YUVARANI NAIDU RAJU NAIDU (MY)
AHMAD KUSHAIRI DIN (MY)
NORMAN HJ KAMARUDIN (MY)
Claim* ! . A method of producing Hgnoce!iuiolyue enzymes comprising: incubating a specific white-rot fungal strain on growth substrates hkh comprises a iignoccllulosic agro wastes and; cultivating the said white-rot fungal stain in the fermentation process under conditions wherein the fungus expresses the ii noeelluio ytic en ymes, 2. The method of ciaim L wherein the specific hhe-rof fungal strain is P. sanguineus (GanoBF2). 3. The method of claim I, wherein the Mgnocell iosic agro wastes is empty fruit bunches (EFB) of oil palm and rice bran (RB). 4. The method of claim I, wherein the fermentation process is solid state fermentation process. 5. The method of claim I, wherein the lignocelfuloiytic enzymes comprise iacease. CMCase, xylanase and amylase. 6. The method of claim 1, whereirs the pH of the formulation was within the range of 4.5-4.8. |
WHim-MOT BASlMQMYCKTE-PrCNOPOittrS SANGUINEUS (Ga»oBF2) FOR PRODUCTION OF LIGNOC ELLULOl. YTIC ENZYMES
USING WGNOCFXLULOSIC AG. O WASTES FIELD OF THE INVENTION
[0001] The present invention relates to a method of producing en ymes, more particularly relates to Hgnocel!tt!o!ytk enzymes such as !accase, CMCase, x ianase and amylase under solid state fermentation (SSF) from white-rot tungi.
BACKGROUND OF THE INVENTION
(0002] Basidio ycete fungi are unique m their ability to degrade most of the wood components due to their competence to synthesize hydrolytie and oxidative extracellular enzymes (ElisashvUt et at 2008. Journal of Industrial Microbiology and Biotechnology, 35, 1531-1538).
[0003] Among basidiomycete, white-rot fungi have the ability to degrade various compounds. The ability to degrade polysaccharide (cellulose, hemiceilulose and iignin) is a result of their secretion of hydroiytie and oxidative extracellular enzymes. Cellulose and hemiceilulose is degraded by hydroiytie enzymes suc as cei!ulases and xylanases whereas !igrun is degraded hy highly oxidative ligninoiy ie enzymes consisting primarily of phenoksxidases.. 10004] The phenoloxida.se enzymes are manganese peroxidase (MnP), iignin peroxidase {LIP), manganese-independent-peroxidase and iaecass. These enzymes break the phenyipropaoe links of Iignin creating much smaller compounds. The peroxidase enzymes may also assist in degrading cellulose and hemi-eelluiose, which are structurally more complex than cellulose. f0005] Recently, extensive research on white-rot fungi has been conducted with aim to isolate new organisms with increased secretion of hgninoiytic enzymes as well as enzymes with properties that are importan for industrial applications. Many species of white-rot. fungi simultaneously remove all structural components from the cell wails of wood, whereas others selectively degrade Ugnim
[0006] Solid state fermentation (SSF) is considered as the most appropriate method for cultivation of filamentous fungi. During solid state fermentation (SSF) cultivation, lignoceliuioiytie enzymes are being produced. This phenomenon is due to the growth conditions closer to their natural habitats and they may be more capable of producing certain enzymes and metabolites, which usually will not be produced or will be produced at low yield in submerged cultures (Pandey e at, 1999, Current Science 77; 149-162).
[0007] Additionally, cultivation of white-rot fungi in the presence of some iignoceliulosic residues significantly enhanced ligninolytk enzyme secretion without supplementation of culture medium with specific inducers, (Rosales et h, 2005. Journal Food Engineering. 66. 419-423).
|0008] Malaysia, one of the largest global producers and exporters of palm oil reported 4.17 million hectares of plantation, 417 mills and 51 refineries by 2009. The largest amounts of palm oil waste being produced are empty fruit bunches (ES-B), oii palm fronds (OFF) and palm pressed fibres (PPF), Wastes are available daily throughou the year and only about 60 % of all the produced fibre and shell waste are burned to generate electricity and steam, <Abd Razak et. aL 2013, Applied Microbiology and Biotechnology, 97 (7); 3207-3213). Cultivation of mushrooms using agricultural wastes represents one of the most efficient biological ways by which these by-products can be recycled.
