Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
X. DENDRORHOUS GENE, METHOD AND NUCLEOTIDE STRUCTURE THAT CAN BE USED FOR THE SPECIFIC AND SELECTIVE GENERATION OF TRANSFORMANTS, SUITABLE FOR THE GENETIC MODIFICATION AND EVALUATION OF ORGANISMS
Document Type and Number:
WIPO Patent Application WO/2010/012118
Kind Code:
A1
Abstract:
The invention relates to molecular and genetic biology and to a method and tools that have been developed that can be used for the production and selection of transformants for multiple productive, industrial, research and control uses among others. The invention comprises a transformation module including at least one resistance or expression cassette containing a strong promoter, a terminator and a selection or expression or reporter gene, which is flanked by two fragments homologous to a region of the genome that is to be incorporated into the module. In addition, the invention relates to a method for the production of the aforementioned transformation module and to the use of same as microorganism study, intervention, improvement, selection and modification tools.

Inventors:
CIFUENTES GUZMAN, Victor (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
NIKLITSCHEK OYARZUN, Mauricio Alejandro (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
MARCOLETA CALDERA, Andres Esteban (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
Application Number:
CL2009/000006
Publication Date:
February 04, 2010
Filing Date:
July 31, 2009
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
UNIVERSIDAD DE CHILE (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
CIFUENTES GUZMAN, Victor (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
NIKLITSCHEK OYARZUN, Mauricio Alejandro (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
MARCOLETA CALDERA, Andres Esteban (Av. Libertador Bdo. O'Higgins 1058, Santiago, CL)
International Classes:
C12N15/81
Foreign References:
US20060286650A12006-12-21
Other References:
NIKLITSCHEK, M. ET AL.: 'Genomic organization of the structural genes controlling the astaxanthin biosynthesis pathway of Xanthophyllomyces dendrorhous.' BIOLOGICAL RESEARCH. vol. 41, no. 1, July 2008, ISSN 0716-9760 pages 93 - 108
ROSEL, H. ET AL.: 'Integrative transformation of the dimorphic yeast Arxu the adeninivorans LS3 based on hygromycin B resistance.' CURRENT GENETICS vol. 33, no. 2, February 1998, ISSN 0172-8083 pages 157 - 163
DATABASE BIOSIS 'Efficient transformation of the astaxanthin-producing yeast Phaffia rhodozyma.' Database accession no. PREV199800317882 & vol. 12, no. 5, May 1998, ISSN 0951-208X
Attorney, Agent or Firm:
BEUCHAT, BARROS & PFENNIGER (Europa 2035, Providencia, Santiago, CL)
Download PDF:
Claims:
REIVINDICACIONES

1. Una estructura nucleotidica CARCATERIZADA porque comprende al menos un cásete de selección y/o expresión que comprende un promotor fuerte, un terminador y un gen reportero o de selección o de expresión; el cual se encuentra flanqueado por dos fragmentos de un gen o fragmento de genoma de interés que permitan la inserción de dicha estructura, donde el partidor y el terminador son seleccionados de distintos genes.

2. Una estructura nucleotidica de acuerdo a la reivindicación 1, CARACTERIADO porque el promotor y el terminador pueden ser del mismo o distinto organismo de origen.

3. Una estructura nucleotidica de acuerdo a la reivindicación 1, CARACTERIADO porque el gen de selección puede ser elegido de aquellos elementos de selección cuya función selectiva sea dependiente de la concentración de dicho agente de selección es un gen de resistencia, de preferencia a antibióticos y de manera preferente el gen corresponde a higromicina B fosfotransferasa.

4. Una estructura nucleotidica de acuerdo a la reivindicación 3, CARACTERIADO porque los genes de selección pueden ser secuencias que confieren resistencia a compuestos quími'cos, modificaciones fisicas del entorno, alteraciones biológicas internas y/o externas, producción de metabolitos, entre otras aplicaciones que entreguen ventajas al organismo modificado .

5. Una estructura nucleotidica de acuerdo a la reivindicación 4, CARACTERIADO porque los genes de selección incluidos en el cásete confieren resistencia a compuestos químicos, de preferencia se trata de resistencia a antibióticos cuyo efecto y actividad sea dependiente de la concentración del compuesto en. el medio, los cuales pueden ser seleccionados entre' los antibióticos blasticina S, zeocina, higromicina B y G-418.

6. Una estructura nucleotidica de acuerdo a cualquiera de las reivindicaciones anteriores, CARACTERIADO porque el promotor puede ser seleccionado de preferencia TEF- Ice.

7. Una estructura nucleotidica de. acuerdo a cualquiera de las reivindicaciones anteriores, CARACTERIADO porque el gen terminador puede ser seleccionado de genes autólogos, heterólogos o parálogos respecto del organismo a modificar, de preferencia se selecciona entre terminadores de genes* de actina (ACT), gliceraldehido 3-fosfato deshidrogenasa {GPD),r imidazol glicerol fosfato hidratasa (HIS3) , isopentenil difosfato isomerasa {idi) .

8. Una estructura nucleotidica de acuerdo a cualquiera de las reivindicaciones anteriores, CARACTERIADO porque de preferencia el promotor es del gen TEF-lα, y el terminador es del gen GPD (gliceraldehido 3-fosfato deshidrogenada .

9. Un método de transformación de organismos, CARACTERIZADO porque genera organismos genéticamente transformados que manifiestan la modificación (transformación) de forma estable y homogénea, generando por ello la obtención de organismos homocigotos para la transformación inicial, en donde se emplea una estructura nucleotidica como la descrita en las reivindicaciones 1 a 8.

