructose. The glucose is fermented by the fructose -6-phosphate in acetic acid and lactic acid. The differences that exist between the various species consist in their ability to ferment different substrates of carbohydrates and alcohols.
The combination according to the present invention comprises two types of Bifidobacteria : Bifidobacterium bifidum and Bifidobacterium animalis .
The kind of lactobacilli is a taxonomic unit of gram -positive non-spore- forrning wide and heterogeneous , comprising a rod shaped lactic acid bacteria . This genus comprises more than 100 different species, with a wide phenotypic, biochemical and physiological variety . Many species of lactobacilli are the important constituents of the normal intestinal flora of humans and animals, even in this case as that of bifidobacteria , their presence and the entity of colonization depends largely by the host.
Usually, the genus Lactobacillus are divided into three groups: group 1, compalsory homofermentative , group 2 ,optionan heterofermentative group 3 compalsory heterofermentative . The phylogenetic taxonomy of the genus is now defined on a molecular basis . Today thanks to the most modern techniques of molecular characterization , there are 112 types belonging to the genus Lactobacillus.
The characteristics and the habitat of most kinds of lactobacilli are well known. Some of the species have a long history of safe use in industrial and agricultural applications . Lactobacilli are used as priming farming in a variety of food fermentations , such as dairy products , fermented meats and , fermented vegetables , sourdough and sausages . So lactobacilli are daily consumed in large quantities in a variety of fermented foods by people of all ages , ethnic groups and health conditions, apparently without negative effects. Apart from their possible involvement in the development of dental caries, lactobacilli are usually considered as non-pathogenic . The specias included according to the invention are, Lactobacillus paracasei ssp , Lactobacillus acidophilus , Lactobacillus thermophilus .
The kind of micro-organisms of lactococci was previously known as N- streptococci. The type Lactococcus lactis (formerly known as Streptococcus lactis ) , which is used in the composition , is a well-known launching organism of dairy products and the members of these species are common elements of the bacterial common in the cheese.
The lactococci belong to the phylum Firmicutes , they are coccoidies , non- mobile and metabolizes in a omofermentative, hexose and pentose eterofermentativa manner . They a re mesophilic for which prefer environments where the temperature fluctuates between 0 20° and 40° C , with the temperature usually at 30 0 C or lower .
Another kind of microrganism present and useful for the wellbeing of bees according to the present invention, is Bacillus clausii . Unlike other microorganisms used in the composition according to the invention and as described so far, Bacillus clausii is a Gram-positive bacterium whose cells , in stressful environmental conditions , produce endospores ovals that can remain inactive for long periods. As most of the bacteria of the genus Bacillus ,its cane- shaped and grows in groups or colonies . It's an alcalofilo microorganism and lives in alkaline environments , and is found mainly in the soil. One of the characteristics of this organism lies in its ability to produce a particular type of enzymes, the subtilisins , which have a protease activity in the highly alkaline environment .
The spores of some logs of B. clausii are used as probiotics , and are able to survive acid environments, a characteristic of the stomach , and to grow and multiply and transform into vegetative forms at the level of the intestine. Once in the intestine , enzymes from the metabolic products of B. clausii acts improving the microbial balanceing ( eubiosis ) of the human microbiota and protecting it from infections of other bacteria. The spores in fact stick on to the mucosa preventing the adhesion of pathogens, competing with them to use the nutrients and produce antimicrobial substances (immunoglobulins ) blocking the growth.
Several clinical studies have underlined the effectiveness and tolerability of the spores of B. inthe case of changes of clausii ( dysbiosis ) of the human microbiota , bloating, diarrhea and abdominal pain.
The bacterial logs that make up the composition according to the present invention have been identified, selected and isolated from various microenvironments (ie. soil , marshes , cheese preparations, etc.), through direct observation of the morphology of the cells under a microscope or through the colonies grown on slabs, and then propagated to the appropriate growth conditions , or alternatively , logs obtained from an official collections, types such as the American Type CultureCollection , ATCC ( Rockville, Md. , USA).
The bacterial strains were then grown under appropriate conditions in order to obtain liquid cultures in an appropriate growth . The cultures were then diluted 1:100 in a sucrose solution of 5% , and finally combined in quantities from 12 to 16 % of the total volume in a sucrose solution of 5%.
