Technical field

The present invention relates to a method for obtaining an aptamer or a library of aptamers capable of binding to a target, comprising the steps of generating a library of candidate aptamers of various sizes, incubating the candidate aptamers with the target and selecting the candidate aptamers that bind to the target. The present invention also relates to a kit for selection of a DNA or RNA aptamer. Further, the present invention relates to a method of diagnosing or treating a disorder or disease by generating and selecting aptamers against a target that characterizes the disease or disorder. The present invention also relates to a method of detecting the presence or absence of a target in a sample.

Background

Aptamers are attractive alternatives to natural antibodies due to their superior stability and comparable binding performance. Further, aptamers can be produced to virtually any target and exhibit no or decreased immunogenicity compared to antibodies. In vitro selection or systematic evolution ligand exponential enrichment (SELEX) has allowed scientists to screen highly heterogeneous libraries of random DNA sequences against molecular targets for functional binding. The technique relies on repeated rounds of partitioning to separate DNA-target complexes from unbound sequences, PCR amplification of the bound DNA and regeneration of the PCR product back into ssDNA. Over a period of several rounds of selection, the number of unique sequences within the library, which can be more than 10 ¹⁴ unique sequences, is typically reduced down to 10 ³ sequences, resulting in an enriched library. Upon sequencing, a binding motif is identified leading to candidate sequences being resynthesized and screened to assess their binding kinetics.

Although SELEX has been established as routine technique for the screening of aptamers, there are still a number of challenges associated with the procedure. For instance, in vitro selection can be both resource and labour intensive often requiring several weeks for the selection. The repeated use of PCR amplification of highly heterogeneous samples can result in PCR bias where a higher proportion of sequences are selected based on their ability to be amplified during PCR rather than their ability to bind to the target. This in turn leads to an increase in probability of false positive candidates being selected and leading thereby to the loss of other sequences with excellent binding properties. Certain targets have proven to be difficult to select good aptamers against such as hydrophobic proteins, small molecules and whole cells. DNA libraries for SELEX are synthesized using solid-phase synthesis with fixed length random regions of 30-60 nucleotides, flanked by constant regions at both the 5 ^' and 3 ^' ends to facilitate PCR amplification. This means that screening is primarily based on the diversity of sequences in a library and their corresponding 3D folding conformations. This in turn means that candidate sequences require additional modifications such as truncation of the constant regions and other post-SELEX modifications and hence their binding properties may not accurately reflect the true binding properties of sequences selected during partitioning. This is especially true where binding motifs appear in the middle of a random DNA sequence in the library. As such, any post-SELEX modification of aptamer sequences can adversely affect their binding properties and lead to the false positive results. Therefore it would be highly desirable to screen target binding aptamers based on both the size of the sequence and their sequences.

Although researchers have used SELEX for the last 2-3 decades, the development of aptamers still remains convoluted, expensive and time consuming and prone to failure. Hence, there is a need for an aptamer selection method that on the one hand allows a time and cost efficient way to select aptamers, and that on the other hand reduces or abolishes errors and biases associated with conventional methods such as SELEX.

Summary

The present inventors have developed a new and unique aptamer selection method which allows for the generation of candidate aptamers and the selection of target binding aptamers therefrom, which advantageously can be performed in a one-round procedure. Advantageously, this method can be used as a screening method to identify aptamers with high specificity for their target. The method takes advantage of the use of variable strand size (vs) polynucleotide libraries formed by a terminal deoxynucleotidyl transferase (TdT) catalyzed enzymatic reaction, thereby generating libraries of candidate aptamers which can be used to screen for target binding sequences in terms of both the size and specific sequence of the candidate aptamer. This simplified methodology reduces the possibility of PCR bias as associated with conventional SELEX-methods, and can at the same time be used for rational design and tailor-made approaches to specific targets.

Therefore, a main aspect of the present invention relates to a method for obtaining an aptamer capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target.

An alternative aspect of the present invention relates to a method for obtaining an aptamer, preferably a DNA aptamer, capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target.

A further aspect of the present invention relates to a method for obtaining a library of aptamers capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the library of candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more libraries of aptamers capable of binding to the target, iv. Optionally, recovering the library of aptamers that binds to the target.

An alternative aspect of the present invention relates to a method for obtaining a library of aptamers, preferably a library of DNA aptamers, capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers, by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the library of candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more libraries of aptamers capable of binding to the target, iv. Optionally, recovering the library of aptamers that binds to the target.

A further aspect of the present invention relates to a kit for selection of a DNA or RNA aptamer, the kit comprising a. a pre-manufactured DNA or RNA library or a DNA or RNA library comprising aptamers as defined in the present disclosure; or b. the reagents to produce a DNA or RNA library or a DNA or RNA library comprising aptamers as defined in the present disclosure, said reagents comprising at least terminal deoxynucleotidyl transferase (TdT), an initiator oligonucleotide and dNTPs.

An alternative aspect of the present invention relates to a kit for selection of an aptamer, preferably a DNA aptamer, the kit comprising a. a pre-manufactured aptamer library, preferably a DNA library, or a library comprising aptamers as obtained by the following steps: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target; or b. the reagents to produce a DNA or RNA library or a DNA or RNA library comprising aptamers as defined in any one of the preceding claims, said reagents comprising at least terminal deoxynucleotidyl transferase (TdT), an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs,.

A further aspect of the present invention relates to a method of diagnosing a disorder or a disease in an individual suspected of suffering of said disorder or disease, wherein the disorder or the disease is characterised by a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Detecting the target in a biological sample obtained from the individual by incubating the sample with the recovered aptamers, wherein if the target is detected the individual is diagnosed as suffering from the disease or disorder, and wherein if the target is not detected the individual is classified as not suffering from the disease or disorder.

A further aspect of the present invention relates to a method of treating a disorder or disease in an individual in need thereof, wherein the disease or disorder is characterised by the presence of a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Administering an effective amount of the recovered aptamers to the individual, thereby treating the disorder or disease in an individual in need thereof.

A further aspect of the present invention relates to a method of detecting a target in a sample suspected of comprising the target, comprising the steps of: i. Generating a candidate aptamer or a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target. v. Contacting an effective amount of the recovered aptamers with the sample, vi. Determining if aptamers bind to the target in the sample, vii. Optionally, isolating aptamers from step vi, thereby detecting the presence of a target in a sample.

In yet another aspect, the present invention relates to the use of a composition comprising a library of candidate aptamers for the selection of aptamers for the detection of a target associated with a disorder or disease, where the library is obtained by the methods described herein. In yet another aspect, the present invention relates to the use of a composition comprising a library of candidate aptamers for the selection of aptamers for the treatment of a disorder or disease, where the library is obtained by the methods described herein.

In yet another aspect, the present invention relates to a library of aptamers obtainable by the method of the present invention.

Description of Drawings

Figure 1: Overview of the size dependent single round selection of protein binding aptamers using vsDNA libraries.

(A) TdT catalysed synthesis of a random ssDNA library in the absence of the target; the established random ssDNA library is subsequently incubated with the target;

(B) partitioning of protein bound DNA sequences from unbound DNA sequences;

(C) TdT catalysed tailing reaction to incorporate a poly A tail and qPCR amplification to form a dsDNA;

(D) next generation sequencing (NGS) to elucidate the sequences of the candidate aptamer sequences.

Figure 2: Random vsDNA libraries visualized on agarose gels

(A) A 5% denaturing gel showing vsDNA libraries formed during different reaction times next to a ssDNA ladder, demonstrating that the size distributions of the resultant libraries correlate well with the time of reaction.

(B) EMSA of each library incubated without target (-) or with (+) 500 nM thrombin protein target. Libraries incubated with thrombin form clear DNA:thrombin complexes correlating in intensity with the time of reaction used during library formation, being well separated from unbound sequences.

(C) A 5% denaturing gel showing vsDNA libraries formed from different reaction times, next to a ssDNA ladder.

(D) EMSA of each library incubated without target (-) or with (+) human lactoferrin (LF) protein target. Libraries incubated with lactoferrin form clear DNA: lactoferrin complexes correlating in intensity with the time of reaction used during library formation. Multiple complex bands correspond to multiple dimers in the protein.

Arrow head: excess unreacted initiator sequence, arrow: aptamertarget complex. Figure 3: Tailored vsDNA libraries

(A) EMSA (5% native acrylamide gel) of tailored vsDNA libraries formed with different nucleotide mixtures (TAGC vs. AC vs. TG) showing that a DNA:thrombin complex is only formed in the libraries utilizing TAGC or TG-nucleotide mixes. Arrow: aptamertarget complex.

(B) A 5% denaturing gel showing vsDNA libraries formed during 1h with cobalt ions present in the reaction mixture, next to a ssDNA ladder, demonstrating that libraries with large size distribution are formed within a short reaction time.

(C) EMSA (5% native acrylamide gel) of tailored vsDNA libraries formed with different nucleotide mixtures (TAGC vs. AC vs. TG) showing that DNA:thrombin complexes are formed.

Figure 4: Amplification of vsDNA libraries

2% Agarose Gels showing the amplification of vsDNA libraries. (A) Effect of annealing temperature on the formation of PCR products and (B) effect of the template (or target) concentration.

Figure 5: Bioinformatic analysis of DNA libraries and binding affinity studies

NGS data; MEME analysis of sequenced thrombin aptamers (A) and lactoferrin (B) aptamers.

Figure 6: Bioinformatic analysis of DNA libraries - Size distributions of random regions for sequenced thrombin (TH) aptamers (A) and of random regions for sequenced lactoferrin (LF) aptamers (B).

Figure 7 A-G: SPR Analysis of thrombin binding aptamer sequences for (A) TH01, (B) TH05, (C) TH 10T, (D) TH07 and (E) TH01T; (F) Kinetic parameters of thrombin binding sequences using the 1:1 binding model and (G) 2:1 binding model of TH10T.

Figure 7 H-L: SPR Analysis of lactoferrin binding aptamer sequences for the truncated sequences of the lead candidates LF02T (H), LF03T (I) and LF04T (J).

(K) Kinetic parameters of lactoferrin binding sequences using the 1:1 binding model. LF02T and LF04T were also fitted using a 2:1 model (L). Figure 7 M-N: SPC Specificity testing

(M) Kinetic parameters of thrombin binding. SPR Analysis of TH10T sequences for Haemoglobin, Fibrinogen and HSA.

(N) Kinetic parameters of HSA binding.

Figure 8: One step formation of molecularly imprinted aptamers

(A) Denaturing gel showing the relative sizes of the formed MIA (molecularly imprinted aptamers) and NIAs (non-imprinted aptamers); (B) 5% EMSA of lactoferrin bound MIA and NIAs.

Figure 9: MIA optimization experiments according to condition 3

(A) Denaturing gel of MIA and NIA for 3a and 3b synthesized using TdT; (B) EMSA of MIA and NIAs for 3a and (C) EMSA of MIA and NIAs for 3b.

Figure 10: MIA optimization experiments according to condition 4

(A) Denaturing gel of MIA and NIA for 4a and 4b synthesized using TdT; (B) EMSA of MIA and NIAs for 4a and (C) EMSA of MIA and NIAs for 4b.

Figure 11: MIA optimization experiments according to condition 5

(A) Denaturing gel of MIA and NIA synthesized for 5a and 5b using TdT; (B) EMSA of MIA and NIAs for 5a and (C) EMSA of MIA and NIAs for 5b.

Figure 12: SPR binding analysis of MIAs

(A) SPR sensorgrams showing the relative response of human lactoferrin towards Immobilized MIAs (NIA subtracted); (B) the maximum absolute SPR responses of human lactoferrin towards MIAs and NIAs.

Figure 13: EMSA of MIAs and NIAs

EMSA (5%) of MIAs (A) and NIAs (B) towards human lactoferrin using the optimized imprinting conditions and (C) specificity of MIAs and NIAs towards human lactoferrin (LF), trypsin (Ty) and human serum albumin (HSA).

Figure 14: Analysis of MIA size distribution

Analysis of size distribution of sequenced MIA aptamers showing broad size distribution. Figure 15: Selectivity of MIAs for human vs. bovine lactoferrin.

Binding affinity studies of the individual LF candidate sequence MIA 4T towards human lactoferrin (A) and bovine lactoferrin (B) using surface plasmon resonance.

Figure 16: DPVs for different concentration of lactoferrin

(A) DPVs for different concentration of lactoferrin in 0.1 M acetate buffer solution (pH 4.5). From bottom to top, the concentration are 0, 10, 20, 30, 40, 50, 75, 100, 150, 200, 470, 700, 900, 1300 ng/mL, respectively. (B) Plot of peak current as a function of lactoferrin concentration. (C) and (D) Calibration curves of lactoferrin in 0.1 M acetate buffer solution (pH 4.5)

Figure 17: DPVs for different concentration of lactoferrin in artificial urine solution

DPVs for different concentration of lactoferrin in artificial urine solution: acetate buffersolution (1:9). From bottom to top, the concentration are 0, 10, 20, 40, 100, 150, 200 ng/mL, respectively. (B) Calibration curve of lactoferrin in artificial urine solution: acetate buffer solution (1:9).

Detailed description

As used herein, the singular forms “a”, “an” and “the” include plural referents unless the context clearly states otherwise. Thus, for example, reference to “an aptamer” includes a plurality of such aptamers, such as one or more aptamers, at least one aptamer, or two or more aptamers.

As used herein, standard abbreviations are used for nucleobases and their respective nucleotides, namely adenine (A), cytosine (C), guanine (G), thymine (T), and uracil (U). Nucleotides may be deoxyribonucleotides (dNTPs) or ribonucleotides (rNTPs).

Throughout the description of the present invention, an aptamer can be understood as a library of aptamers. In other words, an aptamer can refer to a plurality of aptamers, such as one or more aptamers, such as at least two aptamers, such as a library of aptamers. A library of aptamers is to be construed as a library comprising a plurality of aptamers, such as one or more aptamers, such as at least two aptamers. As used herein, the term “target”, which might be referred to as “template”, is to be understood as the entity to which aptamers bind. This can be, but is not limited to, an ion, an atom, a molecule, a nucleic acid, a polynucleotide, a peptide, a polypeptide, a protein, a carbohydrate, a lipid an organelle, a cell or a virus. As such, in the context of aptamer binding, the terms “target” and “template” may interchangeable. In some cases, the term “target” may be preferably used in the context of non-imprinted aptamers (as, for example, the aptamers described in Example 2, or NIAs in Example 3), such as to emphasize the targeting function of the aptamer. In other cases, the term “template” may be preferably used in the context of molecularly imprinted aptamers (as for example the MIAs in Example 3), such emphasizing that the template has certain modelling function for the aptamer. Binding of an aptamer to a target is, for example, influenced by the 3D structural confirmation of the aptamer in relation to the target, thereby allowing electrostatic interaction between aptamer and target and resulting in the formation of an aptamertarget complex.

In the context of PCR reactions, for example involving DNA polymerase reactions, the term “template” is used as commonly understood be the person skilled in the art, i.e. a nucleotide sequence that a primer sequence binds to, and which serves as an template for the polymerase reaction.

The present inventors have developed a new and unique aptamer selection method which allows for the generation of candidate aptamers and the selection of target binding aptamers therefrom, which can advantageously be performed in a one-round procedure. The method takes advantage of the use of variable strand size (vs) polynucleotide libraries formed by a terminal deoxynucleotidyl transferase (TdT) catalyzed enzymatic reaction, thereby generating libraries of candidate aptamers which can be used to screen for target binding sequences in terms of both the size and specific sequence of the candidate aptamer. This simplified methodology reduces the possibility of PCR bias as associated with conventional SELEX-methods, and can at the same time be used for rational design and tailor-made approaches to specific targets. The person skilled in the art will appreciate that the methods can be performed by applying the steps of the invention in one round, thereby obtaining candidate aptamers without having to perform several selection rounds. This streamlined methodology offers a time- and cost-efficient approach, and does at the same time eliminate a potential bias, which might be introduced by a selection procedure over several rounds. However, if needed or desired the method of the present invention can be used in several rounds.

A main aspect of the present invention relates to a method for obtaining an aptamer capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target.

An alternative aspect of the present invention relates to a method for obtaining an aptamer, preferably a DNA aptamer, capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target.

A further aspect of the present invention relates to a method for obtaining a library of aptamers capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the library of candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more libraries of aptamers capable of binding to the target, iv. Optionally, recovering the library of aptamers that binds to the target.

An alternative aspect of the present invention relates to a method for obtaining a library of aptamers, preferably a library of DNA aptamers, capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers, by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the library of candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more libraries of aptamers capable of binding to the target, iv. Optionally, recovering the library of aptamers that binds to the target.