10. Un método de acuerdo a la reivindicación 9, CARACTERIZADO porque comprende los pasos de: a) transformar el organismo de interés con un módulo de transformación, conforme a la presente invención; b) crecer el microorganismo transformado en condiciones de selección que son entregadas por el cásete de selección que comprende el módulo; c) realizar una recombinación mitótica (figura 9) , es decir crecer los transformantes en condiciones de presión selectiva de manera que la concentración del agente de selección aumente progresivamente entre un ciclo de crecimiento y el siguiente; d) alternativamente seleccionar los transformante que muestran ser homocigotos para el módulo de transformación.

11. Un método de acuerdo a las reivindicaciones anteriores, CARRACTERIZADO porque en las etapas de cultivo y crecimiento para las células transformadas se realizan en el medio de cultivo adecuado para el microorganismo, de preferencia en medio liquido, y las etapas de selección se realizan mediante la identificación de colonias transformadas por cultivo en medio sólido.

12. Un método de acuerdo a las reivindicaciones anteriores, CARRACTERIZADO porque en el cultivo con presión selectiva se agrega progresivamente mayor cantidad del elemento de selección entre una y otra etapa de crecimiento, en donde el método comprende al menos dos etapas de crecimiento con presión selectiva, en donde el número de ciclos de crecimiento se selecciona de acuerdo al número de copias del módulo de transformación que se desee obtener en el genoma del organismo transformado, de preferencia se emplean entre 2 y 7 ciclos de crecimiento, como también los ciclos de crecimiento y selección se pueden extender hasta que se logre la adecuada expresión de la cualidad que se busca en el transformante.

13. Un método de acuerdo a las reivindicaciones anteriores, CARRACTERIZADO porque cuando se realiza la selección de los transformantes, la concentración del agente de selección varia entre un ciclo de crecimiento y selección con el siguiente, de preferencia dichas variaciones de concentración del elemento de selección ocurren por el aumento entre 1,1 y 50 veces más de agente de selección en la etapa siguiente respecto de la anterior, de mayor preferencia entre 1,2 y 25, más preferentemente de 1,2 a 10, de manera preferente entre 1,5 y 8 veces y de manera más preferida entre 3-6 veces

/////

Description:
GEN DE X. DENDRORHOUS, MÉTODO Y ESTRUCTURA NUCLEOTIDICA QUE PERMITEN GENERAR TRASFORMANTES DE MANERA ESPECIFICA Y SELECTIVA, UTIL PARA LA EVALUACIÓN Y MODIFICACIÓN GENÉTICA DE ORGANISMOS

La- presente invención comprende un método y una estructura nucleotídica que permiten general transformantes de manera especifica y selectiva, útil para la evaluación y modificación genética de organismos.

DESCRIPCIÓN DE LO CONOCIDO

La transformación con ADN es un proceso donde se contactan células con moléculas de ADN bajo condiciones en que dicho ADN sea capturado e incorporad a la célula para producir un genotipo heredable. Abundante información sobre métodos de transformación están disponibles en la literatura, como por ejemplo en Smith, H. O., et al., "Genetic Transformation, " In: Ann. Rev. Biochem., 50: 41-68, 1981. En este sentido, varias estrategias de transformación emplean recombinación homologa como medio para integrar segmentos de ADN en las secuencia blanco de interés. Yu y col., (Proc Nati Acad Sci U S A 2000 May 23; 97 (11) : 5978-83} , han mostrado que segmentos de ADN que comprenden homologia por secuencias de interés pueden ser integrados en las secuencias seleccionadas. Este enfoque técnico permite múltiples aplicaciones, por ejemplo integrar sitios de recombinación, marcadores de selección, incorporar elementos funcionales o marcar secuencias. Entre las aplicaciones que se han encontrado para estos desarrollos está a acumulación o sobreexpresión de compuestos de interés en las células transformadas, como por ejemplo es el caso de los pigmentos .

Los carotenoides constituyen el grupo más amplio de pigmentos que se encuentran en la naturaleza r ya se han descrito más de 600 estructuras químicas diferentes (Takaichi y cois., 1996). Los carotenoides derivan de la ruta de biosintesis de los isoprenoides, que son compuestos sintetizados a partir de un precursor común de 5 átomos de carbono denominado isopentenil pirofosfato (IPP) (Hirschberg, 1998) . Por su estructura química, se han clasificado en dos grupos: los carotenos, que no presentan átomos de oxigeno en su estructura y las xantófilas, que si poseen átomos de oxigeno. Debido a las características químicas de los carotenoides, se le han encontrado numerosas aplicaciones y usos. Éstos, son utilizados como colorantes y suplementos alimenticios en animales, especialmente salmónidos y crustáceos (Johnson, 1977; Johnson y Lewis, 1979; Schroeder y Johnson, 1993) . Además, existen evidencias de que estos compuestos cumplen un papel importante en la prevención de enfermedades cardiovasculares y el cáncer, catalogándose como productos nutracéuticos (Canfield y cois., 1992; Edge y Truscott, 1999; Schmidt-Dannert, 2000 ) .

La levadura X. dendrorhous -ex. Phaffia rhodozyma- (Golubev, 1995) tiene como principal característica la capacidad de sintetizar carotenoides, entre los cuales se encuentran el fitoeno, el licopeno, el β-caroteno y la astaxantina. La astaxantina es su principal carotenoide, el cual constituye entre el 83 - 87% del contenido total de pigmentos de la célula, generando un alto interés biotecnológico para su utilización en la industria acuícola como agente pigmentante (Miller y cois., 1976; Lorenz y Cysewski, 2000) . Esta levadura presente sobresalientes ventajas para su cultivo y obtención de astaxantina, sin embargo el principal problema para el uso de X. dendrorhous como fuente de astaxantina es la baja producción del pigmento en las cepas silvestres (200 y 400 μg de astaxantina/g de peso seco), lo que resulta poco atractivo desde un punto de vista industrial. Con ello se ha motivado la generación mediante mutagénesis de cepas que puedan producir un mayor contenido de astaxantina, utilizando para ello tratamientos con luz ultravioleta (Retamales y cois., 1998) o con agentes químicos (nitrosoguanidina y etil-metano-sulfonato) (An y cois., 1989; Lewis y cois., 1990; An, 1997; Bon y cois., 1997; Retamales y cois., 1998).