Therefore, the target of the present invention and a composition formed by the combination of selected microorganisms in liquid form , in sucrose solution of 5% in which each strain initially is present in an amount ranging from 12 to 16 % of the total volume , preferably 14 % . Once applied to the hive , the percentages of each log in the together may vary, depending on the specific environmental conditions of each hive , where each log may find more or less a favourable condition for its growth , and therefore could prevail or be limited compared to the other , therefore , after the application of the microorganisms each log can be present in percentages different from 14% . A simple microbial association may be regarded as a single entity , but according to the species from which it is made it interacts as antagonist and as synergistic . Such interactions may influence both the development of a given log as well as its metabolic activity , thereby leading to a completely new and unexpected effect , at times giving a therapeutic combination in the particular field of application.
A subject of the present invention is therefore also a composition consisting of a particular association of microorganisms that provides a useful tool for the biological control of the general well being of the bees and for the treatment of serious infections of bees, especially of viruses , determined by CBPV .
A further object of the present invention is the method based on the use of the microorganisms according to the present invention that finds application in the treatment and prevention of infection of certain pathogens of bees, in particular in the treatment of chronic paralysis of bees and/or of the infection caused by Nosema ceranae . This method helps the treatment of bees , larvae, and other components of the beehive with the comprising composition together with the combination of micro-organisms.
Specific experiments and observations are been conducted in order to verify the positive effect on the colony of bees, and have shown that the composition has a high potential in protecting adult bees and larvae through the multiple mechanisms of action . The treatment resulted a high protection against the external stress and a considerable improvement in the welfare of the colony, of bees treated and a total knock down of the presence of viral particles of CBPV . It is also conceivable that a similar mechanism of action , could give positive effects against other viruses , American foulbrood and European foulbrood that often destroys the hives . Specific investigations are ongoing and preliminary data are very encouraging.
The positive effect exerted by the use of the composition can be evaluated as a function of the strength of the families of bees , by the number ofthe adult bees , by the number of capped brood , by the number of un covered broods and the number of eggs in the hive. Moreover, as a parameter indicative of the good condition of the bee colony and the strength of the families of bees in the hive, it's able to assess the impact of Varroa infection , and the consequences of varroamite disease and other health conditions , known and not, as nosema and viruses .
For this purpose, the hives must rest on supports, suitable to prevent the access of ants in the diagnostic drawer, then the hives must be supported in containers with water . The bases of anti varroa in the hive must be intact and free of obstructions . Furthermore , in order to allow a correct assessment of the actual effectiveness of the treatment on the state of health of the hive , it must not be treated with un allowed products or with products of synthesis in block brood
Methods of evaluation of the hives include:
- assessment of the level of infestation with Varroa at the begirtning of the test and after honey extraction;
- assessment of the level of infection of pathogens closely related to varroa ( Nosema ceranae and viruses ) at the beginning of the test and after honey extraction;
- evaluation the amount of honey produced; - an estimate of the strength of the families at the beginning of the test and after honey extraction .
The composition according to the present invention is applied within the hive by any suitable means known to skilled people , preferably , but not exclusively , the composition is applied by a hand dispensing pump . In this way the composition of microorganisms in sucrose 5% is applied directly on each box of silkworm eggs hive, after opening the roof of the hive without pulling up the box of silkworm eggs . In this way the silkworm eggs, the brood as well as the bees are been wet . Preferably, the composition can also be sprayed on the door entrance of the hive so as to wet the surface which is been crossed by the bees.
The number of applications depends on the conditions of the colony and by the ammount of pests and diseases present . usually the application is repeated at intervals of about 2 to 5 weeks , for a total number of treatments equal to 3 or 4 . The treatments must necessarily be done in the period between spring and late summer. The application is repeated at intervals of approximately 15 days for a period of two months, and then subsequently the administration can be repeated monthly. Obvously skilled personal in this field can easily find various protocols of application (for example, for frequency of application and the effective quantity applied ) which are effective depending on the actual conditions and locations of the hive .
The exact amount , is the amount of composed according to the invention, able to control , reduce , inhibit, enhance or positively affect of one or more symptoms of the disease or conditions to be treated .
Experimental procedure
Stated here are examples according how to use of the composition content of the invention , provided only for illustrative purposes without in any way Umiting the invention . The effect of the composition of microorganisms of the invention against specific pathogens of bees and bee health and of their conditions. This have been investigated both in vivo and in vitro. The main phases of the investigation were conducted as described below .
