VACCINE DIAGNOSTIC EMPLOYING PROTEINS HOMOLOGOUS TO HEAT SHOCK PROTEINS OF TRYPANOSOMA CRUZI

BACKGROUND OF THE INVENTION This invention relates to vaccines and diagnostics and more particularly to vaccines and diagnostics which employ proteins and/or fragments and/or derivatives thereof having homology to heat shock proteins ^" of Trypanosoma cruzi. Heat shock proteins, sometimes referred to as stress proteins, have been found in a wide variety of cells, and have been generally described in an article written by Tissieres on pages 419 through 429 of "Heat Shock from Bacteria to Man" (Cold Spring Harbour Laboratory, 1982) .

DESCRIPTION OF THE FIGURES Figure 1 provides the gene and derived, amino acid sequence for the Hsp70 antigen of T. cruzi.

Figure 2 provides an alignment of heat shock proteins from a variety of organisms: 1. M. hyo¬ pneumoniae, 2. Bacillus megaterium, 3. Escherichia coli, 4. T. cruzi, 5. T. cruzi, 6. Rat, 7. Xenopus laevis 8. human, 9. chicken, 10. Zea mays, 11. Serratia marcescens. Figure 3 provides a restriction map of pMYCOlβ containing the full length gene for the Hsp70 antigen of M. hyopneumoniae.

Figure 4 provides an intermediate plasmid for the expression of the Hsp70 antigen of M. hyopneumoniae.

Figure 5 provides the gene and derived amino acid sequence for the Hsp70 antigen of M. hyopneumoniae.

Figure 6 provides restriction map of pMYC029 which is a low level expression plasmid containing the

full length gene for the. Hsp70 antigen of M. hyopneumoniae.

Figure 7 provides a restriction map of pMYCOSl which is a high level expression plasmid containing the full length gene for the Hsp70 antigen of M. hyopneumoniae.

Figure 8 provides a restriction map of pCAMlOl containing the trpT176 gene.

Figure 9 provides a restriction map of pMYC032 which is an expression plasmid containing the full length gene for the Hsp70 antigen of M. hyopneumoniae and the trpT176 gene.

Figure 10 provides a restriction map of pMGA4 which is an expression plasmid containing the full length gene for the Hsp70 antigen of M. gallisepticum.

Figure 11 provides the gene and derived amino acid sequence for the Hsp70 antigen of M. ■ hyopneumoniae.

Figure 12 provides a restriction map of pMGAlO which is an expression plasmid containing the full length gene for the Hsp70 antigen of M. hyopneumoniae and the trpT176 gene.

SUMMARY OF THE INVENTION Vaccines are disclosed for the protection against organisms which comprise a physiologically acceptable carrier with a protein which is capable of eliciting an antibody which recognizes at least one epitope of a native protein present in the organism, the native protein having at least 50% homology with a heat shock protein of T. cruzi. Processes for protecting a host against an organism are also disclosed which comprise administering an effective amount of a protein capable of eliciting an antibody which recognizes at least one epitope of a native protein present in the organism, the native protein

having at least 50% homology with a T. cruzi heat shock protein.

Further disclosed are processes for determining an organism in a host which comprise contacting a sample derived from a host containing an . organism or suspected of containing an organism with an antibody or antibody fragment which recognizes at least one epitope of a native protein present in the organism, the native protein having at least 50% homology with a ^* heat shock protein of T. cruzi; and determining protein present in the organism bound to the antibody.

For such vaccines and processes, the native protein referred to above may be derived from a species of Mycoplasma, Mycobacteria or Trypanosoma, provided that the native protein is not derived from Trypanosoma cruzi. Preferably, the native protein of Mycoplasma derivation is one selected from the group consisting of M. ycoides, M. bovis, M. bovigenitalium, M. bovoculi, M. bovirhinis, M. dispar, M. hyorhinis, M. hyosynoviae, M. hyopneumoniae, M. gallisepticum, M. pneumoniae, and M. synoviae, most preferably from M. hyopneumoniae and M. gallisepticum. The native protein of Mycobacteria derivation is preferably one selected from the group consisting of M. bovis, M. leprae, and M. tuberculosis.

The recombinant sequence of nucleic acid encoding the heat shock proteins of M. hyopneumoniae and M. gallisepticum is also disclosed.

DETAILED DESCRIPTION Applicant has found that certain heat shock proteins and/or fragments and/or derivatives thereof may be employed in a vaccine to protect against an organism containing such heat shock protein.

Applicant has further found that certain heat shock proteins and/or fragments or derivatives thereof, as well as antibodies produced in response

to such heat shock proteins and/or fragments or derivatives thereof may be employed as a diagnostic for determining an organism containing such heat shock proteins. 5 Applicant has also found that certain DNA

(RNA) sequences encoding for a heat shock protein of an organism may be employed as a diagnostic for determining the organism.

In accordance with the one aspect of the

1.0 present invention, there is provided a vaccine for protecting against an organism which includes a heat shock protein wherein the vaccine includes a protein capable of eliciting an antibody which recognizes at least one epitope of a heat shock protein of the

15 organism which heat shock protein of the organism has at least 50% homology with a heat shock protein of Trypanosoma cruzi (T. cruzi) .

In accordance with another aspect of the present invention, there is provided a process for

20 protecting against a disease caused by an organism which includes a heat shock protein by administering to a host at least one protein capable of eliciting an antibody which recognizes at least one epitope of a heat shock protein of the organism which heat shock

25 protein of the organism has at least 50% homology with a heat shock protein of Trypanosoma cruzi (T. cruzi) .

The term that an antigen or protein has at least 50% homology with a heat shock protein of T.

30 cruzi, as used herein, means that on a position by position basis, at least 50% of the amino acids of the heat shock protein of T. cruzi are also present in the antigen or protein.

More particularly, in a preferred embodiment

35 the heat shock protein or polypeptide of T. cruzi with which an antigen or protein is to have at least 50% homology is at least one of the T. cruzi heat shock

proteins having a molecular weight of about 70 kD, or about 85 kD or about 65 kD, preferably the heat shock protein having a molecular weight of about 70 kD. The T. cruzi heat shock protein having a molecular weight of about 70 kD may be prepared as described in Example 1. The amino acid and DNA sequence for the 70 kD protein is shown in Figure 1 of the drawings, with the 70 kD protein starting at base pair 25 and terminating at base pair 677. The T. cruzi heat shock protein having a molecular weight of about 85 kD is described by Dragon et al. Molecular and Cellular Biology, Volume 7 No. 3 Pages 1271-75 (March 1987).

The protein which is present in the organism and which is at least 50% homologous to a T. ^" cruzi heat shock protein will sometimes be referred to herein as the "homologous protein" or the "homologous heat shock protein".

The protein employed in formulating the vaccine for protection against an organism may be identical to a homologous protein present in the organism to be protected against, or may be a fragment or derivative of such homologous protein, provided that the protein which is used in the vaccine is capable of eliciting an antibody which recognizes at least one epitope of the homologous protein. For example, the protein employed in the vaccine may be only a portion of the homologous protein present in the organism or may have one or more amino acids which differ from the amino acids of the homologous protein in the organism or may be the homologous protein (or fragment or derivative thereof) fused to another protein.

The term "protein which is capable of eliciting an antibody which recognizes at least one epitope of a native protein present in the organism, said native protein having at least 50% homology with a heat shock protein of T. cruzi" (such protein present

in the organism is what is sometimes referred to as the homologous protein) encompasses the homologous protein present in the organism or a fragment of such homologous protein or a derivative of such homologous protein or a fusion product of such homologous protein (or fragment or derivative thereof) with another protein. As should be apparent, the protein or proteins included in the vaccine may include more or less amino acids or amino acids different from the amino acids of the homologous protein present in the organism.

The protein or proteins employed in the vaccine may be identified and produced by recombinant techniques. More particularly, the DNA (or RNA) encoding for a T. cruzi heat shock protein is employed as a probe to identify DNA present in the organism against which protection is sought which has at least 50% homology with the DNA (RNA) encoding for a T. cruzi heat shock protein. The DNA of the organism having the requisite homology is sometimes referred to herein as the "homologous DNA".

The homologous DNA of the organism identified by such probe is employed to produce homologous protein of the organism by recombinant techniques. Thus, for example, the DNA encoding for the protein of Figure 1 may be suitably labeled, for example with ³² P, by procedures known in the art to thereby provide a probe for identifying DNA in the organism having at least 50% homology with the DNA sequence encoding for the protein of Figure 1.

Figure 2 presents an alignment of the amino acid sequences of Hsp70 proteins from a number of species. The amino acids are depicted by their single letter abbreviations. Stretches of sequence identical in all examined species were identified (denoted by upper case text in the consensus sequence depicted below the individual sequences) . Several regions

containing sequences at least six amino acids in length which were identical in all Hsp70 sequences. For example, between amino acid 138 and 209 of T. cruzi lie the sequences TVPAYF, RIINEPTA, and DLGGGTFD which are conserved in Hsp70 sequences. The DNA sequences which could encode these conserved sequences were determined. The 17-mer nucleotide sequences having low coding degeneracy serve as universal oligonucleotide probes for Hsp70 genes. The probing conditions selected are such that hybrids are identified in which there is at least 50% homology between the selected DNA probe which encodes for a T. cruzi heat shock protein and the DNA being probed for in the organism. Such probing is done at relatively low stringency. Low stringency is achieved by known methods such as reduced temperature and increased salt concentrations (e.g., hybridizing at 37 ^β C and 5-6 X standard ^* salt-citrate buffer or 5-6X standard salt-EDTA-Tris buffer) . The selected homologous DNA of the organism may be included in any of a wide variety of vectors or plasmids for producing a protein to be employed in formulating a vaccine against the organism. Such vectors include chromosomal, nonchromosomal and synthetic DNA sequences; e.g., derivatives of SV40; bacterial plasmids; phage DNA's; yeast plasmids; vectors derived from combinations of plasmids and phage DNAs, viral DNA such as vaccinia, adenovirus, fowl pox, virus, pseudorabies, etc. The appropriate DNA sequences may be inserted into the vector by a variety of procedures. In general, the DNA sequences are inserted into an appropriate restriction endonuclease site by procedures known in the art. Such procedures and others are deemed to be within the scope of those skilled in the art.