Se han logrado obtener cepas de X. dendrorhous. sobreproductoras de pigmentos. Sin embargo, éstas han presentado limitaciones para desarrollar procesos productivos in d ustriales. La primera aproximación para, disponer d e un método de transformación para X. dendrorhous fue realizado por ñdrio y Veiga (1995), en donde utilizaron 2 imitantes ura3 de X. dendrorhous (ATCC 96220 y 96221) que transformaron con un vector que contenia el gen URA3 de S. cerevisiae. Sin embargo, debido a la baja complementacióft del gen de S. cerevisiae en X. dendrorhous, hubo una baja eficiencia en la frecuencia de transformación y en la estabilidad de los transformantes. Estos problemas motivaron la búsqueda de otros métodos de transformación, utilizando genes de resistencia a antibióticos como marcadores de selección, independientes del genotipo de la cepa usada.

Estudios de la sensibilidad de X. dendrorhous frente a diferentes antibióticos, determinó que ésta era muy sensible a bajas concentraciones de geneticina (G-418), haciendo a este antibiótico un buen candidato como método de selección de transformantes. Asi, se utilizó como marcador de selección el gen neo del transposón Tn903, que codifica la enzima aminoglucósido fosfotransferasa (APH) , confiriéndoles a E. coli resistencia a kanaπticina y a eucariontes resistencia a G-418 (Davies y Jiménez, 1980; Jiménez y Davies, 1980). Inicialmente, se utilizó este gen bajo el control de su propio promotor de origen bacteriano. Sin embargo, las cepas transformantes obtenidas de X. dendrorhous presentaron un nivel de resistencia bajo o casi nulo frente al antibiótico, posiblemente debido a la baja transcripción del gen. Por este motivo, Wery y cois. (1997) fusionaron en fase, la porción 5' del gen de actina de X. dendrorhous con el gen neo proveniente del transposón Tn5 de -E- coli. Además, para aumentar el número de copias de esta construcción en el genoma de la levadura y asi aumentar la resistencia al antibiótico, se integró a una porción del rADN 18S. Sin embargo, los resultados mostraron una baja eficiencia en la obtención de transformantes, posiblemente debido a la baja' resistencia de estos. Asi, para mejorar el sistema de transformación, Wery y cois. (1998) cambiaron el promotor de actina por el promotor del gen de la enzima gliceraldehido 3- fosfato deshidrogenase (GPD) de X. dendrorhous y además agregaron la región terminadora de la transcripción del mismo gen (Raué, 1994; Wery y cois., 1999). Este tipo de vector permitió obtener un sistema de transformación altamente eficiente en la obtención de cepas transformantes. Además, el clonamiento y la caracterización de los genes involucrados en la ruta de biosintesis de astaxantina (Verdoes y cois., 1999a; Verdoes y cois., 1999b) permitieron el desarrollo de patentes para la obtención y utilización de cepas de X. dendrorhous sobreproductoras de pigmentos {Wery y cois., 1997; Hoshino y cois. , 2000) .

En experimentos posteriores realizados por Verdoes y cois. (2003 ) t se utilizó esta herramienta molecular para aumentar el número de copia de los genes crtYB (fitoeno sintasa-licopeno ciclasa) y crtl (fitoeno desaturasa) involucrados en la ruta de biosintesis de astaxantina, para obtener cepas de X. dendrorhous sobreproductora de ésta, 'sin embargo, aunque los transformantes obtenidos presentaron diferencias en la composición de los pigmentos intermediarios, no hubo un aumento significativo en la cantidad final de astaxantina producida. Además, estos experimentos evidenciaron la condición diploide de las diferentes cepas de X. dendrorhous (Medwid, 1998. Hermosilla y cois., 2003). El nivel de ploidia de las cepas de X. dendrorhous y la complejidad de su sistema carotenogénico, hace necesario tener otros marcadores de selecpión que permitan obtener las cepas transformantes requeridas. Actualmente, sólo se dispone del marcador de selección a G-418 como herramienta para la selección de transformantes, siendo esto insuficiente para el estudio de la biosintesis de astaxantina en organismos diploides. Además, la relación de dependencia entre la síntesis de astaxantina y la dosis, génica de los genes involucrados en su biosintesis, hace necesario tener un sistema de modificación controlada de estos genes-. Actualmente, el sistema de transformación utilizado, hace que el gen de interés se inserte en un número de copias variable en el genoma de X. dendrorhous, haciendo que la dosis génica no sea controlada y por lo tanto, los resultados de los experimentos sean difíciles de analizar.

El ' sistema utilizado actualmente para obtener transformantes de X. dendrorhous tiene como base un cásete de resistencia a G-418 estructurado de la siguiente forma: promotor gen GPD - gen de resistencia a G-418 - terminador gen GPD, integrado en una porción del rADN 18S. Al estructurarse de esta forma, la transformación de esta levadura presenta 3 falencias: 1) al encontrarse el gen de resistencia a G-418 flanqueado por regiones homologas al ADN genómico de X. dendrorhous, se ha observado la inserción de éste en el locus GPD r dando transformantes falsos positivos, 2) las cepas transformantes han presentado bajos niveles de resistencia al antibiótico, posiblemente por la fuerza del promotor utilizado, 3) la inserción en multicopia de esta construcción en el genoma de la levadura, no permite el estudios de procesos dependientes de la dosis de los genes que participan en estos, especialmente la bipsíntesis de astaxantina.

Conforme a lo anterior, en el estado de la técnica no se ha resuelto o mejora la generación de transformantes de X. dendrorhous. Conforme a lo anterior la presente invención se desarrolló una nueva metódica y producto de selección y modificación de transformantes en X. dendrorhous.

