Cross-reference to Related Applications

[0001] The present application claims the benefit of priority of U.S. Provisional

Application No. 61/458,517, filed November 24, 2010, the disclosure of which is incorporated by reference in its entirety.

Background

[0002] Angiogenesis is a fundamental process required for normal growth and

development of tissues, and involves the proliferation of new capillaries from pre-existing blood vessels. Angiogenesis is not only involved in embryonic development and normal tissue growth, repair, and regeneration, but is also involved in the female reproductive cycle, establishment and maintenance of pregnancy, and in repair of wounds and fractures. In addition to angiogenesis which takes place in the healthy individual, angiogenic events are involved in a number of pathological processes, notably tumor growth and metastasis, and other conditions in which blood vessel proliferation, especially of the microvascular system, is increased, such as diabetic retinopathy, psoriasis and arthropathies. Inhibition of angiogenesis is useful in preventing or alleviating these pathological processes.

[0003] Because of the crucial role of angiogenesis in so many physiological and pathological processes, factors involved in the control of angiogenesis have been intensively investigated. A number of growth factors have been shown to be involved in the regulation of angiogenesis; these include fibroblast growth factors (FGFs), platelet-derived growth factor (PDGF), transforming growth factor a (TGFa), and hepatocyte growth factor (HGF). See for example Folkman et al, "Angiogenesis", J. Biol. Chem., 1992 267 10931-10934 for a review.

Summary of the Invention

[0004] The invention includes materials, such as polypeptides, polynucleotides, vectors, recombinant cells, antibodies, and compositions, formulations, kits, and medical devices containing such materials. The invention also includes methods of making and using the materials. In particular, the invention includes many different methods for in vitro, in vivo, and ex vivo modulation of cells, tissues, organs, systems, or organisms using the materials of the invention. Many of the methods have therapeutic value for alleviating symptoms of a disease or condition, or delaying onset or progression of a disease or condition, or providing therapeutic benefit or cure. Many aspects of the invention relate to the inventors discovery of VEGFR-2 selective/specific ligands and structures that are relevant to whether a ligand will bind with selectivity or specificity to VEGFR-2 or will bind to both VEGFR-2 and VEGFR- 3. Many of the aspects of the invention are summarized or defined in the following numbered paragraphs.

[0005] 1. An isolated polypeptide compound comprising an amino acid sequence that is at least 90% identical to amino acids 103-190 of the Vascular Endothelial Growth Factor D (VEGF-D) amino acid sequence set forth in SEQ ID NO: 2,

with the proviso that the polypeptide compound lacks one or more of amino acids at positions 92-99 of SEQ ID NO: 2,

wherein the polypeptide selectively binds Vascular Endothelial Growth Factor Receptor 2 (VEGFR-2).

[0006] 2. The isolated polypeptide of paragraph 2 comprising an amino acid sequence that is at least 90% or 95% identical to amino acids 100-195 of SEQ ID NO: 2.

[0007] 3. The isolated polypeptide of any one of paragraphs 1-2, with the proviso that the polypeptide lacks at least three or more of amino acids at positions 92-99 of SEQ ID NO: 2.

[0008] 4. The isolated polypeptide compound according to any one of paragraphs 1-3, with the proviso that the amino acid of the polypeptide compound that corresponds to the cysteine at position 117 of SEQ ID NO: 2 (Cysl 17) has been deleted or replaced by a different amino acid.

[0009] 5. The isolated polypeptide compound according to paragraph 4, wherein Cys 117 has been replaced with an amino acid with an aliphatic amino acid side chain.

[0010] 6. The isolated polypeptide compound according to any one of paragraphs 1-5 that comprises amino acids 100-195 of SEQ ID NO: 2.

[0011] 7. The isolated polypeptide compound according to any one of paragraphs 1-6, further comprising a VEGF-D carboxy-terminal pro-peptide.

[0012] 8. The isolated polypeptide compound according to paragraph 7, wherein the carboxy-terminal pro-peptide is attached to the compound by a sequence cleavable by a furin.

[0013] 9. The isolated polypeptide compound according to any one of paragraphs 1-8 that comprises amino acids 101-354 of SEQ ID NO: 2. [0014] 10. The isolated polypeptide compound according to any one of paragraphs 1-9 that further comprises a VEGF-D amino terminal pro-peptide.

[0015] 11. The isolated polypeptide compound according to paragraph 10, wherein the amino terminal pro-peptide is attached to the compound by a sequence cleavable by plasmin.

[0016] 12. The isolated polypeptide compound of paragraph 10 or 11, wherein the amino terminal pro-peptide comprises amino acids 22-88 of SEQ ID NO: 2.

[0017] 13. The isolated polypeptide compound according to any one of paragraphs 1-12, further comprising a signal peptide.

[0018] 14. The isolated polypeptide compound of paragraph 13, wherein the signal peptide comprises amino acids 1-21 of SEQ ID NO: 2.

[0019] 15. The isolated polypeptide compound according to any one of paragraphs 1-14, further comprising a heparin binding domain amino acid sequence.

[0020] 16. An isolated polypeptide compound comprising an amino acid sequence at least 90% identical to a fragment of the amino acid sequence set forth in SEQ ID NO: 2,

wherein the amino terminal amino acid sequence of the fragment is selected from amino acids 1 to 101 of SEQ ID NO: 2, with the proviso that the polypeptide lacks amino acids 93-99 of SEQ ID NO: 2;

wherein the carboxy-terminal amino acid sequence of the fragment is selected from amino acids 195 to 354 of SEQ ID NO: 2; and

wherein the polypeptide selectively binds to VEGF -2.

[0021] 17. An isolated polypeptide compound comprising an amino acid sequence that is at least 90% identical to amino acids 120-211 of the Vascular Endothelial Growth Factor C (VEGF-C) amino acid sequence set forth in SEQ ID NO: 4,

with the proviso that the polypeptide compound lacks one or more of amino acids at positions 113 - 119 of SEQ ID NO : 4,

wherein the polypeptide selectively binds Vascular Endothelial Growth Factor Receptor 2 (VEGFR-2).

[0022] 18. The isolated polypeptide compound of paragraph 17, comprising an amino acid sequence that is at least 90% identical to amino acids 120-227 of SEQ ID NO: 4. [0023] 19. The isolated polypeptide compound of paragraph 17, comprising an amino acid sequence that is at least 95% identical to amino acids 120-227 of SEQ ID NO: 4.

[0024] 20. The isolated polypeptide compound according to any one of paragraphs 17-19, with the proviso that the polypeptide lacks three or more of amino acids at positions 113-119 of SEQ ID NO: 4.

[0025] 21. The isolated polypeptide compound according to any one of paragraphs 17-20, with the proviso that the polypeptide lacks five or more of amino acids at positions 113-1 19 of SEQ ID NO: 4.

[0026] 22. The isolated polypeptide compound according to any one of paragraphs 17-20, with the proviso that the polypeptide lacks amino acids at positions 113-119 of SEQ ID NO: 4.

[0027] 23. The isolated polypeptide compound according to any one of paragraphs 17-22, with the proviso that the amino acid of the polypeptide compound that corresponds to the cysteine at position 137 of SEQ ID NO: 4 (Cysl37) has been deleted or replaced by a different amino acid.

[0028] 24. The isolated polypeptide compound according to paragraph 23, wherein Cys l37 has been replaced with an amino acid with an aliphatic amino acid side chain.

[0029] 25. The isolated polypeptide compound according to any one of paragraphs 17-22 that comprises amino acids 120-227 of SEQ ID NO: 4.

[0030] 26. The isolated polypeptide compound according to any one of paragraphs 17-25, further comprising a VEGF-C carboxy-terminal pro-peptide.

[0031] 27. The isolated polypeptide compound according to paragraph B26, wherein the carboxy-terminal pro-peptide is attached to the compound by a sequence cleavable by a furin.

[0032] 28. The isolated polypeptide compound according to any one of paragraphs 17-22 that further comprises amino acids 228-419 of SEQ ID NO: 4.

[0033] 29. The isolated polypeptide compound according to any one of paragraphs 17-28 that further comprises a VEGF-C amino terminal pro-peptide.

[0034] 30. The isolated polypeptide compound according to paragraph 29, wherein the amino terminal pro-peptide is attached to the compound by a sequence cleavable by plasmin. [0035] 31. The isolated polypeptide compound of paragraph 29 or 30, wherein the amino terminal pro-peptide comprises amino acids 32-102 of SEQ ID NO: 4.

[0036] 32. The isolated polypeptide compound according to any one of paragraphs 17-31, further comprising a signal peptide.

[0037] 33. The isolated polypeptide compound of paragraph 32, wherein the signal peptide comprises amino acids 1-31 of SEQ ID NO: 4.

[0038] 34. The isolated polypeptide compound according to any one of paragraphs 17-32, further comprising a heparin binding domain amino acid sequence.

[0039] 35. An isolated polypeptide compound comprising an amino acid sequence at least 90% identical to a fragment of the amino acid sequence set forth in SEQ ID NO: 2,

wherein the amino terminal amino acid sequence of the fragment is selected from amino acids 1 to 120 of SEQ ID NO: 4, with the proviso that the polypeptide lacks amino acids 1 13-1 19 of SEQ ID NO: 4;

wherein the carboxy-terminal amino acid sequence of the fragment is selected from amino acids 211 to 419 of SEQ ID NO: 4; and

wherein the polypeptide selectively binds VEGFR-2.

[0040] 36. A compound comprising the formula X-B-Z or Z-B-X,

wherein X binds Vascular Endothelial Growth Factor Receptor 2 (VEGFR-2) and has an amino acid sequence at least 90% identical to a VEGFR-2 ligand selected from the group consisting of:

(a) fragments of the prepro-VEGF-D amino acid sequence set forth in SEQ ID NO: 2 that selectively bind VEGFR-2;

(b) fragments of the prepro-VEGF-C amino acid sequence set forth in SEQ ID NO: 4 that selectively bind VEGFR-2;

(c) polypeptide compounds according to any one of paragraphs Al to A 17; and

(d) polypeptide compounds according to any one of paragraphs B2 to B17; and wherein Z comprises a heparin-binding amino acid sequence; and wherein B comprises a covalent attachment linking X to Z, and wherein the compound selectively binds VEGF -2.

[0041] 37. The compound of paragraph 36, wherein X comprises an amino acid sequence at least 95% identical to the VEGFR-2 ligand.

[0042] 38. The compound of paragraph 36 or 37, wherein the heparin binding amino acid sequence comprises an amino acid sequence at least 90% identical to a sequence selected from the group consisting of:

(a) amino acids 142-165 of the VEGF206 (SEQ ID NO: 11);

(b) amino acids 183 to 226 of the VEGF206 (SEQ ID NO: 11);

(c) amino acids 142-165 of SEQ ID NO: 11 joined directly to amino acids 183-226 of SEQ ID NO: 11 of the VEGF206;

(d) amino acids 142 to 226 of the VEGF206 (SEQ ID NO: 11);

(e) amino acids 138 to 182 of the VEGF-B167 sequence set forth in SEQ ID NO: 41;

(f) amino acids 193 to 213 of the P1GF-3 sequence set forth in SEQ ID NO: 42;

(g) amino acids of 142 to 162 of the P1GF-2 sequence set forth in SEQ ID NO: 43; and

(h) fragments of (a) - (g) that bind heparin.

[0043] 39. The compound of any one of paragraphs 36-38, wherein X-B-Z or Z-B-X, is a polypeptide.

[0044] 40. The compound of any one of paragraphs 36-39, further comprising a signal peptide at the amino terminus of the polypeptide, wherein the signal peptide directs secretion of a polypeptide comprising X-B-Z or Z-B-X from a cell that expresses the polypeptide.

[0045] 41. The compound of any one of paragraphs 36-40, wherein B is selected from the group consisting of: (a) a peptide bond; and (b) a peptide linker up to 500 amino acids.

[0046] 42. The compound of paragraph 36, wherein B is selected from the group consisting of a peptide bond and a peptide linker up to 50 amino cells in length. [0047] 43. The compound of paragraph 41 or 42, wherein B comprises a peptide bond that is cleavable by an agent that fails to cleave the amino acid sequence X that binds VEGFR-2.

[0048] 44. The compound of paragraph 43, wherein peptide bond is cleaved by a protease.

[0049] 45. The compound of paragraph 44, wherein B comprises an amino acid sequence that contains a protease cleavage site selected from the group consisting of a Factor Xa cleavage site, an enterokinase cleavage site, a thrombin cleavage site, a TEV cleavage site, and a PreScission cleavage site.

[0050] 46. The compound of any one of paragraphs 36-45, wherein B comprises an amino acid sequence of at least four amino acids from a VEGF-C or VEGF-D amino acid sequence, wherein the at least four amino acids are cleaved in vivo to separate an amino- terminal pro-peptide that includes the heparin binding amino acid sequence from a mature VEGFR-2 ligand X.

[0051] 47. The compound of any one of paragraphs 36-46, wherein X comprises an amino acid sequence selected from the group consisting of:

(a) an amino acid sequence identical to a fragment of the prepro-VEGF-D amino acid sequence set forth in SEQ ID NO: 2 that selectively binds VEGFR-2;

(b) the amino acid sequence of (a), with the proviso that the cysteine at position 117 of SEQ NO: 2 has been deleted or replaced with another amino acid;

(c) an amino acid sequence identical to a fragment of the prepro-VEGF-C amino acid sequence set forth in SEQ ID NO: 4 that selectively binds VEGFR-2; and

(d) the amino acid sequence of (a), with the proviso that the cysteine at position 137 of SEQ NO: 4 has been deleted or replaced with another amino acid.

[0052] 48. The compound according to any one of paragraphs 1-47, wherein the compound further includes a peptide tag, such as a polyhistidine tag. Such tags are useful for purification of the compound, and in some variations, are cleavable (e.g., with a chemical or protease).

[0053] 49. The compound according to any one of paragraphs 1-48, wherein the compound stimulates phosphorylation of VEGFR-2 in endothelial cells that express VEGFR- 2. [0054] 50. The compound according to any one of paragraphs 1-49, wherein the compound stimulates angiogenesis in vivo. The ability to stimulate of angiogenesis in vivo is measured in an animal in which the corresponding wildtype ligand in question (wildtype VEGF-C or VEGF-D) stimulates VEGFR-2 in the animal.

[0055] 51. A composition comprising a compound according to any one of paragraphs 1- 50 in a pharmaceutically acceptable carrier.

[0056] 52. A polynucleotide comprising a nucleotide sequence that encodes a polypeptide compound according to any one of paragraphs 1-50.

[0057] 53. The polynucleotide according to paragraph 52 that is DNA.

[0058] 54. The polynucleotide according to paragraph 52 and 53 that is purified or isolated.

[0059] 55. A vector comprising a polynucleotide according to any one of paragraphs 52- 54.

[0060] 56. An expression vector comprising a polynucleotide according to any one of paragraphs 52-54, operably linked to an expression control sequence.

[0061] 57. The expression vector according to paragraph 56, wherein the expression control sequence is a tissue-specific promoter.

[0062] 58. The expression vector according to paragraph 57, wherein the tissue is selected from the group consisting of endothelial cells, skin cells, bone, neural cells, and muscle cells.

[0063] 59. The expression vector according to paragraph 56, wherein the expression control sequence is a promoter that promotes constitutive expression of the polynucleotide in human cells.

[0064] 60. The vector according to any one of paragraphs 56-59, selected from the group consisting of replication-deficient adenoviral vectors, adeno-associated viral vectors, and lentivirus vectors.

[0065] 61. A composition comprising the polynucleotide according to any one of paragraphs 52-54 and a pharmaceutically acceptable carrier, diluent, or excipient.

[0066] 62. A composition comprising the vector according to any one of paragraphs 55- 60 and a pharmaceutically acceptable carrier, diluent or excipient. [0067] 63. An isolated cell transformed or transfected with a polynucleotide according to any one of paragraphs 52-54.

[0068] 64. An isolated cell transformed or transfected with the vector according to any one of paragraphs 55-60.

[0069] 65. The isolated cell according to paragraph 63 or 64 that expresses the polypeptide compound encoded by the polynucleotide.

[0070] 66. A method of modulating the growth of mammalian endothelial cells or mammalian endothelial precursor cells, comprising contacting the cells with a composition comprising a member selected from the group consisting of:

(a) a compound or composition according to any one of paragraphs 1-65;

(b) a polynucleotide that encodes (a);

(c) a polynucleotide according to any one of paragraphs 52-54;

(d) an expression vector containing (c) operatively linked to an expression control sequence;

(e) a vector according to any one of paragraphs 55-60;

(f) an isolated cell transformed or transfected with (b) or (c) that expresses the polypeptide of (a); and

(g) an isolated cell according to any one of paragraphs 63-64.

[0071] 67. The method according to paragraph 66, wherein the contacting comprises administering the composition to a mammalian subject in an amount effective to modulate endothelial cell growth in vivo.

[0072] 68. The method according to paragraph 67, wherein the contacting is performed ex vivo.

[0073] 69. A method of modulating the growth or differentiation of mammalian hematopoietic progenitor cells, comprising contacting the mammalian hematopoietic cells with a composition comprising a member selected from the group consisting of:

(a) a compound or composition according to any one of paragraphs 1-62;

(b) a polynucleotide that encodes (a);

(c) a polynucleotide according to any one of paragraphs 52-54; (d) an expression vector containing (c) operatively linked to an expression control sequence;

(e) a vector according to any one of paragraphs 55-60;

(f) an isolated cell transformed or transfected with (b) or (c) that expresses the polypeptide of (a); and

(g) an isolated cell according to any one of paragraphs 63-64.

[0074] 70. The method according to paragraph 69, wherein the contacting comprises administering the composition to a mammalian subject in an amount effective to modulate growth or differentiation of the hematopoietic progenitor cells in vivo.

[0075] 71. The method according to paragraph 69, wherein the contacting is performed ex vivo.

[0076] 72. A method for activation of VEGFR-2, comprising contacting cells that express VEGFR-2 with a composition comprising a member selected from the group consisting of:

(a) a compound or composition according to any one of paragraphs 1-62;

(b) a polynucleotide that encodes (a);

(c) a polynucleotide according to any one of paragraphs 52-54;

(d) an expression vector containing (c) operatively linked to an expression control sequence;

(e) a vector according to any one of paragraphs 55-60;

(f) an isolated cell transformed or transfected with (b) or (c) that expresses the polypeptide of (a); and

(g) an isolated cell according to any one of paragraphs 63-64.

[0077] 73. A method of stimulating angiogenesis in a mammalian subject comprising: contacting cells of said mammal subject with a composition comprising a member selected from the group consisting of:

(a) a compound or composition according to any one of paragraphs 1-62;

(b) a polynucleotide that encodes (a);

(c) a polynucleotide according to any one of paragraphs 52-54; (d) an expression vector containing (c) operatively linked to an expression control sequence;

(e) a vector according to any one of paragraphs 55-60;

(f) an isolated cell transformed or transfected with (b) or (c) that expresses the polypeptide of (a); and

(g) an isolated cell according to any one of paragraphs 63-64.

[0078] 74. The method according to any one of paragraphs 69-73, wherein the composition is injected into a muscle.

[0079] 75. The method according to paragraph 74, wherein the subject is suffering from one or more conditions selected from atherosclerosis, tissue ischemia, and claudication intermittens.

[0080] 76. The method according to any one of paragraphs 69-73, wherein the composition is injected into the heart.

[0081] 77. The method according to paragraph 76, wherein the subject is suffering from one or more conditions selected from atherosclerosis, tissue ischemia, insufficientia cordis, and angina pectoris.

[0082] 78. The method according to any one of paragraphs 69-74, wherein the composition is administered to the spine or brain.

[0083] 79. The method according to paragraph 78, wherein the subject is suffering from one or more conditions selected from spinal cord injury, cerebral ischemia, and infarction.

[0084] 80. The method according to any one of paragraphs 69-74, wherein the composition is injected into a bone or bone marrow.

[0085] 81. The method according to paragraph 80, wherein the subject is suffering from a bone fracture or a blood disorder.

[0086] 82. The method according to any one of paragraphs 69-81, wherein the mammalian subject is a human or the cells are human cells.

[0087] 83. The method according to any one of paragraphs 69-81, wherein the composition comprises the vector. [0088] 84. The method according to paragraph 83, wherein the vector is a replication- deficient adenoviral vector or adeno-associated virus vector.

[0089] 85. A method of identifying selective modulators of VEGF-D activity comprising: contacting a VEGF-D polypeptide that binds VEGFR-3 and contacting a VEGF-D polypeptide that selectively binds VEGFR-2 in the presence and absence of a test compound; measuring binding between the polypeptides and the VEGFR-3 and the VEGFR-2; and

selecting, as a selective modulator, a compound that interferes with one of said ligand-receptor interactions.

[0090] 86. An isolated peptide epitope consisting of amino acids 93-99 of the VEGF-D amino acid sequence set forth in SEQ ID NO: 2, optionally fused to a non-VEGF-D amino acid sequence.

[0091] 87. An isolated peptide epitope consisting of amino acids 113-119 of the VEGF-C amino acid sequence set forth in SEQ ID NO: 4, optionally fused to a non-VEGF-C amino acid sequence.

[0092] 88. A composition comprising the polypeptide epitope according to paragraph 86 or 87 and a diluent or adjuvant.

[0093] 89. A monocolonal antibody that binds to the peptide epitope according to paragraph 86 or 87.

[0094] 90. A cell that expresses the monoclonal antibody according to paragraph 89.

[0095] 91. The cell according to paragraph 90 that is a hybridoma.

[0096] 92. A method of inhibiting lymphangiogenesis or inhibiting proliferation of lymphatic emdothelia comprising administering to a mammalian subject an antibody according to paragraph 89.

[0097] 93. The method of paragraph 92, wherein the mammalian subject has

lympangioma or lymphangioleiomyomatosis.

[0098] The foregoing summary is not intended to define every aspect of the invention, and additional aspects are described in other sections, such as the Detailed Description. The entire document is intended to be related as a unified disclosure, and it should be understood that all combinations of features described herein are contemplated, even if the combination of features are not found together in the same sentence, or paragraph, or section of this document. Where protein therapy is described, embodiments involving polynucleotide therapy (using polynucleotides that encode the protein) are specifically contemplated, and the reverse also is true. Where embodiments of the invention are described with respect to

VEGF-D, it should be appreciated that analogous embodiments involving VEGF-C are specifically contemplated, and vice versa.

[0099] In addition to the foregoing, the invention includes, as an additional aspect, all embodiments of the invention narrower in scope in any way than the variations defined by specific paragraphs above. For example, certain aspects of the invention that are described as a genus, and it should be understood that every member of a genus is, individually, an aspect of the invention. Also, aspects described as a genus or selecting a member of a genus, should be understood to embrace combinations of two or more members of the genus. Although the applicant(s) invented the full scope of the invention described herein, the applicants do not intend to claim subject matter described in the prior art work of others. Therefore, in the event that statutory prior art within the scope of a claim is brought to the attention of the applicants by a Patent Office or other entity or individual, the applicant(s) reserve the right to exercise amendment rights under applicable patent laws to redefine the subject matter of such a claim to specifically exclude such statutory prior art or obvious variations of statutory prior art from the scope of such a claim. Variations of the invention defined by such amended claims also are intended as aspects of the invention.