The DNA sequences in the vector are operatively linked to an appropriate expression control sequence(s) (promoter) to direct mRNA synthesis. As representative examples of such promoters, there may be mentioned: LTR or SV40 promoter, the E. coli lac or trp, the phage lambda PL promoter and other promoters known to control expression of genes in prokaryotic and eukaryotic cells or their viruses. The expression vector also contains a ribosome binding site for translation initiation and a transcription terminator. The vector may also include appropriate sequences for amplifying expression.

In addition, the expression vectors preferably contain a gene to provide a phenotypic trait for selection of transformed host cells such as dihydrofolate reductase or neomycin resistance for eukaryotic cell culture, or such as tetracycline or ampicillin resistance in E. coli. The vector containing the appropriate DNA sequences as hereinabove described, as well as an appropriate promoter or control sequence, may be employed to transform an appropriate host to permit the host to express the protein. As representative examples of appropriate hosts, there may be mentioned: bacterial cells, such as E. coli. Salmonella typhimurium, fungal cells, such as yeast; animal cells such as CHO or Bowes melanoma; plant cells, etc. The selection of an appropriate host is deemed to be within the scope of those skilled in the art from the teachings herein.

The expression vehicle including the appropriate DNA sequences for the protein to be expressed and the t-RNA inserted at the selected site may include a DNA or gene sequence which is not part of the gene coding for the protein. For example, the desired DNA sequence may be fused in the same reading

frame to a DNA sequence which aids in expression or improves purification or permits increases in the immunonogenicity.

In employing recombinant techniques for producing the active protein, purifications, digestions, ligations and transformations may be accomplished as described in "Molecular Cloning: A Laboratory Manual" by Maniatis et al.. Cole Spring Laboratory, 1982 ("Maniatis"). In addition, transformations may be accomplished by the procedure of Cohen, PNAS, 69:2110 (1973).

When seeking to develop a vaccine, neutralizing or protective antibodies could be targeted toward discontinuous, conformation-dependent epitopes of the native antigen. One must therefore consider whether the protein obtained from the recombinant expression system might have a three dimensional structure (conformation) which differs substantially from that of the original protein molecule in its natural environment. Thus, depending on the immunogenic properties of the isolated proteins, one might need to renature it to restore the appropriate molecular conformation. Numerous methods for renaturation of proteins can be found in the scientific literature and include; 1) denaturation (unfolding) of improperly folded proteins using agents such as alkali, chaotropic agent, organic solvents, and ionic detergents followed by a renaturation step achieved by dilution, dialysis, or pH adjustment to remove the denaturant, and 2) reconstitution of proteins into a lipid bilayer or liposome to re-create a membrane like environment for the immunogenic protein.

The vaccine which includes a protein of the type hereinabove described may be employed in a vaccine for protecting against diseases caused by a wide variety of organisms. Table 1 provides representative examples of such organisms. Of particular interest are

species of Trypanosoma, Mycoplasma and Mycobacteria. Trypanosoma and Mycoplasma heat shock proteins are described herein. Heat shock proteins for Mycobacteria are known. Young et al., P.N.A.S. (USA), 85:4267-4270 (1988) .

A host may be protected against a disease caused by a certain organism by incorporating into the vaccine a protein which is capable of eliciting antibodies which are recognized by at least one epitope of a homologous protein of the organism. As hereinabove indicated the protein which is capable of eliciting such antibodies (hereinafter sometimes referred to as the active protein) may correspond to the homologous protein of the organism or may be a fragment or derivative thereof. As should be apparent, if the disease against which a host is to be protected is Chagas, which is caused by T.cruzi, the protein which is included in the vaccine would be one or more heat shock proteins of T. cruzi or a fragment or derivative thereof capable of eliciting antibodies which recognize an epitope of T. cruzi heat shock protein. The host which is protected is dependent upon the organism against which protection is sought. In general, the host is an animal (either a human or nonhuman animal) which is subject to a disease caused by the organism. Thus, for example if the organism against which protection is sought is one which is known to cause disease in man, then the vaccine including the active protein or proteins would be administered to a human host. If the organism is known to cause a disease in a nonhuman animal, then the vaccine including the active protein would be administered to a nonhuman animal.

In formulating a vaccine, the active protein is employed in the vaccine in an amount effective to provide protection against the disease caused by the organism against which protection is sought. In

general, each dose of the vaccine contains at least 5 micrograms and preferably at least 100 micrograms of the active protein. In most cases, the vaccine does not include the active protein in an amount greater than 20 milligrams.

The term "protection" or "protecting" when used with respect to a vaccine means that the vaccine prevents the disease or reduces the severity of the disease. The active protein is employed in conjunction with a physiologically acceptable vehicle to provide protection against the organism. As representative examples of suitable vaccines in carriers, there may be mentioned: mineral oil, alum, synthetic polymers, etc. Vehicles for vaccines are well known in the art and the selection of a suitable vehicle is deemed to be within the scope of those skilled in the art from the ^* teachings herein. The selection of a suitable vehicle is also dependent upon the manner in which the vaccine is to be administered. The vaccine may be in the form of an injectable dose and may be administered intra-muscularly, intravenously, or by sub-cutaneous administration. It is also possible to administer the vaccine orally by mixing the active components with feed or water; providing a tablet form, etc.

Other means for administering the vaccine should be apparent to those skilled in the art from the teachings herein; accordingly, the scope of the invention is not limited to a particular delivery form.

It is to be understood that a vaccine may also be formulated by use of an antibody elicited in response to a homologous protein of the organism. The protein and/or antibody used in the vaccine is essentially free of the organism; i.e., cellular matter.

In accordance with another aspect of the present invention, there is provided a diagnostic kit and/or assay for determining an organism which employs in the assay and/or kit an antigen which is recognized by an antibody elicited by a protein of the organism which has at least 50% homology with a T. cruzi heat shock protein, as hereinabove described, i.e., a "homologous protein" of the organism.

The antigen employed as a diagnostic may be obtained or produced as hereinabove described with reference to the active protein included in the vaccine.

In accordance with yet a further aspect of the present invention, there is provided a diagnostic assay and/or reagent for determining an organism which includes and/or employs an antibody (or fragment thereof) which recognizes an antigen of the organism to be determined, which antigen of the organism has at least 50% homology with a heat shock protein of T. cruzi, as hereinabove described.

The antibody employed in the assay and/or assay kit may be either a polyclonal or monoclonal antibody elicited in response to a homologous protein. In particular, the antibody employed in the diagnostic assay and/or kit is elicited in response to a protein and/or fragment and/or derivative thereof having at least 50% homology with a heat shock protein of T. cruzi.

A diagnostic kit and/or assay for determining an organism which includes a homologous protein may be formulated to determine such organism by a variety of procedure.

For example, the organism may be determined by a so-called sandwich assay kit or assay for determining the organism by determining in a sample (derived from a host containing or suspected of

containing the organism) antibody elicited in response to a homologous protein of the organism. In this procedure, antigen of the type hereinabove described is contacted with the sample under conditions at which any of such antibody present in the sample is immunobound to the antigen, which antigen is preferably supported on a solid support.

Antibody bound to such antigen may then be determined by use of an appropriate tracer comprised of a ligand bound or recognized by such antibody labeled with a detectable marker or label. The ligand of the tracer may be, for example, an antibody bound by or recognized by the bound antibody.

The marker may be any one of a wide variety of labels (for example a radioactive label, an enzyme label, a chromogen label, etc.).

The techniques for forming such an assay and for providing a tracer are known in the art and no further details in this respect are deemed necessary for understanding the present invention.

For example, there may be employed a so-called ELISA sandwich assay format in which a plastic microtiter plate is coated with an antigen of the type described (one which is recognized by antibody elicited in response to homologous protein of the organism) and sample derived from a host suspected of containing the organism is incubated with the coated antigen. After appropriate washing, labeled immunoglobulin (antiglobulin to the host species which is suspected of containing the organism) labeled with a detectable enzyme (for example horseradish peroxidase or alkaline phosphatase) is incubated with the antibody bound by the coated antigen. After washing, an appropriate developer is added.

Alternatively, an agglutination assay may be employed in which case particles, such as polystyrene

beads, coated with the appropriate antigen is mixed with appropriate sample, and presence of antibody is detected by agglutination.

These and other procedures should be apparent to those skilled in the art.

In an alternative sandwich immunoassay format, an antibody of the type hereinabove described may be employed to directly determine a homologous heat shock antigen or protein of the organism to be determined. - For example, a sample (derived from a host containing or suspected of containing the organism) is subjected to a sandwich assay by contacting the sample with an antibody (or fragment thereof) which recognizes the homologous heat shock antigen of the organism, which antibody is preferably supported on a solid support. Such contacting is effected under conditions which will im unobind the homologous heat shock antigen (if present) to the antibody. Thereafter, bound antigen may be determined by use of a tracer comprised of a ligand (which is bound by or recognizes the homologous antigen) labeled with a detectable marker or label. Thus, for example, the tracer may be labeled antibody elicited in response to the homologous antigen of the organism. As hereinabove indicated, the antibodies capable of recognizing a homologous protein of the organism may be a monoclonal and/or polyclonal antibody.