DESCRIPCIÓN DE LAS FIGURAS

Figura 1 muestra la secuencia de nucleótidos (SEQ ID N° 1) para el gen TEF-lα de X. dendrorhous.

La figura 2 muestra el alineamiento múltiple de secuencias de la región codificante del gen TEF-Ia. Se alinearon y compararon las secuencias de la región codificante del gen TEF-Ia de 25 hongos. En amarillo se destaca aquella base que tiene un 100% de identidad en todas las secuencias. A) primera región conservada en el alineamiento múltiple de secuencias desde donde se diseño el partidor directo EF-aD. B) segunda región conservada en el alineamiento múltiple de secuencias desde donde se diseñó el partidor reverso EF-aR. Las flechas indican la dirección de los partidores.

La figura 3 muestra la comparación de la secuencia obtenida de los clones pBR60 y TEF2-2 con la base de datos, Se ubicaron los partidores especificos del gen TEF-Ia en la secuencia. Se tomó una región de 3.547 pb correspondiente a 1.500 pb de la región rio arriba del partidor EFaD, la región entre ambos partidores (1.047 pb) y 1.000 pb rio abajo del partidor EF-aR y se comparó con la base de datos. En el recuadro inferior se indica el tamaño en pb de las diferentes regiones homologas .

La figura 4 muestra el análisis de la región de 5.647 pb qu¡3 contiene el gen TEF-lα. El promotor en amarillo, el gen en azul y el terminador en negro. El análisis permitió definir el codón de inicio de la traducción ATG en la posición 501 y el codón : de término de la traducción TAA en la posición 2.143. Las potenciales regiones reguladoras se indican a continuación. La caja TATA se ubica en la posición 247 y el sitio de inicio de la trascripción en la posición 277. Se indican los partidores utilizados para aislar el gen TEF-lα EF-aD y EF-aR. La figura 5 muestra la construcción del cásete de resistencia a higromicina B de X. dendrorhous. Amplificación mediante PCR de la región promotora del gen TEF-Ia con los partidores PBF-F-EV y PEF-R-Hyg; el gen de resistencia a higroraicina B con los partidores Hyg-F-PEF e Hyg-R-gpdT; y la región terminadora de la transcripción del gen GPD con los partidores gpdT-F-Hyg y gpdT-R-EV. B) Unión de los fragmentos mediante la extensión de estos y posterior PCR, para la construcción del cásete de resistencia a higromicina B de X. dendrorhous .

La figura 6 muestra un esquema que da cuenta de la Inserción del cásete de resistencia a higromicina B de X. dendrorhous en el locus crtl.

La figura 7 muestra Transformación de dos cepas de X. dendrorhous con el plasmidio pIH que contiene el cásete de resistencia a higromicina B. A) Cepas parentales crecidas en medio YM. B) Cepas parentales y transformantes resistentes a higromicina B crecidas en medio YM. C) Cepas parentales y transformantes resistentes a higromicina B crecidas en medio YM-higromicina a 10 μg/ml. Las cepas parentales no crecen en presencia del antibiótico a diferencia de las cepas transformantes . La figura 8 muestra un crornatograma a 450 nm de pigmentos separados por HPLC. Análisis mediante HPLC de los pigmentos de las diferentes cepas obtenidas. Los máximos de absorción indicados corresponden a los siguientes compuestos: 1) astaxantina, 2) licopeno, 3) β-caroteno y 4) fitoeno. Se indican las cepas utilizadas para el análisis de pigmentos.

La figura 9 muestra una representación esquemática del método de doble recombinación. En el esquema se muestra una caja naranja que representa el 'locus de interés. La caja Banca representa el gADN que flanquea el locus de enteres. La caja amarilla representa las regiones de gADN potencialmente recombinante . La caja azul corresponde a la región del promotor del gen TEF-lα de X. dendrorhous. La caja roja represente el gen hph de E. coli. La caja vede representa la región de término de la transcripción del gen gpd de X. dendrorhous. GENE: representa' cualquier gen del organismo que se transformará .

La figura 10 muestra un análisis de cromatografia liquida en fase reversa del contenido de pigmentos de cepas silvestres, heterocigotos y homocigotos de X. dendrorhous. Los simbolos (+/-) representan los genotipos heterocigotos y (-/-) los homocigotos. Los números representan los diferentes compuestos: 1, astaxantina; 2, foenicoxantina; .3, cantaxantina; 4, 3-hidroxi-4-cetotoruleno; 5, hidroχil-ceto-γ-caroteno; 6, hidroxil echinenona; 7, echinenona; 8, neurosporeno/ 9, β- caroteno; 10, fitoeno.

La figura 11 muestra los principales pigmentos producidos por la levadura X. dendrorhous. Ruta de biosintesis de astaxantina en X. dendrorhous. Se indican los genes y las enzimas participantes. La coloración de las letras para cada pigmento corresponde a la tonalidad del carotenoide puro.

DESCRIPCIÓN DE LA INVENCIÓN

La presente invención se relaciona con la biologia molecular y genética. Se ha desarrollado un método y herramientas que permiten la producción y selección de transformantes para múltiples aplicaciones productivas, industriales, de investigación y control, entre otras aplicaciones .

La invención comprende un módulo de transformación que comprende al menos un cásete de resistencia o expresión que comprende un promotor fuerte, un terminador y un gen reportero o de selección o expresión; el cual se encuentra flanqueado por dos fragmentos homólogos a una región del genoma donde se desea incorporar el módulo.

En forma adicional, la invención aporta un método para la fabricación de dicho módulo de transformación, y la aplicación de los miamos como herramientas de estudio, intervención, mejora, selección y modificación de microorganismos .

