Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
VACCINIA VIRUS H3L AND B5R SPECIFIC MONOCLONAL ANTIBODIES AND METHODS OF MAKING AND USING SAME
Document Type and Number:
WIPO Patent Application WO/2009/048769
Kind Code:
A3
Abstract:
The invention relates to antibodies and subsequences thereof that specifically bind to poxvirus B5R envelope protein, antibodies and subsequences thereof that specifically bind to poxvirus H3L envelope protein, and combinations thereof.

Inventors:
KATO SHINICHIRO (US)
GRANGER STEVE (US)
CROTTY SHANE (US)
RICKERT SANDRA (US)
Application Number:
PCT/US2008/078316
Publication Date:
August 06, 2009
Filing Date:
September 30, 2008
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
KIRIN PHARMA KK (JP)
JOLLA INST ALLERGY IMMUNOLOG (US)
KATO SHINICHIRO (US)
GRANGER STEVE (US)
CROTTY SHANE (US)
RICKERT SANDRA (US)
International Classes:
C07K16/08; A61K39/42; A61P31/20
Domestic Patent References:
WO2003068151A22003-08-21
Other References:
BELL E ET AL: "Antibodies against the extracellular enveloped virus B5R protein are mainly responsible for the EEV neutralizing capacity of vaccinia immune globulin", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 325, no. 2, 1 August 2004 (2004-08-01), pages 425 - 431, XP004520326, ISSN: 0042-6822
LAW MANSUN ET AL: "Antibody neutralization of the extracellular enveloped form of vaccinia virus", VIROLOGY, ACADEMIC PRESS,ORLANDO, US, vol. 280, no. 1, 1 February 2001 (2001-02-01), pages 132 - 142, XP002175487, ISSN: 0042-6822
ALDAZ-CARROLL L ET AL: "EPITOPE-MAPPING STUDIES DEFINE TWO MAJOR NEUTRALIZATION SITES ON THE VACCINIA VIRUS EXTRACELLULAR ENVELOPED VIRUS GLYCOPROTEIN B5R", JOURNAL OF VIROLOGY, THE AMERICAN SOCIETY FOR MICROBIOLOGY, US, vol. 79, no. 10, 1 May 2005 (2005-05-01), pages 6270/6271, XP009052392, ISSN: 0022-538X
Attorney, Agent or Firm:
WETHERELL, John et al. (LLPP.O. Box 1050, Mclean VA, US)
Download PDF:
Claims:

What Is Claimed: An isolated or purified antibody or subsequence thereof that specifically binds to poxvirus B5R envelope protein, wherein said antibody or subsequence comprises a sequence at least 80% identical to any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12, and a sequence at least 80% identical to any light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10 An isolated or purified antibody or subsequence thereof that specifically binds to poxvirus H3L envelope protein, wherein said antibody or subsequence comprises a sequence at least 80% identical to any heavy chain variable region sequence set forth as SEQ ID NO 14, and a sequence at least 80% identical to any light chain variable region sequence set forth as SEQ ID NO 16 An isolated or purified antibody or subsequence thereof that specifically binds to poxvirus B5R envelope protein, wherein said antibody or subsequence comprises any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12, and any light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10, wherein said antibody or subsequence thereof has one or more amino acid additions, deletions or substitutions of SEQ ID NOs 2, 6 or 12, or SEQ ID NOs 4, 8 or 10 An isolated or purified antibody or subsequence thereof that specifically binds to poxvirus H3L envelope protein, wherein said antibody or subsequence comprises any heavy chain variable region sequence set forth as SEQ ID NO 14 and any light chain variable region sequence set forth as SEQ ID NO 16, wherein said antibody or subsequence thereof has one or more amino acid additions, deletions or substitutions of SEQ ID NO 14, or SEQ ID NO 16 The antibody or the subsequence thereof of claims 3 or 4, wherein said substitution is a conservative amino acid substitution The antibody or the subsequence thereof of claims 3 or 4, wherein said substitution is a non- conservative amino acid substitution The antibody or the subsequence thereof of claims 3 or 4, wherein said substitution is located within a complementarity determining region (CDR) or a framework (FR) region The antibody or the subsequence thereof of claims 3 or 4, wherein said substitution is located outside of a CDR or a FR region

An isolated or purified antibody or subsequence thereof that inhibits or competes for binding of the antibody or subsequence thereof of claims 1 or 3 to poxvirus envelope protein B5R or B 6 , or to a B5R or B 6 homolog The antibody of claim 9, wherein the antibody inhibits at least 5 0% of the binding of the antibody or subsequence thereof of claims 1 or 3 to variola poxvirus B 5 R envelope protein or to poxvirus B6 envelope protein, or to the monkeypox B 5 homolog, as determined in an ELISA assay The antibody of claim 9, wherein the antibody or subsequence thereof is human or humanized An isolated or purified antibody or subsequence thereof that inhibits or competes for binding of the antibody or subsequence thereof of claims 2 or 4 to poxvirus H3L envelope protein The antibody of claim 12, wherein the antibody inhibits at least 50% of the binding of the antibody or subsequence thereof of claims 2 or 4 to poxvirus H3L envelope protein, as determined in an ELISA assay The antibody of claim 12, wherein the antibody or subsequence thereof is human or humanized The antibody or subsequence thereof of any of claims 1, 3, or 9 wherein the poxvirus B5R envelope protein comprises or consists of a sequence set forth in SEQ ID NO 41 , and the variola poxvirus B6 envelope protein comprises or consists of a sequence set forth in SEQ ID NO 1 18 The antibody or subsequence thereof of any of claims 2, 4, or 12, wherein the poxvirus H3L envelope protein comprises or consists of a sequence set forth in SEQ ID NO 53 The antibody or subsequence thereof of any of claims 1 , 3, or 9, wherein the antibody or subsequence thereof binds to an epitope comprised within SEQ ID NO 41 or within SEQ ID NO 118 The antibody or subsequence thereof of any of claims 2, 4, or 12, wherein the antibody or subsequence thereof binds to an epitope comprised within SEQ ID NO 53 The antibody or subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the isotype comprises IgM, IgG, IgA, IgD or IgE

The antibody or subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the IgG or IgA isotype is selected from IgGl, IgG2, IgG3, and IgG 4 , and IgAl and IgA2 The antibody subsequence of any of claims 1 to 4, 9 or 12, wherein the antibody subsequence is selected from Fab, Fab', F(ab')2, Fd, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv) and V L and V H domain fragments An isolated or purified antibody or subsequence thereof that inhibits or competes for binding of mouse monoclonal antι-B5R antibody B 12 6 , B 1 16 or B96 to BSR , or to variola B6 protein, or to a B5R or B6 homolog The antibody of claim 22, wherein the antibody or subsequence thereof is human or humanized The antibody or subsequence of claim 1, wherein said antibody or subsequence comprises a sequence at least 85% identical to any heavy chain variable region sequences set forth as SEQ ID NOs 2, 6 or 12, and a sequence at least 85% identical to any light chain variable region sequences set forth as SEQ ED NOs 4, 8 or 10 The antibody or subsequence of claim 2, wherein said antibody or subsequence comprises a sequence at least 85% identical to any heavy chain variable region sequence set forth as SEQ ED NO 14, and a sequence at least 85% identical to any light chain variable region sequences set forth as SEQ ED NO 16 A single chain antibody, comprising a heavy chain variable region sequence at least 80% identical to any of SEQ ED NOs 2, 6 or 12 and a light chain variable region sequence at least 80% identical to any of SEQ ED NOs 4, 8 or 10 A single chain antibody, comprising a heavy chain variable region sequence at least 80% identical to any of SEQ ED NO 14 and a light chain variable region sequence at least 80% identical to any of SEQ ED NO 16 The antibody or the subsequence thereof of any of claims 1 , 3, or 9, wherein the antibody comprises a heavy chain variable region sequence with at least 80 amino acids identical to any of SEQ ED NOs 2, 6 or 12, and a light chain variable region sequence with at least 80 amino acids identical to any of SEQ ED NOs 4, 8 or 10 The antibody or the subsequence thereof of any of claims 2, 4, or 12, wherein the antibody comprises a heavy chain variable region sequence with at least 80 amino acids identical to

any of SEQ ID NO I 4 and a light chain variable region sequence with at least 80 amino acids identical to any of SEQ ID NO 16 The antibody or the subsequence thereof of any of claims 1 , 3 or 9, wherein the antibody comprises a heavy chain variable region sequence with at least 90 amino acids identical to any of SEQ ID NOs 2, 6 or 12, and a light chain variable region sequence with at least 90 amino acids identical to any of SEQ ID NOs 4, 8 or 10 The antibody or the subsequence thereof of any of claims 2, 4 or 12, wherein the antibody comprises a heavy chain variable region sequence with at least 90 amino acids identical to any of SEQ ID NO 14 and a light chain variable region sequence with at least 90 amino acids identical to any of SEQ ID NO 16 The antibody or the subsequence thereof of any of claims 1, 3 or 9, wherein the antibody comprises a heavy chain variable region sequence with at least 100 amino acids identical to any of SEQ ID NOs 2, 6 or 12, and a light chain variable region sequence with at least 100 amino acids identical to any of SEQ ID NOs 4, 8 or IO The antibody or the subsequence thereof of any of claims 2, 4, or 12, wherein the antibody comprises a heavy chain variable region sequence with at least 100 amino acids identical to any of SEQ ID NO 14 and a light chain variable region sequence with at least 100 amino acids identical to any of SEQ ID NO 16 The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody is humanized or human An antibody or subsequence thereof having a binding affinity, K d , within about 1 to 5000 fold of the binding affinity of an antibody or subsequence thereof of any of claims 1 to 4, 9 or 12 to H3L or B5R An antibody or subsequence thereof having a binding affinity, K d , greater or less than the binding affinity of an antibody or subsequence thereof of any of claims 1 to 4, 9 or 12 to H3L or B5R An antibody or subsequence thereof comprising a heavy chain CDR or a light chain CDR selected from one or more of (SEQ ID NOs 17-40) SSAMS, VISISGGSTYYADSVKG, ETRYYYSYGMDV, SYSMN, SISSSSSYIYYADSVKG, ERRYYYSYGMDV, SYSMN, SISSSRSHYYADSVKG, ERRYYYSYGLDV, DYAIH, GISWNGRSIGYADSVKG, DIGFYGSGSLDY, RASQRIGFALA, DASSLET, QQFNTYPFT, RASQGISSALA, DASSLES, QQFNSYPYT, RASQSVSSYLA, DASNRAT, QQRSNWPALT,

RASQRIGFALA, DASSLET, QQFNSYPRT, RASQGISCALA, DASSLES, and QQFNSYPRT, wherein the antibody or subsequence thereof binds to vaccinia B5R, B6 or H3L proteins, or binds to a B5R, B6 or H3L protein homolog of a related The antibody or the subsequence thereof of claim 37, wherein the B 5 R, B6 or H3L protein homolog is a variola or monkeypox virus A heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12 A light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10 A heavy chain variable region sequence set forth as SEQ ID NO 14 A light chain variable region sequence set forth as SEQ ID NO 16 The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody is produced by a hybπdoma or a CHO cell line The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody is produced by a hybπdoma deposited as PTA-8654, PTA-8562,PTA-8653, or PTA-8564 (ATCC 1 10801 University Blvd , Manassas, VA 201 10-2209) The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody inhibits poxvirus infection of a cell, poxvirus proliferation or poxvirus replication in vitro or in vivo The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody neutralizes IMV, CEV or EEV poxvirus, as determined by a virus neutralization assay, a complement dependent virus neutralization assay, or a comet-tail inhibition assay The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody binds to a poxvirus infected cell The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, wherein the antibody comprises an antibody multimer The antibody or the subsequence thereof of any of claims 1 to 4, 9 or 12, further comprising one or more heterologous domains The antibody or the subsequence of claim 45, wherein the heterologous domain comprises an amino acid sequence

A nucleic acid that encodes the antibody or the subsequence of any of claims 1 to 4, 9 or 12 The nucleic acid of claim 51 , further comprising an expression control element A vector comprising a nucleic acid that encodes the antibody or the subsequence of any of claims 1 to 4, 9 or 12 A host cell that expresses the antibody or the subsequence of any of claims 1 to 4, 9 or 12 A host cell transformed with a nucleic acid that encodes the antibody oi the subsequence of any of claims 1 to 4, 9 or 12 A non-human animal that expresses the antibody or the subsequence of any of claims 1 to 4, 9 or 12 The non-human animal of claim 56, wherein the antibody is expressed from a gene locus encoding human immunoglobulin lambda or kappa light chain The non-human animal of claim 56, wherein the non-human animal comprises an animal that contains a human immunoglobulin nucleic acid sequence The non-human animal of claim 56, wherein the non-human animal comprises a transchromosomic animal The non-human animal of claim 56, wherein the non-human animal comprises a mammal The non-human animal of claim 56, wherein the non-human animal comprises a mouse, rat, guinea pig, rabbit, sheep, goat, cow, pig, or horse A plant that expresses the antibody or the subsequence of any of claims 1 to 4, 9 or 12 A pharmaceutical composition, comprising the antibody of any of claims 1 to 4, 9 or 12 and a pharmaceutically acceptable excipient or carrier A composition, comprising at least two antibodies or subsequences thereof of any of claims 1 to 4, 9 or 12 A composition, comprising the antibody of any of claims 1 to 4, 9 or 12 and an additional antibody that binds to a poxvirus protein The composition of claim 65, wherein the poxvirus protein that the additional antibody binds to is a protein present on one or more IMV, CEV or EEV forms of smallpox

The composition of claim 65, wherein the additional antibody binds to vaccinia protein B5R, LlR, D 8 L, A33R, A27L, A17L, L 5 , A21, H2, H3L, A28, A 14, A56, A34, A36, A2, or a B5R, LlR, D8L, A33R, A27L, A17L, LS, A21, H2, H3L, A28, A14, A 5 6, A34, A36, or A2 homolog The composition of claim 65, wherein the composition excludes an antibody that binds to vaccinia protein B5R, LlR, D 8 L, A33R, A27L, A17L, L 5 , A21, H2, H3L, A28, A [4, A56, A34, A36, A2, or a B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A 5 6, A34, A36, or A2 homolog The composition of claim 6 5 , wherein the additional antibody comprises VIG A kit, comprising the antibody of any of claims 1 to 4, 9 or 12 A method for providing a subject with protection against poxvirus infection or pathogenesis, comprising administering an amount of the antibody or subsequence thereof of any of claims 1 to 4, 9 or 12 sufficient to provide the subject with protection against poxvirus infection or pathogenesis The method of claim 71, wherein the method is performed substantially contemporaneously with or after contact of the subject with or exposure of the subject to the poxvirus A method for protecting or decreasing susceptibility of a subject to a poxvirus infection or pathogenesis, comprising administering an amount of the antibody or subsequence thereof of any of claims 1 to 4, 9 or 12 sufficient to protect or decrease susceptibility of the subject to poxvirus infection or pathogenesis The method of claim 73, wherein the method is performed prior to contact of the sub j ect with or exposure of the subject to the poxvirus The method of claims 71 or 73, wherein the poxvirus comprises a pathogenic poxvirus The method of claim 75, wherein the pathogenic poxvirus is selected from variola majorsmallpox virus, variola minor smallpox virus, monkeypox, cowpox, Molluscum Contagiosum and camelpox The method of claims 71 or 73, wherein the method reduces, decreases, inhibits, ameliorates or prevents onset, progression, severity, duration, frequency or probability of one or more symptoms associated with a poxvirus infection or pathogenesis

78 The method of claim 77, wherein the symptom is selected from high fever, fatigue, headache, backache, malaise, rash or lesions, delirium, vomiting, diarrhea, or excess bleeding

79 The method of claims 71 or 73, wherein the subject is immune suppressed or is HIV-positive

80 The method of claims 71 or 73, wheiein the subject is at risk of an adverse side effect or complication to smallpox vaccination

81 The method of claim 80 wherein the adverse side effect or complication comprises fever, rash, pustules or pocks, generalized vaccinia, progressive vaccinia, postvaccinia! encephalitis, vaccinia keratitis, eczema vaccinatum, peπocular infection or accidental infection of close contacts

82 The method of claim 80, wherein the smallpox vaccination comprises vaccination with vaccinia virus (VACV) Wyeth strain (Dryvax®)

83 The method of claims 71 or 73, wherein the subject has atopic dermatitis (AD)

84 The method of claims 71 or 73, wherein the antibody or subsequence thereof administered comprises at least one antibody of claims 1, 3, or 9, and at least one antibody of claims 2, 4, or 12

85 The method of claims 71 or 73, further comprising administering VIG

86 The method of claims 71 or 73, wherein the antibody or subsequence thereof is administered in multiple doses

87 A method for decreasing or preventing an adverse side effect or complication associated with or caused by vaccination with a Vaccinia virus, comprising administering an amount of the antibody or subsequence thereof of any of claims 1 to 4, 9 or 12 to a subject sufficient to decrease or prevent an adverse side effect or complication associated with or caused by vaccination with a Vaccinia virus

88 The method of claim 87, wherein the subject is a candidate for or has been vaccinated with a live or attenuated Vaccinia virus

89 The method of claim 87, wherein the subject is a candidate for or has been vaccinated with modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia virus NYCBOH strain, or vaccinia virus (VACV) Wyeth strain (Dryvax®)

90 The method of claim 87, wherein the side effect is selected from fever, rash, pustules or pocks, generalized vaccinia, progressive vaccinia, postvaccinal encephalitis, vaccinia keratitis, eczema vaccinatum, periocular infection and accidental infection of close contacts

91 The method of claim 87, wherein the subject is administered the antibody or the subsequence thereof prior to, concurrently with, following or within 1 2, 2-4, 4-12 or 12-24 hours of vaccination with a Vaccinia virus

92 The method of claim 87, wherein the subject is immune-suppressed or HIV positive

93 The method of claim 87, wherein the antibody or subsequence thereof administered comprises at least one antibody of claims 1, 3, or 9, and at least one antibody of claims 2, 4, or 11

94 The method of claim 87, wherein the antibody or subsequence thereof is administered in multiple doses

95 The method of any of claims 71, 73or 87, further comprising administering an additional poxvirus protein

96 The method of claim 95, wherein the additional poxvirus protein is present on one or more IMV, CEV or EEV forms of smallpox

97 The method of claim 95, wherein the additional poxvirus protein comprises vaccinia B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A56, A34, A36\ A2, or a B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A56, A34, A36, or A2 homolog

98 The method of claim 95, wherein the additional poxvirus protein does not consist of a live or attenuated vaccinia virus

99 The method of claim 95, wherein the additional poxvirus protein does not consist of live or attenuated poxvirus

100 The method of claim 95, wherein the additional poxvirus protein does not consist of modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia virus NYCBOH strain, or vaccinia virus (VACV) Wyeth strain (Dryvax®)

101 The method of any of claims 71, 73 or 87, further comprising administering an additional antibody or subsequence thereof that binds to a poxvirus protein

102 The method of claim 101, wherein the additional antibody or subsequence thereof that binds to a poxvirus protein is a protein present on one or more IMV, CEV or EEV forms of smallpox

103 The method of claim 101, wherein the additional antibody or subsequence thereof binds to vaccinia protein B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A 5 6, A34, A36, A2, or a B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A56, A34, A36, or A2 homolog

104 The method of claim 101, wherein the additional antibody comprises VIG

105 The method of claim 101, wherein the additional antibody or subsequence thereof is not an antibody that binds to vaccinia protein B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A56, A34, A36, A2, or a B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A 14, A56, A34, A36, or A2 homolog

106 The method of claim 101 , wherein the additional antibody or subsequence thereof is not VIG

107 The method of any of claims 71 , 73 or 87, wherein the antibody or subsequence thereof is administered prior to, concurrently with, or following a poxvirus infection, contact with or exposure to a poxvirus, vaccination with a Vaccinia virus, or vaccination with a poxvirus

108 The method of claim 107, wherein the poxvirus is selected from variola major or variola minor smallpox virus

109 The method of claim 107, wherein the poxvirus is selected from monkeypox, cowpox, Molluscum Contagiosum and camelpox

1 10 The method of any of claims 71, 73 or 87, wherein the method provides partial or complete protection against poxvirus infection or pathogenesis, or a symptom of poxvirus infection or pathogenesis

1 1 1 The method of any of claims 71 , 73 or 87, wherein the antibody or subsequence thereof is human, humanized or chimeric

1 12 The method of any of claims 71 , 73 or 87, wherein the antibody is monoclonal or polyclonal

1 13 A method for providing a subject with protection against poxvirus infection or pathogenesis, comprising administering an antibody or subsequence thereof of any of claims 1 , 3 or 9 in an amount effective to provide the subject with protection against poxvirus infection or pathogenesis

114 The method of claim 1 13, further comprising administering an antibody or subsequence thereof of any of claims 2, 4 or 12

1 15 The method of claim 113, further comprising administering VIG

116 An antibody designated as C 12, C 14, C 18, B96, B 116, B 126, or D67, or a functional fragment thereof

117 An isolated or purified antibody that competes for binding of an antibody designated as C 12, C14, C18, B96, Bl 16, B126, or D67 to B5R or H3L

1 18 An isolated or purified antibody or subsequence thereof that binds to the 1 -80 amino acid region of H3L protein

1 19 An isolated or purified antibody or subsequence thereof that binds to amino acids 20-275, 20- 100 or 20- 132 of B6 protein

120 The antibody of claim 1 19, wherein the antibody does not detectably bind to amino acids 71 to 184 or 33 to 275 of B6 protein

121 An isolated or purified antibody that competes for binding of an antibody designated as C 12, C 14, or C 18, to B5R or B6, but does not compete for binding of antibody B96, B 1 16 or B 126 binding to B5R or B6

122 An isolated or purified antibody that competes for binding of an antibody designated as C 12, C14, C18, B96, Bl 16, or B126, to B5R or B6, respectively having complement fixation ability, as determined by a complement-dependent virus neutralization assay

123 An isolated or purified antibody that competes for binding of an antibody designated as C 12, C 14, C 18, B96, B l 16, or B 126, to B5R or B6, having greater complement fixation ability, as determined by a complement-dependent virus neutralization assay, than the antibody designated as C 12, C 14, C 18, B96, Bl 16, or B 126, respectively

124 The antibody of claim 123, wherein the antibody has a chimeric Fc region comprising portions of human IgGl and IgG3 isotypes

Description:

Vaccinia Virus H3L and B5R Specific Monoclonal Antibodies and Methods of Making and Using

Same

Related Applications

This application claims priority to USSN 61/127,729 filed May I 4 , 2008. and USSN 60/979,028, filed October 10, 2007, which are expressly incorporated herein by reference

Technical Field

The invention relates to antibodies and subsequences thereof that specifically bind to poxvirus B5R envelope protein, antibodies and subsequences thereof that specifically bind to poxvirus H3L envelope protein, and combinations thereof The invention also relates to methods of providing a subject with protection against poxvirus infection or pathogenesis including infectious and pathogenic poxviruses (e g , variola major and variola minor smallpox, monkeypox, cowpox, vaccinia, molluscum contagiosum and camelpox) using antibodies or subsequences thereof that specifically bind to poxvirus B5R envelope protein, antibodies or subsequences thereof that specifically bind to poxvirus H3L envelope protein, and combinations of antibodies or subsequences thereof that specifically bind to poxvirus B5R envelope protein with antibodies or subsequences thereof that specifically bind to poxvirus H3L envelope protein Furthermore, the invention relates to methods of protecting or decreasing susceptibility of a subject to a poxvirus infection or pathogenesis including infectious and pathogenic poxviruses (e g . vanola major and variola minor smallpox, monkeypox, cowpox. molluscum contagiosum and camelpox) and small pox vaccine viruses using antibodies or subsequences thereof that specifically bind to poxvirus B5R envelope protein, antibodies or subsequences thereof that specifically bind to poxvirus H3L envelope protein, and combinations of antibodies or subsequences thereof that specifically bind to poxvirus B 5 R envelope protein with antibodies or subsequences thereof that specifically bind to poxvirus H3L envelope protein

Introduction

Smallpox is a highly lethal viral infection of humans (30% mortality) (Fenner et al , World Health Organization. Geneva, Henderson et al , JAMA 281 2127 (1999)), which can spread rapidly through a population Smallpox is a top bioterroπsm concern, and is frequently generally considered the #1 bioterroπsm danger (Hendersonet al , JAMA 281 2127 (1999), LeDuc and Jahrling, Emerg Infect Dis 7 155 (2001), Meltzer et al , Emerg Infect Dis 7 959 (2001), O'Toole et al , CIm Infect Dis 34 972 (2002)) The smallpox vaccine consists of live vaccinia virus and is the gold standard of vaccines since it has led to the complete eradication of wild smallpox from the human population Renewed fears that

smallpox might be deliberately released in an act of bioterroπsm have led to a resurgence in the study of treatment of smallpox (variola virus) infection rare but severe side effects of the smallpox vaccine (vaccinia virus, VACV), and treatment of other poxviruses such as monkeypox Individuals under the age of 35 (approximately 50% of the population) have not been vaccinated against smallpox leaving them highly susceptible in the event of an outbreak Furthermore, there is an active smallpox vaccination campaign in the USA military, and VIG (Vaccinia Immune Globulin, ) is used to treat the rare side effects of vaccination Finally, in 2003, a monkeypox outbreak occurred for the first time in the USA (Huhn et al , Clin Infect Dis 41 1742 (2005))

Currently, VIG (Vaccinia Immune Globulin) is the only licensed therapeutic to treat the side effects of smallpox vaccination (DryVax immunization), and it is the treatment available in case of an actual smallpox or monkeypox outbreak / bioterroπsm event (Hopkins and Lane, CIm Infect Dis 39 819 (2004) Wittek R , Int J Infect Dis 10 193 (2006)) Unfortunately, VIG is a poorly characterized, highly variable, human product that is only available in very limited quantities and is of limited potency (Hopkins and Lane, CIm Infect Dis 39 819 (2004), Wittek, R , Int J Infect Dis 10 193 (2006)) Each of these issues is a major problem for biodefense preparedness against a smallpox bioterroπsm event

Problems with VIG — particularly the small number of VIG doses available and their limited potency — have led to great interest in the development of a better anti-smallpox immunotherapy

Poxviruses (vaccinia, variola/smallpox, monkeypox) have two virions forms, Intracellular Enveloped Virions (IMV) and Extracellular Enveloped Virions (EEV), each with distinct biology and numerous different surface proteins (Condit et al , Adv Virus Res 66 31 (2006), Smith et al , J Gen Virol 83 2915 (2002)) As such an understanding of the virion structures is required to develop knowledge regarding the targets of protective antibodies

The most abundant viral particle (up to 99% of total) is the intracellular mature viπon (IMV), which accumulates in infected cells and is released as cells die (Moss, B , Poxvindae The Viruses and their Replication In Fundamental Virology, D M Knipe, and P Howley eds (200I )) IMVs are environmentally stable infectious virus particles and likely represent the principle virion type involved in transmission between hosts An alternate morphogenesis pathway is taken by a proportion of IMVs inside infected cells These immature virions become wrapped in a double membrane from the trans-Golgi and are then translocated to the cell surface where the outermost membrane fuses with the plasma membrane (Roos et al , EMBO J 15 2343( 1996)) These virions may be released from the cell surface as extracellular enveloped virus (EEV) (Smith et al , J Gen Virol 83 2915 (2002)) EEV are more fragile and less abundant than the IMV, and are considered to be primarily involved in dissemination within the

same host rather than transmission between hosts (Lustig et al., /. Virol. 79 13454 (2005); Payne, L.G, /. Gen. Virol.50-&9 ( 1980); Smith et al., J. Gen. Virol. 83:2915 (2002))

In humans, high neutralizing antibody titers have been associated with protective immunity against smallpox infection (Mack, l.E.,Pediatr. Nurs. 14.220 (1988); Sarkar et al., Bull World Health Organ 52:307 ( 1975)). Long-term antibody titers and T cell memory to the smallpox vaccine do not correlate in humans (Crotty et al., /. Immunol. 171 :4969 (2003); Hammarlund et al., Nat. Med. 11 : 1005 (2005)) excluding the possibility that antibody titers were simply a biomarker for memory T cells. Vaccinia Immune Globulin (VIG) is an effective treatment against smallpox, as it was able to reduce the number of smallpox cases -80% among exposed individuals in four case controlled studies (Hobday, T.L.,Lancet 1:907 ( 1962); Kempe, C.H., Pediatrics 25: 176 (1960); Kempe et al., Pediatrics 18: 177 ( 1956); Marenmkova, S.S, SMH World Health Organ 27.325 ( 1962)).