[0009] The yields or levels of the h ' gnoeeiiu fytic enzymes production in current technology is unsuitably low at high commercial cost.
[00101 Accordingly, to develop low cost technologies for lignoceliuioiytie enzyme production there is a need to provide a novel, economical and Ume-efBckni method by using specific white-rot strain, fermentation process and iignoceliulosic agro-industrial wastes to improve the environmental character thereof. 1001 1] A more specific object of the present invention is to provide a method of producing !ignoce!luio!ytic enzymes from white rot fungi under solid stale fermentation (SSF) to produce high yields of lacease, CMCase, xylanase and amylase enzyme using lignoeei!ulosic agro-industrial wastes such as empty fruit bunches (EFB) of oil palm and rice bran.
SUMMARY OF THE INVENTION
[0012] The present invention has been devised in the light of above mentioned circumstances and aims to solve the above mentioned problems. Embodiments of the present invention relate to specific white-rot strain, fermentation process, substrate formulation for producing lignocelluiolyt c enzymes under conditions that promote expression of lignoeeilulolylic enz mes at high yields. [0013] in accordance with the present invention, disclosed is a method of producing Hgnocelluloiytic enzymes comprising: incubating a specific while-rot fungal strain on growth substrates which comprises a lignoeelkilosic agro wastes and; cultivating the said white-ro fungal strain in the fermentation process under conditions wherein the fungus expresses the lignoceiiuiolyiie enzymes.
[0014] In accordance with the present invention, disclosed is a specific white-rot fungal strain named P. sanguineus (GanoBF2),
[0015] In accordance with the present invention, disclosed lignoceliulostc agro wastes is empty fruit hunches (EFB) of oil palm and rice bran ( 8).
[0016] In accordance with the present invention, disclosed fermentation process is solid state fermentation process. {0017} In accordance with the present invention, disclosed iignocel!ulo!ytic enzymes comprise lacease, CMCase, xylanase and amylase. Accordingly the aim of this invention is to create novel economically and time-efficient procedure for producing Hgnoceliuktlytic enzymes comprise faccase, C-MCase, xylanase and amylase. BRIEF DESCRIPTION OF THE DRAWING 00181 The accompanying drawings, winch are incorporated into, and form a part of the specification, illustrate several embodiments of the present invention and. together with the description, serve to explain the principles of the in vention. The drawings are only for die purpose of illustrating a preferred embodiment, of the invention and are not to be construed as limiting the invention.
Figure 1 is a graph showing comparison of iignoceiiuioiyuc enzymes activity by P. sanguineus (GaooBFl) on formulation substrates consisting of empty fruit bunches (EFB) and rice bran under solid state fermentation which is subjected to different incubation periods.
DETAILED DESCRIPTION OF THE ' INVENTION [0019] The description that follows illustrates embodiments of the subject matter disclosed herein. Those of skill in the art will recognize that there are numerous variations and modifications of the subject matter provided herein that are encompassed by its scope. Accordingly, the description of certain embodiments sho ld not be deemed to limit the scope of the present invention. j ' 0020 ' j In one aspect of the presen invention is white roi fungus particularly Pycmpor s sanguineus (GanoBF2), which is isolated and sequenced.
