CROSS REFERENCE TO RELATED APPLICATIONS

[0001] The present application claims the priority benefit of U.S. Provisional Application

No. 63/375,171, filed September 9, 2022, which is hereby incorporated by reference in its entirety.

REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY

[0002] The content of the electronically submitted sequence listing (Name:

4525_097PC01_Seqlisting_ST26.xml; Size: 109,664 bytes; and Date of Creation: August 24, 2023), filed with the application, is incorporated herein by reference in its entirety.

FIELD OF DISCLOSURE

[0003] The present disclosure pertains to the medical field, including oncology and gene therapy.

BACKGROUND

[0004] Cancer is associated with high morbidity and mortality, and it is a leading cause of death worldwide, accounting for nearly 10 million deaths in 2020 (Ferlay, J. et al., Global Cancer Observatory: Cancer Today. Lyon: International Agency for Research on Cancer 2020 (Feb. 2021), or nearly one in six illness related deaths. Tumors can form throughout the body and cancer cells can spread from the location where they first formed (i.e., primary tumor) to another or several other parts of the body and form secondary tumors (i.e., metastatic tumor). Current standard of care for cancer include surgery, chemotherapy and radiation therapy. These types of therapy are invasive and may have severe side effects.

[0005] In recent years, therapies based on the activation of the patient's immune system (i.e., targeted immunotherapy) have been used to treat cancer. Monoclonal antibodies (mAbs) and human monoclonal antibodies (HuMAbs) have been used as therapeutics in oncology. However, a wide implementation is hampered by high product cost and prolonged need for frequent administration.

[0006] Cytotoxic T-lymphocyte-associated antigen 4 (CTLA-4) is an immune checkpoint protein acting as a negative regulator of T-cell immune function. Binding of CTLA-4 to its receptor on a cancer cell causes inactivation of the T-cell, limiting the immune system's ability to attack the cancer cell. Inhibition of CTLA-4 via anti-CTLA-4 monoclonal antibodies, resulting in increased activation of the immune system, has led to immunotherapies for several types of cancer (Buchbinder, E. et al., CTLA-4 andPD-1 Pathways, 39:1 American Journal of Clinical Oncology 98-106 (Feb. 2016)).

[0007] Tremelimumab (Ticilimumab, CP-675,206) is a fully human G2 (IgG2) monoclonal antibody that binds to CTLA-4. It has been shown to induce durable tumor responses in patients with metastatic melanoma in Phase 1 and Phase 2 clinical studies. Tremelimumab received orphan drug designation by the FDA to treat mesothelioma, and has been tested on a variety of cancers including lung cancer, melanoma, liver cancer, bladder cancer and head and neck cancer (Comin- Anduix B. et al, Tremelimumab: research and clinical development, Onco Targets Ther. 2016; 9: 1767-1776 (Mar. 2016). However, in a Phase 3 trial in patients with advanced melanoma, tremelimumab failed to demonstrate superiority over standard of care, and as of this filing, tremelimumab has not been approved by the FDA for any indications.

[0008] Ipilimumab, a fully human monoclonal IgGlK antibody against CTLA-4 (Graziani G. et al., Ipilimumab: a novel immunostimulatory monoclonal antibody for the treatment of cancer, 65(1) Pharmacol Res. 9-22 (Jan. 2012)), is the first FDA-approved CTLA-4 inhibitor for oncological use. The cost of Ipilimumab is in the range of thousands of dollars per treatment, and the treatment requires multiple administrations to the patient, thereby contributing to reduced accessibility of the therapeutic agent for a large number of patients. In addition, intravenous (IV) administration of CTLA-4 antibodies may lead to systemic toxicity, and chronic systemic treatments can cause serious side effects, hindering the clinical activity of the treatment. IV administration of CTLA-4 antibodies may also result in limited bioavailability of the antibodies at the tumor sites, urging for the discovery of alternative strategies. BRIEF SUMMARY

[0009] Certain aspects of the disclosure are directed to viral vector (e.g., rAAV) therapies comprising expression constructs for sustained intratumoral expression, and optionally local expression near the tumor, of an anti-CTLA4 antibody in a subject in need thereof. Certain aspects of the disclosure are directed to a viral vector construct capable of providing sustained intratumoral expression of an anti-CTLA4 antibody. In some aspects, the sustained intratumoral expression of the anti-CTLA4 antibody improves one or more of patient compliance, improved treatment outcomes, reduce costs, and/or reduced systemic side effects associated with anti-CTLA4 monoclonal antibody therapy.

[0010] Certain aspects of the disclosure are directed to viral vector therapies comprising expression constructs for sustained intratumoral expression, and optionally local expression, of an anti-CTLA4 antibody in a subject in need thereof, optionally in combination with a second check point inhibiting agent (e.g., a monoclonal antibody). Certain aspects of the present disclosure are directed to a combination therapy, comprising (i) a viral vector construct (e.g., a rAAV) capable of providing sustained intratumoral expression of an anti-CTLA4 antibody and (ii) a checkpoint inhibitor agent (e.g., monoclonal antibody). In some aspects, sustained intratumoral expression of the anti-CTLA4 antibody along with a checkpoint inhibitor agent has the potential to improve patient compliance, improved treatment outcomes, reduce costs, and/or reduced systemic side effects associated with monoclonal antibody therapy alone (e.g., systemic monoclonal antibody therapy).

[0011] Certain aspects of the disclosure are directed to a method of expressing an anti- CTLA4 antibody or antigen-binding fragment thereof in a tumor, comprising administering to the tumor (e.g., by intratumoral injection) a recombinant adeno- associated virus (rAAV) vector comprising an AAV capsid, wherein the rAAV comprises a vector genome packaged within the capsid, the vector genome comprising: (a) an antibody expression cassette comprising: (i) a promoter, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, and (iii) a nucleic acid sequence encoding a light chain variable region (VL) of the anti- CTLA4 antibody or an antigen-binding fragment thereof; (b) a pair of inverted terminal repeats (ITRs). In some aspects, the administration is by intratumoral injection to the tumor. In some aspects, the antibody expression cassette further comprises an enhancer. In some aspects, the antibody expression cassette further comprises a linker sequence.

[0012] In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof is capable of neutralizing CTLA4. In some aspects, the anti-CTLA4 antibody is a monoclonal antibody selected from the group consisting of: Ipilimumab; Zalifrelimab; Tremelimumab (Ticilimumab); Quavonlimab; Bavunalimab (Pavunalimab); Nurulimab; Erfonrilimab; Botensilimab; BMS-986218; KN044; YH001; REGN465; ONC-392; IBI310; HBM4003; ADU-1604; ADG126; and ADG116. In some aspects, the anti- CTLA4 antibody or antigen-binding fragment thereof comprises the VH and VL of Ipilimumab or a functional fragment thereof. In some aspects, the functional fragment comprises an Fc region. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof comprises the VH, VL, and the Fc portion of Ipilimumab.

[0013] In some aspects, the AAV capsid serotype is selected from the group consisting of: AAV1; AAV2; AAV3; AAV4; AAV5; AAV6; AAV7; AAV8; AAVrh8; AAVrh9; AAV9; AAVrhlO; AAVshHIO; AAV10; AAV11; AAV12; and a modified version thereof. In some aspects, the AAV capsid serotype is AAV2. In some aspects, the AAV capsid serotype is AAV6. In some aspects, the AAV capsid is a synthetic capsid. In some aspects, the AAV capsid serotype is a synthetic serotype selected from the group consisting of AAV-DJ, AAV-PHP.B, AAV2-ESGHGYF, AAVM41, AAV-LK03, AAV2-BR1, AAV587MTP, AAV-Anc80L65, AAV2-7m8, AAV2HBKO, AAV2YF, and AAV6.2.

[0014] In some aspects, the tumor comprises a primary tumor and/or a metastatic tumor.

[0015] In some aspects, the tumor comprises a primary tumor and/or a metastatic tumor with lymph node involvement.

[0016] In some aspects, the tumor comprises a mutation indicating that the tumor is susceptible to anti-CTLA-4 treatment.

[0017] In some aspects, the administration comprises injection into a single site of the tumor.

[0018] In some aspects, the administration comprises injection into multiple sites of the tumor.

[0019] In some aspects, the administration comprises injection into a primary tumor.

[0020] In some aspects, the administration comprises injection into a metastatic tumor. [0021] In some aspects, the administration comprises injection into a nodal lesions.

[0022] In some aspects, the administration comprises injection into a primary tumor, or into a metastatic tumor, or into a nodal lesions, or any combination thereof.

[0023] In some aspects, the administration comprises a single dose or multiple doses.

[0024] In some aspects, the administration comprises multiple doses, wherein the first dose is a priming dose and the following doses are maintenance doses. In some aspects, the tumor is an unresectable tumor. In some aspects, the tumor is a resectable tumor. In some aspects, the tumor is removed by surgery. In some aspects, the rAAV particle of the disclosure is administered as a neoadjuvant therapy before the surgery. In some aspects, the rAAV particle of the disclosure is administered as an adjuvant therapy after the surgery. In some aspects, the rAAV particle of the disclosure is administered as a neoadjuvant therapy before the surgery, and as an adjuvant therapy after the surgery. In some aspects, the rAAV particle is co-administer with a chemotherapy. In some aspects, the rAAV particle is co-administer with a radiation therapy.

[0025] In some aspects, the tumor is in an organ and the administration comprises injection into an area in the lymphatic or other vasculature adjacent to the organ.

[0026] In some aspects, the administration comprises a crescendo dosing regimen, wherein the first dose of the rAAV particle is the lowest dose in the dosing regimen and the last dose of the rAAV particle is the highest dose in the dosing regimen. In some aspects, the administration comprises a decrescendo dosing regimen, wherein the first dose of the rAAV particle is the highest dose in the dosing regimen and the last dose of the rAAV particle is the lowest dose in the dosing regimen.

[0027] In some aspects, the administration comprises a dose within the range of between about 1 x 10 ⁸ vg to about 1 x 10 ¹³ vg.

[0028] In some aspects, the tumor is derived from a cancer selected from the group consisting of melanoma, small-cell lung cancer, non-small lung cancer, oat cell carcinoma, prostate cancer, renal carcinoma, urothelial carcinoma, pancreatic cancer, hematologic neoplasms, metastatic sarcoma, non-Hodgkin B-cell lymphoma, gastric or gastroesophageal junction cancer, pediatric advanced solid tumor, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triple-negative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof.

[0029] In some aspects, the tumor is derived from a hematologic malignancy, selected from the group consisting, hematologic neoplasms chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof.

[0030] In some aspects, the cancer is a solid tumor. In some aspects, the tumor is derived from a cancer selected from the group consisting of a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a non-small lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B- cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof

[0031] In some aspects, the size of the tumor (e.g. primary tumor) is at least about 0.1 cm, at least about 0.15 cm, at least about 0.2 cm, at least about 0.25 cm, at least about 0.3 cm, at least about 0.35 cm, at least about 0.4 cm, at least about 0.45 cm, at least about 0.5 cm, at least about 0.55 cm, at least about 0.6 cm, at least about 0.65 cm, at least about 0.7 cm, at least about 0.75 cm, at least about 0.8 cm, at least about 0.85 cm, at least about 0.9 cm, at least about 0.95 cm, at least about 1 cm in diameter, at least about 2 cm in diameter, at least about 3 cm in diameter, at least about 4 cm in diameter, at least about 5 cm in diameter, at least about 6 cm in diameter, at least about 7 cm in diameter, at least about 8 cm in diameter, at least about 9 cm in diameter, at least about 10 cm in diameter, at least about 11 cm in diameter, at least about 12 cm in diameter, at least about 13 cm in diameter, at least about 14 cm in diameter, or at least about 15 cm in diameter.

[0032] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter. In some aspects, the tumor (e.g., primary tumor) is about 0.1 cm to about 15 cm in diameter, about 0.2 cm to about 15 centimeters (cm) in diameter, about 0.3 cm to about 15 cm in diameter, about 0.4 cm to about 15 centimeters (cm) in diameter, about 0.5 cm to about 15 cm in diameter, about 1 cm to about 15 centimeters (cm) in diameter, about 2 cm to about 15 centimeters (cm) in diameter, about 5 cm to about 15 centimeters (cm) in diameter, about 7.5 cm to about 15 centimeters (cm) in diameter, about 10 cm to about 15 centimeters (cm) in diameter, or about 12.5 cm to about 15 centimeters (cm) in diameter.

[0033] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter, about 0.1 cm to about 14 cm in diameter, about 0.1 cm to about 13 cm in diameter, about 0.1 cm to about 12 cm in diameter, about 0.1 cm to about 11 cm in diameter, about 0.1 cm to about 10 cm in diameter, about 0.1 cm to about 9 cm in diameter, about 0.1 cm to about 8 cm in diameter, about 0.1 cm to about 7 cm in diameter, about 0.1 cm to about 6 cm in diameter, about 0.1 cm to about 5 cm in diameter, about 0.1 cm to about 4 cm in diameter, about 0.1 cm to about 3 cm in diameter, about 0.1 cm to about 2.5 cm, about 0.1 cm to about 2 cm in diameter, about 0.1 cm to about 1.5 cm in diameter, about 0.1 cm to about 1 cm in diameter, about 0.1 cm to about 0.75 cm in diameter, about 0.1 cm to about 0.5 cm in diameter, about 0.5 cm to about 10 cm in diameter, about 0.5 cm to about 9 cm in diameter, about 0.5 cm to about 8 cm in diameter, about 0.5 cm to about 7.5 cm in diameter, about 0.5 cm to about 7 cm in diameter, about 0.5 cm to about 6 cm in diameter, about 0.5 cm to about 5 cm in diameter, about 0.5 cm to about 4 cm in diameter, about 0.5 cm to about 3 cm in diameter, about 0.5 cm to about 2 cm in diameter, or about 0.5 cm to about 1 cm in diameter.

[0034] In some aspects, the tumor is treated and/or the tumor size is reduced.

[0035] In some aspects, the method further comprises administering a checkpoint inhibitor agent to a subject suffering from the tumor. In some aspects, the checkpoint inhibitor agent comprises an inhibitor of programmed cell death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), lymphocyte-activated gene 3 (LAG-3), T-cell immunoglobulin mucin-containing protein 3 (TIM-3), B and T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), adenosine A2a receptor (A2aR), killer cell immunoglobulin like receptor (KIR), indoleamine 2,3-dioxygenase (IDO), CD20, CD39, CD73, inducible T-cell costimulatory (ICOS), B7-H3, or any combination thereof. In some aspects, the checkpoint inhibitor agent is an inhibitor of programmed death protein 1 (PD-1) inhibitor. In some aspects, the checkpoint inhibitor agent is an inhibitor of programmed death-ligand 1 (PD-L1) inhibitor.

[0036] In some aspects, the checkpoint inhibitor agent is an antibody.

[0037] In some aspects, the checkpoint inhibitor agent is a monoclonal antibody.

[0038] In some aspects, the checkpoint inhibitor agent is administered to the subject intravenously or intratum orally. In some aspects, the checkpoint inhibitor agent is administered to the subject intravenously.

[0039] In some aspects, the checkpoint inhibitor agent is administered to the subject before or after administering the rAAV. In some aspects, the checkpoint inhibitor agent and the rAAV are administered simultaneously.

[0040] In some aspects, the check point inhibitor agent is administered by rAAV vector comprising an AAV construct expressing the check point inhibitor agent.

[0041] In some aspects, the CTLA-4 neutralization in the tumor is increased following rAAV administration (e.g., intratumoral administration) disclosed herein compared to CTLA-4 neutralization in a tumor in a subject administered a CTLA4 neutralizing checkpoint inhibitor protein (e.g., by systemic administration).

[0042] Certain aspects of the disclosure are directed to a composition comprising a recombinant adeno-associated virus (rAAV) vector comprising an AAV capsid, wherein the rAAV comprises a vector genome packaged within the capsid, the vector genome comprising: (a) an antibody expression cassette comprising: (i) a promoter, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T- Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, and (iii) a nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen-binding fragment thereof; (b) a pair of inverted terminal repeats (ITRs); wherein the rAAV is formulated for intratumoral injection to the tumor.

[0043] In some aspects, the antibody expression cassette further comprises an enhancer (e.g., CMV enhancer). In some aspects, the antibody expression cassette further comprises a linker sequence. [0044] In some aspects, the linker sequence comprises an IRES, a proteolytic cleavage site, or a combination thereof. In some aspects, the proteolytic cleavage site comprises a furin cleavage site, a 2A cleavage site, a P2A cleavage site, a T2A cleavage site, a E2A cleavage site, a F2A cleavage site, a BmCPV 2A cleavage site, a BmIFV 2A cleavage site, or any combination thereof. In some aspects, the proteolytic cleavage site comprises a furin cleavage site and a 2A cleavage site. In some aspects, the furin cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 2. In some aspects, the 2A cleavage site comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 1.

[0045] In some aspects, the promoter is a constitutive promoter. In some aspects, the promoter is a CAG promoter, a CBA promoter, a CMV promoter, an EFla promoter, a CMV promoter with a CMV enhancer, a CMV promoter with a SV40 intron, an EFla with a CMV enhancer, or a tissue specific promoter. In some aspects, the promoter is a CAG promoter.

[0046] In some aspects, the promoter is a cancer specific promoter. In some aspects, the promoter (e.g., cancer specific promoter) is a hTERT promoter, a Survivin promoter, an Integrin promoter, a EGFR promoter, a HER2/NEU promoter, a VEGFR promoter, a FR promoter, a CD71 promoter, a TRA-1-60 promoter, a COX promoter, an AFP promoter, a CCKAR promoter, a CEA promoter, a c-erbB2 promoter, a CXCR4 promoter, a E2F-1 promoter, a HE4 promoter, a MUC1 promoter, a PSA promoter, or a TRP1 promoter. In some aspects, the promoter is a hTERT promoter. In some aspects, the promoter is a Survivin promoter.

[0047] In some aspects, the antibody expression cassette comprises a poly(A) sequence. In some aspects, the poly(A) sequence is selected from a bGHpA, a hGHpA, a SV40pA, a hGHpA, or a synthetic pA.

[0048] In some aspects, the ITRs are AAV2 serotype or a modified version thereof.

[0049] In some aspects, the antibody expression cassette comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49, 50, 51, or 52. [0050] In some aspects, the vector genome comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36, 37, 38, or 39.

BRIEF DESCRIPTION OF THE FIGURES

[0051] FIGs. 1A-1D show an exemplary AAV constructs designed to include flanking ITRs, a promoter, poly A, and open reading frame (ORF) comprising nucleic acids encoding an anti-CTLA-4 antibody heavy chain (HC) and light chain (LC).

[0052] FIGs. 2A-2D show Ipilimumab expression in four cell lines after transfection with four different constructs including different promoters (as shown in FIGs. 1 A-1D). FIG. 2A shows expression levels of HuIgG in HEK293T cells transfected with 1 A-CTLA4- CAG, lD-CTLA4-smCBA, lC-CTLA4-Survivin, or lB-CTLA4-hTERT. FIG. 2B shows expression levels of HuIgG in HT-1080 cells transfected with 1A-CTLA4-CAG, 1D- CTLA4-smCBA, lC-CTLA4-Survivin, or lB-CTLA4-hTERT. FIG. 2C shows expression levels of HuIgG in Cloudman cells transfected with 1 A-CTLA4-CAG, 1D- CTLA4-smCBA, lC-CTLA4-Survivin, or lB-CTLA4-hTERT. FIG. 2D shows expression levels of HuIgG in A549 cells transfected with 1A-CTLA4-CAG, 1D-CTLA4- smCBA, lC-CTLA4-Survivin, or lB-CTLA4-hTERT.

[0053] FIGs. 3A-3B show a CTLA-4 Binding Assay. FIG. 3 A shows a schematic of the Gyrolab xPlore system (Gyros Protein Technologies) assay. FIG. 3B shows CTLA-4 Binding of Expressed IgG (ng/mL) compared to huIgG titer (ng/mL). Measurements were done by Gyrolab xPlore system (Gyros Protein Technologies) assay.

[0054] FIG. 4 shows a chart representing an hCTLA-4 Blockade Bioassay.

DETAILED DESCRIPTION OF THE DISCLOSURE

[0055] Certain aspects of the disclosure are directed to AAV constructs encoding anti- CTLA-4 antibodies (e.g., monoclonal antibodies) or antigen-binding fragments thereof, viral vectors comprising the same (e.g., recombinant adeno-associated viral (rAAV) vectors), and methods of using the same. Certain aspects of the disclosure are directed to a combination therapy comprising (i) a rAAV encoding an anti-CTLA4 antibody antigenbinding fragment thereof and (ii) a checkpoint inhibitor agent. I. Definitions

[0056] In order that the present disclosure can be more readily understood, certain terms are first defined. Additional definitions are set forth throughout the detailed disclosure.

[0057] It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleic acid sequence," is understood to represent one or more nucleic acid sequences, unless stated otherwise. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein.

[0058] Furthermore, "and/or", where used herein, is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone).

[0059] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of and/or "consisting essentially of are also provided.

[0060] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower).

[0061] The term "at least" prior to a number or series of numbers is understood to include the number adjacent to the term "at least," and all subsequent numbers or integers that could logically be included, as clear from context. For example, the number of nucleotides in a nucleic acid molecule must be an integer. For example, "at least 18 nucleotides of a 21 -nucleotide nucleic acid molecule" means that 18, 19, 20, or 21 nucleotides have the indicated property. When at least is present before a series of numbers or a range, it is understood that "at least" can modify each of the numbers in the series or range. "At least" is also not limited to integers (e.g., "at least 5%" includes 5.0%, 5.1%, 5.18% without consideration of the number of significant figures). [0062] As used herein, "no more than" or "less than" is understood as the value adjacent to the phrase and logical lower values or integers, as logical from context, to zero. When "no more than" is present before a series of numbers or a range, it is understood that "no more than" can modify each of the numbers in the series or range.

[0063] As used herein, the term "subject" refers to any organism to which a composition disclosed herein, e.g., a rAAV vector of the present disclosure, can be administered, e.g., for experimental, diagnostic, prophylactic, and/or therapeutic purposes. Typical subjects include any animal (e.g., mammals such as mice, rats, rabbits, non-human primates, and humans). A subject can seek or be in need of treatment, require treatment, be receiving treatment, be receiving treatment in the future, or be a human or animal who is under care by a trained professional for a particular disease or condition.

[0064] The term "derived from," as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism. For example, a nucleic acid sequence (e.g., an AAV vector) that is derived from a second nucleic acid sequence (e.g., another AAV vector) can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of a polynucleotide disclosed herein, the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis. In some aspects, a tumor that is derived from a specified cancer includes a tumor that shares a lineage from the specified cancer.

[0065] As used herein, the term "administration" refers to the administration or delivery of a therapeutic agent (e.g., a construct, a rAAV vector, combination therapy, or composition disclosed herein) to a subject or system. Administration to an animal subject (e.g., to a human) can be by any appropriate route (e.g., intratumoral injection).

[0066] As used herein, the term "intratumoral injection" refers to the injection of a therapeutic agent or composition into a tumor mass. In some aspects, the injection comprises injection with an administrative device such as a needle.

[0067] The term "fanning administration" or "administered by fanning" as used herein refers to a method where the administration device (e.g., needle) moves in multiple directions within a mass (e.g., a tumor). In some aspects, the fanning administration technique allows for more homogenous distribution and coverage of the perfused mass compared to a technique where the needle moves in only one direction.

[0068] As used herein, the terms "re-administration," "repeat administration," and "redosing" refer to an administration of one or more additional dose(s) of a therapeutic agent, e.g., a construct, a rAAV vector, combination therapy, or composition of the disclosure, following a first administration.

[0069] As used herein, the term "priming dose" refers to the initial dose of a drug that is administered.

[0070] As used herein, the term "maintenance dose", refers to the dose of an administered drug which is administered subsequently to the priming dose. The priming dose and the maintenance dose can be the same or different. The priming dose and the maintenance dose can be administered via the same or different route.

[0071] As used herein, the term "crescendo dosing", or "crescendo dosing regimen", refers to a dosing regimen wherein the first dose of the administered substance (e.g., drug, medicine, or rAAV particle) is the lowest dose in the dosing regimen and the last dose of the administered substance (e.g., drug, medicine, or rAAV particle) is the highest dose in the dosing regimen. As used herein, the term "decrescendo dosing", or "decrescendo dosing regimen", refers to a dosing regimen wherein the first dose of the administered substance (e.g., drug, medicine, or rAAV particle) is the highest dose in the dosing regimen and the last dose of the administered substance (e.g., drug, medicine, or rAAV particle) is the lowest dose in the dosing regimen. As used herein, the term "dosing regimen", or "dosage regimen", refers to the frequency of administration, the dose per a single administration, the time interval between administrations, duration of treatments, and how a substance (e.g., drug, medicine, or rAAV particle) is to be taken.

[0072] As used herein, the terms "effective amount," "therapeutically effective amount," and a "sufficient amount" of, e.g., a construct, a rAAV vector, combination therapy, or composition disclosed herein refer to a quantity sufficient to, when administered to the subject, including a human, effect beneficial or desired results, including clinical results, and, as such, an "effective amount" or synonym thereto depends on the context in which it is being applied. In some aspects, a therapeutically effective amount of an agent (e.g., a construct, a rAAV vector, combination therapy, or composition disclosed herein) is an amount that results in a beneficial or desired result in a subject as compared to a control. [0073] The amount of a given agent (e.g., a construct, a rAAV vector, combination therapy, or composition disclosed herein) will correspond to such an amount will vary depending upon various factors, such as the given agent, the pharmaceutical formulation, the route of administration, the type of disease or disorder, the identity of the subject (e.g., age, sex, and/or weight) or host being treated, and the like.

[0074] The term "prophylactically effective amount," as used herein, includes the amount of an agent, (e.g., a construct, a rAAV vector, combination therapy, or composition disclosed herein) that, when administered to a subject having or predisposed to have a disease or disorder (e.g., cancer) is sufficient to prevent, reduce the symptoms of, or ameliorate the disease or disorder or one or more symptoms of the disease or disorder. Ameliorating the disease or disorder includes slowing the course of the disease or disorder or reducing the severity of later-developing disease or disorder. The "prophylactically effective amount" can vary depending on the characteristics of the agent, e.g., a construct, a rAAV vector, combination therapy, or composition of the disclosure, how the agent is administered, the degree of risk of disease, and the history, age, weight, family history, genetic makeup, the types of preceding or concomitant treatments, if any, and other individual characteristics of the patient to be treated.

[0075] A "cancer" refers to a broad group of various diseases characterized by the uncontrolled growth of abnormal cells (e.g., malignant cells) in the body. Unregulated cell division and growth results in the formation of malignant tumors that invade neighboring tissues through local spread and can also metastasize to distant parts of the body through the lymphatic system or bloodstream. In some aspects, the methods of the present disclosure can be used to reduce the size of a primary tumor or a metastatic tumor, or treat a primary tumor or a metastatic tumor.

[0076] The term "primary tumor", as used herein, refers to the original, or first, tumor formed in the subject's body.

[0077] The term "metastasis", "metastatic", "secondary tumor", or "metastatic tumor", as used herein, refer to cancer (e.g., a tumor) formed by cancer cells derived from a primary cancer (e.g., tumor) that spread to further locations or areas of the body.

[0078] The term "locally advanced cancer", as used herein, refers to a metastatic cancer that has spread to nearby tissues or lymph nodes. [0079] The term "tumor" as used herein refers to any mass of tissue that results from excessive cell growth or proliferation, either benign (non-cancerous) or malignant (cancerous), including pre-cancerous lesions.

[0080] As used herein, the term "hematologic malignancy", refers to cancers that affect the blood, the bone marrow, and the lymph nodes. This classification includes various types of leukemia (e.g., acute lymphocytic (ALL), chronic lymphocytic (CLL), acute myeloid (AML), chronic myeloid (CML)), myeloma, and lymphoma (e.g., Hodgkin's and non-Hodgkin's (NHL)).

[0081] As used herein, the term "lesion", refers to an area of abnormal tissue. A lesion may be benign (not cancer) or malignant (cancer). A "nodal lesion", refers to a lesion located at or near a lymph node. A "non-nodal lesion", refers to a lesion located outside of or independent of any lymph nodes.

[0082] As used herein, the terms "treat," "treated," and "treating" mean both therapeutic treatment and prophylactic or preventative measures wherein the object is to prevent or slow down (lessen) an undesired physiological condition, disorder, or disease, or obtain beneficial or desired clinical results. In some aspects, treating reduces or lessens the symptoms associated with a disease or disorder. In some aspects, the treating results in a beneficial or desired clinical result. For example, treating a tumor can reduce or lessen the symptoms associated with the tumor, reduces or lessens the severity of at least one indicator of the presence of the tumor, or induces tumor regression.

[0083] Beneficial or desired clinical results include, but are not limited to, alleviation of symptoms; diminishment of the extent of a condition, disorder, or disease; stabilized (i.e., not worsening) state of condition, disorder, or disease; delay in onset or slowing of condition, disorder, or disease progression; amelioration of the condition, disorder, or disease state or remission (whether partial or total), whether detectable or undetectable; an amelioration of at least one measurable physical parameter, not necessarily discernible by the patient; or enhancement or improvement of condition, disorder, or disease. In some aspects, treatment includes eliciting a clinically significant response without excessive levels of side effects. In some aspects, treatment includes prolonging survival as compared to expected survival if not receiving treatment. As used herein, the term "amelioration" or "ameliorating" refers to a lessening of severity of at least one indicator of a condition or disease. As used herein, the term "preventing" or "prevention" refers to delaying or forestalling the onset, development or progression of a condition or disease for a period of time, including weeks, months, or years.

[0084] The term "pharmaceutical composition," as used herein, represents a composition comprising a compound or molecule described herein, e.g., a rAAV vector disclosed herein, formulated with a pharmaceutically acceptable excipient, and can be manufactured or sold with the approval of a governmental regulatory agency as part of a therapeutic regimen for the treatment of disease in a mammal.

[0085] A "pharmaceutically acceptable excipient," as used herein, refers to any ingredient other than the compounds described herein (for example, a vehicle capable of suspending or dissolving the active compound) and having the properties of being substantially nontoxic and non-inflammatory in a patient.

[0086] The term a "therapeutic agent" or "therapeutic molecule" includes a compound or molecule that, when present in an effective amount, produces a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof. It includes any compound, e.g., a small molecule drug, or a biologic (e.g., a polypeptide drug or a nucleic acid drug) that when administered to a subject has a measurable or conveyable effect on the subject, e.g., it alleviates or decreases a symptom of a disease, disorder or condition. In some aspects, the therapeutic molecule is rAAV vector comprising an expression cassette encoding an anti-CTLA4 antibody or functional fragment thereof.

[0087] As used herein, the term "peri-operative", refers to the period of time around the time of a surgery.