DESCRIPCIÓN DETALLADA DE LA INVENCIÓN

Mutaciones o mutantes son habitualmente posibles de obtener por métodos conocidos en el arte, caracterizados por la baja ocurrencia de mutantes obtenidos. En estos casos, en general se requieren un excesivo y costoso trabajo para obtener dichos mutantes en forma estable. Por lo anterior, se propone aqui un método y herramientas que permiten la generación de mutantes estables de manera expedita y con alto nivel de éxito.

La presente invención comprende un método para la transformación de organismos eucariontes con el módulo anteriormente descrito, para obtener una transformación dirigida y controlada, con el objeto de modificar de manera regulada el número de copias de un determinado gen en el genoma del organismo blanco, asi controlar un determinado parámetro de dicho organismo blanco. En caso que la transformación se efectúe en un gen con limitado número de copias, es posible llegar a obtener homocigosis para el gen incluido en el modulo de transformación. Asi se obtiene organismos establemente transformados con la inserción del módulo en el genoma. El método puede ser empleado en organismos haploides y diploides, incluso en algunos poliploides y/o aneuploides. El método comprende la incorporación en el genoma de una célula eucarionte, o un conjunto de células, de una estructura de ADN denominada módulo de transformación que comprende al menos un cásete de resistencia o expresión que comprende un promotor fuerte, un terminador y un gen reportero o de selección o de expresión; el cual se encuentra flanqueado por dos regiones homologas a un gen o sección del genoma que resulte de interés, el cual se transforma en el blanco de recombinación y/o inserción. Posteriormente, el módulo se duplica y/o multiplica durante la división mitótica, pudiendo seleccionar transformantes homocigotos o con múltiples copias del módulo .

Otro aspecto de la invención entrega un método para la preparación y selección del módulo de transformación anteriormente descrito. En otro aspecto, la invención proporciona un módulo de transformación que comprende al menos un cásete de selección y/o expresión que comprende un promotor fuerte, un terminador y un gen reportero, de selección y/o de expresión; el cual se encuentra flanqueado por dos fragmentos de homólogos a un gen o sección del genoma que resulte de interés, el cual se transforma en el blanco de recombinación. Dicho módulo puede contener adicionalmente un segundo o más cásete de resistencia, de transformación o de expresión.

En un aspecto adicional, el módulo de transformación de la presente invención puede ser aplicado con múltiples objetivos, por ejemplo y sin ánimo de restringir, puede ser aplicado con objetivos productivos, industriales, de investigación, identificación y control, entre otras aplicaciones. En modalidades preferidas, el método y el módulo de la invención se emplean para el estudio de rutas metabólicas o actividades de investigación para modificar, mutar, silenciar o sobre-expresar genes y actividades metabólicas de interés, entre otras aplicaciones. Asi también pueden ser empleados con objetivos productivos para generar organismos resistentes a múltiples factores quimicos, físicos o biológicos de control, por ejemplo contaminantes, nutrientes, competencia biológica, entre otras; aumentar la producción de un determinado metabolito, analito o producto biológico.

En otra modalidad, la invención comprende una secuencia nucleotidica, sus fragmentos, derivados y homólogos. De manera preferida, la presente invención comprende un fragmento nucleotidico que puede ser empleado como promotor y/o terminador, donde dicho fragmento como partidor resulta ser un partidor fuerte y constitutivo para el organismo a transformar.

En una modalidad preferida dicha secuencia corresponde a la secuencia identificada como SEQ ID N° 1 {Figura 1), correspondiente al gen TEF-lα de X. dendrorhous. Además, la invención comprende fragmentos de interés de dicha secuencia identificados como SEQ ID N° 2 y SEQ ID N° 3, correspondientes a un promotor y a un terminador de la transcripción, que se muestran a continuación: SEQ ID N° 2: Promotor TEF-lot ggggctcatcagccgacagttcatccgacacaagctctttgcctagatcgtca aacgatcgacatcgacacgaggtttgacatatctcgatcatgggtaactgggggctcatc agc cgacagttcatccgacacaagctctttgcctagatcgtcaaacgatcgacatcgacacga aaa caaatcccgatcagtcaatcagtagaactgccgaagaatgaaactgaagactgctgtgac acg tgactatagaagcggtgtcatctgacttgcgaatttgcttgtacaaaagtcaggttggct gat tcgctcgcgttgtcgacaagaattaggaaacctcatttccagccttcctttttttcccct cag aacacctcacatcttctcacaaaaaagtaagatattttcacttggagttggtggatttgg cga ctgaatggagagacagaagcttgatactgataagacactcttttgtaatctatctcgaac agc ttcaaa