1002 ! in other aspect of the present invention is the method of production of lignoeeUu!olytie enzymes b P. sanguineus (GanoBF2) under solid state fermentation (SSF) on the formulated substrate containing empty fruit bunches (EFB) of oil palm and rice bran (KB) for different time period. CHARACTERIZATION OF Pyen&p&ms sanguineus <GanoBF2)
[0022] Powdered fungal myceiia of P. sanguineus (20-25 mg) was prepared by grinding with liquid nitrogen and extracted by using Qiagen D easy Plant kit protocol followed by dissolving the DNA in TE buffer and storing It at -20°C until further use, The extracted genomic DNA was checked for its concentration and purity using a spectrophotometer (Uitrospec 2000, UV/Visibie Spectrophotometer, Pharmacia Biotech). PCR amplification of rD A regions ITS1, 5.8S rRNA, and 1TS2 was performed using the fungal specific primer set: FTSI-F (CTT GOT CAT ΤΓΑ GAG GAA GTA A) and FFS4 R (TCC GCT TAT TGA TAT GC) and basidiomyeetes specific primer set: ITSi -f {CTfGGTCAT TTAGAOGAAGTAA) and ITS4B (CAG GAG ACT TGI ACA COG TCC AG). Amplification was performed in 25μ1 of reaction mixture containing 0.25 μ ' Ι of DNA template, 2.S pi I OX PCR buffer, 2.5 mM gCi2, 200 μΜ of each dNTP (dATP, dTTP, dGTP, and dCTP), 0.4 μ.Μ of both primers, I unit Taq polymerase and ddH20. DNA EngineTM Peltier Thermal Cycler Model PTC- 1 DO was used to run the Polymerase Chain Reaction (PCR). The PCR started with denaturation for 2 mm at 95 Λ € followed by 35 cycles of denaturation for 1 nun at 94°C, annealing for 30s at 63°C and extension for 2 rain at. ?2 <> €, and finally one cycle at ?2 a C 1 min. before it was maintained at I0°C. The amplified PCR products were loaded on 1.7% agarose gel, stained with ethidium bromide (EiBr) and visualized under a UV transiliuminator (BioSpectrum® Muiti Spectral Imaging System). The reliability of amplified products was confirmed by DNA sequencing for both reverse and forward primer amplified products. Amplified PCR products were purified using the QiAquick Gei Extraction Kit (QiAGEN, Germany) and directly sequenced. [0023] Sequencing was performed using an outsourced commercial sequencing service provider and compared with those obtained from CABI. United Kingdom, ITS regions were employed to search the closest sequences from the GenBank database (http://www.ncbi.nlm.riih.gov) using a BLAST search. ITS sequence data for each basidiomyeetes isolates were multiple aligned with CiustalWl (www.ehi.ac.uk) and validated visually using BioEdit 7.5.0.3. A phy!ogtam tree based on maximum likelihood with 100 bootstrap replications was constructed using tools from EMBL-BBI. [0024] The sequence obtained is as follows:
GCTGC :CTrCCGGGOCA l^i(3CACACCCiGC rCATCCACTC:TAC A(X:TCrrGCAC TTACTGTAGG1 1OGCGTGGGCTl GG iGCCTCCGGG(:TrrC5ACH:x A rrC ' rGCC GGCCTATGTATCACTACAAACACATAAAGTAACAGAATGTA'ITCGCGTCTAAC GCATCTAAATACAACTTOAGCAACGGATCTC TGGCTCTCGCA CGATGAAG AACGCAGCGAAATGCGATAAGTAATGTGAATTGCAGAA'ITCAGTGAATCATCG AATCTH ' GAACGCACCTTGCGCTCC'nOGTAlTCCGAGGAGCATGCCTGlT GA GTGTCATGGAA rCTCAACCCAC ACGTC -TTGTGATGTTGCGGGCT GGA ^ G CiACKjCllXX;TGCXXXrrC XXXX3ICGGClCCTCTTGAATGCATTAG€rr(jA ' Ii: ' CC GTGCGGATCGG TCTCAGTGTGATAATTGTCTACGCTGTGACCGTGAAGCC^rTT GGCGAGCTTCTAACCGTCCTGTATGGGACAACTTCTTGACATCTGACCTCAAAT CAGGTAGGACTACCCGCTGAA
Note: Accession number (NCB!): FJ234202.1 ; identities: 558/558; Homology: 100%; Score (bits): 1031
[0025} The standard techniques for culture production of basidiomyeetes is from an inoculum which consist of homogenized myce!ia fragments obtained from a pre-eultare. [0026] in the present invention, the process involved in producing inoculum in the fonn of grain containing wheat for rapid mycelium extension and multiplication of P. sanguineus, GanoBf 2 are described as below:
[0027] Fifty grams (50g) aiiquots of wheat grain was weighed into tissue culture bottles (capacity: 350 mL height: 120 mm diameter; 75 mm) and mixed with distilled water (60 m-L) and calcium carbonate ( ig). The bottled grain was autodaved for 2 consecutive da s at l 2i °C for 30 mm with the plastic lid of the bottles slightly opened. Then the bottled grain was aseptically inoculated with 7 mm (diameter) of three (3) mycelium plugs of one - week old pure cultures of P. sanguineus (GanoBFZ) grown on preferred media, namely Potato Dextrose Agar (PDA, Difoo iSi ) and kep for irscuhstion in growth chamber at 2t±2°C for one-week. After the incubation period, fully colonized bottle by P. sanguineus (GanoBF2) at uniform level wa used to Inoculate the fomtoleUon substrate. 56
[0028} In accordance with the present invention substrate for producing hgnoceilufolyiie enzymes are formulated as follows: Dried and finely grounded oil palm EFB, to lengths between 1 .5-4.5 cm diameters, adjusted to pH 6.00*0.15 is obtained from Malaysian Pain? Oil Board, Bang! Research Station, Malaysia. Rice bran, particle size between 1.5 - 4.5 cm diameters is obtained from Federal Land Consolidation and Rehabilition Authority (FELCRA), Malaysia. Calcium sulphate (€aS04>, Magnesium sulphate (MgSO 4 ), Sucrose and Yeast Extract (Difco l ) are obtained commercially.