In this assay format, which employs an antibody which recognizes a homologous protein of the organism, markers (labels) and techniques, as hereinabove described and as known in the art, may also be employed.

The assay or reagent kit which employs antigen and/or antibody of the type hereinabove described may be included in an appropriate reagent kit package. The package may include other materials

useful in the assay, for example, tracer, buffers, standards, etc., in appropriate reagent containers. In accordance with another aspect of the present invention, there.is provided an assay and/or reagent kit for determining the presence of an organism which includes or employs a DNA probe which encodes for a protein of the organism having at least 50% homology with a heat shock protein of T. cruzi as hereinabove described. The DNA probe which is used may be all or a portion of the DNA which encodes for a homologous protein. If a portion of the DNA which encodes for a homologous protein is employed, such DNA portion should include a portion of the DNA which encodes for a variable region of the homologous protein.

Accordingly, the DNA probe is employed under conditions whereby hybridization is accomplished over at least a portion of the DNA which encodes for a variable region (preferably a hypervariable region) of the homologous protein.

The hydridization may be performed with a suitably labeled form of the DNA (for example ³² P, although other detectable labels, including non- radioactive labels may be used) in a procedure similar to the procedure for identifying DNA of the organism encoding for a protein having the requisite homology with a T. cruzi heat shock protein.

The present invention will be further described with respect to the following examples; however, the scope of the invention is not to be limited thereby. Unless otherwise indicated, all methods and abbreviations are well known in the art and are found in Maniatis. All references in this document are hereby incorporated by reference herein.

Example 1 — Trypanosoma Cruzi Heat Shock Protein and Its Reaction with Sera from Infected Persons.

A. Growth and Isolation of Parasites

Trypanosoma cruzi, Peru strain, was used in all experiments. Epimastigotes were grown at 28"C in modified HM (Warren, S. Parasitology, 46:529-539, 1960); 37 g/1 brain heart infusion (Difco Lab., Detroit, MI), 2.5 mg/1 he in, 10% heat-inactivated fetal calf serum. Log phase cells were harvested by centrifugation and washed twice with cold PSG (20 mM sodium phosphate, pH 7.4, 0.9% NaCl, 1.0% glucose). Culture form trypomastigotes were obtained from infected Va-13 cells as previously described. See Sanderson et al., Parasitology, 80:153-162, (1980), and Lanar and Manning, Mol. and Biochem., Parasitology, 11:119-131, (1984).

B. Isolation of DNA and RNA

Parasites were harvested from culture by centrifugation and washed several times with PSG (20 mM sodium phosphate, pH 7.4, 0.9% NaCl, 1.0% glucose). Epimastigotes were resuspended at a concentration of 10 ⁹ /ml in PEG/EGTA buffer (20 mM Tris-HCl, pH 7.6, 25 mM EGTA, 50 mM MgCl, 25mM CaCl, 1.0% Triton-XlOO, and 4mM dithiothreitol) , plus 250 u/ml of RNAS in (Promega Biotec, Madison, WI) , incubated on ice for 20 min. , centrifuged at 8000 x g for 15 minutes at 4 ^β C. The supernatant containing the RNA was phenol extracted 3 times, then extracted once with chloroformisoamyl alcohol (24:1) and ethanol precipitated. The pellet (nuclei and kinetoplasts) was resuspended at a concentration of 10 ⁹ parasite equivalents/ml in 10 mM Tris-HCl, pH 8.0, 50 mM EDTA, 0.1% SDS, 150 ug/ml Proteinase K (Boehringer- Mannheim, Indianapolis, IN) • and incubated at 65°C for 1 hour. After cooling to room temperature, the DNA was gently extracted with an equal volume of phenol for 1 hour. This extraction

was repeated once, and the aqueous phase was extracted with chloroform-isoamyl alcohol (24:1) once. The DNA was recovered by ethanol precipitation. The DNA pellet was gently redissolved in 10 mM Tris-HCl. pH 8.0. 1 mM EDTA and treated with 0.15 mg/ml DNAse-free RNAse A for 30 minutes at room temperature. After RNAse digestion the sample was extracted once with phenol, once with chloroformisoamyl alcohol, and then preσipated with ethanol. The size of the DNA was determined to be greater than 20 kilobase pairs (kb) on agarose gels. Trypomastigote DNA and RNA was prepared in an identical manner except that the parasites were resuspended at a concentration of 5 x 10 ⁹ /ml-*

C . Preparation of A+ mRNA Poly A+ containing RNA was isolated by

Oligo(dT)-cellulose chromatography (Aviv and Leder, J. Immunol., 127:855-859, 1972). Total RNA was loaded onto an oligo (dT)-cellulose column (Type 3, Collaborative Research, Lexington, MA) in 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.2% SDS, 400 mM LiCl. RNA was eluted from the column at 40°C with 10 mM Tris-HCl, pH 7.5, 1 mM EDTA, 0.2% SDS.

D. Construction of the T. cruzi "Sau3a Partial" Genomic Library in Bacteriophage EMBL3 200 μg of T.cruzi epimastigote DNA was digested with the restriction endonuclease Sau3A (Boehringer-Mannheim, Indianapolis, IN) according to manufacturer's specifications. Aliquots of the reaction were removed at 1, 2.5, 5, 10, 20, 40 and 60 minutes. Upon removal each aliquot was diluted to 25 mM in EDTA and heated for 15 minutes at 68*C. The samples were pooled, the DNA was size fractionated over a Sephacryl S-1000 column (Pharmacia, Piscataway, NJ) in 200 mM Tris-HCl, pH 7.5, 100 mM NaCl, 1 mM EDTA. Those fractions containing DNA in size from 5 kb to 20

kd were pooled, ethanol precipiated, and used for cloning. The lambda bacteriophage cloning vector EMBL3 (Frishauf et al., J. Mol. Biol., 170:827-842, 1983) was used. EMBL3 arms and GIGAPAK packaging system were purchased from Vector Cloning Systems (San Diego, CA) and used according to the manufacturer's instructions.

E. Hvbridization-Selection/Translation

Specific T. cruzi RNAs were purified from total T. cruzi RNA using the technique of hybridization-selection/translation as described by

Riccardi et al., PNAS, 76:4927-4931, 1972. 25-50 ug of purified plasmid DNA was digested with an appropriate restriction endonuclease (to linearize the plasmid) , the DNA was cleaned by phenol extraction and chloroform extraction and denatured by boiling for 10 minutes. Following boiling, the DNA was quick-frozen, thawed, then spotted onto a 9mm diameter nitrocellulose filter. The filter was washed several times with•6XSSC-, then air dried and baked for 2 hours at 80"C in vacuo. For hybridization, 100 μg of T. cruzi total RNA was reacted with the DNA containing filter in a solution containing 65% formamide, 0.01 M PIPES, pH 6.4, 0.4 M NaCl at 65 ^β C for 3 hours. Following the hybridization reaction, the filter was washed 10 times with 1XSSC, 0.1% SDS at 60"C, 3 times with 0.002 M EDTA at 60 ^β C, and once with water at room temperature. The specifically hybridized mRNA is eluted from the filter by boiling the filter in a small volume of water for two minutes, quick-freezing the solution, then ethanol precipitating the RNA. The purified RNA is resuspended in water, then translated in an in vitro translation system (such as rabbit reticulocyte) .

F. Immunoprecipitation Reactions

A 1:10 to 1:50 dilution of individual serum was prepared using the 10 mM Tris-HCl, pH7.5, 1% Nonidet

P-40 (NP 40) , 1 mM N-alpha-p-tosyl-L-Lysine chloromethyl ketone (TLCK) , 1 mM phenyl methyl sulfonyl fluoride (PMSF) , and 2.8 Kallikrein Inactivator Units (KIU)/ml aprotinin. The diluted serum was mixed with an equal volume of cell-free translation reaction mixture, and incubated overnight at 4°C. 10 μl of 10% protein-A-Sepharose (Pharmacia, Piscataway, NJ) was added and gently mixed for 1 hour at 4"C. The immune complexes were washed and analyzed on SDS-polyacrylamide gels as described in Dragon et al., Mol. and Biochem., Parasitology, 16:213-229, 1985.

G. Synthesis of cDNA cDNA was synthesized by methods known to those of ordinary skill in the art. Briefly, 2 μg of epimastigote or trypomastigote A+ mRNA was transcribed by the action of AMV reverse transcriptase as described by Ullrich et al.. Science, 196:1313-1319, (1977) and Gubler, Gene, 25:263-269, (1983). Transcription was initiated at the 3' polyadenylated end of the mRNA using oligo(dt) as a primer. The second strand was copied using DNA polymerase I and RNAse H (Boehringer-Mannehim. Indianapolis, IN) and appropriate buffers.

Specifically, 2 μg of oligo-dT (12-18 nucleotides, Pharmacia Molecular Biology Division, Piscataway, NJ) was annealed to 2 micrograms of purified mRNA in the presence of 50 mM NaCl. The annealing reaction was heated to 90"C and then slowly cooled. For the reverse transcriptase reaction, deoxynucleosidetriphosphates (dATP, dTTP, dGTP and dCTP) were added to make a final concentration of 0.5 mM, along with 40 units of enzyme (Molecular Genetic Resources, Tampa, FL) . The reverse transcriptase reaction buffer contained 15 mM Tris-HCl, pH 8.3, 21 mM KCl, 8 mM MgCl ₂ , 0.1 mM EDTA. and 30 mM beta- mercaptoethanol. This mixture was incubated at 42°C

for 45 minutes. The RNA-DNA duplex was extracted once with phenol chloroform and then precipitated with ethanol. The pelleted material was then resuspended in 100 microliter reaction mixture containing the following: 20 mM Tris-HCl pH 7.5, 5 mM MgCl ₂ , 100 mM KCl and 250 UM each dATP, dCTP, dTTP, dGTP.