Vaccinia immune globulin (VIG) is licensed to treat complications following smallpox vaccination and would likely be used in the event of a smallpox or monkeypox outbreak. VIG is produced by purifying and pooling IgG from smallpox vaccine recipients. VIG is tested and treated for blood borne pathogens, and tested for efficacy by in vitro neutralization of VACV and in vivo treatment of SCID mice infected with VACV (CangeneCorporation (2005), Vaccinia Immune Globulin Intravenous (Human) (VIGIV) package insert. F. CBER, ed.; DynportVaccineCompany (2005), Vaccinia Immune Globulin Intravenous (Human) (VIGIV) package insert. F. CBER, ed; Goldsmith et al.. Vox Sang 86: 125 (2004): Wittek. R , Int. J. Inject. Dis. 10: 193 (2006). Recruitment of sufficient donors for production of VIG is a substantial problem, resulting in a small supply of VIG available. Furthermore, the potency of VIG is limited, due to its dilute and polyclonal nature In addition, there are always safety concerns regarding human blood products Altogether, these problems with VIG — particularly the small number of VIG doses available and their limited potency — have led to great interest in the development of a better anti- smallpox immunotherapy These are serious problems with VIG can be solved by production of a high quality mAb product

HumanAntibodies that bind to poxvirus proteins, such as B5R and H3L, or anti-B5R and anti- H3L monoclonal antibodies and subsequences thereof, are described. Antibodiesprovided. Exemplary human antibodies were produced by immunizing trans-chromosomic mice (KM mice™) with soluble recombinant vaccinia virus B5R or H3L protein. Isolated B5R specific antibodies recognize different epitopes on B5R, for example at least two "epitopes" on B5R, as determined by antibody cross-blocking

studies Isolated H3L specific antibodies recognize one or more epitopes on H3L as determined by antibody cross-blocking studies Antibodies that specifically bind B5R or H3L protein, and combinations of such antibodies, inhibit virus infection in vitro and/or protect mice (BALB/c and SCID) from vaccinia virus (VACV WR and VACV NYCBOH ) challenge in in vivo animal models These results confirm the functional characteristics of human anti-vaccinia virus B5R or H3L monoclonal antibodies and their usefulness alone and in combination as a VIG (vaccinia immune globulin) replacement to treat (e g , provide a subject with protection against or decrease susceptibility of a subject) poxvirus (e g , smallpox) infection or as a treatment of adverse side effects or complications associated with or caused by vaccinia virus or poxvirus vaccination, immunization or infection The invention therefore provides antibodies, including human, humanized and chimeric B5R or

H3L binding antibodies, and compositions including antibodies, such as human, humanized and chimeric B5R or H3L binding antibodies such as pharmaceutical compositions, and kits containing antibody The invention also provides methods for prophylactic and therapeutic treatment of poxvirus infection and pathogenesis, methods for providing a subject with protection against a poxvirus infection or pathogenesis, and methods for protecting or decreasing susceptibility of a subject to a poxvirus infection and pathogenesis In various aspects, the poxvirus is a variola major or variola minor smallpox virus In more particular aspects, the poxvirus is monkeypox, cowpox, vaccinia, molluscum contagiosum or camelpox

Compositions include fully human, humanized and chimeric (e g , human/mouse chimera) monoclonal antibodies that recognize and bind to B 5 R or H3L, or homologs thereof, such as vaccinia

B 5 R, B6 or H3L proteins, or B 5 R, B6 or H3L protein homolog of a related poxvirus, e g , such as vaπola or other poxvirus (e g , monkeypox) Methods include passive immunization with human, humanized and chimeric (e g human/mouse chimera) polyclonal and monoclonal antibodies that bind to B 5 R or H3L, before or after contact with, exposure to or infection with a poxvirus, or pathogenesis caused by or associated with poxvirus contact, exposure or infection Methods include treatment methods prior to or before contact with, exposure to or infection with a poxvirus (prophylaxis) as well as treatment methods following contact with, exposure to or infection with a poxvirus (therapeutic) including development of one or more symptoms associated with or caused by poxvirus infection or pathogenesis Non-limiting examples of symptoms of poxvirus infection or pathogenesis include high fever, fatigue, headache, backache, malaise, rash (maculopapular, vesicular or pustular) or lesions, delirium, vomiting, diarrhea and excess bleeding Methods of the invention therefore include reducing, decreasing, inhibiting, ameliorating, delaying or preventing onset, progression, severity, duration, frequency, susceptibility or

probability of one or more symptoms associated with poxvirus contact, exposure, infection or pathogenesis

Antibodies that bind to B5R, or H3L, or B 5 R, or H3L protein homologs are useful for treating a subject having or at risk of having a poxvirus, before infection (prophylaxis) or following infection (therapeutic) The invention therefore provides methods of using antibodies that bind to B5R or H3L in treatment (e g , therapeutic or prophylactic) of poxvirus infection or pathogenesis

The invention further provides methods for providing a subject with protection against, or protecting a subject from, poxvirus infection or pathogenesis In one embodiment, a method includes administering an amount of an antibody that binds to B 5 R or H3L sufficient to provide the subject with protection against, or protect the subject from, poxvirus infection or pathogenesis

The invention also provides methods for protecting or decreasing susceptibility of a subject to a poxvirus infection or pathogenesis In one embodiment, a method includes administering a composition comprising an amount of an antibody that binds to B 5 R or H3L sufficient to protect or decrease susceptibility of the subject to poxvirus infection or pathogenesis The invention additionally provides methods for decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus In one embodiment, a method includes administering a composition comprising a sufficient amount of an antibody that binds B5R or H3L to decrease or prevent an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus In another embodiment, a method includes administering a composition comprising a sufficient amount of an antibody that binds BSR or H3L to an immune-suppressed or HIV-positive subject to decrease or prevent an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus In various aspects, adverse side effects or complications decreased or prevented include postvaccinia! encephalitis, progressive vaccinia, eczema vaccinatum, generalized vaccinia, accidental infection of close contacts, rashes and periocular infection In further aspects, the subject is a candidate for or has been vaccinated with a vaccinia virus (e g modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC 1 6 m8 strain, vaccinia virus NYCBOH strain, vaccinia virus Wyeth strain, vaccinia ACAM 2 OOO, or vaccinia virus prepared from calf lymph, Dryvax®) or immuinized against a poxvirus In additional various aspects, the subject is administered the antibody that binds B 5 R or H3L prior to, concurrently with, following or within 1-2, 2-4-, 4-12, 12-24, 24-48, 48-72 hours or.4, 5, 6, 7, or more days of vaccination with vaccinia virus or immunization against a poxvirus

Antibodies of the invention can bind to B5R or H3L, optionally present on one or more poxvirus (e g , infectious or pathogenic poxvirus or live or attenuated vaccinia virus or a related poxvirus such as monkeypox) strains or isolates or species Thus, the antibodies have one or more effects on virus infectivity, replication, proliferation, titer, or onset, progression, seventy, frequency, duration or probability of one or more symptoms, adverse side effects or complications associated with or caused by virus infection or pathogenesis, or vaccination with a vaccinia virus, vaccinia virus protein, or immunization against a poxvirus

Methods of the invention include methods in which partial or complete protection against poxvirus infection or pathogenesis, or a symptom of poxvirus infection or pathogenesis is provided In one embodiment, a human, humanized or chimeric B5R or H3L binding antibody inhibits poxvirus infection of a cell m vitro or in vivo, or inhibits poxvirus binding to a cell in vitro or in vivo In another embodiment, a human, humanized or chimeric B 5 R or H3L antibody reduces or decreases virus titer, infectivity, replication, proliferation, or an amount of a viral protein of one or more vaccinia virus or poxvirus strains, isolates or species In yet another embodiment, a human, humanized or chimeric B5R or H3L binding antibody inhibits, delays, or prevents increases in virus titer, infectivity, replication, proliferation, or an amount of a viral protein of one or more vaccinia virus or poxvirus strains, isolates or species In still another embodiment, a human, humanized or chimeric B5R or H3L binding antibody provides a subject with protection against a poxvirus infection or pathogenesis or protects or decreases susceptibility of a subject to infection or pathogenesis, by one more poxvirus strains, isolates or species In a further embodiment, a human, humanized or chimeric B5R or H3L binding antibody decreases onset, progression, seventy, frequency, duration or probability of one or more symptoms or complications associated with infection or pathogenesis by one or more poxvirus strains or isolates or subtypes Exemplary symptoms include, for example, high fever, fatigue, headache, backache, malaise, rash (maculopapular, vesicular or pustular) or lesions, delirium, vomiting, diarrhea, and excess bleeding B5R or H3L binding antibody can be administered or delivered in accordance with the invention by any suitable in vitro, ex vivo or m vivo method In various embodiments, a composition is administered prior to, concurrently with, or following contact with or exposure to a poxvirus, poxvirus infection or pathogenesis, or vaccination with a vaccinia virus or immunization against a poxvirus In various aspects, human, humanized or chimeric B5R or H3L binding antibody is administered or m vivo delivered systemically (e g , intravenous injection, subcutaneous injection, intravenous infusion, intramuscular injection), regionally, or locally to a subject

Antibodies of the invention include polyclonal and monoclonal antibodies and mixtures thereof, which can be any of IgG, IgA, IgM, IgE, IgD, and any isotype thereof, for example, IgGi IgG>, IgG 3 or

IgG 4 Antibodies include intact human, humanized and chimeric immunoglobulin molecules with two full-length heavy chains and two full-length light chains (e g , mature portion of heavy and light chain variable region sequences) as well as subsequences/fragments of heavy or light chain which retain at least a part of a function of a reference or parental intact antibody that specifically binds B5R or H3L protein or B5R or H3L homolog Antibody subsequences can have the same or substantially the same binding specificity, binding affinity or anti-poxvirus activity as a reference or parental intact anti-B 5 R or H3L binding antibody

Exemplary subsequences include Fab, Fab', F(ab>, Fv, Fd, single-chain Fvs (scFv), disulfide- linked Fvs (sdFv) and V L or V H , or other binding fragment of an intact immunoglobulin Antibodies of the invention, useful in accordance with the invention methods, therefore include heavy-chain vaπable region sequence and light chain vaπable region sequence of antibody that specifically bind B5R or H3L

In further embodiments, an antibody binds to an antigenic region, determinant or epitope of B5R or H3L Exemplary antigenic regions and epitopes of B5R or H3L homologs include, for example a sequence region of B 5 R or H3L as set forth herein or known to one skilled in the art, or a subsequence or a portion thereof

Antibodies of the invention further include one or more heterologous domains that impart a distinct function or activity on an antibody that binds B5R or H3L Antibodies include an amino acid heterologous domain when one or more amino acids are distinct from the antibody (i e , they are not a part of the native antibody) In one embodiment, a heterologous domain comprises a binding protein (e g , receptor or hgand binding), an enzyme activity, a drug, an antiviral a toxin, an immune-modulator, a detectable moiety or a tag

Combination compositions including BSR and H3L binding antibodies, as well as methods of using such combinations, and methods in which such combinations are administered or combined with other compositions prior to, concurrently with or following administration of B 5 R or H3L antibody In various embodiments, a composition includes antibody that binds B5R or H3L and an agent that decreases, reduces, inhibits, delays or prevents poxvirus infection or pathogenesis, replication, proliferation or decreases, reduces, inhibits, delays or prevent the onset, progression, severity frequency, duration or probability of one or more symptoms or complications associated with poxvirus (e g , infectious or pathogenic poxvirus or vaccinia virus) infection or pathogenesis, or an adverse symptom or complication associated with vaccination or immunization with a vaccinia virus, vaccine virus protein, or a poxvirus or a poxvirus protein Examples include a plurality (e g , a pool) of monoclonal or polyclonal antibodies that each bind B 5 R and H3L, having the same or a different binding specificity or binding

affinity, for B5R and FBL An additional antibody that binds to a poxvirus protein, different from B 5 R or H3L binding antibody, can be administered separately from B5R or H3L binding antibody, or as a combination composition In specific aspects, the additional antibody that binds to a poxvirus protein binds to IMV, cell-associated enveloped virion (CEV) or extracellular enveloped virion (EEV) forms of smallpox In more specific aspects, the additional antibody binds to poxvirus protein B5R, LlR. D8L A33R, A27L, A17L, L5, A21. H2, H3L, A28, Al 4 , A56, AU, A36, A2, or a BSR, LlR, D8L, A33R, A27L, A17L, L 5 , A21, H2, H3L, A28, A14, A 5 6, A 34, A36, or A2 homolog A plurality of antibodies can be individually administered or administered as a combination composition

An additional composition may comprise VIG Thus, compositions and methods of the invention include a combination composition of a B 5 R or HlL binding antibody and VIG, a combination composition of a B 5 R and H3L binding antibody and VIG, a combination method including administering separately or as a combination VIG with B 5 R or H3L binding antibody, and a combination composition of a B5R and H3L binding antibody and VIG

Additional examples of a combination composition and combination method include administering separately or as a combination composition a protein with B5R or HBL binding antibody In one specific aspect, a composition Of B 5 R or FBL binding antibody includes an additional protein (e g , an infectious or pathogenic poxvirus or vaccinia virus or vaccinia virus protein) In another specific aspect, a method includes administering an additional poxvirus or vaccinia vims protein prior to, concurrently with or following administration of B5R or H3L binding antibody An additional poxvirus protein may be present on IMV, CEV or EEV forms of smallpox In specific aspects, an additional poxvirus protein is one or more of BSR, LlR, D8L. A33R. A27L, A17L, L5, A21, H2, HlL, A28, A14, A56, AH A36, A2, or a B5R. LlR, D8L, A33R, A27L, A17L, LS, A21. H2, HIL, A28, A14, A56, A34, A36, or A2 homolog

Pharmaceutical compositions including antibodies of the invention and a pharmaceutically acceptable carrier or excipient are provided Antibodies can be included in a pharmaceutically acceptable earner or excipient pπor to administration to a subject Pharmaceutical compositions can be administered to a subject by systemic, regional or local delivery In one embodiment, a method or carrier is suitable for administration systemically, regionally, or locally to a subject

Kits that include one or more antibodies of the invention are also provided In one embodiment, a kit includes instructions for treating (prophylaxis or therapeutic) one or more symptoms or complications associated with poxvirus infection of a subject by one or more poxvirus strains or isolates or species (e g ,

virus infectivity, replication, proliferation, titer, onset, progression, seventy, frequency, duration or probability of one or more symptoms as set forth herein or known in the art, etc )

Description of Drawings

Figure 1 shows data of human anti-H3 mAb clones titrated in an in vitro VACV IMV neutralization assay to determine PRNT 5O PRNT 50 values for the best 6 monoclonal antibodies are shown (μg/ml, y-axis) Control serum PRNT 50 was greater than 1000 μg/ml

Figure 2 shows data of VACV IHDJ comet tail plaque assay in the presence of no serum (VACViH D J ), isotype control antibodies (IgG3 and IgGl), and a panel of antι-B5 monoclonal antibodies (B96, C 12, C 14, C 18 IgG I , C 18 IgG3, C 18 IgG4) B96 was a very efficient inhibitor of comet tail formation CI2 provided some inhibition, and CI4 provided minimal inhibition C 18 IgG 1 provided some inhibition, but the IgG3 and IgG4 versions did not inhibit comet tails

Figures 3A -3C show protection of BALBc mice from lethal intranasal VACV WR infection data A) and B) Average weight of mice after infection A) Muπne mAb #B96 versus two candidate human mAbs. #C 14 and #C33 ( I OOμg each), l p . PBS as negative control; B) Human mAbs #C 14 and #C 12 versus VIG (vaccinia immune globulin), and C) Survival curve from panel B study

Figures 4A and 4B show protection of SCID mice from VACV WR data A) Mice administered VIG. antι-B5 human mAb #C12, antι-B5 human mAb #C14, or PBS, then infected with VACV WR , and B) Mice administered VIG, anti-H3 mAb #41 , or PBS, then infected with VACV WR (VIG and PBS control groups are the same in both panels All data shown is from an individual study ) Figure 5 shows data indicating that combination mAb therapy protects against VACV NYBOH in

SCID mice better than monotherapy SCID mice administered anti-H3 mAb #41 + human antι-B5 mAb C 14 (triangle symbols), anti-B 5 mAb C 14 alone (filled square symbols), or PBS (filled circles) Untreated, uninfected "naive" mice were used as controls (open circles)

Figures 6A-6C show data indicating that combination mAb therapy protects against VACV NYBOH better than mAb monotherapy by multiple parameters of disease progression SCID mice administered anti-H3 mAb #41 and human anti-B5 mAb C 14 (filled triangle symbols), anti B5 mAb C 14 alone (filled square symbols), or PBS (filled circles) Control untreated, uninfected "naive" mice (open circles) A) Survival curve, B) percent of mice remaining pox free, and C) percent of mice remaining disease free (less than 5% body weight loss)

Figure 7 shows data indicating that combination mAb therapy protects against VACV NYBOH in SCID mice better than commercially available therapy, VIG SCID mice administered anti-H3 mAb #41 and human anti-B5 mAb C 14 (triangle symbols), VIG (filled square symbols), or PBS (filled circles)

Figures 8A-8C show data indicating that combination mAb therapy protects against VACV NYBOH in SCID mice better than VIG by multiple parameters of disease progression SCID mice administered anti-H3 mAb #41 and human anti-B5 mAb C14 (triangle symbols), VIG (Filled square symbols), or PBS (filled circles) A) Survival curve, B) percent of mice remaining pox free, and C) percent of mice remaining disease free (less than 5% body weight loss)

Figure 9 shows results of a Western blot confirming cross-reactivity of anti-B5 top mAbs 13 ICI 2 and 131C 14 with Variola B6 homolog Similar results have been obtained with 13 IC 18 mAb

Figure 10 shows results of a Western blot identifying SCRl as an epitope cluster recognized by anti-B5 mAbs 131C12. 131C 14 and 131C18 131C12 mAb was used in the representative Western blot shown Similar results were obtained with I31C14 and 13 IC18 mAbs

Figure 11 shows results of a Western blot showing summary of anti-B 5 mAbs (131C12, 131C14, and 131C 18) reactivity It confirmed that the antibodies recognized B6R peptide 20-100, including SCRl and N-terminal portion of SCR2 131C 12 mAb was used in the representative Western blot shown Similar results have been obtained with 131C 14 and 131C 18 mAbs

Figures 12A-12B show results of two Western blots confirming cross-reactivity of human anti- vaccinia H3 mAb 131D67 with variola homolog Lanes 3 and 5 lysate of E coli cells transformed with H3L ectodomain constructs from Variola and Vaccinia (respectively) before induction with IPTG Lanes 2 and 4 lysate of E coli cells expressing H3L ectodomain from Variola and Vaccinia (respectively) after induction with IPTG Lane 6 Purified recombinant full-length H3L-His Tag®, 05 μg per lane The membranes were probed with 130D67 antibody (A) and mouse monoclonal antibody specific to His Tag® (B) Figure 13 shows results of a new EEV neutralization assay 50% plaque reduction level indicated by the dashed line "DlO" is medium alone negative control "157-1" is unvaccinated human negative control

Figures 14A-14B show in vivo protection with particular B 5 R antibodies, namely A) B96 (filled square), B 126 (open tπangle), and B) C 18 (filled square), as reflected in loss of body weight PBS (filled circles)

Figures 15A-15G show that anti-B 5 protection in vivo is complement dependent. Complement depletion in vivo abrogated the majority of anti-B 5 protection against VACV (A-D).(A) Complement C3 levels in cobra venom factor (CVF) treated mice, days 1 -5 after treatment Serum from mice pπor to treatment (NMS) was used as control (B-D) Complement-depleted ("+ CVF") or nondepleted mice were treated with lOOμg of anti-B 5 mAbs (B96, B 116, or B 126) or PBS ("PBS") at day -1 and challenged i n with 5 χl0 4 PFU of purified VACV WR at day 0 (B-C) Mean weight loss kinetics in each group, and (D) maximum weight loss (weight nadir) (B) VACV infected mice treated with B 126 were fully protected compared with untreated infected mice (P < 00001) but complement depleted mice had a > 50% specific loss in B 126 mAb protection (C) B96 and B 1 16 provided minimal protection against disease, and neither B96 nor B H6 were affected by CVF treatment (D) Abrogation of anti-B5 B 126 protection by complement-depletion was highly statistically significant (P < 0 0001, "B 126 + CVF" vs B 126 in complement-sufficient recipients, "B 126"), while there were no significant effect of complement depletion on any other group (P » 005, ns) One of three independent studies shown Error bars in (D) indicate SEM in each group Complement depletion in vivo (CVF treatment) did not affect disease in untreated mice (E-F), or the modest activities of B96 or B 1 16 (G)

Figures iβA-lβF show that complement and complement fixing anti-B5 IgG cooperate to efficiently mediate destruction of VACV infected cells Anti-B5 antibodies are able to direct complement lysis of VACV infected cells due to their surface expression of B5 (A) Cell monolayers (Vero E6) were infected with VACV WR (MOI = 5) and surface expression of B5 was tested at 4 hours (black line) and 8 hours (red line) after infection by surface staining infected cells with anti-B5 mAb and performing flow cytometry Uninfected cells, negative control (filled curve) (B-F) Anti-B5 directed complement lysis of infected cells Virus infected Vero E6 monolayer cells (crystal violet stained) at 4OX magnification VACV infected cells were treated with media (B) or complement (' + C ") in the absence (C) or presence of anti-B5 IgG 1 mAb B96 (D) or lgG2a mAb B 126 (E) VACV infected cells were completely and specifically destroyed by anti-B5 IgG2a and complement High magnification images (10Ox) shown in Supplementary Figure 4 (F) Quantitation of live cell numbers Destruction of VACV infected cells was highly statistically significant in the presence of anti-B5 mAb B 126 and complement, vs B 126 alone (P < 00001), complement alone (P < 0001), or B96 plus complement (P < 0 0001) No killing was observed for IgGl B96 in the absence or presence of complement (P » 0 05. ns)

Figures 17A-17C show how complement and complement fixing anti-B5 IgG cooperate to efficiently mediate destruction of VACV infected cells Anti-B5 directed complement lysis of infected cells Virus infected Vero E 6 monolayer cells (crystal violet stained) at 4OX magnification VACV infected cells were treated with media (A) or complement (" + C ") in the absence (A) or presence of huamn anti-B5 IgG 1 mAb C 12 (B) or C 18 IgG 1 (C) VACV infected cells were completely and specifically destroyed by anti-B5 IgGl and complement

Figure 18 shows in vivo protection of SCID mice injected with human anti B5 (C 14) (open diamond), human anti-H3 (#67) (open triangle), a combination of both human antibodies, or VIG (filled square) Control, PBS (filled circles) Mice were infected at Day 0 with VACVny Figures 19A-19C show m vivo protection of SCID mice injected with human anti-B5 (C 14) human anti-H3 (#67), a combination of both human antibodies or VIG Mice were infected with VACVny, as described in Example 9 for Figure 1 1 A) percent pox free mice, B) percent disease free mice, and C) percent survival

Figure 20 shows in vivo protection with a human monoclonal antibody, anti-B 5 mAb (Cl 2) to supplement VIG Body weight was tracked as the measure of clinical illness

Detailed Description

The invention is based at least in part on antibodies and subsequences thereof that specifically bind to poxvirus B5R envelope protein or B5R protein homologs The invention is also based at least in part on antibodies and subsequences thereof that specifically bind to poxvirus H3L protein or H3L protein homologs The invention is further based at least in part on combinations of such antibodies and subsequences

Invention antibodies, among other things, can provide passive protection against an infectious vaccinia virus, and in multiple mouse models protected the animals from a lethal dose challenge of vaccinia virus Antibodies of the invention are therefore useful for prophylactic (prior to poxvirus infection) and therapeutic (following poxvirus infection) treatment In addition antibodies of the invention are useful for prophylactic (prior to poxvirus infection) and therapeutic (following poxvirus infection) treatment in which subjects are at risk of an adverse side effect or complication associated with or caused by vaccination with a vaccinia virus (e g , such as the live-virus preparation of vaccinia virus prepared from calf lymph, known as Dryvax®) or immunization against a poxvirus for example, due to immune suppression In addition, as inventionantibodies include humanantibodies, which are less likely

to induce hypersensitivity from repeated administration and are more likely to remain in a human subjects' body for a longer period of time, antibodies of the invention can be administered to a human subject in advance of contact with or exposure to poxvirus (e g , infectious or a pathogenic poxvirus such as smallpox), or a live or attenuated vaccinia virus, such as the live-virus preparation of vaccinia virus prepared from calf lymph (Dryvax®)

In accordance with the invention there are provided antibodies and subsequences thereof that specifically bind to poxvirus B5R envelope protein In one embodiment, anantibody or subsequence thereof that specifically binds to poxvirus B5R envelope protein includes a sequence at least 60 % or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6, or 12, and a sequence at least 60% or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any light chain variable region sequence set forth as SEQ ID NOs 4. 8 or 10 In another embodiment, anantibody or subsequence thereof that specifically binds to poxvirus B5R envelope protein, includes any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12 , and any light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10, wherein the antibody or subsequence has one or more amino acid additions, deletions or substitutions of SEQ ID NOs 2, 6 or 12, or SEQ ID NOs 4, 8 or 10 In particular aspects, a sequence is at least 80-85%, 85-90%, 90-95%, 95-100% identical to any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12, or light chain variable region sequence set forth as SEQ ID NOs 4. 8 or 10 In further aspects, an antibody that specifically bind to poxvirus B5R envelope protein includes or consists of any one of a heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12. or a light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10

In accordance with the invention, there are also provided antibodies and subsequences thereof that specifically bind to poxvirus H3L envelope protein In one embodiment, anantibody or subsequence thereof that specifically binds to poxvirus H3L envelope protein includes a sequence at least 60% or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth asSEQ ID NO 14, and a sequence at least 60% or more (e g , 65%, 70%. 75%. 80%, 85%, 90%, 95% etc ) identical to any light chain variable region sequence set forth as SEQ ID NO 16 In another embodiment, anantibody or subsequence thereof that specifically binds topoxvirus H3L envelope protein includes any heavy chain variable region sequence set forth as SEQ ID NOs 14 and any light chain variable region sequence set forth as SEQ ID NO 16, wherein the antibody or subsequence has one or more amino acid additions, deletions or substitutions of SEQ ID NO 14, or SEQ ID NO 16 In particular aspects, a sequence is at least 80-85%, 85-90%, 90-95%, 95-100% identical to any heavy chain variable region sequence set forth asSEQ ID NO 14, or any light chain vanable region sequence set forth as SEQ

ID NO.16. In further aspects, an antibody that specifically bind to poxvirus H3L envelope protein includes or consists of any one of a heavy chain variable region sequence set forth asSEQ ID NO.14, or a light chain variable region sequence set forth as SEQ ID NO.16

The term "antibody" refers to a protein that binds to other molecules (antigens) via heavy and light chain variable domains, V H and V L , respectively. "Antibody"refers to anypolyclonal or monoclonal immunoglobulin molecule. or mixtures thereof, such as IgM, IgG, IgA, IgE, IgD. Invention antibodies belong to any antibody class or subclass. Exemplary subclasses for IgG are IgG h IgG 2 , IgGi and IgG 4 .

As used herein, the term "monoclonal," when used in reference to an antibody, refers to an antibody that is based upon, obtained from or derived from a single clone, including any eukaryotic, prokaryotic, or phage clone. A "monoclonal" antibody is therefore defined herein structurally, and not the method by which it is produced.

The terms "B5R antibody" or "anti-BSR antibody," and grammatical variations thereof, mean a polyclonal or monoclonal antibody that binds to vaccinia virus extracellular enveloped virion (EEV) B 5 R protein (also referred to as "B 5 "), or a B 5 R protein homolog from a related poxvirus, such as monkeypox B 5 R or variola B 6 Antibodies include specific or selective binding to B 5 R protein or a B5R protein homolog, which is selective for an epitope or antigenic determinant present in B 5 R protein or B 5 R protein homolog. That is, binding to proteins other than BSR or B 5 R protein homolog is such that the binding does not significantly interfere with detection of B 5 R or B 5 R protein homolog, unless such other proteins havesignificant similarity or the same epitope as epitope in B 5 R protein or B 5 R protein homolog that is recognized by a B 5 R homolog antibody. For example, anti-B5R antibodies I31C12, 131C14 and 131C 18 also bind to poxvirus envelope protein B6, due to a conserved epitope shared by B 5 R and B 6 proteins Selective binding can be distinguished from non-selective binding using specificity, affinity, and competitive and non-competitive binding assays, descπbed herein or known in the art.

The terms "H3L antibody" or "anti-H3L antibody," and grammatical variations thereof, mean a polyclonal or monoclonal antibody that binds to vaccinia virus intracellular mature virion (IMV) H3L protein (also referred to as "H3"), or an H3L protein homolog. Antibodies include specific or selective binding to H3L protein or an H3L protein homolog, which is selective for an epitope or antigenic determinant present in H3L protein or H3L protein homolog. That is, binding to proteins other than H3L or H3L protein homolog is such that the binding does not significantly interfere with detection of H3L or H3L protein homolog, unless such other proteins have a similar or same epitope as epitope in H3L protein or H3L protein homolog that is recognized by an H3L/H3L homolog antibody Selective binding can be

distinguished from non-selective binding using specificity, affinity and other binding assays, and competitive and non-competitive binding assays, descπbed herein or known in the art

The term "isolated," when used as a modifier of an invention composition (e g , antibodies, subsequences, modified forms, nucleic acids encoding same, etc ), means that the compositions are made by the hand of man or are separated, completely or at least in part, from their naturally occurring in vivo environment Generally, isolated compositions are substantially free of one or more mateπals with which they normally associate with in nature, for example, one or more protein, nucleic acid, lipid, carbohydrate, cell membrane The term "isolated" does not exclude alternative physical forms of the composition, such as multimers/oligomers, modifications (e g , phosphorylation, glycosylation, lipidation) or deπvatized forms, or forms expressed in host cells produced by the hand of man

An "isolated" composition (e g , an antibody) can also be "substantially pure" or "purified" when free of most or all of the materials with which it typically associates with in nature Thus, an isolated antibody that also is substantially pure or purified does not include polypeptides or polynucleotides present among millions of other sequences, such as antibodies of an antibody library or nucleic acids in a genomic or cDNA library, for example A "substantially pure" or "purified" composition can be combined with one or more other molecules Thus, "substantially pure" or "purified" does not exclude combinations of compositions, such as combinations of B5R and H3L antibodies, and other poxvirus antibodies or therapies

Antibodies can be modified Examples of modifications include one or more amino acid substitutions (e g , 1-3, 3- 5 , 5- 10 or more residues), additions or deletions (e g , subsequences or fragments) of the antibody In particular embodiments, a modified antibody retains at least part of a function or an activity of unmodified antibody, e g , binding affinity (e g , K d ) or binding specificity to B5R or H3L, binding to a vaccinia virus or pox virus in vitro or an infected cell (e g , in culture), in vitro virus neutralization, complement-dependent virus neutralization, comettail inhibition, protection from or decreasing susceptibility to poxvirus infection or pathogensis, or decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus or against poxvirus, etc

A particular example of a modification is where an antibody is altered to have a different isotype or subclass by, for example substitution of the heavy chain constant region An alteration of Ig subclass can result in a change or an improvement in a function or activity (e g . an anti-poxvirus activity. complement fixation, etc ) Thus, modifications include deleting small and large regions of amino acid

sequences from an antibody and substituting the deleted region with another amino acid sequence, whether the sequence is greater or shorter in length than the deleted region

Antibodies and subsequences of the invention include those having at least partial sequence identity to any heavy or light chain vanable region sequence set forth as SEQ ID NOs 2 δ or 12 or SEQ ID NOs 4, 8 or 10, or SEQ ID NO 14, or SEQ ID NO 16 The percent identity of such antibodies and subsequences can be as little as 60%, or can be more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) The percent identity can extend over the entire sequence length of a heavy or light chain variable region sequence set forth asSEQ ID NOs 2, 6 or 12 or SEQ ID NOs 4, 8 or IO or SEQ ID NO 14, or SEQ JD NO 16, or a contiguous region or area within any of SEQ ID NOs 2, 6 or 12 or SEQ ID NOs 4, 8 or 10, or SEQ ID NO 14, or SEQ ID NO 16 In particular aspects, the length of the sequence sharing the percent identity is 5 or more contiguous amino acids, e g , 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, etc contiguous amino acids In additional particular aspects, the length of the sequence sharing the percent identity is 20 or more contiguous amino acids, e g , 20, 21, 22, 23, 24, 25, 26, 27 28, 29, 30 31, 32, 33 34, 35 etc contiguous amino acids In further particular aspects, the length of the sequence sharing the percent identity is 35 or more contiguous amino acids, e g , 35 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 45, 47, 48, 49, 50, etc , contiguous amino acids In yet further particular aspects, the length of the sequence shaπng the percent identity is 50 or more contiguous amino acids, e g , 50-55, 55-60, 60-65, 65- 70, 70-75, 75-80, 80-85, 85 90, 90-95 95-100, 100 110, etc contiguous amino acids

The term "identity" and grammatical variations thereof, mean that two or more referenced entities are the same Thus, where two antibody sequences are identical, they have the same amino acid sequence The identity can be over a defined area (region or domain) of the sequence "Areas, regions or domains ' of homology or identity mean that a portion of two or more referenced entities share homology or are the same Thus, where two antibody sequences are identical over one or more sequence regions they share identity in these regions The extent of identity between two sequences can be ascertained using a computer program and mathematical algorithm known in the art Such algorithms that calculate percent sequence identity (homology) generally account for sequence gaps and mismatches over the comparison region or area For example, a BLAST (e g , BLAST 20) search algorithm (see, e g , Altschul et al , J MoI Biol 215 403 (1990), publicly available through NCBI) has exemplary search parameters as follows Mismatch -2, gap open 5, gap extension 2 For polypeptide sequence comparisons, a BLASTP algorithm is typically used in combination with a scoring matrix, such as PAMlOO, PAM 250, BLOSUM 62 or BLOSUM 50 FASTA (e g , FASTA2 and FASTA3) and SSEARCH sequence comparison programs are also used to

quantitate the extent of identity (Pearson et al , Proc Natl Acad Sa USA 8 5 2444 (1988), Pearson Methods MoI Biol 132 185 (2000), and Smith et al , J MoI Biol 147 195 (1981)) Programs for quantitating protein structural similarity using Delaunay-based topological mapping have also been developed (Bostick et al , Biochem Biophvs Res Commun 304320 (2003)) In accordance with the invention, there are provided antibodies and subsequences in which there are one or more amino acid substitutions of any heavy or light chain vaπable region sequence set forth as SEQ ID NOs 2, 6 or 12 or SEQ ID NOs 4, 8 or 10, or SEQ ID NO 14, or SEQ ID NO 16 In particular embodiments, a heavy or light chain CDR (CDR I, CDR2 or CDR3) or FR wi Il have 1-8 1-5, 1-3 or fewer (e g , 1 or 2) amino acid substitutions In an additional embodiment, a substitution within a variable region sequence is not within a CDR In another embodiment, a substitution within a variable region sequence is not within an FR Exemplary heavy chain and light chain CDR sequences are as set forth in Table 2 (SEQ ID NOs 17-40) SSAMS, VISISGGSTYY ADSVKG ETRYYYSYGMDV