Brief Description of the Figures

[00100] The patent or application file contains at least one drawing executed in color. Copies of this patent or patent application publication with color drawing(s) will be provided by the Office upon request and payment of the necessary fee.

[00101] Figure 1 discloses the crystal structure of human VEGF-D and its comparison to the other VEGF family ligands. Figure 1A is a cartoon representation of the crystal structure of the covalent VEGF-D (Cysl 17Ala mutant) homodimer in magenta and pink. The N- terminal residues between the two reported proteolytic cleavage sites are colored in yellow (Stacker et al., J. Biol. Chem. 274:32127-32136, 1999) are colored in yellow. The sugar moieties and the disulfide bonds are shown in grey and yellow sticks, respectively. N- and C- termini, the N-terminal helix (aN) and the connecting loops 1-3 (L1-L3) are labeled where applicable. Figure IB is a close-up of the N-terminal helix (aN) in the same orientation as in Figure 1A. The helix is shown in a cartoon loop representation with same coloring as in (A). Aspl03 and Trpl06, the equivalents of the VEGFR-2 binding VEGF-C residues Aspl23 and Trpl26, (Leppanen et al., Proc. Natl. Acad. Sci. U S A. 107:2425-2430, 2010), and the first a-helical residues Thr92-Lysl00 are shown as sticks. Figure 1C is a superposition of the VEGF-D (magenta and yellow) and VEGF-A (PDB code 1FLT; green) monomer structures with VEGF-C (PDB code 2X1W; orange) in the VEGFR-2 complex structure. The C _a -traces are shown as ribbon diagrams. Labeling is the same as in Figure 1 A except that the N-termini are labeled according to the VEGF coloring in the figure. Figure ID are the VEGF-D and VEGF-A monomer structures from Figure 1C superimposed with VEGF-C in the VEGF- C/VEGFR-2D23 complex structure. For clarity, VEGF-C is not shown. VEGFR-2 D2 (R2- D2) and D3 (R2-D3) are shown as a molecular surface model in grey. Coloring as indicated above.

[00102] Figure 2 shows VEGFR-2 interacting residues that are conserved between VEGF- C and VEGF-D. Figure 2 A is a close-up of the VEGF-D Leu99 and Asp 103 (of SEQ ID NO: 2) in the VEGF-D superposition with VEGF-C in the complex with VEGFR2-D23. VEGF-D (magenta), VEGF-C (orange) and VEGFR-2 (grey) are shown as a cartoon loop representation. VEGF-C Leul 19 and Aspl23 (of SEQ ID NO: 4) interaction with VEGFR-2 are shown along with the VEGF-D counterparts Leu99 and Aspl03. VEGF-C and VEGFR-2 numbering is used. Hydrophobic and hydrophilic interactions are shown in grey and red dashed line, respectively. Figure 2B is a close-up of the loop 2 residues as in Figure 2A. VEGF-C Glul69 and Asnl67 (of SEQ ID NO: 4) and its VEGF-D counterparts Glul49 and Asnl47 (of SEQ ID NO: 2) are shown in sticks. VEGF-C Glul69 (of SEQ ID NO: 4) interactions with VEGFR-2 Asn253 and Lys281 are shown. Figure 2C shows the VEGF-D hydrophobic residues in loop 1, loop 3 and in the N-terminal helix. The two VEGF-D monomers in the homodimer are shown in light and dark grey in a cartoon loop

representation. Figure 2D shows a molecular surface model of the same as in Figure 2C. Only the side-chain surface is shown for the hydrophobic (yellow) residues.

[00103] Figure 3 is a characterization of the VEGF-D (CI 17A) N- and C-terminal variants. Figure 3A is an alignment of the human (h) and mouse (m) VEGF-D sequences. The amino acid residue differences are indicated. The N-terminal residues 89, 92 and 100 and the C- terminal residues 195 and 205 of the deletion variants of human VEGF-D are labelled. The residues visible in the crystal structure are colored in yellow and magenta. The residues colored in yellow are between the two proteolytic sites. Figure 3B shows that VEGFR-2/BaF and VEGFR-3/BaF cell survival was induced with the VEGF-D variants. The variants are labeled according to the residue numbering. Figure 3C is a comparison of the wt VEGF-D short form (Dwt, residues 89-205 without the CI 17A mutation), VEGF-D D ₈ 9-i95 and D100-195 variant induced VEGFR-2 and VEGFR-3 phosphorylation in HDME cells. The VEGF-D concentrations (ng/ml) are indicated above the lanes. Figure 2D is a comparison of the wt VEGF-C short form (Cwt, residues 1 12-215; Karpiinen et al., Faseb J. 20: 1462-1472, 2006), VEGF-D Ds9-i95 and D 100-195 variant induced VEGFR-2 and VEGFR-3 phosphorylation in PAE-VEGFR-2 and PAE-VEGFR-3 cells respectively.

[00104] Figure 4 shows the in vivo activity of the major and minor forms of wild-type mature VEGF-D. Figure 4A is a schematic representation of the rAAV vectors. Figure 4B are representative images of the staining. Figure 4C shows the quantification of stained area from five or more randomly chosen view fields.

[00105] Figure 5 shows the thermodynamic analysis of VEGF-D interactions with VEGFR-2 and VEGFR-3. Figure 5A shows the results of the calorimetric titrations of the four VEGF-D (Cys l 17Ala) variants (D ₈ 9_ ₁₉₅ , D92-195, D ₁₀ o-i95 and D100-205) to the Fc-tagged VEGFR-2D23. Figure 5B shows the results of the titrations of the four VEGF-D variants with VEGFR-3D17. Figure 5C is a summary of the enthalpy change (ΔΗ ± s.d.), entropy change (AS), binding affinities (K _D ± s.d.) and stoichiometry (n) of the ITC binding experiments.

[00106] Figure 6 is a characterization of the VEGF-D binding domains in VEGFR-3. Figure 6A shows the thermodynamic analysis of the Fc-tagged VEGFR-3D1-3 (domains 1-3) interactions with the VEGF-D (CI 17A) variants D ₈ 9-i95, D92-195 and D100 195 Figure 6B shows VEGF-D D92-195 complexation with soluble, Fc-tagged VEGFR-2 domains 2 and 3 (R2D23), VEGFR-3 deletion mutants (R3D1 - R3D123) and VEGFR- 1-D WEGFR-3 -D2 (R1/3D12) chimera. SDS-PAGE analysis of Protein A pulldown assays is shown with Coomassie Blue staining. Figure 6C shows the results of thermodynamic titrations of the VEGFR-3 deletion mutants (R3D2 and R3D12) and the VEGFR- 1 /VEGFR-3 (R1/3D12) chimera with VEGF-D D92-195. Figure 6D summarizes the VEGF-D D92-195 binding experiments with Fc-tagged VEGFR-3 deletion mutants and the VEGFR- l/VEGFR-3 (R1/3D12) chimera.

[00107] Figure 7 depicts the differences between mouse and human VEGF-D and VEGFR- 2D23. Figure 7A is a ribbon diagram of the VEGF-D structure (magenta) superimposed with VEGF-C in the VEGFR-2D23 (grey) complex structure. For clarity, only one VEGF-D chain is shown. The differences in the human and the mouse VEGF-D (Figure 3A) and VEGFR-2 (data not shown) sequences are indicated by highlighting the corresponding human residues as spheres. Figure 7B is a close-up of Figure 7) with the key VEGF-D differences labeled. Human VEGF-D Ala 195 is not shown because it was not visible in the crystal structure. The VEGFR-2 sequence differences at ligand-binding surface are highlighted in orange.

[00108] Figure 8 shows a Western blot that demonstrates that the Cysl 17Ala mutant of human VEGF-D is a more stable covalent dimer than wildtype human VEGF-D. The Cys 117Ala mutation shifts the ratio of non-covalent (grey arrow) to covalent dimeric (black arrow) form of VEGF-D towards the covalent dimeric form. The VD1 antibody apparently recognizes a conformational epitope of the native protein that mostly disappears upon reduction as well as to a varying degree nonspecific bands of approximately 24 and 50 kDa.

[00109] Figure 9 shows the in vivo expression and activity of human VEGF-D proteins (i.e., amino acids 89-195 of SEQ ID NO: 2 and amino acids 100-195 of SEQ ID NO: 2). Tibialis anterior muscles of Balb/c male mice were injected with rAAVs encoding the indicated cDNAs (D89 95, residues 89 to 195, the N-terminal major form of the human VEGF-D; D 100-195, residues 100-195, the N-terminal minor form of the human VEGF-D and HAS, human serum albumin as a control) and analyzed two weeks later by

immunohistochemistry of frozen sections. Representative images of the staining are shown. Antibodies against human VEGF-D (VD1; first panel from left) and mouse Podoplanin antibodies (the panel in the middle; lymphangiogenesis) were used for immunostaining. The 3 ^rd panel from the left represents the VD1 /Podoplanin overlay. Scale bar represents ΙΟΟμιη.

Detailed Description

[00110] The present application is based in part on the discovery that certain amino- terminal truncated forms of VEGF-D bind and stimulate VEGFR-2 but not VEGFR-3. Because such N-terminal truncated forms of VEGF-D do not stimulate VEGFR-3, they are useful in therapeutic applications in which the stimulation of angiogenesis (and not lymphangiogenesis) is desired. These ligands of the invention also are expected to have advantages over other VEGFR-2 ligands, such as VEGF-A, that are known to bind to VEGF -1. For example, ligands of the invention are expected to have fewer side-effects relative to ligands that bind to two or more VEGFR's.

[00111] For many applications, the ability of the ligand to bind and selectively stimulate VEGFR-2 is used advantageously for therapeutic or diagnostic purposes. In some variations of the invention, a toxin or pro-toxin can be attached to the ligand to create a vehicle for selectively delivering the toxin to VEGFR-2-expressing cells.

[00112] Vascular endothelial growth factor D (VEGF-D) is one of the five mammalian members of the VEGF family (VEGF-A, VEGF-B, VEGF-C, VEGF-D and placenta growth factor). VEGF-D binds to and induces dimerization and tyrosine autophosphorylation of its endothelial cell specific receptors VEGFR-2 and VEGFR-3 (1). VEGFR-2 signals stimulate endothelial sprouting, proliferation and survival, as well as vascular permeability, and VEGFR-3 signals stimulate similar processes in lymphatic endothelial cells (2,3). Whereas VEGF-A and VEGF-C are indispensable for embryonic vascular development, VEGF-D can be deleted without any obvious phenotype (4-9). However, recombinant VEGF-D is capable of inducing angiogenesis and lymphangiogenesis in several experimental conditions, suggesting that it is of potential therapeutic utility in regenerative medicine (10-12).

[00113] The VEGF family ligands are antiparallel homodimers characterized by eight conserved cysteine residues forming a cystine knot structure (13, 14). The newly synthesized VEGF-D and VEGF-C have long N- and C-terminal propeptides flanking the VEGF homology domain (VHD) (15). Proteolytic processing by furins cleaves between the VHD and the C-terminal propeptide, activating the VEGFR-3 binding activity and subsequent cleavage by extracellular serine proteases, including plasmin, (16) produces the mature human VEGF-D (residues 89-205) that binds also VEGFR-2 (major form) (17). Cleavage at a secondary N-terminal site results in an alternative, N-terminally shorter form comprising residues 100-205 (minor form).

[00114] VEGF-C and VEGF-D occur predominantly as non-covalently linked homodimers (15, 17) although they both have the conserved cysteine residues that form the interchain disulfide bridges in the other VEGFs. Both have also an additional cysteine residue close to the interchain disulfide residues at the dimer interface as seen in the human VEGF-C crystal structure (18, 19). This additional cysteine residue may interfere with the interchain bonding, explaining why its replacement with small hydrophobic residues, including alanines, increased dimer stability and enhanced the activity of both VEGF-C and VEGF-D in cell culture, as well as the biological activity of VEGF-C in vivo (11, 19). However, the

Cys l37Ala mutation in VEGF-C did not affect VEGFR-3 or VEGFR-2 binding affinity (1 1, 18) suggesting its effects were mediated by increased half-life of the active protein. This is believed to be the first disclosure of VEGFR-2 specific ligands.

[00115] For the purposes of defining polypeptide compounds of the invention, the term "selectively binds VEGFR-2" means that the polypeptide binds to the extracellular domain of VEGFR-2 with high affinity (dissociation constant of less than 500 nM, preferably less than 250 nM, more preferably less than 100 nM), and that the polypeptide displays little or no binding affinity for VEGFR-3 (dissociation constant at least 10-fold, and preferably at least 50-fold or 100-fold greater for VEGFR-3 than for VEGFR-2). For ligands that stimulate phosphorylation of VEGFR-2, a phosphorylation assay can also be used to demonstrate selectivity for VEGFR-2, where 10-fold, and preferably 50-fold less phosphorylation activity is indicative of receptor selectivity. By way of example, 25 ng/ml of the D89-195 construct was capable of stimulating phosphorylation of VEGFR-3 in assays described herein, but phosphoylation of VEGFR-3 was not detected with a comparable amount of the D 100- 195 construct. At 500 ng/ml concentration, the VEGFR-3 phosphorylation signal for the D100- 195 construct was detectable, but appeared to be weaker than the phosphorylation signal observed with the25 ng/ml of D89-195. These results indicate selective binding/stimulation of VEGFR-2. In an in vivo context, selective binding to VEGFR-2 is demonstrated when the ligand in question stimulates angiogenesis but not lymphangiogenesis in a mammalian model in which the wildtype mature protein (VEGF-C or VEGF-D) stimulates both

lymphangiogenesis and angiogenesis.

[00116] For purposes of defining molecules of the invention, a polypeptide that

"comprises" a specified portion of an amino acid sequence or nucleotide sequence may further include additional portions of that sequence, or may further include heterologous sequences. However, if the polypeptide "comprises" the specified portion with the proviso that the polypeptide lacks a different defined portion of the same sequence,or lacks a different defined sequence, then the term "comprising" does not negate the limitation imposed by the proviso. The polypeptide should not be construed to include something that it lacks by virtue of the term "comprising." Similarly, a polypeptide whose structure is defined as

"comprising" a sequence consisting of a specified portion of a reference sequence is permitted to include only the specified portion of the reference sequence, to the exclusion of other portions of the reference sequence. In this circumstance, the term "comprising" is construed as permitting attachment of one or more heterologous sequences, e.g., to make a chimeric or fusion protein (or gene).

VEGFR-2 Specific Ligands

[00117] In some embodiments, the VEGFR-2 specific ligand is a VEGF-D construct.

[00118] VEGF-D (SEQ ID NOs: 1 and 2) is initially expressed as a prepro-peptide that undergoes removal of a signal peptide (residues 1-21 of SEQ ID NO: 2), amino-terminal propeptide (residues 22-88 of SEQ ID NO: 2) and a carboxy-terminal propeptide (residues 206-354 of SEQ ID NO: 2) by proteolytic processing, and forms non-covalently linked dimers. Additional proteolytic processing results with removal of additional amino-terminal peptides (residues 89-99 of SEQ ID NO: 2 (Stacker et al, J. Biol. Chem. 274:32127-32136, 1999). VEGF-D stimulates mitogenic responses in endothelial cells in vitro. During embryogenesis, VEGF-D is expressed in a complex temporal and spatial pattern, and its expression persists in the heart, lung, and skeletal muscles in adults. Isolation of a biologically active fragment of VEGF-D designated VEGF-DANAC, is described in

International Patent Publication No. WO 98/07832, incorporated herein by reference. VEGF- DANAC consists of amino acid residues 93 to 201 of VEGF-D (SEQ ID NO: 2) and binds VEGFR-2 and VEGFR-3. Partially processed forms of VEGF-D bind to VEGFR-3 (e.g., amino acids 89-195 and 92-195 of SEQ ID NO: 2).

[00119] In addition, VEGF-D is described in greater detail in International Patent Publication No. WO 98/07832 and U.S. Patent No. 6,235,713, each of which is incorporated herein by reference and describes VEGF-D polypeptides and variants thereof that are useful in producing the chimeras of the present invention. VEGF-D related molecules also are described in International Patent Publication Nos. WO 98/02543 and WO 97/12972, and U.S. Patent No. 6,689,580, and U.S. Patent Application Nos. 09/219,345 and 09/847,524, all of which are incorporated by reference.

[00120] As demonstrated in the Examples, amino acids 196-205 of SEQ ID NO: 2 are not required to retain VEGFR-2 and VEGFR-3 binding activity. For example, the Examples show that truncated forms of VEGF-D (e.g., amino acids 89-195 of SEQ ID NO: 2 and amino acids 92-195 of SEQ ID NO: 2) lacking a carboxy-terminal amino acid after amino acid 195 were capable of binding to VEGFR-2 and VEGFR-3.

[00121] The Examples also demonstrate that amino acids 89-99 of SEQ ID NO: 2 are not required to retain VEGFR-2 binding activity by showing that truncated forms of VEGF-D (e.g., amino acids 89-195 of SEQ ID NO; 2, amino acids 92-195 of SEQ ID NO: 2, amino acids 100-195 of SEQ ID NO: 2 and amino acids 100-205 of SEQ ID NO: 2) lacking amino- terminal amino acids before amino acid 89, after amino acid 92 and after amino acid 100 of SEQ ID NO: 2 were capable of binding to VEGF -2.

[00122] The Examples further demonstrate that amino acids 92-99 of SEQ ID NO: 2 are required to retain VEGFR-3 binding activity by showing that certain amino-terminal truncated forms of VEGF-D (e.g., amino acids 100-195 of SEQ ID NO: 2 and amino acids 100-205 of SEQ ID NO: 2) failed to bind VEGFR-3 while other amino-terminal truncated forms of VEGFR-3 were capable of binding VEGFR-3 (e.g., amino acids 89-195 of SEQ ID NO: 2 and amino acids 92-195 of SEQ ID NO: 2).

[00123] In some embodiments the VEGFR-2 specific ligand comprises an amino acid sequence that comprises an amino-terminal amino acid selected from the group consisting of amino acids 89-99 of SEQ ID NO: 2 and a carboxy-terminal amino acid selected from the group consisting of amino acids 195-205 of SEQ ID NO: 2, wherein the ligand retains the ability to bind VEGFR-2.

[00124] In some embodiments, the VEGFR-2 specific ligand is a truncated VEGF-D construct that comprises an amino acid sequence that lacks amino-terminal amino acids before amino acid 94 of SEQ ID NO: 2 and lacks carboxy-terminal amino acids after amino acid 205 of SEQ ID NO: 2. In some embodiments, the truncated VEGF-D constructs comprise an amino acid sequence selected from the group consisting of amino acids 100-205 of SEQ ID NO: 2, amino acids 99-205 of SEQ ID NO: 2, amino acids 98-205 of SEQ ID NO: 2, amino acids 97-205 of SEQ ID NO: 2, amino acids 96-205 of SEQ ID NO: 2, amino acids, 95-205 of SEQ ID NO: 2 and amino acids 94-205 of SEQ ID NO: 2. In one embodiment, the VEGFR-2 specific ligand is a truncated VEGF-D construct consisting of amino acids 100- 205 of SEQ ID NO: 2.

[00125] In other embodiments, the VEGFR-2 specific ligand is a truncated VEGF-D construct that comprises an amino acid sequence that lacks amino-terminal amino acids before 94 of SEQ ID NO: 2 and lacks carboxy-terminal amino acids after amino acid 201 of SEQ ID NO: 2. In some embodiments, the truncated VEGF-D constructs comprise an amino acid sequence selected from the group consisting of amino acids 100-201 of SEQ ID NO: 2, amino acids 99-201 of SEQ ID NO: 2, amino acids 98-201 of SEQ ID NO: 2, amino acids 97-201 of SEQ ID NO: 2, amino acids 96-201 of SEQ ID NO: 2, amino acids 95-201 of SEQ ID NO: 2, and amino acids 94-201 of SEQ ID NO: 2. In one embodiment, the VEGFR-2 specific ligand is a truncated VEGF-D construct consisting of amino acids 100-201 of SEQ ID NO: 2.

[00126] In still other embodiments, the VEGFR-2 specific ligand is a truncated VEGF-D construct that comprises an amino acid sequence that lacks amino-terminal amino acids before 95 of SEQ ID NO: 2 and lacks carboxy-terminal amino acids after amino acid 195 of SEQ ID NO: 2. In some embodiments, the truncated VEGF-D constructs comprise an amino acid sequence selected from the group consisting of amino acids 100-195 of SEQ ID NO: 2, amino acids 99-195 of SEQ ID NO: 2, amino acids 98-195 of SEQ ID NO: 2, amino acids 97-195 of SEQ ID NO: 2, amino acids 96-195 of SEQ ID NO: 2, amino acids 95-195 of SEQ ID NO: 2 and amino acids 94-195 of SEQ ID NO: 2. In one embodiment, the VEGFR-2 specific ligand is a truncated VEGF-D construct consisting of amino acids 100-195 of SEQ ID NO: 2.

[00127] In some embodiments, the VEGFR-2 specific ligand is modified as described in Toivanen et al (J. Biol. Chem., 2009) and International PCT Publication No. WO

2008/146023, both of which are incorporated herein by reference in their entireties. The '023 publication discloses a modified VEGF-DANAC polypeptide wherein the amino acid at position 117 of full-length VEGF-D (SEQ ID NO: 2) is deleted or replaced with another amino acid. (Cysl 17 of full-length VEGF-D corresponds to Cys25 of the mature VEGF-D sequence, amino acids 93-201 of SEQ ID NO: 2). In some embodiments, the amino acid at position 117 of SEQ ID NO: 2 is deleted or replaced with another amino acid. In some embodiments, the amino acid at position 117 of SEQ ID NO: 2 is replaced with another amino acid selected from the group consisting of alanine, isoleucine, leucine and valine.

[00128] Truncated VEGF-C constructs are also contemplated as VEGFR-2 specific ligands. VEGF-C comprises a VEGF homology domain (VHD) that is approximately 30% identical at the amino acid level to VEGF-A. Secreted VEGF-C protein consists of a non- covalently-linked homodimer, in which each monomer contains the VHD. The intermediate forms of VEGF-C produced by partial proteolytic processing show increasing affinity for the VEGFR-3 receptor, and the mature protein is also able to bind to the VEGFR-2 receptor. (See WO 97/05250; WO 98/33917; WO 00/24412, U.S. Patent Nos. 6,221,839, 6,361,946, 6,645,933, 6,730,658 and 6,245,530; and Joukov, et al., EMBO J., 16(13):3898-391 1 (1997), all of which are incorporated herein by reference.). It has also been demonstrated that a mutant VEGF-C, in which a single cysteine at position 156 is either substituted by another amino acid or deleted, loses the ability to bind VEGFR-2 but remains capable of binding and activating VEGFR-3 [See International Patent Publication No. WO 98/33917 and U.S. Patent Nos. 6, 130,071, and 6,361,946, each of which are incorporated herein by reference].