As used herein, “library” refers to a multitude of polynucleotides which are formed by a TdT-catalysed synthesis. TdT catalyses the synthesis of a random ssDNA or ssRNA library, depending on the nucleotides in the reaction mixture. This reaction results in a polynucleotide library with molecules of different lengths, which can be referred to as a variable size DNA (vsDNA) library or variable size RNA (vsRNA) library. As the oligonucleotides are aimed to be used as aptamers, the variable size library can be referred to as a variable size candidate aptamer library. Furthermore, specific subgroups of variable size candidate aptamer libraries can be generated by the methods of the present invention. The method for obtaining an aptamer capable of binding to a target might be performed by first generating a library of candidate aptamers, which are subsequently contacted with the target, or by letting the library form around the target in one step. The latter option allows the instant formation of a complex of aptamer and target. If the target is a molecule, this process can be understood as the formation of molecular imprinted aptamers (MIAs), a subgroup of a variable size candidate aptamer library, in contrast to non-imprinted aptamers (NIAs) which are generated without the presence of a target molecule and represent another subgroup of a variable size candidate aptamer library. In this sense, the term “NIAs” is or may be equivalent to a “variable size (vs) aptamer library” as used herein, both being formed in the absence of a target. However, the subgroups MIAs and NIAs might be formed under different conditions compared to the formation of a general variable size candidate aptamer library. For example, MIAs and NIAs might be formed in the presence of a lower initiator (forward primer) concentration compared to the formation of a variable size candidate aptamer library, thereby avoiding an excess of the initiator. In the case of MIAs, this increases the number of aptamers binding to the target, thereby enabling the formation of aptamers with increased binding affinity.

Aptamers

The term "aptamer" as used herein refers to a single-stranded oligonucleotide (single- stranded DNA or RNA molecule) that can bind specifically to its target with high affinity. This is achieved by intramolecular folding of the single-stranded aptamer, thereby exhibiting a 3D-dimensional structure that binds to the target. The aptamer can be used as a biosensor element capable of binding to a molecule in a detection/analysis system, and thus has been recognized as a substitutive for antibody. Likewise, aptamers might be used for therapeutic purposes, for example by binding to binding sites and eliciting inhibitory or stimulatory effects. Particularly, aptamers can be used as molecules targeting various organic and inorganic materials, including toxins, unlike antibodies, and once an aptamer binding specifically to a certain material is isolated, it can be consistently reproduced at low costs using automated oligomer synthesis methods. Aptamers can be selected to a wide range of targets, for example, and not limiting to, ions, small molecules, proteins, viruses, bacteria, organelles and cells. Aptamers can typically be produced to virtually any target, they are not dependent on the immunogenicity of the target, they can be chemically synthesized with low batch-to- batch variation, they withstand denaturing in ambient conditions and they do not trigger an intrinsic immune response. An aptamer may, within the context of this disclosure and especially in the experimental part, also be referred to as sequence, single- stranded DNA fragments, polynucleotide aptamer sequence or polynucleotide, or similar.

As used herein, the term "small molecule" is used to refer to molecules, whether naturally-occurring or artificially created (e.g. via chemical synthesis), that have a relatively low molecular weight. Typically, small molecules are monomeric and have a molecular weight of less than about 1500 g/mol. Small molecules may be biologically active in that they produce a local or systemic effect in animals, for example mammals, for example humans. Small molecule may be used as a drug.

The generation of a library of candidate aptamers by a terminal deoxynucleotidyl transferase (TdT) catalyzed enzymatic reaction results in the formation of aptamers with a different length and sequence. The person skilled in the art may use the term variable size (vs) polynucleotide library to describe a library of candidate aptamers. Dependent on the nucleotides used in the reaction mixture, this can be a vsDNA library, in the case of deoxyribonucleotides (dNTPs) (more specifically deoxyribonucleotide triphosphates in the reaction mixture), or this can be a vsRNA library, in the case of ribonucleotides (rNTPs, sometimes only referred to as NTPs) (more specifically ribonucleotide triphosphates in the reaction mixture). The candidate aptamers may therefore be DNA aptamers or RNA aptamers.

The TdT enzyme does not require the presence of a template, meaning for example a nucleotide template strand, but can synthesise a nucleic acid sequence as long as it is provided with the necessary reagents, such as nucleotides, a suitable buffer, and an initiator oligonucleotide. This property is different from other polymerases, for example DNA polymerase I, which needs a template, such as a template which DNA polymerase I reads and which is antisense to the growing nucleotide strand which DNA polymerase I synthesizes.

In some embodiments the aptamers generated and selected by the method are DNA aptamers. In some embodiments the aptamers generated and selected by the method are RNA aptamers. Preferably, the aptamers are DNA aptamers.

As shown herein, TdT can produce DNA aptamers of variable size, and the length of the aptamers produced with the herein disclosed invention correlates with the time the TdT reaction is allowed to occur (see for example Figure 2A). The herein included examples show the production of DNA aptamers of a size of up to 200 nucleotides. However, if the reaction is allowed to occur for a longer time, DNA aptamers of a size of up to 2000 nucleotides or longer are possible to produce. The person skilled in the art will appreciate that, for a large scale production of aptamers, the enzymatic TdT reaction is not the limiting step. Rather, this may be the large scale production of single-stranded DNA fragments (aptamers), i.e. DNA Solid phase synthesis of recombinant DNA, once specific aptamer sequences have been identified by the methods disclosed herein. The methods disclosed herein offer a streamlined protocol to produce a library of aptamers which then can be tested for their performance, e.g. specificity to a target. The identified aptamers can then be amplified, sequenced and produced (e.g. in large scale), e.g. using a single-stranded DNA fragment production service. It is this production of single-stranded DNA fragments which decides maximal length of aptamers possible to produce to date. For example, Integrated DNA Technology’s (IDT’s) Megamer® platform is able to produce single-stranded DNA fragments which are sequence-verified, single-stranded DNA strands of up to 2000 bases. However, this technology is evolving, and even longer single-stranded DNA strands may be producible in the future.

The person skilled in the art may use the selected aptamers directly, or may further amplify and/or analyse the aptamers. The selected aptamers may also be used in further rounds of selection, as described in more detail below.

In some embodiments, the method of generating a library of candidate aptamers and selecting aptamers binding to the target comprises further a step of polyadenylating the aptamers capable of binding to the target, and amplifying the polyadenylated aptamers, thereby obtaining amplified, polyadenylated aptamers.

Polyadenylation encompasses the addition of adenine nucleotides to the aptamer, commonly referred to in the art as a poly-A tail. The person skilled in the art will understand that any tail of a known sequence can be used, for example but not limiting, to a poly-T or a poly-G or a poly-C or a poly-U tail, and that a primer complementary and thereby hybridizing with this tail can be used.

In some embodiments, the method of generating a library of candidate aptamers and selecting aptamers binding to the target comprises further a step of introducing a tail of a known sequence to the aptamers capable of binding to the target, and amplifying the tailed aptamers, thereby obtaining amplified, tailed aptamers.

Generation of a library of candidate aptamers

The present invention takes advantage of the unique properties of deoxynucleotidyl transferase (TdT) which, dependent on the ingredients provided in the reaction mixture, incorporates nucleotides randomly, but also with different reaction kinetics for different nucleotides. This results in the formation of variable size polynucleotides.

In some embodiments, the size distribution of the candidate aptamer library is between 20 to 400 nucleotides. In some embodiments, the size distribution of the candidate aptamer library is between 20 to 400 nucleotides, for example 20 to 100 nucleotides, for example 20 to 200 nucleotides, for example 20 to 300 nucleotides, for example 20 to 400 nucleotides.

The person skilled in the art will be acquainted with the necessary reaction requirements for TdT-enzymatic reactions, and the variety of ingredients that could be used. Whilst no DNA or RNA template is required for TdT-reactions in the present method, the person skilled in the art knows that an initiator oligonucleotide is needed for TdT-polymerisation, and that this nucleotide can be produced by standard methods in the field. In fact, the initiator oligonucleotide is identical to a forward primer in the present invention. While the initiator oligonucleotide is used in the candidate aptamer library formation step to allow TdT-polymerisation, the same oligonucleotide can be employed as primer for amplifying a selected aptamer in a PCR based step.

In some embodiments, the initiator oligonucleotide in a reaction mixture to generate a library of candidate aptamers, or the forward primer to amplify a selected aptamer, is 3 to 25 nucleotides long, for example 4 nucleotides long, or 5 nucleotides long, or 6 nucleotides long, or 7 nucleotides long, or 8 nucleotides long, or 9 nucleotides long, or 10 nucleotides long, or 11 nucleotides long, or 12 nucleotides long, or 13 nucleotides long, or 14 nucleotides long, or 15 nucleotides long, or 16 nucleotides long, or 17 nucleotides long, or 18 nucleotides long, or 19 nucleotides long, or 20 nucleotides long, or 21 nucleotides long, or 22 nucleotides long, or 23 nucleotides long, or 24 nucleotides long, or 25 nucleotides long.

Methods for producing oligonucleotides to be used as primers are well known in the art. Programs are available for optimizing primer/oligonucleotide properties for desired applications, designing primers/ oligonucleotides by parameters such as Gibb’s free energy for self-dimerization, homodimerization, heterodimerization, melting point range and GC content into account. In the field of primer design, the delta G value (Gibbs Free Energy G) is used to predict primer performance. In general terms, the delta G value is the measure of the amount of work that can be extracted from a process operating at a constant pressure. In the field of molecular chemistry it is the measure of the spontaneity of the reaction. The stability of hairpin is commonly represented by its delta G value, the energy required to break the secondary structure. Larger negative value for delta G indicates stable, undesirable hairpins. Therefore, in some embodiments primers/oligonucleotides are used which have delta G values above thresholds defined in the art. The person skilled in the art will know which thresholds to apply for the desired outcome.

In some embodiments, the initiator oligonucleotide in a reaction mixture to generate a library of candidate aptamers, or the forward primer to amplify a selected aptamer, is characterized by: a. a delta G for hairpin folding of >-2 and/or b. a delta G of homodimerization of >-7 and/or c. a delta G of heterodimerization of >- 5 and/or d. a melting point within plus/minus 5 degrees Celsius.

In some embodiments, the initiator oligonucleotide in a reaction mixture to generate a library of candidate aptamers, or the forward primer to amplify a selected aptamer, has a sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 1 , or a homologue thereof having at least 80% identity thereto, such as at least 85%, at least 90% or at least 95% identity thereto.

Homology (sometimes referred to as "identity" and "similarity" ") with respect to a nucleic acid is defined herein as the percentage of nucleic acid in the candidate sequence that is identical with the residues of a corresponding nucleic acid, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent identity / similarity, and considering any conservative substitutions according the NC-IUB rules (hftp://www.chem. qmul.ac.uk/iubmb/misc/naseq.html; NC-IUB, Eur J Biochem (1985) 150: 1-5) as part of the sequence identity. Methods and programs of assessing protein or nucleic acid sequence homology are well known in the art.

As the present invention shows, a variable size (vs) library allows screening for aptamers both on sequence and on size. The person skilled in the art will appreciate that the size distribution of the vs library determines the variation in aptamers that are produced during the library formation step. This size distribution can be affected or controlled by, for example, the duration of the incubation time, the ratio of the initiator to the nucleotide concentrations, the presence or absence of different divalent catalyst metal ions such as cobalt or magnesium or zinc or manganese ions, or the composition of the nucleotides provided in the reaction.

The person skilled in the art will appreciate that the size distribution of the vs library can in theory be infinite, depending on the reaction environment and the reaction time. Further, size distribution, or variable size distribution in relation to the vs library, means that the library comprises aptamers with nucleotide sequences with a maximum length depending on the reaction time, for example sequences up to 400 nucleotides, but also shorter ones. Conclusively, the vs library can contain aptamers with sequences of different length, representing the whole spectrum of aptamer lengths. The minimal aptamer length is defined by the initiator sequence, which is incorporated into each aptamer, and which is then elongated by the addition of nucleotides.

The person skilled in the art will be able to select suitable initiator sequences. For example, the initiator sequence may be 3 to 25 nucleotides long, for example 3 nucleotides, for example 5 nucleotides, for example 10 nucleotides, for example 15 nucleotides, for example 20 nucleotides or for example 25 nucleotides. However, longer initiator sequences may be used. The minimum size of the random region of the aptamer (the part generated by the TdT enzyme) may vary. For example, the random region may have a minimum size of 20 nucleotides. The total size of the aptamer is the sum of initiator sequence and the random, TdT generated sequence. As disclosed in the Examples, the initiator sequence may be retained in the final aptamer. Alternatively, the initiator sequence may not be retained in the final aptamer (referred to as truncated version in the Examples). In some cases, the initiator sequence may contribute to the specific binding of the aptamer to the target. In other cases, the initiator sequence hampers binding to the target, and it is as such beneficial to remove it. This can be done as known in the art.

The maximum sequence is defined by the reaction conditions and reaction time. In some embodiments, the maximum length of the aptamer is 100 nucleotides. In some embodiments, the maximum length of the aptamer is 200 nucleotides. In some embodiments, the maximum length of the aptamer is 400 nucleotides. In some embodiments, the maximum length of the aptamer is 2000 nucleotides. In some embodiments, aptamer can be larger than 2000 nucleotides. Aptamers of any length between the minimum and the maximum length can be part of the library produced with the method of the invention.

Consequently, the length of the resulting aptamers can exceed 400 nucleotides. The minimum library size depends also on the length of the constant initiator sequence. There is no limit on the longest sequence of aptamers possible using the method of the present invention, since the length of the aptamer depends on the reaction time and availability of reactants.

The person skilled in the art will appreciate the advantage of the method of the present invention enabling the production of aptamers with a length of up to, and more than, 400 nucleotides. Aptamers produced by conventional techniques, such as SELEX, are known to have a length of less than 100 nucleotides due to the limitations in the existing SELEX technology which allows the production of aptamers up to around 80 nucleotides in length. The size of the aptamer is limited to the size of the random region in the SELEX DNA libraries.

In some embodiments, the step of generating a library of candidate aptamers is performed for 30 to 120 minutes, such as for 30 minutes, such as for 60 minutes, such as for 90 minutes, such as for 120 minutes.

In some embodiments, the step of generating a library of candidate aptamers is performed for at least 30 minutes, such as for 30 minutes, such as for 60 minutes, such as for 90 minutes, such as for 120 minutes, such as for 150 minutes, such as for 180 minutes, such as for 210 minutes, such as for 240 minutes.

The efficiency and outcome of the generation of a library of candidate aptamers might be influenced by the temperature at which the reaction takes place.

In some embodiments, the generation of a library of candidate aptamers is performed at a temperature between 4°C to 75°C, such as at 4°C, such as at 5°C, such as at 10°C, such as at 15°C, such as at 20°C, such as at 25°C, such as at 30°C, such as at 35°C, such as at 40°C, such as at 45°C, such as at 50°C, such as at 55°C, such as at 60°C, such as at 65°C, such as at 70°C, such as at 75°C.

In some embodiments, the generation of a library of candidate aptamers is performed at a temperature between 30°C to 45°C. In some embodiments, the generation of a library of candidate aptamers is performed at room temperature. In some embodiments, the generation of a library of candidate aptamers is performed at 37°C. In some embodiments, the generation of a library of candidate aptamers is performed at 45°C.

In some embodiments, the size distribution of the library of candidate aptamers is between 3 to 400 nucleotides, such as 3 to 50 nucleotides, such as 3 to 100 nucleotides, such as 3 to 200 nucleotides, such as 3 to 300 nucleotides, such as 3 to 400 nucleotides.

In some embodiments, the size distribution of the library of candidate aptamers is between 3 to 400 nucleotides, such as 10 to 50 nucleotides, such as 50 to 100 nucleotides, such as 100 to 200 nucleotides, such as 100 to 300 nucleotides, such as 200 to 300 nucleotides, such as 200 to 400 nucleotides, such as 300 to 400 nucleotides.

In some embodiments, the aptamers of the library of candidate aptamers are at least 3 nucleotides long, such as at least 10 nucleotides and/or at least 50 nucleotides, and/or at least 100 nucleotides, and/or at least 200 nucleotides and/or at least 300 nucleotides, and or at least 400 nucleotides long.

In some embodiments, the size distribution of the aptamers, or the library of candidate aptamers, is between 10 and 400 nucleotides, such as 10 to 50 nucleotides, such as 10 to 100 nucleotides, such as 10 to 200 nucleotides, such as 10 to 300 nucleotides.

In some embodiments, the size distribution of the aptamers, or the library of candidate aptamers, is between 10 and 400 nucleotides, such as 10 to 50 nucleotides, such as 50 to 100 nucleotides, such as 100 to 200 nucleotides, such as 100 to 300 nucleotides, such as 200 to 300 nucleotides, such as 200 to 400 nucleotides, such as 300 to 400 nucleotides. In some embodiments, the aptamers of the library of candidate aptamers are at least 10 nucleotides long, such as at least 50 nucleotides, and/or at least 100 nucleotides, and/or at least 200 nucleotides and/or at least 300 nucleotides, and/or at least 400 nucleotides long.

In some embodiments, the aptamers of the library of candidate aptamers are at least, or up to, 2000 nucleotides long.

The person skilled in the art will appreciate that tailoring the aptamers of the library of candidate aptamers enables the production of aptamers with specific properties. This tailoring can, for example, encompass the size distribution of the aptamers in the library of candidate aptamers or the nucleotide composition of the library.

Depending on the usage of the aptamers, libraries of candidate aptamers of a certain size distribution, or aptamers of a certain length, might be preferred. The reaction kinetics of the library formation step may be influenced by the presence of divalent ions. These divalent metal ions can act as a catalyst and influence the reaction kinetics. Divalent ions used in the reaction mixture can be magnesium ions and/or cobalt ions and/or manganese ions and/or zinc ions, or any combination of these. Without being bound by theory, in some cases cobalt ions, or manganese ions, or zinc ions, in the reaction mixture might be used instead of e.g. magnesium ions, to increase the reaction kinetics, which could be used to produce vs libraries with aptamers larger than 400 nucleotides. If aptamers shorter than 400 nucleotides are preferred, magnesium ions in the reaction mixture can be used to slow down the reaction kinetics comparing to when cobalt is used. While vs aptamer library formation is possible with different divalent ions, certain ions might be selected depending on the desired outcome. For example, cobalt divalent ions in the reaction mixture may be used to favour the incorporation of CTP and TTP over ATP and GTP, while magnesium divalent ions in the reaction mixture may be used to favour the incorporation of ATP and GTP over CTP and TTP.