SYSMN, SISSSRSFIYYADSVKG, ERRYYYSYGLDV, SYSMN, SISSSSSYIYYADSVKG, ERRYYYSYGMDV, DYAIH, GISWNGRSIGYADSVKG, DIGFYGSGSLDY, RASQRIGFALA, DASSLET, QQFNTYPFT, RASQGISSALA, DASSLES QQFNSYPYT RASQGISSALA, DASSLES, QQFNSYPYT RASQSVSSYLA, DASNRAT, AND QQRSNWPALT

The structural determinants that contribute to antigen (e g , B 5 R and H3L) binding, such as complemetarity determining regions (CDR) and framework regions (FR) within hypervanable regions are known in the art The location of additional regions, such as D- and J-regions are also known Antibodies and subsequences thereof in which one or more CDR and FR sequences will typically have sufficient sequence identity to a heavy or light chain sequence exemplified herein so as to retain at least partial function or activity of an antibody that includes a heavy and a light chain sequence exemplified herein, e g , binding affinity (e g , K 4 ) or binding specificity to B5R or H3L binding to a vaccinia virus or pox virus or an infected cell m vitro (e g , in culture), in vitro virus neutralization, complement-dependent virus neutralization, comet-tail inhibition, protection from or decreasing susceptibility to poxvirus infection or pathogensis, or decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus or against poxvirus

Amino acid substitutions can be conservative or non-conservative and may be in the constant or variable (e g , hypervanable, such as CDR or FR) region of the antibody One or a few amino acid substitutions (e g , 2, 3, 4 or 5) in constant or vaπable regions are likely to be tolerated Non conservative substitution of multiple amino acids in hypervanable regions is likely to affect binding activity specificity or antibody function or activity

A "conservative substitution" means the replacement of one amino acid by a biologically. chemically or structurally similar residue Biologically similar means that the substitution is compatible with biological activity, e g , specifically binds to B5R or H3L Structurally similar means that the amino acids have side chains with similar length, such as alanine, glycine and serine, or similar size Chemical similarity means that the residues have the same charge or are both hydrophilic or hydrophobic

Particular non-limiting examples include the substitution of one hydrophobic residue such as isoleucine, valine, leucine or methionine for another, or the substitution of one polar residue for another, such as the substitution of arginine for lysine, glutamic for aspartic acids, orglutamine for asparagine, serine for threonine, and the like Amino acid substitutions may be with the same amino acid, except that a naturally occurring L- amino acid is substituted with a D-form amino acid Modifications therefore include one or more D- amino acids substituted for L-amino acids, or mixtures of D-amino acids substituted for L-amino acids Modifications further include structural and functional analogues, for example peptidomimetics having synthetic or non-natural amino acids or amino acid analogues and deπvatized forms Regional mutability analysis can be used to predict the effect of particular substitutions in complementarity determining regions (CDR) and framework regions (FR) (Shapiro et al , J Immunol 163 259 (1999)) In bπef, sequence comparison indicates a hierarchy of mutability among di- and trinucleotide sequences located within Ig intronic DNA, which predicts regions that are more or less mutable Quantitative structure-activity relationship (QSAR) can be used to identify the nature of the antibody recognition domain and, therefore, amino acids that participate in ligand binding Predictive models based upon QSAR can in turn be used to predict the effect of substitutions (mutations) For example, the effect of mutations on the association and dissociation rate of an antibody interacting with its antigen has been used to construct quantitative predictive models for both kinetic (K, and Kj) constants, which can in turn be used to predict the effect of other mutations on the antibody (De Genst et α\ , JBιol Chem 277 29897 (2002)) The skilled artisan can therefore use such anlysis to predict amino acid substitutions of antibodies and subsequences that are likely to result in an antibody or subsequence that retains at least partial activity or function of non-susbtituted antibody or subsequence

The effect of a given substitution can be assayed in order to identify antibodies retaining at least a part of the binding activity, specificity or antibody function or activity of unsubstituted antibody For example, an amino acid substitution in a hypervaπable region may be assayed for B 5 R or H3L binding activity or binding specificity binding to a vaccinia virus or pox virus or an infected cell m vitro (e g , in culture), in vitro virus neutralization, complement-dependent virus neutralization, comet-tail inhibition,

protection from or decreasing susceptibility to poxvirus infection or pathogensis, or decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus or against poxvirus Antibodies having amino acid substitutions are included so long as at least a part of a function or activity such as binding affinity, binding specificity, 5 binding to a vaccinia virus or pox virus or an infected cell m vitro (e g , in culture), in vrtro virus neutralization, complement-dependent virus neutralization, comet-tail inhibition, protection from or decreasing susceptibility to poxvirus infection or pathogensis, decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus or against poxvirus, etc is at least partially retained

10 Modifications include changes to an activity or function of a reference composition (e g , affinity or specific binding to B5R or H3L, an anti-poxvirus activity, such as complement fixation, as determined by a complement-dependent virus neutralization assay) Modified antibodies having altered characteπstics. such as increased binding affinity, can be produced using methods known in the art For example, affinity maturation techniques can be used to improve antibody binding affinity (US

15 2004/01624I 3 A1. U S Patent Nos 6,656,467, 6,531,580, 6,590,079 and 5,955,358, Fiedler et al , Protein Eng 15 931 (2002), Pancook et al , Hybrid Hybπdomics 20 383 (2001), Daugherty et al , Protein Eng 1 1 825 ( 1998J 1 WU eI aI 1 PrOc Nat'lAcad Sa USA 95 6037 (1998), and Osboum et al , lmmunotechnology 2 181 (1996))

Antibodies include subsequences (e g , fragments) and modified forms (e g , sequence variants) 20 as set forth herein An"antibody"subsequencerefers to a functional fragment or subsequence of immunoglobulin molecule In particular embodiments, B5R and H3L antibody subsequences include an Fab, Fab', F(ab') 2 , Fd, Fv, single-chain Fvs (scFv), disulfide-linked Fvs (sdFv) and V L or V H domain fragments In particular aspects an Fab, Fab' and F(ab') 2 , Fd, Fv, single-chain Fvs (scFv), disulfide- linked Fvs (sdFv) and V L or V H domain subsequence has at least a part of a sequence set forth in any of 25 SEQ ID NOs 2, 6 or 12 or SEQ ID NOs 4, 8 or 10, or SEQ ID NOs 14 or 22, or SEQ ID NOs 16, 18, 20, 24, 26. or 28 In additional aspects, an Fab, Fab' and F(ab') 2 , Fd, Fv, single-chain Fvs (scFv), disulfide- linked Fvs (sdFv) and V L or V H domain subsequence has substantially the same or has the same B5R or H3L binding affinity or B5R or H3L binding specificity, or one or more functions or activities of B5R or H3L antibody, such as an anti-poxvirus activity in vitro or in vivo (e g , virus neutralization, complement- 30 dependent virus neutralization, comet-tail inhibition, efficacy in providing a subject with some protection against posvirus infection or pathogenesis, protecting or decreasing susceptibility of a subject from poxvirus infection or pathogenesis of a cell in vitro, or decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with or against vaccinia virus)

The terms "functional subsequence" and "functional fragment ' when referring to an antibody of the invention refers to a portion of an antibody that retains at least a part of one or more functions or activities as an intact reference antibody

B 5 R and H3L binding antibody subsequences, including single-chain antibodies, can include all or a portion of heavy or light chain variable region(s) (e g , CDRl, CDR2 or CDR3) alone or in combination with all or a portion of one or more of the following hinge region, CHl, CH2, and CH3 domains Also included are antigen binding subsequences of any combination of of heavy or light chain variable region(s) (e g , CDRI, CDR2 or CDR3) with a hinge region, CHl, CH2, and CH3 domains

B5R and H3L antibody subsequences (e g , Fab, Fab , F(ab')2, Fd scFv sdFv and V L or V H ) can be prepared by proteolytic hydrolysis of the antibody, for example, by pepsin or papain digestion of whole antibodies Antibody fragments produced by enzymatic cleavage with pepsin provide a 5 S fragment denoted F(ab')2 This fragment can be further cleaved using a thiol reducing agent to produce 3 5 S Fab' monovalent fragments Alternatively, an enzymatic cleavage using pepsin produces two monovalent Fab' fragments and the Fc fragment directly (see, e g , U S Patent Nos 4,036,9 4 5 and 4,331,647 and Edelman et al , Methods Enymol 1 422 (1967)) Other methods of cleaving antibodies such as separation of heavy chains to form monovalent light-heavy chain fragments, further cleavage of fragments, or other enzymatic or chemical may also be used Genetic techniques include expression of all or a part of the H3L/H3L homolog antibody gene into a host cell such as Cos cells or E coll The recombinant host cells synthesize intact or single antibody chain, such as scFv (see, e g , Whitlow et al In Methods A Companion to Methods in Enzvmology 2 97 ( 1991 ). Bird et al , Science 242 423 (1988). and U S Patent No 4,946,778) Single-chain Fvs and antibodies can be produced as described in U S Patent Nos 4946,778 and 5 ,2 5 8,498, Huston et al Methods Enzymol 203 46 (1991), Shu et al , Proc Natl Acad Sa USA 90 799 5 (1993), and Skerra et al , Science 240 1038 (1988)

Additional modifications of antibodies included in the invention are antibody additions (deπvatives)/insertions For example, an addition can be the covalent or non-covalent attachment of any type of molecule to the antibody Specific examples of antibody additions and deπvatives include glycosylation, acetylation, phosphorylation, amidation, formylation, ubiquitinatation, and deπvatization by protecting/blocking groups and any of numerous chemical modifications

Additions further include fusion (chimeπc) polypeptide sequences, which is an amino acid sequence having one or more molecules not normally present in a reference native (wild type) sequence

covalently attached to the sequence A particular example is an amino acid sequence of another antibody to produce a multispecific antibody

Another particular example of a modified antibody having an amino acid addition is one in which a second heterologous sequence, i e , heterologous functional domain is attached (covalent or non- covalent binding) that confers a distinct or complementary function upon the antibody Such sequences can be referred to as chimeπc sequences For example, an Fc region can be a chimera that includes portions of human IgGl and IgG3 Fc regions, which provides the antibody with increased complement fixation as compared to an antibody with an IgG 1 or IgG3 Fc In another example an amino acid tag such as T7 or polyhistidine can be attached to antibody in order to facilitate purification or detection of antigen or poxvirus(es) Yet another example is an antiviral attached to an antibody in order to target cells infected with poxvirus for killing, proliferation inhibition, replication inhibition etc Thus, in other embodiments the invention provides antibodies and a heterologous domain, wherein the domain confers a distinct function, i e a heterologous functional domain, on the antibody

Heterologous functional domains are not restπcted to amino acid residues Thus, a heterologous functional domain can consist of any of a variety of different types of small or large functional moieties Such moieties include nucleic acid, peptide, carbohydrate, lipid or small organic compounds, such as a drug (e g , an antiviral) a metal (gold, silver), radioisotope

Linkers, such as amino acid or peptidimimetic sequences may be inserted between the antibody sequence and the heterologous functional domain so that the two entities maintain, at least in part, a distinct function or activity Linkers may have one or more properties that include a flexible conformation, an inability to form an ordered secondary structure or a hydrophobic or charged character which could promote or interact with either domain Amino acids typically found in flexible protein regions include GIy, Asn and Ser Other near neutral amino acids, such as Thr and Ala, may also be used in the linker sequence The length of the linker sequence may vary without significantly affecting a function or activity of the fusion protein (see, e g , U S Patent No 6,087,329) Linkers further include chemical moieties and conjugating agents, such as sulfo-succinimidyl deπvatives (sulfo-SMCC, sulfo- SMPB), disuccinimidyl suberate (DSS), disuccinimidyl glutarate (DSG) and disuccinimidyl tartrate (DST)

Additional examples of heterologous functional domains are detectable labels Thus, in another embodiment, the invention provides B5R and H3L antibodies that are detectably labeled

Specific examples of detectable labels include fluorophores, chromophores, radioactive isotopes (e g , S 35 , P 32 , 1 125 ), electron-dense reagents, enzymes, ligands and receptors Enzymes are typically detected by their activity For example, horseradish peroxidase is usually detected by its ability to convert a substrate such as 3,3-', 5 , 5 -'-tetramethylbenzidine (TMB) to a blue pigment, which can be quantified Ligands may bind other molecules such as biotin, which may bind avidin or streptavidin, and IgG, which can bind protein A

Modifications further include cyclic structures such as an end-to-end amide bond between the amino and carboxy-terminus of the molecule or intra- or inter-molecular disulfide bond Polypeptides may be modified in vitro or in vivo, e g , post-translationally modified to include, for example, sugar residues, phosphate groups, ubiqumn, fatty acids, lipids, etc

It is understood that an invention antibody or subsequence may have multiple (e g , two or more) variations, modifications or labels For example, a monoclonal antibody may be coupled to biotin to detect its presence with avidin as well as labeled with I P5 so that it provides a detectable signal Other permutations and possibilities will be readily apparent to those of ordinary skill in the art, and are considered to be within the scope of the invention

The term "human," when used in reference to an antibody, means that the amino acid sequence of the antibody is fully human A "human B5R antibody" or "human anti-B 5 R antibody" therefore refers to an antibody having human immunoglobulin amino acid sequences, i e , human heavy and light chain variable and constant regions that specifically bind to B5R protein or B5R protein homolog A "human H3L antibody" or "human anti-H3L antibody" therefore refers to an antibody having human immunoglobulin amino acid sequences, i e , human heavy and light chain variable and constant regions that specifically bind to H3L protein or H3L protein homolog That is, all of the antibody amino acids are human or can or do exist in a human antibody Thus, for example, an antibody that is non-human may be made fully human by substituting the non-human amino acid residues with amino acid residues that can or do exist in a human antibody Amino acid residues present in human antibodies, CDR region maps and human antibody consensus residues are known in the art (see, e g , Kabat, Sequences of Proteins of Immunological Interest, 4 th Ed US Department of Health and Human Services Public Health Service (1987), and Chothia and Lesk / MoI Biol 186 651 (1987)) A consensus sequence of human V 11 subgroup III, based on a survey of 22 known human V H III sequences, and a consensus sequence of human V L kappa-chain subgroup I, based on a survey of 30 known human kappa I sequences is described in Padlan MoI Immunol 31 169 ( 1994), and Padlan MoI Immunol 28 489 ( 1991 )) Human antibodies of

the invention therefore include antibodies in which one or more amino acid residues have been substituted with one or more amino acids present m any other human antibody

The term "humanized" when used in reference to an antibody, means that the amino acid sequence of the antibody has non-human amino acid residues (e g , mouse, rat, goat, rabbit, non-human primate, etc ) of one or more determining regions (CDRs) that specifically bind to the desired antigen (e g , H3L) in an acceptor human immunoglobulin molecule, and one or more human amino acid residues in the Fv framework region (FR), which are amino acid residues that flank the CDRs Human framework region residues of the immunoglobulin can be replaced with corresponding non-human residues Residues in the human framework regions can therefore be substituted with a corresponding residue from the non- human CDR donor antibody to alter, generally to improve, antigen affinity or specificity, for example In addition, a humanized antibody may include residues, which are found neither in the human antibody nor in the donor CDR or framework sequences For example, a framework substitution at a particular position that is not found in a human antibody or the donor non-human antibody may be predicted to improve binding affinity or specificity human antibody at that position Antibody framework and CDR substitutions based upon molecular modeling are well known in the art, e g , by modeling of the interactions of the CDR and framework residues to identify framework residues important for antigen binding and sequence comparison to identify unusual framework residues at particular positions (see, e g , U S Patent No 5,585,089, and Riechmann et al , Nature 332 323 ( 1988)) Antibodies referred to as "primatized" in the art are within the meaning of "humanized" as used herein, except that the acceptor human immunoglobulin molecule and framework region amino acid residues may be any pπmate amino acid residue (e g , ape, gibbon, gorilla, chimpanzees orangutan, macaque), in addition to any human residue

As used herein, the term "chimeric" and grammatical variations thereof, when used in reference to an antibody, means that the amino acid sequence of the antibody contains one or more portions that are derived from, obtained or isolated from, or based upon two or more different species That is, for example, a portion of the antibody may be human (e g , a constant region) and another portion of the antibody may be non-human (e g , a muπne heavy or light chain variable region) Thus, a chimeric antibody is a molecule in which different portions of the antibody are of different species origins Unlike a humanized antibody, a chimeric antibody can have the different species sequences in any region of the antibody

As used herein, the terms "B5R." "B5", "B5R protein," "B5 protein," "B5R sequence," "B5 sequence," "B5R domain" and "B5 domain" refer to all or a portion of an B5R protein sequence (e g a

subsequence such as an antigenic region or epitope) isolated from, based upon or present in any naturally occurring or artificially produced (e g , genetically engineered) poxvirus strain or isolate or subtype or a species of poxvirus Thus, the term B5R and the like include B5R sequence of vaccinia virus, or B5R homolog of variola major and variola minor small pox virus, or monkeypox, as well as naturally occurring variants produced by mutation during the virus life-cycle, produced in response to a selective pressure (e g , drug therapy, expansion of host cell tropism or infectivity, etc ), as well as recombinant^ or synthetically produced B5R sequences A B5R homolog is a sequence having a significant sequence similarity or identitiyidentity to one or more exemplary vaccinia virus B5R protein sequence sequences set forth as SEQ ID NOs 41-52 Typical sequence identities of B5R homologs in other poxviruses are 90% or more Sequence identities of B5R homologs may be less, however B5R homologs may be referred to by a different name, due to the position of the coding sequence in the virus genome, which determines the name SequencesRepresentative non-limiting sequences and the names of B 5 R homologs are known in the art B5R and B5R homologs to which antibodies bind include sequences within amino acid sequences set forth as SEQ ID NOs 41-52 (SEQ ID NO.-41)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETξFND KQKVTFTCDQ GYHSSDPNAV

CETDKWKYEN PCKKMCTVSD YVξELYDKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN

DTVTCPNAEC QPLQLEHGξC QPVKEKYξFG EYITINCDVG YEVIGASYIS CTANSWNVIP

ξCQQKCDMPS LξNGLISGST FξIGGVIHLS CKξGFTLTGS PSξTCIDGKW NPILPTCVRS NEKFDPVDDG PDDETDLSKL SKDWQYEQE IESLEKGGRA DPAFLYKWR MNEDLGKPIP NPLLGLDSTR TG

W Copenhagen strain B5R (SEQ ID NO: 42)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFNN NQKVTFTCDQ GYHSSDPNAV CETDKWKYEN PCKKMCTVξD YISELYNKPL YEVNSTMTLξ CNGETKYFRC EEKNGNTSWN DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYMTINCDVG YEVIGASYIS CTANSWNVIP ξCQQKCDIPS LSNGLIξGξT FξIGGVIHLξ CKSGFILTGS PSξTCIDGKW NPVLPICVRT NEEFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCDKNNDQY KFHKLLP

W Western Reserve strain B5R (SEQ ID NO -43)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDQ GYHSSDPNAV CETDKWKYEN PCKKMCTVSD YISELYNKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN DTVTCPNAEC QPLQLEHGSC QPVKEKYξFG EYMTINCDVG YEVIGASYIS CTANSWNVIP scQQKCDMPS LSNGLISGST FSIGGVIHLS CKSGFTLTGS PSSTCIDGKW NPVLPICVRT

NEEFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCDKNNDQY KFHKLLP

W MVA strain B5R (SEQ ID NO:44) MKTISWTLL CVLPAWYξT CTVPTMNNAK LTSTETSFNN NQKVTFTCDQ GYHSSDPNAV

CETDKWKYEN PCKKMCTVSD YISELYNKPL YEVNSTMTLξ CNGETKYFRC EEKNGNTSWN

DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYITINCDVG YEVIGASYIS CTANSWNVIP scQQKCDiPS LSNGLISGST FSIGGVIHLS CKSGFILTGS PSSTCIDGKW NPILPTCVRS

NEKFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCDKNNDQY KFHKLLP

W Acambis strain B5R (ξEQ ID NO: 45)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDQ GYHSLDPNAV CETDKWKYEN PCKKMCTVSD YVSELYDKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN

DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYITINCDVG YEVIGASYIS CTANSWNVIP SCQQKCDMPS LSNGLISGST FSIGGVIHLS CKSGFTLTGS PSSTCIDGKW NPILPTCVRS NEKFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCDKNNDQY KFHKLLP

W B5R Tian Tan strain B5R (SEQ ID NO:46)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDQ GYHSSDPNAV CETDKWKYEN PCKKMCTVSD YISELYNKPL YEVNSTMTLξ CNGETKYFRC EEKNGNTSWN

DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYMTINCDVG YEVIGASYIS CTANSWNVIP

SCQQKCDMPS LSNGLISGST FSIGGVIHLS CKSGFILTGS PSSTCIDGKW NPVLPICVRT

NEEFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IMVALTIMGV IFLISVIVLV CSCDKNNDQY KFHKLLP

Camel pox homolog of W B5R(SEQ ID NO: 47)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYYSLDPNAV CETDKWKYEN PCKKMCTVSD YVSELYDKPL YEVNATITLI CKDETKYFRC EEKNENTSWN DTVTCPNAEC QSLQLEHGSC QPVKEKYSFG EHITINCDVG YEVIGASYIS CTANSRNIIP SCQQKCDIPS LSNGLISGST FSIGGVIHLS CKSGFILTGS SSSTCIDGKW NPVLPICVRS NEEFDPVEDG PDDETDLSKL SKDWQYEQE IESLEVTYHI IIVALTIMGV IFLISVIVLV cscNKNNNQY KFHKLLP

Variola ma] or virus (Bangladesh) glycoprotein homolog of W B5R (SEQ ID NO: 48)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYYSLDPNAV CETDKWKYEN PCKKMCTVSD YVSELYNKPL YEVNAIITLI CKDETKYFRC EEKNGNTSWN DTVTCPNAEC QSLQLDHGSC QPVKGKYSFG EHITINCDVG YEVIGASYIT CTANSWNVIP SCQQKCDIPS LSNGLISGST FSIGGVIHLS CKSGFILTGS PSSTCIDGKW NPVLPICIRS NEEFDPVEDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCNKNNDQY KFHKLLL

Variola major virus (India) gpl75 homolog of W B5R (SEQ ID NO:49)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYYSLDPNAV CETDKWKYEN PCKKMCTVSD YVSELYNKPL YEVNAIITLI CKDETKYFRC EEKNGNTSWN

DTVTCPNAEC QSLQLDHGSC QPVKEKYSFG EHITINCDVG YEVIGASYIT CTANSWNVIP

SCQQKCDIPS LSNGLISGST FSIGGVIHLS CKSGFILTGS PSSTCIDGKW NPVLPICIRS

NEEFDPVEDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCNKNNDQY KFHKLLL

Variola minor virus (Garcia) H7R homolog of W B5R (SEQ ID NO.50)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYYSLDPNAV

CETDKWKYEN PCKKMCTVSD YVSELYNKPL YEVNAIITLI CKDETKYFRC EEKNGNTSWN

DTVTCPNAEC QSLQLDHGSC QPVKEKYSFG EHITINCDVG YEVIGASYIT CTANSWNVIP SCQQKCDIPS LSNGLISGST FSIGGVIHLS CKSGFILTGS PSSTCIDGKW NPVLPICIRS

NEEFDPVEDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISVIVLV CSCNKNNDQY KFHKLL

Monkeypox virus B6R homolog of W B5R (SEQ ID NO: 51) MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYHSLDPNAV CETDKWKYEN PCKKMCTVSD YVSELYDKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYMTINCDVG YEVIGVSYIS CTANSWNVIP SCQQKCDIPS LSNGLISGST FSIGGVIHLS CKSGFTLTGS PSSTCIDGKW NPILPTCVRS NEEFDPVDDG PDDETDLSKL SKDWQYEQE IESLEATYHI IIMALTIMGV IFLISIIVLV CSCDKNNDQY KFHKLLP

Cowpox B4R homolog of W B5R (SEQ ID NO: 52)

MKTISWTLL CVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDQ GYHSLDPNAV

CETDKWKYEN PCKKMCTVSD YVSELYDKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYMTINCDVG YEVIGASYIS CTANSWNVIP scQQKCDiPS LSNGLISGST FSIGGVIHLS CKSGFTLTGS PSSTCIDGKW NPILPTCVRS

NEEFDLVDDG PDDETDLSKI SKDWQYEQE IESLEATYHI IIVALTIMGV IFLISIIVLV CSCDKNNDQY KFHKLLP

As used herein, the terms "H3L," "H3". "H3L protein," "H3 protein," "H3L envelope protein," "H3 envelope protein." "H3L sequence," "H3 sequence," "H3L domain" and "H3 domain" refer to all or a portion of an H3L envelope protein sequence (e g , a subsequence such as an antigenic region or epitope) isolated from, based upon or present in any naturally occurring or artificially produced (e g genetically engineered) poxvirus strain or isolate or subtype or a species of poxvirus Thus, the term H3L and the like include H3L sequence of vaccinia virus, or H3L homolog I3L of variola major and variola minor small pox virus, as well as naturally occurring variants produced by mutation during the virus life- cycle, produced in response to a selective pressure (e g , drug therapy, expansion of host cell tropism or infectivity, etc ), as well as recombinantly or synthetically produced H3L sequences An H3L homolog is a sequence having a significant sequence similarity or identitiy to exemplary vaccinia virus H3L protein sequence set forth as SEQ ID NOs 53-65 Typical sequence identities of H3L homologs in other poxviruses are 90% or more Sequence identities of H3L homologs may be less, however For example, molluscum contagiosum gene MC084L is a VV H3L homolog that has 29% identity, and is 53% similar to H3L set forth as SEQ ID NO 31 H3L homologs also typically have a similar length to exemplary H3L protein sequence set forth as SEQ ID NO 31 , usually a length of about 320-330 amino acids H3L homologs may be referred to by a different name, due to the position of the coding sequence in the virus genome, which determines the name Exemplary names for H3L homologs are H3L, I3L, J3L and MC084L Other sequences and the names of H3L homologs are also known in the art Representative non-limiting H3L and H3L homologs to which antibodies bind include sequences within amino acid sequences set forth as SEQ ID NOs 53-65

Wcopenhagen strain H3L (SEQ ID NO: 53)

MAAVKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRNW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSNFF TELENKKVEY WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK NHTIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEHRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI W western reserve strain H3L (SEQ ID NO- 54)

MAAAKTPVIV VPVIDRLPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRNW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSNFF TELENKKVEY WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK NHAIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSξ GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEHRFE NMKPNFWSRI GTAATKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI

W MVA strain H3L (SEQ ID NO.55)

MAAVKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRNW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSNFF TELENKKVEY WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK NHAIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEYRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI

W Acambis MVA strain H3L (SEQ ID NO: 56)

MAAVKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRMW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDξNFF TELENKKVEY

WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK NHAIFTYTGG

YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD

PRLVAEYRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM

FMLIFNVKSK LLWFLTGTFV TAFI

W Tian Tian strain H3L (SEQ ID NO: 57)

MAAAKTPVIV VPVIDRLPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRNW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDξNFF TELENKKVEY WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK NHAIFTYTGG YDVSLSAYII RVTTELNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEHRFE NMKPNFWSRI GTAATKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI

Camelpox J3L homolog of W H3L (SEQ ID NO: 58) MAAAKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRDW WKDDPDHYK DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSKFF TELENKKVEY WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK DHAIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEHRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI

Variola major virus (Bangladesh) I3L homolog of W H3L (SEQ ID NO: 59)

MATVNKTPVI WPVIDRPPS ξTFPNLHEHI NDQKFDDVKD NEVMPEKRNV VIVKDDPDHY KDYAFIHWTG GNIRNDDKYT HFFSGFCNTM CTEETKRNIA RHLALWDSKF FTELENKKVE YWIVENDNV IEDITFLRPV LKAMHDKKID ILQMREIITG NKVKTELVMD KNHVIFTYTG GYDVSLSAYI IRVTTALNIV DEIIKSGGLS SGFYFEIARI ENEMKINRQI MDNSAKYVEH DPRLVAEHRF ENMKPNFWSR IGTAAVKRYP GVMYAFTTPL ISFFGLFDIN VIGLIVILFI MFMLIFNVKS KLLWFLTGTF VTAFI Variola major virus (India) I3L homolog of W H3L (SEQ ID NO: 60)

MATVNKTPVI WPVIDRPPS ETFPNLHEHI NDQKFDDVKD NEVMPEKRNV VIVKDDPDHY KDYAFIHWTG GNIRNDDKYT HFFSGFCNTM CTEETKRNIA RHLALWDSKF FTELENKKVE YWIVENDNV IEDITFLRPV LKAMHDKKID ILQMREIITG NKVKTELVMD KNHVIFTYTG GYDVSLSAYI IRVTTALNIV DEIIKSGGLS SGFYFEIARI ENEIKINRQI MDNSAKYVEH DPRLVAEHRF ENMKPNFWSR IGTAAVKRYP GVMYAFTTPL ISFFGLFDIN VIGLIVILFI MFMLIFNVKS KLLWFLTGTF VTAFI

Variola minor virus (Garcia) J3L homolog of W H3L (SEQ ID NO: 61) MAAVNKTPVI WPVIDRPPS ETFPNLHEHI NDQKFDDVKD NEVMPEKRNV VIVKDDPDHY KDYAFIHWTG GNIRNDDKYT HFFSGFCNTM CTEETKRNIA RHLALWDSKF FTELENKKVE YWIVENDNV IEDITFLRPV LKAMHDKKID ILQMREIITG NKVKTELVMD KNHVIFTYTG GYDVSLSAYI IRVTTALNIV DEIIKSGGLS SGFYFEIARI ENEMKINRQI MDNξAKYVEH DPRLVAEHRF ENMKPNFWSR IGTAAVKRYP GVMYAFTTPL ISFFGLFDIN VIGLIVILFI MFMLIFNVKS KLLWFLTGTF VTAFI

Camelpox virus strain M96 homolog of W H3L (SEQ ID NO:62) MAAVNRTPVI WPVIDRHPS ETFPNVHEHI NDQKFDDVKD NEVMPEKRDV VIVKDDPDHY KDYAFIQWTG GNIRNDDKYT HFFSGFCNTM CTEETKRNIA RHLALWDSKF FTELENKKVE

YWIVENDNV IEDITFLRPV LKAMHDKKID ILQMREIITG NKVKTELVMD KNYAIFTYTG GYDVSLSAYI IRVTTALNIV DEIIKSGGLS SGFYFEIARI ENEMKINRQI MDNSAKYVEH DPRLVAEHRF ENMKPNFWSR IGTAAAKRYP GVMYAFTTPL ISFFGLFDIN VIGLIVILFI MFMLIFNVKS KLLWFLTGTF VTAFI

Monkeypox virus (Zaire-96-I-16) H3L homolog of W H3L (SEQ ID NO.63)

MAAAKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMQEKRDW IVNDDPDHYK

DYVFIQWTGG NIRDDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSKFF IELENKNVEY

WIIENDNVI EDITFLRPVL KAIHDKKIDI LQMREIITGN KVKTELVIDK DHAIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIM DNSAKYVEHD