RNAase H (100 units/ml Pharmacia Molecular Biology Division, Piscataway, NJ) and DNA Polymerase I — Klenow fragment (50 units/ml Boehringer Mannheim, Indianapolis, IN) were added and the reaction was incubated at 12 ^β C for 60 minutes. The combined activities of these enzymes result in the displacement of the mRNA from the RNA-DNA duplex as the first cDNA strand is used as a template for synthesis of the second cDNA strand. The reaction was stopped by the addition of EDTA to a final concentration of 10 mM and the DNA duplex was then extracted with phenol: chloroform and ethanol precipitated. The sequence of the reactions of DNA Polymerase I and RNAase H was predicted to yield cDNA molecules which were blunt ended at both their 3' and 5' ends. A 3' blunt end is necessary for the subsequent cloning of the cDNA.

H. Construction of the cDNA Library Briefly, the double stranded cDNA preparations were digested with the restriction endonucleases Sad and PvuII (New England Biolabs, Beverly, MA) and ligated, using T4 DNA ligase, into the Sad and Smal sites of the plasmid pUC18 (Yanish-Perron et al.. Gene, 33:103-119, 1985). This mixture was used to transform E. coli K12 strain JM83, selecting for ampicillin resistance conferred by the introduction of the pUC18 into the host cell. From 2 ug of mRNA approximately 150 ng of cDNA were prepared which yielded about 7000 ampicillin resistant clones.

More specifically, the cDNA was resuspended in 100 microliters of sterile water. Approximately 50 ng was digested with Sacl (5000 units/ml) and pVTJII (12000 units/ml) in the presence of 6 mM Tris-HCl (pH and 6 mM beta-mercaptoethanol for 60 7.4) 6 mM MgCl2' minutes at 37 ^β C.

The sample was then re-extracted with phenol: chloroform and ethanol precipitated. For the cloning step a pUClδ vector was used. The vector had been digested with Sacl and Smal. Smal provided the blunt end site necessary for ligation of the 3' end of the cDNA. The ligation reaction was performed using 40 ng of vector DNA and 50 ng of cDNA. Ligation was done overnight at 12°C in a ligase buffer of 50 mM Tris-HCl (pH 7.8), 10 mM MgCl2, 20 mM dithiothreitol, 1.0 mM rATP using one unit of T4 DNA ligase.

The recombinant DNA molecules were then introduced into E. coli K-12 strain JM83 by transformation. The transformed bacteria were spread on agar plates containing the antibiotic ampicillin at a concentration of 50 micrograms/ml. Since the plasmid pUC18 contains the ampicillin resistance gene, only those bacteria which acquired a recombinant plasmid survived. These bacteria each grew and divided to form a bacterial colony. Each cell in the colony is a descendant of the original parental cell and contains the same recombinant plasmid. Using hybridization - selection/translation and immunoprecipitation techniques to screen the cDNA library a clone was identified which contained nucleotide sequences corresponding to a 70 kd T. cruzi peptide.

I. Isolation of the full lenσth 70 kd σene

The cDNA clone was used as a probe to screen the T. cruzi Sau3a partial genomic library as described by Maniatis et al. A lambda phage designated FG21 was identified which contained multiple copies of the 70 kD

gene. A 2.4 kb Smal fragment was sub-cloned into pUC9 from FG 21. This subclone called pEG22 contained one full length copy of the 70 kD gene. The DNA sequence ■ of PEG22 was determined. FG21, was sequenced and used to construct an expression plasmid to allow production of the 70 kd antigen in E. coli. J. Expression of Cloned Genes in E. coli

Several systems are available in the laboratory for expressions of foreign genes in E. coli and other mammalian and bacterial tissue culture cell lines. It is important to provide the cloned genes with an E. coli ribosome binding site for initiation of translation and a strong promotor to obtain sufficiently high levels of protein. Although obtaining "direct" expression of the protein is possible, it appears to be more efficient to produce the protein as a fusion protein, the amino. terminus of which is a small part of an E. coli protein containing .signals for the initiation of protein synthesis. The amino terminus of B-lactamase and the amino terminus of B-galactosidase can make such fusion proteins [Hegpeth et al., Mol. Genet., 163:197- 203 (1980) and Lingappa et al., PNAS, 81:456-460 (1984) ] . These and other systems may be used to obtain expression of the cloned gene.

Sequencing analysis showed that the coding region of the 70 kd gene was flanked by an Ahalll site 30 base pairs upstream from the putative ATG start codon. An additional Ahalll site is located 367 base pairs following the TGA stop codon in the nucleotide sequence of FG21. Subsequently FG21 was digested with the restriction enzyme Ahalll. The resulting DNA fragment was 2,341 base pairs long. It was gel purified and cloned in the Smal site of the expression vector pUC9. The resulting plasmid, pFP70-47, was used to transform E. coli K12 SG936 bacteria.

A sample of this recombinant bacteria has been placed on deposit with the American Type Culture Collection (12301 Parklawn Drive, Rockville, Maryland, USA) as ATCC number 67254. The culture was deposited on November 4, 1986. This strain, SG936/FP70-47 produces a 70 kd polypeptide which can react with chagasic sera. Expression of the entire protein, however, provides as many determinants as possible on the target antigen.

K. Antigen Production

The transformed E. coli are grown in liquid culture containing 50 micrograms per ml of ampicillin to enhance plasmid ability. Cultures are harvested at an OD of 2.0 measured at 550 nm. The cells are then pelleted and washed and lysed by freeze/thaw and sonication. A detergent extraction solubilizes most of the remaining polypeptides. The 70 kd expressed product, however, remains insoluble and is harvested by centrifugation. This insoluble "cement" is denatured in urea and subsequently diluted at a high pH and the pH is then adjusted back to neutral. During the renaturation process the antigen refolds and achieves that immunologically active conformation. The details of this procedure used are identical to those used to restore enzyme activity to recombinant chymosin as described by McCaman et al., J. Biotech., 12:117-191, (1985) .

Example 2 — 74.5 kda M. Hyo Antigen and Use As a Vaccine A. Preparation of M. hyopneumoniae DNA

Strain P-57223 (obtained from Dr. Charles Armstrong, Purdue University) was grown in 1 liter of Friis medium to a density of approximately 10 ⁹ to 10 ¹⁰ color changing units per ml. The cells were harvested by centrifugation and resuspended in 2 ml

phosphate buffered saline which brought the total volume to 3.25 ml. The suspension was then mixed with a solution consisting of 24.53 g cesium chloride dissolved in 19.75 ml 10 mM Tris pH 8.0 1 mM EDTA and 1.53 of 10 mg/ml ethidium bromide was added. This was mixed with a solution consisting of 3.87 g cesium chloride dissolved in 2.15 ml 10 mM Tris pH 8.0. 1 mM EDTA, 8.9% Sarkosyl. The resulting suspension was incubated at 65"C for 10 minutes to completely lyse the cells. The DNA was separated by equilibrium buoyant density centrifugation in a Sorvall TV850 rotor at 43,000 rpm for 18 hours, and withdrawn with an 18 gauge needle. This DNA was subjected to two additional buoyant density centrifugations in a Sorvall TV865 rotor at 55,000 rpm for 7 and 18 hours respectively, each time the band of genomic DNA being removed with an 18 gauge needle. The resulting DNA solution was extracted with cesium chloride saturated isopropanol, to remove ethidium bromide, and extensively dialyzed against 10 mM Tris pH 8.0, lmM EDTA, to remove the isopropanol and cesium chloride.

B. DNA Probing of M. hvopneumonia DNA

Plasmid pEG22, described in Example 1 is purified from E. coli by methods in the art, and labeled with ³² p by nick translation using DNA polymerase I. pEG22 is used as a probe as follows: Mycoplasma genomic DNA was digested with EcoRI under the following conditions at 37 ^β c for 2 hours.

114 microliters P-5722-3 DNA 6 microliters H ₂ 0 15 microliters 10X BRL-3 (Bethesda Research Labs) 15 microliters EcoRI (Bethesda Research

Labs)

67 microliters were mixed with 0.1% Bromphenol blue, glycerol, loaded onto a 1% agarose gel and eleσtrophoresed until the blue color had migrated to within 1cm of gel end. The DNA was transferred to a nitrocellulose filter by Southern's technigue. The filter was hybridized to the DNA probe described above under conditions which allow hybridization in the absence of exact sequence identity. Hybridization: 6 X NET

5 x Denhardts solution 2 2 XX 1100 ⁶⁶ ccoouunnttss ppeerr minute probe. 37 ^β C for 18 hours

Wash: 6 X NET

0.1% SDS

3 times at room temperature,

1 time at 50 ^β C

6 X NET 1 M NaCl

90 mM Tris pH 7.6 6 mM EDTA

Southern blot analysis shows that the DNA probe hybridized to a specific EcoRI restriction endonuclease fragment of approximately 6 kB in length and thus include the antigen's gene.

C. Cloning the Gene by Hybridization

In order to identify the gene by hybridization to the pEG22 DNA probe, 200 micrograms of P-57223 DNA was digested with 120 units of EcoRI in a volume of 600 microliters. The digestion mixture was mixed with glycerol and xylene cyanol blue FF and electrophoresed on a 3.25% acrylamide gel. Five

slices of approximately 0.5 cm were cut from the gel in the size range desired and electroeluted in 0.1% SDS, 0.5 X TBE buffer. The resulting DNA fractions were extracted with phenol/chloroform, ethanol precipitated, and each resuspended in 50 microliters of lOmM Tris pH 8.0, ImM EDTA. By dot-blot analysis, (See Nuc. Acid Res. 7:1541-1552, 1979), fraction 4 was shown to contain the DNA fragment of interest.