1. Estimate of the strength of the families of bees
Experiments were carried out from the beginning of May 2012 to the end of June 2012 for a total of 60 days in an apiary located in the province of Rome
The experiment were made on 24 hives of colonies in hives containing frames, with movable antivarroa at the bottom.
At the beginning of the experiment the bees were not unaffected by any disease .
At the beginning of the experiment ( day 0 ) all hives were subjected to the estimation of sixth on the number of adult bees ,number of capped brood ,of broods non- operculate , and the number of eggs.
The 24 hives were divided into three different groups for treatment: the first group of 8 hives ( marked as T ) they were subjected to the administration of an amount equal to 10ml of a composition for each structure covered by bees, every 15 days for four times , for which the hive is subjected to treatment on day 0 , 15 , 30 , and 45 ; a second group of 8 hives ( marked as M ) was subjected to the adrninistration of an amount equal to 5ml of composition for each structure covered by bees following the same temporal profile of administration , and the third group (group C ) consisting of 8 hives were used as a controller and weren't subjected to any kind of treatment.
After the honey extraction performed at day 60 after the experiment, all hives were retested; in sixths o for the number of adult bees, of capped brood, broods of non-operculate and eggs. In chart n° 1 are the results obtained by estimation of the percentage variation relativeto the sixths of adult bees in the experimental period, represented graphically in Figure 1.
Chart N° 1- Change in the percentage of adult bees
Chart 2 shows the values obtained by estimation of the sixth concerning the change in the percentage of capped brood experimental period, represented graphically in Figure 2.
Chart n° 2 - Percentage change in brood
Chart N° 3 shows the values obtained by estimation of the percentage change in its sixth brood not capped during the period of experimentation, represented graphically in Figure 3.
Chart N° 3 - Percentage change not capped brood
Finally, Chart N° 4 shows the values obtained by estimating its sixth the percentage change of eggs during the period of experimentation, represented graphically in Figure 4.
Chart N° 4 - Change in the percentage of eggs
With regard to the evaluation of the positive effect on the general conditions of the bee families experimented , in the graph of Chart 1 it shows how the treatment according to the timing described above with 5 ml of composition ( group M) determines after two months from the first dose , a significant increase in the number of adult bees , whereas treatment with a double amount ( group T) composition leaves practically unchanged the number of bees and at a level comparable to that of the controlled group that received no treatment. The evolution of change in the number of adult bees in group M also reflects the evolution in the same experimental group of the variation in the number of capped brood and non- operculate , as shown in the graphs of charts 2 and 3, which show a greater and significant increase in the number of hatching, followed by treatment with 5ml of composition of microorganisms , and the adininistration of a double amount of composition determines a variation that coould be compared to that of the control group .
The evaluation of the strength of the bee family according to the variation of eggs following treatment shows that the composition oil microorganisms are able to determine and limit the loss of eggs compared to the controlled group where the loss is equal to to 70 % . Also in this case the best effectiveness of the treatment undergone by the group M is confirmed by the lesser percentage change in the number of eggs in this group (about 20 % ) compared to the group that received a double amount of the composition , the group T, which shows a decrease in the number of eggs are about 40% .
2 . Revelation of the virus CBPV and the genetic material of the spores of Nosema apis and Nosema ceranae in prey bees .
During the experiment there' ve been a sampling of bees for the detection of viruses by nosemiasi and virus research CBPV and genetic material of the spores of Nosema apis and Nosema ceranae inprey bees from the hives subjected to the study , an analysis of the entity of the infestation before and after the treatment with the mixture of microorganisms
CBPV and N. ceranae and N. apis are responsible for persistent and latent infections which often do not show clinical signs but are responsible for huge loss of bees, final and definite symptom of infection. Using the technique of molecular biology Real - time PCR (Polymerase Chain Reaction)it is possible to amplify a very specific characteristic of the genome of the two pathogens , allowing to reach to a definite diagnosis . Having a quantitative the technique allows to evaluate the viral load of CBPV , quantifying the specific RNA of the species and , more generally , the entity of the infection.
The method of quantitative PCR , however, was preceded by a study through PCR tradition (qualitative) .
Preparation of the homogenize and sporulation
The sporulation of the spores allow to extract much more easily the DNA of Nosema spp. As the vegetative phase of microsporidia is characterized by a very thin cell wall it allows to simplify the protocol of extraction .
In order to get the spores of Nosema Ceranae and Nosema apis , about 10-15 bees were selected to which were added 10 ml of IX PBS. 2ml of bee homogenate, these obtained were then collected using a pointed tip and placed in an eppendorf tube of 2ml .