PRLVAEHRFE TMKPNFWSRI GTVAAKRYPG VMYTFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI

Cowpox virus (GRI-90) J3L protein homolog of W H3L (SEQ ID NO.64) MAAAKTPVIV VPVIDRPPSE TFPNVHEHIN DQKFDDVKDN EVMPEKRDW WKDDPDHYK

DYAFIQWTGG NIRNDDKYTH FFSGFCNTMC TEETKRNIAR HLALWDSKFF TELENKKVEY

WIVENDNVI EDITFLRPVL KAMHDKKIDI LQMREIITGN KVKTELVMDK DHAIFTYTGG

YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD

PRLVAEHRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI molluscum contagiosum gene MC084L, a W H3L homolog (SEQ ID NO- 65)

MAESESTIPL YVLPWGRGA AEWPGNKST GTVRVSQWTP GGAKSEQAGQ YYSALCRVLC

SAEAKQTILN HLSLWKELGS ESAPKAAGAE SEYAIWEDD NTVQPLLLQS AAALVGGMRA QQVHVLQLRE PLHAGVRAQT PLSGNPSAYV YPARLHASLG AYIIHKPSAG RLHAEFLRSR VTAGLPLELP RVERAQGLTR MVLAGSSEYV THEYRLRNEL RGREYGASLR ARAGAWLARN YPQAYAAATT PVFSLFGRVD VNVFGVLSVL FVLVLWFDV QSRLAWLLVG ALASGLLQ

Predicted epitopes for H3L comprise three sequences, denoted PEl, PE2 and PE3, (SEQ ID NOs 66-68, respectively, U S Patent No 7,393,533) are underlined and in bold text, within an amino acid sequence (SEQ ID NO 53)

MAAVKTPVIV VPVIDRPPSE TFPNVHEHIN DOKFDDVKDN EVMPEKRNW WKDDPDHYK DYAFIQWTGG NIRHDDKYTH FFSGFCNTMC TEETKRNIAR HIIAIJWDSHFF TELEMKKVEY WIVENPNVI EDITFLRPVL KAMHDKKIDI LOMREIITGN KVKTELVMDK HHTIFTYTGG YDVSLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD PRLVAEHRFE NMKPNFWSRI GTAAAKRYPG VMYAFTTPLI SFFGLFDINV IGLIVILFIM FMLIFNVKSK LLWFLTGTFV TAFI Invention antibodies include antibodies having kappa or lambda light chain sequences, either full length as in naturally occurring antibodies, mixtures thereof (i e , fusions of kappa and lambda chain sequences), and subsequences/fragments thereof Naturally occurring antibody molecules contain two kappa and two lambda light chains The primary difference between kappa and lambda light chainsisin the sequences of the constant region The term "bind," or "binding," when used in reference to an antibody, means that the antibody specifically binds to all or a part of an antigen (e g , B5R, H3L, or B5R or H3L homolog) Thus, an antibody specifically binds to all or a part of sequence or an antigenic epitope present on B5R, H3L, or B5R or H3L homolog but may also bind to other proteins should those proteins have the same or a

similar epitope as B5R, H3L, or B5R or H3L homolog antigenic epitope Antibodies that bind to the same sequence or epitope or a part of the epitope as an antibody that binds to B 5 R, H3L, or B5R or H3L homolog, can have more or less relative binding affinity or specificity for B 5 R, H3L, or B 5 R or H3L homolog, and are expressly included For example, in particular embodiments, antibodies are provided 5 that bind to both B5R and B6 proteins, due to a shared epitope on the B5R and B6 proteins

A part of an antigenic epitope means a subsequence or a portion of the epitope For example, if an epitope includes 8 contiguous amino acids, a subsequence and, therefore, a part of an epitope may be 7 or fewer amino acids within this 8 amino acid sequence epitope In addition, if an epitope includes noncontiguous amino acid sequences, such as a 5 amino acid sequence and an 8 amino acid sequence which 10 are not contiguous with each other, but form an epitope due to protein folding, a subsequence and therefore, a part of an epitope may be either the 5 amino acid sequence or the 8 amino acid sequence alone

Epitopes typically are short amino acid sequences, e g about five to I 5 amino acids in length Systematic techniques for identifying epitopes are also known in the art and are described, for example, in

15 U S Patent No 4,708,871 Briefly, a set of overlapping oligopeptides deπved from an antigen may be synthesized and bound to a solid phase array of pins, with a unique oligopeptide on each pin The array of pins may comprise a 96-well microtiter plate, permitting one to assay all 96 oligopeptides simultaneously, e g , for binding to an anti-H3L monoclonal antibody Alternatively, phage display peptide library kits (New England BioLabs) are commercially available for epitope mapping Using these methods, binding

20 affinity for every possible subset of consecutive amino acids may be determined in order to identify the epitope that a particular antibody binds Epitopes may also be identified by inference when epitope length peptide sequences are used to immunize animals from which antibodies that bind to the peptide sequence are obtained Continuous epitopes can also be predicted using computer programs, such as BEPITOPE, known in the art (Odoπco et al , / MoI Recognit 16 20 (2003))

25 Antibodies of the invention include B 5 R and H3L antibodies and subsequences thereof with more or less affinity for B 5 R or H3L than a reference antibody For example, anantibody or subsequence thereof can have more or less affinity for B 5 R envelope protein and include a sequence at least 60% or more (e g 65%, 70% 7 5 % 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12, and a sequence at least 60% or more (e g , 65%, 70%. 75%,

30 80%, 85%, 90%, 95%, etc ) identical to any light chain vaπable region sequence set forth as SEQ ID NOs 4. 8 or 10 Anantibody or subsequence thereof can have more or less affinity for H3L envelope protein and include a sequence at least 60% or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc )

identical to any heavy chain variable region sequence set forth asSEQ ID NO 14, and a sequence at least 60% or more (e g , 65%. 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any light chain variable region sequence set forth as SEQ ID NO 16

Antibodies may have the same or substantially the same binding specificity as the exemplified 5 antibodiesand subsequences thereof Thus, a given antibody (e g , B5R or H3L) may inhibit or compete for binding of another antibody to B5R or H3L, for example, inhibiting binding by at least 30%. at least 35%, at least 40%, at least 45%, at least 50%, at least 55%, at least 60%, at least 65%, at least 70%. at least 75%, at least 80%, at least 85%, at least 90%, or at least 95% or more of C 12, C 14, C 18, B96, B 1 16, B 126 or D67 antibodies A given B5R or H3L antibody may not detectably compete with or

10 inhibit binding of another antibody to B5R or H3L where the antibodies bind to regions of B5R or H3L that do not interfere with each other Accordingly, antibodies and subsequences thereof that have substantially the binding specificity as antibodies and subsequences thereof that include a sequence at least 60% or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth as SEQ ID NOs 2, 6 or 12. and a sequence at least 60% or more (e g ,

15 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any light chain variable region sequence set forth as SEQ ID NOs 4, 8 or 10 are included, as areantibodies and subsequences thereof that have substantially the binding specificityas antibodies and subsequences thereof that include a sequence at least 60% or more (e g , 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth asSEQ ID NO 14, and a sequence at least 60% or more (e g , 65%, 70%, 75%.

20 80%, 85%, 90%, 95%, etc ) identical to any light chain variable region sequence set forth as SEQ ID NO 16are included

To obtain antibodies that have the same or similar binding specificityas another antibody, antibodies that compete for the binding of the antibody to a target antigen (e g , B5R or H3L) are screened using a conventional competition binding assay Screened antibodies can be characterized by any method 25 known in the art, and affinity or specificity, determined by competitive binding, for example, blocking or binding inhibition assays Antibodies that have the same or similar binding specificity are those that compete for binding to the target antigen (e g , B5R, B6 or H3L) Because the binding affinity of antibodies may differ, the antibodies will vary in their ability to compete for binding to antigen and may provide greater or less effectiveness for treatment as compared to other antibodies or VIG

30 Invention antibodies therefore include human, humanized and chimeric antibodies having the same or different binding affinity for B5R or H3L or homolog thereof and having the same or a different binding specificity for B5R or H3L or homolog thereof For example, aB5R or homolog antibody of the

invention may have an affinity greater or less than 2-5, 5-10, 10- 100, 100- 1000 or 1000- 10,000 fold affinity or any numeπcal value or range or value within such ranges, as another B5R antibody, for example, of C 12, C 14, C 18, B96, or Bl 16 antibody Likewise, an H3L or homolog antibody of the invention may have an affinity greater or less than 2-5, 5-10, 10-100, 100-1000 or 1000-10,000 fold affinity or any numerical value or range or value within such ranges, as another H3L antibody, for example, D67 antibody Antibodies of the invention therefore include human, humanized and chimeric antibodies having the same or different binding affinity or the same or different binding specificity, or function or activity (e g , anti-poxvirus activity), as human polyclonal H3L, B5R or H3L or B5R protein homolog binding antibodies, as set forth herein Exemplary antibody binding affinities for a target antigen (e g , B5R or H3L) have a dissociation constant (Kd) less than 5x10 2 M, 10 2 M, 5xl0 3 M, 10 3 M 1 SxIO- 4 M, 10- 1 M 1 SxIO 5 M, 10 5 M, 5xl0 6 M, 10 6 M, 5xl0 7 M, 10 7 M 5xlO 8 M, 10 8 M, 5xl0 9 M. IO 9 M, 5x10 l0 M, 10 10 M, 5x10 " M, 10 " M, 5x10 12 M. 10 12 M, 5x10 13 M, 10 π M, 5x10 l4 M, 10 14 M, 5x10 15 M and 10 15 M Typically, binding affinities (K,,) for B5R or H3L will be less than 10 7 M, 5xlO 8 M, 10 s M, 5xlO 9 M, 10 9 M, 5x10 l0 M, 10 10 M, 5x10 " M, 10 " M, 5x10 12 M, or 10 12 M

At least a part of binding affinity for a target antigen (e g , B5R or H3L)can be when the antibody has less affinity for target antigen (e g . B5R or H3L) than a reference antibody, e g , 1 -3-fold, 1 -5-fold, 2- 5 fold, 5- 10-fold, 5- 15-fold, 10- 15-fold. 15-20-fold, 20-25-fold, 25-30-fold, 30-50-fold, 50-100 fold, 100- 500-fold 500- 1000-fold, 1000-5000-fold, or less (e g , K 4 ) affinity, or anynumeπcal value or range of values within such ranges, for example, of C12, CI4, C18, B96, B116, B 126 or D67 antibody At least a part of binding affinity for target antigen (e g , B5R or H3L) can be when the antibody has more affinity for the target antigen (e g , B5R or H3L) than a reference antibody, e g , 1-3-fold, 1 -5-fold, 2-5 fold, 5- 10- fold, 5-15-fold IO-15-fold, 15-20-fold, 20-25-fold, 25-30-fold, 30-50-fold, 50-100 fold, 100-500-fold 500- 1000-fold, 1000-5000-fold, or more (e g . K d ) affinity, or anynumerical value or range of values within such ranges, for example, of C12, C14, C18, B96, Bl 16. B126, or Dθ7 antibody

Binding affinity can be determined by association (KJ and dissociation (K 11 ) rate Equilibrium affinity constant. K, is the ratio of KJK 4 An antibody having the same binding affinity as another antibody, means that the dissociation constant (Ka) of each antibody is within about 1 to 10 fold ( 1-10 fold greater affinity or 1-10 fold less affinity, or any numerical value or range or value within such ranges, than the reference antibody) An antibody having "substantially the same" binding affinity as another antibody, means that the dissociation constant (K d ) of each antibody is within about 10 to 1000 fold (10-

1000 fold greater affinity or I - 1000 fold less affinity) for example of C12 C14 CI8 B96, Bl 16, B I26, or D67 antibody

Association (K a ) and dissociation (K d ) rates can be measured using surface plasraon resonance (SPR) (Rich and Myszka, Curr Opin Bwtechnol 1 1 54 (2000) Englebienne, Analyst 123 1599 (1998)) Instrumentation and methods for real time detection and monitoπng of binding rates are known and are commercially available (BiaCore 2000, Biacore AB Upsala, Sweden, and Malmqvist, Biochem Soc Trans 27 335 (1999))

Antibodies include those that have at least a part of an "activity or "function as the reference antibody, for example, binding affinity (e g K d ), binding specificity or protection from or decreasing susceptibility to, or decreasing or preventing an adverse side effect or complication associated with or caused by poxvirus infection or pathogensis or vaccination or immunization with a vaccinia virus or against poxvirus Thus an antibody having an activity of a B5R or H3L binding antibody has at least a part of one or more activities of the B5R or H3L binding antibodies such as anti poxvirus activity in vivo or m vitro complement fixation destruction of VACV infected cells by complement, etc The term "at least a part ' means that the antibody may have less activity but the antibody retains at least a measurable or detectable amount of the activity of the reference antibody, e g at least partial binding affinity for B5R or H3L at least partial protection from or decreasing susceptibility to, or decreasing or preventing an adverse side effect or complication associated with or caused by poxvirus infection or pathogensis or vaccination or immunization with a vaccinia virus vaccinia virus protein against poxvirus etc B5R or H3L antibodies having at least a part of one or more activities or functions of the B5R or H3L binding antibodies and subsequences thereof exemplified herein may also have a greater activity than a reference antibody such as one or more of the B5R or H3L binding antibodies and subsequences thereof exemplified herein Invention antibodies include antibodies having either or both ofantibody dependent cell mediated cytotoxicity (ADCC)andcomplement-mediated cytotoxicity (CDC) activities

Antibodies having an activity or function of B5R or H3L binding antibodies can be identified through various methods disclosed herein or known in the art For example, binding assays against B5R or H3Lon plates or (ELISA), on cells (cell based ELISA) and specific inhibition of antibody binding to B5R or H3L can be used as a measure of binding specificity as well as affinity Additional assays include in vitro binding of vaccinia or poxvirus infected cells, neutralization assays with poxvirus (e g vaccinia virus) complement dependent vims neutralization assay comet-tail inhibition, as well as in vivo animal

protection and other assays as set forth in Examples 4 to 7and lOin order to ascertain and compare antibodies for the ability to provide animals with protection against or protect or decrease susceptibility of vaccinia virus infection or pathogenesis, etc

Methods of producing B5R and H3L binding antibodies are disclosed herein or known in the art B 5 R and H3L binding polyclonal antibodies can be obtained by affinity purification of B5R or H3L antibodies from vaccinia immune globulin (VIG) from vaccinia virus or from B5R. H3L or B5R or H3L homolog immunized animals Human VIG can be used as a source for human polyclonal B 5 R and H3L antibodies

B 5 R and H3L binding monoclonal antibodies can be generated using techniques including conventional hybπdoma technology, recombinant and phage display technologies or a combination thereof (see U S Patent Nos 4.902.614, 4.543,439, and 4,41 1.993 see also Monoclonal Antibodies.

Hvbπdomas A New Dimension in Biological Analyses. Plenum Press, Kennett. McKearn. and Bechtol

(eds ), 1980, and Harlow et al . Antibodies A Laboratory Manual Cold Spring Harbor Laboratory Press.

2nd ed 1988) B5R and H3L binding monoclonal antibodies can also be obtained by direct cloning of immunoglobulin sequences from animals including primate or human subjects that have been exposed to a poxvirus or vaccinated or immunized with live or attenuated vaccinia virus or poxvirus protein

Specific hybπdomas that produce antibodies of the invention have been deposited with ATCC In particular, hybπdoma cell line 13IC14AA (also referred to as Cl 4) which produces an anti-B 5 R antibody, was deposited on September 25, 2007. and has a deposit designation of PTA-8654 (ATCC 1 10801 University Blvd , Manassas. VA 201 10-2209). hybπdoma cell line I3IC18 (also referred to as Cl 8). which produces an anti-B5R antibody, was deposited on August 22. 2007, and has a deposit designation of PTA-8562 (ATCC 1 10801 University Blvd , Manassas, VA 20110-2209), hybπdoma cell line 131 C 12AA (also referred to as C 12), which produces an anti-B5R antibody, was deposited on September 2 5. 2007, and has a deposit designation of PTA-8653 (ATCC 1 10801 University Blvd , Manassas. VA 201 10-2209). and hybπdoma cell line I30D67 (also referred to as D67), which produces an anti-H3L antibody, was deposited on August 22, 2007, and has a deposit designation of PTA-8564 (ATCC 1 10801 University Blvd Manassas, VA 201 10-2209)

Animals may be immunized with B5R, H3L or B 5 R or H3L homoiogs, including mice, rabbits, rats, sheep cows or steer, sheep, goats, pigs, horse, guinea pigs, amd primates including humans, in order to obtain antibodies that bind to B5R H3L or B 5 R or H3L homolog Such animals include genetically modified non human animals having human IgG gene loci (e g , lambda or kappa light chain), which are

capable of expressing human antibodies Conventional hybπdoma technology using splenocytes isolated from immunized animals that respond to the antigen and fused with myeloma cells can be used to obtain human monoclonal antibodies A specific non limiting example is the human transchromosomic KM mice™ (Tomizuka et al . Proc Natl Acad Sa USA 97 722 (2000), and Ishida et al Cloning Stem Cells 4 91 (2004)) which can produce human immunoglobulin genes (WO02/43478) or HAC mice

(WO02/092812) Transgenic animals with one or more human immunoglobulin genes (kappa or lambda) that do not express endogenous immunoglobulins are described for example in, U S Patent No 5 939,598 Such animals can therefore be used to produce human antibodies in accordance with the invention compositions and methods Additional methods for producing human polyclonal antibodies and human monoclonal antibodies are described (see, e g Kuroiwa et al , Nat Biotechnol 20 889 (2002), WO 98/24893 WO 92/01047 WO 96/34096, WO 96/33735, U S Patent Nos 5,413,923 5,625,126, 5,633,425, 5,569 825, 5 661,016, 5,545,806, 5,814 318, 5 885,793, 5,916,771 and 5,939 598) An overview of the technology for producing human antibodies is descπbed in Lonberg and Huszar (Int Rev Immunol 13 65 (1995)) Antigen (e g B5R or H3L) suitable for generating antibodies can be produced by any of a variety of standard protein purification or recombinant expression techniques known in the art For example, B5R or H3L or subsequences thereof can be produced by standard peptide synthesis techniques, such as solid-phase synthesis A portion of the protein may contain an amino acid sequence such as a T7 tag or polyhistidine sequence to facilitate purification of expressed or synthesized B5R or H3L sequence B5R or H3L encoding nucleic acid may be expressed in a cell and protein produced by the cells puπfied or isolated B5R or H3L may be expressed as a part of a larger protein by recombinant methods

Forms of antigen (e g , B5R and H3L) suitable for generating an immune response include peptide subsequences of full length antigen (e g , B5R and H3L), which typically comprise four to five or more amino acids Additional forms of antigen (e g B5R and H3L) include preparations or extracts (such as live or attenuated vaccinia virus, e g , modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia virus NYCB OH strain vaccinia virus Wyeth strain or vaccinia virus prepared from calf lymph Dryvax®), partially purified antigen (e g , B5R and H3L) as well as host cells or viruses that express antigen (e g , B5R and H3L) and preparations or mixtures of such antigen (e g , B5R and H3L) expressing cells or viruses To increase the immune response antigen (e g , B5R and H3L) can be coupled to another protein such as ovalbumin or keyhole limpet hemocyanin (KLH), thyroglobuhn and tetanus toxoid, or mixed with an adjuvant such as Freund's complete or incomplete adjuvant Initial and any optional subsequent

immunization may be through intraperitoneal, intramuscular, intraocular, or subcutaneous routes. Subsequent immunizations may be at the same or at different concentrations of antigen (e.g., B5R and H3L) preparation, and may be at regular or irregular intervals.

Antibodies can be humanized using a variety of techniques known in the art including, for example, CDR-grafting (EP 239,400; W091/09967; U.S. Patent Nos. 5,225,539: 5,530, 101 , and 5,585,089), veneering or resurfacing (EP 592,106; EP 519.596; Padlan, Molecular Immunol. 28:489 (1991), Studnicka et al , Protein Engineering 7:805 (1994); Roguska. et al , Proa N at' L Acad. Sci USA 91.969 ( 1994)), and chain shuffling (U.S. Patent No. 5,565,332) Human consensus sequences (Padlan. MoI. Immunol.3 \ : \69 ( 1994); and Padlan, MoI. Immunol. 28 489 (1991)) have previously used to humanize antibodies (Carter et al. Proa Natl. Acad. Sci USA 89 4285 (1992); and Presta et al., J. Immunol. 151 -2623 (1993)).

Methods for producing chimeric antibodies are known in the art (e.g., Morrison, Science 229: 1202 (1985), Oi et al., BioTechniques 4:214 (1986); Gillies et al.. J. Immunol. Methods 125- 191 (1989); and U.S. Patent Nos.5,807,715; 4.816,567; and 4,816,397). Chimeric antibodies in which a variable domain from an antibody of one species is substituted for the variable domain of another species are described, for example, in Munro, Nature 312-597 ( 1984); Neuberger et al , Nature 312 604 ( 1984); Sharon et al , Nature 309-364 (1984); Morrison et al., Proc. Nat'l Acad. Sci USA 81:6851 (1984); Boulianne et al., Nature 312:643 ( 1984), Capon et al., Nature 337:525 (1989), and Traunecker et al., Nature 339:68 (1989). The invention also provides nucleic acids encoding B5R or H3L binding antibodies. In one embiment, a nucleic acid encodes a sequence at least 60 % or more (e.g., 65%, 70%, 75%, 80%, 85%, 90%, 95%, etc.) identical to any heavy chain variable region sequence set forth as SEQ ID NOs.2, 6 or 12 or a sequence set forth as SEQ ID NOs 4. 8 or IO In another embodiment, a nucleic acid encodes a sequence at least 60 % or more (e g , 65%, 70%, 75%. 80%, 85%, 90%, 95%, etc ) identical to any heavy chain variable region sequence set forth as SEQ ID Nθs-2, 6 or 12 or a sequence set forth as SEQ ID Nθs:4, 8 or 10. In an additional embodiment, a nucleic acid encodes a sequence having one or more amino acid additions, deletions or substitutions of SEQ ID Nθs:2, 6 or 12, or SEQ ID Nθs-4, 8 or 10. In a further embodiment, a nucleic acid encodes a sequence at least 60 % or more (e.g., 65%, 70%, 75%, 80%, 85%. 90%, 95%, etc.) identical to a sequence having one or more amino acid additions, deletions or substitutions of SEQ ID NO.14, or SEQ ID NO: 16. In yet another embodiment, a nucleic acid encodes a sequence having one or more amino acid additions, deletions or substitutions of SEQ ID NO 14, or SEQ

ID NO 16 In particular aspects, a nucleic acid encodes SEQ ID NOs 2, 6 or 12, or SEQ ID NOs 4. 8 or 10, SEQ ID NO 14. or SEQ ID NO 16, and subsequences thereof

The terms "nucleic acid" and "polynucleotide" and the like refer to at least two or more nbo- or deoxy-πbonucleic acid base pairs (nucleotides) that are linked through a phosphoester bond or equivalent 5 Nucleic acids include polynucleotides and polynucleosis Nucleic acids include single, double or tπplex, circular or linear, molecules Exemplary nucleic acids include but are not limited to RNA, DNA, cDNA, genomic nucleic acid, naturally occurring and non naturally occurring nucleic acid, e g , synthetic nucleic acid

Nucleic acids can be of various lengths Nucleic acid lengths typically range from about 20 10 nucleotides to 20 Kb, or any numerical value or range within or encompassing such lengths, 10 nucleotides to 10Kb, 1 to 5 Kb or less, 1000 to about 500 nucleotides or less in length Nucleic acids can also be shorter, for example, 100 to about 500 nucleotides, or from about 12 to 25, 25 to 50, 50 to 100, 100 to 250, or about 250 to 500 nucleotides in length, or any numerical value or range or value within or encompassing such lengths In particular aspects, a nucleic acid sequence has a length from about 10-20. 15 20-30, 30-50, 50-100, 100-150, 150-200, 200-250, 250-300, 300-400, 400-500, 500-1000, 1000-2000, nucleotides, or any numerical value or range within or encompassing such lengths Shorter polynucleotides are commonly referred to as "oligonucleotides" or "probes" of single- or double-stranded DNA However, there is no upper limit to the length of such oligonucleotides

Nucleic acids include sequences that are complementary and sequences that specifically hybridize 20 to SEQ ID NOs 1, 3, 5, 7, 9, or 1 1, or SEQ ID NOs 13 or 15, or a complementary or antisense sequence thereof

The term "complementary" or "antisense" refers to a polynucleotide or peptide nucleic acid capable of binding to a specific DNA or RNA sequence Antisense includes single, double, triple or greater stranded RNA and DNA polynucleotides and peptide nucleic acids (PNAs) that bind RNA

25 transcript or DNA Particular examples include RNA and DNA antisense that binds to sense RNA For example, a single stranded nucleic acid can target a protein transcript that participates in metabolism, catabolism, removal or degradation of glycogen from a cell (e g , mRNA) Antisense molecules are typically 95-100% complementary to the sense strand but can be "partially" complementary, in which only some of the nucleotides bind to the sense molecule (less than 100% complementary, e g 95%. 90%.

30 80%, 70% and sometimes less), or any numerical value or range within or encompassing such percent values

%

The term "hybridize" and grammatical variations thereof refer to the binding between nucleic acid sequences Hybridizing sequences will generally have more than about 50% complementary to a nucleic acid that encodes an amino acid sequence of a reference(e g , B5R or H3L heavy or light chain variable region) sequence The hybridization region between hybridizing sequences typically is at least about 12-15 nucleotides, 15-20 nucleotides, 20-30 nucleotides, 30-50 nucleotides, 50-100 nucleotides, 100 to 200 nucleotides or more, or any numerical value or range within or encompassing such lengths

Nucleic acid sequences further include nucleotide and nucleoside substitutions, additions and deletions, as well as deπvatized forms and fusion/chimeπc sequences (e g , encoding recombinant polypeptide) For example, due to the degeneracy of the genetic code, nucleic acids include sequences and subsequences degenerate with respect to nucleic acids that encode SEQ ID NOs 2, 6 or 12, or SEQ ID NOs 4, 8 or 10, SEQ ID NO 14, or SEQ ID NO 16, and subsequences thereof

Nucleic acids can be produced using various standard cloning and chemical synthesis techniques Techniques include, but are not limited to nucleic acid amplification, e g , polymerase chain reaction (PCR), with genomic DNA or cDNA targets using pπmers (e g , a degenerate pπmer mixture) capable of annealing to antibody encoding sequence Nucleic acids can also be produced by chemical synthesis (e g , solid phase phosphoramidite synthesis) or transcription from a gene The sequences produced can then be translated in vitro, or cloned into a plasmid and propagated and then expressed in a cell (e g , a host cell such as eukaryote or mammalian cell, yeast or bacteria, in an animal or in a plant)

Nucleic acid may be inserted into a nucleic acid construct in which expression of the nucleic acid is influenced or regulated by an "expression control element " An "expression control element" refers to a nucleic acid sequence element that regulates or influences expression of a nucleic acid sequence to which it is operatively linked Expression control elements include, as appropriate, promoters, enhancers, transcription terminators, gene silencers, a start codon (e g , ATG) in front of a protein-encoding gene, etc An expression control element operatively linked to a nucleic acid sequence controls transcription and. as appropriate, translation of the nucleic acid sequence Expression control elements include elements that activate transcription constitutively, that are inducible (i e , require an external signal for activation), or derepressible (ι e , require a signal to turn transcription off, when the signal is no longer present, transcπption is activated or "derepressed"), or specific for cell -types or tissues (i e , tissue- specific control elements)

Nucleic acid may be inserted into a plasmid for propagation into a host cell and for subsequent genetic manipulation. A plasmid is a nucleic acid that can be propagated in a host cell, plasmids may optionally contain expression control elements in order to drive expression of the nucleic acid encoding B5R or H3L binding antibody or antigen (e g , B5R or H3L) in the host cell A vector is used herein synonymously with a plasmid and may also include an expression control element for expression in a host cell (e g , expression vector) Plasmids and vectors generally contain at least an origin of replication for propagation in a cell and a promoter Plasmids and vectors are therefore useful for genetic manipulation and expression of B5R and H3L binding antibodies as well as antigen (e g , B5R or H3L)

Nucleic acids encoding variable regions of B5R or H3L antibody heavy and light chains, or encoding full length B5R or H3L antibody heavy and light chains can be produced synthetically or using recombinant methods, or isolated from a cell such as a hybπdoma Isolated nucleic acids may be inserted into a suitable expression vector, and introduced into suitable host cells (e g , CHO, plant and other cells) which can be cultured for the production of recombinant B 5 R or H3L antibodies

In accordance with the invention, there are provided host cells that express or are transformed with a nucleic acid that encodes a B5R or H3L antibody of the invention Host cells include but are not limited to prokaryotic and eiikaryotic cells such as bacteria, fungi (yeast), plant, insect, and animal (e g , mammalian, including primate and human) cells For example, bacteria transformed with recombinant bacteπophage nucleic acid, plasmid nucleic acid or cosmid nucleic acid expression vectors, yeast transformed with recombinant yeast expression vectors, plant cell systems infected with recombinant virus expression vectors (e g , cauliflower mosaic virus, CaMV, tobacco mosaic virus, TMV) or transformed with recombinant plasmid expression vectors (e g Ti plasmid), insect cell systems infected with recombinant virus expression vectors (e g , baculovirus). and animal cell systems infected with recombinant virus expression vectors (e g , retroviruses, adenovirus, vaccinia virus), or transformed animal cell systems engineered for stable expression The cells may be a pnmary cell isolate cell culture (e g , passaged, established or immortalized cell line), or part of a plurality of cells, or a tissue or organ ex vivo or in a subject (in vivo) In particular embodiments, a cell is a hyperprohferative cell, a cell comprising a cellular hyperprohferative disorder, an immortalized cell, neoplastic cell, tumor cell or cancer cell

The term "transformed" or "transfected" when use in reference to a cell (e g , a host cell) or organism, means a genetic change in a cell following incorporation of an exogenous molecule, for example, a protein or nucleic acid (e g , Ά transgene) into the cell Thus, a "transfected" or "transformed"

cell is a cell into which or a progeny thereof in which an exogenous molecule has been introduced by the hand of man, for example, by recombinant DNA techniques

The nucleic acid or protein can be stably or transiently transfected or transformed (expressed) in the cell and progeny thereof The cell(s) can be propagated and the introduced protein expressed, or nucleic acid transcribed A progeny of a transfected or transformed cell may not be identical to the parent cell, since there may be mutations that occur during replication

Introduction of protein and nucleic acid into target cells (e g , host cells) can also be earned out by methods known in the art such as osmotic shock (e g calcium phosphate), electroporation, microinjection, cell fusion, etc Introduction of nucleic acid and polypeptide in vitro, ex vivo and in vivo can also be accomplished using other techniques For example, a polymeric substance, such as polyesters, polyamine acids, hydrogel, polyvinyl pyrrohdone, ethylene-vinylacetate, tnethylcellulose, carboxymethylcellulose, protamine sulfate, or lactide/glycolide copolymers, polylactide/glycohde copolymers, or ethylenevinylacetate copolymers A nucleic acid can be entrapped in microcapsules prepared by coacervation techniques or by interfacial polymerization, for example, by the use of hydroxymethylcellulose or gelatin-microcapsules, or poly (methylmethacrolate) microcapsules, respectively, or in a colloid system Colloidal dispersion systems include macromolecule complexes, nano-capsules, microspheres, beads, and lipid-based systems, including oil-in-water emulsions, micelles, mixed micelles, and liposomes

Liposomes for introducing various compositions into cells are known in the art and include, for example, phosphatidylcholine, phosphatidylseπne lipofectin and DOTAP (e g , U S Patent Nos