[0088] As used herein, the terms "adjuvant treatment" and "neoadjuvant treatment" refer to treatments that are delivered before or after the primary treatment for a cancer. For example, neoadjuvant therapies can be delivered before the primary treatment, to help reduce the size of a tumor or kill cancer cells that have spread. Adjuvant therapies can be delivered after the primary treatment, to destroy remaining cancer cells.

[0089] The terms "operatively linked," "operatively inserted," "operatively positioned," "under control" or "under transcriptional control" means that the promoter is in the correct location and orientation in relation to the nucleic acid to control RNA polymerase initiation and expression of the gene. The term "operably linked" means that a DNA sequence and a regulatory sequence(s) are connected in such a way as to permit gene expression when the appropriate molecules (e.g., transcriptional activator proteins) are bound to the regulatory sequence(s). The term "operably inserted" means that the DNA of interest introduced into the cell is positioned adjacent a DNA sequence which directs transcription and translation of the introduced DNA (i.e., facilitates the production of, e.g., a polypeptide encoded by a DNA of interest).

[0090] "Nucleic acid," "polynucleotide," and "oligonucleotide," are used interchangeably in the present application. These terms refer only to the primary structure of the molecule. Thus, these terms include double- and single-stranded DNA, as well as double- and single-stranded RNA. The terms "nucleic acid," "polynucleotide," and "oligonucleotide," as used herein, are defined as it is generally understood by the skilled person as a molecule comprising two or more covalently linked nucleosides. Such covalently bound nucleosides can also be referred to as nucleic acid molecules or oligomers. Polynucleotides can be made recombinantly, enzymatically, or synthetically, e.g., by solid-phase chemical synthesis followed by purification. When referring to a sequence of the polynucleotide or nucleic acid, reference is made to the sequence or order of nucleobase moieties, or modifications thereof, of the covalently linked nucleotides or nucleosides.

[0091] The term "mRNA" as used herein, refers to a single stranded RNA that encodes the amino acid sequence of one or more polypeptide chains.

[0092] A "coding sequence" or a sequence "encoding" a particular molecule (e.g., a therapeutic protein or peptide) is a nucleic acid that is transcribed (in the case of DNA) or translated (in the case of mRNA) into polypeptide, in vitro or in vivo, when operably linked to an appropriate regulatory sequence, such as a promoter. The boundaries of the coding sequence are determined by a start codon at the 5' (amino) terminus and a translation stop codon at the 3' (carboxy) terminus. A coding sequence can include, but is not limited to, cDNA from prokaryotic or eukaryotic mRNA, genomic DNA sequences from prokaryotic or eukaryotic DNA, and synthetic DNA sequences. A transcription termination sequence will usually be located 3' to the coding sequence.

[0093] As used herein, the term "polypeptide" is intended to encompass a singular "polypeptide" as well as plural "polypeptides," and comprises any chain or chains of two or more amino acids. Thus, as used herein, a "peptide," a "peptide subunit," a "protein," an "amino acid chain," an "amino acid sequence," or any other term used to refer to a chain or chains of two or more amino acids, are included in the definition of a "polypeptide," even though each of these terms can have a more specific meaning. The term "polypeptide" can be used instead of, or interchangeably with any of these terms. The term further includes polypeptides which have undergone post-translational or postsynthesis modifications, for example, conjugation of a palmitoyl group, glycosylation, acetylation, phosphorylation, amidation, derivatization by known protecting/blocking groups, proteolytic cleavage, or modification by non-naturally occurring amino acids. The term "peptide," as used herein encompasses full length peptides and fragments, variants or derivatives thereof. A "peptide" as disclosed herein, can be part of a fusion polypeptide comprising additional components such as, e.g., an Fc domain or an albumin domain, to increase half-life. A peptide as described herein can also be derivatized in a number of different ways. A peptide described herein can comprise modifications including e.g., conjugation of a palmitoyl group.

[0094] The term "subunit" refers to a polypeptide that can assemble with another polypeptide to form a protein comprising two or more subunits (e.g., an immunoglobulin (Ig)). In some aspects, a delivery vector of the disclosure can include a coding region for each of the subunits. For example, a viral vector can include both the coding region for the Ig heavy chain (or the variable region of the Ig heavy chain) and the coding region for the Ig light chain (or the variable region of the Ig light chain).

[0095] "Percent (%) sequence identity" or "Percent (%) identity" with respect to a reference polynucleotide or polypeptide sequence is defined as the percentage of nucleic acids or amino acids in a candidate sequence that are identical to the nucleic acids or amino acids in the reference polynucleotide or polypeptide sequence, after aligning the sequences and introducing gaps, if necessary, to achieve the maximum percent sequence identity. Alignment for purposes of determining percent nucleic acid or amino acid sequence identity can be achieved in various ways that are within the capabilities of one of skill in the art, for example, using publicly available computer software such as BLAST, BLAST-2, or Megalign software. Those skilled in the art can determine appropriate parameters for aligning sequences, including any algorithms needed to achieve maximal alignment over the full length of the sequences being compared. For example, percent sequence identity values can be generated using the sequence comparison computer program BLAST. [0096] As used herein, the term "modified" refers to a changed state or structure of a molecule of the disclosure. Molecules can be modified in many ways including chemically, structurally, and functionally.

[0097] As used herein, the term "synthetic" means produced, prepared, and/or manufactured by the hand of man. Synthesis of polynucleotides or polypeptides or other molecules of the present disclosure can be chemical or enzymatic.

[0098] As used herein, the term "promoter" refers to a DNA sequence recognized by the machinery of the cell, or introduced synthetic machinery, required to initiate the specific transcription of a gene. The term "promoter" is also meant to encompass those nucleic acid elements sufficient for promoter-dependent gene expression controllable for celltype specific, tissue-specific or inducible by external signals or agents; such elements can be located in the 5' or 3' regions of the native gene. In some aspects, the promoter is a constitutive promoter, a cell-type specific promoter, or an inducible promoter.

[0099] As used herein, the term "regulatable promoter" is any promoter whose activity is affected by a cis or trans acting factor (e.g., an inducible promoter, such as an external signal or agent).

[0100] As used herein, the term "constitutive promoter" is any promoter that directs RNA production in many or all tissue/cell types at most times, e.g., the human CMV immediate early enhancer/promoter region that promotes constitutive expression of cloned DNA inserts in mammalian cells.

[0101] As used herein, the term "ubiquitous promoters" is any promoter that is strongly active in a wide range of cells, tissues and cell cycles.

[0102] As used herein, the term "bidirectional promoter" is the intergenic region between two divergent genes located on complementary strands of the DNA which drives their coordinated transcription in opposite directions.

[0103] As used herein, the term "tissue-specific promoter", refers to a promoter that has activity only in certain cell types, i.e., drives the expression of the operably linked nucleotide sequence only in certain cell types.

[0104] As used herein, the term "cancer specific promoter", refers to a promoter that has activity only or preferentially in cancerous cells, i.e., drives the expression of the operably linked nucleotide sequence only or preferentially in cancerous cells. Cancer specific promoters may have activity in various types of cancers without any particular tissue/tumor specificity (e.g., hTERT promoter), or may have activity in certain types of cancerous cells (e.g., EA4D, liver cancer; LALBA, breast cancer).

[0105] As used herein, the term "enhancer" is a cis-acting element that stimulates or inhibits transcription of adjacent genes. An enhancer that inhibits transcription is also referred to as a "silencer." Enhancers can function (e.g., can be associated with a coding sequence) in either orientation, over distances of up to several kilobase pairs (kb) from the coding sequence and from a position downstream of a transcribed region.

[0106] The terms "transcriptional regulatory protein," "transcriptional regulatory factor," and "transcription factor" are used interchangeably herein, and refer to a nuclear protein that binds a DNA response element and thereby transcriptionally regulates the expression of an associated gene or genes. Transcriptional regulatory proteins generally bind directly to a DNA response element, however in some cases binding to DNA can be indirect by way of binding to another protein that in turn binds to, or is bound to a DNA response element.

[0107] As used herein, the term "termination signal sequence" can be any genetic element that causes RNA polymerase to terminate transcription, such as for example a polyadenylation signal sequence. A polyadenylation signal sequence is a recognition region necessary for endonuclease cleavage of an RNA transcript that is followed by the polyadenylation consensus sequence AATAAA. A polyadenylation signal sequence provides a "polyA site," i.e., a site on a RNA transcript to which adenine residues will be added by post-transcriptional polyadenylation.

[0108] As used herein, the term "internal ribosome entry site" or "IRES" refers to an element that promotes direct internal ribosome entry to the initiation codon, such as ATG, of a cistron (a protein encoding region), thereby leading to the cap-independent translation of the gene. See, e.g., Jackson R J et al., Trends Biochem Sci 15(12):477-83 (199); Jackson R J and Kaminski, A. RNA 1 (10):985-l 000 (1995). "Under translational control of an IRES" as used herein means that translation is associated with the IRES and proceeds in a cap-independent manner.

[0109] The term "self-processing cleavage site" or "self-processing cleavage sequence," as used herein refers to a post-translational or co-translational processing cleavage site or sequence. Such a "self-processing cleavage" site or sequence refers to a DNA or amino acid sequence, exemplified herein by a 2A site, sequence or domain or a 2A-like site, sequence or domain. The term "self-processing peptide" is defined herein as the peptide expression product of the DNA sequence that encodes a self-processing cleavage site or sequence, which upon translation, mediates rapid intramolecular (cis) cleavage of a protein or polypeptide comprising the self-processing cleavage site to yield discrete mature protein or polypeptide products.

[0110] As used herein, the term "additional proteolytic cleavage site," refers to a sequence that is incorporated into an expression construct of the disclosure adjacent a self-processing cleavage site, such as a 2A (e.g., SEQ ID NO: 1) or 2A like sequence, and provides a means to remove additional amino acids that remain following cleavage by the self-processing cleavage sequence. Exemplary 2A peptides include, but are not limited to, P2A, E2A, F2A, and T2A. Exemplary "additional proteolytic cleavage sites" are described herein and include, but are not limited to, furin cleavage sites with the consensus sequence RXKRR (SEQ ID NO: 2) or RXKR. Such furin cleavage sites can be cleaved by endogenous subtili sin-like proteases, such as furin and other serine proteases within the protein secretion pathway. In some aspects, other exemplary "additional proteolytic cleavage sites" can be used, as described in e.g., Lie et al., Sci Rep 7, 2193 (2017).

[OHl] The term "expression vector" or "expression construct" means any type of genetic construct containing a nucleic acid in which part or all of the nucleic acid encoding sequence is capable of being transcribed. In some aspects, the expression vector or construct can comprise an antibody expression cassette.

[0112] As used herein, the term "delivery vector" or "vector" refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell, such as a plasmid, phage, transposon, cosmid, chromosome, artificial chromosome, virus, virion, etc. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A "replicon" refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control. The term "delivery vector" or "vector" includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. In some aspects, insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector. Examples of selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, ie., anthocyanin regulatory genes, isopentanyl transferase gene, and the like. Examples of reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), P-galactosidase (LacZ), P-glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. In some aspects, the delivery vector is selected from the group consisting of a viral vector (e.g., an AAV vector), a plasmid, a lipid, a protein particle, a bacterial vector, and a lysosome.

[0113] Some aspects of the disclosure are directed to biological vectors, which can include viruses, particularly attenuated and/or replication-deficient viruses.

[0114] A "viral vector" refers to a sequence that comprises one or more polynucleotide regions encoding or comprising a molecule of interest, e.g., a protein, a peptide, and an oligonucleotide or a plurality thereof. Viral vectors can be used to deliver genetic materials into cells. Viral vectors can be modified for specific applications. In some aspects, the delivery vector of the disclosure is a viral vector selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0115] The term "adeno-associated virus vector" or "AAV vector" or "adeno-associated viral vector" as used herein refers to any vector that comprises or derives from components of an adeno-associated vector and is suitable to infect mammalian cells, preferably human cells. The term AAV vector typically designates an AAV-type viral particle or virion comprising a payload. The AAV vector can be derived from various serotypes, including combinations of serotypes (i.e., "pseudotyped" AAV) or from various genomes (e.g., single stranded or self-complementary). In addition, the AAV vector can be replication defective and/or targeted. As used herein, the term "adeno- associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3 A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh8, AAVrhlO, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol. 78:6381 (2004)) and Moris et al. (Virol. 33 :375 (2004)), and any other AAV now known or later discovered. See, e.g., FIELDS et al.

VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some aspects, an "AAV vector" includes a derivative of a known AAV vector. In some aspects, an "AAV vector" includes a modified or an artificial AAV vector. In some aspects, an AAV vector includes a hybrid vector (e.g., AAV-DJ, AAV-PHP.B, AAV2-ESGHGYF, AAVM41, AAV-LK03, AAV2-BR1, AAV587MTP, AAV-Anc80L65, AAV2-7m8, AAV2HBKO, AAV2YF, AAV6-RGD or AAV6.2). In some aspects, the terms "AAV genome" and "AAV vector" can be used interchangeably. In some aspects, the AAV vector is modified relative to the wild-type AAV serotype sequence. In some aspects, the modified AAV vector is a modified AAV6, e.g., an AAV6 vector comprising the RGD peptide (an AAV6-RGD vector) or an AAV6 vector comprising mutations of surface exposed tyrosine residues as described, for example, in Sayroo et al. Gene Ther. 2016 Jan; 23(1): 18-25. In some aspects, the AAV6-RGD vector further comprises modified amino acids corresponding to Y705, Y731, T492, and K531, (e.g., Y705, Y73 IF, T492V, and K53 IE; also referred to as AAV-RGD-Y705-731F+T492V+K53 IE).

[0116] As used herein, a "recombinant AAV particle", "recombinant AAV vector", "rAAV particle", or "rAAV vector" refers to an AAV virus that comprises a capsid protein and a vector genome (or an AAV genome) comprising at least one payload region (e.g., an expression cassette including a polynucleotide encoding a therapeutic protein (e.g., an antibody or antigen binding fragment thereof) or peptide)) and at least one inverted terminal repeat (ITR) region. In some aspects, the "AAV vectors of the present disclosure" or "AAV vectors" refer to AAV vectors comprising a polynucleotide encoding an antibody (e.g., an anti-CTLA-4 antibody) and a pair of AAV ITRs, e.g., encapsulated in an AAV particle.

[0117] The terms "antibody" and "antibodies" refer to an immunoglobulin molecule that recognizes and specifically binds to a target, such as a protein, polypeptide, peptide, carbohydrate, polynucleotide, lipid, or combinations of the foregoing through at least one antigen recognition site within the variable region of the immunoglobulin molecule. As used herein, the term "antibody" encompasses intact polyclonal antibodies, intact monoclonal antibodies, chimeric antibodies, humanized antibodies, human antibodies, fusion proteins comprising an antibody, and any other modified immunoglobulin molecule so long as the antibodies exhibit the desired biological activity. An antibody can be of any the five major classes of immunoglobulins: IgA, IgD, IgE, IgG, and IgM, or subclasses (isotypes) thereof (e.g. IgGl, IgG2, IgG3, IgG4, IgAl and IgA2), based on the identity of their heavy-chain constant domains referred to as alpha, delta, epsilon, gamma, and mu, respectively. The different classes of immunoglobulins have different and well known subunit structures and three-dimensional configurations.

[0118] The term "antibody fragment" refers to a portion of an intact antibody. An "antigen-binding fragment," "antigen-binding domain," or "antigen-binding region," refers to a portion of an intact antibody that binds to an antigen. An antigen-binding fragment can contain an antigen recognition site of an intact antibody (e.g., complementarity determining regions (CDRs) sufficient to bind antigen). Examples of antigen-binding fragments of antibodies include, but are not limited to Fab, Fab', F(ab')2, and Fv fragments, linear antibodies, and single chain antibodies (e.g., nanobodies). An antigen-binding fragment of an antibody can be derived from any animal species, such as rodents (e.g., mouse, rat, or hamster) and humans or can be artificially produced.

[0119] The term "nanobody" or "nanobodies" or "single-domain antibody" or "sdAb" refers to a class of antigen-binding fragments that is a single chain immunoglobulin molecule consisting of a monomeric variable antibody domain, which recognizes and specifically binds to an antigen.

[0120] The term "monoclonal" antibody or antigen-binding fragment thereof refers to a homogeneous antibody or antigen-binding fragment population involved in the highly specific recognition and binding of a single antigenic determinant, or epitope. This is in contrast to polyclonal antibodies that typically include different antibodies directed against different antigenic determinants. The term "monoclonal" antibody or antigenbinding fragment thereof encompasses both intact and full-length monoclonal antibodies as well as antibody fragments (such as Fab, Fab', F(ab')2, Fv), single chain (scFv) mutants, fusion proteins comprising an antibody portion, and any other modified immunoglobulin molecule comprising an antigen recognition site. Furthermore, a "monoclonal" antibody or antigen-binding fragment thereof refers to such antibodies and antigen-binding fragments thereof made in any number of manners including but not limited to by hybridoma, phage selection, recombinant expression, and transgenic animals.

[0121] The term "vectorized antibody", as used herein, refers to a delivery vector (e.g., a virus vector) comprising the nucleotide sequence that encodes an antibody or a derivative thereof.

[0122] The term "bispecific" or "bifunctional antibody" or antigen-binding fragment thereof refers to an artificial hybrid antibody having two different heavy /light chain pairs and two different binding sites. Bispecific antibodies can be produced by a variety of methods including fusion of hybridomas or linking of Fab' fragments. See, e.g., Songsivilai & Lachmann, Clin. Exp. Immunol. 79:315-321 (1990); Kostelny et al., J. Immunol. 148, 1547-1553 (1992).

[0123] The term "immunoglobulin" is used herein to include antibodies, functional fragments thereof, Fabs, scFvs, single domain antibodies (e.g., nanobodies), DARTs, F(ab')2, BITEs, and immunoadhesins. These antibody fragments or artificial constructs can include a single chain antibody, a Fab fragment, a univalent antibody, a bivalent of multivalent antibody, or an immunoadhesin. The binding or neutralizing antibody construct can be a monoclonal antibody, a "humanized" antibody, a multivalent antibody, or another suitable construct. An "immunoglobulin molecule" is a protein containing the immunologically-active portions of an immunoglobulin heavy chain and immunoglobulin light chain covalently coupled together and capable of specifically combining with an antigen. Immunoglobulin molecules are of any type (e.g., IgG, IgE, IgM, IgD, IgA and IgY), class (e.g., IgGl, IgG2, IgG3, IgG4, IgAl and IgA2) or subclass. The terms "antibody" and "immunoglobulin" can be used interchangeably herein. An "immunoglobulin heavy chain" is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of a variable region of an immunoglobulin heavy chain. Thus, the immunoglobulin derived heavy chain has significant regions of amino acid sequence homology with a member of the immunoglobulin gene superfamily. For example, the heavy chain in a Fab fragment is an immunoglobulin-derived heavy chain. An "immunoglobulin light chain" is a polypeptide that contains at least a portion of the antigen binding domain of an immunoglobulin and at least a portion of the variable region. Thus, the immunoglobulin-derived light chain has significant regions of amino acid homology with a member of the immunoglobulin gene superfamily. An "immunoadhesin" is a chimeric, antibody-like molecule that combines the functional domain of a binding protein, usually a receptor, ligand, cell-adhesion molecule, or 1-2 immunoglobulin variable domains with immunoglobulin constant domains, usually including the hinge or GS linker and Fc regions. A "fragment antigenbinding" (Fab) fragment" is a region of an antibody that binds to antigens. It is composed of one constant and one variable domain of each of the heavy and the light chain. With respect to immunoglobulins or antibodies as described herein, each fragment of an immunoglobulin coding sequence can be derived from one or more sources, or synthesized. Suitable fragments can include the coding region for one or more of, e.g., a heavy chain, a light chain, and/or fragments thereof such as the constant or variable region of a heavy chain (CHI, CH2 and/or CH3) and/or or the constant or variable region of a light chain. Alternatively, variable regions of a heavy chain or light chain can be utilized. Where appropriate, these sequences can be modified from the "native" sequences from which they are derived, as described herein. As used herein, the term "immunoglobulin construct" refers to any of the above immunoglobulins or fragments thereof which are encoded by and included in the expression cassettes described herein. The immunoglobulin construct encoded by and included in the expression cassettes described herein can be in a combination comprising the immunoglobulin construct and viral vectors described herein.

[0124] As used herein, the terms "variable region" or "variable domain" are used interchangeably and are common in the art. The variable region typically refers to a portion of an antibody, generally, a portion of a light or heavy chain, typically about the amino-terminal 110 to 120 amino acids or 110 to 125 amino acids in the mature heavy chain and about 90 to 115 amino acids in the mature light chain, which differ extensively in sequence among antibodies and are used in the binding and specificity of a particular antibody for its particular antigen. The variability in sequence is concentrated in those regions called complementarity determining regions (CDRs) while the more highly conserved regions in the variable domain are called framework regions (FR). Without wishing to be bound by any particular mechanism or theory, it is believed that the CDRs of the light and heavy chains are primarily responsible for the interaction and specificity of the antibody with antigen. In some aspects, the variable region is a human variable region. In some aspects, the variable region comprises rodent or murine CDRs and human framework regions (FRs). In some aspects, the variable region is a primate (e.g., non-human primate) variable region. In some aspects, the variable region comprises rodent or murine CDRs and primate (e.g., non-human primate) framework regions (FRs).

[0125] The terms "VL" and "VL domain" are used interchangeably to refer to the light chain variable region of an antibody.

[0126] The terms "VH" and " VH domain" are used interchangeably to refer to the heavy chain variable region of an antibody.

[0127] The VH and VL regions can be further subdivided into regions of hypervariability, termed complementarity determining regions (CDR), interspersed with regions that are more conserved, termed framework regions (FR). Each VH and VL is composed of three CDRs and four FRs, arranged from amino-terminus to carboxyterminus in the following order: FR1, CDR1, FR2, CDR2, FR3, CDR3, and FR4. The variable regions of the heavy and light chains contain a binding domain that interacts with an antigen. The constant regions of the antibodies can mediate the binding of the immunoglobulin to host tissues or factors, including various cells of the immune system (e.g., effector cells) and the first component (Clq) of the classical complement system.

[0128] The term "Kabat numbering" and like terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody or an antigen-binding fragment thereof. In certain aspects, CDRs can be determined according to the Kabat numbering system (see, e.g., Kabat EA & Wu TT (1971) Ann NY Acad Sci 190: 382-391 and Kabat EA et al., (1991) Sequences of Proteins of Immunological Interest, Fifth Edition, U.S. Department of Health and Human Services, NIH Publication No. 91-3242). Using the Kabat numbering system, CDRs within an antibody heavy chain molecule are typically present at amino acid positions 31 to 35, which optionally can include one or two additional amino acids, following 35 (referred to in the Kabat numbering scheme as 35 A and 35B) (CDR1), amino acid positions 50 to 65 (CDR2), and amino acid positions 95 to 102 (CDR3). Using the Kabat numbering system, CDRs within an antibody light chain molecule are typically present at amino acid positions 24 to 34 (CDR1), amino acid positions 50 to 56 (CDR2), and amino acid positions 89 to 97 (CDR3). In some aspects, the CDRs of the antibodies described herein can be determined according to the Kabat numbering scheme.

[0129] The term "Chothia numbering" and like terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody or an antigen-binding fragment thereof. In certain aspects, CDRs can be determined according to the Chothia numbering system (see, e.g., Chothia C & Lesk AM (1987) J Mol Biol 196:901-17 and Chothia C et al., (1989 Nature 342:877-83). The term "IMGT® numbering" and like terms are recognized in the art and refer to a system of numbering amino acid residues in the heavy and light chain variable regions of an antibody or an antigen-binding fragment thereof. In certain aspects, CDRs can be determined according to the IMGT® numbering system (see, e.g., Lefranc M P, et al., (1997) Immunol Today 18:509 and Lefranc M P et al (2003) Dev Comp Immunol 27:55- 77). In some aspects, the CDRs of the antibodies described herein can be determined according to the IMGT® numbering scheme.

[0130] As used herein, the term "constant region" or "constant domain" are interchangeable and have the meaning common in the art. The constant region is an antibody portion, e.g., a carboxyl terminal portion of a light and/or heavy chain which is not directly involved in binding of an antibody to antigen but which can exhibit various effector functions, such as interaction with the Fc receptor. The constant region of an immunoglobulin molecule generally has a more conserved amino acid sequence relative to an immunoglobulin variable domain. In certain aspects, an antibody or antigenbinding fragment comprises a constant region or portion thereof that is sufficient for antibody-dependent cell-mediated cytotoxicity (ADCC).

[0131] As used herein, the term "heavy chain" when used in reference to an antibody can refer to any distinct type, e.g., alpha (a), delta (5), epsilon (a), gamma (y), and mu (p), based on the amino acid sequence of the constant domain, which give rise to IgA, IgD, IgE, IgG, and IgM classes of antibodies, respectively, including subclasses of IgG, e.g., IgGl, IgG2, IgG3, and IgG4. Heavy chain amino acid sequences are well known in the art. In some aspects, the heavy chain is a human heavy chain.

[0132] As used herein, the term "light chain" when used in reference to an antibody can refer to any distinct type, e.g., kappa (K) or lambda (X) based on the amino acid sequence of the constant domains. Light chain amino acid sequences are well known in the art. In some aspects, the light chain is a human light chain.

[0133] An "Fc region" (fragment crystallizable region) or "Fc domain" or "Fc" refers to the C- terminal region of the heavy chain of an antibody that mediates the binding of the immunoglobulin to host tissues or factors, including binding to Fc receptors located on various cells of the immune system (e.g., effector cells) or to the first component (Clq) of the classical complement system.

[0134] A "native sequence Fc region" or "native sequence Fc" comprises an amino acid sequence that is identical to the amino acid sequence of an Fc region found in nature. Native sequence human Fc regions include a native sequence human IgGl Fc region; native sequence human IgG2 Fc region; native sequence human IgG3 Fc region; and native sequence human IgG4 Fc region as well as naturally-occurring variants thereof. Native sequence Fc includes the various allotypes of Fc (see, e.g., Jefferis et al., (2009) mAbs 1 : 1; Vidarsson G. et al. Front Immunol. 5:520 (published online Oct. 20, 2014)).

[0135] An "Fc receptor" or "FcR" is a receptor that binds to the Fc region of an immunoglobulin. FcRs that bind to an IgG antibody comprise receptors of the FcyR family, including allelic variants and alternatively spliced forms of these receptors. The FcyR family consists of three activating (FcyRI, FcyRIII, and FcyRIV in mice; FcyRIA, FcyRIIA, and FcyRIIIA in humans) and one inhibitory (FcyRIIB) receptor. Human IgGl binds to most human Fc receptors and elicits the strongest Fc effector functions. It is considered equivalent to murine IgG2a with respect to their types of activating Fc receptors that it binds to. Conversely, human IgG4 elicits the least Fc effector functions. (Vidarsson G. et al. Front Immunol. 5:520 (published online Oct. 20, 2014)). An "Fc effector function" refers to the interaction of an antibody Fc region with an Fc receptor or ligand, or a biochemical event that results therefrom.

[0136] The constant region can be manipulated, e.g., by recombinant DNA technology, to eliminate one or more effector functions. An "effector function" refers to the interaction of an antibody Fc region with an Fc receptor or ligand, or a biochemical event that results therefrom. Exemplary "effector functions" include Clq binding, complement dependent cytotoxicity (CDC), Fc receptor binding, FcyR-mediated effector functions such as ADCC and antibody dependent cell-mediated phagocytosis (ADCP), and down regulation of a cell surface receptor (e.g., the B cell receptor; BCR). Such effector functions generally require the Fc region to be combined with a binding domain (e.g., an antibody variable domain). Accordingly, the term "a constant region without the Fc function" include constant regions with reduced or without one or more effector functions mediated by Fc region. Additionally, the constant region can be manipulated, e.g., by recombinant DNA technology, to increase the antibody specificity, to improve the antibody's activity, to increase the antibody's half-life, to eliminate or reduce off target effects, or any combination thereof. As used herein, the term "antibody's half-life" refers to the time required for half the quantity of the antibody deposited in a living organism to be metabolized or eliminated by normal biological processes.

[0137] Effector functions of an antibody can be reduced or avoided by different approaches. Effector functions of an antibody can be reduced or avoided by using antibody fragments lacking the Fc region (e.g., such as a Fab, F(ab')2, single chain Fv (scFv), or a sdAb consisting of a monomeric VH or VL domain). Alternatively, the so- called aglycosylated antibodies can be generated by removing sugars that are linked to particular residues in the Fc region to reduce the effector functions of an antibody while retaining other valuable attributes of the Fc region (e.g., prolonged half-life and heterodimerization). Aglycosylated antibodies can be generated by, for example, deleting or altering the residue the sugar is attached to, removing the sugars enzymatically, producing the antibody in cells cultured in the presence of a glycosylation inhibitor, or by expressing the antibody in cells unable to glycosylate proteins (e.g., bacterial host cells). See, e.g., U.S. Pub. No. 20120100140. Another approach is to employ Fc regions from an IgG subclass that have reduced effector function. For example, IgG2 and IgG4 antibodies are characterized by having lower levels of Fc effector functions than IgGl and IgG3. The residues most proximal to the hinge region in the CH2 domain of the Fc part are responsible for effector functions of antibodies as it contains a largely overlapping binding site for Clq (complement) and IgG-Fc receptors (FcyR) on effector cells of the innate immune system. Vidarsson G. et al. Front Immunol. 5:520 (published online Oct. 20, 2014). Accordingly, antibodies with reduced or without Fc effector functions can be prepared by generating, e.g., a chimeric Fc region which comprises a CH2 domain from an IgG antibody of the IgG4 isotype and a CH3 domain from an IgG antibody of the IgGl isotype, or a chimeric Fc region which comprises hinge region from IgG2 and CH2 region from IgG4 (see, e.g., Lau C. et al. J. Immunol. 191 :4769-4777 (2013)), or an Fc region with mutations that result in altered Fc effector functions, e.g., reduced or no Fc functions. Such Fc regions with mutations are known in the art. See, e.g., U.S. Pub. No. 20120100140 and U.S. and PCT applications cited therein and An et al., mAbs 1 :6, 572- 579 (2009); the disclosures of which are incorporated by reference to their entirety.

[0138] In some aspects, the antibody (e.g., a monoclonal antibody) or antigen-binding fragment thereof is modified so that it does not bind to the Fc region. See e.g., Saunders K., Front. Immunol., 10: 1296 (2019).

[0139] A "hinge," "hinge domain," "hinge region," or "antibody hinge region" are used interchangeably and refer to the domain of a heavy chain constant region that joins the CHI domain to the CH2 domain and includes the upper, middle, and lower fragments of the hinge (Roux et al., J. Immunol. 1998 161 :4083). The hinge provides varying levels of flexibility between the binding and effector regions of an antibody and also provides sites for intermolecular disulfide bonding between the two heavy chain constant regions.