SEQ ID N° 3: Terminador TEF-lα acgtccccgttggcttcttttcgatacgatcatctcactacctctatcctatc atgttatgatatgtacttccgaatattacacttttctagccctttgacgtatggtgttca cat gagaaatgttcagcggctaaactaactacaacatcaagcaattaatttgaataagcatca caa ttaaggccacaaagaactggcaacctctgattgaaaccacgagtcgtttccaggttgcta ttc aagaacaagtctcaggaagtgaaatctaaacaaactagctctccatagtagataaaacac ttt cgagtgttatgaggacaaactgcgaattgttttaaagagtatcaacttaagtattctgtt ggt aatgaaaaagtgaatcaagagagggagatgacagaagaagaaagaaggtgaggcaaaaac gaa cataggtagtcaaaatacagtcaacattctggcccccttacgttgtgtccaaatgtttct ttc acgagatgaacgatctgtcaaattcaaacgatatcgagactacgggtccgaacgtttgct acc aaacacctgggttgatgcgtacccggtttgagagacagaaaaggaatcagaaatatgagc aga agacttgtaaaagttcatσcgagggaacaaaactatcaacatttccacagaaccgatag gaat ccgacagctttcattgtgtccatcactgatagaatcacgtctaagcctctaccaaacatc cag cccgtatagctaagtggttatagcgcatcgcttgtaacgatgaggtccgtggttcaaatc cgc gttcgggctctttttttcctctctgctcatttgtcttttctctctatcacttcctttttg cga tccaaatttattcgcggtgtgagctgtatctgctcgtgtagtagttcttgatgctactca tgt ccgatagatcttgtttttgttaggtctttctcgtcatgtttctatgcgtaatgggaactc tcg aacgtgttggaaccctccgcagtcagggactaagcagaagaagaatgataatacatgaga caa gccgttcaccttcgactctcgatagccgttcttggtcgacactatcgctttcgcagcctt gaa aacgctgttgaaagctgacagtttaaataatgttccagttgcaatagatcggtgatcttg cag aggcaacatctggagatgatgcacgggaattaaacattatctttttacggtagctattct ttt ccattttctttttctcttctctctgtatcgtcctgcgataggtatattggaacatctggg tag tgatcattccggcttgaaaacaaaaccagaagctaggttagagacgagattatggatgaa gaa cgagcaaagaaggtctggtagaaaaactcaatcacattcatctgtctatctgaaatatac ttt agtcactgaaggtacctggtgaatcaatcggagaagccgaagaggaagaacggaaaatgg act ggctagaaggaaatcgttggagggaaggagccttgggttgccaaacatctttacgaatgc ttc tttctgtcatgatctggcccaggtcgaccagtacttttgagaggttcatggcttgttgct aca aaccgaacgacatggtttcctatctacaataaagcaagtaagctatcggtgaccgatgag gaa ataggcagagtacggaaacagatagggactaacctcagtgaccaaatagttcttggagaa agc tgagaaaagagaaagagaaaaggaaagagagcgttgggcggagagatatatatgtcgaag aac acgaggcaaaacacgaatgccgagatgagaagaaagataaacgagaagatatgaagatac gag aatgagaaggaaggtaagaggagtaaggccaaaaggacaccaagactaacagccacgatg gaa aaaaatgtctgttcagatgttgaatgaaacagactgaggcgaagatgaaacaggatgatt cta agaaatcaccccaacacaatcaaccccaacagatgattccaacactcccactcatcgttg ctg tttatacaaagatgtgagtcattgagaaaagacagattgtcatgatcaaatccgggttga cta tcacagggctactttgcgcaacgtggattattcttgacacagcgtcggttgaagtgcaga acg taacaaaaagctacagatgaacagacagaaaagctccgagaagtggaagtagaagtagag ata gaagaaggagatagagagaagaactaggaacacacctcagtggaccagaatggggttctg gtg atgtctgaggtgaagaaaggagatgggaagctgagaaggcttatatggaaagtggtggac gag aaagttgagcaagcacagagacaagccgaagaaggtggagcaagccggagaaggtgagac tag tcggaaaaaataaatgaaagacatggaaaatatgtagaaacagtatggatcgatagagca agg ttgcctggtccggatggtgaaagaagtagagcgatccgggcgggattggtggagatatgg gcg aaataaggaaaaaatcgagaaacatcaaaggacgaaacgacgaccggcggcgggcgcagg att acgtaagctcgcgcgatgggaggtgatgaagtcaagaaaagaaaaacagaagaaaaatgg atg gaaatatagctatgtggttacagtccgggctgtgcaacatgtggtcacggtgcaattcta aca gaaggaacgtactcaccgtgccgaaggaaaaccagatgtatgcggttgcgctcgagcgag aag gatcaccggaggtcgaagaagtactggaagctacacaaataacacaaacaaaaccaacaa aat cctcaaaacaaaccaaagaagtaaacgaaatgacggaggtagtggagacaccaacaacaa act caaatgaaacatcagcaaacaaaacatcagcagccctgaaaacatcctccctcgagctga tga tggcccacagacggatgggacacatcaacatcggcgcaatcagaaagacagaaagggcgg tcg acggactcactatccagaccggcaggaaggagctcagatgcgaggcatgcaacatcgaaa agg ccaagcgctcgtcgttcaagccgacaggaacggtttacacaaccccaggcgaggtggtct cgg tcgatctgtttggaccccttccaaagacaatggacggatatgcctacggtcttgtcatcg tcg actcggccaccaagtatttccggcttttcttgctcaagctcaagtcggatgcgctgacct gtt ggaaacgttttgttgacgagtccagacgaaaagacatcgccattcaaggcgatgagaagc gac ggaggaggcgagttcgtgagcaatgcattctccgagtacctgtctctgatgaacatcgaa cgg cagac ' gaccaacccgcacactcccgagcagaacggcgaggcagaaag

La invención aporta un método para la transformación de organismos con un módulo de transformación para obtener organismos establemente transformados. El método comprende los pasos de: a) transformar el organismo de interés con un módulo de transformación, conforme a la presente invención; b) crecer el microorganismo transformado en condiciones de selección que son entregadas por el cásete de selección que comprende el módulo; c) crecer los transformantes en condiciones de presión selectiva de manera que la concentración del agente de selección aumente progresivamente entre un ciclo de crecimiento y el siguiente; d) alternativamente seleccionar los transformante que muestran haber aumentado el número de copias del módulo de transformación. La incorporación del módulo de transformación se realiza empleando las técnicas conocidas en el arte como microinyección, biobalistica, electroporación, cruzamiento, fusión de protoplastos, entre otras técnicas conocidas en el arte, de preferencia se emplea electro- transformación.