In some embodiments, aptamers smaller than 400 nucleotides are preferred. In some embodiments, aptamers up to 400 nucleotides and larger are preferred. In some embodiments, the reaction mixture for the library formation comprises magnesium ions. In some embodiments, the reaction mixture for the library formation comprises cobalt ions. In some embodiments, the reaction mixture for the library formation comprises cobalt and magnesium ions. In some embodiments, the reaction mixture for the library formation comprises cobalt and manganese ions. In some embodiments, the reaction mixture for the library formation comprises cobalt and zinc ions.

A further advantage of the present invention is the possibility to tailor the library of candidate aptamers, for example by the duration of the library forming reaction and the presence of divalent ions as described above. Further, different mixtures of nucleotides can be used in the reaction mixture, thereby both influencing the reaction kinetics and the outcome of the incorporated nucleotides in the candidate aptamers. Further, the selection of deoxyribonucleotides (dNTPs) or ribonucleotides (rNTPs) will lead to the formation of DNA aptamers or RNA aptamers, respectively.

In some embodiments, the nucleotides in the reaction mixture are dNTPs.

In some embodiments, the nucleotides in the reaction mixture are a mixture of dATP, dTTP, dGTP and dCTP.

In some embodiments, the nucleotides in the reaction mixture are dNTPs of one kind only, selected from the group consisting of dATP, dTTP, dGTP and dCTP, for example only dATP or only dTTP or only dGTP or only dCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of dATP and dTTP, or of dATP and dGTP, or of dATP and dCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of dTTP and dGTP, or of dTTP and dCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of dGTP and dCTP nucleotides.

In some embodiments, the nucleotides in the reaction mixture are a mixture of three dNTPs which does not comprise one of dATP, dTTP, dCTP or dGTP, preferably the mixture does not comprise one of dATP, dGTP or dCTP. In some embodiments, the nucleotides in the reaction mixture are modified or non natural nucleotides such as 5-lndolyl-AA-dUTP.

In some embodiments, the nucleotides in the reaction mixture are rNTPs.

In some embodiments, the nucleotides in the reaction mixture are a mixture of rATP, rTTP, rGTP and rCTP.

In some embodiments, the nucleotides in the reaction mixture are rNTPs of one kind only, selected from the group consisting of rATP, rTTP, rGTP and rCTP, for example only rATP or only rTTP or only rGTP or only rCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of rATP and rTTP, or of rATP and rGTP, or of rATP and rCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of rTTP and rGTP, or of rTTP and rCTP.

In some embodiments, the nucleotides in the reaction mixture are a mixture of rGTP and rCTP nucleotides.

In some embodiments, the nucleotides in the reaction mixture are a mixture of three rNTPs which does not comprise one of rATP, rTTP, rCTP or rGTP, preferably the mixture does not comprise one of rATP, rGTP or rCTP.

In some embodiments, the nucleotides in the reaction mixture are modified or non natural nucleotides such as 5-lndolyl-AA-rUTP.

It is known by the person skilled in the art that the presence of G-quadruplex secondary structures, bulges, loops and other secondary structures formed in nucleic acids by sequences that are rich in guanine, may be beneficial for the binding of aptamers to a target. The person skilled in the art will appreciate that the methods of the present invention are particularly well suited for the production of aptamers with G-quadruplex secondary structures, bulges, loops and other secondary structures, since the aptamers can be tailored by the ratio of nucleotides in the reaction mixture, for example by using an excess of GTPs compared to other nucleotides, thereby leading to increased incorporation of GTPs and favouring the formation of e.g. G-quadruplexes.

The person skilled in the art will know a variety of buffers, which could be used in the present methods for obtaining an aptamer capable of binding to a target, such as for the polymerisation step of the library of candidate aptamers, the incubation of the library of candidate aptamers or the selection, recovery or amplification of aptamers. Suitable buffers provide for example a buffer range between pH 7 and pH 9.5. These buffers include, but are not limited to, Tris buffers, HEPES buffers or phosphate buffers. Other ingredients might be employed to support the formation of functional aptamers, such as KCI stabilizing G-Quadruplex structures or to influence the reaction kinetics, such as MgCI ₂ or C0CI2. It is understood that other ingredients known in the field of DNA or RNA polymerisation might be used in the reaction mixture.

In some embodiments, the buffer used in the method for obtaining an aptamer capable of binding to a target comprises 1 to 50 mM Tris-HCI, 1 to 50 mM KCI and 1-10 mM MgCI ₂ .

In some embodiments, the buffer used in the method for obtaining an aptamer capable of binding to a target has a pH buffer range between 7 and 9.5 and wherein the buffer contains KCI and MgCI ₂ .

In some embodiments, the buffer used for generating a library of candidate aptamers comprises 1 to 50 mM Tris-HCI, 1 to 50 mM KCI and 1-10 mM MgCI ₂ .

In some embodiments, the buffer used for aptamers selection comprises 1 to 50 mM Tris-HCI, 1 to 50 mM KCI and 1-10 mM MgCI ₂ .

In some embodiments, the buffer used in the method for obtaining an aptamer capable of binding to a target, and/or the buffer used for generating a library of candidate aptamers, and/or the buffer used for aptamers selection, comprises or consists of HEPES (4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid) buffer.

In some embodiments, the buffer used in the method for obtaining an aptamer capable of binding to a target, and/or the buffer used for generating a library of candidate aptamers, and/or the buffer used for aptamers selection, comprises phosphate buffered saline (PBS) buffer.

In some embodiments, the buffer used in the method for obtaining an aptamer capable of binding to a target, and/or the buffer used for generating a library of candidate aptamers, and/or the buffer used for aptamers selection, comprises phosphate buffers.

Aptamer-target interaction

Once the library of candidate aptamers has been generated, the aim is to identify the aptamers that bind to the target. The person skilled in the art will appreciate that a library of candidate aptamers allows the identification of one or more aptamers binding to a target, advantageously in a one-round selection procedure. These aptamers might bind to different binding sites on the target. Conclusively, the method allows for the formation of, for example, bivalent intramolecular protein binding aptamers. Furthermore, especially when the aptamer is long, one aptamer might bind to more than one binding site on the target. Furthermore, the formed aptamer might bind two or more different targets at the same time, thereby acting as a linker. Therefore, the formed aptamers might be intermolecular and/ or intramolecular multivalent aptamers.

In some embodiments, the method results in the formation of at least one aptamer binding to a target, preferably wherein the methods results in the formation of several aptamers binding to a target.

In some embodiments, the method results in the formation of an aptamer which binds to one or more binding sites on the target, such as to two binding sites, such as to three binding sites.

In some embodiments, the method results in the formation of an aptamer with bispecific interaction with a target.

In some embodiments, the method results in the formation of an aptamer with trispecific interaction with a target.

In some embodiments, the method results in the formation of an aptamer which interacts with three or more binding sites on a target. In some embodiments, the method results in the formation of at least one aptamer that binds to a target.

In some embodiments, the method results in the formation of at least one aptamer that binds to at least one target.

In some embodiments, the method results in the formation of at least one aptamer that binds to at least one target.

The person skilled in the art will appreciate that “target” can be understood as different binding sites on an entity e.g. a target molecule or a target cell.

In some embodiments, the aptamer is an intramolecular multivalent aptamer, which binds with different portions of the aptamer to different portions of the target.

The person skilled in the art will appreciate that “target” can also be understood as different entities, e.g. different molecules or different cells or any combination thereof.

In some embodiments, the aptamer is an intermolecular multivalent aptamer, which binds with different portions of the aptamer to different targets such as molecules.

In some embodiments, the method results in the formation of an aptamer that binds to two or more targets.

In some embodiments, the method results in the formation of intermolecular multivalent aptamers.

In some embodiments, the method results in the formation of intramolecular multivalent aptamers.

The person skilled in the art might use different methods to ensure proper folding of the candidate aptamers before contacting the candidate aptamers with the target. In some embodiments, a heating and cooling step is performed subsequent to the generation of the library of candidate aptamers and incubating candidate aptamers with the target to ensure refolding of the library.

In some embodiments, a heating and cooling step is performed subsequent to the generation of the library of candidate aptamers and incubating candidate aptamers with the target by heating the solution to 80 to 96 °C and cooling the solution at a rate of 0.1 to 1°C s-1.

The method for obtaining an aptamer capable of binding to a target might be performed by first generating a library of candidate aptamers, which are subsequently contacted with the target, or by letting the library form around the target in one step. The latter option allows the instant formation of a complex of aptamer and target. If the target is a molecule, this process can be understood as the formation of molecular imprinted aptamers (MIAs), in contrast to non-imprinted aptamers (NIAs) which are generated without the presence of a target molecule. As used herein, the term “NIAs” is equivalent to a “variable size (vs) aptamer library”, both being formed in the absence of a target. However, the subgroups MIAs and NIAs might be formed under different conditions compared the formation of a general variable size candidate aptamer library. For example, MIAs and NIAs might be formed in the presence of a lower initiator (forward primer) concentration compared to the formation of a vs candidate aptamer library, thereby avoiding excess of the initiator. In the case of MIAs, this increases the number of aptamers binding to the target, thereby enabling the formation of aptamers with increased binding affinity.

It will be understood by the person skilled in the art that vs aptamer libraries, as well as NIAs, represent a pool of randomly formed aptamers, controlled by the reaction conditions, such as reaction time, ingredients in the reaction mixture such as divalent metal ions and the presence of certain nucleotides. MIAs are additionally influenced by the presence of a target, which can be understood as a natural selection process.

Throughout the description of the present invention, it is to be understood that all mentioned aptamers can be MIAs (when aptamers are formed by the disclosed method in the presence of a target) or NIAs (when aptamers are formed by the disclosed method in the absence of a target). The MIA-approach is found to increase the population of protein bound aptamers in comparison to NIAs under certain conditions and is a possibility to increase the binding affinity of the final aptamers, by allowing selection of efficient aptamers that can be used in other selection rounds to further increase efficiency e.g. affinity.

In some embodiments of the present invention, the step of generating a library of candidate aptamers and the step of incubating the candidate aptamers with the target are performed sequentially, thereby obtaining non-imprinted aptamers (NIAs).

In some embodiments, the concentration of the target and the concentration of the initiator sequence are the same.

In some embodiments, there is an excess of the target over the initiator sequence.

In some embodiments, there is an excess of the initiator sequence over the target.

In some embodiments, the concentration of target and initiator sequence is from 100 nM to 2 mM.

In some embodiments, the concentration of the target is 100 nM and the concentration of the initiator sequence is 2 pM.

In some embodiments, the concentration of the target is 100 nM and the concentration of the initiator sequence is 100 pM.

In some embodiments, the concentration of the target is between 50 to 500 nM, such as 50 nM, such as 100 nM, such as 200 nM, such as 300 nM, such as 400 nM , such as 500 nM, and the concentration of the initiator sequence is between 1 to 5 pM, such as 1 pM, such as 2 pM, such as 3 pM, such as 4 pM, such as 5 pM.

In some embodiments, the step of generating a library of candidate aptamers and the step of incubating the candidate aptamers with the target are performed simultaneously, thereby obtaining molecular imprinted aptamers (MIAs). In some embodiments, the candidate aptamer is incubated with the target for a duration of between 30 to 120 minutes, such as for 30 minutes, such as for 40 minutes, such as for 50 minutes, such as for 60 minutes, such as for 70 minutes, such as for 80 minutes, such as for 90 minutes, such as for 100 minutes, such as for 100 minutes, such as for 120 minutes.

In some preferred embodiments, the candidate aptamer is incubated with the target for a duration of 1 hour.

The person skilled in the art will appreciate that aptamers can be generated to a wide variety of targets.

In some embodiments, the target is selected from the group consisting of atoms, metal ions, for example mercury ions (Hg ²⁺ ), molecules, organelles, cells.

Aptamers directed to mercury ions (Hg ²⁺ ) have been described in the field (Qi 2020), and have been proven beneficial for monitoring of environmentally harmful substances.

In some embodiments , the target is selected from the group consisting of fungi, bacteria and viruses.

In some embodiments, the target is a molecule, wherein the molecule is a small molecule or a macromolecule.

In some embodiments, the target is a molecule, wherein the molecule a. consists of amino acids such as a peptide, a polypeptide or a protein, optionally a hydrophobic peptide, polypeptide or protein; b. is a carbohydrate; c. is a lipid, d. a nucleic acid or polynucleotide or any combination thereof.

In some embodiments, the target is an organelle, wherein organelles are intracellular organelles or isolated organelles. The person skilled in the art will appreciate that all methods of the state of the art can be employed to separate candidate aptamers bound to target from unbound aptamers. These techniques rely on, for example, the molecular weight difference between the aptamer-target complex compared to unbound aptamers. This difference is used to separate target-bound aptamers from unbound aptamers e.g. when migrating through a gel. Electrophoretic mobility shift assay (EMSA) is such a standard method used in the art. Alternative methods of separating protein targets include capillary electrophoresis as an immobilisation free method, affinity capture columns using agarose gel beads, magnetic microspheres and microfluidic based systems. Further, immunosorption plates where the target protein is conjugated to a stationary phase can be used. For small molecule targets, the reverse partitioning (REVERSE SELEX is used to separate bound DNA whereby the library is docked onto a solid phase such as magnetic beads. When the target binds to the DNA, the DNA sequence changes conformation and comes off the beads. For whole cell targets, ultracentrifugation or fixing the cells to the culture dish can be used to separate bound DNA.

In some embodiments, candidate aptamers that bind to a target are selected by a partitioning method, such as a partitioning method selected from the group consisting of electromobility shift assay (EMSA), capillary electrophoresis, affinity capture columns using agarose gel beads, magnetic microspheres, target-conjugated magnetic beads, nitrocellulose filter-binding, microfluidic bases systems and immunosorption.

Exonuclease degradation of non-binding aptamers

The person skilled in the art will appreciate that further steps may be included which further simplify or streamline the protocol.

In some embodiments, a step comprising incubation with a DNA-degrading enzyme is performed subsequent to step ii. and before iii., wherein said DNA-degrading enzyme degrades aptamers that are not bound to the target and wherein said DNA-degrading enzyme does not degrade aptamers that are bound to the target.

In some embodiments, the DNA degrading enzyme is exonuclease I, for example thermolabile exonuclease I, or DNase I. In some embodiments, the aptamers obtained in step ii. are isolated, diluted in a buffer and incubated with a target before incubation with DNA-degrading enzyme.

Amplification of aptamers

Selected aptamers might be used directly, or they might be amplified and/or analysed further. For direct usage of the aptamer, broad size distribution without the 3’ constant region means that aptamers are already selected in a partially truncated state removing the need for post-SELEX modification. By using the methods of the present invention, aptamers in a partially truncated state are produced, with the 5’ end still present due to the incorporation of the initiator sequence. If desired, the initiator sequence can be cleaved off the aptamer without losing the structural conformation which is needed for aptamer-target binding. Thus in some embodiments the method further comprises the step of cleaving the aptamer, in particular the part of the aptamer which corresponds to the initiator sequence can be removed by methods known in the art.

Further, if desired, a known sequence might be added at the 3’ end of the candidate aptamer by methods known in the art, for example by using an enzyme, e.g. a polymerase such as TdT, or by ligation. This known sequence can form a template for a complementary sequence of nucleotides, e.g. in a primer, which can hybridize to the sequence and be used for amplification.

For example, TdT-enzymatic reaction can be used to add a tail of known sequence to the 3’ end of candidate aptamers. Commonly employed might be polyadenylation of oligonucleotides, but other techniques known in the art might be used. This known tail- structure, e.g. a poly-A tail, can serve as a hybridisation site for a reverse primer complementary to the tail-structure, e.g. a primer with a poly-T stretch. The person skilled in the art will understand that the poly-T stretch in a primer can vary in length and the optimal primer will be chosen by standard criteria for optimal primer design and hybridisation by the person skilled in the art. Together with the initiator oligonucleotides from the initial library formation step, now used as a forward primer, PCR-based amplification of the candidate aptamers can be performed. This procedure might be referred to as rapid amplification of variable size DNA/RNA ends (RAVE). This procedure differs from rapid amplification of cDNA ends (RACE) in that there is no reverse transcription step, but a known tail, such as a poly-A tail, is added followed by an amplification step such as qPCR or PCR. In some embodiments, aptamers binding to a target are polyadenylated.

In some embodiments, the polyadenylated aptamers binding to a target are converted to dsDNA and/or amplified by a polymerase chain reaction (PCR).

In some embodiments, the polyadenylated aptamers binding to a target are converted to dsDNA and/or amplified by quantitative real-time PCR (qPCR).

In some embodiments, the PCR-based method utilizes a forward primer, wherein the forward primer is identical to the initiator oligonucleotide used during aptamer formation in the process of generating a library of candidate aptamers.

In some embodiments, the PCR-based method utilizes a reverse primer which is capable of hybridising to the tailed aptamers, for example to the polyadenylated aptamers.