[0140] As used herein, "isotype" refers to the antibody class (e.g., IgGl, IgG2, IgG3, IgG4, IgM, IgAl, IgA2, IgD, and IgE antibody) that is encoded by the heavy chain constant region genes.

[0141] The phrases "an antibody recognizing an antigen" and "an antibody specific for an antigen" are used interchangeably herein with the term "an antibody which binds specifically to an antigen."

[0142] An "isolated antibody," as used herein, is intended to refer to an antibody which is substantially free of other antibodies having different antigenic. An isolated antibody that specifically binds to an epitope of a protein can, however, have cross-reactivity to other corresponding proteins from different species.

[0143] In some aspects, the antibody (e.g., a monoclonal antibody) or antigen-binding fragment thereof is a chimeric antibody. The term "chimeric" antibodies or antigenbinding fragments thereof refers to antibodies or antigen-binding fragments thereof wherein the amino acid sequence is derived from two or more species. Typically, the variable region of both light and heavy chains corresponds to the variable region of antibodies or antigen-binding fragments thereof derived from one species of mammals (e.g. mouse, rat, rabbit, etc.) with the desired specificity, affinity, and capability while the constant regions are homologous to the sequences in antibodies or antigen-binding fragments thereof derived from another (usually human) to avoid eliciting an immune response in that species.

[0144] In some aspects, the antibody (e.g., a monoclonal antibody) or antigen-binding fragment thereof is a humanized antibody. The term "humanized" antibody or antigenbinding fragment thereof refers to forms of non-human (e.g. murine) antibodies or antigen-binding fragments that are specific immunoglobulin chains, chimeric immunoglobulins, or fragments thereof that contain minimal non-human (e.g., murine) sequences. Typically, humanized antibodies or antigen-binding fragments thereof are human immunoglobulins in which residues from the complementarity determining regions (CDRs) are replaced by residues from the CDRs of a non-human species (e.g. mouse, rat, rabbit, hamster) that have the desired specificity, affinity, and capability ("CDR grafted") (Jones et al., Nature 321 :522-525 (1986); Riechmann et al., Nature 332:323-327 (1988); Verhoeyen et al., Science 239: 1534-1536 (1988)). In some aspects, a humanized antibody or antigen-binding fragment thereof can comprise at least a portion of an immunoglobulin constant region or domain (Fc), typically that of a human immunoglobulin. Examples of methods used to generate humanized antibodies are described in U.S. Pat. 5,225,539; Roguska et al., Proc. Natl. Acad. Sci., USA, 91(3):969- 973 (1994), and Roguska et al., Protein Eng. 9(10):895-904 (1996). In some aspects, a "humanized antibody" is a resurfaced antibody.

[0145] In some aspects, the antibody (e.g., a monoclonal antibody) or antigen-binding fragment thereof is a human antibody. The term "human" antibody (HuMAb) or antigenbinding fragment thereof means an antibody or antigen-binding fragment thereof having an amino acid sequence derived from a human immunoglobulin gene locus, where such antibody or antigen-binding fragment is made using any technique known in the art. This definition of a human antibody or antigen-binding fragment thereof includes intact or full- length antibodies and fragments thereof.

[0146] As used herein, an "epitope" is a term in the art and refers to a localized region of an antigen to which an antibody or antigen-binding fragment thereof can specifically bind. An epitope can be, for example, contiguous amino acids of a polypeptide (linear or contiguous epitope) or an epitope can, for example, come together from two or more noncontiguous regions of a polypeptide or polypeptides (conformational, non-linear, discontinuous, or non-contiguous epitope. The term "epitope mapping" refers to the process of identification of the molecular determinants for antibody-antigen recognition.

[0147] As used herein, the term "inhibitor" refers to any agent that reduces the level and/or activity of a protein. Non-limiting examples of inhibitors include blocking antibodies, inhibitory proteins, dsRNA (e.g., siRNA or shRNA), and vectors, e.g., AAV, comprising polynucleotides encoding blocking antibodies, inhibitory proteins, or dsRNA (e.g., siRNA or shRNA). The term "reducing," as used herein, is used interchangeably with "silencing," "downregulating," "suppressing," and other similar terms, and includes any level of reduction.

[0148] As used herein, the term "inhibitory signal" refers to any intra- or inter-cellular signal that reduces the level and/or activity of a cell. Non-limiting examples of inhibitory signal include signals downstream of immune check point proteins (e.g. CTLA4), which inhibit T cell effector function. The term "reducing," as used herein, is used interchangeably with "silencing," "downregulating," "suppressing," and other similar terms, and includes any level of reduction.

[0149] As used herein, the term "neutralizing" refers to neutralization of biological activity of a target protein when a binding protein specifically binds the target protein. Neutralizing may be the result of different ways of binding of said binding protein to the target. For example, neutralizing may be caused by binding of the binding protein in a region of the target which does not affect receptor binding to the target molecule (or ligand binding to a target receptor). Alternatively binding of a binding protein may result in a blockade of the receptor binding to the target (or a blockade of the ligand binding to the target receptor), which blockade finally neutralizes the target protein activity. Each of said different mechanism can occur according to the disclosure. Preferably a neutralizing binding protein is a neutralizing antibody whose binding to CTLA-4 results in neutralization of a biological activity of CTLA-4. Preferably the neutralizing binding protein binds CTLA-4 and decreases a biologically activity of CTLA-4 by at least about 20%, 40%, 60%, 80%, 85% or more. Neutralization of a biological activity of CTLA-4 by a neutralizing binding protein can be assessed by measuring one or more indicators of CTLA-4 biological activity well known in the art.

[0150] The phrase "contacting a cell" (e.g., contacting a cell with a construct, a rAAV vector, combination therapy, or composition of the disclosure) as used herein, includes contacting a cell directly or indirectly. In some aspects, contacting a cell with a construct, a rAAV vector, combination therapy, or composition of the disclosure includes contacting a cell in vitro or contacting a cell in vivo with the construct, rAAV vector, combination therapy, or composition. Thus, for example, the construct, rAAV vector, combination therapy, or composition can be put into physical contact with the cell by the individual performing the method, or alternatively, the construct, rAAV vector, combination therapy, or composition can be put into a situation that will permit or cause it to subsequently come into contact with the cell.

[0151] In some aspects, contacting a cell in vitro can be done, for example, by incubating the cell with the AAV vector. In some aspects, contacting a cell in vivo can be done, for example, by injecting a construct, a rAAV vector, a combination therapy, or a composition of the disclosure into or near the tissue where the cell is located (e.g., a tumor cell), or by injecting the construct, rAAV vector, combination therapy, or composition into another area, e.g., the bloodstream or the subcutaneous space, such that the agent will subsequently reach the tissue where the cell to be contacted is located. For example, the AAV vector can be encapsulated and/or coupled to a ligand that directs the AAV vector to a site of interest. Combinations of in vitro and in vivo methods of contacting are also possible. For example, a cell can be contacted in vitro with a construct, a rAAV vector, a combination therapy, or a composition and subsequently transplanted into a subject.

[0152] In some aspects, contacting a cell with a construct, a rAAV vector, a combination therapy, or a composition of the present disclosure includes "introducing" or "delivering" (directly or indirectly) the construct, rAAV vector, combination therapy, or composition into the cell by facilitating or effecting uptake or absorption into the cell. In some aspects, in vitro introduction into a cell includes a method know in the art such as electroporation and lipofection.

[0153] As used herein, the term "in vitro" refers to events that occur in an artificial environment, e.g., in a test tube or reaction vessel, in cell culture, in a Petri dish, etc., rather than within an organism (e.g., animal, plant, or microbe).

[0154] As used herein, the term "in vivo" refers to events that occur within an organism (e.g., animal, plant, or microbe or cell or tissue thereof). [0155] As used herein, the term "transfection" refers to methods to introduce exogenous nucleic acids into a cell. Methods of transfection include, but are not limited to, chemical methods, physical treatments and cationic lipids or mixtures. The list of agents that can be transfected into a cell is large and includes, e.g., siRNA, shRNA, sense and/or anti-sense sequences, DNA encoding one or more genes and organized into an expression plasmid, e.g., a vector.

[0156] As used herein, "off target" refers to any unintended effect on any one or more target, gene, RNA transcript, protein, signaling mechanisms.

[0157] As used herein, the term "immune response" refers to a biological response within an organism against a foreign agent or abnormal cell (e.g., a tumor cell), wherein the response protects the organism against such agents/cells and diseases caused by them. An immune response is mediated by the action of a cell of the immune system e.g., a T lymphocyte (T cell), B lymphocyte (B cell), natural killer (NK) cell, macrophage, eosinophil, mast cell, dendritic cell or neutrophil) and soluble macromolecules produced by any of these cells or the liver (including antibodies, cytokines, and complement) that results in selective targeting, binding to, damage to, destruction of, and/or elimination from the organism's body of invading pathogens, cells or tissues infected with pathogens, cancerous or other abnormal cells, or, in cases of autoimmunity or pathological inflammation, normal human cells or tissues. In some aspects, an immune reaction includes, e.g., activation or inhibition of a T cell, e.g., an effector T cell or a Th cell, such as a CD4 ⁺ or CD8 ⁺ T cell, or the inhibition of a regulatory T cell (Treg cell).

[0158] As used herein, the term "checkpoint inhibitor" refers to an inhibitor for a negative checkpoint regulator or an inhibitor for a binding partner of a negative checkpoint regulator. In some aspects, the negative checkpoint regulator comprises programmed cell death protein 1 (PD-1), programmed death ligand 1 (PD-L1), cytotoxic T-lymphocyte- associated protein 4 (CTLA-4), lymphocyte-activated gene 3 (LAG-3), T-cell immunoglobulin mucin-containing protein 3 (TIM-3), B and T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), adenosine A2a receptor (A2aR), killer cell immunoglobulin like receptor (KIR), indoleamine 2,3-dioxygenase (IDO), CD20, CD39, CD73, inducible T-cell costimulatory (ICOS), B7-H3, or any combination thereof. [0159] As used herein, the term "immunotherapy" refers to the treatment of a disease by inducing, enhancing, suppressing or otherwise modifying an immune response.

[0160] As used here, "immunostimulating therapy" refers to a therapy that results in increasing (inducing or enhancing) an immune response in a subject, e.g., for treating cancer. The immunostimulating therapy can increase, induce or enhance an immune response by activating, inducing, increasing, or enhancing an immuno-stimulatory signal, or by inhibiting, blocking, or decreasing an immuno-inhibitory signal.

[0161] As used herein, an "immuno-stimulatory signal", refers to any signaling mechanism which promotes an immune response.

[0162] As used herein, an "immuno-inhibitory signal" refers to any signaling mechanism which inhibits an immune response. For example, without being bound to any particular theory, CTLA-4 transmits an inhibitory signal to T cells, and inhibition of CTLA-4 activity via anti-CTLA-4 binding molecules (e.g., anti-CTLA-4 antibody) induces and immune response by blocking CTLA-4 inhibitory signal.

[0163] As used herein, the term "gene therapy" is the insertion of nucleic acid sequences (e.g., a polynucleotide comprising a promoter operably linked to a nucleic acid encoding a therapeutic molecule as disclosed herein) into an individual's cells and/or tissues to treat, reduce the symptoms of, or reduce the likelihood of a disease. Gene therapy also includes insertion of transgene that are inhibitory in nature, i.e., that inhibit, decrease or reduce expression, activity or function of an endogenous gene or protein, such as an undesirable or aberrant (e.g., pathogenic) gene or protein. Such transgenes can be exogenous. An exogenous molecule or sequence is understood to be molecule or sequence not normally occurring in the cell, tissue and/or individual to be treated. Both acquired and congenital diseases are amenable to gene therapy.

II. Anti-CTLA4 Antibodies and Polynucleotides Encoding the Same

[0164] The present disclosure provides gene therapy compositions comprising a viral vector comprising a polynucleotide (e.g., an antibody expression cassette) comprising a promoter operably linked to a nucleic acid encoding an antibody or antigen binding fragment thereof that specifically binds Cytotoxic T-Lymphocyte Associated Protein 4 (an anti-CTLA4 antibody or antigen binding fragment thereof). In some aspects, the antibody is a monoclonal antibody. [0165] In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding the anti-CTLA4 antibody can be in a viral vector disclosed herein. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding the anti- CTLA4 antibody can be in an AAV vector disclosed herein. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding the anti-CTLA4 antibody can be in a rAAV vector disclosed herein. In some aspects, the anti-CTLA4 antibody is expressed in a host cell (e.g., a human cell). In some aspects, the anti-CTLA4 antibody is expressed in a cancer host cell (e.g., a human cancer cell).

[0166] In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody can be administered to a tumor and/or the tissue surrounding the tumor. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding the anti-CTLA4 antibody is administered to a tumor, and the anti- CTLA4 antibody is secreted by targeted cells into the bloodstream. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding the anti-CTLA4 antibody is administered to a primary tumor and optionally the anti-CTLA4 antibody is secreted by the targeted cells into the bloodstream and reaches a secondary tumor (metastatic tumor). In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody can be administered intramuscularly, intracutaneously, intravenously, or intratum orally. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody can be administered intratumorally. In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody can be administered by fanning administration.

[0167] In some aspects, the anti-CTLA4 antibody is an antibody or antigen-binding fragment thereof selected from a monoclonal antibody, a bispecific antibody, or a multispecific antibody or antigen-binding fragment thereof. In some aspects, the therapeutic protein is an antibody fragment selected from a Fab, a Fab', a F(ab')2, a Fv fragments, a linear antibody, or a single chain antibody (e.g., a nanobody). In some aspects, the therapeutic protein is an antibody fragment comprising an Fc portion of an antibody.

[0168] In some aspects, the anti-CTLA4 antibody is a monoclonal antibody selected from the group consisting of: Ipilimumab, Zalifrelimab, Tremelimumab (Ticilimumab), Quavonlimab, Bavunalimab (Pavunalimab), Nurulimab, Erfonrilimab, Botensilimab, BMS-986218, KN044, YH001, REGN465, ONC-392, IBI31O, HBM4003, ADU-1604, ADG126, and ADG116. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof comprises Ipilimumab. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof comprises Ticilimumab.

[0169] In some aspects, the anti-CTLA4 antibody binds a CTLA-4 receptor. In some aspects, the CTLA-4 receptor binds to the CD80 and CD86 ligands. In some aspects, the CTLA-4 receptor binds to a B7/CD28 family member. In some aspects, the binding of the CTLA-4 receptor to the CD80 and CD86 ligands blocks their binding to the CD28 receptor. In some aspects, the binding of the CTLA-4 receptor to the CD80 and CD86 ligands inhibits the activatory signal resulting from the binding of the CD80 and CD86 ligands to the CD28 receptor.

[0170] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes a variable heavy chain and/or a variable light chain. In some aspects, the encoded anti-CTLA4 antibody comprises the heavy chain and the light chain amino acid sequences of Ipilimumab or a variant thereof. In some aspects, the encoded anti-CTLA4 antibody comprises the heavy chain and the light chain amino acid sequences of Ticilimumab or a variant thereof.

[0171] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes a single-domain antibody (e.g., a nanobody) comprising either (i) a heavy chain variable region (VH) comprising a complementarity determining region (CDR) 1, a VH CDR2, and/or a VH CDR3 or (ii) a light chain variable region (VL) comprising a CDR1, a VL CDR2, and/or a VL CDR3. In some aspects, the encoded VH CDRs and/or VL CDRs are selected from the corresponding CDRs of Ipilimumab. In some aspects, the encoded VH CDRs and/or VL CDRs are selected from the corresponding CDRs of Tremelimumab (Ticilimumab).

[0172] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigen-binding fragment thereof (e.g., Ipilimumab or Tremelimumab) comprises (i) a first promoter sequence, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, (iii) a second promoter sequence, and (iv) a nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen- binding fragment thereof. In some aspects, the antibody expression cassette comprises (i) a first promoter sequence, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, (iii) a second promoter sequence, and (iv) a nucleic acid sequence encoding a light chain variable region (VL) of the anti- CTLA4 antibody or an antigen-binding fragment thereof, in 5'-3' orientation.

[0173] In some aspects, the nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof is operably linked to a first promoter sequence, and the nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen-binding fragment thereof is operably linked to a second promoter sequence. In some aspects, the first and the second promoter are the same. In some aspects, the first and the second promoter are different.

[0174] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigen-binding fragment thereof (e.g., Ipilimumab or Tremelimumab) comprises (i) a promoter sequence, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T- Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, (iii) a linker sequence, and (iv) a nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen-binding fragment thereof. In some aspects, the antibody expression cassette comprises (i) a promoter sequence, (ii) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof, (iii) a linker sequence, and (iv) a nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen-binding fragment thereof, in 5'-3' orientation.

[0175] In some aspects, the nucleic acid sequence encoding a heavy chain variable region (VH) of an anti-Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigen-binding fragment thereof and the nucleic acid sequence encoding a light chain variable region (VL) of the anti-CTLA4 antibody or an antigen-binding fragment thereof are operably linked to a single promoter. In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigen-binding fragment thereof (e.g., Ipilimumab or Tremelimumab) further comprises a linker sequence.

[0176] In some aspects, the linker sequence comprises an IRES, a cleavage site, or any combination thereof. In some aspects, the cleavage site comprises a furin cleavage site, a 2 A cleavage site, a P2A cleavage site, a T2A cleavage site, a E2A cleavage site, a F2A cleavage site, a BmCPV 2A cleavage site, a BmIFV 2A cleavage site, or any combination thereof.

[0177] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigen-binding fragment thereof (e.g., Ipilimumab or Tremelimumab) comprises the elements as shown in FIG. 1 A, FIG. IB, FIG. 1C, or FIG. ID.

[0178] In some aspects, the antibody expression cassette comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49, 50, 51, or 52.

[0179] In some aspects, the vector genome comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36, 37, 38, or 39.

A. Ipilimumab

[0180] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes an antibody comprising a heavy chain and a light chain of Ipilimumab, or an antigen-binding fragment thereof. In some aspects, the polynucleotide disclosed herein encodes an antibody comprising modified heavy chain variable region and a modified light chain variable region of Ipilimumab, or an antigen-binding fragment thereof.

[0181] In some aspects, the anti-CTLA-4 antibody comprises a heavy chain and a light chain. In some aspects, the heavy chain comprises a heavy chain variable region (VH) comprising a complementarity determining region (CDR) 1, a VH CDR2, and a VH CDR3. In some aspects, the VH CDRs 1-3 correspond to the VH CDRs 1-3 of Ipilimumab. In some aspects, the light chain comprises a light chain variable region (VL) comprising a complementarity determining region (CDR) 1, a VL CDR2, and a VL CDR3. In some aspects, the VL CDRs 1-3 correspond to the VL CDRs 1-3 of Ipilimumab. [0182] In some aspects, the anti-CTLA-4 antibody comprises a VH amino acid sequence and a VL amino acid sequence of Ipilimumab.

[0183] Table 1 includes sequences corresponding to Ipilimumab. In some aspects, the anti-CTLA-4 antibody or antigen binding fragment thereof disclosed herein comprises one or more of the amino acid sequences disclosed in Table 1.

Table 1. Ipilimumab Sequences

[0184] In some aspects, the heavy chain (HC) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 3. In some aspects, the heavy chain (HC) comprises an amino acid sequence 100% identical to SEQ ID NO: 3. In some aspects, the light chain (LC) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 4. In some aspects, the light chain (LC) comprises an amino acid sequence 100% identical to SEQ ID NO: 4.

[0185] In some aspects, the heavy chain variable region (VH) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 5. In some aspects, the heavy chain variable region (VH) comprises an amino acid sequence 100% identical to SEQ ID NO: 5. In some aspects, the light chain variable region (VL) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 6. In some aspects, the light chain variable region (VL) comprises an amino acid sequence 100 % identical to SEQ ID NO: 6.

[0186] In some aspects, the heavy chain variable region (VH) comprises a VH CDR1, a VH CDR2, and a VH CDR3. In some aspects, VH CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 7, the VH CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to SEQ ID NO: 8, and the VH CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 9. In some aspects, VH CDR1 comprises an amino acid sequence with 100% identity to SEQ ID NO: 7. In some aspects, VH CDR2 comprises an amino acid sequence with 100% identity to SEQ ID NO: 8. In some aspects, VH CDR3 comprises an amino acid sequence with 100% identity to SEQ ID NO: 9.

[0187] In some aspects, the light chain variable region (VL) comprises a VL CDR1, a VL CDR2, and a VL CDR3. In some aspects, the VL CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 10, the VL CDR2 comprises an amino acid sequence with at least 95%, 96%, 97%, 98%, or 99% identity to the amino acid sequence GAF, and the VL CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 11. In some aspects, the VL CDR1 comprises an amino acid sequence 100% identity to SEQ ID NO: 10, the VL CDR2 comprises an amino acid sequence 100% identity to the amino acid sequence GAF, and the VL CDR3 comprises an amino acid sequence with 100% identity to SEQ ID NO: 11.

[0188] In some aspects, VH CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 26-33 of SEQ ID NO: 5, the VH CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to amino acids 52-58 of SEQ ID NO: 5, and the VH CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 97-107 of SEQ ID NO: 5. In some aspects, VH CDR1 comprises an amino acid sequence with 100% identity to amino acids 26-33 of SEQ ID NO: 5, the VH CDR2 comprises an amino acid sequence with 100% identity to amino acids 52-58 of SEQ ID NO: 5, and the VH CDR3 comprises an amino acid sequence with 100% identity to amino acids 97-107 of SEQ ID NO: 5.

[0189] In some aspects, the VL CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 27-33 of SEQ ID NO: 6, the VL CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 51-53 of SEQ ID NO: 6, and the VL CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 90-98 of SEQ ID NO: 6. In some aspects, the VL CDR1 comprises an amino acid sequence with 100% identity to amino acids 27-33 of SEQ ID NO: 6, the VL CDR2 comprises an amino acid sequence with 100% identity to amino acids 51-53 of SEQ ID NO: 6, and the VL CDR3 comprises an amino acid sequence with 100% identity to amino acids 90-98 of SEQ ID NO: 6.

[0190] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a heavy chain (HC) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 3. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a light chain (LC) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 4.

[0191] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a heavy chain variable region (VH) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 5. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a light chain variable region (VL) comprising an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 6.

[0192] In some aspects, the antibody expression cassette comprises a nucleic acid encoding a heavy chain variable region (VH) which comprises a VH CDR1, a VH CDR2, and a VH CDR3. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VH CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 7, a VH CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 8, and a VH CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 9.

[0193] In some aspects, the antibody expression cassette comprises a nucleic acid encoding a light chain variable region (VL) which comprises a VL CDR1, a VL CDR2, and a VL CDR3. In some aspects, the antibody expression cassette disclosed herein comprises: a nucleic acid sequence encoding: a VL CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 10, a VL CDR2 which comprises an amino acid sequence with at least about 95%, 96%, 97%, 98%, 99%, or 100% identity to the amino acids GAF, and a VL CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 11. [0194] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VH CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 26-33 of SEQ ID NO: 5, a VH CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 52-58 of SEQ ID NO: 5, and a VH CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 97-107 of SEQ ID NO: 5.

[0195] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VL CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 27-33 of SEQ ID NO: 6, a VL CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 51-53 of SEQ ID NO: 6, and a VL CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 90-98 of SEQ ID NO: 6.

[0196] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes an antibody or antigen-binding fragment thereof comprising the six CDRs of an antibody listed in Table 1 (i.e., the three VH CDRs of the antibody listed in Table 1 and the three VL CDRs of the same antibody listed in Table 1). In some aspects, the polynucleotide disclosed herein comprises a nucleotide sequence comprising the nucleotide sequences of the six CDRs of an antibody listed in Table 1 (i.e., the three VH CDRs of the antibody listed in Table 1 and the three VL CDRs of the same antibody listed in Table 1).

[0197] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 1. In some aspects, the polynucleotide disclosed herein encodes an antibody variable heavy chain (VH) sequence listed in Table 1 or antigen-binding fragment thereof.

[0198] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 1. In some aspects, the polynucleotide disclosed herein encodes an antibody variable light chain (VL) comprising a sequence listed in Table 1 or antigen-binding fragment thereof.

[0199] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 1. In some aspects, the polynucleotide disclosed herein encodes an antibody comprising a HC and a LC of an antibody listed in Table 1 (i.e., the HC of the antibody listed in Table 1 and the LC of the same antibody listed in Table 1.

[0200] In some aspects, the antibody expression cassette comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49, 50, 51, or 52.

[0201] In some aspects, the vector genome comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36, 37, 38, or 39.

B. Tremelimumab

[0202] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes an antibody comprising a heavy chain and a light chain of Tremelimumab, or an antigen-binding fragment thereof. In some aspects, the polynucleotide disclosed herein encodes an antibody comprising modified heavy chain variable region and a modified light chain variable region of Tremelimumab, or an antigen-binding fragment thereof.

[0203] In some aspects, the anti-CTLA-4 antibody comprises a heavy chain and a light chain. In some aspects, the heavy chain comprises a heavy chain variable region (VH) comprising a complementarity determining region (CDR) 1, a VH CDR2, and a VH CDR3. In some aspects, the VH CDRs 1-3 correspond to the VH CDRs 1-3 of Tremelimumab. In some aspects, the light chain comprises a light chain variable region (VL) comprising a complementarity determining region (CDR) 1, a VL CDR2, and a VL CDR3. In some aspects, the VL CDRs 1-3 correspond to the VL CDRs 1-3 of Tremelimumab.

[0204] In some aspects, the anti-CTLA-4 antibody comprises a VH amino acid sequence and a VL amino acid sequence of Tremelimumab.

[0205] Table 2 includes sequences corresponding to Tremelimumab. In some aspects, the anti-CTLA-4 antibody or antigen binding fragment thereof disclosed herein comprises one or more of the amino acid sequences disclosed in Table 2. Table 2. Tremelimumab Sequences

[0206] In some aspects, the heavy chain (HC) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 12. In some aspects, the heavy chain (HC) comprises an amino acid sequence 100% identical to SEQ ID NO: 12. In some aspects, the light chain (LC) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 13. In some aspects, the light chain (LC) comprises an amino acid sequence 100% identical to SEQ ID NO: 13.

[0207] In some aspects, the heavy chain variable region (VH) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 14. In some aspects, the heavy chain variable region (VH) comprises an amino acid sequence 100% identical to SEQ ID NO: 14. In some aspects, the light chain variable region (VL) comprises an amino acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identical to SEQ ID NO: 15. In some aspects, the light chain variable region (VL) comprises an amino acid sequence 100 % identical to SEQ ID NO: 15.

[0208] In some aspects, the heavy chain variable region (VH) comprises a VH CDR1, a VH CDR2, and a VH CDR3. In some aspects, VH CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 16, the VH CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to SEQ ID NO: 17, and the VH CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 18. In some aspects, VH CDR1 comprises an amino acid sequence with 100% identity to SEQ ID NO: 16. In some aspects, VH CDR2 comprises an amino acid sequence with 100% identity to SEQ ID NO: 17. In some aspects, VH CDR3 comprises an amino acid sequence with 100% identity to SEQ ID NO: 18.

[0209] In some aspects, the light chain variable region (VL) comprises a VL CDR1, a VL CDR2, and a VL CDR3. In some aspects, the VL CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 19, the VL CDR2 comprises an amino acid sequence with at least 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 20, and the VL CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to SEQ ID NO: 21. In some aspects, the VL CDR1 comprises an amino acid sequence 100% identity to SEQ ID NO: 19, the VL CDR2 comprises an amino acid sequence 100% identity to SEQ ID NO: 20, and the VL CDR3 comprises an amino acid sequence with 100% identity to SEQ ID NO: 21.

[0210] In some aspects, VH CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 26-35 of SEQ ID NO: 14, the VH CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99%, identity to amino acids 50-64 of SEQ ID NO: 14, and the VH CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 99-114 of SEQ ID NO: 14. In some aspects, VH CDR1 comprises an amino acid sequence with 100% identity to amino acids 26-35 of SEQ ID NO: 14, the VH CDR2 comprises an amino acid sequence with 100%, identity to amino acids 50-64 of SEQ ID NO: 14, and the VH CDR3 comprises an amino acid sequence with 100% identity to amino acids 99- 114 of SEQ ID NO: 14. In some aspects, the VL CDR1 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 24-34 of SEQ ID NO: 15, the VL CDR2 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 50-56 of SEQ ID NO: 15, and the VL CDR3 comprises an amino acid sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, or 99% identity to amino acids 89-97 of SEQ ID NO: 15. In some aspects, the VL CDR1 comprises an amino acid sequence with 100% identity to amino acids 24-34 of SEQ ID NO: 15, the VL CDR2 comprises an amino acid sequence with 100% identity to amino acids 50-56 of SEQ ID NO: 15, and the VL CDR3 comprises an amino acid sequence with 100% identity to amino acids 89-97 of SEQ ID NO: 15.

[0211] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a heavy chain (HC) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 12. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a light chain (LC) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 13.

[0212] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a heavy chain variable region (VH) which comprises an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 14. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding a light chain variable region (VL) comprising an amino acid sequence at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 15.

[0213] In some aspects, the antibody expression cassette comprises a nucleic acid encoding a heavy chain variable region (VH) which comprises a VH CDR1, a VH CDR2, and a VH CDR3. In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VH CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 16, a VH CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 17, and a VH CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 18.

[0214] In some aspects, the antibody expression cassette comprises a nucleic acid encoding a light chain variable region (VL) which comprises a VL CDR1, a VL CDR2, and a VL CDR3. In some aspects, the antibody expression cassette disclosed herein comprises: a nucleic acid sequence encoding: a VL CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 19, a VL CDR2 which comprises an amino acid sequence with at least about 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 20, and a VL CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 21.

[0215] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VH CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 26-35 of SEQ ID NO: 14, a VH CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 50-64 of SEQ ID NO: 14, and a VH CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 99-114 of SEQ ID NO: 14.

[0216] In some aspects, the antibody expression cassette disclosed herein comprises a nucleic acid sequence encoding: a VL CDR1 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 24-34 of SEQ ID NO: 15, a VL CDR2 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 50-56 of SEQ ID NO: 15, and a VL CDR3 which comprises an amino acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to amino acids 89-97 of SEQ ID NO: 15.

[0217] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encodes an antibody or antigen-binding fragment thereof comprising the six CDRs of an antibody listed in Table 2 (i.e., the three VH CDRs of the antibody listed in Table 2 and the three VL CDRs of the same antibody listed in Table 2). In some aspects, the polynucleotide disclosed herein comprises a nucleotide sequence comprising the nucleotide sequences of the six CDRs of an antibody listed in Table 2 (i.e., the three VH CDRs of the antibody listed in Table 2 and the three VL CDRs of the same antibody listed in Table 2).