To create a gene library enriched for the desired fragment, 7 microliters of Fraction 4 was ligated to EcoRI digested pUC9 with T4 ligase one-half of the reaction was transformed into JM83 and plated on X-gal plates where white colonies contain plasmids and inserts. Plasmid DNA from 24 white colonies was prepared and transferred to nitrocellulose by the slot-blot modification of the dot-blot procedure and probed with ³² P labeled pEG22.

Plasmid DNA preparations which hybridize to the DNA probe are subjected to EcoRI digest analysis to show that each plasmid contains the same size insert fragment, and most likely the same gene. A plasmid is selected for DNA sequence analysis which shows greater than 50% identity to pEG22.

D. Preparation of Genomic Library A preparative digest of 200 μg genomic DNA of

Mycoplasma hyopneumoniae P-57223 was done using 200 units of EcoRI in a total volume of 1 ml and 250 μl aliquots were removed at 6 min, 25 min, 42 min and 63 min. ^Λ The four preparative samples of partially digested Mycoplasma DNA were then combined (200 μg) and loaded onto an exponential sucrose gradient. The gradient was centrifuged in a Sorvall AH627 rotor at 26 k rpm for 21 hrs at 15*C. The gradient was then slowly fractioned from the bottom by collecting 15 drop fractions (90

fractions total) . 20 μl of each fraction was then run on a 1% agarose gel as described above. Fractions containing DNA fragments smaller than 18 kbp and larger than 15 kbp were pooled (fractions 32-40) and dialyzed against TE (10 mM Tris.HCl pH 7.5, 1 mM EDTA pH 8.0) to remove the sucrose. The DNA (3.5ml) was then precipitated with ethanol and resuspended to about 15 μl (1 mg/ml) under vacuum and stored at -20 ^β C.

EcoRI Arms of bacteriophage lambda-Dash were obtained from Vector Cloning Systems (StrataGene) and were ligated at a concentration of 200 μg/ml to Mycoplasma target DNA at a concentration of 25 μg/ml in a total volume of 10 μl using T4 ligase (Boehringer GmbH) at a concentration of 100 units/ml. The ligation reaction was incubated at room temperature for 2 hours. 4 μl of the ligation was then packaged into lambda particles using the in vitro packaging kit Gigapack (StrataGene). The phage- was then titered on E. coli strain P2392 (StrataGene) and found to be 7.75 x 10 ⁵ pfu/ml (3.1 x 10 ⁵ pfu/ug of lambda-Dash).

E. Screening of Library

The library is screened using the plasmid previously obtained which shows greater than 50% homology to pEG22, by the previously 'described probing procedure. DNA from positive recombinants is prepared, digested with EcoRI, analyzed by gel electrophoresis, to indicate portions of the M. hyopneumoniae genome composed of several EcoRI restriction fragments. One of the fragments is digested with EcoRI, ligated to EcoRI digested pWHA148 and transformed into E. coli strain JM83 and called pMYC016; its DNA was prepared and digested with a number of different restriction endonucleases in order to derive the restriction map shown in Figure 3.

Plasmid pWHA148 is prepared by inserting a synthetic oligonucleotide into the Hind III site of pUC18. The amino terminal coding sequence of the X-complementing peptide of B-galactosidase is shown in Figure 4, and contains 8 additional restriction sites over the parent pUC18. The oligonucleotide insert into pUC18 is shown in Figure 4 between the Sphl and Hind III sites.

An N-terminal portion of pEG22 is used by Southern analysis to hybridize to the 0.6kb

AccI-AsuII restriction fragment of pMYCOlβ. DNA sequence analysis of the 0.6 kb fragment identifies that start codon of the homologous gene.

On the restriction map of pMYCOlδ (Figure 3 the gene begins within the 0.6 kb AccI-AsuII restriction fragment, extends clockwise within the 0.4 kb AsuII - Clal, 1.2 kb Clal - Clal, and 1.4 kb Clal- Hindlll fragments, and ends short of the Hindlll site. DNA sequence analysis shows that pMYC016 contains a 74.5 kD protein homologous to the 70 kD T. cruzi heat shock antigen.

The DNA-amino acid sequence of the 74.5 kD gene is shown in Figure 5.

F. Expression of full length M.hvo. 74.5 kD antigen in E. Coli

Plasmid pMYC016 DNA (Figure 3) was digested with Accl, treated with Mung Bean nuclease to remove the single stranded Accl tails, re-ligated to delete the 1.9 kb Accl fragment in front of the 74.5 kD antigen gene and transformed into E. coli strain JM83. One transformant was named pMYC029; its DNA was digested with a number of different restriction endonucleases in order to derive the restriction map shown in Figure 6.

pMYC029 was subjected to DNA sequence analysis which showed that a spontaneous deletion had occured at the ligation juncture, where two bases were deleted and the Pstl site was retained, as shown below (only a portion of the 5' to 3 ¹ strands are represented) .

PMYC029 expected: TTGCATGCCTGCAGGTACTTTCTTTTGTCT

Pstl pMYC029 observed: TTGCATGCCTGCAGGCTTTCTTTTGTCT Pstl

This fortuitous deletion allows the in frame insertion into the pUC9 open reading frame. Plasmid pMYC029 is a low level expression plasmid.

G. Construction of PMYC031 and expression of 74.5 kD antigen fragment

Because the mycoplasma insert of pMYC029 is oriented away from the Lac promoter of pWHA148, it was desired to insert the gene into another expression vector, pUC9. The two base deletion enabled the gene for the 74.5 kD antigen to be placed in the same reading frame as the beta-galactosidase gene of E. coli vector pUC9.

In order to perform this construction, pMYC029 DNA was digested with Pstl and EcoRI, the Pstl - EcoRI fragment containing the entire 74.5 kD coding sequence was purified, ligated to the Pstl and EcoRI digested vector pUC9, and transformed into E. coli strain JM83. One transformant was named pMYC031 (Figure 7) ; its DNA was prepared and transformed into E. coli strain W3110 by the transformation procedure described above.

H. Construction of PMYC032

It is known that TGA codons encode the amino acid tryptophan in mycoplasma but normally terminate peptide chain elongation in E. coli and that the trpT176 gene, a mutant tryptophan t-RNA which recognizes UGA (Raftery, et al.. Jour. Bacteriol., 158:849-859), allows peptide chain elongation at TGA codons in E. coli laboratory mutants. We reasoned that the addition of trpT176 to expression vectors would allow E. coli peptide chain elongation at the mycoplasma TGA codons of cloned genes.

Plasmid pCAMlOl was purchased from James Curran (University of Colorado) as a convenient source of the trpT176 gene and is shown in Figure 8. DNA from pCAMlOl was digested with EcoRI, the

0.3 kb EcoRI fragment which contains the trpT176 gene was purified, ligated to EcoRI digested pMYC031, and transformed into E. coli strain W3110. One transformant was named pMYC032 and its restriction map is shown in Figure 9.

I. Expression of M. hyopneumoniae 74.5 kD antigen in E. coli

A W3110 (pMYC032) transformant was selected, grown in L-broth, lysated as previously described, and a portion subjected to polyacrylamide gel electrophoresis. New 75 kD and 43 kD proteins were identified by gel electrophoresis which represented approximately 5% and 0.1% of total E. coli protein, respectively. The pMYC032 75 kD protein was shown by Western blot to react with the previously described pig antisera raised against the 74.5 kD M. hyopneumoniae antigen.

An improved expression plasmid pMYC087 has been deposited with the ATCC on June 30, 1989 as ATCC number 68030. It contains an in vitro change of TGA to TGG (Tryptophane) at codon position 211 (see Figure 5) .

J. Use of the recombinant form of Mycoplasma hyopneumoniae 74.5 kD antigen as a vaccine

A W3110 (pMYC032) transformant from Example 2 was selected, grown in M-9 minimal medium in a 14 liter Chemap fermenter to a cell density of 110 O.D. 600, and 120 g (wet weight) of cells were harvested from 500 ml by centrifugation. A suspension was prepared consisting of 2.3 g of cells per 10 ml of PBS containing 12 mM EDTA, 0.5 mg/ml lysozyme. The suspension was incubated at 25 *C for 15 minutes. sonicated on ice for 2 minutes in 30 second bursts, centrifuged at 13,000 g for 10 minutes at 4 ^β C, and the soluble fraction reserved as product. A portion of the product was subjected to polyacrylamide gel electrophoresis. The recombinant form of 74.5 kD antigen made up approximately 25% of the soluble protein and the yield dosages were prepared in PBS at 100 and 500 μg per dose and emulsified on ice with equal volumes of Freund's incomplete adjuvant (Sigma) immediately prior to use.

Vaccination Test Week 0 Three litters of Hampshire, Hampshire X Duroc, and York piglets taken by Caesarian section. Week 1 Piglets divided randomly into 7 pig dosage groups and each vaccinated sub-cutaneously in leg. Week 3 Booster vaccination, as above, opposite leg. Week 8 Challenge administered by trans-tracheal inoculation of 10 ⁶ CCU Mycoplasma hyopneumoniae. Week 12 Necropsy of experimental animals and infection controls.

The results were as follows:

* Number of pigs with a lung lesion score greater than 5% ** % of lung surface effected (mean ± std. dev.)

Example 3. — The 70 kD Hsp Analog from Mycoplasma Gallisepticum.