In some embodiments, the PCR-based method utilizes a reverse primer which is capable of hybridising to the tailed aptamers, for example to the polyadenylated aptamers, and which further contains one single further nucleotide containing cytosine, guanine or adenine, at the 3’-end; this may be useful to increase hybridisation stability.

In some embodiments, the reverse primer comprises a sequence complementary to the known tail of the aptamers, such as a poly-T stretch, said sequence consisting of at least 3 nucleotides, such as 3 nucleotides, such as 4 nucleotides, such as 5 nucleotides, such as 6 nucleotides, such as 7 nucleotides, such as 8 nucleotides, such as 9 nucleotides, such as 10 nucleotides, such as 11 nucleotides, such as 12 nucleotides, such as 13 nucleotides, such as 14 nucleotides.

Apart from the sequence of the reverse primer that is complementary to the nucleotide tail of the aptamer, the person skilled in the art will recognize that the same criteria applies for designing the reverse primer as for the initiator oligonucleotide/forward primer as described. Therefore, in some embodiments, the reverse primer is 3 to 25 nucleotides long, for example 4 nucleotides long, or 5 nucleotides long, or 6 nucleotides long, or 7 nucleotides long, or 8 nucleotides long, or 9 nucleotides long, or 10 nucleotides long, or 11 nucleotides long, or 12 nucleotides long, or 13 nucleotides long, or 14 nucleotides long, or 15 nucleotides long, or 16 nucleotides long, or 17 nucleotides long, or 18 nucleotides long, or 19 nucleotides long, or 20 nucleotides long, or 21 nucleotides long, or 22 nucleotides long, or 23 nucleotides long, or 24 nucleotides long, or 25 nucleotides long.

In some embodiments, reverse primer is 3 to 25 nucleotides long and further characterized by: a. a delta G for hairpin folding of >-2 and/or b. a delta G of homodimerization of >-7 and/or c. a delta G of heterodimerization of >- 5 and/or d. a melting point within plus/minus 5 degrees Celsius.

In some embodiments, the reverse primer has a sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or a homologue thereof having at least 80% identity thereto, such as at least 85%, at least 90% or at least 95% identity thereto.

In some embodiments, the reverse primer has a sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or a homologue thereof having at least 80% identity thereto, such as at least 85%, at least 90% or at least 95% identity thereto, and contains further one single further nucleotide containing cytosine, guanine or adenine, at the 3’-end to increase hybridisation stability.

Once aptamers are amplified, they might be subjected to further analysis, for example with the aim to identify binding motifs or to further characterize the aptamer formation process.

In some embodiments, the amplified aptamers are sequenced, whereby aptamer binding motifs are identified.

In some embodiments, the amplified aptamers are sequenced by next generation sequencing (NGS). The person skilled in the art will appreciate that any other sequencing method of the art might be used. The person skilled in the art will appreciate that the identification of binding motives in newly generated and selected aptamers might be used to be incorporated in further selection rounds, thereby further tailoring aptamers.

In some embodiments, further selection rounds are included after aptamers binding to the target are identified and analysed for their binding specificity.

In some embodiments, further selection rounds are performed by incorporating the identified binding motifs into a further initiator oligonucleotide and repeating the method with said further initiator oligonucleotide.

Usage of a library of candidate aptamers and selected aptamers

Aptamers have a wide range of applications and can be used against a wide range of targets.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, are used for medical diagnostics. In this sense, aptamers can be regarded as receptors binding to ligands to be detected. In another sense, aptamers can be regarded as ligands binding to a receptor, when a receptor, e.g. a cell surface receptor, is the target of the aptamer. The aptamers can be used to detect a target as detailed above, for example a molecule, where said target is known to be expressed in subjects suffering from a given disease. The aptamer can be modified additionally to facilitate detection, for example by additionally molecules loaded or attached to the aptamer in any way used in the field of molecular labelling, e.g. by covalent binding or complexing. These additional modifications can be, for example, fluorochromes or radio-labelled entities or different forms of tags used in the field of molecular labelling. Further, the nucleotides in the aptamer itself can be traceable, for example by the incorporation of radioactive-traceable nucleotides.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, are used for drug delivery. Since aptamers can be used to detect a target as detailed above, and where said target is known to be expressed in subjects suffering from a given disease, the aptamers can be used to deliver drugs to the target. The drug can be loaded or attached to the aptamer in any why used in the field of drug delivery, e.g. by covalent binding or complexing. This methodology allows for targeting specific molecules known to be expressed in disease, while avoiding off-target effects which are associated with general drug delivery that is not targeted.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, are used as therapeutic agents. Since aptamers can be used to detect a target as detailed above, and where said target is known to be expressed in subjects suffering from a given disease, the aptamers can be used to treat diseases or disorders associated with the given disease. This can be done, for example, as detailed above by using aptamers for drug delivery. Other options include, for example, the direct action of the aptamer on the target. For example, the aptamer can inhibit the function of the target, thereby inhibiting further signalling pathways. The aptamer can also stimulate the function of the target, thereby eliciting beneficial pathways. The aptamer can compete with and regulate or block the binding of other molecule to the target, thereby affecting the action of the other molecule, and eliciting a treatment effect.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, can be used in antibody replacement therapy.

Thrombin is known to be involved in coagulation-related reactions and mechanisms therein are known to be involved in many disorders and diseases. Therefore, the person skilled in the art will appreciate the usefulness of thrombin-binding aptamers, produced by the method of the present invention, in targeting and possibly inhibiting thrombin.

In some embodiments, aptamers produced by the method of the present invention and capable of binding to thrombin, are used as a therapeutic agent to inhibit thrombin- induced platelet aggregation and clot-bound thrombin activity.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, are used for food quality control. The aptamers can be used to detect a target which is to be monitored in, for example, food preparations or ingredients or raw material, such as for example a contaminant. As described above, the aptamer itself or a modified variant can be used to detect the presence or absence of targets to be monitored.

In some embodiments, aptamers capable of binding to the target, produced by the method of the present invention, are used for environmental monitoring. The aptamers can be used to detect a target which is to be monitored in, for example, environmental samples such as water samples or soil samples or extracts. As described above, the aptamer itself or a modified variant can be used to detect the presence or absence of targets to be monitored.

In some embodiments, the target which is targeted by an aptamer or a library of aptamers as disclosed herein, and which is targeted in a herein disclosed method of diagnosis, treating or detecting, is a biomarker and/or is involved in pathological pathways or processes of a disease or disorder.

In biomedical contexts, a biomarker, or biological marker is a measurable indicator of some biological state or condition. Biomarkers are often measured and evaluated using body samples e.g. blood, urine, or soft tissues, to examine normal biological processes, pathogenic processes, or pharmacologic responses to a therapeutic intervention.

The method for obtaining an aptamer capable of binding to a target, as described in the present invention, allows for streamlined and straightforward identification of aptamers. Therefore, the reagents might be incorporated in a kit with instructions following the outlined methodology.

An aspect of the present invention relates to a kit for selection of a DNA or RNA aptamer, the kit comprising a. a pre-manufactured DNA or RNA library or a DNA or RNA library comprising aptamers as defined in the present disclosure; or b. the reagents to produce a DNA or RNA library or a DNA or RNA library comprising aptamers as defined in the present disclosure, said reagents comprising at least terminal deoxynucleotidyl transferase (TdT), an initiator oligonucleotide and dNTPs. An alternative aspect of the present invention relates to a kit for selection of an aptamer, preferably a DNA aptamer, the kit comprising a. a pre-manufactured aptamer library, preferably a DNA library, or a library comprising aptamers as obtained by the following steps: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target; or b. the reagents to produce a DNA or RNA library or a DNA or RNA library comprising aptamers as defined in any one of the preceding claims, said reagents comprising at least terminal deoxynucleotidyl transferase (TdT), an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs.

In some embodiments, the kit is for performing all necessary and optional steps of the method for obtaining an aptamer capable of binding to a target as described in the present invention, and the kit comprises the reaction mixture for performing the method. The reaction mixture is preferably as described herein.

In some embodiments, the kit further contains nitrocellulose filter which can be used as a partitioning method to separate target-bound aptamers from non-bound aptamers.

In some embodiments, the kit further contains spin columns, buffers and/or PCR reagents.

In some embodiments, the kit further contains a DNA-degrading enzyme, for example exonuclease I, thermolabile exonuclease I, or DNase I. In some embodiments, the kit further contains a buffer, preferably having a pH between 7 and 9.5, and/or preferably wherein the buffer contains KCI and MgCh. Suitable buffers having a pH between 7 and 9.5 include HEPES (4-(2-hydroxyethyl)-1- piperazineethanesulfonic acid), Tris buffers such as Tris-HCL and phosphate buffers such as PBS. The person skilled in the art will be able to choose a suitable buffer.

The streamlined method for obtaining an aptamer capable of binding to a target offers the possibility to efficiently generate and select aptamers for a specific target, where the target is, for example, implicated in a disease process, and where the need arises to detect or affect this target, for example by aptamer binding. Therefore, the methodology of the present invention might be used for methods of diagnosing and/or treatment of a disease or disorder.

A further aspect aspect of the present invention relates to a method of diagnosing a disorder or a disease in an individual suspected of suffering of said disorder or disease, wherein the disorder or the disease is characterised by a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Detecting the target in a biological sample obtained from the individual by incubating the sample with the recovered aptamers, wherein if the target is detected the individual is diagnosed as suffering from the disease or disorder, and wherein if the target is not detected the individual is classified as not suffering from the disease or disorder.

Another aspect of the present invention relates to a method of treating a disorder or disease in an individual in need thereof, wherein the disease or disorder is characterised by the presence of a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Administering an effective amount of the recovered aptamers to the individual, thereby treating the disorder or disease in an individual in need thereof.

In yet another aspect, the present invention relates to a method of detecting a target in a sample suspected of comprising the target, comprising the steps of: i. Generating a candidate aptamer or a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides, such as dNTPs or rNTPs, preferably dNTPs, in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Contacting an effective amount of the recovered aptamers with the sample, vi. Determining if aptamers bind to the target in the sample, vii. Optionally, isolating aptamers from step vi, thereby detecting the presence of a target in a sample.

In some embodiments, the present invention is used to detect the presence of absence of a target in a the sample that is derived from a food item, thereby detecting targets such as food contaminants. In some embodiments, the present invention is used to detect the presence of absence of a target in a the sample that is derived from an environmental sample, such as for example a water or soil sample, thereby detecting environmental contaminants.

In some embodiments, steps i. to iv. , the TdT, the reaction mixture, the initiator oligonucleotide, the nucleotides, such as dNTPs or rNTPs, preferably dNTPs, the buffer and/or the aptamer or library of aptamers of the above described methods or the kit are as described above.

In some embodiments, above disclosed methods relate to DNA aptamers or libraries of DNA aptamers.

The person skilled in the art will understand that the method of detecting a target with an aptamer, also to be understood as detecting an analyte, can be used in all fields where detection and monitoring of specific analytes is employed.

In one aspect, the present invention relates to the use of a composition comprising a library of candidate aptamers for the selection of aptamers for the detection of a target associated with a disorder or disease, where the library is obtained by the methods described herein.

In another aspect, the present invention relates to the use of a composition comprising a library of candidate aptamers for the selection of aptamers for the treatment of a disorder or disease, where the library is obtained by the methods described herein.

In some embodiments, the individual in need of diagnosis and/or treatment is a human or a an animal.

Lactoferrin is recognized as a biomarker for urinary tract infections. Therefore, the person skilled in the art will appreciate the usefulness of lactoferrin-binding aptamers, produced by the method of the present invention, in detecting lactoferrin.

In some embodiments, aptamers produced by the method of the present invention and capable of binding to lactoferrin, are used as a diagnostic tool, for example for the diagnosis of urinary tract infections. In some embodiments, the above describe methods or are employed for diagnosing or treating urinary tract infection.

In some embodiments, the above describe methods or are employed for detecting biomarkers involved in urinary tract infection, such as lactoferrin.

In yet another aspect, the present invention relates to a library of aptamers obtainable by the method of the present invention.

One advantage of the present invention is the scalability of the process. In Example 2, 20-400 pi reactions are used forTdT catalysed formation of random naive DNA libraries. However, the reaction may be performed at, for example, 800 mI or at even larger volumes. Increasing the reaction volume, together with increasing the reactants, will lead to the production of an even more varied vs aptamer library.

In some embodiments, the aptamers or the library of aptamers obtained by the herein disclosed method, are for use as a medicament.

In some embodiments, the aptamers or the library of aptamers obtained by the herein disclosed method, are for use in the treatment of a disorder or disease, wherein the disease or disorder is characterised by the presence of a target to which said aptamer or library of aptamers specifically bind.

In some embodiments, the invention relates to an aptamer having a nucleotide sequence of SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, or a nucleotide sequence having at least 60% sequence identity or homology to SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 25, SEQ ID NO: 26 or SEQ ID NO: 27, for example at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% sequence identity or homology thereto.

Examples General materials and methods

Both the forward primer (same as initiator sequence) and reverse primers of sequences, 5 ^' ATC AGT TCG AGC AGA TGA GC ^' 3 and 5 ^' CCA GAC TGC GAG CGT TTT TTT TTT -3 ^' respectively as well as a 10-100 nt (nucleotide) oligonucleotide ladder, were purchased from IDT, Terminal deoxynucleotidyl transferase (TdT), dNTPs, PowerUP SYBR master mix, SYBR gold stain and human thrombin were purchased from Thermo Scientific. 5x FIREPol® Master Mix and sample loading buffer were purchased from Solis Biodyne. For all experiments, sample buffer SB1: 50 mM Tris- HCI, 250 mM KCI and 7.5 mM MgCh pH 7.4 (5X) was used. An alternative sample buffer SB2 can also be used: 100 mM Tris-HCI, 300 mM KCI and 50 mM MgCI2 and 10 mM CaCh, pH 7.4 (2X). All oligonucleotide purification steps were performed using an oligonucleotide purification kit from Norgen Biotek. Purification of PCR products was performed using a PCR clean-up kit purchased from Macherey-Nagel GmbH. All electrophoretic mobility shift assays (EMSA); (5-6%) and agarose gels (2%) were prepared in house. qPCR reactions were prepared using a dedicated PCR lab with laminar flow cabinets. qPCR analysis was performed on a BioRad T100 PCR thermocycler. Candidate polynucleotide sequences were also purchased from IDT using their Ultramer® technology including two scrambled sequences (SC01 and SC02), which correspond to the randomised sequence of the longest polynucleotide.

Example 1 : Workflow of the one round selection process to select aptamers

Aim:

Overview over the procedure.

Material and methods:

TdT catalyses the synthesis of a random ssDNA library in the absence of the target, which results in a DNA library with DNA molecules of different length (=variable size DNA library/vsDNA) (Figure 1A). The vsDNA library, which can be referred to as a candidate aptamer library, is refolded on a thermocycler to ensure that the library forms a diverse range of 3D conformations for screening. Subsequently, the resulting library is incubated with target proteins to which aptamers are to be identified. This is followed by partitioning of protein bound DNA from unbound sequences (Figure 1B). On the aptamers which were able to bind to the target, a TdT catalysed tailing reaction to incorporate a poly-A tail is performed, followed by RAVE (rapid amplification of variable sized DNA ends) to form dsDNA (Figure 1C). In the RAVE protocol, either qPCR or PCR can be used for the amplification step. Next generation sequencing (NGS) can be used to elucidate the sequences of the candidate aptamer sequences (Figure 1D). Binding motifs can then be identified and aptamer candidates can be screened for binding affinities, specificity and selectivity.

Results:

The procedure results in a stream-lined selection procedure, thereby avoiding problems associated with procedures employing several rounds of selection, e.g. the conventionally used SELEX procedure (Systematic Evolution of Ligands by Exponential Enrichment) which involves repeated rounds (8-20 rounds) of partitioning and amplification of target bound DNA. The use of vsDNA libraries in the single round selection allows to screen for protein binding sequences in terms of both the size and specific sequence. This is achieved through the use of TdT enzyme to catalyse the formation of an oligonucleotide libraries with broad size distributions starting from an initiator sequence. The methodology reduces the possibility of PCR bias, which can build up over several rounds of repeated PCR amplification and can be performed in a single round of selection in a non-evolutionary manner. The composition of the starting libraries can also be tailored to a particular target molecule by incorporating different ratios of dNTPs into the libraries during synthesis and controlling the time of reaction. A molecular imprinting technique, allowing the aptamer formation in the presence of a target, would remove the need for a library based selection altogether as DNA binding sequences can be synthesized in a continuous manner in the presence of the template. This techniques opens up to the possibility of developing macromolecular aptamers (up to 400nt), which can be intramolecular and intermolecular bispecific aptamers.

Conclusions:

The procedure provides a fast, resource and cost efficient way to produce aptamers which are not only selected based on sequence, as conventional methods do due to the usage of fixed length random DNA libraries. The method employed in Figure 1 produces aptamers which are selected both on sequence and/or on size due to the use of a variable size DNA library, at the same time avoiding bias and errors introduced by conventional methods over several selection rounds. Example 2: Formation of vsDNA libraries for the one round selection of aptamers.

Aim:

Detailed description of the procedure and confirmation of the production of aptamers / libraries of aptamers.