[0218] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 2. In some aspects, the polynucleotide disclosed herein encodes an antibody variable heavy chain (VH) sequence listed in Table 2 or antigen-binding fragment thereof.

[0219] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 2. In some aspects, the polynucleotide disclosed herein encodes an antibody variable light chain (VL) comprising a sequence listed in Table 2, or antigen-binding fragment thereof.

[0220] In some aspects, the polynucleotide disclosed herein encodes an antibody listed in Table 2. In some aspects, the polynucleotide disclosed herein encodes an antibody comprising a HC and a LC of an antibody listed in Table 2 (i.e., the HC of the antibody listed in Table 2 and the LC of the same antibody listed in Table 2). C. Anti-CTLA4 Antibody Constructs and Vectors

[0221] In some aspects, the therapeutic proteins encoded by the antibody expression cassettes disclosed herein are antibodies, (e.g., monoclonal antibodies or antigen-binding fragments thereof) having the VH, VL, HC, and/or LC sequences of Ipilimumab or antibodies having at least 80% identity, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to the corresponding VH, VL, HC, and/or LC sequences of Ipilimumab.

[0222] In some aspects, the therapeutic proteins encoded by the antibody expression cassettes disclosed herein are antibodies, (e.g., monoclonal antibodies or antigen-binding fragments thereof) having the VH, VL, HC, and/or LC sequences of Ticilimumab or antibodies having at least 80% identity, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identity to the corresponding VH, VL, HC, and/or LC sequences of Ticilimumab.

[0223] In some aspects, the antigen-binding fragment of an antibody described herein, such as e.g., Ipilimumab, is encoded by a polynucleotide (e.g., an antibody expression cassette) disclosed herein. Exemplary antigen-binding fragments include but are not limited to Fab, Fab', F(ab')2, and scFv, wherein the Fab, Fab', F(ab')2, or scFv comprises a heavy chain variable region sequence and a light chain variable region sequence of Ipilimumab as described herein. In some aspects, an antigen-binding fragment, such as a Fab, Fab', F(ab')2, or scFv, is fused to a Fc region. In some aspects, the polynucleotides encodes an antibody that competes for binding to the same epitope as Ipilimumab.

[0224] In some aspects, the antigen-binding fragment of an antibody described herein, such as e.g., Ticilimumab, is encoded by a polynucleotide (e.g., an antibody expression cassette) disclosed herein. Exemplary antigen-binding fragments include but are not limited to Fab, Fab', F(ab')2, and scFv, wherein the Fab, Fab', F(ab')2, or scFv comprises a heavy chain variable region sequence and a light chain variable region sequence of Ticilimumab as described herein. In some aspects, an antigen-binding fragment, such as a Fab, Fab', F(ab')2, or scFv, is fused to a Fc region. In some aspects, the polynucleotides encodes an antibody that competes for binding to the same epitope as Ticilimumab. [0225] In some aspects, the antibody (e.g., a monoclonal antibody) or antigen binding fragment thereof disclosed herein is modified so that it has enhanced half-life and/or modify immunogenicity.

[0226] In some aspects, the encoded antibody or antigen-binding fragment thereof is a human antibody, a humanized antibody or a chimeric antibody. In some aspects, the antibody or antigen-binding fragment thereof can be selected from any class of immunoglobulins, including IgM, IgG, IgD, IgA and IgE, and any isotype, including IgGl, IgG2, IgG3 and IgG4. In some aspects, the antibody or antigen-binding fragment thereof is bispecific or multi specific.

[0227] Also provided herein are polynucleotides (e.g., antibody expression cassettes) encoding a CTLA-4 antibody or antigen-binding fragment thereof described herein or a domain thereof that are optimized, e.g., by codon/RNA optimization, replacement with heterologous signal sequences, and elimination of mRNA instability elements. Methods to generate optimized nucleic acids encoding an antibody or antigen-binding fragment thereof described herein or a domain thereof (e.g., heavy chain, light chain, VH domain, or VL domain) for recombinant expression by introducing codon changes (e.g., a codon change that encodes the same amino acid due to the degeneracy of the genetic code) and/or eliminating inhibitory regions in the mRNA can be carried out by adapting the optimization methods described in, e.g., U.S. Patent Nos. 5,965,726; 6,174,666; 6,291,664; 6,414,132; and 6,794,498, accordingly, each of which is incorporated herein by reference in its entirety.

[0228] In some aspects, the polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody or antigen-binding fragment thereof described herein or a domain thereof can be generated from nucleic acid from a suitable source using methods well known in the art (e.g., PCR and other molecular cloning methods). For example, PCR amplification using synthetic primers hybridizable to the 3' and 5' ends of a known sequence can be performed using genomic DNA obtained from hybridoma cells producing the antibody of interest. Such PCR amplification methods can be used to obtain nucleic acids comprising the sequence encoding the light chain and/or heavy chain of an antibody or antigen-binding fragment thereof. Such PCR amplification methods can be used to obtain nucleic acids comprising the sequence encoding the variable light chain region and/or the variable heavy chain region of an antibody or antigen-binding fragment thereof. The amplified nucleic acids can be cloned into vectors for expression in host cells and for further cloning, for example, to generate chimeric and humanized antibodies or antigen-binding fragments thereof.

[0229] In some aspects, the polynucleotides (e.g., an antibody expression cassette) provided herein can be, e.g., in the form of RNA or in the form of DNA. DNA includes cDNA, genomic DNA, and synthetic DNA, and DNA can be double-stranded or singlestranded. If single stranded, DNA can be the coding strand or non-coding (anti-sense) strand. In some aspects, the polynucleotide is a cDNA or a DNA lacking one more endogenous introns. In some aspects, a polynucleotide is a non-naturally occurring polynucleotide. In some aspects, a polynucleotide is recombinantly produced. In some aspects, the polynucleotides are isolated. In some aspects, the polynucleotides are substantially pure. In some aspects, a polynucleotide is purified from natural components.

[0230] Also provided herein is a recombinant AAV (rAAV) vector comprising (i) a polynucleotide comprising an antibody expression cassette comprising a first promoter operably linked to a nucleic acid encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof and (ii) a delivery vector (e.g., an AAV capsid).

[0231] In some aspects, the rAAV vector disclosed herein comprises a polynucleotide (e.g., an antibody expression cassette) comprising coding regions for two or more polypeptides, e.g., a heavy chain and a light chain. When it is desired the polynucleotide (e.g., an antibody expression cassette) can include coding regions for two or more individual polypeptide chains, each additional coding region beyond the first is preferably linked to an element that facilitates co-expression of the proteins in host cells, such as an internal ribosomal entry sequence (IRES) element (See e.g., U.S. Patent No. 4,937,190), a furin cleavage site, a 2A element, or promoter(s). In some aspects, IRES furin cleavage sites, or 2A elements can be used when a single vector comprises sequences encoding each subunit of a multi-subunit protein. In the case when the protein of interest is immunoglobulin with a desired specificity, for example, the first coding region (encoding either the heavy or light chain of immunoglobulin) is located downstream from the promoter. The second coding region (encoding the remaining chain of immunoglobulin) can be located downstream from the first coding region, and an IRES, a furin cleavage site, or a 2A element can be disposed between the two coding regions, e.g., immediately preceding the second coding region. In some aspects, the incorporation of an IRES, a furin cleavage site, or a 2A element between the sequences of a first and second gene (encoding the heavy and light chains, respectively) can allow both chains to be expressed from the same promoter at about the same level in the cell. In some aspects, the cleavage site is a furin cleavage site, a 2A cleavage site, a P2A cleavage site, a T2A cleavage site, a E2A cleavage site, a F2A cleavage site, a BmCPV 2A cleavage site, a BmIFV 2A cleavage site, or any combination thereof.

[0232] In some aspects, the antibody comprises two or more subunits, for example an immunoglobulin (Ig). In some aspects, a delivery vector of the disclosure can include a coding region for each of the subunits. For example, the viral vector can include both the coding region for the Ig heavy chain (or the variable region of the Ig heavy chain) and the coding region for the Ig light chain (or the variable region of the Ig light chain). In some aspects, the vectors include a first coding region for the heavy chain variable region of an antibody, and a second coding region for the light chain variable region of the antibody. In some aspects, the two coding regions can be separated, for example, by a 2A selfprocessing sequence to allow multi-cistronic transcription of the two coding regions. In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprise a eukaryotic promoter operably linked to a DNA of interest that encodes an anti-CTLA4 antibody (e.g., a monoclonal antibody) or an antigen binding fragment thereof disclosed herein. In some aspects, the constructs containing the DNA sequence (or the corresponding RNA sequence) which can be used in accordance with the disclosure can be any eukaryotic expression construct containing the DNA or the RNA sequence of interest. For example, a plasmid or viral construct (e.g. an AAV vector) can be cleaved to provide linear DNA having ligatable termini. These termini are bound to exogenous DNA having complementary, like ligatable termini to provide a biologically functional recombinant DNA molecule having an intact replicon and a desired phenotypic property. In some aspects, the construct is capable of replication in both eukaryotic and prokaryotic hosts, which constructs are known in the art and are commercially available.

[0233] In some aspects, the promoter facilitates expression of the DNA of interest (e.g., encoding an anti-CTLA4 antibody or antigen binding fragment thereof). In some aspects, the promoter is a eukaryotic promoter such as a promoter from cytomegalovirus (CMV), mouse mammary tumor virus (MMTV), Rous sarcoma virus (RSV), or adenovirus. Exemplary promoters include, but are not limited to the promoter from the immediate early gene of human CMV (Boshart et al., Cell 41 :521-530 (1985) and the promoter from the long terminal repeat (LTR) of RSV (Gorman et al., Proc. Natl. Acad. Sci. USA 79:6777-6781 (1982)). In some aspects, the promoter is a CMV early enhancer/chicken P actin (CBA) promoter, smCBA, CAG promoter, CMV, EFla, EFla with a CMV enhancer, a CMV promoter with a CMV enhancer (CMVe/p), a CMV promoter with a SV40 intron or tissue specific promoters. In some aspects, the promoter is a CAG promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 33). In some aspects, the promoter is smCBA promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 44).

[0234] In some aspects, the promoter is a cancer specific promoter. In some aspects, the promoter is a hTERT promoter, a Survivin promoter, an Integrin promoter, a EGFR promoter, a HER2/NEU promoter, a VEGFR promoter, a FR promoter, a CD71 promoter, a TRA-1-60 promoter, a COX promoter, an AFP promoter, a CCKAR promoter, a CEA promoter, a c-erbB2 promoter, a CXCR4 promoter, a E2F-1 promoter, a HE4 promoter, a MUC1 promoter, a PSA promoter, a TRP1 promoter. In some aspects, the promoter is a hTERT promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 45). In some aspects, the promoter is a Survivin promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 46).

[0235] In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigen-binding fragment thereof (e.g., Ipilimumab or Tremelimumab) comprises the elements as shown in FIG. 1 A, FIG. IB, FIG. 1C, or FIG. ID. In some aspects, the polynucleotide (e.g., an antibody expression cassette) disclosed herein encoding the anti-CTLA4 antibody or antigenbinding fragment thereof comprises a nucleic acid sequence having at least 85%, at least 90%, at least 95%, at least 96%, at least 97%, at least 98%, at least 99% or 100% sequence identity to SEQ ID NO: 36, 37, 38, or 39.

[0236] For eukaryotic expression, the construct can comprise at a minimum a eukaryotic promoter operably linked to a DNA of interest, which is in turn operably linked to a polyadenylation sequence. The polyadenylation signal sequence can be selected from any of a variety of polyadenylation signal sequences known in the art. In some aspects, the polyadenylation signal sequence is the SV40 early polyadenylation signal sequence. The construct can also include one or more introns, which can increase levels of expression of the DNA of interest, particularly where the DNA of interest is a cDNA (e.g., contains no introns of the naturally-occurring sequence). Any of a variety of introns known in the art can be used (e.g., the human P-globin intron, which is inserted in the construct at a position 5' to the DNA of interest). In some aspects, the intron is an SV40 intron. In some aspects, the intron is a CAG intron. In some aspects, the intron is from an immunoglobulin heavy chain. In some aspects, the intron is a chimera between the human P-globin and immunoglobin heavy chain gene. In some aspects, the intron comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 22-24.

[0237] In some aspects, the construct can comprise a first promoter and a second promoter. In some aspects, the first and second promoter are different. In some aspects, the first and second promoter are the same. In some aspects, the first and second promoter initiate transcription in the same direction. In some aspects, the first and second promoter initiate transcription in different directions.

[0238] In some aspects, the nucleic acid sequence encoding the first promoter and the nucleic acid sequence encoding the second promoter are operably linked. In some aspects, the nucleic acid sequence encoding the first promoter and the nucleic acid sequence encoding the second promoter are operably linked by a pause element.

[0239] In some aspects, the promoter can be a bidirectional promoter.

[0240] In some aspects, the constructs of the disclosure can also include proteolytic cleavage sites. In some aspects, the proteolytic cleavage sites are furin cleavage sites, 2A cleavage sites, P2A cleavage sites, T2A cleavage sites, E2A cleavage sites, F2A cleavage sites, BmCPV 2A cleavage sites, BmIFV 2A cleavage sites, or any combination thereof. In some aspects, the proteolytic cleavage sites are furin cleavage sites and/or 2A cleavage sites.

[0241] In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprises a poly(A). In some aspects, the poly(A) is a synthetic poly(A) or a bovine growth hormone (BGH) poly(A), or a Human growth hormone (HGH) poly(A). In some aspects, the polynucleotide comprises a poly(A) sequence comprising a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 25-27. [0242] When it is desired to include coding regions for two or more individual polypeptide chains, or two or more subunits of a protein of interest in one viral vector, each additional coding region beyond the first is preferably linked to an element that facilitates co-expression of the proteins in host cells, such as an internal ribosomal entry sequence (IRES) element (See e.g., U.S. Patent No. 4,937,190), a furin cleavage site, or a 2A element. In some aspects, IRES, furin cleavage site, or 2A elements can be used when a single vector comprises sequences encoding each subunit of a multi-subunit protein. In the case when the protein of interest is immunoglobulin with a desired specificity, for example, the first coding region (encoding either the heavy or light chain of immunoglobulin) is located downstream from the promoter. The second coding region (encoding the remaining chain of immunoglobulin) can be located downstream from the first coding region, and an IRES, furin cleavage site, or 2A element can be disposed between the two coding regions, e.g., immediately preceding the second coding region. In some aspects, the incorporation of an IRES, furin cleavage site, or 2A element between the sequences of a first and second gene (encoding the heavy and light chains, respectively) can allow both chains to be expressed from the same promoter at about the same level in the cell.

[0243] In some aspects, the nucleic acid sequence of the construct comprises a promoter, heavy chain, IRES, and light chain sequences in 5'-3' orientation. In some aspects, the nucleic acid sequence of the construct comprises a promoter, light chain, IRES, and heavy chain sequences in 5'-3' orientation

[0244] In some aspects, the nucleic acid sequence construct comprises proteolytic cleavage sites. For example, the nucleic acid sequence may comprise a sequence that is incorporated into an expression construct of the disclosure adjacent a self-processing cleavage site, such as a 2 A (SEQ ID NO: 1) or 2 A like sequence, and provides a means to remove additional amino acids that remain following cleavage by the self-processing cleavage sequence. Exemplary proteolytic cleavage sites are described herein and include, but are not limited to, furin cleavage sites with the consensus sequence RXKRR (SEQ ID NO: 2) or RXKR. Such furin cleavage sites can be cleaved by endogenous subtili sin-like proteases, such as furin and other serine proteases within the protein secretion pathway. In some aspects, other exemplary "additional proteolytic cleavage sites" can be used, as described in e.g., Lie et al., Sci Rep 7, 2193 (2017). [0245] In some aspects, the nucleic acid sequence construct comprises a promoter, heavy chain, furin cleavage site, 2A cleavage site, and light chain sequences in 5'-3' orientation. In some aspects, the nucleic acid sequence construct comprises a promoter, light chain, furin cleavage site, 2A cleavage site, and heavy chain sequences in 5'-3' orientation.

[0246] In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprises a first promoter, a nucleic acid sequence encoding a light chain, a second promoter, and a nucleic acid sequence encoding a heavy chain in 5'-3' orientation.

[0247] In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprises a first promoter, a nucleic acid sequence encoding a heavy chain, a second promoter, and a nucleic acid sequence encoding a light chain in 5'-3' orientation.

[0248] In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprises a nucleic acid sequence encoding a heavy chain, a first promoter sequence, a second promoter sequence, and a nucleic acid sequence encoding a light chain in 5'-3' orientation.

[0249] In some aspects, the polynucleotide (e.g., an antibody expression cassette) comprises a nucleic acid sequence encoding a light chain, a first promoter sequence, a second promoter sequence, and a nucleic acid sequence encoding a heavy chain in 5'-3' orientation.

[0250] In some aspects, the promoter is selected from the group consisting of a CAG, CBA, smCBA, CMV, EFla, EFla with a CMV enhancer, a CMV promoter with a CMV enhancer (CMVe/p), a CMV promoter with a SV40 intron or tissue specific promoter. In some aspects, the promoter is a CAG promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 32). In some aspects, the promoter is a smCBA promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 44).

[0251] In some aspects, the promoter is a cancer specific promoter. In some aspects, the promoter (e.g., cancer specific promoter) is a hTERT promoter, a Survivin promoter, an Integrin promoter, a EGFR promoter, a HER2/NEU promoter, a VEGFR promoter, a FR promoter, a CD71 promoter, a TRA-1-60 promoter, a COX promoter, an AFP promoter, a CCKAR promoter, a CEA promoter, a c-erbB2 promoter, a CXCR4 promoter, a E2F-1 promoter, a HE4 promoter, a MUC1 promoter, a PSA promoter, or a TRP1 promoter. In some aspects, the promoter is a hTERT promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 45). In some aspects, the promoter is a Survivin promoter (e.g., comprising the nucleic acid sequence of SEQ ID NO: 46).

[0252] In some aspects, the nucleic acid sequence comprising the promoter can comprises an intron. In some aspects, the intron is selected from the group consisting of an SV40 intron, MVM intron, or a human betaglobin intron.

[0253] The vectors for delivery of the DNA of interest can be either viral or non-viral, or can be composed of naked DNA admixed with an adjuvant such as viral particles (e.g., AAV particle) or cationic lipids or liposomes. An "adjuvant" is a substance that does not by itself produce the desired effect, but acts to enhance or otherwise improve the action of the active compound. The precise vector and vector formulation used will depend upon several factors such as the secretory gland targeted for gene transfer.

[0254] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a first promoter, nucleic acid sequence encoding a heavy chain, a poly(A), a pause element, a second promoter, a 5' LTR, nucleic acid sequence encoding a light chain, and a poly(A) in the 5'-3' orientation. In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a CMV enhancer, a CMV promoter, a nucleic acid encoding a heavy chain, a BGHpA, a pause element, an EFla promoter, a 5' LTR, a nucleic acid encoding a light chain, and a SynpA in the 5'-3' orientation.

[0255] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a first promoter, nucleic acid sequence encoding a light chain, a poly(A), a pause element, a second promoter, a 5' LTR, nucleic acid sequence encoding a heavy chain, and a poly(A) in the 5'-3' orientation. In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a CMV enhancer, a CMV promoter, a nucleic acid encoding a light chain, a BGHpA, a pause element, an EFla promoter, a 5' LTR, a nucleic acid encoding a heavy chain, and a SynpA in the 5'-3' orientation.

[0256] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a poly(A), a nucleic acid sequence encoding a light chain, an intron, a 5' LTR, a first promoter, a second promoter, an intron, a nucleic acid sequence encoding a heavy chain, and a poly(A) in the 5'-3' orientation. In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a SYNpA, a nucleic acid encoding a light chain, a chimera of a betaglobin intron and a immunoglobulin heavy chain intron, a 5' LTR, a EFla promoter fused to a CMV enhancer, a CMV promoter fused to a SV40 intron, a nucleic acid sequence encoding a heavy chain, and a BGHpA in the 5'-3' orientation.

[0257] In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a poly(A), a nucleic acid sequence encoding a heavy chain, an intron, a 5' LTR, a first promoter, a second promoter, an intron, a nucleic acid sequence encoding a light chain, and a poly(A) in the 5'-3' orientation. In some aspects, the nucleic acid construct or expression construct comprises a polynucleotide comprising a SYNpA, a nucleic acid encoding a heavy chain, a chimera of a betaglobin intron and a immunoglobulin heavy chain intron, a 5' LTR, a EFla promoter fused to a CMV enhancer, a CMV promoter fused to a SV40 intron, a nucleic acid sequence encoding a light chain, and a BGHpA in the 5'-3' orientation.

[0258] In some aspects, the polynucleotide comprising an antibody expression cassette further comprises a Kozak consensus sequence. In some aspects, the Kozak consensus sequence is known as a sequence which occurs on eukaryotic mRNA and has the consensus (gcc)gccRccAUGG or gccgccRccAUGG (SEQ ID NO: 28), where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G." In some aspects, the vector comprises a nucleotide sequence having at least about 85%, at least about 90%, at least about 95% sequence identity, or more to the Kozak consensus sequence. In some aspects, the vector comprises a Kozak consensus sequence. In some aspects, the vector includes a Kozak consensus sequence after the polynucleotide encoding one or more proteins of interest is inserted into the vector, e.g., at the restrict site downstream of the promoter. For example, the vector can include a nucleotide sequence of GCCGCCATG, where the ATG is the start codon of the protein of interest. In some aspects, the vector comprises a nucleotide sequence of GCGGCCGCCATG (SEQ ID NO: 29), where the ATG is the start codon of the protein of interest. In some aspects, the vector comprises a nucleotide sequence of CCR(R)CCAUGG where R is a purine (adenine or guanine) three bases upstream of the start codon (AUG), which is followed by another "G."

[0259] In some aspects, the constructs (e.g., vectors or antibody expression constructs) disclosed herein comprise one or more of the elements listed in Table 3. Table 3. Exemplary Construct Nucleic Acid Sequences

[0260] In some aspects, the antibody expression cassette comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49, 50, 51, or 52.

[0261] In some aspects, the vector genome comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36, 37, 38, or 39. [0262] In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 36 or 49. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 37 or 50. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 38 or 51. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 39 or 52.

[0263] In some aspects, the constructs of the disclosure can also include other components such as a marker (e.g., an antibiotic resistance gene (such as an ampicillin resistance gene) or P-galactosidase) to aid in selection of cells containing and/or expressing the construct, an origin of replication for stable replication of the construct in a bacterial cell (preferably, a high copy number origin of replication), a nuclear localization signal, or other elements which facilitate production of the DNA construct, the protein encoded thereby, or both.

[0264] In some aspects, the vector or construct of the disclosure comprises a backbone, e.g., including the replication origin (oriR) and/or antibiotic resistance gene. In some aspects, the backbone comprises a colicin El gene (ColEl) origin of replication and/or a kanamycin resistance gene (KanR). In some aspects, the backbone is a suitable for use in an AAV payload vector (e.g., comprising an antibody expression cassette flanked by 5' and 3' ITRs). In some aspects, the backbone can be a puc57 backbone (Addgene, SEQ ID NO: 40) or a modified version thereof. In some aspects, the backbone comprises a nucleic acid sequence corresponding to SEQ ID NO: 40. In some aspects, the backbone comprises a nucleic acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 40. In some aspects, the backbone can comprise a filler sequence.

[0265] In some aspects, the exogenous (i.e., donor) DNA used in the disclosure is obtained from suitable cells, and the constructs prepared using techniques well known in the art. Likewise, techniques for obtaining expression of exogenous DNA or RNA sequences in a genetically altered host cell are known in the art (see e.g., Kormal et al., Proc. Natl. Acad. Sci. USA, 84:2150-2154 (1987); Sambrook et al. Molecular Cloning: a Laboratory Manual, 2nd Ed., 1989, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N.Y.; each of which are hereby incorporated by reference with respect to methods and compositions for eukaryotic expression of a DNA of interest).

[0266] In some aspects, the polynucleotide (e.g., antibody expression cassette) encoding an anti-CTLA4 antibody disclosed herein is suitable for delivery to a subject, a human subject, an organ, a tissue, a tumor, or other delivery sites disclosed herein.

[0267] In some aspects, the polynucleotide (e.g., antibody expression cassette) encoding an anti-CTLA4 antibody disclosed herein is suitable for treating a cancer (e.g., a melanoma, a small-cell lung cancer, a non-small lung cancer, oat cell carcinoma, a prostate cancer, a renal carcinoma, a urothelial carcinoma, a pancreatic cancer, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a pediatric advanced solid tumors, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triple-negative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, some esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof.

[0268] In some aspects, the polynucleotide (e.g., antibody expression cassette) encoding an anti-CTLA4 antibody disclosed herein is suitable for treating a hematologic malignancy (e.g., hematologic neoplasms, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof).

[0269] In some aspects, the polynucleotide (e.g., antibody expression cassette) encoding an anti-CTLA4 antibody disclosed herein is suitable for treating a cancer (e.g., a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a non-small lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof.)

[0270] In some aspects, the polynucleotide (e.g., antibody expression cassette) encoding an anti-CTLA4 antibody disclosed herein is suitable for delivery to a tumor. In some aspects, the tumor is primary tumor (e.g., a solid tumor). In some aspects, the tumor is a secondary tumor (e.g., metastatic tumor).

[0271] In some aspects, the size of the tumor is at least about 0.1 cm, at least about 0.15 cm, at least about 0.2 cm, at least about 0.25 cm, at least about 0.3 cm, at least about 0.35 cm, at least about 0.4 cm, at least about 0.45 cm, at least about 0.5 cm, at least about 0.55 cm, at least about 0.6 cm, at least about 0.65 cm, at least about 0.7 cm, at least about 0.75 cm, at least about 0.8 cm, at least about 0.85 cm, at least about 0.9 cm, at least about 0.95 cm, at least about 1 cm in diameter, at least about 2 cm in diameter, at least about 3 cm in diameter, at least about 4 cm in diameter, at least about 5 cm in diameter, at least about 6 cm in diameter, at least about 7 cm in diameter, at least about 8 cm in diameter, at least about 9 cm in diameter, at least about 10 cm in diameter, at least about 11 cm in diameter, at least about 12 cm in diameter, at least about 13 cm in diameter, at least about 14 cm in diameter, at least about 15 cm in diameter.

[0272] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter. In some aspects, the tumor (e.g., primary tumor) is about 0.1 cm to about 15 cm in diameter, about 0.2 cm to about 15 centimeters (cm) in diameter, about 0.3 cm to about 15 cm in diameter, about 0.4 cm to about 15 centimeters (cm) in diameter, or about 0.5 cm to about 15 cm in diameter.

[0273] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter, about 0.1 cm to about 14 cm in diameter, about 0.1 cm to about 13 cm in diameter, about 0.1 cm to about 12 cm in diameter, about 0.1 cm to about 11 cm in diameter, about 0.1 cm to about 10 cm in diameter, about 0.1 cm to about 9 cm in diameter, about 0.1 cm to about 8 cm in diameter, about 0.1 cm to about 7 cm in diameter, about 0.1 cm to about 6 cm in diameter, about 0.1 cm to about 5 cm in diameter, about 0.1 cm to about 4 cm in diameter, about 0.1 cm to about 3 cm in diameter, about 0.1 cm to about 2.5 cm, about 0.1 cm to about 2 cm in diameter, about 0.1 cm to about 1.5 cm in diameter, about 0.1 cm to about 1 cm in diameter, about 0.1 cm to about 0.75 cm in diameter, or about 0.1 cm to about 0.5 cm in diameter.

[0274] In some aspects, the tumor is treated and/or the tumor size is reduced.

III. Delivery Vectors

[0275] In certain aspects, provided herein is a delivery vector, e.g., a viral vector, comprising a polynucleotide (e.g., antibody expression cassette) encoding an anti- CTLA4, which is suitable for delivery to a subject, a human subject, a tissue, an organ, or a tumor.

[0276] In some aspects, the delivery vector is a viral vector, a non-viral vector, a plasmid, a lipid, a protein particle, a bacterial vector, a lysosome, a virus-like particle, a polymeric particle, an exosome, or a vault particle. In some aspects, the delivery vector is a viral vector.

Non-Viral Vectors

[0277] In some aspects, the DNA of interest can be administered using a non-viral vector. "Non-viral vector," as used herein is meant to include naked DNA, chemical formulations containing naked DNA (e.g., a formulation of DNA and cationic compounds (e.g., dextran sulfate)), and naked DNA mixed with an adjuvant such as a viral particle (i.e., the DNA of interest is not contained within the viral particle, but the transforming formulation is composed of both naked DNA and viral particles (e.g., AAV particles) (see e.g., Curiel et al., Am. J. Respir. Cell Mol. Biol. 6:247-52 (1992)). Thus the "non-viral vector" can include vectors composed of DNA plus viral particles where the viral particles do not contain the DNA of interest within the viral genome.

[0278] In some aspects, the non-viral vector is a bacterial vector. See e.g., Baban et al., Bioeng Bugs., 1(6):385— 394 (2010).

[0279] In some aspects, the DNA of interest can be complexed with polycationic substances such as poly-L-lysine or DEAC-dextran, targeting ligands, and/or DNA binding proteins (e.g., histones). DNA- or RNA-liposome complex formulations comprise a mixture of lipids which bind to genetic material (DNA or RNA) and facilitate delivery of the nucleic acid into the cell. Liposomes which can be used in accordance with the disclosure include DOPE (dioleyl phosphatidyl ethanol amine), CUDMEDA (N-(5- cholestrum-3-P-ol 3-urethanyl)-N',N'-dimethylethylene diamine). [0280] Lipids which can be used in accordance with the disclosure include, but are not limited to, DOPE (Dioleoyl phosphatidylethanolamine), cholesterol, and CUDMEDA (N- (5-cholestrum-3-ol 3 urethanyl)-N',N'-dimethylethylenediamine). As an example, DNA can be administered in a solution containing one of the following cationic liposome formulations: Lipofectin™ (LTI/BRL), Transfast™ (Promega Corp), Tfx50™ (Promega Corp), TfxlO™ (Promega Corp), or Tfx20™ (Promega Corp). The concentration of the liposome solutions range from about 2.5% to 15% volumewolume, preferably about 6% to 12% volumewolume. Further exemplary methods and compositions for formulation of nucleic acid (e.g., DNA, including DNA or RNA not contained within a viral particle) for delivery according to the method of the disclosure are described in U.S. Pat. Nos. 5,892,071; 5,744,625; 5,925,623; 5,527,928; 5,824,812; 5,869,715.

[0281] Polymer particles can be used in accordance with the disclosure for polymer- based gene delivery. See e.g., Putnam et al., PNAS 98 (3): 1200-1205 (2001).