4,844,904, 5,000,959 4,863,740, and 4,975,282, and GIBCO-BRL, Gaithersburg Md) Piperazine based amphilic cationic lipids useful for gene therapy also are known (see, e g , U S Patent No 5,861,397) Cationic lipid systems also are known (see, e g , U S Patent No 5,459,127) Polymeric substances, microcapsules and colloidal dispersion systems such as liposomes are collectively referred to herein as "vesicles "

Accordingly, viral and non-viral vector means of delivery into cells, tissue or organs, in vitro, in vivo and ex vivo are included

In accordance with the invention, there are provided methods for providing a subject with protection against poxvirus infection or pathogenesis In one embodiment, a method includes administering an amount of an antibody that binds to B5R or H3L envelope protein sufficient to provide the subject with protection against poxvirus infection or pathogenesis

Also provided are methods for protecting or decreasing susceptibility of a subject to a poxvirus infection or pathogenesis In one embodiment a method includes administering an amount of an antibody that binds to B5R or H3L envelope protein sufficient to protect or decrease susceptibility of the subject to poxvirus infection or pathogenesis Additionally provided are methods for decreasing or preventing an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus a vaccinia virus protein, a poxvirus or a poxvirus protein In one embodiment, a method includes administering a composition comprising an amount of an antibody that binds B5R or H3L envelope protein to a subject sufficient to decrease or prevent an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus (live or attenuated) a vaccinia virus protein or a poxvirus or poxvirus protein In various aspects, adverse side effects or complications decreased or prevented include adverse side effect or complication comprises fever, rash, pustules or pocks, generalized vaccinia, progressive vaccinia, postvaccinia! encephalitis, vaccinia keratitis eczema vaccinatum, periocular infection or accidental infection of close contacts In additional aspects the subject is a candidate for or has been vaccinated with vaccinia virus, live or attenuated a vaccinia virus protein, or a poxvirus or poxvirus protein In other aspects, a subject is administered an antibody that binds B5R or H3L envelope protein or B5R or H3L envelope protein prior to. concurrently with, following or within 1-2, 2-4, 4- 12 or 12-24 hours of vaccination or immunization with vaccinia virus, a vaccinia vims protein or a poxvirus or poxvirus protein Further provided are methods for decreasing or preventing an adverse side effect or complication in an immune-suppressed subject (e g a subject with or at πsk of immunodeficiency, such as an HIV- positive subject) associated with or caused by vaccination with a vaccinia virus, live or attenuated, or a vaccinia vims protein or a poxvirus or poxvirus protein In one embodiment a method includes administering a composition comprising an amount of an antibody that binds B5R or H3L envelope protein to the subject sufficient to decrease or prevent an adverse side effect or complication associated with or caused by vaccination with a Vaccinia vims

Methods of the invention may be practiced prior to, concurrently with, or following poxvirus infection, contact with or exposure to a poxvirus, or vaccination or immunization with a vaccinia virus, a vaccinia virus protein or a poxvirus or poxvirus portein Methods of the invention may be practiced prior to concurrently with or following a poxvirus infection contact with or exposure to a poxvirus, or vaccination with vaccinia virus, a vaccinia virus protein or immunization against a poxvirus or with a poxvirus protein

Invention antibodies and methods include antibodies subsequences thereof and methods that provide a subject with partial or complete protection against poxvirus infection or pathogenesis or a reduction, inhibition, delay, decrease or prevention of a symptom of poxvirus exposure, infection or pathogenesis Invention antibodies and methods include antibodies, subsequences thereof and methods that protect or decrease susceptibility of a subject, at least partially or completely, to a poxvirus infection or pathogenesis, or reduction, inhibition delay, decrease or prevention of a symptom of poxvirus infection or pathogenesis Exemplary symptoms include, for example, high fever, fatigue, headache, backache, malaise, rash (maculopapular, vesicular or pustular) or lesions, viremia, delirium vomiting, diarrhea, and excess bleeding Antibody activity and methods of the invention can include any reduction, inhibition, delay decrease or prevention in the onset, progression, severity, duration frequency or probability of one or more symptoms associated with or caused by a poxvirus infection or pathogenesis, as set forth herein or known in the art, or a subjective or objective detectable or measurable improvement or benefit to the subject

Invention antibodies and methods are applicable to vaccinia viruses and poxviruses generally, more specifically, members of the viral family Poxvmdae Poxviruses can be infectious or pathogenic, or non-infectious or non-pathogenic Specific non-limiting examples of pathogenic poxviruses include variola major and variola minor smallpox viruses Additional specific non-limiting examples of pathogenic poxviruses include monkeypox, cowpox, Molluscum Contagiosum and camelpox Vaccinia viruses are poxviruses that may be infectious or pathogenic, live or attenuated Vaccinia viruses may be non pathogenic, but may be infectious Non-limiting examples of vaccinia virus express an H3L envelope protein Typically non-infectious live or attenuated vaccinia viruses are used to immunize human subjects against variola major and vaπola minor smallpox virus and related species of poxviruses Examples of such vaccinia viruses include modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia virus NYCBOH strain, vaccinia vims Wyeth strain or vaccinia virus Dryvax® For example, VACV WR and VACV IHD J are pathogenic in mice Other non-limiting examples of Poxvmdae express homologs to H3L protein, which are proteins having significant sequence identity or similarity to H3L protein set forth as SEQ ID NO 31 H3L homologs can or are very likely to bind to an antibody that binds to H3L protein due to significant sequence identity or similarity

Methods for treating poxvirus infection or pathogenesis of a subject, include administering to the subject an amount of an antibody that specifically binds B5R or H3L protein sufficient to treat poxvirus infection or pathogenesis In various embodiments, a method provides a subject with protection against poxvirus infection or pathogenesis, protects or decreases susceptibility of a subject to poxvirus infection or pathogenesis, and decreases or prevents an adverse side effect or complication associated with or

caused by vaccination or immunization with a vaccinia virus or vaccinia virus protein, or a poxvirus or poxvirus protein In the methods of the invention, antibody can be administered alone or in combination with other therapeutics (e g , other antibodies, such as a B5R and H3L binding antibody combination, or VIG) prior to, concurrently with, or following, exposure to or contact with poxvirus, or poxvirus infection or pathogenesis The antibody can be administered alone or in combination with other therapeutics (e g , other antibodies, such as a B5R and H3L binding antibody combination, VIG or a poxvirus protein) prior to, concurrently with, or following, vaccination or immunization with a vaccinia virus, a vaccinia virus protein, or a poxvirus or poxvirus protein Thus, prophylactic as well as therapeutic methods are provided Methods of the invention include methods in which treatment results in any beneficial effect, which is also considered therapeutic Particular non-limiting examples of beneficial effects which are also considered therapeutic include reducing, decreasing, inhibiting, delaying or preventing poxvirus infection or pathogenesis, or poxvirus titer, proliferation or replication Additional non-limiting particular examples of beneficial effects include reducing, decreasing, inhibiting, delaying, ameliorating or preventing onset, progression, seventy, duration, frequency, probability or susceptibility of a subject to poxvirus infection or pathogenesis, one or more adverse symptoms or complications associated with poxvirus infection or pathogenesis, accelerating or facilitating or hastening recovery of a subject from poxvirus infection or pathogenesis or one or more symptoms thereof, or decreasing, preventing, reducing inhibiting, or delaying an adverse side effect or complication associated with or caused by vaccination or immunization with a vaccinia virus, a vaccinia virus protein, a poxvirus, etc

Methods of the invention therefore include providing a beneficial or therapeutic effect to a subject, for example, reducing, decreasing inhibiting delaying ameliorating or preventing onset, progression, seventy, duration, frequency or probabilityof one or more symptoms or complications associated with poxvirus infection or pathogenesis, reducing, decreasing, inhibiting, delaying or preventing increases in poxvirus titer, replication, proliferation or an amount of a viral protein of one or more poxvirus strains or isolates or subtypes Stabilizing the infection, pathogenesis, condition or symptom, or preventing or inhibiting or delaying a worsening or progression of the infection, pathogenesis, condition or a symptom or complication associated with poxvirus infection or pathogenesis, are also included in various embodiments of the methods of the invention Symptoms or complications associated with poxvirus infection and pathogenesis whose onset, progression, seventy, frequency, duration or probability can be reduced, decreased inhibited, delayed ameliorated or prevented include, for example, high fever fatigue, headache, backache, malaise, rash

(maculopapular. vesicular or pustular) or lesions, delirium, vomiting, diarrhea, and e\cess bleeding Other symptoms of poxvirus infection or pathogenesis, including variola major and vaπola minor smallpox virus, monkeypox, cowpox, molluscum contagiosum and camelpox, are known in the art and treatment thereof in accordance with the invention is provided In one embodiment, a method includes administering to the subject an amount of an antibody that specifically binds to B5R or H3L envelope protein sufficient to inhibit virus infection or pathogenesis In additional embodiments, methods of the invention provide a subject with protection against poxvirus infection or pathogenesis, protect, reduce, decrease, inhibit or prevent susceptibility of a subject to poxvirus infection or pathogenesis or one or more symptoms thereof, by one or more poxvirus strains or isolates or subtypes or a species of poxvirus In particular aspects, antibody is administered prior to

(prophylaxis), concurrently with or following poxvirus exposure or infection of the subject (therapeutic) Methods of the invention, in particular aspects, provide a beneficial or therapeutic effect which includes, for example, reducing or decreasing or delaying onset, progression, seventy, frequency, duration or probability of one or more symptoms or complications of poxvirus infection or pathogenesis, virus titer, proliferation, replication or an amount of a viral protein of one or more poxvirus strains or isolates or subtypes or species, or susceptibility of a subject to infection or pathogenesis by one or more poxvirus strains or isolates or subtypes or species

The methods of the invention, including treating poxvirus infection or pathogenesis or a symptom or complication associated with or caused by poxvirus infection or pathogenesis or decreasing or preventing an adverse side effect or complication associated with or caused by immunization or vaccination with a vaccinia virus, vaccinia virus protein, or a poxvirus or poxvirus protein can therefore result in an improvement in the subjects' condition An improvement can be any objective or subjective reduction, decrease, inhibition, delay, ameliorating or prevention of onset, progression, severity, duration, frequency or probabihtyof one or more symptoms or complications associated with poxvirus infection or pathogenesis, or virus titer, replication, proliferation, or an amount of a viral protein, or an adverse side effect or complication associated with or caused by immunization or vaccination An improvement can also be reducing or inhibiting or preventing increases in virus titer, replication, proliferation, or an amount of a viral protein of one or more poxvirus strains or isolates or subtypes or species An improvement can also mean stabilizing the symptom or complication associated with poxvirus infection or pathogenesis, or inhibiting, decreasing, delaying or preventing a worsening or progression of the symptom or complication associated with poxvirus infection or pathogenesis, or progression of the underlying poxvirus infection An improvement can therefore be. for example, in any of high fever, fatigue, headache, backache,

malaise, rash (maculopapular, vesicular or pustular) or lesions, delirium, vomiting, diarrhea, or excess bleeding, to any degree or for any duration of lime

An improvement can but need not be complete ablation of any particular symptom or all symptoms, adverse side effects or complications associated with or caused by poxvirus exposure, contact, infection or pathogenesis or vaccinia virus, vaccinia virus protein or poxvirus or poxvirus protein immunization or vaccination Rather, treatment may be any objective or subjective measurable or detectable improvement For example, an improvement may reduce, delay or stabilize high fever, but may not reduce or stabilize fatigue, headache, backache, malaise, rash (maculopapular, vesicular or pustular) or lesions, delirium, vomiting, diarrhea, or excess bleeding Thus, a satisfactory clinical endpoint is achieved when there is an incremental improvement or a partial reduction in the subject's condition or an associated symptom or complication, or an inhibition or prevention of worsening or progression of the symptom or condition (stabilizing the infection or pathogenesis, or one or more symptoms, adverse side effects or complications), over a short or long duration (hours, days, weeks, months, etc ) An improvement also includes reducing or eliminating the need, dosage frequency or amount of an antiviral drug or other agent (e g , protein, antibody) used for treating a subject having or at risk of having a poxvirus infection, or a symptom or complication associated with poxvirus infection

Methods for protecting a subject from poxvirus infection, decreasing susceptibility of a subject to poxvirus infection or pathogenesis and accelerating or hastening a subject's recovery from poxvirus infection or pathogenesis by one or more poxvirus strains or isolates or subtypes or species are further provided In one embodiment, a method includes administering to a subject having or at risk of having poxvirus infection or pathogenesis an amount of an antibody that specifically binds to B5R or H3L protein sufficient to protect the subject from poxvirus infection or pathogenesis, or to decrease susceptibility of the sbject to poxvirus infection or pathogenesis In another embodiment, a method includes administering to the subject an amount of antibody that specifically binds to B5R or H3L protein sufficient to accelerate or hasten a subject's recovery from poxvirus infection.

In invention methods in which improvement is a desired outcome, such as a prophylactic or therapeutic treatment method that provides an objective or subjective benefit as for poxvirus infection or pathogenesis, or an adverse side effect or complication associated with or caused by vaccination or immunization, an antibody can be administered in a sufficient or effective amount As used herein, a

"sufficient amount" or "effective amount" or an "amount sufficient" or an "amount effective" refers to an

amount that provides, in single or multiple doses, alone or in combination with one or more other treatments, therapeutic regimens or agents (e g , a drug), a long term or a short term detectable or measurable improvement or beneficial effect in a given subject of any degree or for any time period or duration (e g , hours, days, months, years or cured) An amount sufficient or an amount effective can but need not be provided in a single administration and can but need not be achieved by a B5R or H3L antibody alone or in combination with each other or another compound, agent, treatment or therapeutic regimen In addition, an amount sufficient or an amount effective need not be sufficient or effective if given in single or multiple doses without a second or additional compound, agent, treatment or therapeutic regimen, since additional doses, amounts or duration above and beyond such doses, or additional drugs, agents, treatment or therapeutic regimens may be included in order to provide a given subject with a detectable or measurable improvement or beneficial effect

An amount sufficient or an amount effective need not be prophylactically or therapeutically effective in each and every subject treated, nor a majority of subjects treated in a given group or population An amount sufficient or an amount effective means sufficiency or effectiveness in a particular subject, not a group or the general population As is typical for such methods, some subjects will exhibit a greater or lesser response to a treatment method

Methods of the invention, including, for example, prophylactic and therapeutic treatment methods, are applicable to any poxvirus strain or isolate or subtype or a species of poxvirus, or combination of strains or isolates or subtypes or species of poxviruses Particular examples are infectious or pathogenic viruses that express B5R or H3L proteins or B5R or H3L homologs, such as a poxviruses expressing a sequence having sufficient sequence homology to B5R or H3L protein so as to bind to an antibody that binds to B5R or H3L protein Specific non-limiting examples of poxviruses include variola major or variola minor smallpox vims Additional specific non-limiting examples include monkeypox, cowpox, Molluscum Contagiosum, vaccinia and camelpox

B5R and H3L antibodies of the invention may be combined with each other as well as other therapeutic agents B5R and H3L antibodies of the invention may be administered as a combination with each other as well as other therapeutic agents in the methods of the invention B5R and H3L antibodies of the invention may be administered alone pπor to, concurrently with, or following administration with other therapeutic agents or treatment protocol or regimen, such as agents having anti-virus activity Accordingly, combination compositions including B5R and H3L antibodies, methods of using such

combinations, as well as methods in which other compositions are administered pπor to, concurrently with or following administration of B5R or H3L antibody, in accordance with the methods of the invention, are provided

Particular non-limiting examples of such combination compositions and combination methods include pooled monoclonal or pooled polyclonal antibodies containing two or more different antibodies that each bind B5R and H3L protein, having the same or a different binding specificity, binding affinity, or efficacy in inhibiting poxvirus infection of a cell m vitro or poxvirus infection or pathogenesis in vivo In particular embodiments, a plurality of antibodies (e g , B5R and H3L antibodies) are administered separately or as a combination composition in accordance with the invention In further particular embodiments, an additional antibody that binds to a poxvirus protein, different from B5R or H3L binding antibody, is administered separately or as a combination composition with B5R and/or H3L binding antibody in accordance with the invention In particular aspects, the additional antibody that binds to a poxvirus protein binds to one or more forms, for example, intracellular mature virion (IMV), cell- associated enveloped virion (CEV) or extracellular enveloped virion (EEV) forms of smallpox In additional particular aspects, the additional antibody that binds to a poxvirus protein binds to vaccinia protein B5R, LlR, D8L, A33R, A27L, AI7L, L5, A21, H2 H3L, A28, Al 4 , A56, A3 4 , A36, A2 or a B5R, LlR, D8L, A33R, A27L, AI7L, L5, A21, H2, H3L, A28, Al 4 , A 5 6, A34, A36, or A2 homolog In a further aspect, an additional antibody can include VIG

Additional examples of such combination compositions and combination methods include administering separately or as a combination composition in accordance with the invention an additional poxvirus protein In one particular embodiment, a B5R or H3L binding antibody includes an additional poxvirus protein In another particular embodiment, a method includes administering an additional poxvirus protein In particular aspects, the additional poxvirus protein is present on one or more of IMV, CEV or EEV forms of smallpox In additional particular aspects, the additional poxvirus protein is one or more of vaccinia B5R, LIR. D8L, A33R, A27L, AI7L. L5, A2I, H2, H3L, A28, Al 4, A56, A34, A36, A2, or a B5R. LlR. D8L, A33R, A27L, A17L, L5, A2I, H2, H3L. A28, A 14, A56, A34, A36, or A2 homolog

Compositions used in accordance with the invention, as well as methods, can exclude certain components or method steps In one embodiment, a method in which the composition excludes one or more poxvirus proteins or one or more antibodies that bind to poxvirus proteins is administered In particular aspects, a composition excludes or does not consist of live or attenuated vaccinia virus (e g , modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia

virus NYCBOH strain, vaccinia virus Wyeth strain, vaccinia virus ACAM2000 or vaccinia virus prepared from calf lymph Dry vax®) In another embodiment, a method excludes administering one or more poxvirus proteins or one or more antibodies that bind to poxvirus proteins different from B 5 R or H3L protein In particular aspects, a method excludes administering live or attenuated virus (e g , poxvirus or modified vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LC16m8 strain, vaccinia virus NYCBOH strain, vaccinia virus Wyeth strain or vaccinia virus prepared from calf lymph. Dryvax®) with an antibody that binds to B5R or H3L protein In additional aspects a method excludes administering poxvirus protein B5R, LlR, D8L A33R, A27L, A17L, L 5 , A21, H 2 , H3L, A28, Al 4 , A 56 , A34, A3ό, A2, or a B 5 R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A5 6 , A34, A3 6 . or A2 homolog In further aspects, a method excludes administering an antibody that binds to poxvirus protein For example, human or non-human vaccinia immune globulin (VIG) or antibody that binds to B5R, LlR, D8L, A33R, A27L, A17L, L5, A21, H2, H3L, A28, A14, A 56 , A34, A36, A2, or a B 5 R, LlR, D8L, A33R, A27L. A17L. L5, A21, H2, H3L, A28, A14, A 5 6, A34, A3ό, or A2 homolog can be excluded in a method or composition that includes an antibody that binds to B 5 R or H3L protein Subjects appropriate for treatment include those having or at risk of having a poxvirus infection or pathogenesis or at risk of having a poxvirus infection Target subjects therefore include subjects that have been exposed to or contacted with poxvirus, or that have developed one or more adverse symptoms of poxvirus infection or pathogenesis, regardless of the type, timing or degree of onset, progression, severity, frequency, duration of the symptoms Target subjects also include those at risk of poxvirus exposure, contact, infection or pathogenesis or at risk of having or developing any poxvirus infection or pathogenesis The invention methods are therefore applicable to treating a subject who is at risk of poxvirus exposure, contact, infection or pathogenesis, but has not yet been exposed to or contacted with poxvirus Prophylactic methods are therefore included Target subjects for prophylaxis can be at increased risk (probability or susceptibility) of poxvirus exposure, contact, infection or pathogenesis, as set forth herein and known in the art For example, a subject with acute or chronic immunological susceptibility (e g . an immune-suppressed, immunocompromised, or HIV-positive subject) is at increased risk of poxvirus infection or pathogenesis

'"Prophylaxis" and grammatical variations thereof mean a method in which contact, administration or in vivo delivery to a subject is prior to contact with or exposure to poxvirus, or vaccination or immunization of a subject against poxvirus or with a vaccinia virus (e g , an infectious or pathogenic poxvirus or live or attenuated vaccinia virus, or vaccinia Ankara (MVA), vaccinia virus Lister strain, vaccinia virus LCl 6 m8 strain, vaccinia virus NYCBOH strain, vaccinia virus Wyeth strain or

vaccinia virus prepared from calf lymph, Dryvax) In certain situations it may not be known that a subject has been contacted with or exposed to poxvirus, or vaccinated or immunized aginst poxvirus or with a vaccinia virus, but administration or in vivo delivery to a subject can be performed prior to manifestation or onset of poxvirus infection or pathogenesis (or an associated symptom) In either case, a method can eliminate, prevent, inhibit, decrease or reduce the probability of or susceptibility towards developing a symptom of poxvirus infection or pathogenesis, or an adverse side effect or complication associated with or caused by vaccination or immunization of a subject against poxvirus or with a vaccinia virus or a vaccinia virus protein or a poxvirus protein

At risk subjects appropπate for treatment include subjects exposed to other subjects having any poxvirus At risk subjects appropriate for treatment therefore include human subjects exposed to or at risk of exposure to other humans that may have a poxvirus infection, or are at πsk of a poxvirus infection At risk subjects appropriate for treatment also include subjects where the risk of poxvirus infection or pathogenesis is increased due to changes in virus infectivity or cell tropism, environmental factors, or immunological susceptibility (e g . an immune-suppressed, immunocompromised, or HIV-positive subject)

Target subjects further include those at risk of an adverse side effect, complication or reaction associated with or caused by a smallpox vaccination (e g , a live or attenuated vaccinia virus or a vaccinia virus prtoetin, etc ) or immunization or treatment against small pox (e g , vaccination or immunization with live or attenuated vaccinia virus or poxvirus, VIG, a vaccinia virus or a poxvirus protein, etc ) Such target subjects include those with atopic dermatitis Subjects afflicted with atopic dermatitis are at πsk of developing eczema vaccinatum when vaccinated or immunized against smallpox

B5R and H3L antibodies and subsequences thereof can be administered in accordance with the methods as a single or multiple dose e g , one or more times daily, weekly, monthly or annually or between about 1 to 10 weeks, or for as long as appropriate, for example, to achieve a reduction in the onset, progression, severity, frequency, duration of one or more symptoms or complications associated with poxvirus infection or pathogenesis, or an adverse side effect or complication associated with or caused by vaccination or immunization of a subject with a vaccinia virus, a vaccinia virus protein, or against a poxvirus or with a poxvirus protein

Doses can vary depending upon whether the treatment is prophylactic or therapeutic, the onset, progression, seventy, frequency, duration probability of or susceptibility of the symptom, the type of virus infection or pathogenesis to which treatment is directed, the clinical endpoint desired, previous or

simultaneous treatments, the general health, age, gender, race or immunological competency of the subject and other factors that will be appreciated by the skilled artisan The skilled artisan will appreciate the factors that may influence the dosage and timing required to provide an amount sufficient for providing a prophylactic or therapeutic benefit Typically, for therapeutic treatment, antibodies will be administered as soon as practical, typically within I -2, 2-4, 4- 12, 12-24 or 24-72 hours after a subject is exposed to or contacted with any poxvirus, or within I -2, 2-4, 4-12. 12-24 or 24-48 hours after development of one or more symptoms associated with poxirus infection or pathogenesis (e g , onset of fever or rash) or symptoms associated with pathogenic poxviruses such as smallpox and monkeypox For prophylactic treatment, antibodies can be administered 0-4 weeks, e g , 2-3 weeks, prior to exposure to or contact with poxvirus since antibodies are predicted to be effective for at least a month following administration For prophylactic treatment in connection with vaccination or immunization of a subject with vaccinia virus (live or attenuated), poxvirus or a poxvirus protein, antibodies can be administered prior to, concurrently with or following immunization of the subject Typically, antibodies are administered concurrently with vaccination or immunization of a subject, but can be administered within 1-2, 2-4 4-12, 12-24 or 24-48 hours prior to vaccination or immunization or within 1-2, 2-4, 4-12, 12-24 or 24-48 hours following vaccination or immunization

Doses can be based upon current existing passive immunization protocols (e g , VIG), empirically determined, determined using animal disease models or optionally in human clinical trials Initial study doses can be based upon the animal studies set forth herein, for a mouse, which weighs about 20 ( 15-30) grams, and the amount of antibody administered that is determined to be effective The dose can be adjusted according to the mass of a subject, and will generally be in a range from about 1-10 μg/kg, 10-25 μg/kg, 25-50 μg/kg. 50-100 μg/kg, 100-500 μg/kg, 500-1,000 μg/kg, 1-5 mg/kg, 5-10 mg/kg, 10-20 mg/kg, 20-50 mg/kg, 50-100 mg/kg, 100-250 mg/kg 250-500 mg/kg, or more, two, three, four, or more times per hour, day, week, month or annually A typical range will be from about 0 3 mg/kg to about 100 mg/kg

The dose amount, number, frequency or duration may be proportionally increased or reduced, as indicated by the status of the subject For example, whether the subject has a poxvirus infection or pathogenesis, whether the subject has been exposed to or contacted with a poxvirus or is merely at πsk of poxvirus contact or exposure, or whether the subject is a candidate for or will undergo vaccination or immunization with vaccinia virus (live or attenuated), poxvirus or a poxvirus protein The dose amount,

number, frequency or duration may be proportionally increased or reduced, as indicated by any adverse side effects, complications or other risk factors of the treatment or therapy

The term "subject" refers to an animal, typically a mammalian animal, such as a non human primate (apes, gibbons, gorillas, chimpanzees, orangutans, macaques), a domestic animal (dogs and cats), a farm animal (poultry such as chickens and ducks, horses, cows, goats, sheep, pigs), experimental animal (mouse, rat, rabbit, guinea pig) and humans Subjects include animal disease models, for example, the mouse models of poxvirus infection (vaccinia virus) exemplified herein

B5R and H3L binding antibodies of the invention, including modified forms, variants and subsequences/fragments thereof, and nucleic acids encoding B5R and H3L binding antibodies, can be incorporated into pharmaceutical compositions Such pharmaceutical compositions are useful for administration to a subject in vivo or ex vivo

Antibodies can be included in a pharmaceutically acceptable carrier or excipient prior to administration to a subject As used herein the term "pharmaceutically acceptable" and "physiologically acceptable ' mean a biologically acceptable formulation, gaseous, liquid or solid, or mixture thereof, which is suitable for one or more routes of administration, in vivo delivery or contact Such formulations include solvents (aqueous or non-aqueous), solutions (aqueous or non-aqueous), emulsions (e g , oil-in- water or water-m-oil), suspensions, syrups, elixirs, dispersion and suspension media, coatings, isotonic and absorption promoting or delaying agents, compatible with pharmaceutical administration or m vivo contact or delivery Aqueous and non-aqueous solvents, solutions and suspensions may include suspending agents and thickening agents Such pharmaceutically acceptable carriers include tablets

(coated or uncoated), capsules (hard or soft), microbeads, powder, granules and crystals Supplementary active compounds (e g , preservatives, antibacterial, antiviral and antifungal agents) can also be incorporated into the compositions

Pharmaceutical compositions can be formulated to be compatible with a particular route of administration Thus, pharmaceutical compositions include carriers, diluents, or excipients suitable for administration by various routes Exemplary routes of administration for contact or m vivo delivery which a composition can optionally be formulated include inhalation, respiration, intranasal, intubation, intrapulmonary instillation oral, buccal, intrapulmonary, intradermal, topical, dermal, parenteral, sublingual, subcutaneous, intravascular, intrathecal, intraarticular, intracavity, transdermal, lontophoretic, intraocular, ophthalmic, optical, intravenous (i v ), intramuscular, intraglandular, intraorgan, intralymphatic

Formulations suitable for parenteral administration comprise aqueous and non-aqueous solutions, suspensions or emulsions of the active compound, which preparations are typically sterile and can be isotonic with the blood of the intended recipient Non-limiting illustrative examples include water, saline, dextrose, fructose, ethanol, animal, vegetable or synthetic oils For transmucosal or transdermal administration (e g , topical contact), penetrants can be included in the pharmaceutical composition Penetrants are known in the art, and include, for example, for transmucosal administration, detergents, bile salts, and fusidic acid derivatives For transdermal administration, the active ingredient can be formulated into aerosols, sprays, ointments, salves, gels, or creams as generally known in the art For contact with skin, pharmaceutical compositions typically include ointments, creams, lotions, pastes, gels, sprays, aerosols, or oils Carriers which may be used include Vaseline, lanolin, polyethylene glycols, alcohols, transdermal enhancers, and combinations thereof

Cosolvents and adjuvants may be added to the formulation Non-limiting examples of cosolvents contain hydroxy! groups or other polar groups, for example, alcohols, such as isopropyl alcohol, glycols, such as propylene glycol, polyethyleneglycol, polypropylene glycol, glycol ether, glycerol, polyoxyethylene alcohols and polyoxyethylene fatty acid esters Adjuvants include, for example, surfactants such as, soya lecithin and oleic acid, sorbitan esters such as sorbitan tπoleate, and poly vinylpyrrol idone

Supplementary active compounds (e g , preservatives, antioxidants, antimicrobial agents including biocides and biostats such as antibacterial, antiviral and antifungal agents) can also be incorporated into the compositions Pharmaceutical compositions may therefore include preservatives, anti-oxidants and antimicrobial agents

Preservatives can be used to inhibit microbial growth or increase stability of ingredients thereby prolonging the shelf life of the pharmaceutical formulation Suitable preservatives are known in the art and include, for example, EDTA, EGTA, benzalkonium chloride or benzoic acid or benzoates, such as sodium benzoate Antioxidants include, for example, ascorbic acid, vitamin A. vitamin E, tocopherols, and similar vitamins or provitamins

An antimicrobial agent or compound directly or indirectly inhibits, reduces, delays, halts, eliminates, arrests, suppresses or prevents contamination by or growth, infectivity, replication, proliferation, reproduction, of a pathogenic or non- pathogenic microbial organism Classes of antimicrobials include, antibacterial, antiviral, antifungal and antiparasitics Antimicrobials include

agents and compounds that kill or destroy (-eidal) or inhibit (-static) contamination by or growth, infectivity, replication, proliferation, reproduction of the microbial organism

Exemplary antibacteπals (antibiotics) include penicillins (e g , penicillin G, ampicillin, methicillin, oxacillin, and amoxicillin), cephalosporins (e g., cefadroxil, ceforanid, cefotaxime, and ceftπaxone), tetracyclines (e g , doxycycline, chlortetracycline, minocycline, and tetracycline), aminoglycosides (e g , amikacin, gentamycin, kanamycin, neomycin, streptomycin, netilmicin, paromomycin and tobramycin), macrolides (e g , azithromycin, clarithromycin, and erythromycin), fluoroquinolones (e g , ciprofloxacin, lomefloxacin, and norfloxacin), and other antibiotics including chloramphenicol, clindamycin, cycloserine, isoniazid, rifampin, vancomycin, aztreonam, clavulanic acid, imipenem, polymyxin, bacitracin, amphotencin and nystatin