[00129] VEGF-C (SEQ ID NOs: 3 and 4) is originally expressed as a larger precursor protein, prepro-VEGF-C, having extensive amino- and carboxy-terminal peptide sequences flanking a VHD, with the C-terminal peptide containing tandemly repeated cysteine residues in a motif typical of Balbiani ring 3 protein. The prepro-VEGF-C polypeptide is processed in multiple stages to produce a mature and most active VEGF-C polypeptide (ΔΝΔΟ VEGF-C) of about 21-23 kD (as assessed by SDS-PAGE under reducing conditions). Such processing includes cleavage of a signal peptide (approximately residues 1-31 of SEQ ID NO: 4);

cleavage of a carboxyl-terminal peptide (approximately residues 228-419 of SEQ ID NO: 4) to produce a partially-processed form of about 29 kD; and cleavage (apparently

extracellularly) of an amino-terminal peptide (approximately residues 32-102 of SEQ ID NO: 4) to produced a fully-processed mature form of about 21-23 kD (approximately residues 103-227 of SEQ ID NO: 4). Experimental evidence demonstrates that partially-processed forms of VEGF-C (e.g., the 29 kD form) are able to bind the Flt4 (VEGFR-3) receptor, whereas high affinity binding to VEGFR-2 occurs only with the fully processed forms of VEGF-C. Moreover, it has been demonstrated that amino acids 103-227 of SEQ ID NO: 13 are not all critical for maintaining VEGF-C functions. For example, a polypeptide consisting of amino acids 1 12-215 (and lacking residues 103-11 1 and 216-227) of SEQ ID NO: 4 retains the ability to bind and stimulate VEGF-C receptors. The cysteine residue at position 156 has been shown to be important for VEGFR-2 binding ability. It appears that VEGF-C polypeptides naturally associate as non-disulfide linked dimers.

[00130] As described in the Examples, comparison of the human VEGF-D to human VEGF-C in the VEGFR-2D23 complex reveals that the VEGFR-2 interacting residues, in particular the hydrophilic Asp 123 and Glul69 in VEGF-C (SEQ ID NO: 4) are structurally conserved in VEGF-D (Aspl03 and Glul49 of SEQ ID NO: 2) and seem to require only minor changes in the sidechain conformations for VEGFR-2 binding.

[00131] In some embodiments, the VEGFR-2 specific ligand is a truncated VEGF-C construct that comprises an amino acid sequence that lacks amino-terminal amino acids before 104 of SEQ ID NO: 4 and lacks carboxy-terminal amino acids after amino acid 227 of SEQ ID NO: 2. In some embodiments, the truncated VEGF-C construct comprises an amino acid sequence selected from the group consisting of amino acids 125-227 of SEQ ID NO: 4, amino acids 124-227 of SEQ ID NO: 4, amino acids 123-227 of SEQ ID NO: 4 amino acids 122-227 of SEQ ID NO: 4 amino acids 121-227 of SEQ ID NO: 4 of amino acids 120-227 of SEQ ID NO: 4, amino acids 1 19-227 of SEQ ID NO: 4, amino acids 1 18-227 of SEQ ID NO: 4, amino acids 1 17-227 of SEQ ID NO: 4, amino acids 116-227 of SEQ ID NO: 4, amino acids 115-227 of SEQ ID NO: 4, amino acids 1 14-227 of SEQ ID NO: 4, amino acids 1 13- 227 of SEQ ID NO: 4, amino acids 1 12-227 of SEQ ID NO: 4, amino acids 11 1-227 of SEQ ID NO: 4, amino acids 110-227 of SEQ ID NO: 4, amino acids 109-227 of SEQ ID NO: 4, amino acids 108-227 of SEQ ID NO: 4, amino acids 107-227 of SEQ ID NO: 4, amino acids 106-227 of SEQ ID NO: 4, amino acids 105-227 of SEQ ID NO: 4, amino acids 104-227 of SEQ ID NO: 4. In one embodiment, the VEGF -2 specific ligand is a truncated VEGF-C construct consisting of amino acids 120-227 of SEQ ID NO: 4.

[00132] Variation from natural (wildtype) sequences are also contemplated. Amino acid differences resulting from insertions, deletions, and substitutions (relative to a wildtype sequence) are specifically contemplated.

[00133] In some embodiments, the VEGFR-2 specific ligand comprises an amino acid sequence at least 90%, 92%, 94%, 95%, 96%, 97%, 98% or 99% identical to an amino acid sequence selected from the group consisting of amino acids 100-205 of SEQ ID NO: 2, amino acids 99-205 of SEQ ID NO: 2, amino acids 98-205 of SEQ ID NO: 2, amino acids 97-205 of SEQ ID NO: 2, amino acids 96-205 of SEQ ID NO: 2, amino acids, 95-205 of SEQ ID NO: 2, amino acids 94-205 of SEQ ID NO: 2, amino acids 100-201 of SEQ ID NO: 2, amino acids 99-201 of SEQ ID NO: 2, amino acids 98-201 of SEQ ID NO: 2, amino acids 97-201 of SEQ ID NO: 2, amino acids 96-201 of SEQ ID NO: 2, amino acids 95-201 of SEQ ID NO: 2, amino acids 94-201 of SEQ ID NO: 2, amino acids 100-195 of SEQ ID NO: 2, amino acids 99-195 of SEQ ID NO: 2, amino acids 98-195 of SEQ ID NO: 2, amino acids 97-195 of SEQ ID NO: 2, amino acids 96-195 of SEQ ID NO: 2, amino acids 95-195 of SEQ ID NO: 2 and amino acids 94-195 of SEQ ID NO: 2, amino acids 125-227 of SEQ ID NO: 4amino acids 124-227 of SEQ ID NO: 4, amino acids 123-227 of SEQ ID NO: 4 amino acids 122-227 of SEQ ID NO: 4 amino acids 121-227 of SEQ ID NO: 4 of amino acids 120-227 of SEQ ID NO: 4, amino acids 1 19-227 of SEQ ID NO: 4, amino acids 1 18-227 of SEQ ID NO: 4, amino acids 1 17-227 of SEQ ID NO: 4, amino acids 116-227 of SEQ ID NO: 4, amino acids 115-227 of SEQ ID NO: 4, amino acids 1 14-227 of SEQ ID NO: 4, amino acids 1 13- 227 of SEQ ID NO: 4, amino acids 1 12-227 of SEQ ID NO: 4, amino acids 11 1-227 of SEQ ID NO: 4, amino acids 110-227 of SEQ ID NO: 4, amino acids 109-227 of SEQ ID NO: 4, amino acids 108-227 of SEQ ID NO: 4, amino acids 107-227 of SEQ ID NO: 4, amino acids 106-227 of SEQ ID NO: 4, amino acids 105-227 of SEQ ID NO: 4, amino acids 104-227 of SEQ ID NO: 4, wherein the ligand retains the ability to bind VEGFR-2.

[00134] As demonstrated in the Examples, amino acids 89-99 of SEQ ID NO: 2 are not required to retain VEGFR-2 binding activity by showing that truncated forms of VEGF-D lacking amino-terminal amino acids before amino acid 89, before amino acid 92 and before amino acid 100 of SEQ ID NO: 2 were capable of binding to VEGFR-2. Thus, VEGFR-2 specific ligand analogs need not retain amino acids 89-99 of SEQ ID NO: 2 in order to bind VEGFR-2.

[00135] Standard methods can readily be used to generate such polypeptides including site-directed mutagenesis of polynucleotides, or specific enzymatic cleavage and ligation. Similarly, use of peptidomimetic compounds or compounds in which one or more amino acid residues are replaced by a non-naturally-occurring amino acid or an amino acid analog that retain binding activity is contemplated. Preferably, where amino acid substitution is used, the substitution is conservative, i.e. an amino acid is replaced by one of similar size and with similar charge properties. As used herein, the term "conservative substitution" denotes the replacement of an amino acid residue by another, biologically similar residue. Examples of conservative substitutions include the substitution of one hydrophobic residue such as isoleucine, valine, leucine, alanine, cysteine, glycine, phenylalanine, proline, tryptophan, tyrosine, norleucine or methionine for another, or the substitution of one similarly charge or polar residue for another, such as the substitution of arginine for lysine, glutamic acid for aspartic acid, or glutamine for asparagine, and the like. Neutral hydrophilic amino acids that can be substituted for one another include asparagine, glutamine, serine and threonine. The term "conservative substitution" also includes the use of a substituted amino acid in place of an unsubstituted amino acid.

[00136] Alternatively, conservative amino acids can be grouped as described in Lehninger, (Biochemistry, Second Edition; Worth Publishers, Inc. NY:NY, pp. 71-77 (1975)) as set out in the following:

Non-polar (hydrophobic)

A. Aliphatic: A, L, I, V, P,

B. Aromatic: F, W,

C. Sulfur-containing: M, D. Borderline: G.

Uncharged-polar

A. Hydroxyl: S, T, Y,

B. Amides: N, Q,

C. Sulfhydryl: C,

D. Borderline: G.

Positively Charged (Basic): , , H.

Negatively Charged (Acidic): D, E.

[00137] VEGFR-2 specific ligand analogs that retain VEGFR-2 receptor binding biological activity are specifically contemplated. In a preferred embodiment, analogs having 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, or 25 such modifications and that retain VEGFR-2 binding activity are also contemplated.

Polynucleotides encoding such analogs are generated using conventional PCR, site-directed mutagenesis, and chemical synthesis techniques.

Heparin Binding Domain

[00138] The truncated VEGF-D constructs described herein may additionally include a heparin binding domain. Without being bound to any mechanisms of action, it is contemplated that the presence of a heparin binding domain on the growth factors facilitates the binding of the growth factors to heparin and allows the concentration of the growth factors in the extracellular matrix to increase the efficiency of binding of the growth factors to their respective cell surface receptors, thereby increasing the bioavailability of the growth factors at a given site.

[00139] Mulloy et al, (Curr Opin Struct Biol. 11(5):623-8, 2001) describes properties from many heparin binding domain structures and identifies many heparin binding domain examples, and is incorporated herein by reference. Any such heparin binding domains may be used in the chimeric molecules of the present invention. In a further embodiment, the chimeric molecules of the present invention may comprise the heparin binding domain of PlGF-2 (see Hauser and Weich, Growth Factors, 9 259-68, 1993). Heparin binding domains from other growth factors also may be linked to the variant VEGF-D constructs described herein such as for example the heparin binding domain from EGF-like growth factor (Shin et al, JPept Sci. 9(4):244-50, 2003); the heparin binding domain from insulin-like growth factor-binding protein (Shand et al, J Biol Chem. 278(20): 17859-66, 2003), and the like. Other heparin binding domains that may be used herein include, but are not limited to, the pleiotrophin and amphoterin heparin binding domains (Matrix Biol. 19(5):377-87, 2000); CAP37 (Heinzelmann et al, Int J Surg Investig. 2(6):457-66, 2001); and the heparin-binding fragment of fibronectin (Yasuda et al, Arthritis Rheum. 48(5): 1271-80, 2003).

[00140] The inclusion of a heparin binding domain in a growth factor construct has been previously described in commonly owned U.S. Patent Publication No. 2005/0032697 and PCT Publication No. WO 2005/016963, both of which are incorporated herein by reference. Preferred heparin binding domains are found in native VEGF/PDGF molecules. VEGF-C and VEGF-D, like VEGF121, lack a heparin binding domain. However, it is known that VEGF 145, VEGF165, VEGF ₁₈ 9 and VEGF206, comprise heparin-binding domains (Keck et al, Arch. Bioch. Biophys., 344: 103-1 13, 1997; Fairbrother et al., Structure 6:637-648, 1998). VEGF145 and VEGF1 ₆ 5 (GenBank Acc. No. M32977) are both capable of binding to heparin; and VEGF1 ₈₉ and VEGF2 ₀₆ show the strongest affinity for heparin and heparan-sulfates. Exons 6 (21 amino acids) and 7 (44 amino acids) contain two independent heparin binding domains (Poltorak et al, Herz, 25: 126-9, 2000). In a preferred embodiment, the heparin binding domain is encoded by exon 6 (Genbank Accession No. M63976), and/or exon 7 (Genbank Accession No. M63977) of VEGF. The heparin binding domain may further comprise the amino acids encoded by exon 8 (Genbank Accession No. M63978) of VEGF.

[00141] The human VEGF-A gene is expressed as numerous isoforms, including VEGFi _45; VEGF165, VEGF189, and VEGF206. A human VEGF206 sequence obtained from the Swiss Prot database (accession no. P15692) is set forth below and in SEQ ID NO: 1 1 :

1 mnfllswvhw slalllylhh akwsqaapma egggqnhhev vkfmdvyqrs ychpietlvd

61 ifqeypdeie yifkpscvpl mrcggccnde glecvptees nitmqimrik phqgqhigem

121 sflqhnkcec rpkkdrarqe kksvrgkgkg qkrkrkksry kswsvyvgar cclmpwslpg

181 phpcgpcser rkhlfvqdpq tckcsckntd srckarqlel nertcrcdkp rr

[00142] Amino acids 1-26 of this sequence represent the signal peptide and mature VEGF2 ₀₆ comprises amino acids 27-232. Referring to the same sequence, the signal peptide and amino acids 142-226 are absent in mature isoform VEGFm (SEQ ID NO: 12). The signal peptide and amino acids 166-226 are absent in mature isoform VEGF 145 (SEQ ID NO: 13). The signal peptide and amino acids 142-182 are absent in mature isoform VEGF1 ₆ 5 (SEQ ID NOs: 14). The signal peptide and amino acids 166-182 are absent in mature isofrom VEGF ₁₈₉ (SEQ ID NO.: 15).

[00143] In other embodiments, the heparin binding domain may be of other, VEGF growth factors, for example the heparin binding domain of VEGF-B may be used. Makinen et ah, (J. Biol. Chem., 274:21217-22, 1999), have described various isoforms of VEGF-B and have shown that the exon 6B encoded sequence of VEGF-B ₁₆₇ resembles the heparin and NRP1- binding domain encoded by exon 7 of VEGFi ₆₅ . Thus exon-6B of VEGF-B ₁₆₇ (or a heparin binding fragment thereof) may be used as the heparin binding domain of the chimeric molecules of the present invention. The publication of Makinen et ah, J. Biol. Chem., 21 A: 21217-22, 1999 provides a detailed description of the construction of the VEGF-B exon 6B- encoded sequence. Nucleotide and deduced amino acid sequences for VEGF-B are deposited in GenBank under Acc. No. U48801, incorporated herein by reference. Also incorporated herein by reference is Olofsson et al, J. Biol Chem. 271 (32), 19310-19317 (1996), which describes the genomic organization of the mouse and human genes for VEGF-B, and its related Genbank entry at AF4681 10, which provides an exemplary genomic sequence of VEGF-B.

Purification of VEGFR-2 Specific Ligands

[00144] For many applications, it is desirable to purify the VEGFR-2 specific ligands. Protein purification techniques are well known. These techniques involve, at one level, the crude fractionation of the cellular milieu to polypeptide and non-polypeptide fractions.

Having separated the VEGFR-2 specific ligands from other proteins, the VEGFR-2 specific ligands may be further purified using chromatographic and electrophoretic techniques to achieve partial or complete purification (or purification to homogeneity).

[00145] Generally, "purified" will refer to a polypeptide, protein or peptide composition that has been subjected to fractionation to remove various other components, and which composition substantially retains its biological activity. Where the term "substantially purified" is used, this designation will refer to a composition in which the polypeptide, protein or peptide forms the major component of the composition, such as constituting about 50%, about 60%, about 70%, about 80%, about 90%, about 95% or more of the proteins in the composition. [00146] Various methods for quantifying the degree of purification of the polypeptide, protein or peptide will be apparent. These include, for example, determining the specific activity of an active fraction, or assessing the amount of polypeptides within a fraction by SDS/PAGE analysis. A preferred method for assessing the purity of a fraction is to calculate the specific activity of the fraction, to compare it to the specific activity of the initial extract, and to thus calculate the degree of purity, herein assessed by a "-fold purification number." The actual units used to represent the amount of activity will, of course, be dependent upon the particular assay technique chosen to follow the purification and whether or not the expressed polypeptide, protein or peptide exhibits a detectable activity.

[00147] Various techniques known in the art for use in protein purification are also suitable. These include, for example, precipitation with ammonium sulphate, PEG, antibodies and the like or by heat denaturation, followed by centrifugation; chromatography steps such as ion exchange, gel filtration, reverse phase, hydroxylapatite, exclusion, and affinity chromatography; isoelectric focusing; gel electrophoresis (including polyacrylamide gel electrophoresis); and combinations of such and other techniques. The order of conducting the various purification steps may be varied, and certain steps may be omitted, and still result in a suitable method for the preparation of a substantially purified polypeptide, protein or peptide.

[00148] There is no general requirement that the polypeptide, protein or peptide always be provided in their most purified state. Indeed, it is contemplated that less substantially purified products will have utility in certain embodiments. Partial purification may be accomplished by using fewer purification steps in combination, or by utilizing different forms of the same general purification scheme. For example, it is appreciated that a cation- exchange column chromatography performed utilizing an HPLC apparatus will generally result in a greater "-fold" purification than the same technique utilizing a low pressure chromatography system. Methods exhibiting a lower degree of relative purification may have advantages in total recovery of protein product, or in maintaining the activity of an expressed protein.

[00149] It is known that the migration of a polypeptide can vary, sometimes significantly, with different conditions of SDS/PAGE (Capaldi et al., Biochem. Biophys. Res. Comm., 76:425, 1977). It will therefore be appreciated that under differing electrophoresis conditions, the apparent molecular weights of purified or partially purified expression products may vary. [00150] In still another related embodiment, described herein is a method for producing VEGF -2 specific ligand, comprising the steps of growing a host cell described herein in a nutrient medium and isolating the construct polypeptide from the cell or the medium.

Isolation of the polypeptide from the cells or from the medium in which the cells are grown is accomplished by purification methods known in the art, e.g., conventional chromatographic methods including immunoaffmity chromatography, receptor affinity chromatography, hydrophobic interaction chromatography, lectin affinity chromatography, size exclusion filtration, cation or anion exchange chromatography, high pressure liquid chromatography (HPLC), reverse phase HPLC, and the like. Still other methods of purification include those wherein the desired protein is expressed and purified as a fusion protein having a specific tag, label, or chelating moiety that is recognized by a specific binding partner or agent. The purified protein can be cleaved to yield the desired protein, or be left as an intact fusion protein. Cleavage of the fusion component may produce a form of the desired protein having additional amino acid residues as a result of the cleavage process.

[00151] In some embodiments, the VEGFR-2 specific ligands are purified using affinity purification using an extracellular domain of VEGFR-2 (KDR/flk-1), or other portions of a receptor that the VEGFR-2 specific ligands constructs may bind. Exemplary affinity purification of VEGF related compositions is described in e.g., U.S. Patent No. 6,342,219, incorporated herein by reference. In an exemplary affinity purification procedure using the VEGFR-2 extracellular domain, the VEGFR-2 specific ligand-containing composition to be purified are initially concentrated 30-50 fold using Centriprep filter cartridges and loaded onto a column of immobilized VEGFR-extracellular domain (EC). Two affinity matrices are prepared. In the first case, the VEGFR-EC-6xHis fusion protein is crosslinked to CNBr- activated Sepharose 4B (Pharmacia) and in the second case the VEGFR-EC-Ig fusion protein is coupled to protein A Sepharose using dimethylpimelidate (Schneider et al., J. Biol. Chem. 257: 10766-10769, 1982). The material eluted from the affinity column is subjected to further purification using ion exchange and reverse-phase high pressure chromatography and SDS-polyacrylamide gel electrophoresis. An affinity purification protocol using the VEGFR- 3 EC domain is described in U.S. Patent No. 5,776,755, incorporated herein by reference.

[00152] Another affinity chromatography purification procedure that may be used to purify the VEGFR-2 specific ligands described herein employ immunoaffmity chromatography using antibodies specific for one or more of the receptor tyrosine kinase binding domain of VEGF-D or a heparin binding domain, if included, epitope tag or linker sequence. Antibodies to various VEGF growth factors are well known in the art and also readily produced using conventional techniques. For example, antibodies specific for VEGF-A are useful for purification of constructs that include the RTK binding domain of VEGF-A. In addition, purification of the truncated VEGF-D constructs can be achieved using methods for the purification of VEGF-D that are described in U.S. Patent No. 6,235,713.

VEGF Receptors

[00153] Growth factor receptor tyrosine kinases generally comprise three principal domains: an extracellular domain, a transmembrane domain, and an intracellular domain. The extracellular domain binds ligands, the transmembrane domain anchors the receptor to a cell membrane, and the intracellular domain possesses one or more tyrosine kinase enzymatic domains and interacts with downstream signal transduction molecules. The vascular endothelial growth factor receptors (VEGFRs) bind their ligand through their extracellular domains (ECDs), which are comprised of multiple immunoglobulin-like domains (Ig- domains). Ig-domains are identified herein using the designation "D#." For example "Dl" refers to the first Ig-domain of a particular receptor ECD. "Dl-3" refers to a construct containing at least the first three Ig-domains, and intervening sequence between domains 1 and 2 and 2 and 3, of a particular construct. Table 1 defines the boundaries of the Ig-domains for VEGFR-1, VEGFR-2, and VEGFR-3.

[00154] The complete ECD of VEGFRs is not required for ligand (growth factor) binding. The ECD of VEGFR-1 (R-l) and VEGFR-2 (R-2) consists of seven Ig-like domains and the ECD of VEGFR-3 (R-3) has six intact Ig-like domains— D5 of R-3 is cleaved post- translationally into disulfide linked subunits leaving VEGFR-3 (Veikkola, T., et al, Cancer Res. 60:203-212 (2000)). In general, receptor fragments of at least the first three Ig-domains for this family are sufficient to bind ligand.

[00155] Table 1 : Immunoglobulin-like domains for VEGFR-1, VEGFR-2 and VEGFR-3

D7 2281-2452 678-735 2050-2221 683-740 2102-2275 695-752

[00156] The extracellular parts of VEGFR-2 and VEGFR-3 share the same overall structure of seven immunoglobulin (Ig)-like domains (International Application No. WO 2005/087808 and U.S. Patent No. 7,422,741, the disclosure of which are incorporated herein by referenced in their entireties). Structural and functional studies have yielded insights into how the distinct domains contribute to VEGFR activity. The VEGFR-2 ligand-binding has been mapped to domains 2 and 3 (D23) by using deletion mutants (20,21) and by determining the crystal structure of VEGF-C-receptor complexes (18). VEGFR-2 D2 is the major ligand- binding domain, but D3 contributes important interactions for VEGF-C binding. In addition, in a recent EM study, VEGF-A binding to the VEGFR-2 D23 has been shown to induce receptor dimerization with additional homotypic interactions between the membrane- proximal domains (22). In contrast to VEGFR-1 and VEGFR-2, VEGFR-3 ligand (VEGF-C) binding is Dl dependent and the minimal construct needed for VEGF-C binding contains domains Dl and D2 (21).