[0282] In some aspects, the DNA of interest can also be administered as a chemical formulation of DNA or RNA coupled to a carrier molecule (e.g., an antibody or a receptor ligand) which facilitates delivery to host cells for the purpose of altering the biological properties of the host cells. The term "chemical formulations" refers to modifications of nucleic acids to allow coupling of the nucleic acid compounds to a carrier molecule such as a protein or lipid, or derivative thereof. Exemplary protein carrier molecules include antibodies, specific to specific cell types, or receptor ligands, i.e., molecules capable of interacting with receptors associated with a specific target cell.

Viral Vectors

[0283] In some aspects, the viral vectors used in accordance with the disclosure are composed of a viral particle derived from a naturally-occurring virus which has been genetically altered to render the virus replication-defective and to express a recombinant gene of interest in accordance with the disclosure. Once the virus delivers its genetic material to a cell, it does not generate additional infectious virus but does introduce exogenous recombinant genes into the cell, preferably into the genome of the cell.

[0284] In some aspects, the viral vector is a retrovirus, an adenovirus, an adeno- associated virus (AAV), a herpes simplex virus (HSV), a cytomegalovirus (CMV), a vaccinia and a poliovirus vectors. In some aspects, retroviral vectors are less preferred since retroviruses require replicating cells and target organs can comprise slowly replicating and/or terminally differentiated cells. In some aspects, adenovirus and AAV are preferred viral vectors since this virus efficiently infects slowly replicating and/or terminally differentiated cells. In some aspects, the delivery vector (e.g., viral vector) is selected from the group consisting of an adeno-associated viral (AAV) vector, an adenoviral vector, a lentiviral vector, or a retroviral vector.

[0285] Where a replication-deficient virus is used as the viral vector, the production of infective virus particles containing either DNA or RNA corresponding to the DNA of interest can be produced by introducing the viral construct into a recombinant cell line which provides the missing components essential for viral replication. In some aspects, transformation of the recombinant cell line with the recombinant viral vector will not result in production of replication-competent viruses, e.g., by homologous recombination of the viral sequences of the recombinant cell line into the introduced viral vector. Methods for production of replication-deficient viral particles containing a nucleic acid of interest are well known in the art and are described in, e.g., Rosenfeld et al., Science 252:431-434 (1991) and Rosenfeld et al., Cell 68:143-155 (1992) (adenovirus); U.S. Patent No. 5,139,941 (adeno-associated virus); U.S. Patent No. 4,861,719 (retrovirus); and U.S. Patent No. 5,356,806 (vaccinia virus).

[0286] In certain aspects, the viral delivery vector disclosed herein is suitable for intratumoral delivery. In some aspects, the viral vector is suitable for delivery to a solid tumor by direct injection (e.g., fanning administration). In some aspects, the tumor is a primary tumor. In some aspects, the tumor is a malignant tumor. In some aspects, the solid tumor is a surface lesion.

[0287] In some aspects, of the disclosure, the viral vector disclosed herein can be administered in combination with a checkpoint inhibitor.

IV. Adeno-Associated Virus (AAV)-Mediated Gene Therapy

[0288] AAV, a parvovirus belonging to the genus Dependovirus, has several features not found in other viruses. For example, AAV can infect a wide range of host cells, including non-dividing cells. Furthermore, AAV can infect cells from different species. AAV has not been associated with any human or animal disease, and does not appear to alter the physiological properties of the host cell upon integration. Finally, AAV is stable at a wide range of physical and chemical conditions, which lends itself to production, storage, and transportation requirements. [0289] The AAV genome, a linear, single-stranded DNA molecule containing approximately 4700 nucleotides (the AAV-2 genome includes 4681 nucleotides), generally comprises an internal non-repeating segment flanked on each end by inverted terminal repeats (ITRs). The ITRs are approximately 145 nucleotides in length (AAV-1 has ITRs of 143 nucleotides) and have multiple functions, including serving as origins of replication, and as packaging signals for the viral genome.

[0290] The internal non-repeated portion of the genome includes two large open reading frames (ORFs), known as the AAV replication (rep) and capsid (cap) regions. These ORFs encode replication and capsid gene products, respectively: replication and capsid gene products (i.e., proteins) allow for the replication, assembly, and packaging of a complete AAV virion. More specifically, a family of at least four viral proteins are expressed from the AAV rep region: Rep 78, Rep 68, Rep 52, and Rep 40, all of which are named for their apparent molecular weights. The AAV cap region encodes at least three proteins: VP1, VP2, and VP3.

[0291] AAV is a helper-dependent virus, requiring co-infection with a helper virus (e.g., adenovirus, herpesvirus, or vaccinia virus) in order to form functionally complete AAV virions. In the absence of co-infection with a helper virus, AAV establishes a latent state in which the viral genome inserts into a host cell chromosome or exists in an episomal form, but infectious virions are not produced. Subsequent infection by a helper virus "rescues" the integrated genome, allowing it to be replicated and packaged into viral capsids, thereby reconstituting the infectious virion. While AAV can infect cells from different species, the helper virus must be of the same species as the host cell. Thus, for example, human AAV will replicate in canine cells that have been co-infected with a canine adenovirus.

[0292] In some aspects, to produce recombinant AAV (rAAV) virions containing the DNA of interest, a suitable host cell line is transfected with an AAV vector containing the DNA, but lacking rep and cap. The host cell is then infected with wild-type (wt) AAV and a suitable helper virus to form rAAV virions. Alternatively, wt AAV genes (known as helper function genes, comprising rep and cap) and helper virus function genes (known as accessory function genes) can be provided in one or more plasmids, thereby eliminating the need for wt AAV and helper virus in the production of rAAV virions. The helper and accessory function gene products are expressed in the host cell where they act in trans on the rAAV vector containing the heterologous gene. The heterologous gene is then replicated and packaged as though it were a wt AAV genome, forming a recombinant AAV virion. When a patient's cells are transduced with the resulting rAAV virion, the DNA enters and is expressed in the patient's cells. Because the patient's cells lack the rep and cap genes, as well as the accessory function genes, the rAAV virion cannot further replicate and package its genomes. Moreover, without a source of rep and cap genes, wt AAV virions cannot be formed in the patient's cells. See e.g., U.S. Appl. Publ. No. 2003/0147853.

[0293] In some aspects, AAV vectors of the present disclosure can comprise or be derived from any natural or recombinant AAV serotype. According to the present disclosure, the AAV serotype can be, but is not limited to, AAV1, AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAVrh8, AAV9, AAV10, AAVrhlO, AAV11, and AAV12. In some aspects, the AAV vector is an AAV2 serotype. In some aspect, the AAV vector is modified relative to the wild-type AAV serotype sequence. In some aspects, the modified AAV vector is a modified AAV6 vector. In some aspects, the modified AAV6 is an AAV6-RGD vector. In some aspects, the AAV6-RGD vector further comprises modified amino acids corresponding to Y705, Y731, T492, and K531, (e.g., Y705, Y731F, T492V, and K531E; also referred to as AAV-RGD-Y705- 731F+T492V+K531E). In some aspects, the AAV serotype is a synthetic serotype (e.g., AAV-DJ, AAV-PHP.B, AAV2-ESGHGYF, AAVM41, AAV-LK03, AAV2-BR1, AAV587MTP, AAV-Anc80L65, AAV2-7m8, AAV2HBKO, AAV2YF, AAV6-RGD, or AAV6.2 capsid). In some aspects, the AAV serotype is AAV2. In some aspects, the AAV serotype is AAV6. In some aspects, the AAV serotype is a modified AAV6, e.g. AAV6 comprising the RGD peptide (AAV6-RGD) or AAV6 comprising mutations of surface exposed tyrosine residues as described, for example, in Sayroo et al. Gene Ther. 2016 Jan; 23(1): 18-25. In some aspects, the AAV serotype is AAV-DJ.

[0294] Certain aspects of the disclosure are directed to an AAV delivery vector comprising a polynucleotide an antibody expression cassette comprising a nucleic acid encoding an anti-CTLA4 antibody.

[0295] Certain aspects of the disclosure are directed to a combination therapy comprising an AAV vector comprising a polynucleotide (e.g., an antibody expression cassette) comprising a nucleic acid encoding an anti-CTLA4 antibody or antigen-binding fragment thereof disclosed herein.

[0296] In some aspects, the AAV vector disclosed herein is suitable for intratumoral delivery. In some aspects, the AAV vector is suitable for delivery to a solid tumor by direct injection (e.g., fanning administration). In some aspects, the tumor is a primary tumor. In some aspects, the tumor is a malignant tumor. In some aspects, the solid tumor is a surface lesion.

[0297] In some aspects, of the disclosure, the AAV vector disclosed herein can be administered in combination with a checkpoint inhibitor disclosed herein.

[0298] In some aspects, the AAV vector comprising the antibody expression cassette encoding the anti-CTLA4 antibody and optionally the checkpoint inhibitor can be delivered in combination (e.g., simultaneously or sequentially). In some aspects, the checkpoint inhibitor described herein, can be administered prior to, at the same time, or after the administration of the AAV vector and/or the checkpoint inhibitor described herein.

V. AAV Vector Components

[0299] In some aspects, the AAV vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises flanking ITRs, a promoter, nucleic acid sequences encoding a heavy chain (HC) and a light chain (LC), a polyA sequence. In some aspects, the AAV vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure further comprises a linker disclosed herein. In some aspects, the AAV vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises two or more promoters. In some aspects, the AAV vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises the components shown in FIG. 1A, FIG. IB, FIG. 1C, or FIG. ID.

[0300] In some aspects, the antibody expression cassette comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 49, 50, 51, or 52.

[0301] In some aspects, the vector genome comprises a nucleic acid having a sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 36, 37, 38, or 39. [0302] In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 36 or 49. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 37 or 50. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 38 or 51. In some aspects, the vector, construct, or polynucleotide (e.g., antibody expression cassette) of the disclosure comprises a nucleic acid sequence corresponding to SEQ ID NO: 39 or 52.

[0303] In some aspects, the vector or construct of the disclosure comprises a backbone, e.g., including the replication origin (oriR) and/or antibiotic resistance gene. In some aspects, the backbone comprises a colicin El gene (ColEl) origin of replication and/or a kanamycin resistance gene (KanR). In some aspects, the backbone is a suitable for use in an AAV payload vector (e.g., comprising an antibody expression cassette flanked by 5' and 3' ITRs). In some aspects, the backbone can be a puc57 backbone (Addgene, SEQ ID NO: 40) or a modified version thereof. In some aspects, the backbone comprises a nucleic acid sequence corresponding to SEQ ID NO: 40. In some aspects, the backbone comprises a nucleic acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 40. In some aspects, the backbone comprises a filler sequence.

Inverted Terminal Repeats (ITRs)

[0304] The AAV vectors (e.g., rAAV vectors) of the present disclosure comprise a viral genome with at least one ITR region and a payload region, e.g., a polynucleotide encoding a therapeutic protein, e.g., an anti-CTLA-4 antibody or an antigen binding fragment thereof. In some aspects, the AAV vector comprises an antibody expression cassette disclosed herein. In some aspects, the AAV vector has two ITRs (i.e., a pair of ITRs). These two ITRs flank the payload region (e.g., antibody expression cassette) at the 5' and 3' ends. The ITRs function as origins of replication comprising recognition sites for replication. ITRs comprise sequence regions, which can be complementary and symmetrically arranged. ITRs incorporated into AAV vectors of the disclosure can be comprised of naturally occurring polynucleotide sequences or recombinantly derived polynucleotide sequences. [0305] The ITRs can be derived from the same serotype as the capsid, selected from any of the serotypes listed herein, or a derivative thereof. The ITR can be of a different serotype from the capsid. In some aspects, the AAV vector has more than one ITR. In a non-limiting example, the AAV vector has a viral genome comprising two ITRs. In some aspects, the ITRs are of the same serotype as one another. In some aspects, the ITRs are of different serotypes. Non-limiting examples include zero, one or both of the ITRs having the same serotype as the capsid. In some aspects, both ITRs of the AAV vector are AAV2 ITRs.

[0306] Independently, each ITR can be about 75 to about 175 nucleotides in length. An ITR can be about 100-105 nucleotides in length, about 106-110 nucleotides in length, about 111-115 nucleotides in length, about 116-120 nucleotides in length, about 121-125 nucleotides in length, about 126-130 nucleotides in length, about 131-135 nucleotides in length, about 136-140 nucleotides in length, about 141-145 nucleotides in length or about 146-150 nucleotides in length. In some aspects, the ITRs are about 140-142 nucleotides in length. Non-limiting examples of ITR length are about 102, about 140, about 141, about 142, about 145 nucleotides in length, and those having at least 95% identity thereto.

[0307] In some aspects, the AAV vector comprises at least one inverted terminal repeat having a length such as, but not limited to, about 75-80, about 75-85, about 75-100, about 80-85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90-115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105-115, about 105-130, about 110- 115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120-130, about 120-145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135-140, about 135-145, about 135- 160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about 150-155, about 150-160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165-175, or about 170-175 nucleotides.

[0308] In some aspects, the length of a first and/or a second ITR regions for the AAV vector can be about 75-80, about 75-85, about 75-100, about 80-85, about 80-90, about 80-105, about 85-90, about 85-95, about 85-110, about 90-95, about 90-100, about 90- 115, about 95-100, about 95-105, about 95-120, about 100-105, about 100-110, about 100-125, about 105-110, about 105-115, about 105-130, about 110-115, about 110-120, about 110-135, about 115-120, about 115-125, about 115-140, about 120-125, about 120- 130, about 120-145, about 125-130, about 125-135, about 125-150, about 130-135, about 130-140, about 130-155, about 135-140, about 135-145, about 135-160, about 140-145, about 140-150, about 140-165, about 145-150, about 145-155, about 145-170, about ISO- 155, about 150-160, about 150-175, about 155-160, about 155-165, about 160-165, about 160-170, about 165-170, about 165-175, and about 170-175 nucleotides.

[0309] In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein which can be located near the 5 ' end of the flip ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located near the 3' end of the flip ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody) or an antigen binding fragment thereof disclosed herein, which can be located near the 5' end of the flop ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located near the 3' end of the flop ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located between the 5' end of the flip ITR and the 3' end of the flop ITR in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located between (e.g., half-way between the 5' end of the flip ITR and 3' end of the flop ITR or the 3' end of the flop ITR and the 5' end of the flip ITR), the 3' end of the flip ITR and the 5' end of the flip ITR in the vector.

[0310] In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located within about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, about 20, about 21, about 22, about 23, about 24, about 25, about 26, about 27, about 28, about 29, about 30 or more than about 30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector. [0311] As another non-limiting example, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located within about 1-5, about 1-10, about 1-15, about 1- 20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15-25, about 15- 30, about 20-25, about 20-30 or about 25-30 nucleotides downstream or upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0312] In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located within the first about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25% or more than about 25% of the nucleotides upstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

[0313] As another non-limiting example, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located with the first about 1-5%, about 1-10%, about 1- 15%, about 1-20%, about 1-25%, about 5-10%, about 5-15%, about 5-20%, about 5-25%, about 10-15%, about 10-20%, about 10-25%, about 15-20%, about 15-25%, or about 20- 25% downstream from the 5' or 3' end of an ITR (e.g., Flip or Flop ITR) in the vector.

Promoters and Enhancers

[0314] In some aspects, the payload region of the AAV vector comprises at least one element to enhance the nucleic acid specificity and/or expression. Non-limiting examples of elements to enhance the nucleic acid specificity and expression include, e.g., promoters, endogenous miRNAs, post-transcriptional regulatory elements (PREs), polyadenylation (Poly A) signal sequences and upstream enhancers (USEs), CMV enhancers, and introns.

[0315] Expression of nucleic acid of the present disclosure after delivery to or integration in the genomic DNA of a target cell can require a specific promoter, including but not limited to, a promoter that is species specific, inducible, tissue-specific, or cell cyclespecific (Parr et al., Nat. Med.3: 1145-9 (1997); the contents of which are herein incorporated by reference in their entirety). [0316] In some aspects, the promoter is deemed to be efficient when it drives expression of the nucleic acid encoding the protein of interest (e.g., an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein), which is carried in the payload region of the AAV vector. In some aspects, the promoter is a promoter deemed to be efficient when it drives expression of the anti-CTLA4 antibody or an antigen-binding fragment of the present disclosure, wherein the cell being targeted is a tumor cell.

[0317] Promoters can be naturally occurring or non-naturally occurring. Non-limiting examples of promoters include viral promoters and mammalian promoters. In some aspects, the promoters can be human promoters. In some aspects, the promoter can be truncated. Promoters which drive or promote expression in most tissues include, but are not limited to, human elongation factor la-subunit (EFla), cytomegalovirus (CMV) immediate-early enhancer and/or promoter, chicken P-actin (CBA) and its derivative CAG, P glucuronidase (GUSB), or ubiquitin C (UBC). In some aspects, the promoter is a CBA promoter, a CMV promoter, an EF-la (Elongation Factor la) promoter, aRSV (Rous Sarcoma Virus) promoter, an Ubiquitin (UbC) promoter, an hTERT promoter, a Survivin promoter, or any combination thereof. In some aspects, the promoter is a CAG promoter.

[0318] In some aspects, tissue-specific expression promoter can be used to restrict expression to certain cell types such as, but not limited to, muscle specific promoters, B cell promoters, monocyte promoters, leukocyte promoters, macrophage promoters, pancreatic acinar cell promoters, endothelial cell promoters, lung tissue promoters, astrocyte promoters, or nervous system promoters which can be used to restrict expression to neurons, astrocytes, T cell promoter, melanocyte promoter, or oligodendrocytes.

[0319] In some aspects, the promoter is a cancer specific promoter. In some aspects, the promoter is a hTERT promoter, a Survivin promoter, an Integrin promoter, a EGFR promoter, a HER2/NEU promoter, a VEGFR promoter, a FR promoter, a CD71 promoter, a TRA-1-60 promoter, a COX promoter, an AFP promoter, a CCKAR promoter, a CEA promoter, a c-erbB2 promoter, a CXCR4 promoter, a E2F-1 promoter, a HE4 promoter, a MUC1 promoter, a PSA promoter, a TRP1 promoter. In some aspects, the promoter is an hTERT promoter. In some aspects, the promoter is a Survivin promoter. In some aspects, the promoter is an inducible promoter. In some aspects, the promoter is a bidirectional promoter.

[0320] In some aspects, the promoter can be less than 1 kb. In some aspects, the promoter can have a length between about 15-20, about 10-50, about 20-30, about 30-40, about 40- 50, about 50-60, about 50-100, about 60-70, about 70-80, about 80-90, about 90-100, about 100-110, about 100-150, about 110-120, about 120-130, about 130-140, about 140- 150, about 150-160, about 150-200, about 160-170, about 170-180, about 180-190, about 190-200, about 200-210, about 200-250, about 210-220, about 220-230, about 230-240, about 240-250, about 250-260, about 250-300, about 260-270, about 270-280, about 280- 290, about 290-300, about 200-300, about 200-400, about 200-500, about 200-600, about 200-700, about 200-800, about 300-400, about 300-500, about 300-600, about 300-700, about 300-800, about 400-500, about 400-600, about 400-700, about 400-800, about 500- 600, about 500-700, about 500-800, about 600-700, about 600-800 or about 700-800 nucleotides.

[0321] In some aspects, the promoter can be a combination of two or more components of the same or different starting or parental promoters such as, but not limited to, CMV, CAG, EFla, and CBA. In some aspects, the promoter is a CMV early enhancer/chicken P actin (CAG) promoter, CAG, CBA, CMV, EFla, EFla with a CMV enhancer, a CMV promoter with a CMV enhancer (CMVe/p), a CMV promoter with a SV40 intron.

[0322] In some aspects, each component in the promoter can have a length between about 200-300, about 200-400, about 200-500, about 200-600, about 200-700, about 200-800, about 300-400, about 300-500, about 300-600, about 300-700, about 300-800, about 400- 500, about 400-600, about 400-700, about 400-800, about 500-600, about 500-700, about 500-800, about 600-700, about 600-800 or about 700-800 nucleotides. In some aspects, the promoter is a combination of a 382 nucleotide CMV-enhancer sequence and a 260 nucleotide CBA-promoter sequence.

[0323] In some aspects, the promoter combination comprises a CMV enhancer, a CBA promoter, and a CAG intron (e.g., SEQ ID NO: 30, 31 or 48, 23, respectively).

[0324] In some aspects, the AAV vector comprises a ubiquitous promoter. Non-limiting examples of ubiquitous promoters include, e.g., CMV, CBA (including derivatives CAG, CBh, etc ), EF-la, PGK, UBC, GUSB (hGBp), and UCOE (promoter of HNRPA2B1- CBX3). [0325] In some aspects, the promoter is not cell specific. In some aspects, the promoter is an ubiquitin c (UBC) promoter. The UBC promoter can have a size of 300-350 nucleotides. In some aspects, the UBC promoter is 332 nucleotides. In some aspects, the promoter is a P-glucuronidase (GUSB) promoter. The GUSB promoter can have a size of 350-400 nucleotides. In some aspects, the GUSB promoter is 378 nucleotides. In some aspects, the promoter is a neurofilament light (NFL) promoter. The NFL promoter can have a size of 600-700 nucleotides. In some aspects, the NFL promoter is 650 nucleotides. In some aspects, the construct can be AAV-promoter-CMV/globin intron- modulatory polynucleotide-RBG, where the AAV can be self-complementary and the AAV can be the DJ serotype.

[0326] In some aspects, the AAV vector comprises a Pol III promoter. In some aspects, the AAV vector comprises a PI promoter. In some aspects, the AAV vector comprises a FXN promoter. In some aspects, the promoter is a phosphogly cerate kinase 1 (PGK) promoter. In some aspects, the promoter is a chicken P-actin (CBA) promoter. In some aspects, the promoter is a CAG promoter which is a construct comprising the cytomegalovirus (CMV) enhancer fused to the chicken beta-actin (CBA) promoter with a chimeric intron. In some aspects, the promoter is a cytomegalovirus (CMV) promoter. In some aspects, the promoter is an EFla promoter. In some aspects, the promoter is an EFla promoter fused to a CMV enhancer. In some aspects, the promoter is a CMV promoter fused to a CMV enhancer. In some aspects, the promoter is a CMV promoter fused to a SV40 intron. In some aspects, the AAV vector comprises a HI promoter. In some aspects, the AAV vector comprises a U6 promoter. In some aspects, the AAV vector comprises a SP6 promoter (SEQ ID NO: 35). In some aspects, the promoter comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 31-35, 44-46, or 48.

[0327] In some aspects, the AAV vector comprises an enhancer element, a promoter and/or a 5' UTR intron. The enhancer element, also referred to herein as an "enhancer," can be, but is not limited to, a CMV enhancer, the promoter can be, but is not limited to, a EFla, CMV, CBA, UBC, GUSB, NSE, Synapsin, MeCP2, and GFAP promoter and the 5'UTR/intron can be, but is not limited to, SV40, CAG, CBA-MVM (Minute virus of mice), human P-globin, immunoglobulin heavy chain, a chimera between the human P- globin and immunoglobin heavy chain gene.. In some aspects, the intron comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any one of SEQ ID NOs: 22-24. In some aspects, the enhancer is a CMV enhancer. In some aspects, the CMV enhancer comprises a comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 30. In some aspects, the enhancer, promoter and/or intron used in combination can be: (1) CMV enhancer, CMV promoter, SV40 5' UTR intron; (2) CMV enhancer, CBA promoter, SV40 5' UTR intron; (3) CMV enhancer, CBA promoter, CBA-MVM 5'UTR intron; (4) UBC promoter; (5) GUSB promoter; (6) NSE promoter; (7) Synapsin promoter; (8) MeCP2 promoter, (9) GFAP promoter, (10) HI promoter; (11) U6 promoter; (12) CMV promoter, CMV enhancer; (13) EFla promoter, CMV enhancer; or (14) CMV promoter, SV40 intron; (15) human P-globin intron and immunoglobin heavy chain intron chimera, EFla promoter, CMV enhancer, CMV promoter, SV40 intron. In some aspects, the promoter is a cytomegalovirus (CMV) promoter. In some aspects, the intron is a SV40 intron, MVM intron or a human betaglobin intron in the vector. In some aspects, the promoter is a CBA promoter. In some aspects, the promoter is an EFla promoter. In some aspects, the promoter is a CMV promoter fused to a CMV enhancer. In some aspects, the promoter is a CMV enhancer fused to an EFla promoter. In some aspects, the promoter is a CMV promoter fused to a SV40 intron. In some aspects, the AA vector comprises an engineered promoter. In some aspects, the AAV vector comprises a CMV early enhancer/chicken P actin (CAG) promoter. In some aspects, the AAV vector comprises a promoter from a naturally expressed protein.

Untranslated Regions (UTRs)

[0328] Wild-type untranslated regions (UTRs) of a gene are transcribed but not translated. Generally, the 5' UTR starts at the transcription start site and ends at the start codon and the 3' UTR starts immediately following the stop codon and continues until the termination signal for transcription.

[0329] Features typically found in abundantly expressed genes of specific target organs can be engineered into UTRs to enhance transcribed product stability and production.

[0330] Wild-type 5' untranslated regions (UTRs) include features which play roles in translation initiation. Kozak sequences, which are commonly known to be involved in the process by which the ribosome initiates translation of many genes, are usually included in 5' UTRs. Kozak sequences have the consensus CCR(R)CCAUGG, where R is a purine (adenine or guanine) three bases upstream of the start codon (ATG), which is followed by another 'G. In some aspects, the 5' UTR in an AAV vector of the present disclosure includes a Kozak sequence. In some aspects, the 5' UTR in an AAV vector of the present disclosure does not include a Kozak sequence.

[0331] Wild-type 3' UTRs are known to have stretches of Adenosines and Uridines embedded therein. These AU rich signatures are particularly prevalent in genes with high rates of turnover. Based on their sequence features and functional properties, the AU rich elements (AREs) can be separated into three classes (Chen et al, 1995, the contents of which are herein incorporated by reference in its entirety). Class I AREs, such as, but not limited to, c-Myc and MyoD, contain several dispersed copies of an AUUUA motif within U-rich regions. Class II AREs, such as, but not limited to, GM-CSF and TNF-oc, possess two or more overlapping UUAUUUA(U/A)(U/A) nonamers. Class III ARES, such as, but not limited to, c-Jun and Myogenin, are less well defined. These U rich regions do not contain an AUUUA motif. Most proteins binding to the AREs are known to destabilize the messenger, whereas members of the ELAV family, most notably HuR, have been documented to increase the stability of mRNA. HuR binds to AREs of all the three classes. Engineering the HuR specific binding sites into the 3' UTR of nucleic acid molecules will lead to HuR binding and thus, stabilization of the message in vivo.

[0332] Introduction, removal or modification of 3' UTR AU rich elements (AREs) can be used to modulate the stability of polynucleotides. When engineering specific polynucleotides, e.g., payload regions of viral genomes, one or more copies of an ARE can be introduced to make polynucleotides less stable and thereby curtail translation and decrease production of the resultant protein. Likewise, AREs can be identified and removed or mutated to increase the intracellular stability and thus increase translation and production of the resultant protein.

[0333] In some aspects, the 3' UTR of an AAV vector of the present disclosure can include an oligo(dT) sequence for addition of a poly- A tail. In some aspects, an AAV vector of the present disclosure can include at least one miRNA seed, binding site or full sequence. microRNAs (or miRNA or miR) are 19-25 nucleotide noncoding RNAs that bind to the sites of nucleic acid targets and down-regulate gene expression either by reducing nucleic acid molecule stability or by inhibiting translation. A microRNA sequence comprises a "seed" region, i.e., a sequence in the region of positions 2-8 of the mature microRNA, which sequence has perfect Watson-Crick complementarity to the miRNA target sequence of the nucleic acid.

[0334] In some aspects, an AAV vector of the present disclosure can be engineered to include, alter or remove at least one miRNA binding site, sequence or seed region.

[0335] Any UTR from any gene known in the art can be incorporated into an AAV vector of the present disclosure. These UTRs, or portions thereof, can be placed in the same orientation as in the gene from which they were selected or they can be altered in orientation or location. In some aspects, the UTR used in an AAV vector of the present disclosure can be inverted, shortened, lengthened, made with one or more other 5' UTRs or 3' UTRs known in the art. As used herein, the term "altered" as it relates to a UTR, means that the UTR has been changed in some way in relation to a reference sequence. For example, a 3' or 5' UTR can be altered relative to a wild-type or native UTR by the change in orientation or location as taught above or can be altered by the inclusion of additional nucleotides, deletion of nucleotides, swapping or transposition of nucleotides. In some aspects, an AAV vector of the present disclosure comprises at least one artificial UTRs, which is not a variant of a wild-type UTR. In some aspects, an AAV vector of the present disclosure comprises UTRs, which have been selected from a family of transcripts whose proteins share a common function, structure, feature or property.

Polyadenylation Sequence

[0336] In some aspects, the AAV vectors or expression cassettes of the present disclosure comprise at least one polyadenylation sequence. The AAV vectors of the present disclosure can comprise a polyadenylation sequence between the 3' end of the payload coding sequence and the 5' end of the 3' ITR.

[0337] In some aspects, the polyadenylation sequence or "polyA sequence" can range from absent to about 500 nucleotides in length.

[0338] In some aspects, the polyadenylation sequence is about 10-100, about 10-90, about 10-80, about 10-70, about 10-60, about 10-55, about 10-50, about 20-100, about 20-90, about 20-80, about 20-70, about 20-60, about 20-55, about 20-50, about 30-100, about 30-90, about 30-80, about 30-70, about 30-60, about 30-55, about 30-50, about 40- 100, about 40-90, about 40-80, about 40-70, about 40-60, about 40-55, about 40-50, about 45-100, about 45-90, about 45-80, or about 45-70 about 45-60, about 45-55, about 45-50 nucleotides in length. In some aspects, the polyadenylation sequence is about 49 nucleotides in length.

[0339] In some aspects, the AAV vector or expression cassette comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located upstream of the polyadenylation sequence in the vector. In some aspects, the AAV vector comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, which can be located downstream of a promoter such as, but not limited to, EFla, CMV, U6, CAG, CBA EFla with a CMV enhancer, CMV promoter with a SV40 intron, CMV promoter with a CMV enhancer, or a CBA promoter with a SV40 intron, MVM intron a human betaglobin intron, immunoglobulin heavy chain intron, or a chimera of a human betaglobin intron and a immunoglobulin heavy chain intron in the vector.

[0340] In some aspects, the AAV vector or expression cassette comprises a nucleic acid sequence encoding a protein of interest (e.g., an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein), which can be located within about 1-5, about 1-10, about 1-15, about 1-20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15-25, about 15-30, about 20-25, about 20-30 or about 25-30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in the vector.