Samples of the homogenate were centrifuged at 13.000rpm , at the room temperature for 10 minutes . At the end of centrifugation , the supernatant was gently removed and the precipitate was weighed on a precise balance so as to add the right amount of reagents necessary for the sporulation of the spores. The precipitate obtained , weighing generally between 35 and 50 mg , to this were added 40ul buffer germination and was immediately incubated for 15 minutes at 37 ° C and shaking at 300rpm . The germination buffer has the following composition : 75 ml of sodium hydrogen carbonate 1M to pH 6.5 and 75ml of sodium chloride 1M . Once prepared, the buffer germination is filtered through a 0,22um filter and stored at room temperature .
After the incubation period , to the precipitated were added 180ul of lysozyme [ lOmg / ml] , everything gently mixed and left in incubation at 37 ° C for 30 minutes .
Extraction of DNA from the vegetative phase According to the manufacturer's instructions,a commercial kit QIAamp® DNA Blood Mini Kit (Qiagen )was used for the DNA extraction .
PCR traditional reaction
Two PCR are performed : the first specification for Nosema ceranae and the second specific for Nosema apis .
1) Reserch of Nosema ceranae through PCR
The reaction was carried out following the protocol indicated in Martin- Hernandez R. et al. , 2007 ( Outcome of colonization of Apis mellifera by Nosema ceranae . Appl Environ Microbiol . 73:633-8).
The following pair of oligonucleotides were used as primer for the amplification reaction :
- 218MITOC-FOR : 5 -CGGCGACGATGTGATATGAAAATATTAA-3 ' ;
- 218MITOC-REV : 5'- CCCGGTCATTCTCAAACAAAAAACCG -3 ' , such oligonucleotides allow the amplification of a portion of 218-219 bp internal to the main subnit 165 of the RNA ribosomal ( 16S rRNA ) , the reaction mixture has the following composition : 5ul Buffer 10X , 0,4 uM 218 MTTOC fOR, 0,4 uM 218 MITOC REV, 0,4mM deoxynucleotide ( dNTP ) 3mM MgCl2 0, 2mg/ml Bovine Serum Albumin , 0 , 1% TritonX -100 , 0,05 U/ul Ampli Gold Taq (5U/ul ) , 5ul of template DNA and H2O DEPC until it reaches the final volume of 50ul . The reaction mixture was prepared using the Ampli Gold Taq Polymerase kit ( Applied. Biosystems , Branchburg , New Jersey, USA ) .
The amplification was carried out using a thermal cycler Gene Amp ® PCR System 9700 (Applied Biosystems , Carlsbad, USA) according to the following protocol :
- 94 0 C for 10 minutes ; - 35 cycles consisting of 94 ° C for 1 minute, 61 , 8 0 C for 1 minute, 72 0 C for 1 minute ;
- 72 ° C for 10 minutes.
2 ) Reserch of Nosema apis by PCR
( R. Martin- Hernandez et al. , 2007)
The following pair of oligonucleotides were used as a primer for the amplification reaction : -
-321APIS -FOR : 5 - GGGGGCATGTCTTTGACGTACTATGTA -3 ' ;
-321APIS -REV : 5'- GGGGGGCGTTTAAAATGTGAAACAACTATG -3 ', such primers permit the amplification of a 321 internal bp portion to the main subunit 16S of the ribosomal RNA (16S rRNA ) , the reaction mixture has the following composition : 5ul Buffer 10X , 0,4uM 3211 API- FOR, 0.4 uM321 APIS -REV , 0, 4mM deoxynucleotide ( dNTP ) , 3mM MgCb , 0, 2mg/ml Bovine Serum Albumin, 0,1% TritonX-100, 0,05 U/ul Ampli Gold Taq ( 5U/ul ) , 5ul of template DNA and DEPC H20 until it reaches the final volume of 50ul . The reaction mixture was performed using the Ampli Gold Taq Polymerase kit ( Applied. Biosystems , Branchburg , New Jersey , USA).
The amplification was carried out using a thermal cycler Gene Amp ® PCR System 9700 (Applied Biosystems , Carlsbad, USA) according to the following protocol :
- 94 ° C for 10 minutes; - 35 cycles consisting of 94 ° C for 1 minute, 61 , 8 ° C f or 1 min , 72 ° C for 1 min;
- 72 0 C for 10 minutes.