Material and methods:

Formation of vsDNA libraries:

The TdT catalysed formation of random naive DNA libraries could in general be achieved by preparing a 20-400 mI solution containing 1-2 mM of the initiator sequence (forward primer), 75 - 400 mM of dNTPs (dATP X mM, Y mM dCTP, Y mM dTTP and Z mM dGTP) in 1 x SB1. Here, the TdT catalysed formation of the random naive or G-rich DNA library was achieved by preparing a 20 mI solution containing 1 U/mI of TdT, 2 mM of the initiator sequence (forward primer), 150 mM of dNTPs (dATP 25 mM, 25 mM dCTP, 50 mM dTTP and 50 mM dGTP) in 10 mM Tris-HCI, 50 mM KCI and 1.5 mM MgCI ₂ .

The reaction was initiated by the addition of TdT and allowed to occur at room temperature for 30, 60 or 120 min. Here, advantage is taken of the broad sizes of polynucleotides which form from using a mixture of all four dNTPs to generate a random or G-rich, variable size library from the TdT reaction. Magnesium divalent ions were used in the reaction mixture creating a bias for the incorporation of G and A base groups. Alternatively, cobalt divalent ions were used instead of magnesium in the reaction mixture. Each reaction was terminated using 4 mI of 0.2 M EDTA or heat at 75 °C for 10 minutes. The resultant libraries were purified and concentrated using the oligonucleotide clean-up kit (Machary Nagel) and eluted into 20-30 mI of elution buffer (5mM Tris HCI).

Selection of human thrombin and human lactoferrin binding aptamers using vsDNA library:

A solution containing about 30 ng/mI vsDNA library (7mI) in either 1 x SB1 or 1 x SB2 was refolded by heating the solution to 94 °C and cooling at a rate of 0.5 °C s ¹ . The library was then incubated with 0.5 mM of human thrombin or 0.2 mM lactoferrin protein, respectively, for 1 hour at room temperature. The resultant complex was then separated on a 5 % native EMSA acrylamide gel. The DNA: thrombin complex or DNA: lactoferrin complex was visualised by staining with 1 x SYBR gold stain. The gel fragment containing the complex bands were extracted from the gel and transferred to a 0.5 ml tube punctured with a 20 gauge needle and placed into a 2ml tube. The crush and soak method was used to extract the DNA from the gel. This involved freezing the gel fragment at -20C° and crushing the gel. The tube was centrifuged at 10,000 g for 10 minutes to crush the gel fragment. The resultant gel pieces were then incubated with 50 pi of nuclease free water at 37 °C for two hours with lateral shaking, to allow the DNA to diffuse out of the gel fragments. The liquid was transferred to the top of a filter tip and centrifuged again at 10,000 g for 10 minutes. The resultant solution was purified using the oligonucleotide clean-up kit (Machary Nagel) and eluted into 20-30 mI of elution buffer.

Tailoring of the vsDNA libraries:

In order to determine whether further tailoring of the vsDNA library can be achieved, we synthesized libraries containing mixtures of TG, AC and ATCG nucleotides respectively. The TdT catalysed formation of random naive DNA libraries was achieved by preparing a 400 mI solution containing, 1-2 mM of the forward primer, 150 mM of dNTPs. The AC mixture consisted of (dATP 75 mM, 75 mM dCTP, 0 mM dTTP and 0 mM dGTP) and the TG mixture (dATP 0 mM, 0 mM dCTP, 75 mM dTTP and 75 mM dGTP) in 1 x SB1. The reaction was initiated by the addition of 1-2 U/mI of TdT and allowed to occur at room temperature for 1 hour. Previous SELEX studies for the screening of thrombin binding aptamers have elucidated that thrombin binding is mainly due to the presence of G quadruplex structure. In fact, the observation of G rich sequences forms the basis for a number of successful aptamer sequences. The previous reports for the selection of thrombin binding aptamers found a sequence comprising of 15 nt entirely of G and T nucleotides and 29-mer DNA aptamer containing more of a mixture of all four nucleotides. These sequences rely on the formation of a G-quadruplex structures. We therefore hypothesized that we could introduce some rational design before the selection by tailoring the mixture of nucleotides based on the previous knowledge of thrombin binding aptamers. We therefore synthesized new libraries containing the original mixture of nucleotides, a mixture of T and G nucleotides only and C and A only.

Poly (A) Tailing Reaction, gPCR Amplification, sequencing: In order to amplify and sequence the bound aptamers, a RAVE based assay was performed. The protein bound aptamers were converted to dsDNA using rapid amplification of variable ends assays (RAVE) and sequenced using next generation sequencing. In order to amplify and sequence the aptamers from the first method, a poly (A) tail was introduced at the 3 ^' end using TdT tailing reaction. 20 pi solutions containing dATP, 10 mM Tris-HCI, 50 mM KCI and 1.5 mM MgCh buffer, the resultant aptamer library (10 mI) and TdT 1- 2 U/mI were prepared and incubated for 0.5-2 hours followed by termination of the reaction by heating the solution to 75 °C for 10 minutes. The resultant product was used directly as the template in PCR. 20 mI solutions containing 1x master mix (10 mI), 0.1 -0.5 mM (1 mI) of the forward and reverse primers and 1-5 mI of the aptamer poly (A) template was prepared. PCR reactions were performed over 30-40 cycles consisting of a denaturing step at 94 °C for 30 seconds, an annealing step at 49 - 65 °C for 30 seconds and an extension step of 72 °C for 30 seconds. The resultant dsDNA libraries were sequenced using a NovaSeq 6000 (Macrogen, South Korea). Aptamers were sequenced by ligating each sample into adapter sequences using TruSeq Nano DNA (LMW) kit and confirmed using bioanalzyer (BIORAD). All sample libraries were prepared using an lllumina TruSeq DNA PCR free library construction (Insert 350bp) and a shotgun sequencing was performed. Next generation sequencing (NGS) was performed on a Novaseq 6000 using the NovaSeq 150bp PE read.

Bioinformatic analysis of DNA libraries and binding affinity studies of aptamer candidates:

The sequences identified from next generation sequencing (NGS) and analysed using MEME Suite to identify the binding motifs and UNAfold to determine the secondary structures and G-mapper to predict their ability to form G-quadruplexes. For NGS of aptamer candidates, aptamers were sequenced by ligating each sample into adapter sequences using TruSeq Nano DNA (LMW) kit and confirmed using bioanalzyer (BIORAD). NGS was performed on a Novaseq 3000 using the NovaSeq 150bp PE read. Candidate sequences were resynthesized and analysed for binding affinity using SPR.

Binding Affinity Studies Using Surface Plasmon Resonance

Surface Plasmon Resonance (SPR) studies were performed on a MP-SPR Navi™ 200 OTSO SPR instrument. Aptamer candidates were immobilised onto SPR chips prior to analysis. Firstly, a self-assembly monolayer was prepared by incubating bare gold chip into 5mM of mercaptodecanoic acid 11-MUA into degassed ethanol for 24 hours. The resultant chips were then washed using water and ethanol, dried using nitrogen and docked into the instrument. The instrument was primed with the run buffer (water) prior to immobilisation of the aptamer and the flow rate was set at 20 pi / min. For the immobilisation of the aptamer candidates, the chip surface was activated using an aqueous solution of mixture of NHS and EDC (80 mI). Streptavidin was then injected (80 mI, 50 pg / ml) in 50 mM sodium acetate buffer pH 5.0 onto the activated chip surface. The unreacted activated ester groups were blocked by injecting 1M ethanolamine pH 8.3 (80mI). 1mM Biotin tagged aptamers (80 mI) in SB1 were then injected while a scrambled aptamer sequences (SC01 for thrombin and SC02 for lactoferrin) were injected onto the reference channel. Kinetic analysis was performed by priming the SPR instrument with 1x SB1 run buffer and setting the flow rate to 20 mI / min. 1-300nM of each protein (80mI) was injected and the relative response of the analyte after the removal of the response of the reference channel was recorded. The kinetic binding affinities were determined using either a 1 to 1 binding model or 1 to 2 binding model where two G-quadruplex structures were predicted, using the trace drawer data analysis software. The binding affinities (KD) were determined from the association and dissociation rates where ka is the association rate and kd is the dissociation rate. All SPR experiments were performed in duplicate. The binding of LF02 and TH10T and SC01 and SC02 were also analyzed by a qualitative 5% EMSA using SYBR gold stain by titrating decreasing amounts of each protein against 1 mM of each aptamer sequence. Binding for LF02 and TH10T was confirmed. As expected, the scrambled sequences controls (SC01 and SC02) do not display any binding.

CD spectroscopy

Aptamers (10 mM) were suspended in SB1 and placed in 1 mm path length quartz cells. All CD spectroscopy experiments were performed on a J-1500 Circular Dichroism Spectrophotometer. An average of four scans from 310 to 210 nm were made at 100 nm min-1, with a 1 s response time and 0.1 nm bandwidth. The baseline signal was subtracted from each spectrum.

Results:

Formation of vsDNA libraries: The use of TdT to generate a random aptamer library offers several advantages over existing methods. Firstly, a typical TdT reaction often utilises only one dNTP due to the desire to produce polynucleotides with narrow size distributions. In our application, we actively took advantage of the broad sizes of polynucleotides which result from using a mixture of all four dNTPs to generate a random library from the TdT reaction and substituted cobalt for magnesium divalent metal catalyst ions in order to create a bias for G and A base groups. The ratio of dTTP and dGTP to dATP and dCTP was kept to 2:1 to encourage the formation of G-Quadruplex structures within the library. Figure 2A demonstrates that the size distributions of the resultant libraries correlates well with the time of reaction. TdT reactions were carried out for 30, 60 and 120 minutes, respectively, and analysed on a 5 % denaturing gel stained with SYBR gold. The vsDNA libraries are characteristically visualised as a broad sized smear with the initiator sequence observed in excess. Libraries corresponding to a 30 minute reaction resulted in a smear which falls within the range of 20 - 100 nt when compared to the ssDNA ladder while 1 and 2 hour reactions resulted in libraries with much larger size distributions >100 nt. The broad size distribution of the formed libraries allowed us to screen thrombin binding aptamers based on both the sequence and size of the strand while allowing for some control of the size ranges of the formed libraries. Thrombin- DNA mixtures were incubated for at least 1 hour in order to form stable DNA-thrombin complexes. Controls containing the library in the absence of thrombin and the initiator sequence in the presence of thrombin were also analysed. These mixtures were then separated on a 5% EMSA native acrylamide gel stained with 1x SYBR gold. Upon incubation of the vsDNA with thrombin, EMSA analysis shows distinct differences between vsDNA libraries incubated with thrombin and the corresponding vsDNA libraries in the absence of the thrombin as shown in Figure 2B. In libraries corresponding to 30 minutes, 1 hour and 2 hour reactions, bands corresponding to the thrombin binding aptamers were observed with increasing intensity, respectively. The complex band is well separated from unbound aptamers in the “library-only” control. With this methodology, a number of different sequences might bind to the target, depending on the time of reaction. The time of reaction determines both the total number of sequences in the library and the size distribution of the library. For thrombin, it is known that there are two binding sites (namely the exosite 1 which is the binding site for fibrinogen and exosite 2 which is involved in the activation of factor V and factor VIII) for the aptamer to bind to, so with longer sequences bispecific interactions might be assumed as well as monovalent interactions. However, only the bands corresponding to 30 minute and 1 hour reaction period demonstrated adequate resolution of the complex band from the free DNA smear on PAGE gel when compared to the corresponding vsDNA libraries in the absence of the thrombin target. In contrast, some overlap between the larger fragments of vsDNA library and the corresponding complex band for the vsDNA library formed after 2 hours of reaction were observed, suggesting that there would be carryover of non-binding aptamers from excising of gel band. Interestingly, the complex band in all three libraries appears as a much narrower band on the gel, which either suggests that an optimal size of aptamer is binding to the target or that the DNA contributes very little to the electrophoretic shift in the gel. Dissociation of binding DNA is also observed between the complex band and free DNA smear. Overall, these results suggest that we can tailor the size distributions to a particular target and hence we can separate thrombin binding aptamers based on both size and sequence, leading to a higher probability of finding sequences capable of binding the target with high binding affinities.

The selection of aptamers using vsDNA libraries was also performed for lactoferrin protein as the target. We demonstrated the partitioning of lactoferrin bound aptamers using the vsDNA library as shown in Figure 2C and Figure 2D which showed comparable results to the thrombin aptamers. However, it is worth noting that multiple complex bands are observed for lactoferrin corresponding to multiple polymeric forms of the protein. The same gel extraction was also performed on these protein aptamer complex bands and pooled together.

The use of EMSA, or other suitable methods (i.e. solidphase materals, agarose gels, 2D surfaces, for example ELISA plates, microfluidics, capillary electrophoresis, affinity capture columns using agarose gel beads, magnetic microspheres, target-conjugated magnetic beads, nitrocellulose filter-binding, microfluidic bases systems, immunosorption), may remove the necessity for a counter screening step against other closely related proteins. However, a counter screening step can be performed by incubating the vsDNA library with the protein conjugated stationary phase such as agarose beads or magnetic microspheres and retaining the unbound library.

Tailoring of the vsDNA libraries:

Tailored libraries were incubated with thrombin and a further EMSA assay was carried out (Figure 3A). To our surprise, a complex band for both the incubation mixtures corresponding to TG and ATCG was observed while no complex band was observed for the library consisting of AC only. The complex band is well separated from unbound aptamers (arrow in Figure 3A). These results suggest that the tailoring of the libraries to contain a certain percentage of each nucleotide is possible and as a result, one could therefore introduce rational design prior to further selection rounds with e.g. Systematic Evolution of Ligands by Exponential Enrichment (SELEX). In combination, with In Silico SELEX experiments, a method for bottom up rational design of aptamers may be feasible. When cobalt divalent ions were present during the library formation step, aptamer libraries with a larger size distribution where produced. Figure 3B shows libraries formed under different conditions (different nucleotide compositions) in the presence of cobalt, where aptamers with a length over 200 nucleotides were produced. Figure 3C shows that also under these conditions, aptamertarget protein (thrombin) complexes can be identified. Although the separation of these complexes from the free DNA proved difficult on a PAGE gel, other separation methods can be used to separate these larger fragments.

Conclusively, through control of time of reaction, primer to nucleotide ratios and the ratios of each individual nucleotide within our pre-polymerisation mixtures, we can tune the apparent binding of each library to a particular protein target and increase the fraction of bound DNA. This in turn allows us to narrow the range of sequences screened through pre-screening rational design of the vsDNA libraries. This setup provides a feedback loop for synthesizing aptamers, testing their apparent binding and then changing one of the reaction parameters.

Optimised vsDNA libraries with a higher proportion of G and T were chosen for further screening against thrombin and vsDNA libraries containing a higher proportion of GT and C (LVS1) were used for the lactoferrin.

Poly (A) Tailing Reaction, QPCR Amplification:

After extraction from the gel and subsequent purification, the retained DNA aptamers were converted to dsDNA products for preparation of the library for NGS analysis.

A poly (A) tail was introduced to the 3 ^' end of the aptamer sequences via a TdT tailing reaction. This was to ensure that the reverse primer which contained a complimentary poly T sequence was able to hybridise to the candidate ssDNA aptamer sequences during the PCR amplification step. The poly (A) tailing reactions were incubated with the recovered libraries for both 30 - 120 minute reaction times. This was to ensure that the poly-A tail was sufficiently long for hybridisation of the reverse primer and because the exact concentration of DNA recovered from the gel was below the limit of quantification the dATP was present in excess of the DNA sequences. The successful incorporation of the poly(A) tail and amplification of the binding aptamer candidates and optimal annealing temperature was confirmed by 2 % agarose gel (Figure 4A). The length of the Poly (A) tail is critical depending on the type of downstream sequencing experiment to be performed.

Candidate aptamer sequences were converted into dsDNA for next generation sequencing using PCR. PCR products for both the 30 minute and 2 hours resulted in the formation of the dsDNA PCR products and were visualised using a 2 % agarose gel (Figure 4B). The gel showed the formation of broad sized PCR products with the highest intensity at about 200 base pairs, respectively, which became more pronounced as less template and longer poly (A) tailing reaction times were used. This suggests that we selected thrombin and lactoferrin binding candidate aptamers of a broad size ranges during the EMSA partitioning. The TdT tailing reaction further increases the overall size distribution of the DNA. In order to confirm this and to elucidate the sequences of our aptamer candidates, we performed next generation sequencing (NGS) on the purified dsDNA products from both the aptamer candidate pools obtained from the selection of thrombin and lactoferrin. Aptamers were sequenced by ligating each sample into adapter sequences using TruSeq Nano DNA (LMW) kit and confirmed using a bio analyzer (Biorad). NGS analysis was performed on a Novaseq 6000 using the NovaSeq 150bp PE read.

It is worth noting that, although this procedure can be carried out in a single round of selection, further rounds of selection can be performed if necessary by identifying the binding motifs from next generation sequencing, incorporating them onto the initiator sequence and performing additional TdT forming reactions.

Bioinformatic analysis of DNA libraries and binding affinity studies of aptamer candidates:

Candidate aptamer sequences from the selection of aptamers for lactoferrin and thrombin were analysed for binding motifs, size, secondary structure folding energies and G-Quadruplex score using QGRS Mapper. G-Quadruplex score is a measure of the likelihood that a particular ssDNA sequence will form a G-Quadruplex structure.