Las etapas de cultivo y crecimiento para las células transformadas se realizan en el medio de cultivo adecuado para el microorganismo, de preferencia en medio liquido, y las etapas de selección se realizan mediante la identificación de colonias transformadas por cultivo en medio sólido u otras modalidades conocidas en el arte, entre ellas citometria de flujo entre otras. En el cultivo con presión selectiva se agrega progresivamente mayor cantidad del elemento de selección entre una y otra etapa de crecimiento. El método comprende al menos dos etapas de crecimiento con presión selectiva, en donde el número de ciclos de crecimiento se selecciona de acuerdo al número de copias del módulo de transformación que se desee obtener en el genoma del organismo transformado. De manera preferida se emplean entre 2 y 7 ciclos de crecimiento, sin embargo los ciclos de crecimiento y selección se pueden extender hasta que se logre la adecuada expresión de la cualidad que se busca en el transformante. Dicho agente de selección varia su concentración entre una etapa y la otra para efectuar una presión selectiva como la mencionada. Cuando se realiza la selección de los transformantes, la concentración del agente de selección varia entre un ciclo de crecimiento y selección con el siguiente, de preferencia dichas variaciones de concentración del elemento de selección ocurren por el aumento entre 1,1 y 50 veces más de agente de selección en la etapa siguiente respecto de la anterior, de mayor preferencia entre 1,2 y 25, más preferentemente de 1,2 a 10, de manera preferente entre 1,5 y 8 veces y de manera más preferida entre 3-6 veces.

Conforme al método anteriormente descrito se obtienen organismos genéticamente transformados que manifiestan la transformación de forma estable y homogénea, en algunos casos generando por ello la obtención de organismos homocigotos para la transformación inicial, dicho proceso se ha denominado método de recombinación doble y se explica en la figura 9. En caso de transformantes con múltiples copias del cásete de selección o expresión, la mantención de la presión selectiva permitirá conservar estable el número de copias en el organismo seleccionado. La confirmación genética de la transformación puede ser efectuada mediante ensayos moleculares -por ejemplo PCR-, con la incorporación de un segundo agente de selección, mediante el seguimiento de expresiones fenotipicas, entre otras maneras . Para la ejecución del método se ha desarrollado un modulo de transformación que comprende al menos un cásete de selección más fragmentos homólogos a una región del genoma donde se desea incorporar el módulo de transformación, para que se realice la recombinación en los extremos externos de dichos c á sete. Dicho cásete comprenden un promotor, un gen de selección y un terminador, de preferencia el cásete de selección comprende un promotor fuerte, un terminador y un gen de selección. En una modalidad de la invención el módulo de transformación puede comprende al menos un cásete adicional, donde al menos uno de ellos es de selección y el o los otros pueden ser cásete de expresión y/o de transformación.

En otra modalidad, el cásete de selección de la presente invención comprende un gen de selección que puede ser elegido de aquellos elementos de selección cuya función selectiva sea dependiente de la concentración de dicho agente de selección. Los genes de selección pueden ser secuencias que confieren resistencia a compuestos químicos, modificaciones físicas del entorno, alteraciones biológicas internas y/o externas, producción de metabolitos, entre otras aplicaciones que entreguen ventajas al organismo modificado. De manera preferida, los elementos de selección incluidos en el cásete confieren resistencia a compuestos químicos, de preferencia se trata de resistencia a antibióticos cuyo efecto y actividad sea dependiente de la concentración del compuesto en el medio, por lo tanto son útiles en el método de doble recombinación anteriormente descrito. Más preferentemente el elemento de selección es seleccionado entre los antibióticos blasticina S, zeocina, higromicina B y G-418.

El cásete de selección descrito también comprende un promotor y un terminador que pueden pertenecer al mismo gen o ser de genes distintos, pueden ser genes autólogos, heterólogos o parálogps . El promotor debe ser un promotor fuerte para el organismo que se transformará con el módulo de transformación, de preferencia dicho promotor podria pertenecer a un gen distinto al del terminador. En una modalidad preferida de la invención, dicho promotor y terminador pueden corresponder a aquellos del gen TEF-lα, de preferencia dicho gen es de X. dendrorhous. De manera preferente, las secuencias SEQ ID N 0 2 y SEQ ID N 0 3 anteriormente descritas corresponderán a promotor y terminador, siendo factible emplearlos en conjunto o en combinación con otras secuencias promotoras y/o terminadoras según corresponda.

En otra modalidad la invención comprende un modulo de transformación que comprende al menos un cásete de selección que comprende un promotor distinto al terminador. De preferencia el promotor es del gen TEF-lα, y el terminador es del gen GPD (gliceraldehido 3-fosfato deshidrogenada) .

El cásete de selección comprende un terminador que puede provenir de cualquier tipo de gen, autólogo o heterólogo, ya que dicha región no es excesivamente determinante en la operación del módulo y en el éxito de la transformación, sin embargo es necesaria. De manera preferida se emplean terminadores del mismo organismo que se transformará, algunos de los cuales por ejemplo puede ser seleccionado entre las secuencias terminadoras de los genes actina (ACT) , gliceraldehido 3-fosfato deshidrogenasa [GPD) , imidazol glicerol fosfato hidratasa (HIS3) , isopentenil difosfato isomerasá (idi) , entre otros.

El módulo de transformación puede contener más de un cásete de selección donde los promotores y terminadores pueden ser todos distintos, de preferencia dichos múltiples módulos contendrán el mismo promotor. De manera preferida dichos cásete comprenden el promotor del gen TEF-I α.

El módulo de transformación comprende al menos un cásete que se encuentra flanqueado por dos regiones homologas a un gen o sección del genoma que resulte de interés intervenir, este gen o sección del genoma se transforma asi en el blanco de recombinación y/o inserción. Estas regiones homologas cumplen la función de recombinar, por ello deben ser seleccionadas de acuerdo al blanco génico de interés en el método de transformación anteriormente descrito, donde las cualidades de homología, extensión y separación entre ellas puede ser variable y determinará la frecuencia de recombinación, por lo tanto también puede ser empleado como mecanismo de regulación y control para la recombinación.