Particular non-limiting classes of anti-virals include reverse transcriptase inhibitors, protease inhibitors, thymidine kinase inhibitors, sugar or glycoprotein synthesis inhibitors, structural protein synthesis inhibitors, nucleoside analogues, and viral maturation inhibitors Specific non-limiting examples of anti-virals include nevirapine, delavirdine, efavirenz, saquinavir, ritonavir, indinavir, nelfinavir, amprenavir, zidovudine (AZT), stavudine (d4T), larnivudine (3TC), didanosine (DDI), zalcitabine (ddC), abacavir acyclovir, penciclovir, valacyclovir, ganciclovir, 1 ,-D-πbofuranosyl- 1 ,2,4- tnazole-3 carboxamide. 9->2-hydroxy-ethoxy methylguamne, adamantanamine, 5-iodo-2'-deoxyuπdine, cidofivir, ST-246, tπfluorothymidine, interferon and adenine arabinoside

Pharmaceutical formulations and delivery systems appropriate for the compositions and methods of the invention are known in the art (see, e g , Remington The Science and Practice of Pharmacy (2003) 20* ed , Mack Publishing Co , Easton, PA. Remington's Pharmaceutical Sciences (1990) 18 th ed , Mack Publishing Co , Easton, PA, The Merck Index (1996) 12 th ed , Merck Publishing Group, Whitehouse, NJ, Pharmaceutical Principles of Solid Dosage Forms (1993), Technonic Publishing Co , Inc , Lancaster, Pa , Ansel and Stoklosa, Pharmaceutical Calculations (2001) 1 1 th ed .Lippincott Williams & Wilkins, Baltimore, MD, and Poznansky et al , Drug Delivery Systems (1980), R L Juliano, ed , Oxford, N Y , pp 253-315)

Antibodies and compositions thereof can be packaged in unit dosage form (capsules, troches, cachets, lozenges, or tablets) for ease of administration and uniformity of dosage A "unit dosage form" as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated, each unit containing a predetermined quantity of active ingredient optionally in association with a pharmaceutical carrier (excipient, diluent, vehicle or filling agent) which, when administered in one or

more doses, is calculated to produce a desired effect (e g , prophylactic or therapeutic effect) Unit dosage forms also include, for example, ampules and vials, which may include a composition in a freeze- dπed or lyophilized state, a sterile liquid carrier, tor example, can be added prior to administration or delivery in vivo Unit dosage forms additionally include, for example, ampules and vials with liquid compositions disposed therein Individual unit dosage forms can be included in multi-dose kits or containers Pharmaceutical formulations can be packaged in single or multiple unit dosage form tor ease of administration and uniformity of dosage

The invention provides kits composing B5R and H3L antibodies, combination compositions and pharmaceutical formulations thereof, packaged into suitable packaging material A kit typically includes a label or packaging insert including a descπption of the components or instructions tor use in vitro in vivo, or ex vivo, of the components therein A kit can contain a collection of such components, e g , two or more B5R and H3L antibodies alone or in combination with an anti-poxvirus agent (e g a poxvirus protein or an antibody that binds to a poxvirus protein different than B5R and H3L, VIG, etc ) or drug

The term "packaging material" refers to a physical structure housing the components of the kit The packaging mateπal can maintain the components sterilely, and can be made of material commonly used for such purposes (e g paper, corrugated fiber, glass, plastic foil, ampules, vials, tubes, etc )

Kits of the invention can include labels or inserts Labels or inserts include "printed matter," e g , paper or cardboard or separate or affixed to a component, a kit or packing mateπal (e g , a box), or attached to an ampule, tube or vial containing a kit component Labels or inserts can additionally include a computer readable medium, such as a disk (e g , a diskette, hard disk, ZIP disk, etc ) optical disk such as CD- or DVD-ROM/RAM, DVD, MP3 magnetic tape, or an electπcal storage media such as RAM and ROM or hybrids of these such as magnetic/optical storage media FLASH media or memory type cards

Labels or inserts can include identifying information of one or more components therein, dose amounts, clinical pharmacology of the active ιngredient(s) including mechanism of action, pharmacokinetics and pharmacodynamics Labels or inserts can include information identifying manufacturer information, lot numbers, manufacturer location and date

Labels or inserts can include information on a condition, disorder or disease for which a kit component may be used Labels or inserts can include instructions tor the clinician or subject for using one or more of the kit components in a method, or treatment protocol or therapeutic regimen Instructions can include dosage amounts, frequency or duration, and instructions for practicing any of the methods, treatment protocols or prophylactic or therapeutic regimes described herein Exemplary instructions

include, instructions for treating poxvirus infection or pathogenesis Kits of the invention therefore can additionally include labels or instructions for practicing any of the methods of the invention described herein including treatment, detection, monitoπng or diagnostic methods Thus, for example, a kit can include an antibody that has one or more anti-poxvirus functions or activities as set forth herein, together with instructions for administering the antibody in a prophylactic or therapeutic treatment method of the invention

Labels or inserts can include information on any benefit that a component may provide, such as a prophylactic or therapeutic benefit Labels or inserts can include information on potential adverse side effects, complications or reactions, such as warnings to the subject or clinician regarding situations where it would not be appropriate to use a particular composition Adverse side effects or complications could also occur when the subject has, will be or is currently taking one or more other medications that may be incompatible with the composition, or the subject has, will be or is currently undergoing another treatment protocol or therapeutic regimen which would be incompatible with the composition and, therefore, instructions could include information regarding such incompatibilities Invention kits can additionally include a growth medium (e g , for a B5R or H3L binding antibody producing cell line), buffeπng agent, or a preservative or a stabilizing agent in a pharmaceutical formulation containing a B5R or H3L binding antibody Each component of the kit can be enclosed within an individual container and all of the various containers can be within a single package Invention kits can be designed for cold storage Invention kits can further be designed to contain B5R or H3L binding antibody producing hybπdoma or other host cells (e g , CHO cells) The cells in the kit can be maintained under appropriate storage conditions until the cells are ready to be used For example, a kit including one or more hybndoma or other cells can contain appropriate cell storage medium so that the cells can be thawed and grown

Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs Although methods and matenals similar or equivalent to those described herein can be used in the practice or testing of the present invention, suitable methods and materials are described herein

All applications, publications, patents and other references, GenBank citations and ATCC citations cited herein are incorporated by reference in their entirety In case of conflict, the specification, including definitions, will control

As used herein, the singular forms "a," "and," and "the" include plural referents unless the context clearly indicates otherwise. Thus, for example, reference to a "B5R or B5R homolog binding antibody" or "an H3L or H3L homolog binding antibody" includes a plurality of such antibodies and reference to an "activity or function" such as "an anti-poxvirus activity or function" can include reference 5 to one or more activities or functions, and so forth.

As used herein, all numerical values or ranges include fractions of the values and integers within such ranges and fractions of the integers within such ranges unless the context clearly indicates otherwise. Thus, to illustrate, reference to a numerical range, such as a percentage range, 90-100%, includes 91%, 92%. 93%, 94%, 95%, 95%, 97%, etc , as well as 91.1%, 91 2%, 91.3%, 91.4%, 91 5%, etc., 92.1%, 10 922%, 92.3%, 92.4%, 92.5%, etc , and so forth. Reference to a range of 1-5 fold therefore includes 1, 2, 3. 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14, 15, I 6 , 17, 18, 19. 20, fold, etc., as well as 1 1, 1.2, 1.3, 1 4, 1.5, fold, etc., 2.1. 2.2. 2 3, 2.4, 2.5. fold, etc , and so forth

The invention is generally disclosed herein using affirmative language to describe the numerous embodiments. The invention also specifically includes embodiments in which particular subject matter is

15 excluded, in full or in part, such as substances or materials, method steps and conditions, protocols, procedures, assays or analysis. For example, in certain embodiments or aspects of the invention, antibodies or subsequences that specifically bind to poxvirus proteins are excluded. In certain embodiments and aspects of the invention, poxvirus proteins are excluded. Thus, even though the invention is generally not expressed herein in terms of what the invention does not include embodiments

20 and aspects that expressly exclude compositions (e.g , poxvirus antibodies or proteins) and method steps are nevertheless disclosed and included in the invention.

A number of embodiments of the invention have been described. Nevertheless, it will be understood that various modifications may be made without departing from the spirit and scope of the invention. Accordingly, the following examples are intended to illustrate but not limit the scope of 25 invention described in the claims.

This example describes various materials and methods Antigen preparation 30 Baculovirus expressed B5R recombinant protein: DNA was isolated from 5xlO 6 vaccinia virus (Dryvax

vaccine- New York City Board of Health strain (NYCBOH or NYBOH) infected HeIa cells using the QIAamp DNA Mini Kit (QIAGEN Inc , Valencia, CA) following manufacturer's instructions The sequence encoding the extracellular domain of vaccinia B5R was amplified by reverse-transcription polymerase chain reaction using primers B5R-Ftopo dir gate and B 5 R Rtopo dir gate (Table 1) The product was sub-cloned into the pENTR™/D-TOPO® Gateway entry vector (Invitrogen Corp, Carlsbad, CA) The cloned PCR amplified product was sequenced and confirmed to be identical to the published sequence of vaccinia B5R WR stain (SEQ NO 28) Recombinant baculovirus were generated that encoded the C-terminal 6xHis tagged vaccinia B 5 R protein (B 5 R His) by performing the recombination reaction between the Gateway pENTR™/D-TOPO B 5 R-HiS and the Gateway BaculoDirect tm C-term linear DNA (Invitrogen Corp, Carlsbad, CA) Tnchoplusia m High-Five BTI-TN- 5 b I -4 (Tn 5 ) insect cells (Invitrogen Corp ) were infected with the B 5 R-HiS recombinant baculovirus for protein production

The nucleotide sequence of vaccinia B5R-6xHis protein from initiation codon (ATG) to 6xHis tag (bold) is as follows (SEQ ID NO 69)

ATGAAAACGA TTTCCGTTGT TACGTTGTTA TGCGTACTAC CTGCTGTTGT TTATTCAACA 60 TGTACTGTAC CCACTATGAA TAACGCTAAA TTAACGTCTA CCGAAACATC GTTTAATGAT 120

AAACAGAAAG TTACATTTAC ATGTGATCAG GGATATCATT CTTCGGATCC AAATGCTGTC 18O

TGTGAAACAG ATAAATGGAA ATACGAAAAT CCATGCAAGA AAATGTGCAC AGTTTCTGAT 240

TATGTCTCTG AATTATATGA TAAGCCATTA TACGAAGTGA ATTCCACCAT GACACTAAGT 300 TGCAACGGCG AAACAAAATA TTTTCGTTGC GAAGAAAAAA ATGGAAATAC TTCTTGGAAT 360 GATACTGTTA CGTGTCCTAA TGCGGAATGT CAACCTCTTC AATTAGAACA CGGATCGTGT 420

CAACCAGTTA AAGAAAAATA CTCATTTGGG GAATATATAA CTATCAACTG TGATGTTGGA 48O TATGAGGTTA TTGGTGCTTC GTACATAAGT TGTACAGCTA ATTCTTGGAA TGTTATTCCA 540

TCATGTCAAC AAAAATGTGA TATGCCGTCT CTATCTAACG GATTAATTTC CGGATCTACA 600

TTTTCTATCG GTGGCGTTAT ACATCTTAGT TGTAAAAGTG GTTTTACACT AACGGGGTCT 660 ccATCATCCA CATGTATCGA CGGTAAATGG AATCCCATAC TCCCAACATG TGTACGATCT 720

AACGAAAAAT TTGATCCAGT GGATGATGGT CCCGACGATG AGACAGATTT GAGCAAACTC 780

TCGAAAGACG TTGTACAATA TGAACAAGAA ATAGAATCGT TAGAAAAGGG TGGGCGCGCC 840 GACCCAGCTT TCTTGTACAA AGTGGTGAGA ATGAATGAAG ATCTGGGGAA GCCTATCCCT 900 AACCCTCTCC TCGGTCTCGA TTCTACGCGT ACCGGTCATCATCACCATCACCATTGA 960 The amino acid sequence of vaccinia virus B 5 R 6xHis protein, signal peptide (bold) and όxHis (underlined) is as follows (SEQ ID NO 70) MKTISWTLLCVLPAWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDQ GYHSSDPNAV 60

CETDKWKYEN PCKKMCTVSD YVSELYDKPL YEVNSTMTLS CNGETKYFRC EEKNGNTSWN 120

DTVTCPNAEC QPLQLEHGSC QPVKEKYSFG EYITINCDVG YEVIGASYIS CTANSWNVIP 180

SCQQKCDMPS LSNGLISGST FSIGGVIHLS CKSGFTLTGS PSSTCIDGKW NPILPTCVRS 240

NEKFDPVDDG PDDETDLSKL SKDWQYEQE IESLEKGGRA DPAFLYKWR MNEDLGKPIP 300 NPLLGLDSTR TGHHHHHH Bacteπallv expressed recombinant H3L protein

The DNA from cells infected with the NYBOH strain of vaccinia virus that was used for B5R cloning above, was likewise used as a PCR template for cloning full length H3L The sequence encoding the full- length open reading frame of vaccinia H3L was amplified by reverse-transcription polymerase chain reaction using primers H3L F Ndel pET-15b and H3L R Bam HI pET-15b (Table I) As a cloning intermediate, this PCR product was cloned into the TA-topo 2 1 vector following manufacturers instructions (Invitrogen, Carlsbad CA) This H3L-TA-topo2 1 plasmid was then used as a template for PCR using primers H3L Nhel fwd P ET28 and H3L Xhol rev pET28 (Table 1) The amplified full-length PCR product was digested with Nhel and Xhol and ligated into the Nhel and Xhol sites of the bacterial expression vector pET28a to create pET28a-full length H3L-His, which encodes a H3L with a C-terminal

The nucleotide sequence of vaccinia H3L-6xHis protein from initiation codon (ATG) to 6xHis tag (bold) is as follows (SEQ ID NO 71 )

ATGGCTAGCG CGGCGGCGAA AACTCCTGTT ATTGTTGTGC CAGTTATTGA TAGACTTCCA 60

TCAGAAACAT TTCCTAATGT TCATGAGCAT ATTAATGATC AGAAGTTCGA TGATGTAAAG 120 GACAACGAAG TTATGCCAGA AAAAAGAAAT GTTGTGGTAG TCAAGGATGA TCCAGATCAT ieo TACAAGGATT ATGCGTTTAT ACAGTGGACT GGAGGAAACA TTAGAAATGA TGACAAGTAT 240 ACTCACTTCT TTTCAGGGTT TTGTAACACT ATGTGTACAG AGGAAACGAA AAGAAATATC 300

GCTAGACATT TAGCCCTATG GGATTCTAAT TTTTTTACCG AGTTAGAAAA TAAAAAGGTA 360

GAATATGTAG TTATTGTAGA AAACGATAAC GTTATTGAGG ATATTACGTT TCTTCGTCCC 420 GTCTTGAAGG CAATGCATGA CAAAAAAATA GATATCCTAC AGATGAGAGA AATTATTACA 480

GGCAATAAAG TTAAAACCGA GCTTGTAATG GACAAAAATC ATGCCATATT CACATATACA 540

GGAGGGTATG ATGTTAGCTT ATCAGCCTAT ATTATTAGAG TTACTACGGA GCTGAACATC 600 GTAGATGAAA TTATAAAGTC TGGAGGTCTA TCATCGGGAT TTTATTTTGA AATAGCCAGA 660 ATTGAAAACG AAATGAAGAT CAATAGGCAG ATACTGGATA ATGCCGCCAA ATATGTAGAA 720

CACGATCCCC GACTTGTTGC AGAACACCGT TTCGAAAACA TGAAACCGAA TTTTTGGTCT 780

AGAATAGGAA CGGCAGCTAC TAAACGTTAT CCAGGAGTTA TGTACGCGTT TACTACTCCA 840 CTGATTTCAT TTTTTGGATT GTTTGATATT AATGTTATAG GTTTGATTGT AATTTTGTTT 9OO ATTATGTTTA TGCTCATCTT TAACGTTAAA TCTAAACTGT TATGGTTCCT TACAGGAACA 960 TTCGTTACCG CATTTATCCT CGAGCACCAC CACCACCACC ACTGA 1020

The amino acid sequence of vaccinia virus H3L-His protein and 6x His (underlined) is as follows (SEQ ID NO 72)

MASAAAKTPV IWPVIDRLP SETFPNVHEH INDQKFDDVK DNEVMPEKRN VWVKDDPDH 60

YKDYAFIQWT GGNIRNDDKY THFFξGFCNT MCTEETKRNI ARHLALWDSN FFTELENKKV 120 EYWIVENDN VIEDITFLRP VLKAMHDKKI DILQMREIIT GNKVKTELVM DKNHAIFTYT 180

GGYDVSLSAY IIRVTTELNI VDEIIKSGGL SSGFYFEIAR IENEMKINRQ ILDNAAKYVE 240

HDPRLVAEHR FENMKPNFWS RIGTAATKRY PGVMΫAFTTP LISFFGLFDI NVIGLIVILF 300 IMFMLIFNVK SKLLWFLTGT FVTAFILEHH HHHH

H3L production and protein purification To produce H3L-His in bacteria, the expression vector pET28a- full length H3L-His was transformed into BL21 (DE3) pLysS competent cells and bacterial cultures were induced to express H3L-Hιs by a 2 hr incubation of diluted (I 20) overnight cultures in ImM IPTG (sopropyl-beta-D-thiogalactopyranoside) Cells were harvested by centπfugation for protein purification Recombinant full-length H3L with N-terminal HisTag® was purified by metal chelate affinity chromatography with Ni Sepharose 6 Fast Flow resin (GE Healthcare) Bacteπal cells were lysed with microfluidizer (model MlOL, Microfluidics, Inc ) Lysis buffer included 0 5% Triton X-100

(Calbiochem), and the chromatography was performed in the presence of appropriate non-ionic detergent, like 0 5% Tπton X-100 or 0 58% Octyl Glucoside (Calbiochem) H3L was eluted from the column with 200 mM imidazole, and subsequently dialyzed against 20 niM Na phosphate buffer, pH 8 0, 0 25M NaCl, 10% glycerol, and appropriate detergent (see above) Protein concentration was determined by DC Lowry protein assay (Bio-Rad) using BSA standard (Pierce Biotechnology) in the same buffer

B5R production and protein purification B5R-His recombinant protein was generated by infecting 1 liter of insect Tn5 cells with B5R-His baculovirus for 4 days Growth media was harvested and clarified by centπfugation Recombinant B5R-His was purified by metal chelate affinity chromatography with Ni Sepharose 6 Fast Flow resin (GE Healthcare) . The baculovirus-infected Tn5 insect cell supernatant was concentrated and diafiltered into PBS by tangential flow filtration using a membrane with 10 kDa molecular weight cut off B5R was eluted from the column with 200 mM imidazole, and subsequently

dialyzed against PBS Protein concentration was determined by Lowry protein assay (Bio-Rad) using BSA standard (Pierce Biotechnology)

Mice Human trans-chromosomic KM mice™ (WO02/43478, WO02/092812, Ishida and Lonberg, IBC s 11" 1 Antibody Engineering Meeting Abstract (2000), and Kataoka, S IBCs 13 lh Antibody Engineering Meeting Abstract (2002)) harboring human chromosome fragments encoding the human immunoglobulin region were obtained from Kinn Brewery Co , Ltd , Japan, and were housed in the animal facility at the La JoIIa Institute for Allergy and Immunology An overview of the technology for producing human antibodies is described in Lonberg and Huszar (Int Rev Immunol 13 65 (1995)) Transgenic animals with one or more human immunoglobulin genes (kappa or lambda) that do not express endogenous immunoglobulins are described, for example in, U S Patent No 5,939,598 Additional methods for producing human antibodies and human monoclonal antibodies are described (see, e g , WO 98/24893, WO 92/01047, WO 96/34096, WO 96/33735, U S Patent Nos 5,413,923, 5,625,126, 5,633,425, 5,569.825, 5,661,016, 5,545,806, 5,814,318. 5,885,793, 5,916,771, and 5,939,598) Development of bovine carrying human immunoglobulin genes, TC cows, is described in Kuroiwa et al , Nat Biotechnol 20 889 (2002), and Kuroiwa et al , Nat Genet 36 775 (2004)

Immunization B5R-His or H3L-His recombinant protein was mixed with an equal volume of complete Freund's adjuvant (CFA, Sigma) and an emulsion was prepared KM mice™ were immunized subcutaneously with 25 to 50 μg protein of soluble recombinant B5R-His or H3L-His in CFA/IFA Mice were boosted subcutaneously with 10 to 20 μg of protein emulsified in incomplete Freund's adjuvant (IFA, Sigma) at 1 to 2 week intervals for 2 boosts The first boost was with 10% CFA/90%IFA. the second boost was IFA alone A final intravenous injection of lOμg of soluble B5R-His or H3L-His without adjuvant was given 3 days pπor to fusion

Hvbπdoma production Several of the mice raised anti-B5R or H3L specific antibodies, with a range in human IgG B5R or H3L specific titers The mice with the highest anti-B5R or anti-H3L IgG specific antibody titer in their serum were selected for production of monoclonal antibodies Spleens were harvested and single cell suspensions were fused to a myeloma cell line (SP2/O-Agl4) (ATCC, Rockville. MD) at a ratio of 5 1 with 50% polyethylene glycol (Boehπnger Mannheim, Indianapolis, IN) to generate human anti-vaccinia B5R or H3L producing hybπdomas The fusions were plated into 96 well flat bottom plates at an optimal density and cultured in complete DMEM-IO medium (Dulbecco's Modified Engle"s Medium with 10% fetal bovine serum (FBS, Invitrogen, Corp ), 2 mM L-glutamine, 100 U/ml penicillin, 100 μg/ml streptomycin sulfate (all from BioWhittaker, Walkersville, MD), HAT supplement (Sigma), and 10% Hybπdoma Cloning Factor (HCF, Biovaπs, San Diego, CA) in a 10% CO 2 , 37 0 C incubator Approximately 1100 wells from 4 fusions were screened by ELISA for human IgG containing B5R or H3L specific antibodies Production of human anti-vaccinia B5R or H3L IgG

antibodies were confirmed by ELISA Crude hybπdoma supernatant was used for a preliminary evaluation of virus neutralizing activity in vitro Positive wells were expanded and subjected to 2 to 3 rounds of limiting dilution cloning to obtain monoclonal antibodies

Antibody protein purification For antibody purification, hybπdomas were cultured in 2 liter roller bottles at 350 milliliter to 1 liter/bottle or in a 1 liter Integra system (INTEGRA Bioscience, Inc Ijamsville, MD) with hybπdoma-SFM medium (Invitrogen, Corp ) supplemented with ultra low IgG fetal bovine serum (Invitrogen, Corp ) Human monoclonal antibodies were purified from culture media using recombinant Protein A-Sepharose Fast Flow gel (Amersham Biosciences) Conditioned medium generated in roller bottles was first concentrated using an Ultrasette tangential flow system (Pall Corp , East Hills, NY) The conditioned medium was filtered with a 0 22 μm vacuum filter unit (Millipore, Bedford, MA) and loaded onto a Protein A-Sepharose Fast Flow column (Amersham Biosciences) of appropriate size for the amount of human antibody in the medium The column was washed thoroughly with 20 column volumes of PBS and the antibody was eluted with 0 1 M GIy HCl pH 3 6, 0 15 M NaCI and neutralized with 1 M Tπs HCI, pH 8 0 The fractions were analyzed by SDS PAGE and the positive fractions were pooled and concentrated with a centrifugal concentrator (Vivaspin, 50,000 MWCO Sartoπus, Gettingen,

Germany) Sephadex G-25 desalting columns, (NAP, Amersham Biosciences), were used for buffer exchange to PBS, pH 7 4 Finally, the antibody was filter sterilized using syringe filters with 0 22 μm pore diameters and the antibody concentration was determined by the Lowry method Pyrogen content was determined using a Limulus Amebocyte Lysate (LAL) assay (Associates of Cape Cod, Falmouth, MA) The limits of detection of this assay are 006 EU/mg If the test was negative, the samples were considered endotoxin free

Human IeG Quantitation ELISA To determine the amount of human antibody present in supernatants and purified stocks the following protocol was used Goat anti-human Fcγ specific antibody (Jackson Immunoresearch Laboratories, West Grove, PA) was coated to 96 well plates (Nunc, Denmark) in carbonate buffer at 0 5 μg/well for 1 hour at 37 0 C The plates were then blocked with Superblock (Pierce, Rockford, IL) for 30 minutes followed by addition of the samples to the plates Standard curves were generated using total human IgG (Sigma) or purified human IgG 1 or IgG4 (Kinn Brewery Co , Ltd) The plates were incubated for I hour at 37 0 C. washed in PBS/l%BSA/0 l%Tween20 (Sigma), and the bound antibody was detected with goat anti-human Fcγ specific antibody conjugated to horseradish peroxidase (HRP, Jackson Immunoresearch) for 1 hour at 37 0 C The TMB substrate (Sigma) was added for 10 minutes and the reaction was stopped with H 2 SO 4 (LabChem, Pittsburgh PA) The OD was measured at 450 nm on a microplate reader

B5R or H3L Specific Antibody Detection ELISA Antibody titers specificity, and production by hybπdomas were determined by ELISA In brief, 96 well flat bottom plates were coated with 50 μl of

B5R-His or H3L at 5 μg/ml in carbonate buffer (pH 94) overnight at 4 0 C or at 37 0 C for I hour After washing twice with PBS/0 1% Tween 20, plates were blocked with PBS/1 %BSA/0 ]%Tween20 at 37 0 C for I hour The serum, supernatant, or puπfied antibody was diluted in blocking buffer, added to the wells, and the plates were incubated for 1 hour at 37°C The plates were washed 4 times with PBS/0 1% Tween 20 and the peroxidase conjugated sheep anti-human kappa detection antibody (The Binding Site, Birmingham, UK) was added at a dilution of I 2000 Following a 1 hour incubation at 37°C , the plates were washed and the TMB (Sigma) substrate was added and incubated at room temperature for 10 to 30 minutes The reaction was stopped with H 2 SO 4 (LabChem) and the optical density was measured at 450 nm by a microplate reader ELISAs were also performed using whole vaccinia virus antigen from infected cell lysates

Anti-B5R or H3L Antibody Cross-blocking (Binding Competition) Assays In order to determine if the antibodies bind the same "epitope" of B5R or H3L an ELISA protocol was used Nunc 96 well flat bottom ELISA plates were coated with the human anti-B5R or H3L antibodies in carbonate buffer at 2 μg/ml for I hour at 37 0 C The plates were washed and then blocked with PBS/ 1%BSA/T ween 20 The human anti-B 5 R or H3L antibodies were then pre-incubated with recombinant B5R-His or H3L protein for 30 minutes at room temperature The combinations of antibody-BSR or H3L protein were added to the plate and incubated for 1 hour at 37 0 C After 3 washes, bound B5R-His or H3L-His was detected with peroxidase conjugated mouse anti-poly His IgG2a (Clonetech) The ELISA was completed as described above The percent inhibition was determined using the OD of each sample in the following formula %inhibition =100- ((sample/Maximum binding)* 100)

Isolation of Human Anti-B5R or H3L Antibody Genes Cultured hybπdoma cells, which produce either anti-B5R or H3L antibodies were collected by centnfugation Total RNA was purified from these cells using the RNeasy kit (QIAGEN Inc , Valencia, CA) following the manufacturer's instructions The SMART-RACE cDNA Amplification Kit (Clontech Co , Ltd , Palo Alto, CA) was used for cloning of cDNA that encodes the vanable region of the immunoglobulin genes from total hybπdoma cell RNA Briefly, first strand cDNA was prepared by reverse transcriptase from 2 microgram of total RNA This cDNA was used as a template for polymerase chain reaction (PCR) to amplify the variable region and a part of the constant region of heavy and light chains (HV and LV, respectively) The amplified sequences also contained the antibody leader peptide sequences The reaction was as follows 2 5 U Pfu Ultra DNA polymerase (Stratagene, La Jolla, CA), 0 2 μM 3' Pπmer (for Heavy chain IgGIp, for Light chain hk5, Table 1), IX Universal Pπmer Mix A for the 5' end (UMP pπmer Mix A included in the SMART RACE Kit), 200 μM dNTP mix. 1 mM MgCl 2 , Pfu Ultra Buffer (final concentration is Ix), and cDNA template The thermocycling program was 5 cycles of 94°C x 30 sec, 72°C x 3min 5 cycles of 94°C x 30 sec, 70 0 C x 30 sec, 72°C x 3 mm 25 cycles of 94°C x 30 sec, 68°C x 30 sec, 72°C x 3 mm followed by an

extension at 72°C x 7 mm Amplified DNA fragments were collected by agarose gel electrophoresis, and purified using the QIAquick Gel Extraction Kit (Qiagen Co , Ltd , Germany) Purified DNA fragments of HV and LV were integrated into the PCR 4 Blunt- TOPO vector using the Zero Blunt TOPO PCR Cloning Kit (Invitrogen, Carlsbad, CA), and each construct plasmid was transformed into E coll Bacterial colonies were selected and plasmid purified from those containing plasmid with HV or LV sequences Nucleotide sequences of each insert (HV and LV) in the construct plasmids were analyzed using specific primers (Ml 3F, Ml 3R. Table I ) Based on the sequence obtained from HV and LV, oligonucleotide primers were designed to amplify VH and VL (Table I ) Anti B5R 131C12 antibody VH and VL were cloned into the IgGl mammalian expression vector Briefly, oligonucleotide primers containing 5'-SaII and 3'-NheI restriction enzyme recognition sites were designed to amplify the variable region of the Heavy chain (HV) by PCR PCR was performed using pTopo-VH miniprep DNA as a template and antibody clone 131C 12 specific primers 12H FWD Sail and 12H REV Nhel (Table 1 ), with Pfu Ultra DNA polymerase After digestion of the PCR product with Nhel and Sail, a 410 bp fragment was sub-cloned into the IgGl expression vector (IDEC Pharmaceuticals, San Diego, CA, N5KG 1 VaI Lark (a modified vector of N5KG 1 , U S Patent No

6,001,358)) that was pre-digested with Nhel and Sail (8 9 kilobases DNA fragment) The existence of variable region of the Heavy chain (HV) was analyzed by restriction digest

As the second step, LV was inserted into N5KG1 VaI Lark-VH vector as follows the DNA vector was digested by two DNA restriction enzymes, BgHI and BsiWI The 9 1 kb DNA fragment was isolated Similarly to the heavy chain construct, a primer set for PCR of LV was designed to contain the recognition sites for 5'BgII and 3'BsiWi These pπmers, 12K FWD BgIII and 12K REV BsiWI (Table I ), were used to amplify LV from the pTopo LV mimprep plasmid DNA The PCR product was digested with BgIII and BsiWI and isolated by agarose gel electrophoresis and gel purification This fragment, containing either B5R or H3L specific antibody LV, was Ii gated to the prepared 9 I kb vector with T4 DNA ligase and used to transform ToplO cells (Invitrogen) Positive E coll transformants were selected The resulting expression vectors were purified, and the presence of both LV and HV regions confirmed by restriction analysis and DNA sequencing

Generation of vectors to produce recombinant I3IC14, I31CI8, 130D67 and 130D53 antibodies was performed in the manner described above, the 3' primers used for amplification of the heavy and light chain genes in the RACE reactions were HH-2 and HK-2, respectively

Amplification of the heavy chains for I31C14, 131C18, 130D25 130D67 and 13OD53 was performed using the respective primers listed in Table 1 The I31CI4, 131C18, 130D25, 130D67 and 130D53 light chain variable region amplification was also performed using the respective primers listed in Table 1

The resulting vectors, pKLG i/131Cl 4 , pKLG l/I3 IC18, pKLGl/130D2 5 , and pKLGl/130D67 were confirmed by restriction enzyme digestion and sequencing

Table 1: Synthesized PNA primers (SEO ID NOS.73-107)

Production of recombinant human anti-B5R antibody from CHO cells For production of recombinant antibody, individual antibodyvectors containing anti-B5R or H3L antibody were nucleofected into host cell dhfr-defective strain of Chinese Hamster Ovary cell (CHO cells, ATCC #CRL- 9096) and recombinant antibody was isolated from the supernatant of the transfected cells Briefly, 2μg DNA of purified DNA expression vector was linearized by a DNA restriction enzyme, Ascl, and the DNA was nucleofected into 1 x 10 7 cells CHO cells using the nucleofector kit V (Cat No VCA- 1003) and the Amaxa nucleofector (Amaxa Biosystems) following manufacturer's instructions The transfected cells were seeded in 96-well culture plates in EX-CELL 325 PF CHO serum-free medium with glutamine (JRH Bioscience, Lenexa, KS), supplemented with penicillin/streptomycin (BioWhitaker), HT (Sigma), and Geneticin (Invitrogen, Corp ) for selecting CHO cells containing the DNA vector After the selection of several stable transfectant lines, high human IgG producers were identified by ELISA. and used for production of recombinant antibody

This example describes exemplary heavy and light chain variable region sequences of antibodies that bind to B5R.