A. Preparation of Genomic Libraries

Two strains of M. gallisepticum F-K810 and R, were obtained from R. Yamamoto (U. C. Davis) and grown in F-80 media for the preparation of genomic DNA. (Nord Veterinaermed. 27:337-339) .

Approximately 22 ml of stationary phase M. gallisepticum culture was centrifuged at 13,000 X g at 4"C for 10 minutes to harvest mycoplasma cells. The supernatant was discarded and the cell pellet was resuspended in PBS to wash. Cells were harvested by centrifugation after washing. The cells were washed a total of three times with PBS and the resulting cell pellet frozen at -78"C. After thawing, the cells were resuspended in 2 ml 10 mM Tris-HCl pH 8.0, 50 mM EDTA, 1% SDS, and 100 μg Proteinase K was added. The cells were lysed at 50 ^β C for one hour with occasional mixing. The lysate was extracted with phenol then with chloroform/isoamyl alcohol to remove cellular debris.

The DNA-containing aqueous phase was dialyzed against 4 liters of 10 mM Tris-HCl, 5 mM EDTA twice, and 10 mM Tris-HCl, 1 mM EDTA once. From each strain, 60 μg of DNA was recovered, an amount sufficient for restriction analyses. Southern blot analyses, and library construction. Restriction digests indicated that the

two strains are similar to each other with limited restriction fragment length polymorphism.

B. Mixed oligonucleotide probes for isolating the Hsp70 protein from M. gallisepticum When the Hsp70 amino acid sequence from T.

Cruzi aligned with the amino acid sequence of the M. hyopneumoniae 74.5 kD antigen of Example 2. Several regions containing sequences six amino acids in length are identical in both sequences. The array of DNA sequences which could encode these amino acid regions was determined. The two amino acid sequences corresponding to nucleotide sequences having the lowest degeneracy, were selected for use as oligonucleotide probes. These were synthesized as follows:

COD1159 Ile-Ile-Asn-Glu-Pro-Thr

ATA-ATA-AAC-GAA-CCA-AC C C T G C T T G

T

COD1218 Gly-Gly-Gly-Thr-Phe-Asp GGA-GGA-GGA-ACA-TTC-GA C C C C T G G G G T T T T

Pools of the above oligonucleotides were labeled with ³² P using polynucleotide kinase (BRL) and used to probe Southern transfers of Hindlll digested M. gallisepticum chromosomal DNA. After 50 ^β C washes in 6X NET, 0.1 SDS, COD 1159 hybridized to two Hindlll fragments. COD 1218 hybridized to two Hindlll fragments at 45 ^β C under likewise identical conditions. Both probes hybridize to an apparently identical 3.4 kb fragment, where as the other fragments differ in length

and probably represent hybridization due to non¬ specific sequence homology. The hybridization of both probes to the same 3.4 kb Hindlll fragment is highly significant as the probability that hybridization of both probes to the same fragment of genomic DNA results from non-specific sequence homology is less that 2X10 ^"3 . The hybridization patterns for DNA purified from strain R strain and F-K810 strain of M. gallisepticum were identical to one another. Plasmid DNA from pMYC087, containing the gene for M. hyopneumoniae (ATCC 68030 deposited with the American Type Culture Collection on June 30, 1989) was labeled using the Boeringer Mannheim nonradioactive Southern hybridization kit (Genius kit) and used to probe a Southern transfer of EcoRI and Hindlll restriction digested chromosomal DNA from the F-strain and M. hyopneumoniae as a positive control. The probe detected bands of the expected size in the M. hyopneumoniae genome and an EcoRI band of 6.8 kb and a Hind III band of 3.3kb in the M. gallisepticum digests after washes at 65 ^β C in 0.5X SSC and 0.1% SDS.

C. Preparation of Size Selected Genomic Libraries The general approach for cloning the hsp antigen gene from M. gallisepticum was analogous to the procedure used for the T. cruzi 70 kD hsp. M. gallisepticum genomic DNA, 1 μg from both the R strain and the F-K8 I 0 strain, was digested to completion with the bacterial restriction endonuclease Hindlll and separated on 3.25% polyacrylamide gels. DNA from four gel slices containing restriction digest fragments ^between 2 and 5 kb was electroeluted. An aliquot of DNA electroeluted from each of the four gel slices was subjected to agarose gel electrophoresis, transfered to a nitrocellulose membrane by Southern transfer and probed with ³² P-labeled C0D1159 to identify the fraction which contains the 3.3kb hybridizing Hindlll band. In

this way, a positive DNA fraction was identified. This positive DNA fraction was then ligated into Hind III digested pUC9 and transformed into E. coli DH5a.

D. Identification of Positive Clones For each strain, 12 and F-K810, plasmid DNA from forty-eight recombinant clones was isolated by the method of Holms and Quigley 1981 (Anal. Biochem. 114:193-197, 1981), transferred to nitrocellulose using a Bio-Rad dot blot apparatus, and probed with COD1159 in the case of the R-strain or both COD1159 and COD1218 on duplicate blots In the case of strain F-K810. ^"

One positive isolate was found for each strain. Plasmid pMGA4 contains a positive R-strain insert and has been deposited with the American Type Culture Collection on 1989 with the designation . A map of pMGA4 is provided in

Figure 10. The sequence of of the M. gallispeticum Hsp70 DNA and the derived amino acid sequence is provided in Figure 11.

E. Expression, Purification and Use as a Vaccine

DNA from pCAMlOl was digested with EcoRI, a 0.3 kb EcoRI fragment including trpT176 was purified, ligated to EcoRI digested pUC9, transformed into E. coli strain JM83, and one transformant was named pWHA160 (see Figure 12) .

Plasmid pMGA4 DNA was digested with Hindlll and Bglll, ligated to Hindlll and BamHI digested pWHAlβO, digested with BamHI and Bglll, and transformed into E. coli strain DH5a. One transformant was named pMGAlO. The MGA10 transformant was grown in L-broth at 37 ^β C, and the cells harvested by centrifugation and frozen. The cell pellet from 4 ml of culture was resuspended in 100 μl of a solution consisting of 0.5 mg/ml hen egg-white lysozyme dissolved in 25 mM Tris pH 8.0 10 mM EDTA; and incubated at 25°C for 10 minutes.

A portion of the resulting lysate was subjected to polyacrylamide gel electrophoresis and a new 67 kD protein was identified. Western blot analysis, using pig anti-74.5kD serum, showed that the new 67 kD protein was immunologically related to Hsp70.

F. Use of Bacterially Produced M. gallisepticum HSP 70 Protein to Raise an Immune Response in Chicken

The purified M. gallisepticum protein is concentrated by lyophilization and resuspended to a final concentration of 0.5-2.0 mg/ml in 0.1% SDS. For use, the immunizing antigen is formulated in one volume of protein concentrate to three volumes of oil carrier consisting of 5% Arlacel, 94% Drakeol 6-VR and 1% Tween 80. The dose of the antigen employed is 100 μg/dose. Chicken receive the formulated vaccine by subcutaneous injection. A booster vaccination by the same route is done two weeks later.

Numerous modifications and variations of the present invention are possible in light of the above teachings; therefore, within the scope of the appended claims the invention may be practiced otherwise than as particularly described.

Table 1. Representative Pathogenic Organisms.

1: DISEASE AGENTS

1.1: BACTERIA

1.1.1: ACTINOBACILLUS SPP.

1.1.1.1: Actinobacillus lingiresii

Mastitis infections in cattle, sheep, swine, equine 1.1.1.2: Also known as Haemophilus swine pneumoni

1.1.2: BACILLUS SPP.

Bacillus anthracis

Anthrax, an acute febrile disease of all mammals

1.1.3: BORDETELLA SPP.

1.1.3.1: B. bronchiseptica - repiratory disease in many species

1.1.3.2: B. pertussis - whooping cough in man 1.1.4: BORRELIA SPP.

1.1.4.1: B. burgdorferi - Lyme disease in dogs, deer, man

1.1.5: BRUCELLA SPP.

1.1.5.1: Brucella abortus, B. suis, B. melitensis brucellosis in cattle, sheep, swine, equine, canine, man

1.1.6: CAMPYLOBACTER SPP. 1.1.6.1: Campylobacter fetus causes infertility and embryonic death in cattle, swine, sheep, equine

(vibriosis) 1.1.6.2: Vibrio cholerae - cholera in man

1.7: CHLAMYDIA SPP.

1.7.1: C. psittaci - respiratory disease in birds

1.7.2: C. cati - conjunctivitis in cats

1.8: CLOSTRIDIUM SPP. 1.8.1. : C. chauvoei blackleg in cattle and sheep 1.8.2: C. septicum malignant edema in cattle and sheep 1.8.3: C. haemolyticum red water in cattle 1.8.4: C. novyi black disease in cattle and sheep 1.8.5: C. βordelli big head disease in cattle and sheep 1.8.6: C. perfringens enterotoxemia in cattle, sheep, swine, equine, gas gangrene in man

1.1.8.7: C. tetani tetanus in all mammals 1.1.8.8: C. boutulinum

8 types, causing botulism in all species

1.1.9: CORYNEBACTERIUM SPP.

1.1.9.1: C. diptheria - Diptheria in man

1.1.9.2: C. pyogenes -causes pyogenic processes in cattle, sheep, swine, goats 1.1.9.3: C. renale - cystitis in cattle 1.1.9.4: C. equi - pneumonia in horses

1.1.10.1: ERYSIPELOTHRIX SPP.

1.1.10.1: Erysipelothrix rhusipothiae - erysipelas in swine and man

1.1.11: HAEMOPHILUS SPP.

1.1.11.1: H. influenza, respiratory disease in various species 1.1.11.2: H. paraninfluenza, H. parasuis, H. suis - respiratory disease in swine

1.1.12: KLEBSIELLA SPP.