The amplified products of the various PCR reactions were visualized by electrophoresis in agarose gel of 1 , 5 % ( p / v) .
Experiment Real - time quantitative PCR .
The quantifications were performed by the method of absolute quantification in which it was used as a standard in which a plasmid was cloned in the DNA sequence of interest .
The test of detection of N. ceranae through real time PCR was performed according to the protocol described by Bourgeois et al. 2010 ( Genetic detection and quantification of N. Apis and N. Ceranae in the honey bee . Journal of Invertebrate Pathology. 103 : 53-58 ), using the following set of oligonucleotides : N. ceranae CRA Forw : 5'- AAGAGTGAGACCTATCAGCTAGTTG -3 ' ;
N. ceranae CRA Rev : 5 - CCGTCTCTCAGGCTCCTTCTC -3 ' ;
N. Ceranae CRA Probe : 5 - JOE - ACCGTTACCCGTCACAGCCTTGTT -3" - BHQ -1.
The sequences of the oligonucleotides used in the study were designed on the basis of specific genomic sequences of both the strain Nosema ceranae ( GenBank DQ486027 ) and of the strain Nosema apis ( GenBank U97150 ) . The amplicon obtained from the amplification of the DNA obtained from spores of N. ceranae is a fragment of 142bp that appears to be a specific type .
The test of detection of CBPV through real time PCR was performed according to the protocol described in Blanchard et al. 2007, ( Evaluation of a real-time two- step RT -PCR assay for quantitation of Chronic bee paralysis virus ( CBPV ) genomic in experimentally -infected bee tissues and in life stages of a symptomatic colony , Journal of Virological Methods 141: 7-13), using the following set of oligonucleotides :
CBPV Forward: 5 - CGCAAGTACGCCTTGATAAAGAAC -3 ' ;
CBPV Revesre : 5'- ACTACTAGAAACTCGTCGCTTCG -3 ' ;
CBPV Probe: 5 -FAM-TCAAGAACGAGACCACCGCCAAGTTC -TAMRA- 3 ' .
The primers and the sonde were positioned within the RNA of the gene code the RNA 1 - for RNA viral polymerase and amplify a fragment of lOlbp
( Ribiere et al . 2002 Molecular diagnosis of chronic bee paralysis virus infection . Apidologie . 33 : 339-351 ) .
The sequences of the primers used for the quantification of viral load CBPV and extent of infection of Nosema ceranae are summarized in Chart 5 .
Chart 5
The colonies of bees from the 24 hives involved in the experiment described as in paragraph 1 were hence assayed for the presence and entity of infection of CBPV and Nosema ceranae based on the amount of genomic molecole of the two pathogens found through Real Time PCR.
The analysis obtained showed that indeed during the experimental period the hives tested were contaminated by the microsporidium responsible for the nosemiasi and chronic of the bee paralysis virus . The test also showed that treatment with the combination of microorganisms according to the present invention is able to exert a significant effect on the infection of N. Ceranae (Figure 6) . The effect of treatment against infection of CBPV is consistent and significant in the two groups that received the treatment compared to the control group , with the difference that in the group T treatment with 10 ml of composition keeps constant the amount of ' infection , because the viral load remains substantially unchanged before and after the treatment , while in group M the treatment with 5ml of composition is able to clear the viral load , which does not take place in the control group where the viral load during the experimental period increases by a factor of 10 4 (Figure 5 ) .
The composition according to the present invention has thus demonstrated to be useful for the treatment of viral CBPV , revealing an unexpected ability to cancel the viral load following treatment according to the method described . This feature is very important , because in the first place, there aren't any known effective kind of treatments against this type of virus , usually transported and distributed by the acaro varroa. Often this is the real cause of death or of the depopulation of households, infested with varroa .
As it clearly appears, the above results , it's also important to emphasize that , it is possible to optimize the effect on the health of the bees , regulating and modulating the amount of composition of microorganisms that must be applied , as well as the number of applications.
Currently analyzes are being done by the Applicant with regards to the results of the infestation of varroa mites and other pathogens related to varroa, even in these cases, the preliminary results are very encouraging and demonstrate a considerable reduction in the extent of infection in the experimental groups who received the composition according to the invention of microorganisms.
Next Patent: METHOD FOR BIOMETRIC RECOGNITION WITH CLUSTERING OF REGISTERED DATA FOR POS/ATM APPLICATIONS