[0029] The following examples further illustrate this invention. It should be clearly understood, however, that these example is given only by way of illustration of the subject, of the invention, of which they in no way constitute a limitation.
Example 1 Production of Hgnoeel In lo lytic enzymes by P. sanguineus (GanoBF2) under solid state fermentation (SSF)
[0030] CuUnring process is discussed in more detail as follows. Empty fruit bunches (EFB) of oil palm. (16g) was mixed with rice bran (RB) (4g), calcium sulphate, CaSO,¾ (2g), magnesium sulphate, gSO\ (0.2g), sucrose (2g) d yeast extract (2g) in a tissue culture bottles (capacity: 350 mE, height: 120 mm diameter: 75 mm). The moisture content of the bottles were adjusted within the range of 75-85% (v/w) by adding distilled water and subjected to sterilization for 2 consecutive days at 12 PC for 30 min. After sterilization and cooling down, the contents of the bottles were inoculated with wheat grain inoculum (20g). prepared as mentioned in the previous method and incubated at. growth chamber -at 25 A 2°C under SSF (static condition). The fermentation was carried for 7 I E 14 and 21 days and after desired fermentation period, four culture boUles were randomly sampled for iignocellulolytic enzyme assays. [0031 j In accordance with the present invention, the lactase assay is outlined as follows: The content of each bottles were extracted with cold 50 m.M sodium citrate buffer, at pH 4.8 (100 mL) (Vlkineswary et a!., 2006, Bioresource Technology, 97, 171 - 17?}. after each of the desired fermentation period. Solid culture was break into smaller panicles using spatula. The smaller particles of solid culture we e transferred into 250 mL E enmeyer flasks and kept to an incubator shaker at 4°C and 200 rpm for approximately I S h (Kuroarart et al, 1997, World Journal of Microbiology and Biotechnology. 13, 43-49). After shaking on incubator, the contents were cenlrifuged at 4 Λ €, 9000 rpm for 20 min. The crude culture filtrate containing fungal enzymes were analyzed to determine the pH of the filtrate, and the activity of hydrolyiic and oxidative enzymes. The crude culture was stored at -20 °C for 24 h prior for enzyme assays (iaeease, CMCase, amylase and xyiauase). [0032] Laccase was assayed usin 2, 6-dimethoxyphenol (Piuka, Swizeriand) as substrate. Reactions were carried out in 3 mL cuvette containing lOOmM citric acid buffer, pH 5,0 (0.6 mL), distilled water (0.2 mL), enzyme extract ( 1 .0 ml.) and LOm.M substrate (0,2 mL) as described by Husaini et aL, 201 1 (Journal Biochemical Technology, 3(2), 245-250), Reactions with 2. 6-dimethoxypheno! (BMP) were monitored at 468um using Spectrophotometer,
[0033] In accordance with the present invention, the CathoxymethyS cellulose (CMCase) assay is outlined as follows: CMCase was assayed using 1 % CMC, Carhoxymethyl celJttiase (F!uka, Swizeriand) as an enzyme substrate dissolved i 0.05 M. citrate buffer, w/v (p.H 5.3) using a modified methods of Ghose, 198? (Pure AppL Chem., 59, 257-268) and ts uemheo et al, 2012 (World Journal of Microbiology and Biotechnology, 2S, 1961 -1966). Reactions were carried out in 3 ml. cuvette containing enzyme extract (0.5 mL) and ' ! % CMC (0.5 mt) followed by incubation in water bath at 50 °C for 15 minutes. The reaction was stopped by addition DNS color reagent (LO mL) (Miller, 1959, Anal. Chem., 31 , 426-428) followed by incubation i boiling water ( I 00°C) for 5 minutes. The mixture was cooled lown at room temperature and reactions were monitored as. 540nm using Spectrophotometer. One unit of enzyme activity is defined a I umof of glucose equivalents released per minute under the given conditions,
[0034] Irs accordance w ith the present invention, the xylanase assay is outlined as follows: Xylanase was assayed using 1 % birch wood xyian, {Sigma} dissolved in 0.05 M citrate buffer, w/v (pH 5.3) as substrate. .Reactions were carried out in 3 mL cuvette containing enzyme extract (0.5 mL) and 1 % soluble starch (0.5 mL) followed by incubation in water bath at 50 °C for 15 minutes. The reaction was stopped by addition .DNS color reagent ( 1 .0 000056