[00157] In some embodiments, the VEGFR-2 specific ligand binds a VEGFR-2 polypeptide comprising an amino acid sequence selected from the group consisting of amino acids 24-326 of SEQ ID NO: 6, amino acids 118-326 of SEQ ID NO: 6, amino acids 118-220 of SEQ ID NO: 6, amino acids 118-226 of SEQ ID NO: 6, and amino acids 118-232 of SEQ ID NO: 6. In some embodiments, the VEGFR-2 specific ligand binds a VEGFR-2 polypeptide comprising an amino acid sequence selected from the group consisting of amino acids 106-240 of SEQ ID NO: 6, amino acids 1 12-234 of SEQ ID NO: 6, amino acids 1 14- 220 of SEQ ID NO: 6, amino acids 1 15-220 of SEQ ID NO: 6, amino acids 116-222 of SEQ ID NO: 6, amino acids 117-220 of SEQ ID NO: 6, amino acids 118-221 of SEQ ID NO: 6, amino acids 1 18-222 of SEQ ID NO: 6, amino acids 1 18-223 of SEQ ID NO: 6, amino acids 118-224 of SEQ ID NO: 6, and amino acids 118-228 of SEQ ID NO: 6. In some embodiments, the VEGFR-2 specific ligand binds a VEGFR-2 polypeptide comprising an amino acid sequence selected from the group consisting of amino acids 48-203 of SEQ ID NO: 6, amino acids 145-310 of SEQ ID NO: 6 and amino acids 48-310 of SEQ ID NO: 6.

Nucleic Acids and Related Compositions.

[00158] Polynucleotides that encode the VEGFR-2 specific ligands as well as polynucleotides that hybridize under moderately stringent or high stringency conditions to the complete non-coding strand, or complement, of such polynucleotides are also contemplated. Complementary molecules are useful as templates for synthesizing coding molecules, and for making stable double-stranded polynucleotides. Due to the well-known degeneracy of the universal genetic code, one can synthesize numerous polynucleotide sequences that encode each chimeric polypeptide of the present invention. All such polynucleotides are contemplated as part of the invention. Such polynucleotides are useful for recombinant expression of polypeptides of the invention in vivo or in vitro (e.g., for gene therapy). The polynucleotides also are useful for manipulation to design constructs of the inventions with introduced functional domains or mutations or the like.

[00159] This genus of polynucleotides embraces polynucleotides that encode polypeptides with one or a few amino acid differences (additions, insertions, or deletions) relative to amino acid sequences specifically depicted herein. Such changes are easily introduced by performing site directed mutagenesis, for example.

[00160] Polynucleotides (and polypeptides encoded thereby) can be defined by molecules that hybridize under specified conditions to a polynucleotide sequence complementary to a sequence that encodes a construct described herein.

[00161] Exemplary highly stringent hybridization conditions are as follows: hybridization at 65°C for at least 12 hours in a hybridization solution comprising 5X SSPE, 5X Denhardt's, 0.5% SDS, and 2 mg sonicated non homologous DNA per 100 ml of hybridization solution; washing twice for 10 minutes at room temperature in a wash solution comprising 2X SSPE and 0.1% SDS; followed by washing once for 15 minutes at 65°C with 2X SSPE and 0.1% SDS; followed by a final wash for 10 minutes at 65°C with 0. IX SSPE and 0.1% SDS.

Moderate stringency washes can be achieved by washing with 0.5X SSPE instead of 0. IX SSPE in the final 10 minute wash at 65°C. Low stringency washes can be achieved by using IX SSPE for the 15 minute wash at 65°C, and omitting the final 10 minute wash. It is understood in the art that conditions of equivalent stringency can be achieved through variation of temperature and buffer, or salt concentration as described Ausubel, et al. (Eds.), Protocols in Molecular Biology, John Wiley & Sons (1994), pp. 6.0.3 to 6.4.10.

Modifications in hybridization conditions can be empirically determined or precisely calculated based on the length and the percentage of guanosine/cytosine (GC) base pairing of the probe. The hybridization conditions can be calculated as described in Sambrook et al., (Eds.), Molecular Cloning: A Laboratory Manual, Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York (1989), pp. 9.47 to 9.51. [00162] For example, described herein is a polynucleotide that comprises a nucleotide sequence that hybridizes under moderately stringent or high stringency hybridization conditions to the complement of any specific nucleotide sequence of the invention, and that encodes a VEGFR-2 specific ligand as described herein.

[00163] In a related embodiment, described herein is a polynucleotide that comprises a nucleotide sequence that is at least 75%, 80%, 85%, 90%, 95%, 97%, 98%, or 99% identical to any specific nucleotide sequence (such as a VEGF-D nucleotide sequence encoding a VEGFR-2 specific ligand described herein), and that encodes a polypeptide that binds at least one of the naturally occurring vascular endothelial growth factor receptors.

[00164] In a related embodiment, described herein are vectors comprising a polynucleotide comprising a nucleotide sequence that encodes a variant VEGF-D construct described herein Such vectors are useful, e.g., for amplifying the polynucleotides in host cells to create useful quantities thereof, and for expressing polypeptides of the invention using recombinant techniques. In preferred embodiments, the vector is an expression vector wherein the polynucleotide of the invention is operatively linked to a polynucleotide comprising an expression control sequence. Autonomously replicating recombinant expression constructs such as plasmid and viral DNA vectors incorporating polynucleotides of the invention are specifically contemplated. Expression control DNA sequences include promoters, enhancers, and operators, and are generally selected based on the expression systems in which the expression construct is to be utilized. Preferred promoter and enhancer sequences are generally selected for the ability to increase gene expression, while operator sequences are generally selected for the ability to regulate gene expression. Expression vectors are useful for recombinant production of polypeptides of the invention. Expression constructs of the invention may also include sequences encoding one or more selectable markers that permit identification of host cells bearing the construct. Expression constructs may also include sequences that facilitate, and preferably promote, homologous recombination in a host cell. Preferred constructs of the invention also include sequences necessary for replication in a host cell.

[00165] In preferred embodiments, polynucleotides described herein further comprise additional sequences to facilitate the gene therapy. In one embodiment, a "naked" transgene encoding a polypeptide of the invention (i.e., a transgene without a viral, liposomal, or other vector to facilitate transfection) is employed for gene therapy. In this embodiment, the polynucleotide optionally comprises a suitable promoter and/or enhancer sequence (e.g., cytomegalovirus promoter/enhancer [Lehner et al., J. Clin. Microbiol., 29:2494 2502 (1991); Boshart et al, Cell, 41 :521 530 (1985)]; Rous sarcoma virus promoter [Davis et al, Hum. Gene Ther., 4: 151 (1993)]; Tie promoter [Korhonen et al, Blood, 86(5): 1828 1835 (1995)]; or simian virus 40 promoter) for expression in the target mammalian cells, the promoter being operatively linked upstream (i.e., 5') of the polypeptide coding sequence. In a preferred embodiment, the promoter sequence comprises a skin specific promoter. Preferred promoter sequences include the 14, K5, 6, K16 promoters for the epidermis and alpha 1(1) collagen promoter for the dermis (Diamond, I., et al., J. Invest. Dermatol., 115(5):788-794 (2000); Galera, P., et al., Proc. Natl. Acad. Sci. USA, 91(20):9372-9376 (1994); Wawersik, M. I, et al, Mol. Biol. Cell, 12(11):3439-3450 (2001)). All of the foregoing documents are incorporated herein by reference in the entirety. In some embodiments, the polynucleotides also further includes a suitable polyadenylation sequence (e.g., the SV40 or human growth hormone gene polyadenylation sequence) operably linked downstream (i.e., 3 ') of the polypeptide coding sequence. The polynucleotides of the invention also preferably comprise a nucleotide sequence encoding a secretory signal peptide fused in frame with the polypeptide sequence. The secretory signal peptide directs secretion of the polypeptide of the invention by the cells that express the polynucleotide, and is cleaved by the cell from the secreted polypeptide. The signal peptide sequence can be that of another secreted protein, or can be a completely synthetic signal sequence effective to direct secretion in cells of the mammalian subject.

[00166] The polynucleotide may further optionally comprise sequences whose only intended function is to facilitate large scale production of the vector, e.g., in bacteria, such as a bacterial origin of replication and a sequence encoding a selectable marker. However, in a preferred embodiment, such extraneous sequences are at least partially cleaved off prior to administration to humans according to methods of the invention. One can manufacture and administer such polynucleotides for gene therapy using procedures that have been described in the literature for other transgenes. See, e.g., Isner et al., Circulation, 91 : 2687-2692 (1995); and Isner et al, Human Gene Therapy, 7: 989-1011 (1996); incorporated herein by reference in their entirety.

[00167] Vectors also are useful for "gene therapy" treatment regimens, wherein a polynucleotide that encodes a polypeptide of the invention is introduced into a subject in need of treatment involving the modulation (stimulation or blockage) of vascular endothelial growth factor receptors, in a form that causes cells in the subject to express the polypeptide of the invention in vivo. Gene therapy aspects that are described in commonly owned U.S. Patent Publication No. 2002/0151680 and WO 01/62942 both of which are incorporated herein by reference, also are applicable herein.

[00168] Any suitable vector may be used to introduce a polynucleotide that encodes a VEGF-D construct described herein, into the host. Exemplary vectors that have been described in the literature include replication deficient retroviral vectors, including but not limited to lentivirus vectors [Kim et al., J. Virol., 72(1): 81 1-816 (1998); Kingsman & Johnson, Scrip Magazine, October, 1998, pp. 43 46.]; adeno-associated viral (AAV) vectors [ U.S. Patent No. 5,474,935; U.S. Patent No. 5, 139,941; U.S. Patent No. 5,622,856; U.S. Patent No. 5,658,776; U.S. Patent No. 5,773,289; U.S. Patent No. 5,789,390; U.S. Patent No.

5,834,441; U.S. Patent No. 5,863,541 ; U.S. Patent No. 5,851,521; U.S. Patent No. 5,252,479; Gnatenko et al., J. Invest. Med., 45: 87 98 (1997)]; adenoviral (AV) vectors [See, e.g., U.S. Patent No. 5,792,453; U.S. Patent No. 5,824,544; U.S. Patent No. 5,707,618; U.S. Patent No. 5,693,509; U.S. Patent No. 5,670,488; U.S. Patent No. 5,585,362; Quantin et al., Proc. Natl. Acad. Sci. USA, 89: 2581 2584 (1992); Stratford Perricadet et al, J. Clin. Invest., 90: 626 630 (1992); and osenfeld et al., Cell, 68: 143 155 (1992)]; an adenoviral adenoassociated viral chimeric (see for example, U.S. Patent No. 5,856, 152) or a vaccinia viral or a herpesviral (see for example, U.S. Patent No. 5,879,934; U.S. Patent No. 5,849,571; U.S. Patent No. 5,830,727; U.S. Patent No. 5,661,033; U.S. Patent No. 5,328,688; Lipofectin mediated gene transfer (BRL); liposomal vectors [See, e.g., U.S. Patent No. 5,631,237 (Liposomes comprising Sendai virus proteins)] ; and combinations thereof. All of the foregoing documents are incorporated herein by reference in their entirety. Replication deficient adenoviral vectors constitute a preferred embodiment.

[00169] Naked plasmid DNA gene therapy is another vehicle to administer the variant VEGF-D constructs described herein. A trial, GENASIS (Genetic Angiogenic Stimulation Investigational Study), was perfomed by Corautus Genetics, Inc., to evaluate the safety and efficacy of a VEGF family member for the treatment of patients with severe angina. The trial reportedly employed defined doses of the transgene in the form of "naked" plasmid DNA, a non- viral delivery vector, delivered to diseased heartmuscle tissue via the Stiletto™ (Boston Scientific Corporation ) endocardial direct injection catheter system. Once administered, the DNA plasmid appeared to be taken up and expressed by myocardium near the injection site. The results of the clinical trial did not demonstrate a statistically significant difference between the placebo- and therapeutic -treated patients. [00170] In another related embodiment, host cells, including prokaryotic and eukaryotic cells, that are transformed or transfected (stably or transiently) with variant VEGF-D constructs described herein are also contemplated Polynucleotides encoding the variant VEGF-D constructs described herein may be introduced into the host cell as part of a circular plasmid, or as linear DNA comprising an isolated protein coding region or a viral vector. Methods for introducing DNA into the host cell, which are well known and routinely practiced in the art include transformation, transfection, electroporation, nuclear injection, or fusion with carriers such as liposomes, micelles, ghost cells, and protoplasts. As stated above, such host cells are useful for amplifying the polynucleotides and also for expressing the variant VEGF-D construct encoded by the polynucleotide. The host cell may be isolated and/or purified. The host cell also may be a cell transformed in vivo to cause transient or permanent expression of the polypeptide in vivo. The host cell may also be an isolated cell transformed ex vivo and introduced post-transformation, e.g., to produce the polypeptide in vivo for therapeutic purposes. The definition of host cell explicitly excludes a transgenic human being.

[00171] Such host cells are useful in assays as described herein. For expression of polypeptides of the invention, any host cell is acceptable, including but not limited to bacterial, yeast, plant, invertebrate (e.g., insect), vertebrate, and mammalian host cells. For developing therapeutic preparations, expression in mammalian cell lines, especially human cell lines, is preferred. Use of mammalian host cells is expected to provide for such post- translational modifications (e.g., glycosylation, truncation, lipidation, and phosphorylation) as may be desirable to confer optimal biological activity on recombinant expression products of the invention. Glycosylated and non-glycosylated forms of polypeptides are embraced by the present invention. Similarly, the invention further embraces polypeptides described above that have been covalently modified to include one or more water soluble polymer attachments such as polyethylene glycol, polyoxyethylene glycol, or polypropylene glycol.

[00172] In a related embodiment, the invention provides a kit comprising a polynucleotide, polypeptide, or composition of the invention packaged in a container, such as a vial or bottle, and further comprising a label attached to or packaged with the container, the label describing the contents of the container and providing indications and/or instructions regarding use of the contents of the container to treat one or more disease states as described herein.

VEGF Receptor Binding Assays [00173] Abundant evidence demonstrates that the VEGF family of growth factors exert their growth factor, cell maturation, cell migration, and other activities by binding and stimulating phosphorylation of cell surface receptor tyrosine kinases (RT s). (Evidence indicates that a growth factor polypeptide dimer binds and stimulates a receptor dimer). VEGFR-2 specific ligands that bind and stimulate phosphorylation of VEGFR-2 are useful as agonists of VEGFR-2. On the other hand, constructs that bind but fail to stimulate are useful as agonists of endogenous VEGF growth factor activity. RTK binding properties of native growth factors are described below.

[00174] At least three cell surface receptors that interact with VEGF family members described above have been identified. These include VEGFR-l/Flt-1 (fms-like tyrosine kinase-1;) [GenBank Acc. No. X51602; De Vries, et al, Science 255:989-991 (1992)];

VEGFR-2/KDR/Flk-l (kinase insert domain containing receptor/fetal liver kinase-1)

[GenBank Acc. Nos. X59397 (Flk-1) and L04947 (KDR); Terman, et al, Biochem. Biophys. Res. Comm. 187: 1579-1586 (1992); Matthews, et al, Proc. Natl. Acad. Sci. USA 88:9026- 9030 (1991)]; and VEGFR-3/Flt4 (fms-like tyrosine kinase 4; sometimes referred herein as "R-3") [U.S. Patent No. 5,776,755 and GenBank Acc. No. X68203 and S66407; Pajusola et al, Oncogene 9:3545-3555 (1994)].

[00175] VEGF 121, VEGF 165, VEGF-B, PlGF-1 and P1GF-2 bind VEGFR-1; VEGF 121, VEGF 145, VEGF 165, (fully processed mature) VEGF-C, (fully processed mature) VEGF-D, VEGF-E, and NZ2 VEGF bind VEGFR-2; VEGF-C and VEGF-D bind VEGFR-3;

VEGF 165, VEGF-C, P1GF-2, and NZ2 VEGF bind neuropilin-1; and VEGF 165 and VEGF- C binds neuropilin-2. [Neufeld, et al, FASEB. J. 13 :9-22 (1999); Stacker and Achen, Growth Factors 17: 1-1 1 (1999); Ortega, et al, Fron. Biosci, 4: 141-152 (1999); Zachary, Intl. J. Biochem. Cell Bio. 30: 1169-1174 (1998); Petrova, et al, Exp. Cell. Res. 253 : 1 17-130 (1999); U.S. Pat. Appl. Pub. No. 20030113324].

[00176] The expression of VEGFR-1 occurs mainly in vascular endothelial cells, although some may be present on monocytes, trophoblast cells, and renal mesangial cells [Neufeld et al., FASEB. J. 13 :9-22 (1999)]. High levels of VEGFR-1 mRNA are also detected in adult organs, suggesting that VEGFR-1 has a function in quiescent endothelium of mature vessels not related to cell growth. VEGFR-1-/- mice die in utero between day 8.5 and 9.5. Although endothelial cells developed in these animals, the formation of functional blood vessels was severely impaired, suggesting that VEGFR-1 may be involved in cell-cell or cell-matrix interactions associated with cell migration. It has been demonstrated that mice expressing a mutated VEGFR- 1, in which only the tyrosine kinase domain was missing, show normal angiogenesis and survival suggesting that the signaling capability of VEGFR- 1 is not essential. [Neufeld, et al., FASEB. J. 13:9-22 (1999); Ferrara, J. Mol. Med. 77:527-543 (1999)].

[00177] VEGFR-2 expression is similar to that of VEGFR- 1 in that it is broadly expressed in the vascular endothelium, but it is also present in hematopoietic stem cells,

megakaryocytes, and retinal progenitor cells [Neufeld, et al., FASEB. J. 13:9-22 (1999)]. Although the expression pattern of VEGFR- 1 and VEGFR-2 overlap extensively, evidence suggests that, in most cell types, VEGFR-2 is the major receptor through which most of the VEGFs exert their biological activities. Examination of mouse embryos deficient in VEGFR- 2 further indicate that this receptor is required for both endothelial cell differentiation and the development of hematopoietic cells [Joukov, et al., J. Cell. Physiol. 173:211-215 (1997)].

[00178] VEGFR-3 is expressed broadly in endothelial cells during early embryogenesis. During later stages of development, the expression of VEGFR-3 becomes restricted to developing lymphatic vessels [Kaipainen, A., et al., Proc. Natl. Acad. Sci. USA 92:3566-70 (1995)]. In adults, the lymphatic endothelia and some high endothelial venules express VEGFR-3, and increased expression occurs in lymphatic sinuses in metastatic lymph nodes and in lymphangioma. VEGFR-3 is also expressed in a subset of CD34 ⁺ hematopoietic cells which may mediate the myelopoietic activity of VEGF-C demonstrated by overexpression studies [WO 98/33917]. Targeted disruption of the VEGFR-3 gene in mouse embryos leads to failure of the remodeling of the primary vascular network, and death after embryonic day 9.5 [Dumont, et al, Science 282:946-49 (1998)]. These studies suggest an essential role for VEGFR-3 in the development of the embryonic vasculature, and also during

lymphangiogenesis.

[00179] Receptor binding assays for determining the binding of VEGF growth factors to one or more of VEGF receptors are well-known in the art. Examples of such receptor binding assays are taught in e.g., U.S. Patent Application No. 09/795,006, WO 01/62942; Thuringer et al., J. Biol. Chem., 277:2028-2032 (2002) and Cao et al, FASEB I, 16: 1575- 1583 (2002) each incorporated herein by reference. (See, e.g., Example 3 of U.S. Patent Application No. 09/795,006, and WO 01/62942, which details binding assays of VEGF-C and related VEGF receptor ligands to soluble VEGF receptor Fc fusion proteins. Example 5 of those documents details analyses of receptor activation or inhibition by such ligands. Example 6 describes analyses of receptor binding affinities of such ligands. In addition, Achen et al., Proc Natl Acad Sci USA 95:548 53 (1998), incorporated by reference in its entirety, teaches exemplary binding assays. Thuringer et al., J. Biol. Chem., 277:2028-2032 (2002) details binding assays (activation and inhibition) for VEGF-A to VEGFR-2. The binding of the VEGFR-2 specific ligands described above to VEGFR-2 may be analyzed using such exemplary assays.

[00180] It will be appreciated that such binding assays can be performed with any form of naturally occurring VEGF receptors that retain the ability to bind their respective ligands, including but not limited to whole cells that naturally express a receptor or that have been recombinantly modified to express the receptor; truncated, solubilized extracellular ligand binding domains of receptors; fusions comprising receptor extracellular domains fused to other proteins such as alkaline phosphatase (e.g., VEGFR-2 AP described in Cao et al, J. Biol. Chem. 271 :3154-62, 1996) or immunoglobulin sequences; and fusions comprising receptor extracellular domains fused to tag sequences (e.g., a polyhistidine tag) useful for capturing the protein with an antibody or with a solid support; and receptor extracellular domains chemically attached to solid supports such as CNBr activated Sepharose beads. Exemplary receptor binding assays may be performed according to the method set forth in Example 3 of e.g., U.S. Patent Application No. 09/795,006, and WO 01/62942, each incorporated herein by reference.

[00181] In another set of assays, the VEGFR-2 specific ligands are evaluated for therapeutic applications where activation of one or more VEGF receptors is desired. For example, a candidate VEGFR-2 specific ligand can be added to stable cell lines expressing a particular VEGF receptor whose activation is necessary for cell survival. Survival of the cell line indicates that the candidate VEGFR-2 specific ligand is able to bind and activate that particular VEGF receptor. On the other hand, death of the cell line indicates that the candidate VEGFR-2 specific ligand fails to activate the receptor. Exemplary examples of such cell survival assays have been described in International Patent Publication No. WO 98/07832 and in Achen et al., Proc Natl Acad Sci USA 95:548 553 (1998), incorporated herein by reference. This assay employs Ba/F3 NY EpoR cells, which are Ba/F3 pre B cells that have been transfected with a plasmid encoding a chimeric receptor consisting of the extracellular domain of VEGFR-2 and the cytoplasmic domain of the erythropoietin receptor (EpoR). These cells are routinely passaged in interleukin-3 (IL-3) and will die in the absence of IL-3. However, if signaling is induced from the cytoplasmic domain of the chimeric receptor, these cells survive and proliferate in the absence of IL-3. Such signaling is induced by ligands which bind to the VEGFR-2 extracellular domain of the chimeric receptor. For example, binding of VEGF-A or VEGF-D to the VEGFR-2 extracellular domain causes the cells to survive and proliferate in the absence of IL-3. Parental Ba/F3 cells which lack the chimeric receptor are not induced by either VEGF-A or VEGF-D to proliferate in the absence of IL-3, indicating that the responses of the Ba/F3-NYK-EpoR cells to these ligands are totally dependent on the chimeric receptor.

[00182] Candidate VEGFR-2 specific ligands can be tested for binding to the VEGFR-2 extracellular domain and subsequent activation of a chimeric receptor by assaying cell survival in the absence of IL-3. On the other hand, VEGFR-2 specific ligands that interfere with the binding of VEGF-A or VEGF-D to the extracellular domain, or with the activation of the cytoplasmic domain, will cause cell death in the absence of IL-3.

[00183] As an alternative indicator of activity, the ability of a VEGFR-2 specific ligand to stimulate autophosphorylation of a particular VEGF receptor can also be examined. A candidate VEGFR-2 specific ligand is added to cells expressing a particular VEGF receptor (e.g., VEGFR-2). The cells are then lysed and immunoprecipitated with anti-VEGF receptor antiserum and analyzed by Western blotting using anti-phosphotyrosine antibodies to determine VEGFR-2 specific ligand induced phosphorylation of the VEGF receptor.