[0341] In some aspects, the AAV vector or expression cassette comprises a rabbit globin polyadenylation (poly A) signal sequence. In some aspects, the AAV vector or expression cassette comprises a human growth hormone polyadenylation (poly A) signal sequence. In some aspects, the AAV vector or expression cassette comprises a human growth hormone polyadenylation (poly A) (hGHpA) signal sequence. In some aspects, hGHpA has a nucleic acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 27. In some aspects, the AAV vector comprises a bovine growth hormone polyadenylation (poly A) (bGHpA) signal sequence. In some aspects, bGHpA has a nucleic acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 26. In some aspects, the AAV vector comprises a synthetic (SYN) polyadenylation (poly A) (SYNpA) signal sequence. In some aspects, SYNpA has a nucleic acid sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to SEQ ID NO: 25.

Introns

[0342] In some aspects, the payload region of an AAV vector of the present disclosure comprises at least one element to enhance the expression such as one or more introns or portions thereof. Non-limiting examples of introns include, MVM (67-97 bps), F.IX truncated intron 1 (300 bps), P-globin SD/immunoglobulin heavy chain splice acceptor (250 bps), adenovirus splice donor/immunoglobin splice acceptor (500 bps), SV40 late splice donor/splice acceptor (19S/16S) (180 bps) and hybrid adenovirus splice donor/IgG splice acceptor (230 bps). In some aspects, non-limiting examples of introns include, but are not limited to, SV40 intron, CAG intron, or a chimeric intron that can be a chimera of a human betaglobin intron and a human immunoglobin heavy chain intron. In some aspects, the intron can have a nucleotide sequence with at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 22-24.

[0343] In some aspects, the intron or intron portion can be between about 100 and about 500 nucleotides in length. In some aspects, the intron can have a length between about 80-100, about 80-120, about 80-140, about 80-160, about 80-180, about 80-200, about 80-250, about 80-300, about 80-350, about 80-400, about 80-450, about 80-500, about 200-300, about 200-400, about 200-500, about 300-400, about 300-500, or about 400-500 nucleotides.

[0344] In some aspects, the AAV vector or expression cassette can comprise a chimeric intron. In some aspects, the AAV vector or expression cassette can comprise a SV40 intron. In some aspects, the AAV vector or expression cassette can comprise an immunoglobulin heavy chain intron. In some aspects, the AAV vector or expression cassette can comprise a human betaglobin intron. In some aspects, the AAV vector or expression cassette can comprise a chimera of a human betaglobin intron and an immunoglobulin heavy chain intron.

[0345] In some aspects, the encoded anti-CTLA4 antibody or antigen binding fragment thereof disclosed herein can be located downstream of a promoter in an expression vector such as, but not limited to, CMV, U6, HI, CB A, CAG, or a CBA promoter with an intron such as SV40, MVM intron, a human betaglobin intron, human immunoglobulin heavy chain intron, a chimera of a human betaglobin intron and a human immunoglobulin heavy chain intron, or others known in the art. In some aspects, the intron is selected from the group consisting of an SV40 intron, a CAG intron, a MVM intron, a human betaglobin intron, a human immunoglobulin heavy chain intron, or a chimera of a human betaglobin intron and a human immunoglobulin heavy chain intron. In some aspects, the intron comprises a nucleotide sequence at least 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identical to any of SEQ ID NOs: 22-24.

[0346] Further, the encoded antibody or antigen-binding fragment thereof can also be located upstream of the polyadenylation sequence in an expression vector. In some aspects, the encoded a therapeutic protein, e.g., antibody (e.g., a monoclonal antibody) or antigen binding fragment thereof or the fusion protein (e.g., the Fc fusion protein) disclosed herein, or therapeutic peptide can be located within about 1-5, about 1-10, about 1-15, about 1-20, about 1-25, about 1-30, about 5-10, about 5-15, about 5-20, about 5-25, about 5-30, about 10-15, about 10-20, about 10-25, about 10-30, about 15-20, about 15- 25, about 15-30, about 20-25, about 20-30 or about 25-30 nucleotides downstream from the promoter and/or upstream of the polyadenylation sequence in the vector.

Filler Sequences

[0347] In some aspects, the AAV vector comprises one or more filler sequences (also referred to as "stuffer sequences"). In some aspects, the AAV vector comprises one or more filler sequences in order to have the length of the AAV vector be the optimal size for packaging. In some aspects, the AAV vector comprises at least one filler sequence in order to have the length of the AAV vector be about 2.0-2.5 kb, e.g., about 2.3 kb. In some aspects, the vector backbone comprises a filler sequence.

[0348] In some aspects, the AAV vector comprises one or more filler sequences in order to reduce the likelihood that a hairpin structure of the vector genome (e.g., a modulatory polynucleotide described herein) can be read as an inverted terminal repeat (ITR) during expression and/or packaging.

[0349] In some aspects, the AAV vector is a single stranded (ss) AAV vector and comprises one or more filler sequences which have a length about between 0.1 kb and about 3.8 kb, such as, but not limited to, about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 0.6 kb, about 0.7 kb, about 0.8 kb, about 0.9 kb, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, about 1.5 kb, about 1.6 kb, about 1.7 kb, about 1.8 kb, about 1.9 kb, about 2 kb, about 2.1 kb, about 2.2 kb, about 2.3 kb, about 2.4 kb, about 2.5 kb, about 2.6 kb, about 2.7 kb, about 2.8 kb, about 2.9 kb, about 3 kb, about 3.1 kb, about 3.2 kb, about 3.3 kb, about 3.4 kb, about 3.5 kb, about 3.6 kb, about 3.7 kb, or about 3.8 kb.

[0350] In some aspects, the AAV vector is a self-complementary (sc) AAV vector and comprises one or more filler sequences which have a length about between about 0.1 kb and about 1.5 kb, such as, but not limited to, about 0.1 kb, about 0.2 kb, about 0.3 kb, about 0.4 kb, about 0.5 kb, about 0.6 kb, about 0.7 kb, about 0.8 kb, about 0.9 kb, about 1 kb, about 1.1 kb, about 1.2 kb, about 1.3 kb, about 1.4 kb, or about 1.5 kb.

[0351] In some aspects, the AAV vector comprises any portion of a filler sequence. The vector can comprise, e.g., about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% of a filler sequence.

[0352] In some aspects, the AAV vector is a single stranded (ss) AAV vector and comprises one or more filler sequences in order to have the length of the AAV vector be about 4.6 kb. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the 5' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to a promoter sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to the 3' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located between two intron sequences. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located within an intron sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 5' to a promoter sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 5' to the 5' ITR sequence.

[0353] In some aspects, the AAV vector is a self-complementary (sc) AAV vector and comprises one or more filler sequences in order to have the length of the AAV vector be about 2.3 kb. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the 5' ITR sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to a promoter sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises at least one filler sequence and the filler sequence is located 5' to the 3' ITR sequence.

[0354] In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located between two intron sequences. In some aspects, the AAV vector comprises at least one filler sequence, and the filler sequence is located within an intron sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 5' to a promoter sequence and the second filler sequence is located 3' to the polyadenylation signal sequence. In some aspects, the AAV vector comprises two filler sequences, and the first filler sequence is located 3' to the 5' ITR sequence and the second filler sequence is located 5' to the 5' ITR sequence.

[0355] In some aspects, the AAV vector can comprise one or more filler sequences between one of more regions of the AAV vector. In some aspects, the filler region can be located before a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and/or a polyadenylation signal sequence region. In some aspects, the filler region can be located after a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and/or a polyadenylation signal sequence region. In some aspects, the filler region can be located before and after a region such as, but not limited to, a payload region, an ITR, a promoter region, an intron region, an enhancer region, and/or a polyadenylation signal sequence region.

[0356] In some aspects, the AAV vector can comprise one or more filler sequences which bifurcates at least one region of the AAV vector. The bifurcated region of the AAV vector can comprise about 1%, about 2%, about 3%, about 4%, about 5%, about 6%, about 7%, about 8%, about 9%, about 10%, about 15%, about 20%, about 25%, about 30%, about 35%, about 40%, about 45%, about 50%, about 55%, about 60%, about 65%, about 70%, about 75%, about 80%, about 85%, about 90%, about 95%, or about 99% of the of the region to the 5' of the filler sequence region.

[0357] In some aspects, the filler sequence can bifurcate at least one region so that about 10% of the region is located 5' to the filler sequence and about 90% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 20% of the region is located 5' to the filler sequence and about 80% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 30% of the region is located 5' to the filler sequence and about 70% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 40% of the region is located 5' to the filler sequence and about 60% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 50% of the region is located 5' to the filler sequence and about 50% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 60% of the region is located 5' to the filler sequence and about 40% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 70% of the region is located 5' to the filler sequence and about 30% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 80% of the region is located 5' to the filler sequence and about 20% of the region is located 3' to the filler sequence. In some aspects, the filler sequence can bifurcate at least one region so that about 90% of the region is located 5' to the filler sequence and about 10% of the region is located 3' to the filler sequence.

[0358] In some aspects, the AAV vector comprises a filler sequence after the 5' ITR. In some aspects, the AAV vector comprises a filler sequence after the promoter region. In some aspects, the AAV vector comprises a filler sequence after the payload region. In some aspects, the AAV vector comprises a filler sequence after the intron region. In some aspects, the AAV vector comprises a filler sequence after the enhancer region. In some aspects, the AAV vector comprises a filler sequence after the polyadenylation signal sequence region. In some aspects, the AAV vector comprises a filler sequence before the promoter region. In some aspects, the AAV vector comprises a filler sequence before the payload region. In some aspects, the AAV vector comprises a filler sequence before the intron region.

[0359] In some aspects, the AAV vector comprises a filler sequence before the enhancer region. In some aspects, the AAV vector comprises a filler sequence before the polyadenylation signal sequence region. In some aspects, the AAV vector comprises a filler sequence before the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the promoter region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the payload region.

[0360] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the 5' ITR and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the payload region.

[0361] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the promoter region and the 3' ITR.

[0362] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the intron region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the payload region and the 3' ITR.

[0363] In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the enhancer region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the intron region and the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the enhancer region and the polyadenylation signal sequence region. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the enhancer region and the 3' ITR. In some aspects, a filler sequence can be located between two regions, such as, but not limited to, the polyadenylation signal sequence region and the 3' ITR.

[0364] In some aspects, an AAV vector can comprise two filler sequences. The two filler sequences can be located between two regions as described herein.

Method for Producing Recombinant AA Vs

[0365] The present disclosure provides also methods for the generation of AAV particles, by viral genome replication in a viral replication cell comprising contacting the viral replication cell with an AAV polynucleotide or AAV genome (e.g., an AAV vector of the present disclosure). In the context of the present disclosure, the AAV vectors disclosed herein, e.g., AAV vectors comprising at least one polynucleotide (e.g., an antibody expression cassette) encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein are considered AAV payload construct vectors.

[0366] In some aspects, an AAV particle is produced by a method comprising the steps of (1) co-transfecting competent bacterial cells with a bacmid vector and either a viral construct vector and/or AAV payload construct vector, (2) isolating the resultant viral construct expression vector and AAV payload construct expression vector and separately transfecting viral replication cells, (3) isolating and purifying resultant payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, (4) co-infecting a viral replication cell with both the AAV payload and viral construct particles comprising viral construct expression vector or AAV payload construct expression vector, and (5) harvesting and purifying the viral particle comprising a parvoviral genome.

[0367] In one aspect, the present disclosure provides a method for producing an AAV particle comprising the steps of (1) simultaneously co-transfecting mammalian cells, such as, but not limited to HEK293 cells, with a payload region (e.g., polynucleotide encoding an anti-CTLA4 antibody of the disclosure), a construct expressing rep and cap genes and a helper construct, and (2) harvesting and purifying the AAV particle comprising a viral genome.

[0368] In some aspects, the AAV particles can be produced in a viral replication cell that comprises an insect cell. Growing conditions for insect cells in culture, and production of heterologous products in insect cells in culture are well-known in the art, see, e.g., U.S. Patent No. 6,204,059.

[0369] The viral replication cell can be selected from any biological organism, including prokaryotic (e.g., bacterial) cells, and eukaryotic cells, including, insect cells, yeast cells and mammalian cells. Viral replication cells can comprise mammalian cells such as A549, WEH1, 3T3, 10T1/2, BHK, MDCK, COS 1, COS 7, BSC 1, BSC 40, BMT 10, VERO. W138, HeLa, HEK293, Saos, C2C12, L cells, HT1080, HepG2 and primary fibroblast, hepatocyte and myoblast cells derived from mammals. Viral replication cells comprise cells derived from mammalian species including, but not limited to, human, monkey, mouse, rat, rabbit, and hamster or cell type, including but not limited to fibroblast, hepatocyte, tumor cell, cell line transformed cell, etc.

[0370] Viral production disclosed herein describes processes and methods for producing AAV particles that contact a target cell to deliver a payload, e.g. a recombinant viral construct, which comprises a polynucleotide (e.g., an antibody expression cassette) sequence encoding a payload such as an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein.

[0371] In some aspects, the AAV particles can be produced in a viral replication cell that comprises a mammalian cell. Viral replication cells commonly used for production of recombinant AAV particles include, but are not limited to 293 cells, COS cells, HeLa cells, and KB cells. [0372] In some aspects, AAV particles are produced in mammalian cells wherein all three VP proteins are expressed at a stoichiometry approaching 1 : 1 : 10 (VP1 :VP2:VP3). The regulatory mechanisms that allow this controlled level of expression include the production of two mRNAs, one for VP1, and the other for VP2 and VP3, produced by differential splicing.

[0373] In some aspects, AAV particles are produced in mammalian cells using a triple transfection method wherein a payload construct, parvoviral Rep and parvoviral Cap and a helper construct are comprised within three different constructs. The triple transfection method of the three components of AAV particle production can be utilized to produce small lots of virus for assays including transduction efficiency, target tissue (tropism) evaluation, and stability.

[0374] In some aspects, the viral construct vector and the AAV payload construct vector can be each incorporated by a transposon donor/acceptor system into a bacmid, also known as a baculovirus plasmid, by standard molecular biology techniques known and performed by a person skilled in the art. Transfection of separate viral replication cell populations produces two baculoviruses, one that comprises the viral construct expression vector, and another that comprises the AAV payload construct expression vector. The two baculoviruses can be used to infect a single viral replication cell population for production of AAV particles.

[0375] Baculovirus expression vectors for producing viral particles in insect cells, including but not limited to Spodoptera frugiperda (Sf9) cells, provide high titers of viral particle product. Recombinant baculovirus encoding the viral construct expression vector and AAV payload construct expression vector initiates a productive infection of viral replicating cells. Infectious baculovirus particles released from the primary infection secondarily infect additional cells in the culture, exponentially infecting the entire cell culture population in a number of infection cycles that is a function of the initial multiplicity of infection, see, e.g., Urabe, M. et al., J Virol. 2006 Feb; 80 (4): 1874-85, the contents of which are herein incorporated by reference in their entirety.

[0376] Production of AAV particles with baculovirus in an insect cell system can address known baculovirus genetic and physical instability. Baculovirus-infected viral producing cells are harvested into aliquots that can be cryopreserved in liquid nitrogen; the aliquots retain viability and infectivity for infection of large-scale viral producing cell culture (Wasilko DJ et al., Protein Expr Purif. 2009 Jun; 65(2): 122-32).

[0377] In some aspects, stable viral replication cells permissive for baculovirus infection are engineered with at least one stable integrated copy of any of the elements necessary for AAV replication and viral particle production including, but not limited to, the entire AAV genome, Rep and Cap genes, Rep genes, Cap genes, each Rep protein as a separate transcription cassette, each VP protein as a separate transcription cassette, the AAP (assembly activation protein), or at least one of the baculovirus helper genes with native or non-native promoters.

[0378] In some aspects, AAV particle production can be modified to increase the scale of production. Transfection of replication cells in large-scale culture formats can be carried out according to any methods known in the art.

[0379] In some aspects, cell culture bioreactors can be used for large scale viral production. In some cases, bioreactors comprise stirred tank reactors.

Cell Lysis

[0380] Cells of the disclosure, including, but not limited to viral production cells, can be subjected to cell lysis according to any methods known in the art. Cell lysis can be carried out to obtain one or more agents (e.g. viral particles) present within any cells of the disclosure.

[0381] Cell lysis methods can be chemical or mechanical. Chemical cell lysis typically comprises contacting one or more cells with one or more lysis agent. Mechanical lysis typically comprises subjecting one or more cells to one or more lysis condition and/or one or more lysis force. In some aspects, chemical lysis can be used to lyse cells. As used herein, the term "lysis agent" refers to any agent that can aid in the disruption of a cell. In some cases, lysis agents are introduced in solutions, termed lysis solutions or lysis buffers. As used herein, the term "lysis solution" refers to a solution (typically aqueous) comprising one or more lysis agent. In addition to lysis agents, lysis solutions can include one or more buffering agents, solubilizing agents, surfactants, preservatives, cryoprotectants, enzymes, enzyme inhibitors and/or chelators.

[0382] Concentrations of salts can be increased or decreased to obtain an effective concentration for rupture of cell membranes. Lysis agents comprising detergents can include ionic detergents or non-ionic detergents. Detergents can function to break apart or dissolve cell structures including, but not limited to cell membranes, cell walls, lipids, carbohydrates, lipoproteins and glycoproteins.

[0383] In some aspects, mechanical cell lysis is carried out. Mechanical cell lysis methods can include the use of one or more lysis condition and/or one or more lysis force. As used herein, the term "lysis condition" refers to a state or circumstance that promotes cellular disruption. Lysis conditions can comprise certain temperatures, pressures, osmotic purity, salinity and the like. In some aspects, lysis conditions comprise increased or decreased temperatures. In some aspects, lysis conditions comprise changes in temperature to promote cellular disruption. Cell lysis carried out according to such aspects can include freeze-thaw lysis.

[0384] As used herein, the term "lysis force" refers to a physical activity used to disrupt a cell. Lysis forces can include, but are not limited to mechanical forces, sonic forces, gravitational forces, optical forces, electrical forces and the like. Cell lysis carried out by mechanical force is referred to herein as "mechanical lysis." Mechanical forces that can be used according to mechanical lysis can include high shear fluid forces.

[0385] In some aspects, a method for harvesting AAV particles without lysis can be used for efficient and scalable AAV particle production. In a non-limiting example, AAV particles can be produced by culturing an AAV particle lacking a heparin binding site, thereby allowing the AAV particle to pass into the supernatant, in a cell culture, collecting supernatant from the culture; and isolating the AAV particle from the supernatant, as described in US Patent Application 20090275107.

AA V Purification

[0386] Cell lysates comprising viral particles can be subjected to clarification. Clarification refers to initial steps taken in purification of viral particles from cell lysates. Clarification serves to prepare lysates for further purification by removing larger, insoluble debris. Clarification steps can include, but are not limited to centrifugation and filtration.

[0387] In some aspects, AAV particles can be purified from clarified cell lysates by one or more methods of chromatography. Chromatography refers to any number of methods known in the art for separating out one or more elements from a mixture. Such methods can include, but are not limited to ion exchange chromatography (e.g. cation exchange chromatography and anion exchange chromatography), immunoaffinity chromatography and size-exclusion chromatography.

VI. Methods of Treatment and Use

[0388] Certain aspects of the disclosure are directed to a method of treating a subject suffering from cancer and/or a tumor comprising administering an AAV vector, a construct (e.g., antibody expression construct), a polynucleotide, a rAAV vector, a combination therapy, or a composition disclosed herein to the subject.

[0389] Certain aspects of the disclosure are directed to a method of reducing the size of a tumor or treating a cancer (e.g., inducing tumor regression) in a subject in need thereof comprising administering an AAV vector, a construct (e.g., antibody expression construct), a polynucleotide, a rAAV vector, a combination therapy, a gene therapy, or a composition disclosed herein to the subject.

[0390] Some aspects of the present disclosure are directed to a method of delivering a polynucleotide encoding an anti-CTLA4 antibody or antigen-binding fragment thereof to a subject in need thereof. In some aspects, the administration is suitable for delivery of an AAV vector, a construct (e.g., antibody expression construct), a polynucleotide, a rAAV vector, a combination therapy, a gene therapy, or a composition to a tumor. In some aspects, the administration is by injection (e.g., fanning administration). In some aspects, the administration is intratumoral. In some aspects, the administration is intravenous. In some aspects, the tumor is in an organ and the administration comprises injection into an area in the lymphatic or other vasculature adjacent to the organ.

[0391] In some aspects, the method treats or reduces symptoms in a subject suffering from a tumor, e.g., a primary tumor and/or a metastatic tumor and/or a nodal lesion.

[0392] In some aspects, the method reduces the size of a tumor, e.g., a primary tumor and/or a metastatic tumor and/or a nodal lesion.

[0393] In some aspects, the tumor comprises a primary tumor. In some aspects, the tumor comprises a metastatic tumor. In some aspects the tumor comprises a nodal lesion.

[0394] In some aspects, the size of the tumor is at least about 0.1 cm, at least about 0.15 cm, at least about 0.2 cm, at least about 0.25 cm, at least about 0.3 cm, at least about 0.35 cm, at least about 0.4 cm, at least about 0.45 cm, at least about 0.5 cm, at least about 0.55 cm, at least about 0.6 cm, at least about 0.65 cm, at least about 0.7 cm, at least about 0.75 cm, at least about 0.8 cm, at least about 0.85 cm, at least about 0.9 cm, at least about 0.95 cm, at least about 1 cm in diameter, at least about 2 cm in diameter, at least about 3 cm in diameter, at least about 4 cm in diameter, at least about 5 cm in diameter, at least about 6 cm in diameter, at least about 7 cm in diameter, at least about 8 cm in diameter, at least about 9 cm in diameter, at least about 10 cm in diameter, at least about 11 cm in diameter, at least about 12 cm in diameter, at least about 13 cm in diameter, at least about 14 cm in diameter, at least about 15 cm in diameter.

[0395] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter. In some aspects, the tumor (e.g., primary tumor) is about 0.1 cm to about 15 cm in diameter, about 0.2 cm to about 15 centimeters (cm) in diameter, about 0.3 cm to about 15 cm in diameter, about 0.4 cm to about 15 centimeters (cm) in diameter, or about 0.5 cm to about 15 cm in diameter.

[0396] In some aspects, the size of the tumor (e.g., primary tumor) is about 0.1 cm to about 15 centimeters (cm) in diameter, about 0.1 cm to about 14 cm in diameter, about 0.1 cm to about 13 cm in diameter, about 0.1 cm to about 12 cm in diameter, about 0.1 cm to about 11 cm in diameter, about 0.1 cm to about 10 cm in diameter, about 0.1 cm to about 9 cm in diameter, about 0.1 cm to about 8 cm in diameter, about 0.1 cm to about 7 cm in diameter, about 0.1 cm to about 6 cm in diameter, about 0.1 cm to about 5 cm in diameter, about 0.1 cm to about 4 cm in diameter, about 0.1 cm to about 3 cm in diameter, about 0.1 cm to about 2.5 cm, about 0.1 cm to about 2 cm in diameter, about 0.1 cm to about 1.5 cm in diameter, about 0.1 cm to about 1 cm in diameter, about 0.1 cm to about 0.75 cm in diameter, or about 0.1 cm to about 0.5 cm in diameter.

[0397] In some aspects, the tumor is treated and/or the tumor size is reduced.

[0398] In some aspects, the administration comprises injection into a single site of the tumor. In some aspects, the administration comprises injection into multiple sites of the tumor. In some aspects, the administration comprises injection into a primary tumor. In some aspects, the administration comprises injection into a metastatic tumor. In some aspects, the administration comprises injection into a nodal lesion. In some aspects, the tumor is in an organ and the administration comprises injection into an area in the lymphatic or other vasculature adjacent to the organ. In some aspects the injection is a fanning administration.

[0399] In some aspects, the administration comprises a single dose. In some aspects, the administration comprises a multiple doses. In some aspects, the administration comprises multiple doses, wherein the first dose is a priming dose and the following dose or doses are maintenance dose or doses. In some aspects the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein, are administered in a first priming dose and in one or more subsequent maintenance doses. In some aspects, the priming dose and the maintenance dose or doses are the same. In some aspects, the priming dose and the maintenance dose or doses are different. In some aspects, the priming dose and the maintenance dose or doses are administered through the same route. In some aspects, the priming dose and the maintenance dose or doses are administered through a different route.

[0400] In some aspects, the administration is peri-operative. In some aspects, the method is directed to an adjuvant treatment, which is delivered before or after the primary treatment for a cancer. In some aspects, the tumor is an un-resectable tumor. In some aspects, the tumor is a resectable tumor. In some aspects, the tumor is removed by surgery. In some aspects, the administration is a neoadjuvant therapy administration which is administered before the surgery. In some aspects, the administration is an adjuvant therapy administration which is administered after the surgery. In some aspects, the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition of the disclosure is administered as a neoadjuvant therapy before the surgery, and/or as an adjuvant therapy after the surgery In some aspects, the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition of the disclosure is co-administer with a chemotherapy. In some aspects, the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition of the disclosure is co-administer with a radiation therapy.

[0401] In some aspects, the administration comprises a crescendo dosing regimen, wherein the first dose of the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition disclosed herein is the lowest dose in the dosing regimen and the last dose of the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition disclosed herein is the highest dose in the dosing regimen. In some aspects, the administration comprises a decrescendo dosing regimen, wherein the first dose of the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition disclosed herein is the highest dose in the dosing regimen and the last dose of the construct, the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition disclosed herein is the lowest dose in the dosing regimen.

[0402] In some aspects, the tumor is treated and/or the tumor size is reduced.

[0403] In some aspects, the AAV vector, the construct (e.g., antibody expression construct), the polynucleotide, the rAAV vector, the combination therapy, the gene therapy, or the composition is administered via blood vessels or lymphatic vessels in proximity to the tumor, rather than by direct intratumoral injection.

[0404] In some aspects, the method further comprises administering a checkpoint inhibitor agent to a subject suffering from the tumor.

[0405] In some aspects, the checkpoint inhibitor agent comprises an inhibitor of programmed cell death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), lymphocyte-activated gene 3 (LAG-3), T-cell immunoglobulin mucin-containing protein 3 (TIM-3), B and T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), adenosine A2a receptor (A2aR), killer cell immunoglobulin like receptor (KIR), indoleamine 2,3- dioxygenase (IDO), CD20, CD39, CD73, inducible T-cell costimulatory (ICOS), B7-H3, or any combination thereof.

[0406] In some aspects, the checkpoint inhibitor agent is an antibody, or an antigen binding fragment thereof. In some aspects, the checkpoint inhibitor agent is a monoclonal antibody, or an antigen binding fragment thereof. In some aspects, the checkpoint inhibitor agent is a vectorized antibody, or an antigen binding fragment thereof.

[0407] In some aspects, the checkpoint inhibitor agent is administered to the subject intravenously or intratum orally. In some aspects, the checkpoint inhibitor agent is administered to the subject intravenously. In some aspects, the checkpoint inhibitor agent is administered to the subject before or after administering the construct, the polynucleotide, the rAAV vector, or the composition administered to deliver the anti- CTLA4 antibody or antigen-binding fragment thereof to the subject. In some aspects the anti-CTLA4 antibody or antigen-binding fragment thereof, and the checkpoint inhibitor agent are administered simultaneously.

[0408] In some aspects, the method comprises administering an AAV vector, a construct (e.g., antibody expression construct), a polynucleotide, a rAAV vector, a combination therapy, a gene therapy, or a composition disclosed herein to a tumor, wherein an anti- CTLA4 antibody or antigen-binding fragment thereof is expressed in the tumor, it is released into the bloodstream or the lymphatic system of the subject suffering from the tumor and reaches the sites of a secondary tumor, and treats the secondary tumor (e.g., reduces the size of the secondary tumor).

[0409] Certain aspects of the disclosure are directed a method of neutralizing CTLA4 in a subject comprising administering an AAV vector, a construct (e.g., antibody expression construct), a polynucleotide, a rAAV vector, a combination therapy, the gene therapy, or a composition disclosed herein to the subject, wherein the anti- CTLA4 antibody or antigen-binding fragment thereof expressed in the subject is capable of neutralizing CTLA4. In some aspects, the CTLA4 neutralization is increased compared to CTLA4 neutralization in a subject administered recombinant Ipilimumab. In some aspects, the CTLA4 neutralization is increased compared to CTLA4 neutralization in a subject administered recombinant Ticilimumab.

[0410] In some aspects, the subject suffers from a tumor, e.g. a primary and/or a metastatic tumor. In some aspects, the tumor is derived from a cancer selected from the group consisting of a melanoma, a small-cell lung cancer, a non-small lung cancer, oat cell carcinoma, a prostate cancer, a renal carcinoma, a urothelial carcinoma, a pancreatic cancer, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a pediatric advanced solid tumors, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triple-negative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, some esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof.

[0411] In some aspects, the subject suffers from a tumor, e.g. a primary and/or a metastatic tumor. In some aspects, the tumor is a hematologic malignancy (e.g., hematologic neoplasms, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof).

[0412] In some aspects, the subject suffers from a tumor, e.g. a primary and/or a metastatic tumor. In some aspects, the tumor is derived from a cancer selected from the group consisting of a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a non-small lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof.)

[0413] In some aspects the tumor is a primary tumor. In some aspects, the tumor is a metastatic tumor. In some aspects the tumor comprises a nodal lesion. In some aspects, the tumor is derived from an advanced cancer. In some aspects, the cancer is locally advanced. In some aspects, the cancer is metastatic. In some aspects, the tumor does not extend into nearby blood vessels. In some aspects, the tumor is resectable. In some aspects, the tumor extends into nearby blood vessels. In some aspects, the tumor is un- resectable. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition, disclosed herein treat, or reduce the size, or reduce the symptoms of an un-resectable tumor. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein treat, or reduce the size, or reduce the symptoms of a resectable tumor before the surgery. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein are used as a neoadjuvant therapy. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein treat, or reduce the size, or reduce the symptoms of a resectable tumor after the surgery. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein are used as an adjuvant therapy. In some aspects, the construct, the polynucleotide, the rAAV particle, the combination therapy, the gene therapy or the composition disclosed herein are used as a neoadjuvant therapy before the surgery, and/or as an adjuvant therapy after the surgery.

[0414] In some aspects, the tumor comprises a primary tumor and/or a metastatic tumor with lymph node involvement. In some aspects, the tumor comprises a mutation indicating that the tumor is susceptible to anti-CTLA-4 treatment. In some aspects, the mutation is a mutation in the BRAF gene.

[0415] In some aspects, the administration is intratumoral and the dosing is a fixed dose per patient, which can be divided among the tumors. In some aspects, the administration is intravenous and the dosing can be either a fixed dose per patient or a dose of vg/kg.