The higher the number, the more likely a given sequence forms a G-Quadruplex structure. The binding motifs of both thrombin and lactoferrin based aptamers showed G-rich sequences suggesting that G-Quadruplex structures featured heavily in all of the aptamer candidates for both thrombin and lactoferrin (Figure 5A-B). G-quadruplex secondary structures are formed in nucleic acids by sequences that are rich in guanine. The size distribution of both sequenced aptamer libraries was high, although the copy numbers were low (Figure 6 A-B). This may be due to the loss of some aptamer candidates where the size of the Poly (A) tail is too large meaning that the reverse read was cut to short before the random region could be properly sequenced or due to the presence of flipped sequences. Table 1 and Table 2 show a list of candidate aptamer sequences with the corresponding sizes and G-Score (bold sequences represent the initiator sequence) as well as scrambled sequences which are represented as a randomised sequence of the longest TH (thrombin) or LF (lactoferrin) aptamer sequence identified. The scrambled sequences are the control sequences used to show the specific binding towards the aptamers. In this case the scrambled sequences are immobilised onto the reference channel of the SPR instrument. In some cases, the program identified more than one possible G-Quadruplex sequences giving rise to the possibility of a bi- or tri-specific aptamers being selected.

The secondary structures of each aptamer candidate in both the full and truncated (where the initiator sequence is removed from the aptamer) can be modelled by different bioinformatics tools.

Table 1 : List of candidate thrombin binding aptamer sequences and G-Quadruplex analysis.

Bold sequences represent the initiator sequence, which may be removed, for example by cleavage, from the final aptamer before use.

Table 2: List of candidate lactoferrin binding aptamer sequences and G- Quadruplex analysis.

Bold sequences represent the initiator sequence, which may be removed, for example by cleavage, from the final aptamer before use.

Binding Affinity Studies Using Surface Plasmon Resonance (SPR): Thrombin aptamers: The candidate sequences TH01, TH05, TH07 and TH10 as well as the corresponding truncated sequences (where the initiator sequence is removed from the aptamer) were further analysed using SPR. Sensorgrams were obtained through the injection of a range of concentrations (300 - 1 nM) based on the expected K _D for 240 seconds followed by 300 seconds of dissociation. The binding kinetics of each candidate aptamer sequence was determined from the normalised response of the analyte after subtraction of the response of the scrambled aptamer sequence reference channel (Figure 7A-E). All the candidate sequences demonstrated low nanomolar binding using the 1:1 kinetic model although some loss of binding affinity is observed when the sequences were truncated (Figure 7F-G). The truncated sequences TH01T and TH10T both showed the highest binding affinities with a KD values of 28.1 nM and 8.49 nM, respectively. In the case of TH10T both a 1:1 binding model and a 2:1 model was used for the kinetic analysis as two possible binding sites on the aptamer for the thrombin were assumed and were demonstrated by binding affinity values of 26.7 nM and 12.8 nM. The binding of THIOT was further confirmed and compared to SC01 using a qualitative EMSA gel (data not shown, see in Ashley 2021). Thrombin showed a higher preference for binding to TH10T than SC01.

Lactoferrin aptamers: For lactoferrin, candidate sequences, sensorgrams for LF01, LF02, LF03, LF04 and LF07 (data not shown, see Ashley 2021) and the truncated sequences of the lead candidates LF02T (Figure 7H), LF03T (Figure 7I), and LF04T (Figures 7J) were obtained in the same manner as described for thrombin. The truncated polynucleotides LF02T, LF03T and LF04T demonstrated low nanomolar binding with 1.4 nM, 5.5 and 5 nM respectively when fitted with a 1:1 kinetic model (Figures 7K and 7L). LF02T and LF04T were also fitted using a 2:1 model demonstrating binding affinities of KD1 of 30 pM and KD2 0.2 nM for LF02T and KD1 of 4.9 nM and KD1 8.3 nM for LF04T. These results confirmed comparable binding to typical antibodies raised against thrombin and lactoferrin. Candidates for both targets showed an increased avidity affect which may be due in large to the increase in size which agrees with previous reports on the dimerization of aptamers. The binding of LF02T was also assessed by EMSA and compared to SC02 (data not shown, see Ashley 2021). Human lactoferrin showed a higher preference for binding to LF02T than for SC02.

Specificity testing Thrombin: The lead candidate aptamer TH10T was tested for specificity using SPR. Concentrations of haemoglobin, fibrinogen and human serum album (HSA) were injected and sensorgrams were obtained based on the absolute SPR signal for both the analyte channel and reference channel (data can be seen in Ashley 2021, supplemental Figure S5). The data was fitted using a 1:1 binding model to obtain the binding affinities. Both haemoglobin and HSA demonstrated micromolar binding towards TH10T while fibrinogen showed a KD of 0.3 mM (Figure 7M), suggesting that the inhibition effect of thrombin binding aptamers may be enhanced by inhibition of the substrate.

Lactoferrin: The specificity of LF02T, LF03T and LF04T was tested against HSA as described for thrombin (data can be seen in Ashley 2021, supplemental Figure S6). HSA demonstrated micromolar binding towards LF02T, LF03T and LF04T and the corresponding reference channel containing SC02, confirming that high specificity for binding of each sequence towards human lactoferrin (Figure 7N).

Overall these results showed that protein binding aptamers could be formed by TdT enzyme which displayed comparative binding performance to antibodies.

CD spectroscopy

CD spectroscopy studies were performed on the truncated aptamer sequences for both targets (data not shown, see Ashley 2021). CD spectra of the thrombin aptamer TH10T showed a strong maxima signal at 265 nm characteristic of a parallel G-quadruplex. However, the broad size of the peak suggests the presence of a hybrid type G- quadruplexes containing both parallel and antiparallel G-quadruplexes as observed in some previous reports for the selection of thrombin binding aptamers. The CD spectra of LF02T, LF03T and LF04T (data not shown, see Ashley 2021) also shows a maxima at about 265 nm although the asymmetric nature of the peak also suggests hybrid G- quadruplexes are present.

Further details and further figures can be seen in Ashley et al. (Terminal deoxynucleotidyl transferase-mediated formation of protein binding polynucleotides, Nucleic Acids Res. 2021 Jan 25).

Conclusions: Overall, we demonstrated the first proof-of-concept for the use of vsDNA libraries in the single round selection of protein binding aptamers. The resultant aptamers demonstrated low nanomolar binding and high selectivity towards their respective targets. The here described selection method allows for the screening of aptamers in terms of size and sequence, allows the library to be tailored based on pre selection rational design, removes PCR bias due to removal of intermittent selection steps and allows for structural switching. Importantly, binding studies of the produced aptamers confirmed that the proposed non-evolutionary approach for the development of aptamers using tailored vsDNA libraries leads to the successful selection of monovalent and bivalent aptamers with comparable binding affinities to those obtained using traditional SELEX technology. This data also confirms that the size of the DNA strand is a critical factor in improving the efficiency of aptamers screening.

Example 3: One step formation of molecularly imprinted aptamers (MIA)

Aim:

Optimization of production of MIAs.

Material and methods:

Synthesis of I actoferrin binding MIAs:

Protein binding aptamers were formed by preparing a 400 pi solution containing 0.5 -2 mM of the forward primer, 0.5- 2 mM of lactoferrin, 75 - 400 mM of dNTPs (dATP X mM,

Y mM dCTP, Y mM dTTP and Z mM dGTP, as indicated below) in 1 x SB1. The difference between the MIA and a naive vsDNA library is that for MIA, target protein was spiked (human lactoferrin) into the mixture and TdT to formed the aptamers around the template (or target) and a lower concentration of the primer is used. The reaction was initiated by addition of 1-2 U/mI of TdT and allowed to occur at room temperature for 0.5 - 2 hours. Each reaction was terminated using heat at 75 °C for 10 minutes. The resultant aptamers were purified and concentrated using the oligonucleotide clean-up kit (Machary Nagel) and eluted into 20-30 mI of elution buffer. The corresponding Non-lmprinted aptamers (NIAs) were also prepared in the absence of lactoferrin, corresponding to vsDNA libraries as prepared in Example 2 but using a lower concentration of the initiator sequence. This was in order to increase the number of sequences formed from an imprinting effect and to minimise the number of sequences which bind through selection as observed in Example 2. To further optimise MIA for human lactoferrin, MIAs and corresponding NIAs were formed using the conditions described in Table 3 and Table 4. 3a, 3b, 4a and 4b correspond to MIAs and NIAs formed using different ratios of dNTPs, 5a and 5b correspond to MIAs formed using different amounts of the template (or target) protein lactoferrin and decreased dATP concentrations.

Table 3: Conditions for the TdT mediated molecularly imprinted aptamers

Table 4: Conditions for the TdT mediated molecu arly imprinted aptamers

Partitioning of MIAs / NIAs:

The size range of the MIAs or NIAs were monitored using a 5 % denaturing acrylamide gel and visualised by staining with 1 x SYBR gold stain.

Rebinding Studies of Ml As:

A solution containing about 30 ng/mI MIAs (7mI) in either 1 x SB1 or 1 x SB2 was refolded by heating the solution to 94 °C and cooling at a rate of 0.5 °C s ¹ . The library was then incubated with 0.1 to 1 mM of lactoferrin protein respectively for 1 hour at room temperature. The resultant complex was then separated on a 5 % native EMSA acrylamide gel. The DNA: lactoferrin complex was visualised by staining with 1 x SYBR gold stain.

Gel analysis of lactoferrin Binding Polynucleotides

Resultant MIAs and NIAs (7 mI) were placed in 1 x SB1 was refolded by heating the solution to 94 °C and cooling at a rate of 0.5 °C s ¹ . 0.250 mM lactoferrin protein for 1 hour at room temperature. The resultant complex was then separated on a 5 % native EMSA acrylamide gel and visualised by staining with 1 x SYBR gold stain. Selectivity studies were performed by incubating MIAs and NIAs with lactoferrin, trypsin and human serum albumin respectively and analysing on a 5% EMSA with SYBR gold stain.

SPR binding Analysis of MIA mixtures and individual sequences SPR binding analysis was performed on a MP-SPR Navi™ 200 OTSO SPR instrument. Firstly, a self-assembly monolayer was prepared by incubating bare gold chips into 5 mM of mercaptodecanoic acid 11-MUA in ethanol for 24 hours. The resultant chips were then washed using water and ethanol, dried using nitrogen and docked into the instrument. The instrument was primed with the run buffer Dl water prior to immobilization of the aptamer and the flow rate was set at 20 pi / min. For the immobilization of the MIA mixtures, MIAs and NIAs were immobilized onto each channel respectively by injecting an aqueous solution of NHS and EDC (80 mI). Neutravidin was then injected (80 mI, 50 pg / ml) in 50 mM sodium acetate buffer pH 5.0 onto the activated chip surface. The unreacted activated ester groups were then blocked by injecting 1M ethanolamine pH 8.3 (80 mI). MIA mixtures were injected on to the analyte channel (channel 1) and NIA mixtures were injected onto the reference channel (channel 2). Kinetic analysis was performed by priming the SPR instrument with 1x SB1 run buffer and setting the flow rate to 20 mI / min. Injections of 0 - 350 nM of human lactoferrin (80 mI) or other proteins were performed on both channels and the relative response of the MIAs after the removal of the response of the reference channel containing the immobilized NIAs was recorded. For the analysis of individual MIA sequences, 1 mM of the biotin tagged individual sequences (80 mI) in SB1 were injected on the analyte channel (channel 1), while scrambled sequences were injected onto the reference channel (channel 2) respectively. Injections of 0 - 350 nM of human lactoferrin (80 mI) or other proteins were performed on both channels and the relative response of the individual sequences after the removal of the response of the reference channel containing the scrambled sequence was recorded. The kinetic binding parameters were fitted against the relative response using 1 :1 model or bivalent model using the trace drawer data analysis software. The binding affinities (KD) were determined from the association and dissociation rates where k _a is the association rate and k _d is the dissociation rate. All SPR experiments were performed in duplicate. The specificity of the MIAs , NIAs and individual sequences were determined by measuring the absolute response of different concentrations of each protein and performing equilibrium analysis using trace viewer.

Rapid Amplification of variable ends (RAVE) and next generation sequencing MIA protein complexes were gel extracted, purified and concentrated using the oligonucleotide clean-up kit (Machary Nagel) and eluted into 60 mI of elution buffer (5 mM Tris HCI). These sequences were converted to dsDNA using a RAVE assay. A poly (A) tail was introduced at the 3'end of the polynucleotides using TdT tailing reaction. TdT (1-2 U/mI) was incubated with solutions (20 mI) containing dATP, 10 mM Tris-HCI, 50 mM KCI and 1.5 mM MgCh buffer, the extracted bound polynucleotide sequences (10 mI) for 0.5-2 h followed by termination of the reaction by heating the solution to 75°C for 10 min. The resultant extended sequences were used directly as the template for subsequent PCR reactions. 20 mI solutions containing 1* master mix (10 mI), 0.1-0.5 mM (1 mI) of the forward and reverse primers and 1-5 mI of the DNA-poly (A) templates were prepared. PCR reactions were performed over 30-40 cycles consisting of a denaturing step at 94°C for 30 s, an annealing step at 45-65°C for 30 s and an extension step of 72°C for 30 s. The resultant dsDNA libraries were purified again and were sequenced using a illumina Hiseq2500 using a 250bp pair end read (Macrogen, South Korea). All sample libraries were prepared using an Illumina TruSeq Nano DNA kit prior to sequencing.

Results:

Optimization of conditions for MIA production

Inspired by molecular imprinting, we hypothesized that aptamers could potentially be formed in the presence of a template (or target) protein. In a pre-polymerization mixture containing a template (or target) protein, nucleotides (monomers), the initiator DNA sequence (the initiator) and TdT (the catalyst), we can form molecularly imprinted aptamers (MIA) which bind to human lactoferrin. Upon purification, the relative size distributions of the MIAs shown as a DNA smear is slightly shorter than the corresponding non-imprinted aptamer (NIA); (Figure 8A). Rebinding studies with the protein on an EMSA (Figure 8B) shows a higher degree of binding of MIAs onto the protein (observed as multiple complex bands) compared to the NIA, suggesting that an imprinting effect via non-competitive inhibition is occurring. This means that the selection of aptamers is no longer limited by the size and number of sequences in the DNA library as we can continually form in place MIAs around the target and can tune their size and binding ability based on the ratio of nucleotides, concentration of the target protein and time of reaction removing the need for in vitro selection entirely. In addition, this method is scalable.

During the optimization experiments, MIAs and corresponding NIAs were formed using the conditions described in Table 3 or Table 4. In the Table 3, 3a, 3b, 4a and 4b correspond to MIAs and NIAs formed using different ratios of dNTPs. Figure 9A,

Figure 10A and Figure 11 A show the 5 % denaturing gel demonstrating slight changes in the maximum size range of the formed aptamers under condition 3, 4 or 5 in Table 3 or 4, respectively. Figure 9B-C and Figure 10B-C shows the EMSA rebinding assay after purification of the MIA and their corresponding NIA to human lactoferrin formed under different imprinting conditions (3a, 3b, 4a and 4b). The degree of binding towards MIAs is dependent on the ratio of dNTPs used confirming that the apparent binding affinities of each library can be tuned towards a particular target. The degree of binding towards the MIA in 3b, 4a and 4b is higher when compared to their corresponding NIA suggesting that the presence of the target during the TdT reaction suggests that an imprinting effect is occurring. When following the protocol according to table 4, as we increased the ratios of dTTP, dCTP and dGTP while reducing the ratio of dATP (5a) and increase the template (or target) concentration (5b) there is a slight size difference between MIAs and NIAs for 5a while the difference in size distributions for NIA and MIAs for 5b increased (Figure 11 A). The rebinding EMSA for 5a showed a higher intensity for the (Figure 11 B) suggesting that the amount of dATP played less of a role in the binding towards lactoferrin. In the EMSA of 5b, a decrease in binding intensity was observed for the MIA when compared to 5a suggesting that over a certain concentration, the target starts to inhibit the reaction (Figure 11C). This apparent decrease in binding may be due to difference in size of the MIA compared to the NIA which means less SYBR gold dye can intercalate with the DNA or that the template (or target) starts inhibiting the TdT enzyme reaction more to the determent of MIA formation.

SPR binding analysis of MIA mixtures and individual sequences Comprehensive binding studies were performed on the MIAs with the composition showing the highest apparent binding affinity (Figure 15A) using surface plasmon resonance (SPR) (Figure 12A). We determined the binding affinity (KD) of the MIA mixture towards human lactoferrin to be about 12 ± 1.3 nM by fitting a bivalent kinetic model meaning that MIA mixtures display comparable binding to individual sequences selected against the same target. The difference between binding of both MIAs and NIAs can also be seen from their absolute responses on the SPR sensor (Figure 12B). The relative binding of MIAs and NIAs of Figure 15A were also confirmed on a 5% EMSA in Figure 1 A-B.

Specificity testing

To test the specificity of the synthesized MIAs and NIAs, we incubated both the MIAs and NIAs with micromolar amounts of human serum albumin (HSA) trypsin (Ty).