1.1.12.1: Klebsiella pneumoniae - Pneumonia and septicemia in animals and man

1.1.13: LISTERIA SPP.

1.1.13.1: L. onocytogenes - Listeriosis encephalitis in ruminants

1.1.14: MYCOBACTERIUM SPP.

1.1.14.1: M. tuberculosis, M. bovis, M. avium -

Tuberculosis in various species 1.1.14.2: M. paratuberculosis - Johne's disease in cattle, sheep, and goats

1.1.15: PASTEURELLA SPP.

1.1.15.1: P. pestis - Plague in man and rodents 1.1.15.2: P. haemolytica, P. multocida respiratory disease in many species

1.1.16: PSEUDOMONAS SPP.

1.1.16.1: P. aeruginosa - respiratory disease in various animals 1.1.16.2: P. mallei - Glanders disease in dogs and cats

1.1.17: SALMONELLA SPP.

1.1.17.1: S. typhimurium - enteric disease in a number of species 1.1.17.2: S. typhisuis, S. choleraesuis - enteric disease in swine 1.1.17.3: S. typhi - Typhoid fever

1.1.17.4 S. paratyphi - Paratyphoid - A in man 1.1.17.5 S. gallinaru - fowl typhoid 1.1.17.6 S. pullorum - pullorum disease in chickens

1.1.18: STREPTOCOCCUS SPP.

1.1.18.1: S. agalactiae, S. dysgalactiae - mastitis in numerous species

1.1.18.2 S. dispar - enteritis in numerous species 1.1.18.3 S. equi - cholic in horses 1.1.18.4 S. genitalium - uterine infections in horses

1.1.18.5: S. pneumoniae - respiratory disease in man

1.1.19: STAPHYLOCCUS SPP.

1.1.19.1: S. aureus - mastitis in many species

1.1.19.2: S. epidermidis - pyoderma in many species

1.1.20: TULAREMIA SPP.

1.1.20.1: Francisella tularensis - Tularemia in man

.6: HERPESVIRIDAE

.6, H. simplex Type 1 - Oral Herpes in man .6. H. simplex Type 2 - Genital Herpes in man .6. Epstein-Barr Virus - Mononucleosis in man .6. H. s iae - Herpes B. in primates .6. H. suis-Adjuskie's disease - pseudorabies in swine and cattle

.6. H. canis - Respiratory infection of dogs .6. H. equi - Equine rhinopneu onit s respiratory and abortion in horses

1.2 .6.8 H. bovis - IBR (Infectious Bovine

Rhinotracheitis) in cattle

1.2 6.9: H. feliβ - FVR (Feline Viral

Rhinotracheitis)

1.2.6.10: Laryngotracheitis virus -

Laryngotrachetis in birds

1.2.6.11: Marek'β Disease Virus - Merek's disease in birds

Feline caliciviruβ (FCV)

1.2.6.12: Cytomegaloviruses-many diseases in various animals

1.2.13: POXVIRIDAE

1.2.13.1 SMALLPOX - WAS A MAJOR DISEASE IN MAN 1.2.13.2 VACCINIA - USED TO VACCINATE ACAINST

SMALLPOX

1.2.13.3 C0WP0X - SKIN DISEASE OF CATTLE 1.2.13.4 SWINEPOX - SKIN DISEASE OF SWINE 1.2.13.5 ECTROME IA - MOUSEPOX 1.2.13.6 AVIPOXVI USES - FOWLPOX, CANARYPOX,

PIECEONPOX, TURKEYPOX,

1.2.13.7: CAPRIPOXIVIRUSES - LUMPY SKIN DISEASE IN

SHEEP AND GOATS 1:2:13:8: PARAPOXIVIRUSES - "SORE MOUTH" IN SHEEP

AND GOATS, BOVINE PAPULAR STOMATITIS

1.3: MYCOPLASMA

1.3.1: M. mycoides - Bovine respiratory disease

1.3.2: M. bovis - bovine mastitis

1.3.3: M. bovigenitalium - bovine epidymitiε

1.3.4: M. bovoculi - Infectious bovine keratoconjuntivitis 1.3.5: M. bovirhinis and M. dispar - respiratory disease 1.3.6: M. hyorhinis and M. hyosynoviae respiratory disease and lameness in swine 1.3.7: m. gallisepticum and M. synoviae respiratory disease in poultry

1.4: RICKETTSIA

1.4.1: Rickettεiaceae

1.4.1.1: R. prowazekii - Typhus fever

1.4.1.2: R. typhi - murine thyphuε in ^* man

1.4.1.3: R. rickettsii - Rocky Mountain Spotted

Fever 1.4.1.4: Coxiella Burnet i - Q Fever in cattle, sheep, goats, birds, and man 1.4.1.5: Cowdria ruminatum - Heartwater in cattle 1.4.2: Anaplasmataceae 1.4.2.1: A. marginale and A. centrale

Anaplasmosis in cattle 1.4.2.2: A. ovis - Anaplasmosis in sheep 1.4.2.3: Hae obartonella felis - Hemobartonelloεis in cats (Feline Infectious Anemia) 1.4.2.4: Haemobartonella canis - Hemobartonelloεis in dogs 1.4.2.5: Eperythrozoon - parasites which attack red blood cells in various animals

1.5: CHLAMYDIACEAE

1.5.1: C. psittaci - Psittacosis - a febrile pulonary disease in man and birds 1.5.1.1: also causes Sporadic Bovine

Encephalomyelitis and polyarthritis in cattle 1.5.1.2: also causes Epizootic Abortion in cattle and sheep 1.5.1.3: also causes pneumonia in cattle and hβeep 1.5.1.4: also causes Feline Pneumonitis in cats 1.5.2: C. trachomatis - Veneral disease in man

1.6: SPIROCHAETALE

1.6.1: Leptospria spp.

41

1.6.1.1: L. canicola, L. grippotyphosa, L. hardjo,

L. icterohaaemorrhagiae 1.6.1.2: L. po ona - all cause disease in various species 1.6.2: Treponema SPP.

1.6.2.1: T. hyodysenteriae - Swine Dysentery 1.6.2.2: T. pallidum - Syphilis in man 1.6.3: Borrelia spp. 1.6.3.1: B. anserina 0 Avian borrelosis or spirochaetosis in birds

1.7: FUNGAL DISEASES

1.7.1: Aεperigillus fumigatus - brooder pneumonia in poultry 1.7.2: Blastomyces dermatitidis - pulmonary infection in animals and man 1.7.3: Candida albicans - Thrush in birds, cats, cattle, swine and man 1.7.4: EPIDERMOPHYTON SPP.

1.7.4.1: E. floccosum - Athletes foot in man 1.7.5: HISTOPLASMA SPP. 1.7.5.1: H. capsulatum - systemic fungal infection in many species 1.7.6: MICROSPORUM SPP. 1.7.6.1: M. canis - ringworm in dogs, cats, man, cattle 1.7.5.2: M. gypseum - ringworm in dogs, cats, horses, man 1.7.7: TRICHOPHYTON SPP. 1.7.7.1: T. rubrum - ringworm in dogs, primates, and man 1.7.7.2: T. equinum and T. quinkeanum - ringworm in horses 1.7.8: KYCOTOXICOSES (Moldy feed) caused by numerous filamentous fungi 1.7.8.1: Aflatoxins, Mycotoxins, Aspergillus toxins

2: PARASITES

2.1: PROTOZOA

2.1.1: AMEBA

2.1.1.1: Enta oeba h βtolytica - A ebic dysentery in dogs, cats, pigs and man 2.1.2: BABESIA SPP. 2.1.2.1: Babesia bigemina and B. bovis are major causes babesiosis in cattle

(babesiosis also known as Texas fever,

Tick Feber, Prioplasmosis) 2.1.2.2 _: B. argentina, B. Divergens, and B. major also cause babesiosis in cattle 2.1.2.3 _: B. canis and B. Gigsoni - cause babesiosis in dogs

2.1.2.4: B. equi and B. caballi cause babesiosis in horses 2.1.2.5: B. motasi and B. ovis - cause babesiosis in horses 2.1.2.6: B. trautmanni - babesiosis in pigs 2.1.2.7: B. felis - babesiosis in cats

2.1.3: COCCIDIA

2.1.3.1: EIMERIA SPP.

E. tenelia, E. necatrix, E. brunetti, E. acervulina, E. maxima in chickens

E. bovis, E. zuernii in cattle 2.1.3.2: ISOSPORA SPP.

I. suis - seine 2.1.3.3: SARCOYSTIS SPP.

S. tenelia - infects sheep

S. blanchardi, S. fayerei, and S. fusiformis - infect cattle

S. iescheriana - infects swine 2.1.3.4: TOXOPLASMA GONDII wide spread distribution, especially in cats, swine, sheep, humans causes abortion, birth defects, deafness 2.1.3.5: CRYTOSPORIDUM SPP. cause diarrhea in cattle, swine, sheep, birds, and man

A component of AIDS complex 2.1.4: GIARDIA SPP.

2.1.4.1: G. lamblia - infects man 2.1.4.2: G. canis - infects dogs 2.1.4.3: G. cati - infects catas 2.1.4.4: G. bovis - infects cattle 2.1.5: LEISHMANIA SPP. 2.1.5.1: L. donovani - visceral leishmania in man, dogs, cats, cattle sheep 2.1.5.2: L. tropica - cutaneous leβhmania in man, dogs, and rodents 2.1.5.3: L. braziliensis - American leishmaniasis in man, dogs, and cats 2.1.6: PLASMODIUM SPP.