[0416] In some aspects, the administration comprises a dose within the range of about 1 x 10 ⁸ vg to about 1 x 10 ¹³ vg. In some aspects, the administration comprises a dose within the range of about 1 x 10 ⁸ vg to about 1 x 10 ¹³ vg, about 1 x 10 ⁹ vg to about 1 x 10 ¹³ vg, about 1 x IO ¹⁰ vg to about 1 x 10 ¹³ vg, about 1 x 10 ¹¹ vg to about 1 x 10 ¹³ vg, about 1 x 10 ¹² vg to about 1 x 10 ¹³ vg, about 1 x 10 ⁸ vg to about 1 x 10 ¹² vg, about 1 x 10 ⁸ vg to about 1 x 10 ¹¹ vg, about 1 x 10 ⁸ vg to about 1 x IO ¹⁰ vg, about 1 x 10 ⁸ vg to about 1 x 10 ⁹ vg, about 1 x IO ¹⁰ vg to about 1 x 10 ¹² vg, about 1 x 10 ⁹ vg to about 1 x 10 ¹² vg, or about 1 x IO ¹⁰ vg to about 1 x 10 ¹¹ vg.

[0417] In some aspects, the administration comprises a dose within the range of about 1 x 10 ⁶ vg/kg to about 1 x 10 ¹¹ vg/kg. In some aspects, the administration comprises a dose within the range of about 1 x 10 ⁶ vg/kg to about 1 x 10 ¹¹ vg/kg, about 1 x 10 ⁷ vg/kg to about 1 x 10 ¹¹ vg/kg, about 1 x 10 ⁸ vg/kg to about 1 x 10 ¹¹ vg/kg, about 1 x 10 ⁹ vg/kg to about 1 x 10 ¹¹ vg/kg, about 1 x IO ¹⁰ vg/kg to about 1 x 10 ¹¹ vg/kg, about 1 x 10 ⁶ vg/kg to about 1 x IO ¹⁰ vg/kg, about 1 x 10 ⁶ vg/kg to about 1 x 10 ⁹ vg/kg, about 1 x 10 ⁶ vg/kg to about 1 x 10 ⁸ vg/kg, about 1 x 10 ⁶ vg/kg to about 1 x 10 ⁷ vg/kg, about 1 x 10 ⁸ vg/kg to about 1 x IO ¹⁰ vg/kg, about 1 x 10 ⁷ vg/kg to about 1 x IO ¹⁰ vg/kg, or about 1 x 10 ⁸ vg/kg to about 1 x 10 ⁹ vg/kg.

[0418] Certain aspects of the disclosure are directed a method of treating a tumor, reducing the size of a tumor, or reducing the symptoms of a tumor in a subject in need thereof comprising intratumorally administering to the subject an effective amount of a recombinant adeno-associated virus (rAAV) particle comprising a capsid and a vector genome, the vector genome comprising an inverted terminal repeat (ITR) and an antibody expression cassette, wherein the antibody expression cassette comprises (a) a promoter, (b) a nucleic acid sequence encoding a heavy chain variable region (VH) of an anti- Cytotoxic T-Lymphocyte Associated Protein 4 (anti-CTLA4) antibody or an antigenbinding fragment thereof, and (c) a nucleic acid sequence encoding a light chain variable region (VL) of an anti- CTLA4 antibody or an antigen-binding fragment thereof, optionally, wherein the AAV capsid serotype is AAV2, an AAV6 (e.g., AAV6-RGD or a modified version thereof), thereby expressing the anti-CTLA4 antibody or antigenbinding fragment thereof in the subject and treating the ocular disease or disorder. In some aspects, the antibody expression cassette further comprises a linker sequence.

[0419] In some aspects, the tumor, e.g., primary tumor or the metastatic tumor, is derived from a cancer selected from the group consisting of a melanoma, a small-cell lung cancer, a non-small lung cancer, oat cell carcinoma, a prostate cancer, a renal carcinoma, a urothelial carcinoma, a pancreatic cancer, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a pediatric advanced solid tumors, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triplenegative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, some esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof.

[0420] In some aspects, the tumor, e.g., primary tumor or the metastatic tumor, is a hematologic malignancy (e.g., hematologic neoplasms, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof).

[0421] In some aspects, the tumor, e.g., primary tumor or the metastatic tumor, is derived from a cancer selected from the group consisting of a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a non-small lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B- cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof.)

[0422] In some aspects, the disclosure is directed to a method of delivering a gene therapy or a combination therapy, to a subject, a human subject, a tissue, an organ, a tumor, or any other delivery site disclosed herein. In some aspects, the disclosure is directed to a method of delivering a gene therapy or a combination therapy, to a subject, a human subject, a tissue, an organ, or a tumor, or any other delivery site disclosed herein to express an anti-CTLA4 antibody or antigen-binding fragment thereof in a tumor. In some aspects, the therapeutic effect of the anti-CTLA4 antibody or antigen-binding fragment thereof is local, systemic, or both.

[0423] In some aspects, the administration is suitable for delivery of a gene therapy or a combination therapy (e.g., the rAAV particle or vector disclosed herein) to one or more tumors in a subject suffering from a tumor or a metastatic tumor. In some aspects, the administration is by injection (e.g., fanning administration). In some aspects, the administration is intratumoral. In some aspects, the administration is intravenous.

[0424] Some aspects of the present disclosure are directed to a method of delivering a polynucleotide to a cell of a subject, comprising administering to a cancerous cell, or to a non-cancerous cell, or to any combination thereof, of the subject an adeno-associated virus (AAV) capsid and an AAV genome comprising a nucleic acid comprising a promoter operably linked a polynucleotide encoding an anti-CTLA4 antibody or antigenbinding fragment thereof (e.g., a monoclonal antibody or an antigen binding fragment thereof), thereby delivering the polynucleotide to the cancerous cell, or to the non- cancerous cell of the subject. In some aspects, the anti-CTLA4 antibody or antigenbinding fragment thereof is expressed in the cancerous cell, or in the non-cancerous cell, or any combination thereof. In some aspects, the anti-CTLA4 antibody or antigenbinding fragment thereof is released from the cancerous cell, or from the non-cancerous cell, or from any combination thereof. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof is released into the bloodstream or into the lymphatic system of the subject. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof is released into the bloodstream or into the lymphatic system of the - I l l - subject and reaches one or more other cancerous cells, or non-cancerous cells, or any combination thereof.

[0425] In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof is expressed in a cancerous cells, or in a non-cancerous cells, or in any combination thereof. In some aspects, the anti-CTLA4 antibody or antigen-binding fragment thereof is released from the cancerous cell, or from the non-cancerous cell, or from any combination thereof. In some aspects, the administration is suitable for delivery of a composition or a combination therapy (e.g., the rAAV particle or vector disclosed herein) to a cancerous cell, or to a non-cancerous cell, or from any combination thereof. In some aspects, the administration is by injection (e.g., fanning administration). In some aspects, the administration is intratumoral. In some aspects, the administration is intravenous.

[0426] In some aspects, the disclosure is directed to a method of delivering a polynucleotide to a cell of a subject, comprising administering to a cell of the subject an adeno-associated virus (AAV) capsid comprising a nucleic acid comprising a promoter operably linked a polynucleotide encoding an antibody (e.g., a monoclonal antibody) or an antigen binding fragment thereof disclosed herein, thereby delivering the polynucleotide to the cell of the subject.

[0427] In some aspects, the disclosure is directed to a method of delivering a polynucleotide to a cancerous cell of a subject, comprising administering to a cancerous cell of the subject an adeno-associated virus (AAV) capsid comprising a nucleic acid comprising a promoter operably linked a polynucleotide encoding an anti-CTLA4 antibody or an antigen binding fragment thereof disclosed herein, thereby delivering the polynucleotide to the cancerous cell of the subject.

[0428] In some aspects, the disclosure is directed to a method of delivering a polynucleotide to a non-cancerous cell of a subject, comprising administering to a non- cancerous cell of the subject an adeno-associated virus (AAV) capsid comprising a nucleic acid comprising a promoter operably linked a polynucleotide encoding an anti- CTLA4 antibody or an antigen binding fragment thereof disclosed herein, thereby delivering the polynucleotide to the non-cancerous cell of the subject.

[0429] In some aspects, the methods disclosed herein can be practiced through the administration of the gene therapy, or a composition therapy composition comprising the AAV vector, the AAV vector, the rAAV particle, a cell comprising an AAV vector of the present disclosure, a cell comprising the rAAV particle of the present disclosure, a cell comprising a polynucleotide encoding an anti-CTLA4 antibody or antigen-binding fragment thereof of the present disclosure integrated into its genomic DNA, or a pharmaceutical compositions comprising any of the above. Thus, methods disclosed herein reciting the administration of an AAV vector of the present disclosure can be also practiced by administering any of these compositions.

[0430] In some aspects, methods disclosed herein can be practiced through the administration of a gene therapy, or a composition therapy composition comprising a nucleic acid encoding an antibody or antigen binding fragment thereof comprising (i) a heavy chain variable region (VH) comprising a complementarity determining region (CDR) 1, a VH CDR2, and a VH CDR3 and (ii) a light chain variable region (VL) comprising a CDR1, a VL CDR2, and a VL CDR3. In some aspects, the VH CDRs 1-3 and VL CDRs 1-3 is from the corresponding CDRs of Ipilimumab. In some aspects, the VH CDRs 1-3 and VL CDRs 1-3 is from the corresponding CDRs of Ipilimumab or Tremelimumab.

[0431] In some aspects, the composition or combination therapy comprising a construct or a rAAV vector of the present disclosure is for use in therapy, or for use as a medicament, or for use in treating a tumor, wherein tumor is derived from a cancer selected from the group consisting of a melanoma, a small-cell lung cancer, a non-small lung cancer, oat cell carcinoma, a prostate cancer, a renal carcinoma, a urothelial carcinoma, a pancreatic cancer, an hematologic neoplasms, a metastatic sarcoma, a nonHodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a pediatric advanced solid tumors, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triple-negative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, some esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof.

[0432] In some aspects, the composition or combination therapy comprising a construct or a rAAV vector of the present disclosure is for use in therapy, or for use as a medicament, or for use in treating a tumor, wherein tumor is a hematologic malignancy (e.g., hematologic neoplasms, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof).

[0433] In some aspects, the composition or combination therapy comprising a construct or a rAAV vector of the present disclosure is for use in therapy, or for use as a medicament, or for use in treating a tumor, wherein tumor is derived from a cancer selected from the group consisting of a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a nonsmall lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof.)

[0434] In some aspects, the tumors to be treated by the methods of the disclosure can comprise genetic mutations which can be targeted by specific drugs, to counteract the oncogenetic effect of the mutation. Oncogenic gene mutations may be targeted or druggable in several different ways, e.g., (a) they can encode a protein that can be targeted in a manner distinct from the wild type protein; (b) they can cause abnormal activation of a protein (e.g., through a gain-of-function mutation or amplification) that is targetable or druggable but for which mutant-specific targeting has not been achieved; and/or (c) they can create novel molecular dependencies that are druggable ("actionable mutations").

[0435] In some aspects, the delivery vector for any of the methods or uses disclosed herein comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or antigenbinding fragment thereof comprising: (i) the VH and VL CDRs of Ipilimumab (e.g., SEQ ID NOs: 7-11; amino acids 26-33, 52-58, and 97-107 of SEQ ID NO: 5, and amino acids 27-33, 51-53, and 90-98 of SEQ ID NO: 6; any of the CDR sequences disclosed in Table 1; or any combination thereof); (ii) the VH and VL of Ipilimumab (e.g., SEQ ID NOs: 5- 6; any of the VH or VL sequences disclosed in Table 1; or any combination thereof); (iii) the HC and LC of Ipilimumab (e.g., SEQ ID NOs: 3-4; any of the VH or VL sequences disclosed in Table 1-1; or any combination thereof). In some aspects, the delivery vector comprises any of SEQ ID NOs: 3-11; any of the sequences disclosed in Table 1; or any combination thereof.

[0436] In some aspects, the delivery vector for any of the methods or uses disclosed herein comprises a nucleic acid sequence encoding an anti-CTLA4 antibody or antigenbinding fragment thereof comprising: (i) the VH and VL CDRs of Ticilimumab (e.g., SEQ ID NOs: 16-21; amino acids 26-35, 50-64, and 99-114 of SEQ ID NO: 14, and amino acids 24-34, 50-56, and 89-97 of SEQ ID NO: 15; any of the CDR sequences disclosed in Table 2; or any combination thereof); (ii) the VH and VL of Ticilimumab (e.g., SEQ ID NOs: 14-15; any of the VH or VL sequences disclosed in Table 2; or any combination thereof); (iii) the HC and LC of Ticilimumab (e.g., SEQ ID NOs: 12-13; any of the VH or VL sequences disclosed in Table 2; or any combination thereof). In some aspects, the delivery vector comprises any of SEQ ID NOs: 12-21; any of the sequences disclosed in Table 2; or any combination thereof.

[0437] In some aspects, the AAV vector, construct (e.g., antibody expression cassette), rAAV, or polynucleotide any of the methods or uses disclosed herein comprises the components shown in FIG. 1A, FIG. IB, FIG. 1C, or FIG. ID.

[0438] In some aspects, the AAV vector, construct (e.g., antibody expression cassette), rAAV, or polynucleotide disclosed herein comprises a nucleic acid sequence with at least about 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% identity to SEQ ID NO: 36, 37, 38, or 39.

[0439] In some aspects, AAV vector the construct (e.g., antibody expression cassette), rAAV, combination therapy, or composition disclosed herein is administered intraductally, intratumorally, intravenously, intrasplenicly, intrathecally, intrahepaticly, intraosseously, intradermally, or intraparenchymally. In some aspects, the checkpoint inhibitor disclosed herein is administered intraductally, intratumorally, intravenously, intrasplenicly, intrathecally, intrahepaticly, intraosseously, intradermally, intraparenchymally.

[0440] In some aspects, the encoded antibody (e.g., a monoclonal antibody) or an antigen-binding fragment thereof disclosed herein is delivered to a tumor is released into the bloodstream or in the lymphatic system, and reaches a different tumor. In some aspects, the therapeutic effect of the secreted antibody or antigen-binding fragment thereof or peptide is local, systemic, or both.

[0441] In some aspects, the administration is by injection (e.g., fanning administration) into the tumor.

VII. Combination Therapy

[0442] Certain aspects of the disclosure are directed to a combination therapy comprising (i) a rAAV disclosed herein for expressing an anti-CTLA4 antibody or functional fragments thereof and (ii) a checkpoint inhibitor agent.

[0443] In some aspects, the combination therapy is administered to subject having a tumor (e.g., a primary tumor and/or a metastatic tumor). Some aspects of the present disclosure are directed to a method of treating a subject suffering from a tumor, e.g., a primary tumor or a metastatic tumor, comprising administering a combination therapy disclosed herein to the tumor.

[0444] In some aspects, the checkpoint inhibitor agent comprises an inhibitor of programmed cell death protein 1 (PD-1), programmed death-ligand 1 (PD-L1), lymphocyte-activated gene 3 (LAG-3), T-cell immunoglobulin mucin-containing protein 3 (TIM-3), B and T lymphocyte attenuator (BTLA), T cell immunoreceptor with Ig and ITIM domains (TIGIT), V-domain Ig suppressor of T cell activation (VISTA), adenosine A2a receptor (A2aR), killer cell immunoglobulin like receptor (KIR), indoleamine 2,3- dioxygenase (IDO), CD20, CD39, CD73, inducible T-cell costimulatory (ICOS), B7-H3, or any combination thereof. In some aspects, the checkpoint inhibitor agent is a programmed cell death protein 1 (PD-1) inhibitor. In some aspects, the checkpoint inhibitor agent is a programmed death-ligand 1 (PD-L1) inhibitor.

[0445] In some aspects, the checkpoint inhibitor agent is an antibody. In some aspects, the checkpoint inhibitor agent is a monoclonal antibody. In some aspects, the checkpoint inhibitor agent is a vectorized antibody.

[0446] In some aspects, the checkpoint inhibitor agent comprises a PD-1 inhibitor, a PD- L1 inhibitor, or a LAG3 inhibitor. In some aspects, the checkpoint inhibitor comprises an antibody. In some aspects, checkpoint inhibitor comprises an anti -PD-1 antibody, an anti- PD-L1 antibody, or an anti-LAG3 antibody. In some aspects, the checkpoint inhibitor agent is a programmed cell death protein 1 (PD-1) inhibitor. In some aspects, the checkpoint inhibitor agent is a programmed death-ligand 1 (PD-L1) inhibitor. [0447] In some aspects, the checkpoint inhibitor agent is a combination of checkpoint inhibitors, including a combination of PD-1 inhibitors, a combination of PD-L1 inhibitors, a combination of LAG3 inhibitors, a combination of TIGIT inhibitors, a combination of TIM-3 inhibitors, a combination of VISTA inhibitors, a combination of BTLA inhibitors, a combination of ICOS inhibitors, a combination of B7-H3 inhibitors, or a combination of any combination thereof.

[0448] In some aspects, the checkpoint inhibitor agent is a PD-1 inhibitor. In some aspects, the PD-1 inhibitor is an anti-PD-1 antibody. In some aspects, the checkpoint inhibitor comprises pembrolizumab, nivolumab, cemiplimab, toripalimab, spartalizumab, dostarlimab-gxly, tislelizumab, balstilimab, BI-754091, zimberelimab, INCMGA00012, camrelizumab, or any combination thereof. In some aspects, the checkpoint inhibitor comprises pembrolizumab, atezolizumab, or nivolumab, or any combination thereof.

[0449] In some aspects, the checkpoint inhibitor agent is a PD-L1 inhibitor. In some aspects, the checkpoint inhibitor comprises pembrolizumab, atezolizumab, or nivolumab, or any combination thereof.

[0450] In some aspects, the checkpoint inhibitor agent is administered to the subject intravenously or intratum orally. In some aspects, the checkpoint inhibitor agent is administered to the subject before, or after administering the rAAV encoding the anti- CTLA4 antibody. In some aspects, the checkpoint inhibitor agent and the rAAV are administered simultaneously.

VIII. Pharmaceutical Compositions

[0451] Certain aspects of the disclosure are directed to a pharmaceutical composition comprising a polynucleotide (e.g., antibody expression cassette), a rAAV vector, and/or a checkpoint inhibitor disclosed herein, and a pharmaceutically-acceptable excipient or carrier, e.g., in a form suitable for intratumoral administration and/or intravenous administration.

[0452] Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition.

[0453] Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a delivery vector of the present disclosure (e.g., an AAV vector) or a plurality thereof (see, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. In some aspects, the pharmaceutical composition comprises more than one AAV vector of the present disclosure, wherein each vector comprises at least one polynucleotide (e.g., an antibody expression cassette) encoding at least one therapeutic molecule disclosed herein.

[0454] In some aspects, a first pharmaceutical composition comprising a rAAV vector disclosed herein is administered (e.g., intratumorally) and a second pharmaceutical composition comprising a checkpoint inhibitor agent disclosed herein is administered (e.g., intravenously) to a subject in need thereof.

[0455] In some aspects, a pharmaceutical composition a rAAV vector and/or a checkpoint inhibitor disclosed herein is administered after the administration of one or more therapeutic agents for the treatment of a disease or disorder (e.g., a cancer or a tumor). In some aspects, a pharmaceutical composition comprising rAAV vector and/or a checkpoint inhibitor agent disclosed herein is administered concurrently with one or more therapeutic agents for the treatment of a disease or disorder (e.g., a cancer or a tumor).

[0456] In some aspects, the pharmaceutical composition of the disclosure is formulated for injection. In some aspects, the pharmaceutical composition of the disclosure is formulated for intratumoral injection.

[0457] Also provided herein are pharmaceutical compositions comprising delivery vectors disclosed herein (e.g., AAV vectors or rAAV particle) having the desired degree of purity, and a pharmaceutically acceptable carrier or excipient, in a form suitable for administration to a subject. Pharmaceutically acceptable excipients or carriers can be determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising a plurality of vectors, e.g., AAV vectors described herein. (See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 21st ed. (2005)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration.

[0458] Acceptable carriers, excipients, or stabilizers are nontoxic to recipients (e.g., animals or humans) at the dosages and concentrations employed. [0459] Examples of carriers or diluents include, but are not limited to, water, saline, Ringer's solutions, dextrose solution, and 5% human serum albumin. Except insofar as any conventional media or compound is incompatible with the delivery vectors disclosed herein (e.g., AAV vectors or rAAV particle), use thereof in the compositions is contemplated.

[0460] In some aspects, a pharmaceutical composition is formulated to be compatible with its intended route of administration. In some aspects, the pharmaceutical composition is administered intratumorally, e.g. by direct injection. In some aspects, the pharmaceutical composition is administered intravenously.

[0461] In some aspects, the rAAV and/or checkpoint inhibitor disclosed herein can be formulated using one or more excipients to (1) increase stability; (2) increase cell transfection or transduction; (3) permit the sustained or delayed release; or (4) alter the biodistribution (e.g., target the AAV vector to specific tissues or cell types such as tumor cells).

[0462] The construct, rAAV vector, composition or combination therapy can be administered by any route which results in a therapeutically effective outcome, e.g., for therapeutic expression of an anti-CTLA4 antibody or antigen-binding fragment thereof disclosed herein. In some aspects, the methods disclosed herein can comprise readministering one or more of a construct, rAAV vector, composition or combination therapy, and/or a checkpoint inhibitor of the present disclosure to the subject.

[0463] In some aspects, the delivery can be intratumoral, e.g., by direct injection to the tumor. In some aspects, the construct, rAAV vector, composition or combination therapy is administered as a single dose. In some aspects, the single dose can comprise one or more injections. In some aspects, the single dose includes multiple injections into different regions of the tumor. In some aspects, the delivery comprises fanning administration to the tumor.

[0464] The precise amount of rAAV vector and/or nucleic acid administered will vary greatly according to a number of factors including the susceptibility of the target cells to transformation, the size and weight of the subject, the levels of protein expression desired, and the condition to be treated.

[0465] The methods of the disclosure can be used to accomplish delivery of anti-CTLA4 antibody to the bloodstream on either a long-term basis (e.g., by repeated administration of the construct) or on a short-term basis (e.g., for several hours or a few days). In this regard, the disclosure takes advantage of the normal turnover of the cells that are transformed by the introduced construct in order to provide a means for controlling dosage of the polypeptide to the bloodstream.

[0466] The a construct, rAAV vector, composition or combination therapy disclosed herein can be administered in any suitable form, either as a liquid solution or suspension, as a solid form suitable for liquid solution or suspension in a liquid solution.

[0467] In some aspects, a construct, rAAV vector, composition or combination therapy disclosed herein is administered to a human. In further aspects, a construct, rAAV vector, composition or combination therapy disclosed herein is administered to an elderly human (i.e., human > 65 years of age). In other aspects, a construct, rAAV vector, composition or combination therapy disclosed herein is administered to a human who is immunocompromised or immunodeficient.

[0468] In some aspects, rAAV vector or pharmaceutical composition disclosed herein is administered prior to, at the same time, or after the administration of the checkpoint inhibitor agent.

[0469] In some aspects, the rAAV vector or pharmaceutical composition disclosed herein is administered in the same composition as the checkpoint inhibitor.

[0470] In some aspects, the rAAV vector or pharmaceutical composition disclosed herein is administered in a different composition than the checkpoint inhibitor.

[0471] In some aspects, the checkpoint inhibitor is administered intravenously (e.g., intravenous infusion). In some aspects, the checkpoint inhibitor is administered as a single dose. In some aspects, the checkpoint inhibitor is administered in multiple doses.

[0472] In some aspects, the subject suffers from a solid tumor cancer. In some aspects, the solid tumor is a primary tumor or a metastatic tumor. In some aspects, the solid tumor is a sarcoma, a carcinoma, or a lymphoma. In some aspects, the solid tumor is a surface lesion.

[0473] In some aspects, the subject suffers from a cancer selected from the group consisting of a melanoma, a small-cell lung cancer, a non-small lung cancer, oat cell carcinoma, a prostate cancer, a renal carcinoma, a urothelial carcinoma, a pancreatic cancer, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a pediatric advanced solid tumors, metastatic melanoma, cutaneous malignant melanoma, cutaneous squamous cell carcinoma, basal cell carcinoma, invasive breast cancer, triple-negative breast cancer, Her2 negative HR positive breast cancer, inflammatory breast cancer, glioblastoma multiforme, medulloblastoma, pituitary carcinoma, brain stem gliomas, astrocytomas, oligodendrogliomas, hemangiopericytomas, germ cell tumors, pineal tumors, chordomas, chondrosarcomas, osteosarcomas, Ewing sarcomas, fibrosarcomas, adamantiomas, giant cell tumors, head and neck squamous cell carcinoma (HNSCC), salivary gland cancer, oropharyngeal cancer, hypopharyngeal cancer, laryngeal cancer, lip and oral cavity cancer, nasopharyngeal cancer, thyroid cancer, cancer of the parathyroid gland, paranasal sinus and nasal cavity cancer, ovarian cancer, uterine cancer, fallopian tube cancer, endometrial cancer, cervical cancer, vaginal cancer, vulvar cancer, renal cancer, urethral cancer, urothelial cancer, bladder cancer, cancer of the kidney or ureter, cancer of the renal pelvis, testicular cancer, penile cancer, cancer of the adrenal gland, cancer of the anal region, bile duct cancer, hepatocellular carcinoma, colon cancer, cancer of the small intestine, esophageal cancer, gallbladder cancer, cholangiocarcinoma (intrahepatic, extrahepatic cholangiocarcinoma), gastrointestinal stromal tumors, liver cancer, pancreatic ductal adenocarcinoma, colorectal cancer, stomach/gastric cancer, uveal melanoma, retinoblastoma, Merkel cell carcinoma, intraocular malignant melanoma, mucosa-associated lymphoid tissue lymphoma, orbital lymphoma, orbital sarcoma, lacrimal gland tumors, non-small cell lung cancer, small cell lung cancer, mesothelioma, thymic malignancies, tracheal tumors, some esophageal cancer, chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, CNS; atypical teratoid/rhaboid tumor, spinal axis tumor, Kaposi's sarcoma, epidermoid cancer, other B cell malignancies, neuroblastoma, olfactory neuroblastoma, rhabdomyosarcoma, and any combination thereof. [0474] In some aspects, the subject suffers from a hematologic malignancy, selected from the group consisting, hematologic neoplasms chronic or acute leukemia, acute myeloid leukemia (AML), chronic myeloid leukemia (CML), acute lymphoblastic leukemia (ALL) (including non-T cell ALL), chronic lymphocytic leukemia (CLL), Hodgkin's lymphoma, non-Hodgkin's lymphoma (NHL), non-Hodgkin B-cell lymphoma, diffuse large B-cell lymphoma, Waldenstrom macroglobulinaemia, primary mediastinal large B cell lymphoma (PMBC), diffuse large B cell lymphoma (DLBCL), follicular lymphoma (FL), transformed follicular lymphoma, mantle cell lymphoma, marginal zone lymphoma, splenic marginal zone lymphoma (SMZL), cutaneous T-cell lymphoma (CTCL), lymphocytic lymphoma, primary CNS lymphoma, multiple myeloma, and any combination thereof.

[0475] In some aspects, the subject suffers from a cancer selected from the group consisting of a melanoma, an uveal melanoma, a cutaneous melanoma, a mucosal melanoma, a squamous cell carcinoma (SCC), a head and neck squamous cell carcinoma (HNSCC), a breast cancer, a small-cell lung cancer, a non-small lung cancer, a prostate cancer, a renal carcinoma, a urothelial cancer, a urothelial carcinoma, a bladder cancer, a prostate cancer, an ovarian cancer, an uterine cancer, a bladder carcinoma, a pancreatic cancer, a pancreatic ductal adenocarcinoma (PDAC), a gallbladder cancer, a liver cancer, a hepatocellular carcinoma (HCC), gastric cancer, esophageal cancer, colon cancer (CRC), breast cancer, a renal cell carcinoma (RCC), a sarcoma, an hematologic neoplasms, a metastatic sarcoma, a non-Hodgkin B-cell lymphoma, a gastric or gastroesophageal junction cancer, a cholangiocarcinoma, a Merkel cell carcinoma, a pediatric advanced solid tumors, and any combination thereof.

[0476] In some aspects, the rAAV vector or pharmaceutical composition disclosed herein are administered to patients with i) unresectable solid tumors; ii) resectable solid tumors; iii) relapsed refractory tumors (with adjuvant); iv) relapsed refractory tumors (with neoadjuvant); and v) relapsed refractory tumors (with radiation). In some aspects the rAAV vector or pharmaceutical composition disclosed herein are administered via intratumoral or intravenous routes. In some aspects the rAAV vector or pharmaceutical composition disclosed herein are administered dosed by both priming dosing schedule and priming maintenance schedule. IX. Kits

[0477] The present disclosure also provides kits, or products of manufacture, comprising (i) the delivery vector of the present disclosure, or a pharmaceutical composition of the present disclosure, and (ii) optionally instructions for use (e.g., a package insert with instructions to perform any of the methods described herein).

[0478] In some aspects, the kit or product of manufacture comprises (i) a combination therapy comprising: (a) a recombinant adeno-associated virus (rAAV) vector comprising an AAV capsid protein and a vector genome, wherein the vector genome comprises (i) a pair of inverted terminal repeat (ITR) sequences, and (ii) an antibody expression cassette comprising a first promoter operably linked to a nucleic acid encoding an anti-CTLA4 antibody or an antigen-binding fragment thereof; and (b) optionally, an additional therapeutic agent (e.g., a checkpoint inhibitor), and (iii) optionally, instructions for use (e.g., a package insert with instructions to perform any of the methods described herein are also contemplated).

[0479] In some aspects, the components of a kit or product of manufacture disclosed herein are in one or more containers. In some aspects, the kit or product of manufacture comprises (i) an AAV vector comprising a polynucleotide (e.g., an antibody expression cassette) encoding an anti- CTLA4 antibody or antigen-binding fragment thereof disclosed herein, and (ii) a brochure with instructions to insert the polynucleotide in the AAV vector.

[0480] One skilled in the art will readily recognize that vectors, polynucleotides, and pharmaceutical compositions of the present disclosure, or combinations thereof, can be readily incorporated into one of the established kit formats which are well known in the art.

[0481] The practice of the present disclosure will employ, unless otherwise indicated, conventional techniques of cell biology, cell culture, molecular biology, transgenic biology, microbiology, recombinant DNA, and immunology, which are within the skill of the art. Such techniques are explained fully in the literature.