mL) (Miller, 1959, Anal. Che ., 31, 426-428) followed by incubation in boiling water ( 100°C) for 5 minutes. The mixture was cooled down at room temperature and reactions were monitored at 54Qnm using Spectrophotometer. One unit of enzyme activity is defined as 1 pmol of xylose equivalents released per minute under the given conditions. 0035] in accordance with the present invention, the Amylase assay is outlined as follows: Amylase was assayed using 1% soluble starch, (Sigma) dissolved in 0.05 M citrate buffer, w/v (pH 5.3) as substrate. Reactions were carried out in 3 mL cuvette containing enzyme extract (0.5 mL) and 1% soluble starch (0.5 mL) followed by incubation in water bath at SO °C for 15 minutes. The reaction was stopped by addition DNS color reagent. { 1.0 raL) (Miller, 1 59, Analytical Chemistry, 31: 426-428) followed by incubation in boiling water (1.00 f, C) for 5 minutes. The mixture was cooled down at room temperature and reactions were monitored at 340nm using Spectrophotometer. One unit of enzyme activity is defined as 1 umol of glucose equivalents released per minute under the given conditions.
[0000] In accordance with the present invention estimation of fungal biomass was performed as follows: After 21 days of fermentation, process, the myeelia with fermented substrates were separated by centri legation {5800g; 15 minutes) at 4 , C. The biomass was then dried at 60 °C to a constant weight and total nitrogen was determined according to the Kjekiahl method. Protein content was also calculated as the total nitrogen multiplied by 4.38, ( achlishviiii et al., 2012, World journal of Microbiology and Biotechnology, 22: 391 -397).
[0036] Referring to Figure 1 , Lignoediu!oytic enzymes produced by P, sanguineus (GanoBP2) in the formulation substrate consisting of EPS and rice bran are shown. The pH of the formulation was within the range of 4.5-4,8, which slightly increases towards the end of the incubation period i.e. day- 21 as depicted in Table 1 taccase activity was increased almost 4~fokl higher towards the end of the incubation period i.e da -·2 Ϊ ith a value of 22.7? U/mL. Similar trend was observed on the enz me acti v ities of xyianase arid amylase, two-fold increases were detected, 13.89 U/mL and 15.38 U/mL, respectively. The highest peak for CMCase activity was also observed on day-21 with a value of 15.42 U/mL. (0037J The production of hydrolytk- and oxidative enzymes (such s cei!ulases, xylanases and laecase) as well as amylase enzyme towards the end of the incubation period (day-21) correiated vvith the biomass yield (protein gain), with signifieant increase on day-2 i , with a value of 53 mg ~ ' flask and greater weight loss (%) was attained by the present formulation substrates of 58 % { Table 1 )
T ble 1; Effect of different incubation periods on the plh protein gain (mg "; flask) and weight
loss {¾) of the formulation consisting of EFB and rice brats.
Da s of Incubation pll Protein gain (mg " flask) Weight Loss (%}
.11 4.5a 47 b a
Ϊ4 4.5a 36 c SI a
2! 4.8a 53 a 58 a
Means with different letters within the same column are significantly different (P < 0.05) according (P < 0,05) according Fisher's protected LSD test. Note: Analyses for the different times are independent. [0038] It was concluded that formulated substrate containing EFB and rice bran incubated under SSF for a period of 21 days was an idea! substrate for the growth and lignocei!ulolytic enzymes production by P. sanguineus (GanoBf 2) white-rot fungi. j ' 0039} All publications mentioned herein are hereby incorporated by reference in their entirety as if each individual publication was specifically and individually indicated to be incorporated by reference.