[00184] The ability of a VEGFR-2 specific ligand to stimulate autophosphorylation (detected using the anti-phosphotyrosine antibodies) is scored as stimulating the receptor. The level of stimulation observed for various concentrations of VEGFR-2 specific ligand, relative to known concentrations of VEGF molecules, provide an indication of the potency of receptor stimulation. Polypeptides that have been shown to bind the receptor, but are incapable of stimulating receptor phosphorylation, are scored as inhibitors. Inhibitory activity can be further assayed by mixing a known receptor agonist such as recombinant VEGF-A, VEGF-D or VEGF-C with either media alone or with concentrated conditioned media, to determine if the concentrated conditioned media inhibits VEGF-A-mediated, VEGF-D-mediated or VEGF-C-mediated receptor phosphorylation.

[00185] Assays to determine whether or not the VEGFR-2 specific ligands described herein bind to a VEGF receptor other than VEGFR-2 can also be performed. For such experiments, the candidate VEGFR-2 specific ligand may be expressed in an insect cell system, e.g., SF9 cells, to eliminate contamination with endogenous VEGF-C or VEGF-D found in mammalian cells. To measure the relative binding affinities of candidate VEGFR-2 specific ligands, an ELISA type approach is used. For example, to examine binding affinity for VEGFR-2, serial dilutions of competing VEGFR-2 IgG fusion proteins and a

subsaturating concentration of the candidate VEGFR-2 specific ligand tagged with the myc epitope is added to microtitre plates coated with VEGFR-2, and incubated until equilibrium is established. The plates are then washed to remove unbound proteins. VEGFR-2 specific ligands that remain bound to the VEGFR-2 coated plates are detected using an anti-myc antibody conjugated to a readily detectable label e.g., horseradish peroxidase. Binding affinities (EC50) can be calculated as the concentration of competing VEGFR IgG fusion protein that results in half maximal binding. These values can be compared with those obtained from analysis of VEGF-A, VEGF-C or VEGF-D to determine changes in binding affinity of one or more of the VEGFRs. Similarly, binding to VEGFR-3 is accomplished by using a VEGFR-3 IgG fusion protein, and binding to VEGFR- 1 is determined using a VEGFR- 1 IgG fusion protein.

Therapeutic Uses for the VEGFR-2 Specific Ligands

[00186] VEGFR-2 specific ligands are contemplated has having comparable therapeutic potential as VEGF-A. VEGF-A has played a therapeutic role in various cardiovascular disorders. It has been shown that intraarterial or intramuscular administration of VEGF-A significantly augments perfusion and development of collateral vessels in a rabbit model where chronic ischemia was created by surgical removal of the femoral artery (Takeshita et al., J. Clin. Invest., 93 :662-670, 1994; Takeshita et al, Circulation, 90:228-234, 1994). These studies provided angiographic evidence of neovascularization in the ischemic limbs. Other studies have shown that VEGF-A administration also leads to a recovery of normal endothelial reactivity in dysfunctional endothelium (Sellke et al., Am. J. Physiol,

262:H1669-1675, 1992; Bauters et al, Circulation, 91 :2793-2801, 1995). Isner et al, (Hum. Gene Ther., 7:859-888, 1996) tested the hypothesis that treatment with VEGF-A results in therapeutically significant angiogenesis in a gene therapy trial in patients with severe limb ischemia. Arterial gene transfer of naked plasmid DNA encoding VEGF-A applied to the hydrogel polymer coating of an angioplasty balloon resulted in angiographic and histological evidence in the knee, midtibial, and ankle. Bauters et al., (Am. J. Physiol, 267:H1263-1271, 1994) have shown that both maximal flow velocity and maximal blood flow are significantly increased in ischemic limbs after VEGF-A administration. It has also been demonstrated that after VEGF-A administration, increased blood flow occurred in a dog model of coronary insufficiency (Banai et al., Circulation, 89:2189-2189, 1994). These observations provide an indication that the VEGFR-2 specific ligands described herein may be used to treat or prevent various cardiovascular disorders through therapeutic angiogenesis.

[00187] In some embodiments, described herein is the use of the VEGFR-2 specific ligands or host cells described herein in the manufacture of a medicament for the treatment of disorders including but not limited to disorders characterized by insufficient or undesirable endothelial cell proliferation and/or disorders characterized by ischemia and/or vessel occlusion, wherein neovascularization is desirable.

[00188] VEGFR-2 specific ligands that only bind and stimulate VEGFR-2 activity may be used to treat wounds, surgical incisions, sores, and other indications where healing is reasonably expected to be promoted if the process of neovascularization can be induced and/or accelerated. In certain embodiments, such polypeptides can be used to improve healing of skin flaps or skin grafts following surgery as described in commonly owned, co- filed U.S. Patent Application No. 10/868,549, filed June 14, 2004, and International Patent Application No. PCT/US2004/019197, filed June 14, 2004, each incorporated herein by reference.

[00189] In addition, the expression of receptors for vascular endothelial growth factors have been observed in certain progenitor cells, such as hematopoietic and/or endothelial progenitor cells, and VEGF-C has been observed to have myelopoietic activity. These observations provide an indication that VEGFR-2 specific ligands may be used to treat or prevent inflammation, infection, or immune disorders by modulating the proliferation, differentiation and maturation, or migration of immune cells or hematopoietic cells. Thus, in another embodiment, described herein is a method of stimulating the proliferation of progenitor cells comprising contacting the progenitor cells with an amount of a VEGFR-2 specific ligand effective to stimulate the proliferation of progenitor cells. In one

embodiment, the contact step occurs ex vivo.

[00190] VEGFR-2 specific ligands may be useful for stimulating myelopoiesis (especially growth of neutrophilic granuloctyes) or inhibiting it. Overexpression of VEGF-C in the skin of K14 VEGF-C transgenic mice correlates with a distinct alteration in leukocyte populations [see International Publication W098/33917, incorporated herein by reference]. Notably, the measured populations of neutrophils were markedly increased in the transgenic mice. The effects of the VEGFR-2-specific ligands on hematopoiesis can be analyzed using

fluorescence activated cell sorting analysis using antibodies that recognize proteins expressed on specific leukocyte cell populations. Leukocyte populations are analyzed in blood samples taken from the transgenic mice, and from their non transgenic littermates. Alterations in leukocyte populations has numerous therapeutic indications, such as stimulating an immune response to pathogens, recovery of the immune system following chemotherapy or other suppressive therapy, or in the case of inhibitors, beneficial immunosuppression (e.g., to prevent graft-versus-host-disease or autoimmune disorders.) Use of VEGFR-2 specific ligands for these therapeutic indications is specifically contemplated. Use of antibodies that recognize various stem cell or progenitor cell populations permits evaluation of the effect of VEGFR-2 specific ligands on such cell types.

[00191] Thus, described herein is a method for modulating myelopoiesis in a mammalian subject comprising administering to a mammalian subject in need of modulation of myelopoiesis an amount of a VEGFR-2 specific ligand that is effective to modulate myelopoiesis. In one embodiment, a mammalian subject suffering from granulocytopenia is selected, and the method comprises administering to the subject an amount of a polypeptide effective to stimulate myelopoiesis. In particular, a VEGFR-2 specific ligand is administered in an amount effective to increase the neutrophil count in blood of the subject.

[00192] In a related embodiment, described herein is a method of increasing the number of neutrophils in the blood of a mammalian subject comprising the step of expressing in a cell in a subject in need of an increased number of blood neutrophils a DNA encoding a VEGFR-2 specific ligand that is able to activate signaling through VEGFR-2, the DNA operatively linked to a promoter or other control sequence that promotes expression of the DNA in the cell. Similarly, the described herein is a method of modulating the growth of neutrophilic granulocytes in vitro or in vivo comprising the step of contacting mammalian stem cells with a VEGFR-2 specific ligand in an amount effective to modulate the growth of mammalian endothelial cells.

[00193] Also described herein is a method for modulating the growth of mammalian CD34 ⁺ progenitor cells (especially hematopoietic progenitor cells and endothelial progenitor cells, such as CD34 ⁺ /VEGFR-2 ⁺ or CD133+/VEGFR2+ cells) in vitro or in vivo comprising the step of contacting mammalian CD34+ progenitor cells with a VEGFR-2 specific ligand in an amount effective to modulate the growth and/or differentiation of such cells (Peichev et al, Blood, 95:952-958, 2000; Salven et al., Blood, 168-172, 2003). For in vitro methods, CD34+ progenitor cells isolated from cord blood or bone marrow are specifically contemplated. Further isolation of the CD133+/VEGFR2+ subfractions are also contemplated. In vitro and in vivo methods for stimulating the growth of CD34+ precursor cells also include methods wherein the VEGFR-2 specific ligands are employed together (simultaneously or sequentially) with other polypeptide factors for the purpose of modulating

hematopoiesis/myelopoiesis or endothelial cell proliferation. Such other factors include, but are not limited to colony stimulating factors ("CSFs," e.g., granulocyte CSF (G CSF), macrophage CSF (M CSF), and granulocyte macrophage CSF (GM CSF)), interleukin 3 (IL 3, also called multi colony stimulating factor), other interleukins, stem cell factor (SCF), other polypeptide factors, and their analogs that have been described and are known in the art. See generally The Cytokine Handbook, Second Ed., Angus Thomson (editor), Academic Press (1996); Callard and Gearing, The Cytokine FactsBook, Academic Press Inc. (1994); and Cowling and Dexter, TIBTECH, 10(10):349 357 (1992). The use of a VEGFR-2 specific ligand as a progenitor cell or myelopoietic cell growth factor or co-factor with one or more of the foregoing factors may potentiate previously unattainable myelopoietic or differentiation effects and/or potentiate previously attainable myelopoietic or differentiation effects while using less of the foregoing factors than would be necessary in the absence of a VEGFR-2 specific ligand.

[00194] VEGFR-2 specific ligands may also be used in the treatment of lung disorders to improve blood circulation in the lung and/or gaseous exchange between the lungs and the blood stream; to improve blood circulation to the heart and 0 ₇ gas permeability in cases of cardiac insufficiency; to improve blood flow and gaseous exchange in chronic obstructive airway disease; and to treat conditions such as congestive heart failure, involving

accumulations of fluid in, for example, the lung resulting from increases in vascular permeability, by exerting an offsetting effect on vascular permeability in order to counteract the fluid accumulation.

[00195] VEGFR-2 specific ligands that bind but do not stimulate signaling be used to treat chronic inflammation caused by increased vascular permeability, retinopathy associated with diabetes, rheumatoid arthritis and psoriasis. VEGFR-2 specific ligands that are able to inhibit the function of VEGFR-2 can also be used to treat edema, peripheral arterial disease, Kaposi's sarcoma, or abnormal retinal development in premature newborns. [00196] In another embodiment, described herein is a method for modulating the growth of endothelial cells in a mammalian subject comprising the steps of exposing mammalian endothelial cells to a VEGFR-2 specific ligand in an amount effective to modulate the growth of the mammalian endothelial cells. In one embodiment, the modulation of growth is affected by using a polypeptide capable of stimulating tyrosine phosphorylation of VEGFR-2 in a host cell expressing the VEGFR-2. In modulating the growth of endothelial cells, the modulation of endothelial cell related disorders is also contemplated. In a preferred embodiment, the subject, and endothelial cells, are human. The endothelial cells may be provided in vitro or in vivo, and they may be contained in a tissue graft. An effective amount of a VEGFR-2 specific ligand is an amount necessary to achieve a reproducible change in cell growth rate (as determined by microscopic or macroscopic visualization and estimation of cell doubling time, or nucleic acid synthesis assays).

[00197] Since angiogenesis and neovascularization are essential for tumor growth, inhibition of angiogenic activity can prevent further growth and even lead to regression of solid tumors. VEGFR-2 specific ligands, when conjugated to a cytotoxic agent may be used to treat neoplasias including sarcomas, melanomas, carcinomas, and gliomas by inhibiting tumor angiogenesis. Thus, it is contemplated that a wide variety of cancers may be treated using the VEGFR-2 specific ligands including cancers of the brain (glioblastoma, astrocytoma, oligodendroglioma, ependymomas), lung, liver, spleen, kidney, lymph node, pancreas, small intestine, blood cells, colon, stomach, breast, endometrium, prostate, testicle, ovary, skin, head and neck, esophagus, bone marrow, blood or other tissue.

[00198] In many contexts, it is not necessary that the tumor cell be killed or induced to undergo normal cell death or "apoptosis." Rather, to accomplish a meaningful treatment, all that is required is that the tumor growth be slowed to some degree or localized to a specific area and inhibited from spread to disparate sites. It may be that the tumor growth is completely blocked, however, or that some tumor regression is achieved. Clinical terminology such as "remission" and "reduction of tumor" burden also are contemplated given their normal usage. In the context of the present disclosure, the therapeutic effect may result from an inhibition of angiogenesis.

[00199] VEGF-C and VEGF-D of the VEGF family of growth factors have utility for preventing stenosis or restenosis of blood vessels. See International Patent Application No. PCT/US99/24054 (WO 00/24412), "Use of VEGF-C or VEGF-D Gene or Protein to Prevent Restenosis," filed October 26, 1999, incorporated herein by reference in its entirety. As discussed therein, VEGF-A also has been tested to inhibit restenosis. VEGF-A accelerates reendotheliazation and has been found to attenuate intimal hyperplasia in balloon-injured rat carotid artery or rabbit aorta (Asahara et al., Circulation, 92:2802-2809, 1995; Callow et al., Growth Factors, 10:223-228, 1994). The VEGFR-2 specific ligands described herein also will have utility for these indications and can substitute for (or be used together with) VEGF- A, VEGF-C and VEGF-D with respect to the materials and methods described therein. Thus, in another aspect, the described herein is a method of treating a mammalian subject to prevent stenosis or restenosis of a blood vessel, comprising the step of administering to a mammalian subject in need of treatment to prevent stenosis or restenosis of a blood vessel a composition comprising one or more VEGFR-2 specific ligands described herein, in an amount effective to prevent stenosis or restenosis of the blood vessel. In one embodiment, the administering comprises implanting an intravascular stent in the mammalian subject, where the stent is coated or impregnated with the composition. Exemplary materials for constructing a drug- coated or drug-impregnated stent are described in literature cited above and reviewed in Lincoff et al, Circulation, 90: 2070-2084 (1994). In another embodiment, the composition comprises microparticles composed of biodegradable polymers such as PGLA,

non-degradable polymers, or biological polymers (e.g., starch) which particles encapsulate or are impregnated by a VEGFR-2 specific ligand. Such particles are delivered to the intravascular wall using, e.g., an infusion angioplasty catheter. Other techniques for achieving locally sustained drug delivery are reviewed in Wilensky et al, Trends Caridovasc. Med., 3: 163-170 (1993), incorporated herein by reference. Such materials and devices are themselves aspects of the invention.

[00200] Administration via one or more intravenous injections concurrent with or subsequent to the angioplasty or bypass procedure also is contemplated. Localization of the VEGFR-2 specific ligands to the site of the procedure occurs due to expression of VEGF receptors on proliferating endothelial cells. Localization is further facilitated by

recombinantly expressing the polypeptides of the invention as a fusion polypeptide (e.g., fused to an apolipoprotein B-100 oligopeptide as described in Shih et al, Proc. Natl Acad. Sci. USA, 87: 1436-1440 (1990). Co-administration of VEGFR-2 specific ligands is also contemplated.

[00201] Likewise, described herein are surgical devices that are used to treat circulatory disorders, such as intravascular or endovascular stents (U.S. Patent Nos. 6,846,323 and 4,580,568), balloon catheters (U.S. Patent No. 6,238,401), infusion-perfusion catheters (U.S. Patent No. 5,713,860), extravascular collars (International Patent Publications WO 98/20027 and WO 99/55315), elastomeric membranes, and the like, which have been improved by coating with, impregnating with, adhering to, or encapsulating within the device a composition comprising a VEGFR-2 specific ligand(s).

[00202] VEGFR-2 specific ligands described herein can be administered purely as a prophylactic treatment to inhibit stenosis, or shortly before, and/or concurrently with, and/or shortly after a percutaneous transluminal coronary angioplasty procedure, for the purpose of inhibiting restenosis of the subject vessel. In another embodiment, the VEGFR-2 specific ligand is administered before, during, and/or shortly after a bypass procedure (e.g., a coronary bypass procedure) or other vessel graft, to prevent stenosis or restenosis in or near the transplanted (grafted) vessel, especially stenosis at the location of the graft itself. In yet another embodiment, the VEGFR-2 specific ligand is administered before, during, or after a vascular transplantation in the vascular periphery that has been performed to treat peripheral ischemia or intermittent claudication. By inhibition of stenosis or restenosis is meant prophylactic treatment to reduce the amount/severity of, and/or substantially eliminate, the stenosis or restenosis that frequently occurs in such surgical procedures. The VEGFR-2 specific ligand is included in the composition in an amount and in a form effective to promote stimulation of VEGF receptors in a blood vessel of the mammalian subject, thereby preventing stenosis or restenosis of the blood vessel.

[00203] The mammalian subject in some embodiments is a human subject. For example, in some embodiments, the subject is a human suffering from coronary artery disease that has been identified by a cardiologist as a candidate who could benefit from a therapeutic balloon angioplasty (with or without insertion of an intravascular stent) procedure or from a coronary bypass procedure. Practice of methods of the invention in other mammalian subjects, especially mammals that are conventionally used as models for demonstrating therapeutic efficacy in humans (e.g., primate, porcine, canine, or rabbit animals), also is contemplated.

[00204] The VEGFR-2 specific ligands described herein may be used to modulate the growth of isolated cells or cell lines. For example, certain neoplastic disease states are characterized by the appearance of VEGF receptors on cell surfaces [Valtola et ah, Am J Path 154: 1381-90 (1999)]. VEGFR-2 specific ligands may be screened to determine the ability of the polypeptide to modulate the growth of the neoplastic cells. Other disease states are likely characterized by mutations in VEGF receptors [Ferrell et at, Hum Mol Genetics 7:2073-78 (1998)]. VEGFR-2 specific ligands that modulate the activity of the mutant forms of the VEGF receptor in a manner different than naturally occurring vascular endothelial growth factors will be useful at modulating the symptoms and severity of such disease states.

[00205] VEGFR-2 specific ligands may be used to modulate the growth of stem cells, progenitor cells for various tissues, and primary cell isolates that express receptor for the polypeptides. Various neural cells express one or more of the VEGF receptors (e.g., VEGFR-1, VEGFR-2 and neuropilin-1) and can thus directly respond to VEGF-A released by neighboring neural cells (Oosthuyse et al., Nat. Genet., 28: 131-138, 2001; Sondell et al., J. Neurosci., 19-5731-5740, 1999; Sondell et al, Neuroreport, 12: 105-108, 2001). For instance, VEGF-A stimulates axonal outgrowth in explant cultures of retinal or superior cervical and dorsal root ganglia. Furthermore, under conditions of hypoxic, excitotoxic, or oxidative stress, VEGF-A increases the survival of hippocampal, cortical, cerebellar granule, dopaminergic, autonomic, and sensory neurons. VEGF-A also stimulates the growth and survival of Schwann cells in hypoxic conditions, and increases proliferation and migration of astrocytes and microglial cells (Silverman et al., Neuroscience, 90: 1529-1541, 1999; Krum et al., Neuroscience, 110:589-604, 2002; and Forstreuter et al, J. Neuroimmunol, 132:93-98, 2002). These observations provide an indication for use of the VEGFR-2 specific ligands described herein to treat or prevent or slow the progression of neurodegenerative disorders.

[00206] As indicated herein above, and discussed further in U.S. Patent Application No. 10/669, 176, filed September 23, 2003, VEGF-C compositions are useful in the treatment of neurological disorders. Compositions comprising the VEGFR-2 specific ligand(s) described herein are useful in the treatment of such disorders either alone or in conjunction with additional therapeutics, such as a neural growth factor. Exemplary neural growth factors include, but are not limited to, interferon gamma, nerve growth factor, epidermal growth factor (EGF), basic fibroblast growth factor (bFGF), neurogenin, brain derived neurotrophic factor (BDNF), thyroid hormone, bone morphogenic proteins (BMPs), leukemia inhibitory factor (LIF), sonic hedgehog, and glial cell line-derived neurotrophic factor (GDNF), vascular endothelial growth factor (VEGF), interleukins, interferons, stem cell factor (SCF), activins, inhibins, chemokines, retinoic acid and ciliary neurotrophic factor (CNTF).

[00207] In some embodiments, such methods are performed wherein the subject has a disease or condition characterized by aberrant growth of neuronal cells, neuronal scarring and damage or neural degeneration. A disease or medical disorder is considered to be nerve damage if the survival or function of nerve cells and/or their axonal processes is

compromised. Such nerve damage occurs as the result of conditions including: physical injury, which causes the degeneration of the axonal processes and/or nerve cell bodies near the site of the injury; ischemia, as a stroke; exposure to neurotoxins, such as the cancer and AIDS chemotherapeutic agents such as cisplatin and dideoxycytidine (ddC), respectively; chronic metabolic diseases, such as diabetes or renal dysfunction; and neurodegenerative diseases such as Parkinson's disease, Alzheimer's disease, and Amyotrophic Lateral Sclerosis (ALS), which cause the degeneration of specific neuronal populations. Conditions involving nerve damage include Parkinson's disease, Alzheimer's disease, Amyotrophic Lateral Sclerosis, stroke, diabetic polyneuropathy, toxic neuropathy, glial scar, and physical damage to the nervous system such as that caused by physical injury of the brain and spinal cord or crush or cut injuries to the arm and hand or other parts of the body, including temporary or permanent cessation of blood flow to parts of the nervous system, as in stroke.

[00208] In one embodiment, the disease or condition being treated is a neurodegenerative disorder, wherein the neurodegenerative disorder is selected from the group consisting of Alzheimer's disease, Parkinson's disease, Huntington's disease, motor neuron disease, Amyotrophic Lateral Sclerosis (ALS), dementia and cerebral palsy. In another embodiment, the disease or condition is selected from the group consisting of neural trauma or neural injury. Methods described herein also can be performed to treat or ameliorate the effects of neural trauma or injury, such as injury related to stroke, spinal cord injury, post-operative injury, brain ischemia and other traumas.

[00209] The VEGF -2 specific licands described herein can be used to treat one or more adverse consequences of central nervous system injury that arise from a variety of conditions. Thrombus, embolus, and systemic hypotension are among the most common causes of stroke. Other injuries may be caused by hypertension, hypertensive cerebral vascular disease, rupture of an aneurysm, an angioma, blood dyscrasia, cardiac failure, cardiac arrest, cardiogenic shock, kidney failure, septic shock, head trauma, spinal cord trauma, seizure, bleeding from a tumor, or other loss of blood volume or pressure. These injuries lead to disruption of physiologic function, subsequent death of neurons, and necrosis (infarction) of the affected areas. The term "stroke" connotes the resulting sudden and dramatic neurologic deficits associated with any of the foregoing injuries.