Figure 13A-C shows that both MIAs and NIAs demonstrated specific binding towards human lactoferrin. The specificity was reconfirmed by SPR (figure not shown) and revealed that. Ml As demonstrated at least a 1000 x higher binding towards human lactoferrin compared to HSA and trypsin. This confirms that the synthesized Ml As are highly specific towards the target protein. Complexes were extracted from the gel and converted to dsDNA using rapid amplification of variable ends and sequenced using an lllumina HiSeq platform. Binding motifs were identified and sequences containing the motifs were ranked by copy number. NGS data and bioinformatics studies revealed that MIA sequences were more G-rich compared to previously reported polynucleotides (Figure 14). Individual sequences were chosen based on their Gibbs free energy and ability to form G-quadruplex structures. From binding affinity studies our lead sequence LF_MIA 4T (Table 5) demonstrated low nanomolar binding (5.4 ± 1.9 nM) and at least a 10 x selectivity towards human lactoferrin compared to bovine lactoferrin (59 ± 9.8 nM);(Figure 15). In Table 5, the initiator sequence has been removed (truncated aptamer sequences). Table 5: Summary of the lead polynucleotide found from NGS sequencing of Ml As

Conclusions:

Overall, we confirmed that the formation of protein binding aptamers in the presence of a template protein is possible using TdT enzyme. In addition, through carefully altering the compositions of the pre-polymerisation mixtures, we can effectively rationally design aptamers in a bottom-up manner.

The results show that aptamers can be molecularly imprinted in an analogous way to molecularly imprinted polymers, where TdT acts as a catalyst and the DNA oligonucleotide sequence acts as the initiator. In this respect, the development of aptamers is no longer dependent on the number of sequences within a library as the aptamers can be continuously formed in the presence of the target and can be rationally designed through the adjustment of the ratios of each nucleotides and the ratios of the initiator sequence with the template (or target) protein.

Inspired by the chemical synthesis of molecularly imprinted polymers, we demonstrated the first synthesis of molecularly imprinted aptamers (MIA) which specifically bind towards a protein target. We showed that the binding properties of MIAs towards the protein target can be tuned through the altering of the reaction parameters in pre polymerisation mixtures in terms of the time of reaction, the ratio of initiator to template, and the ratio of each nucleotide. The large populations of formed MIAs, the scalability of the synthesis step and the ability to easily purify MIAs means that we can effectively synthesize the DNA equivalent of a polyclonal antibody. These MIAs ultimately remove the need for evolutionary selection and opens up the possibility of bottom-up design of aptamers.

Example 4: Lactoferrin aptamer for biomarker detection in urinary tract infection

Aim:

To show that aptamers binding to lactoferrin, as produced as disclosed herein, can be used to detect urinary tract infection.

Background Urinary tract infection (UTI) is caused due to the presence of microbial pathogens within the urinary tract, which is classified as the most frequently occurring nosocomial infections in Europe, including Denmark. Early diagnosis and prompt decision-making on the initial treatment are important, but there are still have challenges with UTI diagnosis due to the non-specific signs and symptoms, high incidence of asymptomatic bacteriuria particularly in elderly populations, and lack of a definitive gold standard for UTI diagnosis. Biomarkers would be helpful to design new biosensors to diagnose UTI and determine the severity of infection. However, the conventional biomarkers including C-reactive protein (CRP), urine nitrite, leukocyte esterase, pyuria, and proteinuria have a low sensitivity and specificity for UTI diagnostics. Therefore, novel biomarkers that are more specific, easily measurable, and widely available are needed.

Human lactoferrin is known as a promising marker for UTI diagnosis and is a useful target for immunoassay development. Lactoferrin is a single polypeptide chain glycoprotein with a molecular weight of around 78 kDa that belongs to the transferrin family of protein. Lactoferrin is mainly found in all mammalian milk and a trace amount in the body fluids like saliva, tear, bile, pancreatic juice, and intestinal fluid. For example, urinary lactoferrin is measured for diagnosis of urinary tract infections (UTI), while for diagnosis of inflammatory bowel disease fecal lactoferrin is evaluated. Moreover, low salivary lactoferrin reflects dysfunctions in the immune system in sporadic Alzheimer's disease. The main methods used so far for detection of lactoferrin include spectrophotometry, chromatography, and immunoassay techniques. Among them, immunoassay techniques have high sensitivity and selectivity due to the strong affinity of the specific antigen- antibody reaction. However, they are operationally cumbersome and require expert knowledge, multiple-step assay protocols, and dedicated laboratory equipment. Moreover, antibodies have limited stability under non- physiological conditions and temperature sensitivity.

As described in Examples 1-3 we have screened for ssDNA sequences up to 200 nucleotides in length using new non-evolutionary screening method. We demonstrated that both target proteins (thrombin and human lactoferrin) bound candidate polynucleotides with low nanomolar binding which is comparable to the typical strength of interaction between antibodies and their corresponding antigens. Candidate thrombin and human lactoferrin polynucleotides displayed the bivalent binding towards thrombin and human lactoferrin, respectively. Herein, we used a novel multivalent aptamer and developed the first label-free electrochemical aptasensor for the detection of human lactoferrin in urine samples with extended linear detection range and high sensitivity. A simple procedure was used for the fabrication of electrochemical aptasensor. The sensor utilizes a multivalent binding aptamer to improve binding affinity of aptamer to human lactoferrin. As disclosed in Examples 1 to 3, we have developed a new non-evolutionary screening method which allows for the bottom-up rational design of aptamers and the screening of larger DNA sequences with multivalent binding ability.

As a further development for detecting lactoferrin with regard to urinary tract infection, a developed aptamer (lead candidate resulting from the experiments as disclosed in Examples 1-3), was self-assembled onto the surface of screen-printed gold electrode (SPGE). All modification steps of the biosensor surface were characterized using electrochemical impedance spectroscopy (EIS). The response of the aptasensor to lactoferrin was investigated by monitoring electrochemical signal of lactoferrin via differential pulse voltammetry (DPV). Under optimal conditions, lactoferrin was quantified with ultra-high sensitivity of 0.9 ng/mL and good selectivity with an extended dynamic range from 10 ng/mL to 1300 ng/mL in buffer solution. Therefore, we could achieve comparable sensitivity as the commercially available ELISA kit for lactoferrin detection (1 ng/mL), while much wider detection range, which is due to the presence of our multivalent aptamer, enabling late saturation of bioreceptor binding sites. The fabricated aptasensor demonstrated an ability to detect lactoferrin in spiked urine solutions. Monitoring the electrochemical signal of lactoferrin allowed us to detect lactoferrin without requiring incubating and washing steps. This fact causes reducing the time of sensing procedure, which would be desirable for application in point-of-care device.

Material and methods:

Chemicals

Potassium hexacyanoferrate(lll) (ACS reagent, ³99.0%), potassium hexacyanoferrate(ll) (ACS reagent, 98.5-102.0%), 6-Mercapto-1-hexanol (MCH, 97%), sodium acetate (³99%), acetic acid (³99%), phosphate buffer saline (10X PBS, pH 7.4), human lactoferrin (³90%), human serum albumin (HSA, ³98%) and SurineTM negative urine control were purchased from Sigma-Aldrich. The standard stock solution of lactoferrin (concentration of 510 mg/L) was prepared in PBS (pH 7.4) and stored in the dark at 4 °C. Working standard solutions were prepared daily by dilution of the stock solution. The following 5’ end amino modified DNA aptamer sequence (Ultramer®):

5’NH2-AAG GGG GGT CGG AGG TGG GCG CGG TAC CGG GAA GGG CGG ATG GCG TGG ATG GGC GAG AGG GAG AAG GGA GGC TTA GTC GAG GCT TTT GAT GAC AGA GGC GAG GAA GGG AGT CTT GAA ATT GGA GTG GGG CG for lactoferrin was synthesized by Integrated DNA Technologies.

The production of this aptamer is described in Example 2. This aptamer corresponds to SEQ ID NO: 15 (LF_02), with the constant part (the initiator sequence) being removed.

Apparatus

The electrochemical measurements were carried out using Potentiostat/ Galvanostat Metrohm Autolab (Model No. PGSTAT204) instrument. Screen-printed gold electrodes (SPGEs) were obtained from Metrohm (C220AT). SPGEs consist of gold, silver, and gold as the working electrode (with 4 mm diameter), reference electrode, and counter electrode, respectively.

Fabrication of aptasensors

In this paper, we set out to design an electrochemical sensor based on a lactoferrin aptamer with multivalent binding, which can be applied for direct detection of lactoferrin. Recently, we developed a new non-evolutionary screening method that employs terminal deoxy nucleotidyl transferase (TdT) enzyme to form libraries of polynucleotides[21] . We screened the aptamers based on size as well as sequence in a single round, and incubated the resultant variable size DNA (vs-DNA) libraries with the target molecule including lactoferrin. The protein bound sequences were converted to dsDNA using rapid amplification of variable ends assays (RAVE) and directly sequenced through next generation sequencing (NGS). The binding motifs of lactoferrin based polynucleotides showed G-rich sequences and the most promising candidate sequences for lactoferrin was chosen using surface plasmon resonance (SPR). With this in mind, we were interested to demonstrate these newly selected sequences as multivalent receptors for an electrochemical sensor device for sensitive detection of lactoferrin over a wider dynamic range. For this goal, the selected polynucleotide aptamer sequences was immobilized on SPGE using the following procedure. Screen-printed gold electrodes were firstly cleaned by electrochemical scan in 0.5 M H2S04 solution between 0 and 1.2 V until stable cyclic voltammograms were obtained. Then, 20 pl_ aliquot of a 5 mM DNA capture probe solution (in PBS, pH 7.4) was casted over SPGE and incubating 2 h at RT and overnight at 4 °C in a humid chamber. After thoroughly washing with Milli-Q water and drying with nitrogen, the DNA capture probemodified SPGEs is treated with 10 pL of 0.1 mM MCH aqueous solution (in PBS, pH 7.4) for 5 min followed by washing with Milli-Q water and storage at 4 °C (Scheme 1). The fabrication procedure of aptasensors were tested by electrochemical impedance spectroscopy (EIS) with amplitude of 10 mV over applied frequency ranges varying from 100 kHz to 0.01 Hz. All EIS plots were fitted and analyzed using Nova 2.1 software to determine the elemental parameters in the equivalent circuit.

Electrochemical measurements

Human lactoferrin in buffer or artificial urine samples were analyzed through differential pulse voltammetry using the aptasensor. 100 mI of 0.1 M acetate buffer solution (pH 4.5) was dropped on the SPGE and aptamer/SPGE to record the blank signal. Then 100 mI of lactoferrin standard solution in 0.1 M acetate buffer or artificial urine solutions was dropped on the SPGE and aptamer/SPGE and DPV measurements were immediately performed. DPV was applied by scanning from 0.4 to 1.1 V at 10 mV s-1 with pulse amplitude of 25 mV and pulse width of 50 ms. All DPV plots were analyzed using Nova 2.1 software to determine the anodic peak potentials and anodic peak currents. To obtain the optimal sensing performance for lactoferrin with the designed aptasensor, the effect of pH of electrolyte solutions was investigated. In order to assess the optimized pH, 200 ng/ml of lactoferrin was dissolved in acetate buffer with different pH range from 3.5 to 5.5. Then the electrochemical responses of lactoferrin was evaluated on the aptamer/SPGE through DPV measurements. Before each experiment, DPV responses of each individual acetate buffer solution was recorded as the blank signal. The sensitivity of the electrochemical aptasensor was investigated using dilution series of lactoferrin samples ranging from 10 ng/mL to 50 ng/ml_. By taking the anodic peak currents from the DPV measurements as the function of lactoferrin concentration, the calibration curve was achieved. The limit of detection (LOD) was calculated as three times of the standard deviation for the blank measurement in the absence of test analyte, divided by the slope of the calibration plot between DPV current and the concentration. Apart from the sensitivity, the specificity of electrochemical aptasensor was also tested towards lactoferrin detection. For assessing the selectivity of the aptasensor, 2000 ng/ml of HSA, which is 10-folds of the lactoferrin solution (200 ng/ml), as an interfering protein was dissolved in acetate buffer. Then the sensor responses for the individual solution and binary mixtures of lactoferrin and HSA were recorded. In order to examine the practical application of aptasensor, known concentrations of purified lactoferrin ranging from 10 ng/mL to 200 ng/mL were spiked into artificial urine solution. The calibration curve was obtained by plotting the anodic peak currents from the DPV measurements as the function of lactoferrin concentration. Then the LOD was calculated by dividing the standard deviation for three times the blank measurement to the slope of the calibration plot.

Details and further figures can be seen in Naseri et al. (A multivalent aptamer-based electrochemical biosensor for biomarker detection in urinary tract infection, Electrochimica Acta).

Results:

Under the optimized pH, the linear concentration range, limit of detection (LOD) and limit of quantification (LOQ) of the aptamer/SPGE sensor were investigated for lactoferrin detection. Analytical response of the sensor at investigated concentration ranges of 10 ng/mL to 1300 ng/mL was shown in Figure 17A. The calibration curve was obtained by plotting oxidative peak current values of lactoferrin from the DPVs versus concentration as shown in Figure 17B. Two linear concentration ranges for lactoferrin were determined in the range of 10 ng/mL to 50 ng/mL and 50 ng/mL to 1300 ng/mL with correlation coefficient R ² of 0.991. The LODs (3 S/N) and LOQs (5 S/N) values were obtained as 0.9 ng/mL and 3.1 ng/mL, respectively. The presence of these two linear ranges can be explained by the change in binding states from the different binding sites on the aptamer. The obtained LOD using aptamer/SPGE sensor is comparable to the LOD over the commercially available ELISA kit for lactoferrin detection (1 ng/mL). However, the dynamic range of these ELISA kits is much narrower compared to our developed sensor owing to the limitations in the physics of binding of single site receptors which lead to a classical dose based response and a 10-90% saturation of the receptor binding sites over a narrow range of concentrations. This means that by utilizing a multivalent aptamer as the receptor, we can detect a wider range of concentrations of lactoferrin to account for interpatient variation. In a previous work, Arao et al evaluated the lactoferrin concentrations in 121 normal specimens and 88 specimens from patients (60 with UTI) by ELISA to find the required sensitivity for UTI diagnostics (Arao 1999). They obtained the lactoferrin concentrations as 3300 ± 646.3 ng/mL, 60.3 ± 14.9 ng/mL, and 30.4 ± 2.7 ng/mL in the specimens from UTI patients, patients without UTI, and healthy persons, respectively and proposed 200 ng/mL lactoferrin concentration as the cut-off value for negativity. Owing to extended dynamic range towards lactoferrin detection, aptamer/SPGE sensor enables to provide this required sensitivity for UTI diagnostics.

In real matrices of urine samples, common protein species are present along with the target analyte that may adsorb on the sensor surface and influence the sensing performance of aptasensor in practical application. Therefore, it is necessary to investigate the effect of potential interferences on sensor performance and its validation for lactoferrin detection. Since human serum albumin (HSA) is known as a major protein present in urine during urinary tract infection, we investigated the specificity of lactoferrin aptasensor by testing against HSA as non-target protein. In this regards, DPV was applied to detect HSA and the mixed solution with lactoferrin using the proposed aptasensor (data not shown, see Naseri 2021). The results indicate that no obvious DPV response is observed for HSA and the anodic peak current caused by detecting the mixed solution is comparable to that of pure lactoferrin solution (94.06%). The results suggest that our proposed aptasensor exhibits outstanding specificity for lactoferrin detection, which is attributed to the specific recognition between the polynucleotide aptamer and lactoferrin.

Lactoferrin detection in spiked artificial urine

After establishing conditions for detection of lactoferrin in buffer solution using aptamer/SPGE sensor, we sought to detect lactoferrin in artificial urine solution. First, urine samples should be diluted with acetate buffer pH 4.5 to adjust the pH. In order to find optimum condition, DPV responses of urine samples as a blank signal were tested at different dilutions (undiluted, 3-, 5-, and 10-fold dilution). Compared to acetate buffer, the signals for urine samples were higher (data not shown). This fact may be attributed to urine matrix effect, as urine contains a high concentration of electrolytes. For further experiments, 10-fold dilution was selected as an optimized condition to spike lactoferrin due to its lower blank signal. Then DPV responses of aptasensor at different concentrations of lactoferrin in urine solutions were examined (Figure 17A). By plotting oxidative peak current values of lactoferrin from the DPVs versus its logarithmic concentration, a linear calibration curve was obtained in the range of 10 ng/mL to 200 ng/mL with the LODs of 1.2 ng/mL (Figure 17B; all concentrations were calculated in diluted urine). The obtained LOD in urine solution is compatible to the LOD in acetate buffer pH 4.5 (0.9 ng/mL).

Conclusions:

A multivalent aptamer was utilized aiming to extend the dynamic range and increase the sensitivity of the biosensor. A high R _ct value in EIS at aptamer/SPGE confirmed that aptamer was successfully immobilized on the surface of SPGE. Aptamer/SPGE significantly enhanced the oxidation current signal of lactoferrin as compared to unmodified SPGE. Under optimized conditions, aptamer/SPGE possess the excellent selectivity, repeatability, and ultra-high sensitivity in a wide dynamic range from 10 ng/mL to 1300 ng/mL with LOD of 0.9 ng/mL towards detection of lactoferrin in buffer solution. Thanks to direct detection of lactoferrin without requiring the external electrochemical probe, the response time decreased which provides its potential application in point-of-care device. Furthermore, the excellent analytical performance of the fabricated aptasensor towards lactoferrin detection in artificial urine solution made it promising for early diagnosis of UTI.

Example 5: Exonuclease degradation of non-binding aptamers

Aim:

To explore further optimizing steps.