Nucleotide sequence of cDNA of 131C 12 heavy chain vaπable region (HV) (from initiation codon (ATG) to the end of vaπable region) is as follows (SEQ ID NO 1)

ATGGAGTTTG GGCTGAGCTG GCTTTTTCTT GTGGCTATTT TAAAAGGTGT CCAGTGTGAG 60

GTGCAGCTGT TGGAGGCCGG GGGAGGCTTG GTACAGCCTG GGGGGTCCCT GAGACTCTCC 120

TGTGCAGCCT CTGGATTCAC CTTTAGCAGC TCTGCCATGA GCTGGGTCCG CCAGGCTCCA 180

GGGAAGGGGC TGGAGTGGGT CTCAGTTATT AGTATTAGTG GTGGTAGCAC ATACTACGCA 240 GACTCCGTGA AGGGCCGGTT CACCATCTCC AGAGACAATT CCAAGAACAC GCTGAATCTG 300

CAAATGAACA GCCTGAGAGC CGAGGACACG GCCGTATATT ACTGTGCGAA AGAAACTCGG 360

TACTATTATT ccTACGGTAT GGACGTCTGG GGCCAAGGGA CCACGGTCAC CGTCTCCTCA 42O

Nucleotide sequence of cDNA of 131C12 light chain variable region (LV) (from initiation codon (ATG) to the end of variable region) is as follows (SEQ ID NO 3) ATGGACATGA GGGTCCCCGC TCAGCTCCTG GGGCTTCTGC TGCTCTGGCT CCCAGGTGCC 60

AGATGTGCCA TCCAGTTGAC CCAGTCTCCA TCCTCCCTGT CTGCATCTGT AGGGGACAGA 12O

GTCACCATCA CTTGCCGGGC AAGTCAGCGC ATTGGCTTTG CTTTAGCCTG GTATCAGCAG 180

AAACCAGGGA AAGCTCCTAA ACTCCTGATC CATGATGCCT CCAGTTTGGA AACTGGGGTC 240

CCATCAAGGT TCAGCGGCAG TGGATCTGGG ACAGATTTCA CTCTCGCCAT CAGCAGCCTG 300 CAGCCTGAAG ATTTTGCAAC TTATTACTGT CAACAGTTTA ATACTTACCC ATTCACTTTC 360

GGCCCTGGGA CCAAAGTGGA TATCAAA 420

Nucleotide sequence of cDNA of 131C 14 heavy chain vaπable region (HV) (from initiation codon (ATG) to the end of variable region) is as follows (SEQ ID NO 5)

ATGGAACTGG GGCTCCGCTG GGTTTTCCTT GTTGCTATTT TAGAAGGTGT CCAGTGTGAG 60 GTGCAGCTGG TGGAGTCTGG GGGAGGCCTG GTCAAGCCTG GGGGGTCCCT GAGACTCTCC 120

TGTGCAGCCT CTGGATTCAC GTTCAGCAGC TATAGCATGA ACTGGGTCCG CCAGGCTCCA 180

GGGAAGGGAC TGGAGTGGGT CTCATCTATT AGTAGTAGTA GAAGTTTCAT ATACTACGCA 240

GACTCAGTGA AGGGCCGATT CACCATCTCC AGAGACATCG CCAAGAACTC ACTGTCTCTG 300

CAAATGAGCA GCCTGAGAGT CGAGGACACG GCTGTGTATT ACTGTGCGAG AGAAAGGAGG 360

TACTACTACT CCTACGGTCT GGACGTCTGG GGCCAAGGGA CCACGGTCAC CGTCTCCTCA 42O

Nucleotide sequence of cDNA of 131C 14 light chain variable region (LV) (from initiation codon (ATG) to the end of variable region) is as follows (SEQ ID NO 7) ATGGACATGA GGGTCCCCGC TCAGCTCCTG GGGCTTCTGC TGCTCTGGCT CCCAGGTGCC 60

AGATGTGCCA TCCAGTTGAC CCAGTCTCCA TCCTCCCTGT CTGCATCTGT AGGAGACAGA 120

GTCACCATCA CTTGCCGGGC AAGTCAGGGC ATTAGCAGTG CCTTAGCCTG GTATCAGCAG 180

AAACCAGGGA AAGCTCCTAA GCTCCTGATC TATGATGCCT CCAGTTTGGA AAGTGGGGTC 240

CCATCAAGGT TCAGCGGCAG TGGATCTGGG ACAGATTTCA CTCTCACCAT CAGCAGCCTG 300 CAGCCTGAAG ATTTTGCAAC TTATTACTGT CAACAGTTTA ATAGTTACCC GTACACTTTT 360

GGCCAGGGGA CCAAGCTGGA GATCAAA 420

Nucleotide sequence of cDNA of C18 kappa light chain variable region (LV) (from initiation codon (ATG) to the end of variable region) is as follows (SEQ ID NO 9)

ATGGACATGA GGGTCCCCGC TCAGCTCCTG GGGCTTCTGC TGCTCTGGCT CCCAGGTGCC 60 AGATGTGCCA TCCAGTTGAC CCAGTCTCCA TCCTCCCTGT CTGCATCTGT AGGGGACAGA 120

GTCACCATCA CTTGCCGGGC AAGTCAGCGC ATTGGCTTTG CTTTAGCCTG GTATCAGCAG 180

AAACCAGGGA AAGCTCCTAA ACTCCTGATC CATGATGCCT CCAGTTTGGA AACTGGGGTC 240

CCATCAAGGT TCAGCGGCAG TGGATCTGGG ACAGATTTCA CTCTCGCCAT CAGCAGCCTG 300

CAGCCTGAAG ATTTTGCAAC TTATTACTGT CAACAGTTTA ATACTTACCC ATTCACTTTC 360 GGCCCTGGGA CCAAAGTGGA TATCAAA 420

Nucleotide sequence of cDNA of C18 heavy chain variable region (HV) (from initiation codon (ATG) to the end of variable region) is as. follows (SEQ ID NO I I)

ATGGAACTGG GGCTCCGCTG GGTTTTCCTT GTTGCTATTT TAGAAGGTGT CCAGTGTGAG 60

GTGCAGCTGG TGGAGTCTGG GGGAGGCCTG GTCAAGTCTG GGGGGTCCCT GAGACTCTCC 120 TGTGCAGCCT CTGGATTCAC CCTCAGTAGC TATAGCATGA ACTGGGTCCG CCAGGCTCCA 180

GGGAAGGGGC TGGAGTGGGT CTCATCCATT AGTAGTAGTA GTAGTTACAT ATACTACGCA 240

GACTCAGTGA AGGGCCGATT CACCATCTCC AGAGACATCG CCAAGAACTC ACTGTCTCTG 300

CAAATGAGCA GCCTGAGAGC CGAGGACACG GCTGTGTATT ACTGTGCGAG AGAAAGGAGG 360

TACTACTACT CCTACGGTAT GGACGTCTGG GGCCAAGGGA CCACGGTCAC CGTCTCCTCA 420

Amino acid sequence of cDNA of 131C 12 heavy chain variable region (HV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 2)

MBFGLSHI.FL VAILKGVQCE VQLLEAGGGL VQPGGSLRLS CAASGFTFSS SAMSWVRQAP 60

GKGLEWVSVI SISGGSTYYA DSVKGRFTIS RDNSKNTLNL QMNSLRAEDT AVYYCAKETR 120 YYYSYGMDVW GQGTTVTVSS 180

Amino acid sequence of cDNA of 131C 12 light chain variable region (LV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 4)

MπMRVPAQLL GLLLLWLPGA RCAIQLTQSP SSLSASVGDR VTITCRASQR IGFALAWYQQ 60

KPGKAPKLLI HDASSLETGV PSRFSGSGSG TDFTLAISSL QPEDFATYYC QQFNTYPFTF 120 GPGTKVDIK 180

Amino acid sequence of cDNA of 131 C I4 heavy chain vaπable region (HV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 6)

MELGLRWVFL VAILEGVQCE VQLVESGGGL VKPGGξLRLS CAASGFTFSS YSMNWVRQAP 60

GKGLEWVssi SSSRSFIYYA DSVKGRFTIS RDIAKNSLSL QMSSLRVEDT AVYYCARERR 120 YYYSYGLDVW GQGTTVTVSS 180

Amino acid sequence of cDNA of 131CI4 light chain variable region-A (LV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 8) MDMRVPAQLL GLLLLWLPGA RCAIQLTQSP SSLSASVGDR VTITCRASQG ISSALAWYQQ 60

KPGKAPKLLI YDASSLESGV PSRFSGSGSG TDFTLTISSL QPEDFATYYC QQFNSYPYTF 120 GQGTKLEIK 180

Amino acid sequence of Cl 8 kappa light chain variable region (LV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 10)

MDMRVPAQLL GLLLLWLPGARCAIQLTQSP SSLSASVGDR VTITCRASQR IGFALAWYQQ 60

KPGKAPKLLI HDASSLETGV PSRFSGSGSG TDFTLAISSL QPEDFATYYC QQFNTYPFTF 120 GPGTKVDIK 180

Amino acid sequence of C18 heavy chain variable region (HV) (leader sequence (bold) and vaπable region) is as follows (SEQ ID NO 12)

MELGLRWVFLVAILEGVQCE VQLVESGGGL VKSGGSLRLS CAASGFTLSS YSMNWVRQAP 60

GKGLEWVSSI SSSSSYIYYA DSVKGRFTIS RDIAKNSLSL QMSSLRAEDT AVYYCARERR 120 YYYSYGMDVW GQGTTVTVSS 180

This example descπbes exemplary heavy and light chain variable region sequences of antibodies that bind to H3L

Analysis of 130D25 130D67 and 130D53 heavy and light chains revealed that they had the same heavy and light chain sequences Hence only the heavy and light chain variable region sequences of 130D67 are shown

Nucleotide sequence of cDNA of 130D67 heavy chain variable region (HV) (from initiation codon (ATG) to the end of variable region) is as follows (SEQ ID NO 13) ATGGAGTTGG GACTGAGCTG GATTTTCCTT TTGGCTATTT TAAAAGGTGT CCAGTGTGAA 60 GTGCAGCTGG TGGAGTCTGG GGGAGGCTTG GTACAGCCTG GCAGGTCCCT GAGACTCTCC 120

TGTGCAGCCT CTGGATTCAC CTTTGATGAT TATGCCATTC ACTGGGTCCG GCAAGCTCCA 180 GGGAAGGGCC TGGAGTGGGT CTCAGGTATT AGTTGGAATG GTCGTAGCAT AGGCTATGCG 240

GACTCTGTGA AGGGCCGATT CACCATCTCC AGAGACAACG CCAAGAACTC CCTGTATCTG 300

CAAATGAACA GTCTGAGAGC TGAGGACACG GCCTTGTATT ACTGTGCAAA GGATATAGGC 360 TTCTATGGTT CGGGGAGCCT TGACTACTGG GGCCAGGGAA CCCTGGTCAC CGTCTCCTCA 420

Nucleotide sequence of cDNA of 130D67K Light chain variable region (LV) (from initiation codon is as follows (SEQ ID NO 15)

ATGGAAGCCC CAGCTCAGCT TCTCTTCCTC CTGCTACTCT GGCTCCCAGA TACCACCGGA 60

GAAATTGTGT TGACACAGTC TCCAGCCACC CTGTCTTTGT CTCCAGGGGA AAGAGCCACC 120 CTCTCCTGCA GGGCCAGTCA GAGTGTTAGC AGCTACTTAG CCTGGTACCA ACAGAAACCT I80

GGCCAGGCTC CCAGGCTCCT CATCTATGAT GCATCCAACA GGGCCACTGG CATCCCAGCC 240

AGGTTCAGTG GCAGTGGGTC TGGGACAGAC TTCACTCTCA CCATCAGCAG CCTAGAGCCT 300 GAAGATTTTG CAGTTTATTA CTGTCAGCAG CGTAGCAACT GGCCTGCGCT CACTTTCGGC 360 GGAGGGACCA AGGTGGAGAT CAAA 420 Amino acid sequence of cDNA of 130D67 heavy chain variable region (HV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 14) MELGLSWIFL LAILKGVQCE VQLVESGGGL VQPGRSLRLS CAASGFTFDD YAIHWVRQAP 60

GKGLEWVSGI SWNGRSIGYA DSVKGRFTIS RDNAKNSLYL QMNSLRAEDT ALYYCAKDIG 120 FYGSGSLDYW GQGTLVTVSS 140 Amino acid sequence of cDNA of 130D67 light chain variable region (LV) (leader sequence (bold) and variable region) is as follows (SEQ ID NO 16)

MEAPAQLLFL LLLWLPDTTG EIVLTQSPAT LSLSPGERAT LSCRASQSVS SYLAWYQQKP 61

GQAPRLLIYD ASNRATGIPA RFSGSGSGTD FTLTISSLEP EDFAVYYCQQ RSNWPALTFG 121

GGTKVEIK

Example 4

This example includes a description of CDRs for exemplary B5R and H3L antibodies. This example also includes ATCC deposit numbers for exemplary B5R and H3L antibodies.

Exemplary CDR sequences (CDRl, CDR2 and CDR3) for variable region heavy (VH) and variable region light (VL) of exemplary B5R and H3L antibodies are set forth in Table 2 below:

Table 2 (SEQ ID NOs: 17-40):

VH βWl WCCWt "WH CBtJ %tet*ϊ Vtfi-*S ooi ITVPi T

S fSHN 2AiSLEi OOPiil'p'tT

D£bbLO oor ^bi PvT

DfAlII ./ASNRAT

The CDR sequences of light and heavy chain in Table 2 were identified using the NCBI Ig BLAST tool (CDRl and CDR2 for both heavy and light chain) using the Rabat rules, and the position of CDR3 (CDR- L3 and -H3) was determined by applying the following rules: The Cys residues are the most conserved feature.

For CDR-Ll, start approximately at residue 24, Residue before a Cys, Residue after a Trp. Typically, for example, Trp-Tyr-Gln, but also, Trp-Leu-Gln, Trp-Phe-Gln, Trp-Tyr-Leu. Length 10 to 17 residues. For CDR-L2, start 16 residues after the end of Ll, residues before generally Ile-Tyr, but also, Val-Tyr, Ile-Lys, or Ile-Phe. Length typically 7 residues (except NEW (7FAB)which has a deletion in this region). For CDR-L3, start 33 residues after end of L2 (except NEW (7FAB) which has the deletion at the end of CDR-L2), residue before a Cys, residues after Phe-Gly-XXX-Gly (SEQ ID NO: 123). Length 7 to 1 1 residues. For CDR-Hl, start approximately at residue 26 (4 after a Cys) [Chothia /AbM definition], Rabat definition starts 5 residues later. Residues before Cys-XXX-XXX-XXX (SEQ ID NO: 124), residues after a Trp. Typically Trp-Val, but also, Trp-Ile, Trp-Ala. Length 10 to 12 residues [AbM definition], Chothia definition excludes the last 4 residues.

For CDR-H2, start 15 residues after the end of Rabat /AbM definition of CDR-Hl, residues before typically Leu-Glu-Trp-Ile-Gly (SEQ ID NO: 108), but there are variations, residues after Lys/Arg- Leu/Ile/Val/Phe/Thr/Ala-Thr/Ser/Ile/Ala. Length Rabat definition 16 to 19 residues; AbM (and recent Chothia) definition ends 7 residues earlier.

For CDR-H3, start 33 residues after end of CDR-H2 (2 after a Cys), residues before Cys-XXX-XXX (typically Cys-Ala-Arg), and residues after Trp-Gly-XXX-Gly (SEQ ID NO' 109) Length 3 to 2 5 residues

ATCC deposit numbers for exemplary B5R and H3L antibodies are set forth in Table 3 below Table 3:

ATCC* fate* by . DegesiBft

Hybπdoma Cell Line 131Cl 4 PTA-8654 131C18 PTA-8562 131C12 PTA-8653 130D67 PTA-8564

Example 5

This example descπbes functional and molecular studies to characterize H3L and B5R antibodies The panel of 12 human antι-H3 mAbs was characterized m vitro by assays to identify antι-H3 mAb for further examination and development One functional test was virus neutralization in vitro Molecular characterizations also assess relatedness of the clones, isotypes and affinities

Supernatants from uncloned anti-H3 hybπdoma cultures were pre-screened for neutralization activity After cloning, anti-H3 mAbs of known concentration were screened in a conventional in vitro neutralization assay (Davies et al , / Virol 79 11724 (2005), Crotty et al , J Immunol 171 4969 (2003), Newman et al , J Clin Microbiol 41 3154 (2003), Frey et al , N Engl J Med 346 1275 (2002)) Neutralization potency of each mAb was determined by quantitative dose titrations, measuring the lowest mAb concentration able to inhibit VACV infection 50%, as measured by plaque assay (PRNT 50 ) The mAbs were analyzed in a series of three independent studies Human mAbs were compared against several controls Serum from an unvaccinated human was used as a negative control Serum from a vaccinated human was used as a positive control Mouse anti-H3 mAbs have also been isolated, and the best of those mAbs #41 was used as an additional comparison

The results of analysis of anti-H3 mAbs are shown in Figure 1 Seven out of 9 clones analyzed exhibited VACV virus neutralization activity Six of these clones had strong virus neutralization activity (#25, #53, #58, #62, #67, #137) (Figure 1) In this assay, the best human mAb was #67, with a neutralization activity of 0 06 μg/ml, which was better than the best mouse mAb isolated in a pilot study (#41, PRNT 5O = 0 3 μg/ml tested in parallel)

Anti-H3 mAbs were or will be subjected to molecular characteπzation First, all anti-H3 mAbs were isotyped for both heavy chain and light chain, and all clones are human IgGl K Second, estimates of relative affinities are determined by endpoint dilution ELISA using recombinant H3 as the capture

antigen Anti-H3 niAbs with higher affinities will generally report better endpoint dilution titers Third, IEF gels will determine if all nine anti-H3 mAbs are independent clones, as indicated by distinct isoelectric points Fourth, cross-blocking studies will determine if there are different epitopes on H3 recognized by the panel of 12 mAbs, and which mAbs are specific for the same (or overlapping) epitopes Mouse mAbs will also be used in the cross-blocking studies to obtain more complete complementation groups

Candidates for m vivo studies are determined by identifying the clones with potent m vitro neutralization activity Clones with non-overlapping epitopes (i e clones 1, 2, and 3 for in vivo testing not all being specific to one epitope) are analyzed as different epitopes may have different levels of exposure in vivo Finally, since all H3L clones thus far are human IgGl, and human IgGl is a complement-fixing isotype, selection based on isotype at this point is unnecessary

The panel of 11 B5R mAbs were characterized in vitro by assays to identify the best anti-B5 mAbs for further examination and development One functional assay was direct neutralization in vitro A second was a complement dependent neutralization assay (described in Example 8) Vaccinia EEV neutralization is desired for an anti-B5 mAb to be used as a human immunofherapeutic

However, neutralization of EEV is less well defined than neutralization of IMV EEV particles are highly labile and therefore it is difficult to produce EEV stocks (Smith et al J Gen Virol 83 2915 (2002), Amanna et al , Immunol Rev lU 320 (2006), Isaacs et al , J Virol 66 7217 (1992), Lustig et al , Virology 328 30 (2004)) Furthermore, direct neutralization of EEV is very inefficient, with -50% neutralization as a common best ca&e scenario (Aldaz Carroll et al , J Virol 79 6260 (2005)) One assay that resolves some of these problem is the comet tail inhibition assay (Amanna et al . Immunol Rev 211 320 (2006), Galmiche et al , Virology 254 71 (1999))

Some poxvirus strains, particularly if left for a longer time (e g 72 hrs) will form ' comet tail plaques The comet tails are due to the release of EEV virions from infected cells, and the EEV particles diffuse a short distance before infecting new cells The directionality of the comet tail is due to weak convection currents in the medium Comet tail formation can be inhibited by addition of anti-B5 antibodies to medium (Lustig et al , J Virol 79 13454 (2005), Bell et al , Virology 325 425 (2004), Lustig et al , Virology 328 30 (2004), Viner et al , Microbes Infect 7 579 (2005)) The full panel of human and B5 mAbs were analyzed by comet tail inhibition VACV 1HDJ was used in the assay as it produces a higher percentage of EEV than VACV NYBOH and thereby more distinct comet tails VACV 1HDJ is used by other research groups studying EEV for this reason

HeIa cells were infected at low density (40 PFU in a 6 well dish) and then overlaid with medium containing 20μg/ml anti-B5 mAb Serum from a vaccinated donor with the highest and B5 titer was used as a positive control (at a 1 10 dilution), and serum samples from several unvaccinated donors were used

as negative controls (also at 1 IO dilution) Cells were incubated for 72 hrs without disturbance and then developed with crystal violet fixation to observe comet tails Positive control serum from a vaccinated donor with the highest anti-B5 IgG titer gave nearly complete inhibition of comet tail formation (Figure 2A) Serum from unvaccinated donors did not prevent comet tail formation Isotype control IgGl or IgG3 mAbs did not prevent comet tail formation (Figure 2) Several anti-B5 mAbs partially inhibited comet tail formation (e g 131 C 12 and B96) while others had no detectable effect on comet tail formation (e g 131 C 18-G3 or 131 C 18-G4) (Figure 2)

While the comet tail in vitro assay can measure functional anti-EEV neutralization, this assay has two limitations First, comet tails can be inhibited by anti EEV B5 specific antibodies, but the inhibition requires a high concentration of antibody- 20-40 μg/ml is frequently used This is ~500x more IgG than the amount of anti-H3 mAb needed to neutralize IMV It is also much higher than the IgG concentrations required to neutralize a wide variety of viruses in vitro, such as influenza, SARS, polio and rabies Such high levels of anti-B5 IgG may not be physiological Second, anti-EEV antibodies targeting the A33 protein are protective in vivo but do not inhibit comet tail formation, indicating a distinction between in \ιtro EEV comet tail inhibition and in vivo EEV neutralization (Lustig et al J Virol 79 13454 (2005), Galmiche et al , Virology 254 71 ( 1999)) Given these limitations, the power of the comet tail assay to predict which anti-B5 mAbs would be most efficacious, m vivo is limited Thus, the complement dependent neutralization assay described in Example 8 can be used as a primary endpoint B5R mAbs were also subjected to the molecular characterizations described above for H3 mAbs The 1 1 human anti-B5 mAbs were isotyped for both heavy chain and light chain (All K) SIX of 1 1 were IgGl, three were IgG4, one was IgG3, and one was IgG2 Second, estimates of relative affinity of the purified clones are determined by endpoint dilution ELISA using recombinant B5 as the capture antigen in a standard BIAcore assay using purified mAbs MAbs with higher affinities will generally report better endpoint dilution titers Third, IEF gels were run to determine if all six of the most promising mAbs are independent clones, as indicated by distinct isoelectric points

Cross blocking studies were performed to determine the number of different epitopes on B5 recognized by a panel of mAbs, and which mAbs are specific for the same (or overlapping) epitopes An ELISA was used to determine if the antibodies bind to the same B5R epitope In brief, NUNC 96 well flat bottom ELISA plates were coated with individual mouse or human anti-B5R antibodies in carbonate buffer at 2 μg/ml for 1 hour at 37 0 C The plates were washed and then blocked with PBS/1 %BSA/T ween 20 Anti-B5R antibodies were then pre incubated with recombinant vaccinia virus 6x His tagged soluble B5R for 30 minutes at 4°C The combinations of antibody-protein were added to the plate and incubated for 1 hour at 4 0 C After 3 washes, bound B5R 6x His was detected with peroxidase conjugated anti-6xHis epitope tag Ig (Clonetech) Cl 2 and C14 are human anti-B5R

antibodies and B96, B 116 and B 126 are mouse anti-B5R antibodies The percent inhibition was determined using the OD of each sample in the following formula %inhibition = (max - sample/max)* 100 Max represents the OD from the sample with no inhibiting Ab or hlgG isotype control The cross-blocking results are illustrated in Tables 4A and 4B Table 4A

Table 4B

The data show that C 12, C 14 C 18, C33 and C30 block each other and are therefore members of the same epitope group BI l 6 B 126 and B96 are not blocked, and therefore each representdistinct epitope groups In toto, there are five epitope groups (Groups A-D) recognized by the anti-B 5 R antibodies based on competition for binding to recombinant B 5 R protein (B 5 R-6xHis) by ELISA Top B5R antibody candidates bind to the overlapping epitope groups C12 and C14 seem to recognize the same or very closely related epitope, and C 18 seem to recognize an epitope cluster overlapping with but not identical to that of C12 and C14

This example describes in vivo efficacy studies of B5R and H3L antibodies using three standard lethal challenge vaccinia models

There are three m vivo models used to study the ability of mAb pretreatment to protect mice The first is intranasal challenge of BALBc with VACV WR The second is intravenous challenge of SCID mice with VACV WR vaccine strain The third is intravenous challenge of SCID mice with VACV NYBOH vaccine strain Studies with these models are described in detail below All 10 anti-B5 mAbs were analyzed for the ability to protect BALBc mice from a lethal intranasal challenge with VACV WR This is the same assay used in the studies descπbed in Example 4 and is widely used as a model for smallpox inhalation in humans (Ramirez et al , J Gen Virol 83 1059 (2002), Zhang et al J Virol 74 11654 (2000), Belyakov et al , Proc Natl Acad Sa U S A 100 9458 (2003), Alcami et al , Cell 71 153 (1992)) In this regard, the respiratory route of infection of VACV WR and smallpox are the same An excellent feature of this model is that while the primary endpoint is survival, weight loss can also be tracked as a quantitative measure of protection Both severity (nadir) and duration of weight loss can be used as criteria to measure the severity of the infection in instances of partial protection In brief, each mouse was> administered lOOμg of a particular antι-B5 mAb i p at day -1 (5 mice/group) After light anesthesia (isofluorane), mice were infected intranasally with 3 x 10 4 PFU VACV WR (2 LD W ) in a lOμl volume Mouse weight was measured daily for a period of four weeks Any mouse with 30% weight loss was euthanized as per the animal protocol, based on earlier work showing mice do not recover from that severe weight loss Mice were also examined for clinical symptoms (lethargy, ruffled fur, hunched back) that can be composited into a mean clinical disease score (similar to Crotty et al , Blood 108 3085 (2006)) The human mAbs were compared to a muπne mAb #B96 In a first study, human anti-B5 mAbs #C 14 and #C33 provided 100% protection from death and provided better protection against weight loss than the mouse mAb #B96 (Figure 3A) Plasma from an unvaccinated person was used as a negative control and had no protective effect A study of the full panel of human anti-B5 mAbs was then performed Eight of 10 human anti-B5 provided at least partial protection against mouse death (B5 antibodies, C12, C14, C30, C33, C18, C35, C29, C39) In a subsequent study, the best candidate human mAbs, based on weight loss amelioration, were compared side-by-side in the VACV WR i n challenge model with VIG used as the benchmark treatment The specific VIG used for this study was the reference Baxter VIG currently used by the FDA and CDC as their benchmark standard (Goldsmith et al , Vox Sang 86 125 (2004), Manischewitz et al , J Infect Dis 188 440 (2003)) Four of five untreated (PBS) mice lost weight rapidly and died or were euthanized by day 7 (Figure 3B) VIG barely protected the mice from death (the 70% weight cutoff was almost reached for 3 of the 4 VIG-treated mice) In contrast, two human anti-B5 mAbs, namely C12 and C14, given as 50 μg doses provided complete protection against death and both mAbs ameliorated weight loss substantially better than VIG (Figure 3B-3C) These results indicate that both human mAbs are superior to VIG, even as a single mAb therapy These results also demonstrate that high quality mAb, of

comparable protective efficacy, virus, neutralization, B5R binding affinity, etc , can be readily obtained from KM mice using the protocol described herein

The ability of particular B 5 antibodies to protect in vivo was not predicted by the m vitro comet tail inhibition assay, highlighted most clearly by comparisons against B96, the best comet tail inhibiting mAb, which had poor protection m vivo These results confirmed that the comet tail assay, although providing valuable information, is somewhat limited in predicting in vivo efficacy In contrast, the complement dependent neutralization assay descπbed herein was highly predictive of protective efficacy, both for mouse and human mAbsantibodies (Table 5 ) A summary of the isotype, binding, neutralization and in vivo protective activity of several anti-B5R antibodies is illustrated in Table 5. C12, C14 and C18 are human anti-B 5 R antibodies

Using similar conditions, the protective efficacy of several human antι-B5 mAbs were studied in SCID mice infected with VACV WR , a more virulent VACV strain than VACV NYBOH The data is shown in Figure 4 In brief, groups of 5 SCID mice were administered VIG, lOOμg anti-B 5 human mAb #C1 2 , lOOμg antl- B5 human mAb #C I 4 , or PBS at day -1, then infected i v with 1 x 10 3 PFU VACV WR on day 0 Mice pretreated with either human antι-B5 mAb (C12, C14) were well protected from VACV WR The antι-B5 mAb treated mice had minimal weight loss and were all alive at day 14, while untreated mice (PBS) rapidly lost weight and all died by day 14 The antι-B5 mAbs both protected significantly better than VIG (Figure 4A) This is similar to protection observed in the intranasal model (Figure 3) Table 5

The full panel of anti-H3 human mAbs, which have been characterized for virus neutralization m vitro, are tested in vivo The best three candidates based upon neutralization assays are #67, #2 5 , and #53, with #78 and #58 also being of similar potency Antibody #54 is a suitable negative control mAb, since it

exhibited no detectable neutralization in vitro The VACV WR BALBC l n challenge system and the VACV NYBOH SCID I v challenge system are used as described above for anti-B5 Since anti-H3 antibodies are protective in vivo (Davies et al , J Virol 79 1 1724 (2005)), rabbit anti-H3 serum is used as a positive control An in vivo protection study with mouse anti-H3 mAb #41 was performed In brief, SCID mice were administered VIG, 200μg anti-H3 #41 or PBS at day -1, then infected l v with 1 x IO 3 PFU VACV WR on day 0 The mice administered antι-H3 #41 exhibited substantial protection from weight loss for greater than two weeks after infection with virulent VACV WR (Figure 4B) This data indicates that single mAb treatment with either anti-B5 or antι-H3 can outperform VIG in an in vivo SCID protection model similar to the one used for licensure of VIG Since three human anti-H3 mAbs (#67, #25, and #53) have been identified that neutralize better than or equal to #41, it was expected that these antibodies will exhibit in vivo protection This is demonstrated in Example 10 Combination anti-H3L and anti-B5R antibody therapy is therefore predicted to be very potent This is also demonstrated below Combination anti-H3L and antι-B5R antibody therapy is therefore predicted to be very potent, which is also demonstrated below