[00210] The terms "ischemia" or "ischemic episode," as used herein, means any circumstance that results in a deficient supply of blood to a tissue. Thus, a central nervous system ischemic episode results from an insufficiency or interruption in the blood supply to any locus of the brain such as, but not limited to, a locus of the cerebrum, cerebellum or brain stem. The spinal cord, which is also a part of the central nervous system, is equally susceptible to ischemia resulting from diminished blood flow. An ischemic episode may be caused by a constriction or obstruction of a blood vessel, as occurs in the case of a thrombus or embolus. Alternatively, the ischemic episode may result from any form of compromised cardiac function, including cardiac arrest, as described above. Where the deficiency is sufficiently severe and prolonged, it can lead to disruption of physiologic function, subsequent death of neurons, and necrosis (infarction) of the affected areas. The extent and type of neurologic abnormality resulting from the injury depend on the location and size of the infarct or the focus of ischemia. Where the ischemia is associated with a stroke, it can be either global or focal in extent.

[00211] The VEGF -2 specific ligands described herein will also be useful for treating traumatic injuries to the central nervous system that are caused by mechanical forces, such as a blow to the head. Trauma can involve a tissue insult selected from abrasion, incision, contusion, puncture, compression, etc., such as can arise from traumatic contact of a foreign object with any locus of or appurtenant to the mammalian head, neck or vertebral column. Other forms of traumatic injury can arise from constriction or compression of mammalian CNS tissue by an inappropriate accumulation of fluid (e.g., a blockade or dysfunction of normal cerebrospinal fluid or vitreous humour fluid production, turnover or volume regulation, or a subdural or intracranial hematoma or edema). Similarly, traumatic constriction or compression can arise from the presence of a mass of abnormal tissue, such as a metastatic or primary tumor.

[00212] It is further contemplated that methods of the invention directed to neurological indications can be practiced by co-administering a VEGFR-2 specific ligand with a neurotherapeutic agent. By "neurotherapeutic agent" is meant an agent used in the treatment of neurodegenerative diseases or to treat neural trauma and neural injury. Exemplary neurotherapeutic agents include tacrine (Cognex), donepezil (Aricept), rivastigmine (Exelon), galantamine (Reminyl), and cholinesterase inhibitors and anti-inflammatory drugs, which are useful in the treatment of Alzheimer's disease as well as other neurodegenerative diseases.

[00213] Additional neurotherapeutic agents include anti-cholinergics, dopamine agonists, catechol-O-methyl-transterases (COMTs), amantadine (Symmetrel), Sinemet®, Selegiline, carbidopa, ropinirole (Requip), coenzyme Q10, Pramipexole (Mirapex) and levodopa (L- dopa), which are useful in the treatment of Parkinson's disease as well as other

neurodegenerative diseases. Other therapeutics agents for the treatment of neurological disorders will be known to those of skill in the art and may be useful in the combination therapies contemplated herein.

[00214] Pharmaceutical Formulation and Routes of Administration

[00215] VEGFR-2 specific ligands may be administered in any suitable manner using an appropriate pharmaceutically acceptable vehicle, e.g., a pharmaceutically acceptable diluent, adjuvant, excipient or carrier. Liquid, semisolid, or solid diluents that serve as

pharmaceutical vehicles, excipients, or media are preferred. Any diluent known in the art may be used. Exemplary diluents include, but are not limited to, water, saline solutions, polyoxyethylene sorbitan monolaurate, magnesium stearate, methyl and

propylhydroxybenzoate, talc, alginates, starches, lactose, sucrose, dextrose, sorbitol, mannitol, glycerol, calcium phosphate, mineral oil, and cocoa butter. Such formulations are useful, e.g., for administration of the VEGFR-2 specific ligands described herein to mammalian (including human) subjects in therapeutic regimens.

[00216] In some embodiments, the composition to be administered according to methods described herein comprises (in addition to the polynucleotide or vector) a pharmaceutically acceptable carrier solution such as water, saline, phosphate buffered saline, glucose, or other carriers conventionally used to deliver therapeutics intravascularly.

[00217] The "administering" that is performed according to the present method may be performed using any medically-accepted means for introducing a therapeutic directly or indirectly into the vasculature of a mammalian subject, including but not limited to injections (e.g., intravenous, intramuscular, subcutaneous, or catheter); oral ingestion; intraocular (e.g., via eye drops) intranasal or topical administration; and the like. In one embodiment, administration of the composition comprising a VEGFR-2 specific ligand is performed intravascularly, such as by intravenous, intra-arterial, or intracoronary arterial injection. The therapeutic composition may be delivered to the subject at multiple sites. The multiple administrations may be rendered simultaneously or may be administered over a period of several hours. In certain cases it may be beneficial to provide a continuous flow of the therapeutic composition. Additional therapy may be administered on a period basis, for example, daily, weekly or monthly. To minimize angiogenic side effects in non-target tissues, preferred methods of administration are methods of local administration, such as administration by intramuscular injection. [00218] In general, peroral dosage forms for the therapeutic delivery of polypeptides is ineffective because in order for such a formulation to the efficacious, the peptide must be protected from the enzymatic environment of the gastrointestinal tract. Additionally, the polypeptide must be formulated such that it is readily absorbed by the epithelial cell barrier in sufficient concentrations to effect a therapeutic outcome. The VEGFR-2 specific ligands described herein may be formulated with uptake or absorption enhancers to increase their efficacy. Such enhancer include for example, salicylate, glycocholate/linoleate, glycholate, aprotinin, bacitracin, SDS caprate and the like. An additional detailed discussion of oral formulations of peptides for therapeutic delivery is found in Fix, J. Pharm. Sci., 85(12) 1282 1285, 1996, and Oliyai and Stella, Ann. Rev. Pharmacol. Toxicol., 32:521 544, 1993, both incorporated by reference.

[00219] The amounts of peptides in a given dosage will vary according to the size of the individual to whom the therapy is being administered as well as the characteristics of the disorder being treated. In exemplary treatments, it may be necessary to administer about 50mg/day, 75 mg/day, lOOmg/day, 150mg/day, 200 mg/day, 250 mg/day. These concentrations may be administered as a single dosage form or as multiple doses per day. In some embodiments, the treatment regimen comprises administration of the VEGFR-2 specific ligand in a dose of about 0.5 μg to about 50 μg multiple times per day.

[00220] In gene therapy embodiments employing viral delivery, the unit dose may be calculated in terms of the dose of viral particles being administered. Viral doses include a particular number of virus particles or plaque forming units (pfu). For embodiments involving adenovirus, particular unit doses include 10 ³ , 10 ⁴ , 10 ⁵ , 10 ⁶ , 10 ⁷ , 10 ⁸ , 10 ⁹ ' 10 ¹⁰ , 10 ¹¹ , 10 ¹² , 10 ¹³ or 10 ¹⁴ pfu. Particle doses may be somewhat higher (10 to 100 fold) due to the presence of infection-defective particles.

[00221] The polypeptides may also be employed in accordance with the present invention by expression of such polypeptide in vivo, which is often referred to as gene therapy. The present invention provides a recombinant DNA vector containing a heterologous segment encoding a VEGFR-2 specific ligand that is capable of being inserted into a microorganism or eukaryotic cell and that is capable of expressing the encoded VEGFR-2 specific ligand.

[00222] In a preferred embodiment, the composition is administered locally. Thus, in the context of treating restenosis or stenosis, administration directly to the site of angioplasty or bypass is preferred. For example, in some embodiments, the administering comprises a catheter mediated transfer of the transgene containing composition into a blood vessel of the mammalian subject, especially into a coronary artery of the mammalian subject. Exemplary materials and methods for local delivery are reviewed in Lincoff et al., Circulation, 90: 2070 2084 (1994); and Wilensky et al., Trends Cardiovasc. Med., 3: 163 170 (1993), both incorporated herein by reference. For example, in some embodiments, the composition is administered using infusion perfusion balloon catheters (preferably microporous balloon catheters) such as those that have been described in the literature for intracoronary drug infusions. See, e.g., U.S. Patent No. 5,713,860 (Intravascular Catheter with Infusion Array); U.S. Patent No. 5,087,244; U.S. Patent No. 5,653,689; and Wolinsky et al, J. Am. Coll. Cardiol., 15: 475 481 (1990) (Wolinsky Infusion Catheter); and Lambert et al., Coron. Artery Dis., 4: 469 475 (1993), all of which are incorporated herein by reference in their entirety. Use of such catheters for site directed somatic cell gene therapy is described, e.g., in Mazur et al., Texas Heart Institute Journal, 21; 104 1 11 (1994), incorporated herein by reference. In an embodiment where the transgene encoding a VEGFR-2 specific ligand is administered in an adenovirus vector, the vector is preferably administered in a pharmaceutically acceptable carrier at a dose of 10 ⁸ to 10 ¹⁴ viral particles, and more preferably at a dose of 10 ⁸ to 10 ¹⁰ viral particles. The adenoviral vector composition preferably is infused over a period of 15 seconds to 30 minutes, more preferably 1 to 10 minutes.

[00223] For example, in subjects with angina pectoris due to a single or multiple lesions in coronary arteries and for whom PTCA is prescribed on the basis of primary coronary angiogram findings, an exemplary protocol involves performing PTCA through a 7F guiding catheter according to standard clinical practice using the femoral approach. If an optimal result is not achieved with PTCA alone, then an endovascular stent also is implanted. (A nonoptimal result is defined as residual stenosis of > 30 % of the luminal diameter according to a visual estimate, and B or C type dissection.) Arterial gene transfer at the site of balloon dilatation is performed with a replication deficient adenoviral vector expressing a VEGFR-2 specific ligand immediately after the angioplasty, but before stent implantation, using an infusion perfusion balloon catheter. The size of the catheter will be selected to match the diameter of the artery as measured from the angiogram, varying, e.g., from 3.0 to 3.5F in diameter. The balloon is inflated to the optimal pressure and gene transfer is performed during a 10 minute infusion at the rate of 0.5 ml/min with virus titer of 1.15 X 10 ¹⁰ pfu/ml.

[00224] In another embodiment, intravascular administration with a gel coated catheter is contemplated, as has been described in the literature to introduce other transgenes. See, e.g., U.S. Patent No. 5,674, 192 (Catheter coated with tenaciously adhered swellable hydrogel polymer); Riessen et al., Human Gene Therapy, 4: 749 758 (1993); and Steg et al,

Circulation, 96: 408 41 1 (1997) and 90: 1648 1656 (1994); all incorporated herein by reference. Briefly, DNA in solution (e.g., a polynucleotide of the invention) is applied one or more times ex vivo to the surface of an inflated angioplasty catheter balloon coated with a hydrogel polymer (e.g., Slider with Hydroplus, Mansfield Boston Scientific Corp.,

Watertown, MA). The Hydroplus coating is a hydrophilic polyacrylic acid polymer that is cross linked to the balloon to form a high molecular weight hydrogel tightly adhered to the balloon. The DNA covered hydrogel is permitted to dry before deflating the balloon. Re- inflation of the balloon intravascularly, during an angioplasty procedure, causes the transfer of the DNA to the vessel wall.

[00225] In yet another embodiment, an expandable elastic membrane or similar structure mounted to or integral with a balloon angioplasty catheter or stent is employed to deliver the transgene encoding a polypeptide of the invention. See, e.g., U.S. Patent Nos. 5,707,385, 5,697,967, 5,700,286, 5,800,507, and 5,776, 184, all incorporated by reference herein.

[00226] In yet another embodiment, the composition containing the VEGFR-2 specific ligands are administered by intramuscular injection. See e.g., Shyu et al, Am. J. Med., 114:85-92 (2002); Freedman et al., Hum. Gene Ther., 13: 1595-1603 (2002). Injection of the VEGFR-2 specific ligands into muscle tissue including, but not limited to, cardiac tissue, and muscle tissue in the arms, legs, buttocks, abdominal areas of the human subject are specifically contemplated.

[00227] The VEGFR-2 specific ligands can also be administered by a transdermal patch. The thickness of the transdermal patch depends on the therapeutic requirements and may be adapted accordingly. Transdermal patches represent an alternative to the liquid forms of application. These devices can come in a variety of forms, all having the capability of adhering to the skin, and thereby permitting prolonged contact between the therapeutic composition and the target area. They also have the advantage of being relatively compact and portable, and permitting very precise delivery of a composition to the area to be treated. These patches come in a variety of forms, some containing fluid reservoirs for the active component, others containing dry ingredients that are released upon contact with moisture in the skin. Many require some form of adhesive to retain them in connection with the skin for an adequate period. A different type of patch is applied dry, with water applied to wet the patch to form a sticky film that is retained on the skin [00228] As used herein "patch" comprises at least a topical composition described herein, a covering layer, such that, the patch can be placed over a surgically closed wound, incision, skin flap, skin graft, or burn, thereby positioning the patch/composition adjacent to the compromised tissue surface. Preferably, the patch is designed to maximize composition delivery through the stratum corneum, upper epidermis, and into the dermis, and to minimize absorption into the circulatory system, reduce lag time, promote uniform absorption, and reduce mechanical rub-off.

[00229] Preferred patches include (1) the matrix type patch; (2) the reservoir type patch; (3) the multi-laminate drug- in-adhesive type patch; and (4) the monolithic drug-in-adhesive type patch; (Ghosh, T. K., et al, Transdermal and Topical Drug Delivery Systems,

Interpharm Press, Inc. p. 249-297 (1997) incorporated herein by reference). These patches are well known in the art and generally available commercially.

[00230] In another embodiment, a dressing for the delivery of a composition comprising the VEGFR-2 specific ligands is provided. The term "dressing", as used herein, means a covering designed to protect and or deliver a (previously applied) composition. "Dressing" includes coverings such as a bandage, which may be porous or non-porous and various inert coverings, e.g., a plastic film wrap or other non-absorbent film. The term "dressing" also encompasses non-woven or woven coverings, particularly elastomeric coverings, which allow for heat and vapor transport. These dressings allow for cooling of the pain site, which provides for greater comfort.

[00231] In another embodiment, a surgical suturing thread impregnated with VEGFR-2 specific ligand(s) is provided.

[00232] In another variation, the composition containing the transgene encoding a VEGFR-2 specific ligand is administered extravascularly, e.g., using a device to surround or encapsulate a portion of vessel. See, e.g., International Patent Publication WO 98/20027, incorporated herein by reference, describing a collar that is placed around the outside of an artery (e.g., during a bypass procedure) to deliver a transgene to the arterial wall via a plasmid or liposome vector.

[00233] In still another variation, endothelial cells or endothelial progenitor cells are transfected ex vivo with the transgene encoding a VEGFR-2 specific ligand, and the transfected cells as administered to the mammalian subject. Exemplary procedures for seeding a vascular graft with genetically modified endothelial cells are described in U.S. Patent No. 5,785,965, incorporated herein by reference.

[00234] Other non-viral delivery mechanisms contemplated include calcium phosphate precipitation (Graham and Van Der Eb, Virology, 52:456-467, 1973; Chen and Okayama, Mol. Cell Biol., 7:2745-2752, 1987; Rippe et al., Mol. Cell Biol., 10:689-695, 1990) DEAE- dextran (Gopal, Mol. Cell Biol, 5: 1 188-1 190, 1985), electroporation (Tur-Kaspa et al, Mol. Cell Biol., 6:716-718, 1986; Potter et al, Proc. Nat. Acad. Sci. USA, 81 :7161-7165, 1984), direct microinjection (Harland and Weintraub, J. Cell Biol, 101 : 1094-1099, 1985.), DNA- loaded liposomes (Nicolau and Sene, Biochim. Biophys. Acta, 721 : 185-190, 1982; Fraley et al., Proc. Natl. Acad. Sci. USA, 76:3348-3352, 1979; Feigner, Sci Am. 276(6): 102 6, 1997; Feigner, Hum Gene Ther. 7(15): 1791 3, 1996), cell sonication (Fechheimer et al, Proc. Natl. Acad. Sci. USA, 84:8463-8467, 1987), gene bombardment using high velocity

microprojectiles (Yang et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990), and receptor- mediated transfection (Wu and Wu, J. Biol. Chem., 262:4429-4432, 1987; Wu and Wu, Biochemistry, 27:887-892, 1988; Wu and Wu, Adv. Drug Delivery Rev., 12: 159-167, 1993).

[00235] The expression construct (or the polypeptide construct itself) may be entrapped in a liposome. Liposomes are vesicular structures characterized by a phospholipid bilayer membrane and an inner aqueous medium. Multilamellar liposomes have multiple lipid layers separated by aqueous medium. They form spontaneously when phospholipids are suspended in an excess of aqueous solution. The lipid components undergo self-rearrangement before the formation of closed structures and entrap water and dissolved solutes between the lipid bilayers (Ghosh and Bachhawat, In: Liver diseases, targeted diagnosis and therapy using specific receptors and ligands, Wu G, Wu C ed., New York: Marcel Dekker, pp. 87-104, 1991). The addition of DNA to cationic liposomes causes a topological transition from liposomes to optically birefringent liquid-crystalline condensed globules (Radler et al., Science, 275(5301):810 4, 1997). These DNA-lipid complexes are potential non-viral vectors for use in gene therapy and delivery.

[00236] Liposome-mediated nucleic acid delivery and expression of foreign DNA in vitro has been successful. Also contemplated are various commercial approaches involving "lipofection" technology. In certain embodiments of the invention, the liposome may be complexed with a hemagglutinating virus (HVJ). This has been shown to facilitate fusion with the cell membrane and promote cell entry of liposome-encapsulated DNA (Kaneda et al., Science, 243:375-378, 1989). In other embodiments, the liposome may be complexed or employed in conjunction with nuclear nonhistone chromosomal proteins (HMG-1) (Kato et al., J. Biol. Chem., 266:3361-3364, 1991). In yet further embodiments, the liposome may be complexed or employed in conjunction with both HVJ and HMG-1. In that such expression constructs have been successfully employed in transfer and expression of nucleic acid in vitro and in vivo, then they are applicable for the present invention.

[00237] Other vector delivery systems that can be employed to deliver a nucleic acid encoding a therapeutic gene into cells include receptor-mediated delivery vehicles. These take advantage of the selective uptake of macromolecules by receptor-mediated endocytosis in almost all eukaryotic cells. Because of the cell type-specific distribution of various receptors, the delivery can be highly specific (Wu and Wu, 1993, supra).

[00238] In other embodiments, the delivery vehicle may comprise a VEGFR-2 specific ligand and a liposome. For example, Nicolau et al. (Methods Enzymol., 149: 157-176, 1987) employed lactosyl-ceramide, a galactose-terminal asialganglioside, incorporated into liposomes and observed an increase in the uptake of the insulin gene by hepatocytes. Thus, it is feasible that a nucleic acid encoding a therapeutic gene also may be specifically delivered into a particular cell type by any number of receptor-ligand systems with or without liposomes.

[00239] In another embodiment, the expression construct may simply consist of naked recombinant DNA or plasmids. Transfer of the construct may be performed by any of the methods mentioned above that physically or chemically permeabilize the cell membrane. This is applicable particularly for transfer in vitro, however, it may be applied for in vivo use as well. Dubensky et al. (Proc. Nat. Acad. Sci. USA, 81 :7529-7533, 1984) successfully injected polyomavirus DNA in the form of CaP04 precipitates into liver and spleen of adult and newborn mice demonstrating active viral replication and acute infection. Benvenisty and Neshif (Proc. Nat. Acad. Sci. USA, 83:9551-9555, 1986) also demonstrated that direct intraperitoneal injection of CaP0 ₄ precipitated plasmids results in expression of the transfected genes.

[00240] Another embodiment for transferring a naked DNA expression construct into cells may involve particle bombardment. This method depends on the ability to accelerate DNA coated microprojectiles to a high velocity allowing them to pierce cell membranes and enter cells without killing them (Klein et al., Nature, 327:70-73, 1987). Several devices for accelerating small particles have been developed. One such device relies on a high voltage discharge to generate an electrical current, which in turn provides the motive force (Yang et al., Proc. Natl. Acad. Sci USA, 87:9568-9572, 1990). The microprojectiles used have consisted of biologically inert substances such as tungsten or gold beads.

[00241] In embodiments employing a viral vector, preferred polynucleotides include a suitable promoter and polyadenylation sequence as described above. Moreover, it will be readily apparent that, in these embodiments, the polynucleotide further includes vector polynucleotide sequences (e.g., adenoviral polynucleotide sequences) operably connected to the sequence encoding a VEGFR-2 specific ligand.

Kits

[00242] Also described herein are kits which comprise VEGFR-2 specific ligands (or compositions comprising the VEGFR-2 specific ligands) packaged in a manner which facilitates their use to practice methods described herein. In a simplest embodiment, such a kit includes aVEGFR-2 specific ligand or composition described herein as useful for practice the methods described herein, packaged in a container such as a sealed bottle or vessel, with a label affixed to the container or included in the package that describes the use of the VEGFR- 2 specific ligand or composition described herein. In some embodiments, the composition is packaged in a unit dosage form. In another embodiment, the kit includes a composition comprising a VEGFR-2 specific ligand packaged together with a physical device useful for implementing methods described herein, such as a stent, a catheter, an extravascular collar, a polymer film, a bandage, a suture or the like. In another embodiment, the kit includes compositions comprising a VEGFR-2 specific ligand packaged together with a hydrogel polymer, or microparticle polymers, or other carriers described herein as useful for delivery of the VEGFR-2 specific ligand to a subject in need thereof.

Examples

Example 1 - Identification of VEGF-D mutants

[00243] The identification of VEGF-D mutants that demonstrate angiogenic activity have been previously identified (Toivanen et al., J. Biol. Chem., 284: 16037-13048, 2009, incorporated herein by reference).

[00244] Briefly, the structural and functional properties of VEGF-D using homology modeling and site-directed mutagenesis was studied. VEGF-D contains an additional cysteine residue, Cys-25 (which corresponds to amino acid 117 of SEQ ID NO: 2), on its dimer interface when compared with the consensus sequence of VEGF family members. The mutation of Cys-1 17 to several other residues, such as Ala, He, Leu, or Val, enhanced the formation of disulfide-linked dimers.

[00245] For all of the truncated forms of VEGF -D disclosed herein, it is contemplated, in some embodiments, that the amino acid at position 117 of SEQ ID NO: 2 is deleted or replaced with such other amino acids described above.

Example 2 - Materials and Methods for Examples 2-7

[00246] Protein expression and purification: Drosophila S2 expression constructs for the N- and C-terminal variants of VEGF-D were obtained by cloning PC -amplified fragments of human VEGF-D cDNA (forward primers 5'-

CGGATCCATTTGCGGCAACTTTCTATGAC-3' for variant D89-195 (SEQ ID NO: 16), 5'- CGGATCCAACTTTCTATGACATTGAAACACT-3' for variant D92-195 (SEQ ID NO: 17) and 5'-CGGATCCAAAAGTTATAGATGAAGAATGGCAA-3' for variants D100-195 and D100-205 (SEQ ID NO: 18); reverse primers 5'-

TGAATTCAATGATGATGATGGTGATGGGCTGTTGGCAAGCACTTAC-3' for variants D89-195 (SEQ ID NO: 19), D92-195 and D100-195 and 5'-

CATCTAGATCAATGATGATGATGGTGGTGTCTTCTGATAATTGAGTAAGGATGG- 3' for variant D100-205 (SEQ ID NO: 20); template human VEGF-D cDNA containing the C I 17A mutation) as BamHI/blunt-end fragments into a Bglll/EcoRV-opened modified pMTBiP-V5His-C vector (Invitrogen) (23). The construct for the expression of wild type VEGF-D was used by Achen et al. (1998): a PCR fragment (primers 5'- GTCAAGCTTAATGATGATGATGGTGATGGGGGGCTGTTGGC-3' (SEQ ID NO: 21) and 5'-GAGGATCCGTCAGCATCC-3' (SEQ Id NO: 22), template: wild type human VEGF- D cDNA) was cloned into a pFASTBAC 1 vector (Invitrogen) that had been modified to contain the mellitin signal peptide and multiple cloning site from pVT-Bac (1,24). Viral stocks were generated and the protein was expressed in High Five cells. Protein purification was performed as described below for the proteins derived from S2 cells. Stably transfected S2 cell pools were prepared according to the instructions of the supplier (Invitrogen).