Material and methods:

TdT catalysed molecular imprinting for production of molecularly imprinted aptamers (MIAs) will be performed by preparing 400 pi solutions containing 0.5 mM of the initiator sequence, 75 - 400 mM of dNTPs (dATP X mM, Y mM dCTP, Y mM dTTP and Z mM dGTP) in a buffer, for example 1 x SB1 (sample buffer for example as under “General material and methods”), and template (or target) protein (0.5 mM), for example thrombin or lactoferrin (see for examples as described in Examples 2 and 3). Corresponding non-imprinted aptamers will be formed in the same manner as for MIAs but in the absence of the template (or target) protein (see for examples as described in Examples 2 and 3). Reactions will be initiated by the addition of 1-2 U/mI of TdT and the entire mixture will be allowed to incubate at room temperature for 0.5 - 2 hours. Each reaction will be terminated using 4 pi of 0.2 M EDTA or heat at 75 °C for 10 minutes. The resultant aptamers (the library of aptamers) will be purified using a PCR clean up kit and eluted into 30mI of SB1 buffer. The resultant eluted aptamers will be incubated with 100 - 500 nM of template (or target) protein and diluted with SB1 buffer to a volume of 60mI and will be incubated with 1-2 U/mI of thermolabile exonuclease I for two hours at 37 degrees Celsius. The reaction will be terminated by heating to 80 degrees for 10 minutes. The resultant mixture will be purified again using a PCR clean-up kit and eluted in 30 mI. In the presence of the target (or template), bound aptamers supress the exonuclease activity compared to the unbound polynucleotides, since bound aptamers adopt a secondary structure that suppresses exonuclease activity. As such, unbound aptamers will be degraded, while bound aptamers will not. This serves to increase the efficiency of screening and ensures that the majority of polynucleotide aptamers present in the mixture are binders. In other words, this acts as an additional purification step. The step of exonuclease incubation may be performed at different steps of the production of NIAs and MIAs, depending on the target. In the case of protein targets, a heat denaturing at the end of the synthesis step (as described above) means that the aptamers need to be purified (as the conformation of the protein may be affected by the heat and aptamers may not be able to bind any longer), and add new target protein needs to be added. In the case of small molecule targets, the purification step may be omitted as conformational change may not be occurring or may not be problematic for binding of the aptamers to the target. In this case the exonuclease step can be performed directly after the aptamers, i.e. the library of aptamers, have formed. However, an isolation step may be performed as well. The RAVE step (rapid amplification of variable size DNA/RNA ends) will be performed after separating and extracting the bound aptamers.

Results:

By incubating the target-aptamer library mixture with thermolabile exonuclease I, unbound aptamers will be degraded, while bound aptamers are preserved. This step will act to remove the non-binding aptamers within a mixture of polynucleotides i.e. unbound aptamers. This increases the efficiency of screening when performed with a further separation technique, for example EMSA or by using conjugated beads. This additional step will further increase separation efficiency, separating aptamers specifically binding to the target protein from unbound aptamers. Alternatively, when the step of thermolabile exonuclease l-incubation is added, other partition methods may be omitted.

Conclusions: The step of thermolabile exonuclease l-incubation will further streamline the production of aptamers, thereby simplifying the workflow further.

Sequences

The sequences denoted by SEQ ID NOs 3 to 12 (Thrombin aptamers), as well as SEQ ID NOs 14 to 23 (Lactoferrin aptamers), represent full length aptamers as obtained with the methods disclosed herein. These full length aptamers comprise the initiator sequence (ATCAGTTCGAGCAGATGAGC = SEQ ID NO: 1 at the N-terminus of the aptamer, i.e. from nucleotide at position 1 to and including the nucleotide at position 20). Alternatively, as disclosed herein, a truncated form of the aptamer can be produced, omitting the initiator sequence. For these truncated variants, the first (N- terminal) nucleotide of the aptamer would be the one in position 21 of the sequences denoted by SEQ ID NOs 3 to 12 (Thrombin aptamers), as well as SEQ ID NOs 14 to 23 (Lactoferrin aptamers).

References

Arao 1999, Measurement of urinary lactoferrin as a marker of urinary tract infection, J. Clin. Microbiol. 37 (1999) 553-557.

Ashley 2021, Terminal deoxynucleotidyl transferase-mediated formation of protein binding polynucleotides, Nucleic Acids Res. 2021 Jan 25;49(2): 1065-1074.

Naseri 2021, A multivalent aptamer-based electrochemical biosensor for biomarker detection in urinary tract infection, Electrochimica Acta (2021), doi: https://doi.Org/10.1016/j.electacta.2021.138644

Qi 2020, Practical aptamer-based assay of heavy metal mercury ion in contaminated environmental samples: convenience and sensitivity, Analytical and

Bioanalytical Chemistry (2020) 412:439-448, https://doi.org/10.1007/s00216-019-

02253-8

Items

1. A method for obtaining an aptamer capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Optionally, recovering the candidate aptamers that bind to the target.

2. A method for obtaining a library of aptamers capable of binding to a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and nucleotides in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the library of candidate aptamers with the target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more libraries of aptamers capable of binding to the target, iv. Optionally, recovering the library of aptamers that binds to the target. The method according to any one of the preceding items, further comprising a step of polyadenylating the aptamers capable of binding to the target, and amplifying the polyadenylated aptamers, thereby obtaining amplified, polyadenylated aptamers. The method according to any one of the preceding items, further comprising a step of sequencing the aptamers capable of binding to the target, and/or the amplified, polyadenylated aptamers. The method according to any one of the preceding items, wherein the aptamers are DNA aptamers. The method according to any one of the preceding items, wherein the aptamers are RNA aptamers. The method according to any one of the preceding items, wherein the initiator oligonucleotide in step i. is 3 to 25 nucleotides long. The method according to any one of the preceding items, wherein the initiator oligonucleotide in step i. is further characterized by: a. a delta G for hairpin folding of >-2 and/or b. a delta G of homodimerization of >-7 and/or c. a delta G of heterodimerization of >- 5 and/or d. a melting point within plus/minus 5 degrees Celsius. The method according to any one of the preceding items, wherein the initiator oligonucleotide in step i. has a sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 1, or a homologue thereof having at least 80% identity thereto, such as at least 85%, at least 90% or at least 95% identity thereto. The method according to any one of the preceding items, wherein step i. is performed for 30 to 120 minutes, such as for 30 minutes, such as for 60 minutes, such as for 90 minutes, such as for 120 minutes. The method according to any one of the preceding items, wherein the reaction mixture comprises divalent metal ions such as magnesium ions and/or cobalt ions and/or manganese ions and/or zinc ions, preferably magnesium ions. The method according to any one of the preceding items, wherein the method results in the formation of at least one aptamer binding to a target, preferably wherein the methods results in the formation of a plurality of aptamers binding to a target. The method according to any one of the preceding items, wherein the method results in the formation of an aptamer which binds to one or more binding sites on the target, such as to two binding sites, such as to three binding sites. The method according to any one of the preceding items, wherein the method results in the formation of intermolecular multivalent aptamers. The method according to any one of the preceding items, wherein the method results in the formation of intramolecular multivalent aptamers. The method according to any one of the preceding items, wherein the size distribution of the aptamers is between 3 to 400 nucleotides, such as 3 to 50 nucleotides, such as 3 to 100 nucleotides, such as 3 to 200 nucleotides, such as 3 to 300 nucleotides, such as 3 to 400 nucleotides. The method according to any one of the preceding items, wherein the size distribution of the aptamers is between 3 to 400 nucleotides, such as 10 to 50 nucleotides, such as 50 to 100 nucleotides, such as 100 to 200 nucleotides, such as 100 to 300 nucleotides, such as 200 to 300 nucleotides, such as 200 to 400 nucleotides, such as 300 to 400 nucleotides. The method according to any one of the preceding items, wherein the aptamers are at least 3 nucleotides long, such as at least 10 nucleotides and/or at least 50 nucleotides, and/or at least 100 nucleotides, and/or at least 200 nucleotides and/or at least 300 nucleotides, and/or at least 400 nucleotides long. The method according to any one of the preceding items, wherein the nucleotides are dNTPs, preferably the dNTPs are a. a mixture of dATP, dTTP, dGTP and dCTP, and/or b. dNTPs of one kind only, selected from the group consisting of dATP, dTTP, dGTP and dCTP; and/or c. a mixture of dATP and dTTP, or of dATP and dGTP, or of dATP and dCTP; and/or d. a mixture of dTTP and dGTP, or of dTTP and dCTP and/or e. a mixture of dGTP and dCTP nucleotides and/or f. a mixture of three dNTPs which does not comprise one of dATP, dTTP, dCTP or dGTP, preferably the mixture does not comprise one of dATP, dGTP or dCTP; and/or g. modified or non-natural nucleotides such as 5-lndolyl-AA-dUTP. The method according to any one of the preceding items, wherein the nucleotides are rNTPs, preferably the rNTPs are a. a mixture of rATP, rUTP, rGTP and rCTP, and/or b. rNTPs of one kind only, selected from the group consisting of rATP, rUTP, rGTP and rCTP; and/or c. a mixture of rATP and rUTP, or of rATP and rGTP, or of rATP and rCTP; and/or d. a mixture of rUTP and rGTP, or of rUTP and rCTP and/or e. a mixture of rGTP and rCTP nucleotides and/or f. a mixture of three rNTPs which does not comprise one of rATP, r UTP, rCTP or rGTP, preferably the mixture does not comprise one of rATP, rGTP or rCTP; and/or g. modified or non-natural nucleotides such as 5-lndolyl-AA-rUTP. 21. The method according to any one of the preceding items, wherein a heating and cooling step is performed subsequent to step i. and before ii. to ensure refolding of the library.

22. The method according to item 21, wherein the heating and cooling step is performed by heating the solution to 80 to 96 °C and cooling the solution at a rate of 0.1 to 1°C s ¹ .

23. The method according to any one of the preceding items, wherein step i. and ii. are performed sequentially, thereby obtaining non-imprinted aptamers (NIAs).

24. The method according to any one of the preceding items, wherein step i. and ii. are performed simultaneously, thereby obtaining molecular imprinted aptamers (MIAs).

25. The method according to any one of the preceding items, wherein the candidate aptamer is incubated with the target for a duration of between 30 to 120 minutes, preferably for a duration of 60 minutes.

26. The method according to any one of the preceding items, wherein the buffer has a pH buffer range between 7 and 9.5 and wherein the buffer contains KCI and MgCI ₂ .

27. The method according to any one of the preceding items, wherein the buffer comprises 1 to 50 mM Tris-HCI, 1 to 50 mM KCI and 1-10 mM MgCI ₂ .

28. The method according to any one of the preceding items, wherein the aptamer selection in step iii. is performed in a second buffer comprising 1 to 50 mM Tris- HCI, 1 to 50 mM KCI and 1-10 mM MgCI ₂ .

29. The method according to any one of the preceding items, wherein the buffer used in steps i. to iii. is the same buffer or wherein different buffers are used in steps i. to iii.

30. The method according to any one of the preceding items, wherein the candidate aptamers that bind to a target are selected by a partitioning method, such as a partitioning method selected from the group consisting of electromobility shift assay (EMSA), capillary electrophoresis, affinity capture columns using agarose gel beads, magnetic microspheres, target-conjugated magnetic beads, nitrocellulose filter-binding, microfluidic bases systems and immunosorption.

31. The method according to any one of the preceding items, wherein the polyadenylated candidate aptamers are converted to dsDNA and/or amplified by a polymerase chain reaction (PCR).

32. The method according to any one of the preceding items, wherein the PCR is quantitative real-time PCR (qPCR).

33. The method according to any one of the preceding items, wherein the PCR-based method utilizes a forward primer, wherein the forward primer is identical to the initiator oligonucleotide used during aptamer formation in item 1.

34. The method according to any one of the preceding items, wherein the PCR utilizes a reverse primer which is capable of hybridising to the polyadenylated aptamers.

35. The method according to any one of the preceding items, wherein the reverse primer comprises a poly-T stretch consisting of at least 3 nucleotides, such as 3 nucleotides, such as 4 nucleotides, such as 5 nucleotides, such as 6 nucleotides, such as 7 nucleotides, such as 8 nucleotides, such as 9 nucleotides, such as 10 nucleotides, such as 11 nucleotides, such as 12 nucleotides, such as 13 nucleotides, such as 14 nucleotides.

36. The method according to any one of the preceding items wherein the reverse primer is 3 to 25 nucleotides long.

37. The method according to any one of the preceding items wherein the reverse primer is further characterized by: a. a delta G for hairpin folding of >-2 and/or b. a delta G of homodimerization of >-7 and/or c. a delta G of heterodimerization of >- 5 and/or d. a melting point within plus/minus 5 degrees Celsius. 38. The method according to any one of the preceding items wherein the reverse primer has a sequence comprising or consisting of the nucleotide sequence of SEQ ID NO: 2, or a homologue thereof having at least 80% identity thereto, such as at least 85%, at least 90% or at least 95% identity thereto.

39. The method according to any one of the preceding items, further comprising sequencing the amplified aptamers, whereby aptamer binding motifs are identified.

40. The method according to item 39 wherein the sequencing is done by next generation sequencing (NGS).

41. The method according to any one of the preceding items, wherein further selection rounds are included.

42. The method according to item 41, wherein further selection rounds are performed by incorporating the identified binding motifs into a further initiator oligonucleotide and repeating the method with said further initiator oligonucleotide.

43. The method according to any one of the preceding items, wherein the target is selected from the group consisting of fungi, bacteria and viruses.

44. The method according to any one of the preceding items, wherein the target is selected from the group consisting of atoms, molecules, organelles and cells.

45. The method according to item 44, wherein the molecule is a small molecule or a macromolecule.

46. The method according to any one of items 44 to 45, wherein the molecule a. consists of amino acids such as a peptide, a polypeptide or a protein, optionally a hydrophobic peptide, polypeptide or protein; b. is a carbohydrate; c. is a lipid, d. a nucleic acid or polynucleotide or any combination thereof. 47. The method according to item 44, wherein organelles are intracellular organelles or isolated organelles.

48. The method according to any one of the preceding items, wherein the one or more aptamers capable of binding to the target are used for medical diagnostics, for drug delivery, as therapeutic agents, for food quality control or for environmental monitoring.

49. The method according to any one of the preceding items, wherein the aptamer is a library of aptamers.

50. A kit for selection of a DNA or RNA aptamer, the kit comprising a. a pre-manufactured DNA or RNA library or a DNA or RNA library comprising aptamers as defined in any one of the preceding items; or b. the reagents to produce a DNA or RNA library or a DNA or RNA library comprising aptamers as defined in any one of the preceding items, said reagents comprising at least terminal deoxynucleotidyl transferase (TdT), an initiator oligonucleotide and dNTPs.

51. The kit according to item 50 wherein the kit is for performing the method of any one of items 1 to 49.

52. The kit according to item 50, wherein the kit comprises the reaction as defined in any one of items 1 to 49.

53. The kit according to any one of items 50 to 52 wherein the kit further contains nitrocellulose filters.

54. The kit according to any one of items 50 to 53 wherein the kit further contains spin columns, buffers and/or PCR reagents.

55. The kit according to any one of items 50 to 54, wherein the kit further contains a buffer having a pH between 7 and 9.5 and wherein the buffer contains KCI and MgCI ₂ . A method of diagnosing a disorder or a disease in an individual suspected of suffering of said disorder or disease, wherein the disorder or the disease is characterised by a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and dNTPs in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Detecting the target in a biological sample obtained from the individual by incubating the sample with the recovered aptamers, wherein if the target is detected the individual is diagnosed as suffering from the disease or disorder, and wherein if the target is not detected the individual is classified as not suffering from the disease or disorder. A method of treating a disorder or disease in an individual in need thereof, wherein the disease or disorder is characterised by the presence of a target, comprising the steps of: i. Generating a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and dNTPs in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Administering an effective amount of the recovered aptamers to the individual, thereby treating the disorder or disease in an individual in need thereof. The method according to any one items 56 to 57 wherein the individual in need of diagnosis and/or treatment is a human or a an animal. 59. A method of detecting a target in a sample suspected of comprising the target, comprising the steps of: i. Generating a candidate aptamer or a library of candidate aptamers by incubating terminal deoxynucleotidyl transferase (TdT) with a reaction mixture comprising an initiator oligonucleotide and dNTPs in the presence of a buffer, said library comprising aptamers of various sizes, ii. Incubating the candidate aptamers with said target, iii. Selecting the candidate aptamers that bind to the target, thereby obtaining one or more aptamers capable of binding to the target, iv. Recovering the candidate aptamers that bind to the target, v. Contacting an effective amount of the recovered aptamers with the sample, vi. Determining if aptamers bind to the target in the sample, vii. Optionally, isolating aptamers from step vi, thereby detecting the presence of a target in a sample.

60. The method according to item 59 wherein the sample is a food item, thereby detecting food contaminants.

61. The method according to item 59 wherein the sample is an environmental sample, thereby detecting environmental contaminants.

62. The method according to any one of items 56 to 59, wherein the aptamer or library of aptamers are as defined in any one of the preceding items.

63. Use of a composition comprising a library of candidate aptamers for the selection of aptamers for the detection of a target associated with a disorder or disease.

64. Use of a composition comprising a library of candidate aptamers for the selection of aptamers for the treatment of a disorder or disease.

65. An aptamer or a library of aptamers obtainable by the method of any one of items 1 to 49.