2.1.6.1: Plaβmodium falciparum - malaria in man 2.1.6.2: P. malariae, P. vivax, and P. ovale - malaria in man 2.1.6.3: P. gallinaceum - avian malaria 2.1.6.4: numerous Plasmo ium spp. cause malaria in man 2.1.7: PNEUMOCYSTOSIS SPP. 2.1.7.1: P. carinii - cause of pneumonia in man, dogs, horses, swine, goats 2.1.7.2: A component of the AIDS complex 2.1.8: THEILERIA SPP. 2.1.8.1: T. parva, T. annulata, T. mutans, T. lawrencβi and T. cervi

all cause East Coast Fever in cattle, buffalo and deer

2 .8.2: T. hirci and T. ovis infect sheep 2 .9: TRITRICHOMONAS SPP. 2 .9.1: T. vaginalis - a veneral disease of man 2, T. foetus - causes trichomonaiasis, a genital infection of cattle

Trichomonas gallinae - causes tricomoniasis, a G.I. infection in birds

2.1.10: TRYPANOSOMA SPP. 2.1 .10.1: T. cruzi - Chagas disease in man 2.1.10.2: T. congolense —■ Trypanoεomiasis in cattle, horses, pigs, dogs

2.1.10.3: T. rhodesiense and T. gambiense sleeping sickness in man and antelope

2.2: HELMINTHS 2.2.1: TREMATODES 2.2.1.1: FLUKES

Fasciola hepatica - cattle and sheep

F. gigantica - cattle and sheep

Fascioloides magna - cattle, sheep and swine

Dicrocoelium dendriticum - cattle, sheep, horses, swine, man 2.2.1.2: SCHISTOSOMIASIS

Schistosoma japonicum, S. hematobium, S. mansoni, S. intercalatum - man

S. bovis, S. spindale, S. mattheei cattle, sheep, goat, horse

S. nasalis, S. indium - cattle, sheep, goats 2.2.1.3: PARAGONI IASIS (SALMON POISONING)

Paragonimus westermani - man

P. kellicotti - mink, dog, cat, pig 2.2.2: CESTODES 2.2.2.1: TAPEWORMS

Taenia aaginata, and T βolium - man

(cysticercus)

Echinococcus granulosus, and E. ultilocularis - man, dog

Taenia hydatigena, T. ovis - dog

T. pisiformis - dog and cat

Dipylidium caninum - dog and cat

Anoplocephala magna, A. perfoliata horses

2.2. ECHINOCCUS SPP. 2.2. DIPHYLLOBOTHRIUM SPP.

2 2. SPIROMETRA SPP.

2 2.2.5: FASCIOLA SPP. 2 2.3: NEMATODES 2 2.3.1: FΣLARIAL PARASITES

Dirofilaria im itis - heartworm in dogs 2.2.3.2: HOOKWORMS

44

A. duodenale and Necator americanuε - hookworm in man

A. caninum, A. braziliense - dogs and cats ■

Uncinaria stenocephala - dogs Bunostomum phlebotomum - cattle

B. trigonocephalum - sheep and goats Globecephalus urosubulatus - swine

2.2.3.3: KIDNEY WORMS

Dicoctophyma renale - dog 2.2.3.4: LUNGWORMS

Dictyocaulus viviparus - lungworm in cattle

D. filaria - lungworm in sheep, goat, cattle

Muellerium capillaris - lungworm in sheep

Metastrongylus apri, M. pudendotectus, M. salmi - swine 2.2.3.5: NODULAR WORMS

Oesophagostomum denatum - swine

O. radiatium, and O. columbianum cattle, sheep, goats 2.2.3.6: ONCHOCERIASIS

Onchocerca volvulus - blindness in humans 2.2.3.7: PINWORMS

Enterobius vermicularis - man

Oxyuris equi - horses

Skrjabinema ovis - sheep and goats 2.2.3.8: ROUNDWORMS

Ascaris lumricoides - roundworms in man, swine

Toxocara canis - dogs

Toxocara cati - cats

Paraβcaris equorum - horse

Ascaridia galli - chickens 2.2.3.9: SPIROCERCAS

Spriocerca lupi - dogs 2.2.3.10: STOMACH WORMS

Habronema, H. ajus, H. megastoma horses 2.2.3.11: STRONGYLES

Strongylus vulgaris, S. equinus, S.

•dentatus - horses 2.2.3.12: STRONGYLOIDS

Strongyloides westeri - horses

S. stercoraliβ - man

S. ranβomi - βwine

S. canis - dogs

S. tumefaciens - cats 2.2.3.13: TRICHINA

Trichinella βpiralis - trichinella in swine and man 2.2.3.14: TRICHOSTRONGYLES

45

Ostertagia ostertagi - cattle

Haemonchus placei - cattle

Trichostronglyus axei - cattle

Cooperia punctate - cattle

Haemonchus contortus, Cuperia curticei - sheep

Ostertagia circu cincta - sheep

Trichostronglyus colubriformis - equine, swine, cattle, sheep

Nematodirus filicollis - cattle and sheep

Hyostrongylus rubidus - swine

2.2.3.15: WHIPWORMS

Trichuris ovis - cattle, sheep, goats

Trichuris suis - swine

T.. trichiura - man

T. vulpis - dogs

2.3: ARTHROPODS

2.3.1: ACARIASIS 2.3.1.1 Demodex folliculoru - mange in dogs, cats, cattle, swine, sheep, man

2.3.1.2; Demodex phylloides - mange in swine 2.3.1.3 Der acentor andersoni - wood tick

2.3.1.4 Dermanyssus gallinae - red mite in poultry

2.3 1.5 Ixodes holocyclus - Austrailian tick

2.3 1.6 Notoedres cati - cat mange

2.3.1.7 Otobiuβ megnini - spinose ear tick 2.3.1.8 Ostodectes cynotis - ear mite in dog. cat 2.3.1.9 Psoroptes communis - scab in cattle sheep, horses

2.3.1.10: Sarcoptes scabiei, S. canis - mange in dogs

2.3.2: DIPTERA

2.3.2.1 BOTFLIES

Gasterophilus intestinaliβ equine botfly

Gasterophilus hemorrhoidalis equine nose botfly

Gasterophilus nasalis - equine chinfly

Gasterophilus pecorum - European botfly

Gasterophilus inermis - botfly

Oestrus ovis - βheep botfly

2.3.2.2: FLEAS

Otenocephalides canis - dog flea

Ctenocephalides felis - cat flea

2.3.2.3 FLIES

Chrysopβ βpp. - deer flies

Fannia βpp. - little house flies

Haematobia irritans - horn flies

Haematotobia irritans exigua - buffalo fly (similar to horn fly)

Hermetia illucens - black soldier fly

Hybomitra spp. common fly

Hydrotaea irritans - head flies Ophyra spp. - dump flies Melophagus ovinus - sheep ked Musca ^• autumnal!s - face flies Musca domestica - house fly Muscina spp. - false stable flies Simulium βpp. - black flies (no-see-ums) Stomoxys calcitrans - stable flies Tabanus βpp. - horse files

2.3.2.4: GRUBS

Hypoderma lineatum, H. bovis - Heel fly, cattle grub

Calitroga americana - screw-worm fly Dermatobia hominis - cutaneous myiasis in man, cattle sheep, dogs, cats Cochliomyia hominivorax - blow fly

2.3.2.5: LICE

Damalinia bovis - cattle biting louse

Anoplura spp. - cattle louse

Haematopinus euryεternus - shortnosed cattle louse

Linognathus vituli - longnosed cattle louse

Solenoptes capillatus - little blue cattle louse

Haematopinus suis - swine lice

Haematopinus asini - horse sucking louse

Trichodectes canis - dog louse

Felicola βubrostrata - cat louse

2.3.2.6: MOSQUITOES Aedes spp. Anopheles βpp. Culex βpp. Culiβeta βpp. Psorophora βpp.

Disease Pathoqen(β)

Malaria Plaβmodium falciparum

P. vivax P. malariae P. ovale P. berghei etc.

Chagas' Disease Trypanosoma cruzi

African Trypanosomiasis Trypanosoma gambiense

T. rhodesiense T. brucei etc.

LeishmaniasiB Leishmania donovani

L. infantum

L. tropica

L. mexicana

L. braziliensis

L. chagaεi etc.

Leprosy Mycobacterium leprae

Tuberculosis Mycobacterium tuberculoεis

Filariasis Brugia malayi B. timori

Onchocerca volvulus Wuchereria bancrofti

Schistosomaasis Schistosoma mansoni S. japonicum

Leptoεpirosis Leptospira interroganε L. iceterohaemorrhagiae L. hebdomadiε L. pomona etc.

Plague Yersinia pestis

Typhoid Fever Salmonella typi

Cholera Vibrio cholerae

Diptheria Corynebacterium diphtheriae

Ly e Diεease Borrelia burgdorferi

Pneumonia/bronchitis Streptococcus pneumoniae Mycoplasma pneumoniae Branhamella catarrhalis Bordetella bronchiseptica Haemophilus influenza

Urethritis Mycoplasma hominiβ Ureasplama urealyticum

Giardia Giardia lamblia

Amoebic dynβentery Entamoeba hiβtolytica

Syphilis Treponema pallidum

Chla ydia • Chlamydia trachomatis

Candidiasis Candida albicanε

C. glabrata

Gonorrhea Neisseria gonorrhoeae

Toxopϊaεmosis Toxoplasma gondii

Tetanus Clostridium tetani

Caries Streptococcus mutans

Whooping cough Bordetella pertussis

Q fever endocarditis Coxiella burnetti

Anthrax Bacillus anthracis

Brucellosis Brucella abortus

Numerous modifications and variations of the present invention are possible in light of the above teachings; therefore, within the scope of the appended claims the invention may be practiced otherwise than as particularly described.