[00247] For protein expression, the S2 cells were adapted to suspension culture at 27°C and induced at a density of 2-4 x 10 ⁶ cells/ml for 5 days with 0.5 mM CuS0 ₄ . The conditioned medium was harvested by centrifugation and the VEGF-D variants were extracted by Ni ²⁺ -charged chelating sepharose (GE Healthcare) in batch. The resin was washed in PBS containing 15 mM imidazole and the proteins were eluted with 400 mM imidazole. Finally, the VEGF-D variants were purified by gel filtration on a Superdex 200 (GE Healthcare) column in HBS (10 mM HEPES, 0.1 M NaCl) at pH 7.5. VEGF-C was expressed and purified similarly (21). Soluble, Fc-tagged (human IgG) VEGFR-2 domains 2+3 (R2D23; residues 120 to 326 of SEQ ID NO: 6), VEGFR-3 domain 1 (R3D1, residues 1- 133 of SEQ ID NO: 10), VEGFR-3 domain 2 (R3D2, residues 132-229 of SEQ ID NO: 10), VEGFR-3 domains 1+2 (R3D12, residues 1-229 of SEQ ID NO: 10), VEGFR-3 domains 2+3 (R3D23, residues 132-329 of SEQ ID NO: 10), VEGFR-3 domains 1-3 (R3D1-3, residues 1- 329 of SEQ ID NO: 10) and VEGFR-3 domains 1-7 (D17Fc, residues 1-776 of SEQ ID NO: 10) were prepared as described (21). Fc-tagged VEGFR-l/VEGFR-3 chimera (R1/3D12) consists of VEGFR-1 Dl (residues 1-129 of SEQ ID NO: 10) and VEGFR-3 D2 (residues 134-228 of SEQ ID NO: 8). All the receptor constructs were expressed in Sf21 insect cell using baculovirus expression and were purified by Protein A-Sepharose (GE Healthcare) affinity step followed by gel filtration on a Superdex 200 column. A Factor Xa cleavage site allowed the proteolytic Fc-tag removal and the preparation of the monomeric VEGFR-3 D17 construct.

[00248] Reversed phase chromatography and N-terminal sequencing: Protein separation by reversed phase chromatography was performed on a 1 x 20mm TSKgel-250 TMS (ΙΟμιη, 250A) column using the ETTAN™ LC (GE Healthcare). Proteins were eluted with a linear gradient of acetonitrile (0-100% in 30min) in 0.1% trifluoroacetic acid. N-terminal sequencing of the proteins collected from reversed phase chromatography was performed with Edman degradation in a Procise 494A-HT sequencer (Applied Biosystems) on BioBrene Plus (Applied Biosystems) treated glass fiber filters. N-terminal sequencing confirmed the correct VEGF-D sequences and indicated N-terminal Pro (D100-195) and Asp-Pro from the linkers.

[00249] Recombinant AA V (rAA V) expression in vivo and immunohistochemistry of skeletal muscles: Production of the rAAVs (serotype 8) and the transduction of mouse (NMRI, females) tibialis anterior muscles were done essentially as described (11). The rAAVs tested encode the cDNAs of the major form of the mature human VEGF-D (residues 89-205 of SEQ ID NO: 2), the same VEGF-D with the Cys l 17Ala mutation and HSA, human serum albumin, as a control. For the analysis of the N-terminal deletion in vivo, the rAAVs used encode the cDNAs of the wild-type VEGF-D D89-195 and D100-195. Two weeks after transfection, the muscles were isolated and frozen in O.C.T (TissueTek, Sakura Finetek). Cryosections (8 μπι) were cut, acetone-fixed, and immunostained using the following antibodies: rat anti-PECAM- 1 (Pharmingen), goat anti-Prox-1 (R&D Systems), hamster anti- Podoplanin (Acris), mouse anti-smooth muscle actin (SMA)-Cy3 (Sigma) and rabbit anti- human LYVE-1. Secondary antibodies were Alexa Fluor-conjugated (Molecular Probes). Microvessel area density was quantified using ImageJ software (NIH). Results are presented as mean values ± SD, calculated using ANOVA for multiple comparisons.

[00250] Cell culture and the MTT assay: Porcine aortic endothelial (PAE) cells expressing VEGFR-2 or VEGFR-3 were a kind gift from Dr. Lena Claesson-Welsh (University of Uppsala) (25). Human dermal microvascular endothelial (HDME) cells were obtained from PromoCell. The BaF-hVEGFR-3 and BaF-m VEGFR-2 cell lines represent transfected derivatives of the murine pro-B cell line BaF (3, 1,6) which stably expresses a chimeric receptor containing the extracellular domain of human VEGFR-3 or VEGFR-2, respectively, fused to the transmembrane and cytoplasmic domains of the mouse erythropoietin receptor. These cells were maintained in DMEM containing 10 % FBS. For maintenance, the cell cultures were supplemented with 2 ng/mL murine IL-3 (Calbiochem) and 250 μg/ml Zeocin (Invitrogen). In the absence of IL-3, BaF-VEGFR-3 cells grow only in presence of VEGF-C or VEGF-D. The BaF/VEGFR cell survival was quantified using the mitochondrial MTT substrate, resulting in a color development (11). The survival of VEGFR-2/BaF cells (VEGF-A, VEGF-C or VEGF-D) was measured after incubation at 37oC for 48 h in the presence of the human VEGF-D variants up to 500 ng/ml.

[00251] Antibodies: The following primary antibodies were used in this study: mouse monoclonal 9D9F9 (9D9) or C-20 (Santa Cruz Biotechnology) against human VEGFR-3, goat polyclonal AF357 (R&D Systems) against human VEGFR-2, the VD1 antibody against human VEGF-D and G410 (Millipore) antibody against phosphotyrosines. (26,27).

[00252] Western blotting and immunoprecipitations: For the comparison of wt and Cys l l7Ala mutant forms of VEGF-D (residues 89-205) under reducing and non-reducing conditions, the constructs were transfected into 293T cells in D-MEM supplemented with 10% FCS. 24 hours later, the cell culture medium was replaced by D-MEM 0.2% BSA and 48 hours later the cell culture medium was harvested, cleared by centrifugation and immunoprecipitated with the VD 1 antibody. The immunoprecipitates were boiled for 5 min with non-reducing Laemmli sample buffer. After taking aliquots, β-mercaptoethanol was added to a final concentration of 2.5% and samples were boiled again for 5 minutes. Non- reducing and reducing samples were resolved by SDS-PAGE and visualized by Western blotting using the same antibody. [00253] For the VEGFR-2 and VEGFR-3 phoshorylation assays, the cells were lysed in 1 ml PLCLB lysis buffer (150 mM NaCl, 5 % glycerol, 1 % Triton X-100, 1.5 M MgC12, 50 mM HEPES, pH 7.5) supplemented with 1 mM vanadate, 2 mM phenylmethylsulphonyl fluoride (PMSF), 2 μ^πιΐ leupeptin and 0.07 U/ml aprotinin. Cleared lysates were incubated with 2 μg of primary antibody for 2 hours. Subsequently, the immunocomplexes were captured using protein G-sepharose, washed three times in the PLCLB buffer, and the proteins were separated by SDS-PAGE under reducing conditions. After blotting of the proteins to nitrocellulose membranes and blocking of the membranes in 5 % BSA, the filters were probed with the monoclonal antibodies (0.5 μ^ηιΐ) and the HRP -coupled secondary antibodies (Dako) were visualized by chemiluminescence (Pierce).

[00254] Affinity measurements: Isothermal calorimetric titrations of the binding of human VEGF-D (Cysl 17Ala) variants to the soluble, Fc-tagged VEGFR-2 domains 2+3 (D23), VEGFR-3 deletion mutants (domains 1-3; R3D1-R3D1-3), VEGFR- 1 -D l/VEGFR-3 -D2 chimera (R1/3D12) and to the untagged VEGFR-3 domains 1-7 (Dl-7), were carried out at 25°C using a VP-ITC calorimeter (MicroCal). To control for heat dilution effects, all the protein buffers were adjusted to HBS at pH 7.5. The receptor constructs were used in the calorimeter cell at a concentration of 5-8 μΜ, and the VEGF-D ligands in the syringe at a concentration of 0.10-0.20 mM. Following the ITC titrations, the samples were visually analyzed for aggregation. Data were processed using the MicroCal Origin 7.0 software.

[00255] Pulldown assay: Purified, soluble Fc-tagged VEGFR-2 (D23), VEGFR-3 deletion mutants (R3D1-D3D1-3) and the VEGFR- 1 -D l VEGFR-3 -D2 chimera (R1/3D12) were incubated with VEGF-D (Cysl 17Ala) D92-195 in molar excess (50 μg + 20 μg, respectively) at room temperature for 1 hour. Protein complexes were precipitated using Protein A- Sepharose (GE Healthcare) and the beads were collected with Ultrafree (Millipore) centrifugal filter units. Following a wash with PBS, the protein complexes were eluted with 0.2 M Glycine, pH 3.0 and analyzed by SDS-PAGE under reducing conditions. The gel was stained with Coomassie Blue.

[00256] Crystallization and structure determination: For crystallization, VEGF-D

(Cysl 17Ala) D92-195 was concentrated to 2 mg/ml and the buffer (HBS) was supplemented with 0.1 % (v/v) P8340 protease inhibitor cocktail (Sigma) and 0.01 % (w/v) NaN3.

Crystallization conditions were screened using the sitting-drop vapor-diffusion technique. A single VEGF-D crystal grew in 6 weeks at room temperature over a reservoir solution of 0.1 M phosphate/citrate buffer at pH 4.2, 40 % Ethanol (v/v) and 5 % PEG 1000 (w/v). The hexagonal crystal belongs to spacegroup P6122 (a, b = 95.72 A and c = 70.94 A) with half of the covalent dimer per asymmetric unit and solvent content of 50 % (Table 1). For data collection, the crystal was frozen in liquid nitrogen in a 1+1 mixture of Paratone-N and Mineral oils (Hampton Research).

[00257] A complete dataset to 2.9 A resolution was collected from the single crystal at the beamline X06SA at the Swiss Light Source (SLS) in Villigen, Switzerland (Supplementary Table 1). Data were processed with XDS and the CCP4 suite of programs (CCP4).30,28 The VEGF-D structure was solved by molecular replacement by Molrep using a single VEGF-C chain (PDB code 2X1W) as a search model.29 The phases were further improved by solvent flattening and the VEGF-D model was completed by iterative refinement in Phenix and model-building in Coot.30,31,32 A subset of 10 % of the diffraction data were omitted from refinement for calculating the free R factor (Rfree). The final VEGF-D model comprises residues 92-194, an N-terminal proline from cloning, 13 solvent molecules and two glycan chains. The glycan chains, linked to Asnl55 and Asnl 85, consist of two N-acetyl- glucosamines and three or one mannose moieties, respectively. Stereochemical properties were assessed by Molprobity.33 All figures were prepared using the program PyMol (http://pymol.sourceforge.net).

Example 3- Establishment of the angiogenic activity of human VEGF-D (Cysl 17Ala) in vivo

[00258] As described in Toivanen et al (J. Biol. Chem.,284: 16037-16048, 2009), the Cys 117Ala mutation of human VEGF-D gives rise to improved VEGFR-2 and VEGFR-3 activation in cultured cells presumably as a consequence of higher dimer stability of the protein. In vitro, the Cys 117Ala mutant exists mainly as a covalent dimer whereas the wild- type protein runs as a monomer on a reducing gel.

[00259] The following Example demonstrates that the Cysl 17Ala VEGF-D mutant retains biological activity in vivo. The wild-type and Cys l 17Ala mutants (major form consisting of residues 89-205 of SEQ ID NO: 2) were fused with the sequence encoding the mouse IL-3 signal peptide and expressed via the recombinant adeno-associated virus (rAAV) vector in mouse tibialis anterior muscles. Analysis by immunohistochemical staining of blood vessel endothelial cells (PECAM-1) and perivascular smooth muscle cells (SMA) indicated that the angiogenic activity was retained in this mutant VEGF-D that we subjected to further structural analysis.

Example 4 - VEGF-D structure determination [00260] The human VEGF-D (Cysl 17Ala) VHD (encompassing residues 92-195 of SEQ ID NO: 2) fused to a C-terminal histidine tag was crystallized for structure determination. Crystallization conditions were screened using the sitting-drop vapor-diffusion technique. A single VEGF-D crystal grew in 6 weeks at room temperature over a reservoir solution of 0.1 M phosphate/citrate buffer at pH 4.2, 40% Ethanol (v/v) and 5 % PEG 1000 (w/v). The hexagonal crystal belongs to spacegroup P6122 (a, b = 95.72 A and c = 70.94 A) with half of the covalent dimer per asymmetric unit and solvent content of 50 % (Table 2). For data collection, the crystal was frozen in liquid nitrogen in a 1+1 mixture of Paratone-N and Mineral oils (Hampton Research).

mMim (k) 0 - 2. 0

No, idlecHass 4543

No, u

Preie n 774

GlycaR I

R>mJ. dteyi&tk s

Bmd lengths (A) 0.019

Bond, sidles (") ί ,.54 )

*VaMes in ai fcses are £ - he_¾r¾solMiie¾ sfedt,

[00261] A complete dataset to 2.9 A resolution was collected from the single crystal at the beamline X06SA at the Swiss Light Source (SLS) in Villigen, Switzerland (Table 2). Data were processed with XDS and the CCP4 suite of programs (CCP4) (28, 30). The VEGF-D structure was solved by molecular replacement by Molrep using a single VEGF-C chain (PDB code 2X1W) as a search model (29). The phases were further improved by solvent flattening and the VEGF-D model was completed by iterative refinement in Phenix and model-building in Coot (30,31,32). A subset of 10 % of the diffraction data were omitted from refinement for calculating the free R factor (Rfree). The final VEGF-D model comprises residues 92-194, an N-terminal proline from cloning (13) solvent molecules and two glycan chains. The glycan chains, linked to Asnl55 and Asnl85, consist of two N- acetyl-glucosamines and three or one mannose moieties, respectively. Stereochemical properties were assessed by Molprobity (33). All figures were prepared using the program PyMol (www.pymol.sourceforge.net).

[00262] The asymmetric unit of the VEGF-D crystals contains one VEGF-D monomer and the VEGF-D covalent dimer is generated by a crystallographic two-fold axis in the hexagonal spacegroup. The human VEGF-D residues are numbered according to the full-length protein. The final model contains residues 92-194 of SEQ ID NO: 2, an N-terminal proline from the linker, two N-linked glycan chains and 13 solvent molecules. Overall, the electron density is of good quality but several sidechains, including loop 1 and 3 residues 124-129 of SEQ ID NO: 2 and 169-173 of SEQ ID NO: 2, respectively, had poor density and part of the sidechain atoms were omitted from the refinement.

[00263] VEGF-D comparison with other VEGF family ligands and putative VEGFR-2 interactions: Similar to the other VEGF family ligands, human VEGF-D monomer structure consists of an antiparallel four-stranded β-sheet, three connecting loops (L1-L3), and an N- terminal a-helix (aN), that folds on top of the second monomer (Figure 1A). The VEGF-D antiparallel homodimer is further stabilized with two intermolecular disulfide bridges between Cysl36 and Cysl45'. Like in VEGF-C, Alal 17 (Cysl 17 in the native VEGF-D) is only a few A from the intermolecular Cys l36-Cys l45 disulfide bridge and its side chain points towards the dimer interface. The extended 18 residue N-terminal a-helix of VEGF-D starts from the very first VEGF-D residue (Thr92) in the construct, and is well visible in the electron density (Figure IB). The VEGF-D and VEGF-C monomer structures can be superimposed with a root mean square difference (r.m.s.d) of 1.3 A for 96 Ca-atoms (Figure 1C). VEGF-D and VEGF-A monomers also superimpose well with an r.m.s.d of 1.1 A for 91 Ca-atoms, but differences in the N-termini form the structural hallmarks of the two subfamilies (Figure 1C and ID).

[00264] VEGF-D and VEGF-C VHD domains have 60% sequence identity and VEGF-D retains essentially all of the VEGF-C residues involved in the VEGFR-2 interactions (Leppanen et al., Proc. Natl. Acad. Sci. USA, 107:2425-2430, 2010, the disclosure of which is incorporated herein by reference). Superposition of the VEGF-D monomer structure with a VEGF-C monomer in the VEGFR-2D23 complex structure (PDB code 2X1W) reveals a highly similar loop 2 (L2) conformation (Figure 2A). VEGF-D Asnl47 points up towards VEGFR-2 domain 2 and Glul49 down towards domain 3, like Asnl67 and Glul69 in VEGF- C, and are thus capable of making the same VEGFR-2 interactions. VEGF-C Aspl23 in the N-terminal a-helix, salt-bridged and hydrogen-bonded to VEGFR-2 Argl64 and Tyrl65, respectively, is also conserved in VEGF-D. VEGF-D Aspl03 and Glul49 need just to adjust the sidechain rotamers to accommodate the VEGFR-2 interactions visible in the VEGF-C complex. Of the VEGFR-2 interacting hydrophobic residues, VEGF-C Leul 19 (Figure 2 A) and Trpl26 in the N-terminal helix, Phel51 in loop 1 (LI) and Phel86, Ilel 88, Vall90 and Leul 92 in loop 3 (L3) are conserved both in the VEGF-D sequence and in the structure (Figure 2C)(18). These loop 1 and 3 residues, together with loop 3 Prol71, Vall76 and Pro 177 and the hydrophobic residues in the VEGF-D N-terminal helix comprise a large hydrophobic surface (Figures 2C-2D).

[00265] In general, growth factors and their receptors display cross-species functionality, but mouse VEGF-D and mouse VEGFR-2 are an exception (36). Mouse VEGF-D does not bind to or activate mouse VEGFR-2 although it binds to human VEGFR-2 and human VEGF-D binds mouse VEGFR-2. With the VEGFR-2D23 (18) and our VEGF-D structures, it is now possible to analyze the sequence differences in detail. We superimposed the VEGF- D structure on the VEGF-C structure in the VEGFR-2 complex and mapped the differences in human and mouse sequences in these structures (Figure 7A). VEGFR-2 sequence differences were scattered with most amino acid changes residing in D3 outside of the ligand binding site. In addition, none of the residues that differed in the ligand-binding surface was involved in VEGF-C binding in the VEGFR-2 complex, suggesting that amino acid changes in the mouse VEGFR-2 residues are not responsible for the inability of mouse VEGF-D to bind the mouse VEGFR-2 (Figure 7B). Most of the differences in the VEGF-D sequences, on the other hand, are located in the binding surface, including the Ile96 and the loop 2 triplet Serl50-Leul51-Ilel51 counterparts (Figure 7A). Consistent with the mutagenesis data (36), we propose that the residues altered in mouse VEGF-D are responsible for its inability to bind mouse VEGFR-2.

Example 5 - VEGF-D N-terminal residues are important for VEGFR-3 activation.

[00266] The bioactive VEGF-D short form (VHD domain) is generated upon proteolytic processing at either one of the two different N-terminal proteolytic sites, corresponding to N- terminal residues 89 and 100 of SEQ ID NO: 2 (17). To better understand the effect of these sites on VEGF-D binding to and activation of VEGFR-2 and VEGFR-3, we generated a set of VEGF-D Cysl 17Ala variants with deletions at both ends (Figure 3 A). The C-terminal site for deletion was selected according to the VHD domain boundary and the additional N- terminal site, at residue 92, was designed to optimize the crystallization properties.

[00267] The binding behavior and activity of the VEGF-D variants towards VEGFR-2 and VEGFR-3 was assessed by ligand dependent BaF cell proliferation (Figure 3B), VEGFR-2 and VEGFR-3 phoshorylation (Figure 3C) and by receptor binding assays (Figure 3B). All of the tested VEGF-D Cysl 17 Ala variants induced strong BaF/VEGFR-2 cell proliferation. The variants VEGF-D89-195 (comprising residues 89-195 of SEQ ID NO: 2) and VEGF- D92-195 (comprising residues 92-195 of SEQ ID NO: 2) induced also strong BaF/ VEGFR-3 cell proliferation, whereas variants VEGF-D 100- 195 (comprising residues 100-195 of SEQ ID NO: 2) and VEGF-D100-205 (comprising residues 100-205 of SEQ ID NO: 2) did not. To confirm these results from the BaF VEGFR assays, we determined receptor activation in HDME cells and in VEGFR-2 or VEGFR-3 expressing PAE cells using phospho-specific antibodies for VEGFR-2 and VEGFR-3. We tested three concentrations for the VEGF-D variants D89-195 and D 100- 195 in receptor phosphorylation assays in the HDME cells Figure 3C). In line with the results of the BaF/VEGFR assays, both of the variants induced strong VEGFR-2 phosphorylation, whereas the N-terminally truncated D 100- 195 failed to activate VEGFR-3 at the lowest concentration. Unlike the BaF/VEGFR- 3 cells, the HDME cells express both VEGFR-2 and VEGFR-3 and thus the ligand may, similarly to VEGF-C, induce also receptor heterodimerization leading to cross-phosphorylation of VEGFR-2 and VEGFR-3 in the heterodimer (34,35). When phosphorylation was tested in PAE cells expressing either VEGFR-2 or VEGFR-3, both variants showed comparable VEGFR-2 autophosphorylation, but the D 100- 195 variant induced weak VEGFR-3 activation only at the highest concentration (Figure 3D).

[00268] Discussion: The determination of the VEGF-D crystal structure completes the structural studies of the human VEGF family ligands and allows conclusions about their structural diversity. This analysis shows that VEGF-C and VEGF-D comprise a functional subfamily of VEGFR-3 ligands with long N- and C-terminal propeptides requiring proteolytic processing to produce mature forms that bind VEGFR-2 and VEGFR-3 with high affinity (15, 17). All five VEGFs contain an antiparallel β-sheet with three connecting loops (L1-L3) and an N-terminal a-helix that form two equal receptor binding surfaces (14). The VEGF-D structure revealed an extended N-terminal a-helix for the first 18 residues whereas in the other members, like in VEGF-A (Figure 1C-1D; PDB code 1FLT), the N-terminal a- helix is short with preceding residues folding away from the receptor binding surface. In the VEGF-C structures the N-terminal residues are only partially visible but the nature of an extended a-helix is clear (Figure 1C) (18).