The third m vivo assay used as a screen for candidate mAbs is the animal model considered to resemble closely human progressive vaccinia In this system, SCID mice are infected with smallpox vaccine VACV MYBOH and then measured for weight loss, pox formation, and death This model has been used by VIG vendors (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)) and the FDA (Goldsmith et al , Vox Sang 86 125 (2004)) This model is valuable both because it uses the human vaccine strain of vaccinia and immunodeficient or immunocompromised humans are a group of concern for failing to control VACV and develop progressive vaccinia or other life threatening side effects, which are the clinical conditions for which VIG is licensed In this model, treatment with a human mg/kg equivalent dose of VIG is able to extend life by > 1 week (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)), (Goldsmith et al , Vox Sang 86 125

(2004)) Since SCID mice are fully immunodeficient, a complete cure is not expected, but life extension correlates with the ability of VIG to reduce or prevent severe vaccinia side effects in humans, and an effective post-exposure prophylactic against smallpox Since this assay uses the human smallpox vaccine strain, models vaccinia infection in an immunodeficient/ immunocompromised setting, and has been used at the FDA, this animal model is useful for identifying successful candidate mAbs

In brief groups of six SCID mice were administered anti-H3 mAb #41 + human anti-B5 mAb C 14 (200μg and lOOμg respectively)(Figure 5, triangle symbols), or anti-B5 mAb C 14 alone (lOOμg) (Figure 5, filled square symbols), or PBS (Figure 5, filled circles) l p at day - 1 Mice were then infected with 1 x 10 4 PFU VACV NYBOH i v Untreated, uninfected "naive"' mice were used as healthy controls (Figure 5,

open circles) As illustrated in Figure 5, anti-H3 + anti-B5 mAb combination far outperformed anti-B 5 mAb monotherapy (P < 000Q7)

These mice were also scored for percent survival, development of pox lesions and those mice that reamined disease free (Figure 6) Untreated, uninfected "naive" mice were used as healthy controls (Figure 6, open circles) Combination mAb therapy (Figure 6A, filled triangle symbols) was significantly better than monotherapy (Figure 6A, Filled square symbols) (P < 000 4 7) and no therapy (PBS, Figure 6A, filled circles) (P < 0 Q007) in terms of survival Mice were examined for the development of pox lesions daily, and thepercent of mice that remained pox free is shown in Figure 6 B Combination mAb therapy was significantly better than monotherapy (P < 00009), and monotherapy or combination therapy was significantly better than no therapy (P < 00009) Thepercent of mice that remained disease free, defined on the basis of weight loss is shown in Figure 6C The start of observable disease was defined as > 5% weight loss Combination mAb therapy was significantly better than monotherapy (P < 0003) and monotherapy or combination therapy were both significantly better than no therapy (P < 00006 and P < 0 016) Work by other groups has shown that after initiation of infection, VIG can have a modest partial effect given post-exposure at day +2 to +4 (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)) Given the data with the more virulent VACV WR strain, human mAbs will likely outperform VIG The mAbs were compared to the commercially available "standard of care" VIG therapy Mabs are considered "noninfeπor" to VIG if they extend survival time by an equivalent number of days, and mAbs are considered "superior" to VIG if they extend survival time longer than VIG. as measured by standard Kaplan-Meier survival curve statistical analysis

In brief groups of six SCID mice were given anti-H3 mAb #41 (200μg) + human anti-B5 mAb C 14 ( lOOμg) (Figure 7, tπangle symbols), or VIG (2mg) (Figure 7, filled square symbols), or PBS (Figure 7, filled circles) at day -1 Mice were then infected with I x 10 4 PFU VACV NYBOH i v As shown in Figure 7. anti-H3 + anti-B5 mAb combination outperformed VIG (P < 0004)

These mice were also scored for percent survival, development of pox lesions and for those that remained disease free (Figure 8) As shown in Figure 8, anti-H3 + anti B5 mAb combination therapy was significantly better than VIG therapy in terms of survival (Figure 8A, P < 00045), the percent of mice remaining pox free (Figure 8B, P < 00009). and the percent of mice remaining disease free (Figure 8C, P < 0 0062)

WorkReports by others groups hashave shown that after initiation of infection, VIG can have a modest partial effect given post-exposure at day +2 to +4 (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)) Given the data with the more virulent VACVWR strain, human mAbsantibodies will likely outperform VIG

This example includes a descπptioπ of additional assays useful in characterizing function and broad reactivity spectrum of antibodies Demonstration of immunological cross-reactivity of top antibodies with variola virus homologs H3 protein is highly conserved among orthopox viruses The H3 protein sequence is 96-98% conserved between VACV and variola (smallpox), and 94% conserved between VACV and monkeypox B5 has similarly high levels of conservation, close to 92% For some mAbs. Western blot analysis can be used to check their cross-reactivity in vitro Bacteπallv expressed recombinant full-length B6 protein and its fragments 825 nucleotides of the predicted nucleotide sequence coding for amino acids 1-275 of the variola vims protein B6 (accession # X65519) were synthesized by GenScπpt Corporation (Piscataway, NJ, USA) Five vectors for the expression of various lengths of the B 6 protein were produced using bacterial expression vector pMAL- C4X (New England BioLabs, Ipswich, MA, USA) The pMAL-C4X vector contains the malE gene for expression of maltose-binding protein (MBP) All of the vectors were constructed such that the nucleotides coding for the B6 protein were inserted downstream of, and in the same translational reading frame as, the malE gene As a result, the translation initiating with the MBP protein should continue through the coding region of the B6 forming an MBP-B6 fusion protein In general, the resulting fusion proteins consist of 391 amino acids at the amino-terminal end coding for the maltose-binding protein followed by the portion of B 6 protein coded for by the region of B6 cloned into that particular expression vector Constructs encoding B6 fragments were designed to contain overlapping short consensus repeat sequences (SCR) to facilitate narrowing down epitope specificity for top anti-B5 mAbs The five expression vectors created are 1) pMAL-B6R (B6 amino acids 20-275), 2) pMAL-B6R(SCRl-SCR2) (B6 amino acids 20-132), 3) pMAL-B6R(SCR2-SCR3) (B 6 amino acids 71 - 184), 4) pMAL-B6R(SCR3- SCR4) (B6 amino acids 133-275), 5) pMAL-B6R (20-100) (B6 amino acids 20-100) All of the above vectors were constructed using the same technique Briefly, oligonucleotide primers specific for the regions of interest were designed containing 5'-EcoRI and 3'-HmDIII restriction endonuclease recognition sites B6 (20-275) (primers SCRl_EcoRl_F58, ExCelLHindIII_R828), B6 (20-132) (primers SCRl_EcoRl_F58, SCR2_HindIII_R396), B6 (71-184) (primers SCR2_EcoRI_F211 , SCR3_HindIII_R552), B6 ( 133-275) (primers SCR3_EcoRl_F397, ExCelLHindIII_R828), B6 (20-100) (pπmers SCRl_EcoRl_F58, B6R_HindIII_R300) (Table 6) Respective oligonucleotide primers were used to amplify B6 gene fragments from the B6 template by polymerase chain reaction (PCR) with KOD Hot Start DNA polymerase (EMD Chemicals Inc , Gibbstown, NJ, USA) The resulting nucleotide fragments were digested with restriction enzymes EcoRI and HinDIII (New England BioLabs), as was the

pMAL-C4X vector All nucleotide fragments were run on agarose gels, and DNA bands corresponding to the theoretical nucleotide size were extracted and purified by column purification (QIAquick Gel Extraction Kit, Qiagen Inc , Valencia, CA, USA) Each of the B6 nucleotide fragments were separately ligated into the pMAL-C4X vector using DNA Ligase Mighty Mix (Takara Bio USA. Madison, WI, USA) Ligation mix was transformed into E coli bacteria strain DH 5 a (Invitrogen Corp , Carlsbad, CA, USA) and grown on Luπa-Bertani (LB) broth (MP Biomedicals, LLC, Solon, OH, USA) agarose plates containing ampicillin (lOOug/mL) (Sigma-Aldπch, St Lois, MO, USA) Colonies were grown in LB broth with ampicillin, plasmid DNA was isolated (QIAprep Spin Miniprep Kit, Qiagen, Inc ), analyzed by restriction digest and sequenced to verify nucleotide sequence of the B6 fragments (GENEWIZ, Inc , San 0 Diego, CA USA) Table 6 (SEQ ID NOs 110-116)

B6 Bacterial Expression:

B6 expression vectors were transformed into E coll bacteria strain DH5a and grown on LB broth-agarose 5 plates containing ampicillin ( I OOug/mL) Individual colonies were grown over night (~ 18 hours) at 37 0 C shaking at 250 rpm in liquid LB containing ampicillin ( 100ug/mL) Cultures were diluted 1 part in 20 into two containers of fresh LB with ampicillin and incubated as before When cultures reached an optical density at a wavelength of 600 nm (OD 600 ) of 0 5 -0 8, one of the duplicate cultures was induced to express the B6 protein by adding isopropyl •-D-1-thiogalactopyranoside (IPTG) (BioPioneer, Inc , San 0 Diego, CA, USA) to a final concentration of ImM, the other paired culture was not induced The cultures were grown as before for three hours Equal volumes of each culture were removed, bacteria pelleted by centπfugation, supernatant removed, and pellets were lysed by adding 2x Laemmli buffer (Laemmli UK, Nature 227, 680-685, 1970) and incubating at 95 0 C for 5 minutes B6 Sequences 5

Nucleotide sequence of the extracellular domain of variola virus B6 cDNA (accession # X65519) from initiation codon (ATG) to the end of extracellular domain (nucleotides 1 -825) SEQ ID NO 117

ATGAAAACGA TTTCCGTTGT TACGTTGTTA TGCGTACTAC CTGCGGTTGT TTATTCAACA 60

TGTACTGTAC 120

AAACAAAAAG 180

TGTGAAACAG 240 TATGTCTCTG 300

TGTAAAGACG 360

GATACTGTTA 420

CAACCAGTTA 480

TATGAGGTTA 540 TCATGTCAAC 600

TTTTCTATCG 660

CCATCATCCA 720

AACGAAGAAT 780

TCAAAAGACG TAGAA 840

Amino acid sequence of Variola major virus, strain India-1967, B6 extracellular domain (amino acids I-

27 5 , leader sequence (bold)), SEQ ID NO 1 18

MKTISWTLL CVLPλWYST CTVPTMNNAK LTSTETSFND KQKVTFTCDS GYYSLDPNAV 60

CETDKWKYEN EEKNGNTξWN 120 DTVTCPNAEC QSLQLDHGSC QPVKEKYξFG 180

SCQQKCDIPS LSNGLIξGξT FξIGGVIHLS CKξGFILTGξ PξξTCIDGKW 240

NEEFDPVEDG SKDWQYEQE IESLE 300

Demonstration of cross-reactivity of the lead anti-B5R mAbs with variola virus homolog by Western blot All top anti-B5R mAbs demonsrated their reactivity against B5R in Western blot conditions Based on this result, Western blot assay could be used to check their cross-reactivity with variola homolog, B6

In this assay, adequate amounts of B6 ectodomain, its fragments, and B5R protein were blotted on PVDF membrane (0 4 5um, Invitrogen) following electrophoresis on SDS PAGE (A-IWo Tπs -Glycine gels. Invitrogen) The blocked with milk membranes were incubated with 131C12, 131C14, or 131C18 human mAbs. and their binding was detected with goat anti-human IgG FcγHRP conjugate (Jackson Immunoresearch Labs) The antigen bands were visualized on X-ray film following exposure of the membranes pre-incubated wit h ECL Plus™ chemilimunescence substrate (GE Healthcare) Based on the wetern blot data, all top human anti-B5R mAbs demonstrated strong cross-reactivity with variola homolog protein, B6 (Fig 9)

Narrowing down epitope specificity for the top human antι-B5R mAbs by Western blot The epitope specificity of human anti-B5R mAbs was narrowed down to N-terminal portion of B5R protein, including SCR l based upon the demonstrated reactivity towards fragments of B6 protein (Fig 10 and I I) The results are summarized in Table 7 Table 7

Cloning of vaccinia and variola H3L ectodomains Homologous nucleotide regions coding for amino- terminal extracellular domains of the H3 protein from variola virus strain Lister (VACVIis) (accession # AYδ7827δ), and variola major virus strain Bangladesh- 1975 (VARVban) (accession # L22579) were separately cloned into bacterial expression vector pET21a(+) (EMD. Novagen Brand, Madison, WI,

USA) such that translation of the H3 coding frame would add a six histidine tag (6-HIS tag), coded for by nucleotides in the vector, at the carboxy-terminus of the H3 protein Specifically, 807 nucleotides of the predicted nucleotide sequence coding for amino acids 1-269 of the H3 protein from VACVIis, and 810 nucleotide of the predicted nucleotide sequence coding for amino acids 1-270 of the H3 protein from VARVban were synthesized by OenScπpt Corporation (Piscataway, NJ, USA) Nucleotides coding for the restπction endonuclease sites of Ndel and Xhol were added at the 5' and 3' ends respectively of each H3 nucleotide fragment during synthesis The nucleotide fragments were digested with restπction enzymes Ndel and Xhol, as was vector pET21a(+) Resulting H3 and pET21a(+) nucleotide fragments were isolated by agarose gel electrophoresis and purified using QIAquick Gel Extraction Kit (Qiagen Inc , Valencia, CA, USA) Purified H3 nucleotide fragments were then ligated individually into the digested pET2 la(+) vector, transformed into E coli bacteria strain DH5α (Invitrogen Corp , Carlsbad, CA, USA) and grown on Luna-Bertani (LB) broth (MP Biomedicals, LLC, Solon, OH, USA) agarose plates containing ampicillin ( 100ug/mL) (Sigma-Aldπch, St Lois, MO, USA) Colonies were grown in LB broth with ampicillin, plasmid DNA was isolated (QIAprep Spin Miniprep Kit, Qiagen, Inc ), analyzed by restπction digest and sequenced to verify nucleotide sequence of the H3 fragments (GENEWIZ, Inc , San Diego, CA, USA)

Protein Expression Individually, H3 expression vectors were transformed into E coll bacteria strain DH 5 CX and grown on LB broth-agarose plates containing ampicillin ( 100ug/mL) Individual colonies were grown over night (-18 hours) at 37 0 C shaking at 250 rpm in liquid LB broth containing ampicillin

( lOOug/mL) Cultures were diluted 1 part in 20 into two containers of fresh LB with ampicillin and incubated as before When cultures reached an optical density at a wavelength of 600 nm (OD KJO ) of 0 S- 0 8, one of the duplicate cultures was induced to express the H3 protein by adding isopropyl β-D-l- thiogalactopyranoside (IPTG) (BioPioneer, Inc , San Diego, CA, USA) to a final concentration of ImM, the other paired culture was not induced The cultures were grown as before for three hours Equal volumes of each culture were removed, bacteria pelleted by centπfugation, supernatant removed, and pellets were lysed by adding 2x Laemmli buffer (Laemmli UK, Nature 227, 680-685. 1970) and incubating at 95 0 C for 5 minutes. H3L Ectodomains Nucleotide Sequences Synthesized nucleotide sequence of H3 from vaccinia virus strain Lister (from Ndel restriction site (CATATG) through Xhol restriction site (CTCGAG) Start codon is ATG ) SEQ ID NO 119

CATATgGCGG CGGTGAAAAC TCCTGTTATT GTTGTGCCAG TTATTGATAG ACCTCCATCA 60

GAAACATTTC 120

AACGAAGTTA 180 AAGGATTATG 240

CACTTCTTTT 300

AGACATTTAG 360

TATGTAGTTA 420

TTGAAGGCAA 480 AATAAAGTTA 540

GGGTATGATG 600

GATGAAATTA 660

GAAAACGAAA 720

GATCCTCGAC 780 ATAGGAACGG CTCQAG 840

Synthesized nucleotide sequence of H3 from variola major virus strain Bangladesh- 1975 (from Ndel restriction site (CATATG) through Xhol restriction site (CTCGAG) Start codon is ATG ) SEQ ID NO 120

CATATgGCGA CTGTGAATAA AACTCCTGTT ATTGTTGTGC CAGTTATTGA TAGACCTCCA 60 TCAGAAACAT TTCCTAATCT TCATGAGCAT ATTAATGATC AGAAGTTCGA TGATGTGAAG 120

GACAACGAAG 180

TACAAGGATT 240

ACTCACTTCT 300

GCTAGACATT 360 GAATATGTAG 420

GTCTTAAAGG 480

GGCAATAAAG TTAAAACCGA GCTAGTAATO GACAAAAATC ATGTCATATT CACATATACA 540

GGAGGGTATG 600

GTAGATGAAA TCATCGGGAT 660

ATCGAAAACG AAATGAAGAT TAACAGGCAA ATAATGGATA ACTCTGCCAA ATACGTAGAA 720 CACGATCCTC 780

AGAATAGGAA CCACTCOXQ 840

Amino acid sequence of H3 protein from vaccinia virus strain Lister expressed from vector pET21a(+) (amino acids [-269 of H3 through the 6-HIS tag coded by the vector (underlined)) SEQ ID NO 121

MAAVKTPVIV VPVIDRPPSE DQKFDDVKDN EVMPEKRNW WKDDPDHYK 60 DYAFIQWTGG HLALWDξNFF 120

WIVENDNVI EDITFLRPVL LQMREIITGN 180

YDVξLSAYII RVTTALNIVD EIIKSGGLSS GFYFEIARIE NEMKINRQIL DNAAKYVEHD 240

PRLVAEYRFE NMKPNFWξRI GTAAAKRYPL EHHHHHH 300

Amino acid sequence of H3 protein from vaπola major virus strain Bangladesh- 1975 expressed from vector pET21a(+) (amino acids 1-269 of H3 through the 6-HIS tag coded by the vector (underlined)) SEQ ID NO 122

MATVNKTPVI OTPVIDRPPS NDQKFDDVKD 60

KDYAFIHWTG HFFξGFCNTM 120

YWIVEHDNV IEDITFLRPV ILQMREIITG 180 GYDVξLSAYI IRVTTALNIV DEIIKξGGLS SGFYFEIARI ENEMKINRQI MDNξAKYVEH 240

DPRLVAEHRF LEHHHHHH 300

Demonstration of cross-reactivity of human anti-vaccinia H3L 130D67 mAb with vaπola virus homolog by Western blot

Western blot assay confirmed that 130D67 human mAb raised against vaccinia H3L cross-reacts with variola homolog The antibody showed strong recognition of H3L ectodomain both from vaccinia and variola viruses (Figure 12 A) Based on the lack of reactivity with the lower H3L band recognized by anti-His Tag® mAb, the epitope of 130D67 has been mapped to the 1-80 aa region of H3 (Fig 12 A,B) This finding supports broad spectrum reactivity of the 130D67 antibody and its suitability to protect against vaπola smallpox virus Neutralization of vaπola and monkeypox While VIG lots are not directly tested for efficacy against variola or monkeypox, mAbs can be assayed for neutralization of vaπola and/or monkeypox Given that the best available data indicates that post-exposure treatment with VIG is -75% effective against smallpox (Hopkins et al , CIm Infect Dis 39 819 (2004)), a national or military VIG stockpile would

likely be dual purpose- treatment of smallpox vaccine side effects and emergency treatment of a smallpox outbreak

Ng/NDA VACV WR eczema vaccinatum model A mouse model for eczema vaccinatum has been established (K awakami et al Alergol Int Epub, 56, Sept (2QQ7)) Given that eczema vaccinatum is a concern of the smallpox vaccine, the ability of mAb therapy to treat eczema vaccinatum is studied Atopic dermatitis is induced in Ng/NDA mice, which are then infected with VACV WR at the site of the dermatitis Eczema vaccinatum is measured by lesion size and clinical score Mice are treated with anti- B5 mAb, anti-H3 mAb, or VIG intravenously immediately prior to VACV WR scarification Protection is measured by reduction of eczema vaccinatum lesion size and lesion duration In a separate set of studies, protection is measured by reduction of viral loads in the lesion (at the site of infection) at day 7, and prevention/reduction of viral spread as measured by viral titers in lung at day 7 post-infection Skin biopsies can also be taken from this study at day 7, and pathology scoring of histological sections from each animal will be done to measure severity of epithelial damage and leukocyte infiltration SCID VACV wp tail pocks model This is a model that has been used by investigators to query protection against pock/lesion formation after VACV infection While the lesions are not histologically the same as human smallpox, monkeypox, or vaccinia infection, the model does recapitulate the basic phenomenon of distinct viral skin pustules While this assay has been around for 40 years (Joshi et al , Appl Microbiol 18 935 (1969)), there can be large variability between individual mice making it necessary to use large numbers of animals to determine statistically significant differences (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)) Groups of 12 BALBc mice are treated with mAbs or VIG at day - 1 and then infected with 2 x 10 5 PFU VACV NYBOH at day 0 by subcutaneous injection of the tail Necrotic pocks on the tail skin are visualized at day 8 by counterstaining (Shearer et al , Antimicrob Agents Chemother 49 2634 (2005)), Joshi et al . Appl Microbiol 18 935 (1969)) and quantified If VACV NYBOH vaccine strain fails to give sufficient pocks, a more virulent VACV strain (VACV WR or VACVi HD ,) can be used, as has been done by other investigators (CangeneCorporation, (ed WIPO) (2003), Neyts et al ,

Antimicrob Agents Chemother 46 2842 (2002) Spπggs et al , Pwc Natl Acad Sa USA 89 6070 ( 1992))

Example 8

This example includes a description of a new EEV neutralization assay that correlates with in vivo protection against vaccinia This example also includes in vivo protection data and data generated with this EEV neutralization assay

Conventional neutralization assays are done in the absence of complement (using heat inactivated serum) and are what can be called "direct neutralization assays While such assays provide useful information, it is likely that aspects of neutralization m vivo are heavily influenced by complement and mAbs are likely to

vary in their virus neutralization in the presence of complement (see, for example, B 5 , described later) Thus, it is useful to assay virus neutralization in the presence of complement Given that the EEV comet tail inhibition assay is limited in terms of predicting protective efficacy of anti-B5 mAbs in vivo (Table S), and EEV are resistant to conventional direct neutralization, a new m vitro EEV neutralization assay that more accurately predicts or correlates with in vivo protection was developed This assay can be used to develop data to provide greater in vivo relevancy for comparing functional antiviral characteristics of mAbs vs VIG

In brief VACV WR (80 PFU) EEV (standard preparation of secreted EEV as the 48 hr supernatant of VACV WR infected HeLa cells, titered and kept at 4 0 C for < 30 days, ref (Bell et al , Virology 325 425 (2004), Lustig et al , Virology 328 30 (2004), Viner et al Microbes Infect 7 579 (2005)) was incubated with 10% rabbit complement plus I μg/ml anti-B5 mAb for 60 min at 37 0 C, then added to Vero cells After 1 hr vims was washed from the monolayer and cells were incubated 42 hrs at 37 0 C and then developed with crystal violet and VACV plaques were enumerated This assay was performed on a large panel of human and murine anti-B5 mAbs (Figure 13) Individual mAbs alone without complement did not exhibit any significant neutralization Complement alone did not significantly reduce PFU (' DlO" medium (DMEM +10% heat inactivated FBS) plus complement ( 10% rabbit complement) Figure 13 far right) In the presence of complement, anti-B5 human mAbs with good in vivo protective efficacy (#C12, #C 14, B 126) exhibited potent anti-EEV neutralization activity, while minimally protective or non- protective mAbs (#D3 #C29) did not In bπef, this was confirmed in vivo mice were administered 1 OOμg of a particular anti-B5 mAb i p (or PBS as a negative control) at day -I (5 mice/group) After light anesthesia (lsofluorane), mice were infected intranasally with 3 x 10 4 PFU VACV WR (2 LD 50 ) in a lOμl volume Mouse weight was measured daily Any mouse with 30% weight loss was euthanized Monoclonal antibody B 126 was highly protective while B96 was weakly protective (Figure 14A) Monoclonal antibody C 14 was also highly protective (Figure 14B)

The data demonstrate a high correlation between in vitro neutralization activity in the presence of complement and protection in vivo against a lethal VACV WR challenge (Figure 14, Table 5) Human mAb #C18 exhibited potent in vitro neutralization activity, and provides in vivo protection against a lethal VACV WR (Figure 14) The most protective murine anti-B5 mAb in vivo, #B126 was the only murine mAb to possess strong complement-mediated EEV neutralization (Figure 13, 14)

The best comet tail inhibiting mAB, #B96, did not exhibit complement mediated EEV neutralization, nor was this antibody effective in vivo (Figure 13, 14) further confirming the limited predictive power of the comet tail assay While comet tail inhibiting mAbs can be protective (Chen et al , Proc Natl Acad Sa U S A 103 1882 (2006)), this data shows that this assay does not correlate with in vivo protection These

studies have been repeated multiple times with reproducible results This data strongly supports the accuracy and utility of the complement mediated EEV neutralization assay

Example 9 This example includes demonstration of the significant role of the complement in the protection mechanism of anti-B5 antibodies

Requirement for complement in vivo B 126 antibody was distinguished from other murine anti B5 mAbs by its ability to neutralize EV in vitro The neutralization assay incorporated complement B 126 was also the only murine IgG2a clone identified, and IgG2a is the most efficient complement binding murine isotype These findings indicated that the potent protective efficacy of B 126 in vivo was likely due to its ability to fix complement To confirm this hypothesis the efficacy of B 126 after depleting complement was analyzed in vivo Complement was depleted by administering cobra venom factor (CVF), which was confirmed by measuring serum levels of C3 (94% depletion, Fig 15 A) Two different anti-B5 IgGl mAbs were used for comparison to B 126 B 1 16 and B96 Complement depletion did not affect the modest protection provided by either B96 or B 1 16 (average nadir weight loss 22-24%, Fig 15 C G) Nor did depletion of complement affect pathogenesis or kinetics of disease in untreated mice infected with VACV (Fig 15 E-F) In contrast, depletion of complement ablated B 126 activity by more than 50% (Fig 15 B, D) Mice treated with B 126 and infected with VACV WR lost no weight (average nadir weight loss 1%, Fig 6B, D). but complement depleted mice had a specific loss in B 126 mAb protection (average nadir weight loss 14% Fig 15 B. D) This data demonstrated that the majority of the protection against VACV provided by the IgG2a anti-B5 mAb B 126 was due to complement (P < 0001 ) Even so, some protection was still present in the absence of complement, and B 126 was still more protective than IgGl isotype B5 antibodies of comparable affinity (P < 0 02) implicating additional Fc-mediated functions The physiological EV neutralization assay in vitro demonstrated that anti B5 antibodies can efficiently neutralize EV virions, and this functionality was predictive of protective efficacy m vivo Complement can function in multiple ways, and the observation that complement fixing mAbs were so effective in vivo that mice developed no clinical symptoms suggested that the VACV infection may be stopped very rapidly These observations mean that anti-B5 antibodies are likely able to direct complement mediated destruction of VACV infected cells, utilizing the membrane attack complex, and thereby rapidly quenching the spread of VACV, leading to resolution of the infection

The ability of antι-B5 mAbs to direct complement lysis of cells infected with VACVwas studied While MV VACV virions (MV) the most abundant virion form, are produced intracellularly and do not have cell surface exposed proteins, EV are secreted from the plasma membrane VACV infected cells express B5 on the surface This expression can be detected within 4 hours of infection, and is at high levels by 8-

IO hours (infected MFI 500 vs uninfected MFI 16, Fig I 6 A)

Adherent cells were infected with VACV and examined for susceptibility to antibody directed complement lysis at time points after infection when virus expression Of B 5 protein led to an accumulation of B 5 on the surface of infected cells (8- 12 hrs) Treatment with antibody or complement alone had no effect on infected cells (Fig 16 B, C) In stark contrast, addition of anti-B5 mAb B 126 with complement resulted in rapid and complete killing of infected cells (P < 00001 Fig I 5 E, Fig 16 F) Treatment with a non-complement fixing anti-B 5 mAb (B96 murine IgGl) in the presence of complement did not direct cell lysis, again highlighting the importance of antibody isotype and complement fixation in this antiviral activity (P » 005, ns Fig 16 D, F) Similar data on in vitro direct complement-mediated lysis of VACV infected cells were obtained with human antibodies (Fig 17) In summary, human antibodies that had subclasses capable of fixing complement (IgGI and IgG3) proven to be effective in lysing infected cells These results provided further confirmation of the importance of complement in the protective mechanism of anti-B5 antibodies Antibody modifications leading to increased Fcγ complement fixation have been described (see, for example, Idusogie EE, Wong PY, Presta LG, et al Engineered antibodies with increased activity to recruit complement J Immunol 2001 , 166 2571 -5) Several studies have reported that CDC can be enhanced through improved C 1 q binding as a result of engineered Fc or hinge antibody regions (Dall'Acqua et al J lmmunoMl 1 129 (2006), Michaelsen et al Scand J lmmuno ,32 5 I7 (1990)8, Brekke et al MoI Immunol 30 1419 (1993) Scientists of Kyowa-Hacco Kogyo Co , Ltd have described an approach to generate highly potent CDC activity by creating unique chimeric Fcγ construct sharing domains of human IgGl and IgG3 isotypes (see, Natsume et al Cancer Res 68 3863 (2008) The data indicate that anti-B 5 antibodies with modifications enhancing complement fixation and CDC will have enhanced protective potency in vivo and therefore greater therapeutic value

Example 10

This example includes a description of in vivo protection data of human anti-B5 antibody, anti-H3 antibody, and a combination therapy with anti-B5 antibody and anti H3 antibody A combination of two mAbs specific to H3L and B5R were compared to individual mAbs and VIG for in vivo protection of mice, as described in Example 6 This study was done with fully human mAbs In brief, SCID mice were injected at Day -1 with lOOμg human anti-B 5 (C14), 200μg human anti-H3 (#67), a combination of both, or VIG ( 1 25 mg per mouse) Mice were infected at Day 0 with VACV MYBOH I V I XIO 4 PFU

Individual administration of human mAbs specific for H3L or B5R provided equivalent protection to VIG, measured by weight loss (Figure 18), clinical scores (pox formation, Figure 19A), time to disease

(Figure 19B), and survival (Figure 19C) Administration of human H3L and B5R mAbs in combination was superior to VIG or single mAb protection by all or almost all of the foregoing measurements (Figures 18 and 19) In particular, weight loss was subtantially ameliorated by the combination therapy (P < 00001 VIG vs combination therapy) and survival time was extended by 13 days over VIG and 26 days over no treatment, both of which were statistically significant This was also reflected in the measurement of disease free mice (weight loss less than 5%, and no pox) (P < 00109 VIG vs combination therapy and P < 0 0006 PBS vs combination therapy ) A related clinical measure was observation of pox formation, which again was most delayed by the mAb combination therapy (P < 00007 PBS vs combination therapy )

Example Il

This example includes a descπption of m vivo protection data of combination therapy with anti- B5 antibody and VIG Using an intranasal VACV WR challenge model, fully human mAbs can be used to supplement VIG In brief, mice were injected at Day -1 with 600 μg human VIG or 600 μg human VIG supplemented with 0 5 μg human anti B5 mAb (C 12), or 600 μg human VIG supplemented with 5 0 μg human anti-B 5 mAb (C12), or PBS Mice were infected at Day 0 with VACVwr i n (5 xlO 4 PFU)

Mice treated with VIG supplemented with 0 5 or 5 0 μg human anti-B 5 mAb (C12) exhibited better heath than mice provided VIG alone (Figure 20) Body weight was tracked as the measure of clinical illness Mean weight loss at nadir were 73% for VIG B, 76% for VIG B + 0 5μg anti B 5 , and 91% for VIG B + 5 μg anti-B 5

Supplementing VIG with anti-B5 human monoclonal antibody (Mab) had a significant benefit protecting mice The data therefore indicate that monoclonal antibodies can be used to supplement VIG and provide therapeutic enhancement