[0482] All of the references cited above, as well as all references cited herein, are incorporated herein by reference in their entireties. The following examples are offered by way of illustration and not by way of limitation. Examples

Example 1 - Anti-CTLA4 Antibody Expression Cassette

[0483] Exemplary AAV constructs were designed and constructed to include flanking ITRs, a promoter, poly A, and open reading frame (ORF) comprising nucleic acid sequences encoding an anti-CTLA-4 antibody (Ipilimumab) heavy chain (HC) and light chain (LC). Exemplary constructs included the features shown in FIGs 1A-1D. In particular, the following constructs listed in Table 4 were prepared.

Table 4. Exemplary AAV-anti-CTLA4 Constructs

Example 2 - Antibody Expression

[0484] HEK293T, HT-1080, Cloudman, and A549 cell lines were seeded in cell culture- treated 48-well plates in regular media with 10% Fetal Bovine Serum and 1% Penicillin Streptomycin at 40-75% confluency depending on cell type and cell doubling. 24 hours after seeding, when cells were 80-90% confluent, cell media was exchanged for 300 pL fresh media per well, and AAV plasmid constructs to be transfected (containing the expression constructs described in Example 1, corresponding to FIGs. 1 A-1D) were diluted in OptiMEM and incubated with Lipofectamine 3000 (Invitrogen, Waltham, MA, USA) according to the manufacturer's instructions. Diluted plasmids and Lipofectamine mix were added to cell culture in triplicate at three concentrations (0.83 pg/mL, 0.42 pg/mL, and 0.21 pg/mL per well; reported as 250 ng/well, 125 ng/well, and 62.5 ng/well in a 48 well plate).

[0485] After 72 hours, supernatant were collected and cells were washed for RNA extraction with PBS three times. Both media supernatant and the cells were stored at -80 °C until further analyzed or processed.

[0486] HuIgG expression was determined by performing immunoassays carried out using a Gyrolab xPlore and Gyrolab huIgG low titer kit. Kit included Bioaffy 1000HC CD, biotinylated capture and Alexafluor647 detection antibodies, wash buffers, and standard diluent Reagent E. All supernatants containing huIgG were centrifuged at 1,000 g for 30 minutes at 4 °C and tested neat. To quantify huIgG within each supernatant, a standard curve was prepared using Gyrolab huIgG standard starting at 25,000 pg/mL and diluted as recommended by kit literature in Reagent E. Concentration determined using the kit specific three-step (capture - analyte - detection), two wash solution, 0.05% PMT method.

[0487] High levels of expression were observed in HEK293T cells transfected with all the different plasmids, compared to the other cell lines used. In all cell lines, the expression levels of the Survivin, and of the hTERT constructs, were lower compared to the expression levels of the CAG and the smCBA constructs, with the expression levels of the Survivin, and of the hTERT constructs being 10-30 fold lower in HEK293T and A549 cell lines (results are shown in FIGs. 2A-D).

[0488] RNA expression was also analyzed (data not shown). Total RNA was isolated from transfected/transduced cells using the Zymo Quick-RNA 96 Kit (Zymo catalog # R1052) following the manufacturer's instructions. Isolated RNA was then subjected to DNase treatment/purification using the RNA Clean & Concentrator-96 Kit (Zymo catalog # R1080) following the manufacturer's instructions. The concentration of isolated RNA was measured via UV/VIS spectroscopy using the NanoDropOne instrument (Fisher catalog #13-400-518). Transgenic RNA was quantified via l-step reverse transcription quantitative PCR (RT-qPCR) using a 5' endonuclease activity assay. The RT-qPCR assay targeted the bovine growth hormone polyadenylation signal (bGH-PolyA) present in transgenic ipilimumab mRNA. Restriction enzyme linearized plasmid DNA containing the bGH-PolyA DNA sequence was used as a quantification standard for this RT-qPCR assay.

[0489] All RT-qPCR primers were purchased from Integrated DNA Technologies.

[0490] RT-qPCR primers included 1) bGH-PolyA-Forward: 5' TCTAGTTGCCAGCCATCTGTTGT 3' (SEQ ID NO: 41); 2) bGH-PolyA-Reverse: 5' TGGGAGTGGCACCTTCCA 3' (SEQ ID NO: 42); and 3) bGH-PolyA-Probe: 5' TCCCCCGTGCCTTCCTTGACC 3' (SEQ ID NO: 43), with probe modifications including 5' 6-FAM (Fluorescein) and 3' ZEN/Iowa Black fluorescence quenchers. [0491] TaqMan™ Fast Virus 1-Step Master Mix (ThermoFisher catalog # 4444434) was used to create 1-step RT-qPCR master mix. QuantStudio 5 (ThermoFisher catalog # A28568) PCR platform was used for RT-qPCR, using "Fast" instrument settings.

[0492] Thermocycling conditions were as follows:

1) 50 °C for 5 minutes

2) 95 °C for 20 seconds

3) 95 °C for 3 seconds

4) 60 °C for 30 seconds Repeat steps 3-4 39 times

Example 3 - CTLA-4 Binding Assay (Gyros)

[0493] A three-step (capture-analyte-detection) immunoassay using a Gyrolab xPlore system (Gyros Protein Technologies) with Bioaffy 1000 HC CDs (Gyros Protein Technologies, method 1000HC-3W-011-A) was performed to quantify CTLA-4-binding IgG in cell culture supernatant (FIG. 3A). Biotinylated recombinant human CTLA-4 protein (Aero Biosystems) was diluted to 700 nM in PBS-0.01% Tween 20 and used as the capture molecule, and 10 nM AlexaFluor647-labeled rat anti -human IgG Fc antibody (BioLegend), diluted in Rexxip F, was used as the detection molecule. A standard curve (0.5-1000 ng/mL) was generated using a recombinant anti-CTLA-4 antibody ipilimumab biosimilar (Bio X Cell) diluted in Rexxip CCS; for cell lines in which the cell culture media generated high background signal and/or interference, the standard curve was prepared using the respective cell culture media instead of Rexxip CCS. Cell culture supernatant samples were added to the sample microplate neat or diluted 1 :2-l :200 in Rexxip CCS as needed. The concentration of CTLA-4-binding IgG in cell culture supernatant was determined by comparison of sample signal at 1% PMT to the standard curve signal fit to a five-parameter logistic curve using the Gyrolab Evaluator software (Gyros Protein Technologies).

[0494] The CTLA-4 binding versus total IgG (functional Ipilumab) showed correspondence between the human IgG titer and the CTLA-4 binding results (FIG. 3B).

Example 4 - hCTLA-4 Blockade Bioassay

[0495] The CTLA-4 blockade assay kit (Promega) was used to measure activity of supernatants of transfected cells in accordance with the manufacturer's instructions. Inner wells of two 96-well white tissue-culture treated plates were seeded with 25 pL of CTLA- 4 effector cells. Anti-CTLA-4 control antibody (25 pL, Promega) was added to each plate in triplicate in a 10-point three-fold dilution series beginning at 30 pg/mL. Media supernatants from transfections of Ipilimumab expressing plasmids were run in triplicate on each plate in a 10-point three-fold dilution series beginning with neat sample, with 25 pL added to wells. aAPC/Raiji cells (25 pL) were added to plates containing samples, control, and CTLA-4 effector cells, and an additional 75 pL of assay media was added to outer wells. Plates were incubated for 6 hours in a 37 °C, 5% CO2 incubator. To the plates, 75 pL of Bio-Gio reagent was added to plates and luminescence was measured using a Spectramax M5 plate reader.

[0496] In assays performed with HEK293T cells, results showed signal increases with blocking of the CTLA-4 pathway, with secretion of ipilimumab demonstrating blocking of CTLA-4 signaling (results shown in FIG. 4).

Example 5 - Treatment of MC38 tumors in hCTLA C57BL/6 mice with AAV2-anti-CTLA-4 (Prophetic)

Syngeneic MC38 mouse model

[0497] Subcutaneous murine MC38 tumors will be established in female hCTLA4 C57BL/6 mice. This mouse strain (C57BL/6-C7/A-/" ^H/ ' ^{r// l7} 7Bcgen) is a humanized CTLA4 mouse model on a C57BL/6J background. The exon 2 of mouse ctla4 gene that encodes the extracellular domain is replaced by human CTLA4 exon 2 in B-hCTLA4 mice, such that the expressed protein is recognized by anti-human CTLA4 antibodies such as ipilimumab.

[0498] Following establishment of subcutaneous MC38 tumors, mice will be randomized based on tumor volumes into groups for the efficacy arms (groups 1-6; median tumor volume on day 0 approximately 75 mm ³ ) and groups for the pharmacodynamic arms (groups 7-10; median tumor volume on day 0 approximately 100 mm ³ ). On day 0, tumorbearing mice will be treated as shown in tables 5 and 6 with a single intertumoral injection containing an AAV2-delivered antibody expression cassette encoding Ipilimumab (designated as AAV2-Ipilimumab) at 1E11 vg/tumor formulated in 25 pL of a vehicle consisting of lx PBS, 5% Sorbitol, 0.001% pluronic acid F68, either alone or in combination with murine anti-PD-1 (BioXCell) administered at 5 mg/kg intraperitoneally twice weekly for 3 weeks. Control animals will be treated with vehicle plus rat isotype IgG antibody (BioXCell) administered at 5 mg/kg intraperitoneally twice weekly for 3 weeks. Additional control groups will be treated with anti-murine PD-1 antibody and human anti-CTLA4 (Biosimilar Ipilimumab) (BioXCell)) antibody alone or in combination, each administered at 5 mg/kg intraperitoneally twice weekly for 3 weeks.

[0499] Tumor growth in the efficacy cohorts will be followed until day 28 with tumor volume being assessed 2-3 times weekly using calipers. Individual tumor volumes will be calculated using the following equation:

Tumor volume (mm ³ ) = (length x width ² ) x 0.5

[0500] In addition to tumor volumes, individual body weights will be measured at least twice weekly along with clinical observations.

Table 5. Treatment assignments for efficacy arms

Table 6. Treatment assignments for sampling arms

[0501] Tumor Growth

[0502] Intertumoral delivery of AAV2-Ipilimumab will be tested alone and in combination with systemic anti-mPD-1 treatment. No meaningful effect on body weight or gross clinical adverse signs outside those commonly associated with tumor burden will be observed.

[0503] Humanized CTLA4 mice will be used as human anti-CTLA4 treatment would be expected to be inactive in a wild-type syngeneic tumor model as neither the mouse or tumor express human CTLA4. Treatment of murine MC38 tumors grown in hCTLA4 mice with AAV2- Ipilimumab will be compared to vehicle treated tumors. Systemic anti- CTLA4 (Ipilimumab Biosimilar) treatment will be tested in the MC38 model as a positive control. The combination of systemic anti-mPD-1 and anti-CTLA4 will also be tested in the MC38 model as a positive control.

Vector Genome Quantification by qPCR

[0504] DNA Isolation from Tumor Samples. Snap frozen tumor samples will be weighed and placed in an Eppendorf tube containing 600 pL of a P-mercaptoethanol and RLT lysis buffer mixture. The tissue solution will be vortexed thoroughly and then be placed in a -80 °C freezer overnight or until ready for use. On the day of the DNA isolation experiment, the cell solution will be removed from the freezer and transferred into a Precellys Tissue Homogenizing Kit (VWR, Cat# 10144-508). The solution will undergo homogenization at conditions of 6000 rpm 3x 15s with 5s intervals and will be centrifuged at 16x g for 30s. Following Qiagen®’ s AllPrep DNA/RNA Mini Sample Prep kit instructions, the lysate mixture will be placed in an AllPrep DNA spin column and will be centrifuged for 30s at 16x g. The sample will be washed with 500 pL of AW1 wash buffer and will be centrifuged for 15s at 16x g. 500 pL of AW2 buffer will be added and will be centrifuged for 2 minutes at full speed to wash the spin column membrane. Elution buffer (100 pL) will be added to the spin column and then be transferred from a collection tube to a 1.5 mL Eppendorf tube. The sample will then be incubated at room temperature for 1 minute before centrifuging the sample for 1 minute at 16x g to elute DNA. The DNA sample will be collected in a Eppendorf tube and will be placed in either a -20 °C freezer (short-term) or -80 °C freezer (long-term).

[0505] DNA Concentration Measurement. DNA sample concentrations will be measured using a NanoDrop spectrophotometer. Target criteria for the DNA samples will include a concentration >20 ng/pL and a A260/A280 range of 1.7 - 1.9. The measurement for each sample will be recorded and calculations performed to dilute the samples to 100 ng/pL, to ensure accuracy during sample analysis. DNA samples that will only be used for spiking Standard Curves and Quality Controls (QCs) will be diluted to 1000 ng (10 ng/pL) when preparing the Master Mix the day of the qPCR experiment.

[0506] Vector Genome Quantification (qPCR). TaqMan Advanced Master Mix, F2A Linker probe, Forward/Reverse F2A Linker primers and samples will be thawed on ice. Standard curves ranging from 2.5+07 - 12.5 vg cps/pL will be prepared using a restricted enzyme linearized plasmid DNA (mouse cag-native-IL12-F2A). QCs will also be prepared with the plasmid at 3 different concentration points: 2.5E+07 (High QC), 2.5E+05 (Medium QC), and 2.5E+03 (Low QC). Two different master mixes both containing TaqMan Master Mix, F2A Linker probe (5 pM), Forward/Reverse F2A Linker primers (10 pM) and Nuclease-Free H ₂ O will be generated. One master mix will then be spiked with 1000 ng of C57BL/6 mouse liver DNA, while the other master mix will remain matrix free. The master mix containing spiked DNA will be added to the wells containing the standard curves, QCs and non-template controls (NTCs); while the nonspiked (matrix free) master mix will be added to wells that will be used for sample analysis. Vector genome levels will be quantified via quantitative PCR (qPCR) using a 5’ endonuclease activity assay. Restriction enzyme linearized plasmid DNA containing the bGH-PolyA DNA sequence will be used as a quantification standard for this qPCR assay. All primer qPCR were purchased from Integrated DNA Technologies.

[0507] Primers/Probes:

[0508] Forward Primer F2A Link: 5’-CCTGAAACAGACCCTGAA-3’ (SEQ ID NO:

53)

[0509] Reverse Primer F2A Link: 5’-TCCACCAGGATTAGACTCCA-3’ (SEQ ID NO:

54)

[0510] Probe F2A Link: 5’-FAM-TGACCTCTTGAAGCTTGC-MGBNFQ- 3’ (SEQ ID NO: 55).

[0511] TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher catalog # 4444434) will be used to create 2-step qPCR master mix. QuantStudio 5 (Thermo Fisher catalog # A28568) PCR platform will be used for qPCR, using “Fast” instrument settings. Thermocycling conditions will be set to the conditions shown in table 7.

Table 7. qPCR conditions RT-qPCR

[0512] RNA Isolation from Tumor Samples. Snap frozen tumor samples will be weighed and placed in an Eppendorf tube containing 600 pL of a P-mercaptoethanol and RLT lysis buffer mixture. The tissue solution is vortexed thoroughly and will then be placed in a -80 °C freezer overnight or until ready for use. On the day of the RNA isolation experiment, the cell solution is removed from the freezer and transferred into a Precellys Tissue Homogenizing Kit (VWR, Cat# 10144-508). The solution will undergo homogenization at conditions of 6000 rpm 3 x 15s with 5s intervals and is centrifuged at 16 x g for 30s before the sample is mixed with equal parts 70% ETOH. Following Qiagen’s RNeasy Plus Mini Sample Prep kit, up to 700 pL of the mixture is placed in a spin column and centrifuged for 30s at 16 x g. The sample is washed with 700 pL of RW1 wash buffer and centrifuged for 30s at 16 x g. The samples are incubated with 80 pL of DNase I stock for 15 min at room temperature (RT) before adding 350 pL of RW1 wash buffer and centrifuging for 30s at 16x g. RPE buffer is used to wash the solution twice, with the second wash lasting 2 mins at 16x g. RNase free water (up to 50 pL) is added to the spin column and the column is transferred from a collection tube to a 1.5 mL Eppendorf tube, where it is centrifuged for 1 min at 16 x g. The RNA sample is collected in the Eppendorf tube is placed in the -20 °C freezer (short-term) or -80 °C freezer (longterm).

[0513] RNA Concentration Measurement. RNA sample concentrations will be measured using a NanoDrop spectrophotometer. Target criteria for the RNA samples include a concentration >20 ng/pL, a A260/A280 range of 1.8 - 2.1 and a A260/A230 range of 1.6 - 2.2. The measurement for each sample is recorded and calculations are performed to dilute the samples to 20 ng/pL, to ensure accuracy during sample analysis. Tumor samples that will only be used for spiking Standard Curves and Quality Controls (QCs) will be diluted to 100 ng (5 ng/pL) when preparing the Master Mix the day of the qPCR experiment.

[0514] cDNA Synthesis. A 2X RT master mix will be prepared using a High-Capacity cDNA kit (Thermo Fisher, Cat # 4367381) following the manufacturer’s instructions. A 1 :2 dilution of the RT master mix and the RNA sample will be made in a labeled 0.2 mL reaction tube. Each sample will be thoroughly vortexed and spun down to eliminate any air bubbles before loading to the thermocycler at the conditions shown in table 8. Table 8. cDNA synthesis

[0515] The samples will then be placed in the -20 °C freezer for short-term storage, until ready to use for the next part of the experiment.

[0516] mRNA Quantitation. TaqMan Advanced Master Mix, F2A Linker probe, Forward/Reverse F2A Linker primers and samples are thawed on ice. Standard curves ranging from 12.5 -2.5E7 vg/pL are prepared using a restricted enzyme linearized plasmid DNA (mouse cag-native-IL12-F2A). QCs are also prepared with the plasmid at 3 different concentration points: 2.5E+07 (High QC), 2.5E+05 (Medium QC), and 2.5E+03 (Low QC). Two different master mixes both containing TaqMan Master Mix, F2A Linker probe (5 pM), Forward/Reverse F2A Linker primers (10 pM) and Nuclease-Free H2O will be made. One master mix is then spiked with 100 ng of C57BL/6 mouse liver RNA, while the other master mix remained matrix free. The master mix containing spiked RNA is added to the wells containing the standard curves, QCs and non-template controls (NTCs); while the non-spiked (matrix free) master mix is added to wells that will be used for sample analysis. Transgenic RNA will be quantified via 1-step reverse transcription quantitative PCR (RT-qPCR) using a 5’ endonuclease activity assay. The RT-qPCR assay targets the bovine growth hormone polyadenylation signal (bGH-PolyA) present in transgenic F2A Linker mRNA. Restriction enzyme linearized plasmid DNA containing the bGH-PolyA DNA sequence will be used as a quantification standard for this RT- qPCR assay. All primer RT-qPCR are purchased from Integrated DNA Technologies.

[0517] Primers/Probes:

[0518] Forward Primer F2 A Link: 5’ -CCTGAAACAGACCCTGAA-3’ (SEQ ID NO:

53)

[0519] Reverse Primer F2A Link: 5’-TCCACCAGGATTAGACTCCA-3’ (SEQ ID NO:

54)

[0520] Probe F2 A Link: 5 ’ -F AM-TGACCTCTTGAAGCTTGC-MGBNFQ- 3 ’ (SEQ ID

NO: 55). [0521] TaqMan™ Fast Virus 1-Step Master Mix (Thermo Fisher catalog # 4444434) will be used to create 1-step RT-qPCR master mix. QuantStudio 5 (Thermo Fisher catalog # A28568) PCR platform will be used for RT-qPCR, using “Fast” instrument settings. Thermocycling conditions will be set to the conditions shown in table 9.

Table 9. RT-qPCR conditions

[0522] Quantification of Ipilimumab in mouse serum and tumor lysate by MSD Mouse IFN-y U-Plex:

Mouse serum assay: In brief, MSD T-Plex plates will be precoated with capture antibodies against human IgG and blocked with 150 pL of MSD Blocker A solution for a minimum of 30 minutes with shaking at -650 RPM. Nine non-zero standards will be prepared using anti-CTLA-4 antibody ipilimumab biosimilar (BioXCell) in Diluent 100 (MSD) along with a blank buffer (standard 10). The top and bottom calibration points serve as anchors; thus, the quantifiable calibration range is between 195 pg/mL and 200,000 pg/mL. Three control levels spanning the standard calibration curve at high, mid, and low levels will be prepared fresh in Diluent 100 (80,000 pg/mL, 4,000 pg/mL, and 300 pg/mL respectively). Serum samples will be diluted to a minimum required dilution of lOx in Diluent 100. At the end of blocking, the plates will be washed with 3x 150 pL of MSD Wash Buffer. Following washing, 25 pL of standards, controls, and diluted study samples will then be added to the appropriate wells on the assay plates. Diluent 100 will be added to all wells not containing standards, controls, or samples. The plates will then be covered and incubated at RT for - 2 hours with shaking at -650 RPM. During sample incubation, 60 pL of sulfo-tagged anti-human IgG detection antibody will be added to 2,940 pL of diluent 100 (volumes listed for 1 plate). At the end of incubation, the plates will be washed as described above, and 25 pL of detection antibody solution will be added to all wells of the assay plate(s). The plates will be covered and incubated at RT for - 2 hours with shaking at -650 RPM. Finally, the plates will be washed again as described above, and 150 pL of 2x MSD Read Buffer T will be added to all wells on the plates. The plates will be read on the MESO QuickPlex SQ 120 instrument within 5 minutes. [0523] Mouse Tumor Lysate Assay - sample preparation. Tumor samples will be sectioned, weighed, and transferred into chilled Precellys tubes containing 4 stainless steel Precellys beads. Complete Lysis Buffer (MSD lysis buffer, lOOx Halt Protease Inhibitor Cocktail, lOOx Halt EDTA) will be added to each tube using the following formula (Weight in mg X 10 pL). Samples will be homogenized using the Precellys homogenizer using the tumor lysis program (4000 RPM 15 Sec, 3X). Following homogenization, samples will be centrifuged and evaluated for total protein yield using the Bio-Rad DC quantification assay.

[0524] Mouse Tumor Lysate Assay for detection of Ipilimumab Protein. In brief, MSD T-Plex plates precoated with capture antibodies against human IgG will be blocked with 150 pL of MSD Blocker A solution for a minimum of 30 minutes with shaking at -650 RPM. Nine non-zero standards will be prepared using anti-CTLA-4 antibody ipilimumab biosimilar (BioXCell) in Diluent 100 (MSD) along with a blank buffer (standard 10). The top and bottom calibration points are anchors; thus, the quantifiable calibration range is between 195 pg/mL and 200,000 pg/mL. Three control levels spanning the standard calibration curve at high, mid, and low levels will be prepared fresh in Diluent 100 (80,000 pg/mL, 4,000 pg/mL, and 300 pg/mL respectively). All tumor lysate samples will be diluted to 1 mg/mL total protein in Diluent 100. At the end of blocking, the plates will be washed with 3 x 150 pL of MSD Wash Buffer. Following washing, 25 pL of standards, controls, and diluted study samples will then be added to the appropriate wells on the assay plates. Diluent 100 will be added to all wells, not containing standards, controls, or samples. The plates will be covered and incubated at RT for - 2 hours with shaking at -650 RPM. During sample incubation, 60 pL of sulfotagged anti -human IgG detection antibody will be added to 2,940 pL of diluent 100 (volumes listed for 1 plate). At the end of incubation, the plates will be washed as described above, and 25 pL of detection antibody solution will be added to all wells of the assay plate(s). The plates will be covered and incubated at RT for - 2 hours with shaking at -650 RPM. Finally, the plates will be washed again as described above, and 150 pL of 2x MSD Read Buffer T will be added to all wells on the plates. The plates will be read on the MESO QuickPlex SQ 120 instrument within 5 minutes.

[0525] Interferon-y Quantification in mouse serum and tumor lysate by MSD Mouse IFN- y U-Plex [0526] Mouse serum Assay. In brief, 200 pL of Biotinylated Capture antibody will be combined with 3300 pL Diluent 100. Then 25 pL of capture antibody solution will be added to each well of the small spot streptavidin coated MSD plate. The plate(s) will be covered and incubated at room temperature for ~ 1 hour with shaking at -750 RPM. During incubation, MSD Calibrator 5 will be reconstituted with 250 pL of Diluent 41 and allowed to incubate for 15-20 minutes before pulse vortexing. 50 pL of reconstituted calibrator 5 will be added to 200 pL Diluent 41 to create Standard 1. Six additional nonzero standard points (7 total) will be prepared using a 4-fold serial dilution scheme along with a blank buffer standard 8 (curve values vary by lot, about 0.700 pg/mL - 3,000 pg/mL). Three control levels spanning the standard calibration curve at high, mid, and low levels will be prepared and frozen prior to testing (QC values vary by calibrator lot, values are about 600 pg/mL, 100 pg/mL, and 7.50 pg/mL respectively). At the end of incubation, the plates will be washed 3x with 150 pL of MSD Wash Buffer. Following washing, 25 pL of Diluent 41 will be added to all wells of the assay plates. 25 pL of standards, controls, and study samples will then be added to the appropriate wells on the assay plates. Diluent 41 will be added to all wells, not containing standards, controls, or samples. The plates will be covered and incubated at room temperature for - 1 hour with shaking at -750 RPM. During sample incubation, 60 pL of sulfo-tagged IFN-y detection antibody will be added to 5,940 pL of diluent 45. At the end of incubation, the plates will be washed as described above, and 50 pL of detection antibody solution will be added to all wells of the assay plate(s). The plates will be covered and incubated at room temperature for - 1 hour with shaking at -750 RPM. Finally, the plates will be washed again as described above, and 150 pL of MSD Gold Read Buffer B will be added to all wells on the plates. The plates will be read on the MESO QuickPlex SQ 120 instrument within 5 minutes.

[0527] Mouse Tumor Lysate Assay - sample preparation. Tumor samples will be sectioned, weighed, and transferred into chilled Precellys tubes containing 4 stainless steel Precellys beads. Complete Lysis Buffer (MSD lysis buffer, lOOx Halt Protease Inhibitor Cocktail, lOOx Halt EDTA) will be added to each tube using the following formula (Weight in mg X 10 pL). Samples will be homogenized using the Precellys homogenizer using the tumor lysis program (4000 RPM 15 Sec, 3X). Following homogenization, samples will be centrifuged and evaluated for total protein yield using the Bio-Rad DC quantification assay.

[0528] Mouse Tumor Lysate Assay. In brief, 200 pL of biotinylated capture antibody will be combined with 3300 pL Diluent 100. Twenty-five pL of capture antibody solution will then be added to each well of the small spot streptavidin coated MSD plate. The plate(s) will be covered and incubated at room temperature for ~ 1 hour with shaking at -750 RPM. During incubation, MSD Calibrator 5 will be reconstituted with 250 pL of Diluent 41 and allowed to incubate for 15-20 minutes before pulse vortexing. Fifty pL of reconstituted calibrator 5 will be added to 200 pL of MSD Lysis Buffer plus 2 mg/mL BSA to create Standard 1. Six additional non-zero standard points (7 total) will be prepared using a 4-fold serial dilution scheme along with a blank buffer standard 8 (curve values vary by lot, about 0.700 pg/mL - 3,000 pg/mL). Three control levels spanning the standard calibration curve at high, mid, and low levels will be freshly prepared in MSD Lysis Buffer plus 2 mg/mL BSA (QC values vary by calibrator lot, values are about 600 pg/mL, 100 pg/mL, and 7.50 pg/mL respectively). At the end of incubation, the plates will be washed with 3x 150 pL of MSD Wash Buffer. Following washing, 25 pL of Diluent 41 will be added to all wells of the assay plates. All tumor lysate samples will be diluted to 1 mg/mL total protein in complete lysis buffer (MSD Lysis Buffer, lOOx Halt Protease Inhibitor Cocktail, lOOx Halt EDTA).

[0529] Twenty-five pL of standards, controls, and study samples will then be added to the appropriate wells on the assay plates. MSD Lysis Buffer plus 2 mg/mL BSA will be added to all wells, not containing standards, controls, or samples. The plates will be covered and incubated at room temperature for - 1 hour with shaking at -750 RPM. During sample incubation, 60 pL of sulfo-tagged IFN-y detection antibody will be added to 5,940 pL of diluent 45. At the end of incubation, the plates will be washed as described above, and 50 pL of detection antibody solution will be added to all wells of the assay plate(s). The plates will be covered and incubated at room temperature for - 1 hour with shaking at -750 RPM. Finally, the plates will be washed again as described above, and 150 pL of MSD Gold Read Buffer B will be added to all wells on the plates. The plates will be read on the MESO QuickPlex SQ 120 instrument within 5 minutes. Single-nuclei RNA sequencing

[0530] From each spleen, 15 milligrams of tissue will be isolated with a razor blade and used as the input to isolate nuclei from the Nuclei Isolation Kit according to the manufacturer’s protocol (10X Genomics). Whole lymph nodes will be input into the same kit with minor modifications, specifically only a single wash step will be performed using the Wash and Resuspension Buffer. Nuclei will be stained with Ethidium Homodimer- 1 (Thermo Fisher Scientific) and counted manually on an EVOS M5000 (Thermo Fisher Scientific). Nuclei will be diluted to 1100 nuclei per pL and will be used for partitioning single nuclei by the Chromium X into Gel Bead-In-Emulsions (GEMs, 10X Genomics) to attain approximately 10,000 cells per sample. Following partitioning, RNA sequencing libraries will be prepared using the Chromium Single Cell 3’ Library Kit v3 (10X Genomics) according to the manufacturer’s protocol. Libraries will be sequenced on a Nextseq 2000 instrument using a P3 200 cycle kit (138 cycles) to attain at least 15,000 reads per individual cell.

Single-nuclei RNA sequencing analysis

[0531] FASTQ files will be converted from BCL files using Illumina DRAGEN software and subsequently analyzed using cellRanger (v3.1) using a custom reference as described by the vendor protocol (10X Genomics). Further data analysis will be performed in R using the package Seurat (version 4.3.0.1). For each dataset, outlier nuclei will be excluded based on a shared set of criteria (number of Unique molecular identifiers greater than 250, number of genes greater than 200, loglO genes per unique molecular identifier greater the 0.8, and mitochondrial ration of less than 20%). No features that are expressed in fewer than 5 cells will be kept for downstream analysis. Each animal sample will be integrated into a single Seurat object using SCTransform and will be integrated with 3000 features selected with high variable expression across the entire dataset. The number of components will be identified using Principal Component Analysis with the RunPCA() function, followed by clustering, Uniform Manifold Approximation and Projection (UMAP) using the FindNeighbors(), FindClusters(), and RunUMAP() functions in Seurat. The default resolution for this analysis will be 0.3 and the set dimensions will be 30. Selected marker genes will be identified using the PrepSCTFindMarkers() and FindAllMarkers() functions, to identify and assign cell types using previously published cell markers. To generate subclustering of identified cell types, the function subset() will be used to create new Seurat objects with defined identities based on the cell markers of interest for subsequent visualization by UMAP, heatmap, or Volcano Plot.

Table 10. Listing of Sequences