[00269] Comparison of the human VEGF-D structure to human VEGF-C in the VEGFR- 2D23 complex reveals that the VEGFR-2 interacting residues, in particular the hydrophilic Asp 123 and Glul69, in VEGF-C are structurally conserved in VEGF-D (Asp 103 and Glul49) and seem to require only minor changes in the sidechain conformations for VEGFR- 2 binding. VEGF-D loops 1 and 3 bear multiple hydrophobic residues and comprise a large hydrophobic surface extending to the N-terminal helix. These residues include equivalents of the VEGF-C loop 1 and 3 hydrophobic residues shown to be important for VEGFR-2 binding and residues found at the VEGFR-2 interface in the VEGF-C complex structure (18,21). The deletion of the first N-terminal residues of VEGF-D (Phe89-Leu99; D100-195 and D100-205 variants) had essentially no effect in the VEGFR-2 activity or VEGFR-2D23 affinity assays, suggesting that these residues do not contribute to VEGFR-2 binding. This is consistent with the VEGF-C/VEGFR-2 complex structure (PDB code 2X1 W) where the VEGF-C N-terminal residues extending to the Glu97 residue of VEGF-D and the neighboring VEGFR-2 D2 residues 128-131 were disordered, indicating a lack of interactions. The structural comparison of VEGF-D and VEGF-C together with the very similar thermodynamic parameters for VEGFR-2 binding, including the affinity (BCD) and the changes in enthalpy (ΔΗ) and entropy (AS) (Figure 5) (18) suggest that the two ligands share the structural determinants of VEGFR-2 specificity revealed in the analysis of the VEGF-C/VEGFR-2 complex.

Example 6 - The N-terminal residues of VEGF-D account for high-affinity VEGFR-3 binding.

[00270] To further characterize the VEGF-D variants, we measured the binding affinity of the VEGF-D ligands for VEGFR-2D23 (VEGFR-2 domains 2+3; Figure 5A) and VEGFR- 3D17 (VEGFR-3 domains 1-7; Figure 5B) using isothermal titration calorimetry (ITC).

[00271] Consistent with the BaF cell assays (Figure 3), the binding data indicated that all of the tested VEGF-D variants are high-affinity ligands for VEGFR-2 (Figure 5C). The D89- 195 and D92-195 variants with the long N-terminal helix were also VEGFR-3 ligands, whereas the D100-195 and D100-205 variants with N-terminal truncations showed no binding. The D89-195 and D92-195 variants showed almost identical thermodynamic parameters and affinities (Figure 5C), suggesting that the residues 92-99 of SEQ ID NO: 2, visible in the D92-195 crystal structure, rather than the three residue difference (FAA, residues 89-91 of SEQ ID NO: 2) are important for VEGFR-3 binding. The VEGFR-2 and VEGFR-3 binding isoterms indicated that binding of the dimer-stabilized VEGF-D is both enthalpically and entropically favorable and suggested a 2:2 ligand:receptor stoichiometry.

[00272] VEGFR-3 domain 1 is important for VEGF-D binding: The VEGF-D binding site to VEGFR-3 was mapped by measuring the binding affinities of VEGF-D (Cysl 17 Ala) for a set of VEGFR-3 domains and their combinations. VEGFR-3 domains 1 -3 comprise the high affinity binding site for the major form (Figure 6A). In a pulldown assay, only the VEGFR-3 domain combinations Dl and D2 (R3D12) and Dl to D3 (R3D1-3) were able to interact with the D92-195variant (Figure 6B). In the calorimetric titrations, consistent with the pulldown assays, only R3D12 of the single or the two-domain VEGFR-3 constructs showed binding (Figure 6C-6D). However, R3D12 affinity for D92-195 was decreased in comparison to R3D1-3. VEGFR- 1 /VEGFR-3 chimera (R1/3D12) showed no binding confirming the importance VEGFR-3 Dl in VEGF-D binding.

[00273] Discussion: In VEGF-D, the N-terminal but not the C-terminal deletions affected VEGFR-3 binding and activity. D100-195 and D100-205 variants were both poor inducers of BaF/VEGFR-3 cell proliferation and D 100- 195 induced weaker VEGFR-3 phosphorylation in HDME cells than D89-195. However, both were equally active in induction of VEGFR-2 phosphorylation in these cells. VEGF-C induced VEGFR-2/VEGFR-3 heterodimerization and cross-activation has been reported in co-expressing endothelial cells (34,35). Similarly, possible VEGFR-2 and VEGFR-3 heterodimerization may explain the relatively high DlOO- 195 activity towards VEGFR-3 in the HDME cells. In contrast, in VEGFR-3 expressing PAE cells, the D89-195 variant showed high VEGF-C like activity already at the lowest concentration whereas the DlOO-195 variant was active only at the highest concentration. VEGF-D variants DlOO-195 and D100-205 showed no binding in the ITC binding assays, suggesting that the KD is higher than the receptor concentration (5 - 8 μΜ) in the calorimeter cell, which represents the detection limit of the calorimetric titrations. Extension of the C- terminal residues (Prol96-Arg205) in the D 100-205 protein did not rescue VEGFR-3 activity, suggesting that the N-terminal residues of VEGF-D forming the a-helix revealed by the crystal structure are crucial for high affinity binding and VEGFR-3 activity.

[00274] VEGFR-3 ligand binding utilizes multiple domains and is domain Dl dependent. Unlike the ligand binding in VEGFR- 1 and VEGFR-2, VEGFR-3 domain D2 and even domains D23 need the presence of domain Dl for VEGF-C binding (18,21,37-39). Similarly, we show here that also VEGF-D binding to VEGFR-3 is Dl dependent (Figure 6). The combination of VEGFR-3 domains Dl and D2 is the minimal VEGF-D binding construct and the presence of D3 increases the affinity for VEGF-D. All the three first VEGFR-3 domains are thus involved and VEGFR-3 ligand binding is likely to be centered on D2 following the general scheme of type III and V receptor tyrosine kinases (18,40). The extended VEGF-D N-terminal a-helix, pointing upwards, presumably towards Dl, could interact with this domain or with the D1 D2 junction. Importantly, the VEGF-D structure reported here represents a truncated form of the originally described mature form lacking three N-terminal residues (FAA). Thus, our data suggests an important role for the N-terminal residues for VEGFR-3 binding and the proposed proximity with D 1 in the ligand-receptor complex suggests that the VEGF-D N-terminal residues could also interact with Dl or with the D1/D2 junction. In general, the extended N-terminal a-helix of VEGF-D comprises part of the VEGFR binding surface and our data clearly shows that the N-terminal residues are crucial for VEGFR-3 binding and activation.

Example 7 - VEGF-D with N-terminal deletion induces angiogenesis but not

lymphangiogenesis in vivo.

[00275] The biological activity of the wild-type VEGF-D variants D89-195 and D 100- 195 was analyzed in mouse tibialis anterior muscles by rAAV delivery (Figure 4A). Two weeks after the injection of the rAAV vectors, the muscles were processed for

immunohistochemical staining of PECAM- 1 (endothelial cells), SMA (smooth muscle cells and pericytes) and for the lymphatic endothelial cell markers LYVE-1, Prox-1 and

Podoplanin (Figures 4B-4C). In comparison to rAAV encoded HSA, both of the VEGF-D variants induced angiogenesis and VEGF-D D89-195 induced also lymphangiogenesis.

Interestingly, VEGF-D D 100- 195 with the N-terminal deletion did not induce detectable lymphangiogenesis under these conditions suggesting the lack of VEGFR-3 interactions in vivo. VD1 antibody staining was used to confirm the expression of both VEGF-D variants (27). Notably, the expression pattern of the major form D89-195 correlates with the accompanying Podoplanin staining.

[00276] Discussion: We show here that the rAAV-delivered major and minor forms of human VEGF-D induce angiogenesis in skeletal muscle. Consistent with our in vitro

VEGFR-3 activation and binding assays, the major form did also induce lymphangiogenesis at the 2-week time point whereas the minor form with N-terminal deletion (residues 100-195) did not (Figure 4). Thus, the minor form of VEGF-D may be considered as a VEGFR-2 specific angiogenic growth factor. The N-terminal truncation results from proteolytic cleavage of VEGF-D in the human HEK293 cells (17). This, and our data presented here, suggest that differential proteolytic processing of the VEGF-D N-terminus may provide additional control over VEGF-D activity towards VEGFR-2 and VEGFR-3.

Example 8 - Assay to determine activity of N-terminal truncated forms of VEGF-C

[00277] The experiments described in Examples 6 and 7 are repeated using truncated forms of VEGF-C (e.g., amino acids 103-227 of SEQ ID NO: 4, amino acids 113-227 of SEQ ID NO: 4, amino acids 120-227 of SEQ ID NO: 4, amino acids 1 13-213 of SEQ ID NO: 4 and amino acids 120-213 of SEQ ID NO: 4.) Results are expected to indicate the more extreme N-truncated forms of VEGF-C (e.g., comprising amino acids 120-227 or 120-213 of SEQ ID NO: 4) demonstrate VEGFR-2 specificity, while less truncated forms of VEGF-C (e.g., beginning at reisude 103 or 1 13) tested do not.

Example 9 - Assay for determining Modulation of Myelopoiesis

[00278] Overexpression of VEGF-C in the skin of K14-promoter driven VEGF-C transgenic mice correlates with a distinct alteration in leukocyte populations [see

International Publication W098/33917, incorporated herein by reference]. Notably, the measured populations of neutrophils were markedly increased in the transgenic mice. The effects of the VEGFR-2 specific ligands on hematopoiesis can be analyzed in an analogous model in which the VEGF-C coding sequence is replaced with a coding sequence for a ligand according to the invention. Fluorescence-activated cell sorting (FACS) analysis using antibodies that recognize proteins expressed on specific leukocyte cell populations is used to evaluate the effect of the ligand on leukocyte production/population. Leukocyte populations are analyzed in blood samples taken from the Fl transgenic mice described above, and from their non transgenic littermates. Alterations in leukocyte populations has numerous therapeutic indications, such as stimulating an immune response to pathogens, recovery of the immune system following chemotherapy or other suppressive therapy, or in the case of inhibitors, beneficial immunosuppression (e.g., to prevent graft-versus-host-disease or autoimmune disorders.) Use VEGFR-2 specific ligands for these therapeutic indications is specifically contemplated. Use of antibodies that recognize various stem cell or progenitor cell populations permits evaluation of the effect of VEGFR-2 specific ligands on such cell types. Example 10 - Using VEGFR-2 Specific Ligand Therapy In Reconstructive Surgery

Following A Severe Buen or Other Skin Trauma

[00279] The following example describes a procedure and delivery of a VEGFR-2 specific ligand (e.g., amino acids 100-195 of SEQ ID ON: 2, amino acids 100-205 of SEQ ID NO: 2 and amino acids 120-227 of SEQ ID NO: 4), to tissue traumatized from a burn to improve healing following reconstructive surgery. Burn victims often require extensive surgical interventions that include substantial skin grafts to restore damaged tissue. The following example provides a method to improve tissue healing following reconstructive surgery for a burn or other skin trauma.

A. Animals and Skin Preparation

[00280] New Zealand white rabbits have been shown to be appropriate for burn studies (Bucky, et al., Plast. Reconstr. Surg., 93(7): 1473-1480 (1994)). Further, the structural characteristics of the skin layers in rabbits and humans are similar. Three days prior to the operation, the backs of 10 New Zealand White Rabbits are depilated with a depilatory cream. Since the thickness of the skin is dependent upon the stage of the hair growth cycle, estimation of the hair growth pattern is carefully assessed. Immediately prior to infliction of the burn injury, the operation area is depilated a second time to achieve a smooth and hairless skin surface.

B. Operative Technique

[00281] Rabbits are sedated by intramuscular administration of ketamine (25 mg/kg BM) as described in the art (Knabl et al., Burns, 25:229-235 (1999)). A soldering iron with an adjustable aluminum contact stamp is used for infliction of the burn. The temperature of the stamp is set to 80°C and continuously monitored. Burns are inflicted on the dorsal skin of the rabbits for approximately 14 seconds using only the weight of the stamp (approximately 85 g). The wounds are then immediately cooled with thermoelements which provide a consistent temperature of 10°C for 30 minutes (Knabl, et al., supra).

[00282] To minimize the fact that different parts of the body with different skin thickness have different re-epithelialization and healing potentials, the same donor site on the animals is used. Therefore, any observed differences could be attributed to the treatment itself rather than to other variables. A Padget Electric Dermatome is used to harvest a 0.12 inch thick skin graft from the depilated thigh in all animals. The graft is carefully spread on the burn area. It is held in place either by gentle pressure from a well-padded dressing or by a few small stitches. The raw donor area is covered with a sterile non-adherent dressing for a 3-5 days to protect it from infection until full re-epithelialization is observed.

[00283] lxlO ⁹ pfu of AdVEGF, AdVEGF-D(amino acids 100-195 of SEQ ID NO: 2), AdVEGF-C, and AdLacZ are injected intradermally into the dorsal skin to the burn site of the rabbits. AdVEGF construction has been described previously (Makinen, et al, supra) and AdVEGFD (amino acids 100-195 of SEQ ID NO: 2) is constructed as described herein. Reduction of edema and increase in skin perfusion at a burn wound site as a result of an increase in functional lymph nodes is assessed by following the accumulation of fluorescent dextran.

[00284] Additionally, healing is monitored by evaluating the cosmetic appearance of the skin graft. Normal graft color is similar to that of the recipient site. Surface temperature of the graft can be monitored using adhesive strips (for an accurate number) or the back of the hand (to provide a comparative assessment with the surrounding skin). Problems with arterial inflow are suggested when the graft is pale relative to the donor site and/or cool to the touch. Problems with venous outflow are suggested when the graft is congested and/or edematous. Color and appearance of congested grafts can vary depending on whether the congestion is mild or severe and ranges from a prominent pinkish hue to a dark bluish purple color.

C. Summary

[00285] The aforementioned model demonstrates the therapeutic potential of using VEGFR-2 specific ligands to improve healing and reduce edema and concomitant postsurgical complications in burn victims.

[00286] It should be understood that the foregoing description relates to preferred embodiments of the invention and equivalents and variations that will be apparent to the reader are also intended as aspects of the invention. The references cited herein throughout are all specifically incorporated herein by reference. References:

[00287] All of the references cited herein are incorporated herein by reference in their entirety.

[00288] 1. Achen MG, Jeltsch M, Kukk E, et al. Vascular endothelial growth factor D (VEGF-D) is a ligand for the tyrosine kinases VEGF receptor 2 (Flkl) and VEGF receptor 3 (Flt4). Proc Natl Acad Sci U S A. 1998;95:548-553.

[00289] 2. Shibuya M, Claesson- Welsh L. Signal transduction by VEGF receptors in regulation of angiogenesis and lymphangiogenesis. Exp Cell Res. 2006;312:549-560.

[00290] 3. Tammela T, Alitalo K. Lymphangiogenesis: Molecular mechanisms and future promise. Cell. 2010; 140:460-476.

[00291] 4. Ferrara N, Carver-Moore K, Chen H, et al. Heterozygous embryonic lethality induced by targeted inactivation of the VEGF gene. Nature. 1996;380:439-442.

[00292] 5. Carmeliet P, Ferreira V, Breier G, et al. Abnormal blood vessel development and lethality in embryos lacking a single VEGF allele. Nature. 1996;380:435-439.

[00293] 6. Makinen T, Veikkola T, Mustjoki S, et al. Isolated lymphatic endothelial cells transduce growth, survival and migratory signals via the VEGF-C/D receptor VEGFR-3. EMBO J. 2001;20:4762-4773.

[00294] 7. arkkainen MJ, Haiko P, Sainio K, et al. Vascular endothelial growth factor C is required for sprouting of the first lymphatic vessels from embryonic veins. Nat Immunol. 2004;5:74-80.

[00295] 8. Baldwin ME, Halford MM, Roufail S, et al. Vascular endothelial growth factor D is dispensable for development of the lymphatic system. Mol Cell Biol.

2005;25:2441-2449.

[00296] 9. Haiko P, Makinen T, Keskitalo S, et al. Deletion of vascular endothelial growth factor C (VEGF-C) and VEGF-D is not equivalent to VEGF receptor 3 deletion in mouse embryos. Mol Cell Biol. 2008; 15:4843-4850.

[00297] 10. Rissanen TT, Markkanen JE, Gruchala M, et al. VEGF-D is the strongest angiogenic and lymphangiogenic effector among VEGFs delivered into skeletal muscle via adenoviruses. Circ Res. 2003;92: 1098-1106. [00298] 11. Anisimov A, Alitalo A, Korpisalo P, et al. Activated forms of VEGF-C and VEGF-D provide improved vascular function in skeletal muscle. Circ Res. 2009; 104: 1302- 1312.

[00299] 12. Roy H, Bhardwaj S, Babu M, Lahteenvuo JE, Yla-Herttuala S. VEGF- DdeltaNdeltaC mediated angiogenesis in skeletal muscles of diabetic WHHL rabbits. Eur J Clin Invest. 2010;40:422-432.

[00300] 13. Holmes DI, Zachary I. The vascular endothelial growth factor (VEGF) family: angiogenic factors in health and disease. Genome Biol. 2005;6:209.

[00301] 14. Grunewald FS, Prota AE, Giese A, Ballmer-Hofer K. Structure-function analysis of VEGF receptor activation and the role of coreceptors in angiogenic signaling. Biochim Biophys Acta. 2010; 1804:567-580.

[00302] 15. Joukov V, Sorsa T, Kumar V, et al. Proteolytic processing regulates receptor specificity and activity of VEGF-C. EMBO J. 1997; 16:3898-3911.

[00303] 16. McColl BK, Baldwin ME, Roufail S, et al. Plasmin activates the

lymphangiogenic growth factors VEGF-C and VEGF-D. J Exp Med. 2003;198:863-868.

[00304] 17. Stacker SA, Stenvers K, Caesar C, et al. Biosynthesis of vascular endothelial growth factor-D involves proteolytic processing which generates non-covalent homodimers. J Biol Chem. 1999;274:32127-32136.

[00305] 18. Leppanen VM, Prota AE, Jeltsch M, et al. Structural determinants of growth factor binding and specificity by VEGF receptor 2. Proc Natl Acad Sci U S A.

2010; 107:2425-2430.

[00306] 19. Toivanen PI, Nieminen T, Viitanen L, et al. Novel vascular endothelial growth factor D variants with increased biological activity. J Biol Chem. 2009;284: 16037-16048.

[00307] 20. Fuh G, Li B, Crowley C, Cunningham B, Wells JA. Requirements for binding and signaling of the kinase domain receptor for vascular endothelial growth factor. J Biol Chem. 1998;273: 11 197-1 1204.

[00308] 21. Jeltsch M, Karpanen T, Strandin T, Aho K, Lankinen H, Alitalo K. Vascular Endothelial Growth Factor (VEGF)/VEGF-C Mosaic Molecules Reveal Specificity

Determinants and Feature Novel Receptor Binding Patterns. J Biol Chem. 2006;281 : 12187- 12195. [00309] 22. Ruch C, Skiniotis G, Steinmetz MO, Walz T, Ballmer-Hofer K. Structure of a VEGF-VEGF receptor complex determined by electron microscopy. Nat Struct Mol Biol. 2007; 14:249-250.

[00310] 23. arpanen T, Heckman CA, Keskitalo S, et al. Functional interaction of VEGF-C and VEGF-D with neuropilin receptors. Faseb J. 2006;20: 1462-1472.

[00311] 24. Tessier DC, Thomas DY, Khouri HE, Laliberte F, Vernet T. Enhanced secretion from insect cells of a foreign protein fused to the honeybee melittin signal peptide. Gene. 1991;98: 177-183.

[00312] 25. Waltenberger J, Claesson-Welsh L, Siegbahn A, Shibuya M, Heldin CH. Different signal transduction properties of KDR and Fltl, two receptors for vascular endothelial growth factor. J Biol Chem. 1994;269:26988-26995.

[00313] 26. Jussila L, Valtola R, Partanen TA, et al. Lymphatic endothelium and Kaposi's sarcoma spindle cells detected by antibodies against the vascular endothelial growth factor receptor-3. Cancer Res. 1998;58: 1599-1604.

[00314] 27. Achen MG, Roufail S, Domagala T, et al. Monoclonal antibodies to vascular endothelial growth factor-D block its interactions with both VEGF receptor-2 and VEGF receptor-3. Eur J Biochem. 2000;267:2505-2515.

[00315] 28. Kabsch W. Automatic processing of rotation diffraction data from crystals of initially unknown symmetry and cell constants. Journal of Applied Crystallography.

1993;26:795-800.

[00316] 29. Vagin A, Teplyakov A. An approach to multi-copy search in molecular replacement. Acta Crystallogr D Biol Crystallogr. 2000;56: 1622-1624.

[00317] 30. CCP4. The CCP4 suite: programs for protein crystallography. Acta Cryst D Biol. 1994;50:760-763.

[00318] 31. Adams P, Grosse-Kunstleve R, Hung L, et al. PHENIX: building new software for automated crystallographic structure determination. Acta Cryst D Biol.

2002;58: 1948-1958.

[00319] 32. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr. 2004;60:2126-2132. [00320] 33. Davis IW, Leaver-Fay A, Chen VB, et al. MolProbity: all-atom contacts and structure validation for proteins and nucleic acids. Nucleic Acids Res. 2007;35:W375-383.

[00321] 34. Dixelius J, Makinen T, Wirzenius M, et al. Ligand-induced vascular endothelial growth factor receptor-3 (VEGFR-3) heterodimerization with VEGFR-2 in primary lymphatic endothelial cells regulates tyrosine phosphorylation sites. J Biol Chem. 2003;278:40973-40979.

[00322] 35. Nilsson I, Bahram F, Li X, et al. VEGF receptor 2/-3 heterodimers detected in situ by proximity ligation on angiogenic sprouts. EMBO J. 2010;29: 1377-1388.

[00323] 36. Baldwin ME, Catimel B, Nice EC, et al. The specificity of receptor binding by vascular endothelial growth factor-d is different in mouse and man. J. Biol. Chem.

2001;276: 19166-19171.

[00324] 37. Wiesmann C, Fun G, Christinger HW, Eigenbrot C, Wells JA, de Vos AM. Crystal structure at 1.7 A resolution of VEGF in complex with domain 2 of the Flt-1 receptor. Cell. 1997;91 :695-704.

[00325] 38. Christinger HW, Fuh G, de Vos AM, Wiesmann C. The crystal structure of placental growth factor in complex with domain 2 of vascular endothelial growth factor receptor-1. J. Biol. Chem. 2004;279: 10382-10388.

[00326] 39. Iyer S, Darley PI, Acharya KR. Structural insights into the binding of vascular endothelial growth factor-B by VEGFR-1(D2): recognition and specificity. J. Biol. Chem. 2010;285:23779-23789.

[00327] 40. Shim AH, Liu H, Focia PJ, Chen X, Lin PC, He X. Structures of a platelet- derived growth factor/propeptide complex and a platelet-derived growth factor/receptor complex. Proc. Natl. Acad. Sci. U S A. 2010; 107: 11307-11312.