En una modalidad de la invención, el módulo de transformación se aplica a la producción de analitos o metabolitos útiles en la industria, intervenir en los procesos de crecimiento y proliferación productiva del organismo de interés, favorecer la resistencia del organismos de interés a condiciones biológicas, competencia o contaminación por otros organismos, faculta al organismo blanco de cualidades mejoradas para resistir los desafios del entorno, otorga resistencia químicas o físicas que perjudican el normal desarrollo de todas sus cualidades productivas, entre otras aplicaciones. De manera preferida la invención emplea un módulo de transformación que comprende en su cásete de selección un promotor fuerte, de preferencia el promotor del gen TEF-lα, en donde de manera preferente se selecciona de X. dendrorhous. Esta modalidad preferida puede ser empleada en faenas industriales, productivas, comerciales y de investigaron para la producción de analitos o metabolitos útiles en la industria, intervenir en los procesos de crecimiento y proliferación productiva del organismo de interés, favorecer la resistencia del organismos de interés a condiciones biológicas, competencia o contaminación por otros organismos, faculta al organismo blanco de cualidades mejoradas para resistir los desafios del entorno, otorga resistencia químicas o físicas que perjudican el normal desarrollo de todas sus cualidades productivas, entre otras aplicaciones.

En una modalidad preferente de la invención el método y el módulo, que comprende el promotor del gen TEF-I de X. dendrorhous, se emplea para la producción de pigmentos y metabolitos en organismos naturalmente productores de los mismos o para atribuir dicha cualidad a organismos de interés. Preferentemente dichos pigmentos son carotenoides, con mayor preferencia son compuestos seleccionados entre fitoeno, liσopeno, β-caroteno y astaxantina; de preferencia esta última. De preferencia el método y el módulo, que comprende el promotor del gen TEF-Ia de X. dendrorhous, se emplea para la producción de pigmentos y metabolitos en X. ' dendrorhous.

En otra modalidad, un promotor como el divulgado en la presente invención se emplea para aumentar la producción de analitos y metabolitos, mediante la incorporación de dicho promotor TEF-lα de manera constitutiva al organismo blanco con el objeto que aumente la expresión o actividad del gen de interés. Lo anterior influye en la acumulación de pigmentos de interés en el organismo blanco. De preferencia dicho organismo blanco es X. dendrorhous, donde se aumenta la producción de pigmentos son carotenoides, con mayor preferencia de fitoeno, licopeno, β-caroteno y/o astaxantina.

EJEMPLOS

Ejemplo 1. Obtención de una estructura nucleotidica que permita obtener recombinantes de X. dendrorhous.

Con el objeto de diseñar un cásete de resistencia se consideraron los estudios realizados en hongos filamentosos y levaduras (Guldener y cois., 1996; Kitamoto y cois., 1998; R δ sel y Kunze, 1998; Nakazato y cois., 2006) r en base a estos se decidió utilizar el promotor del gen que codifica para el factor de elongación de la traducción 1-α [TEF-Ia), por ser éste uno de los promotores eucarióticos más fuerte.

Elección de región promotora. Para el clonamiento de la región promotora del gen TEF-Ia, se buscó en la base de datos la secuencia de la región codificante de este gen, en todos los hongos disponibles y se realizó un alineamiento múltiple de secuencia para dilucidar las regiones más conservadas en todos estos organismos. Este alineamiento fue analizado y corregido manualmente utilizando las secuencias de los 25 hongos siguientes: Ajellomyces capsulatus (U14100) ,

Aureobasidium pullulans (U19723) , Arxula adeninivorans

(Z47379) , Benjaminiella poitrasii (AF157234), Candida albicans

(M29935) , Chaetocladiυm brefeldii (AF157236) , Cokeromyces recurvatus (AF157242) , Cryptococcus neoformans (U81803) ,

Dichotomocladium elegans (AF157245), Dissophora decumbens

(AF157247), Echinosporangium transversale (AF157248) ,

Echinosporangium transversale (AF157248), Eremothecium gossypii

(X73978), Fennellomyces linderi (AF157250) , Helicostylum elegans (AF157254), Mortierella chlamydospora (AF157259) , Mucor indicus (AF157266), Mycotypha africana (AF157271) , Phycomyces blakesleeanus (AF157275) , Pilaira anómala (AF157276) ,

Piriformospora indica (AJ249912), Protomycocladus faisalabadensis (AF157280) f Radiomyces spectabilis (AF157281) ,

Ξyncephalastrum monosporum (AF157294) , Thamnostylum piriforme

(AF157298) y Yarrowia lipolytica (AF054510) . El resultado de este alineamiento múltiple permitió seleccionar 2 regiones altamente conservadas, desde las cuales se diseñó un juego de partidores (EF-aD y EF-aR) para amplificar el gen TEF-Ia

(figura 2) .

Posteriormente, se buscó mediante PCR el gen TEF-Ia en una genoteca de ADN genómico de X. dendrorhous, desde la cual finalmente se aislaron 2 clones positivos para la reacción de PCR, cuyos insertos se sub-clonaron en el plasmidio pBlueScript SK(pBS) pre-digerido con BamEI. Los 2 sub-clones obtenidos (pBR60 y TEF2-2) se secuenciaron completamente, obteniéndose un fragmento de ADN genómico de un tamaño total de 14.107 pb. Las secuencias obtenidas se analizaron para ubicar el gen TEF-lα y asi definir su región promotora. Para esto, se ubicó en la secuencia los partidores utilizados en la búsqueda del gen TEF-lα en la genoteca (EF-aD y EF-aR) . Luego, se tomó una región de 3.547 pb, correspondiente a 1.500 pb de la región rio arriba del partidor EF-aD, la región entre ambos partidores (1.047 pb) y 1.000 pb rio abajo del partidor EF-aR, y se comparó con la base de datos (figura 3) . Paralelamente se realizó la búsqueda del marco abierto de lectura en la secuencia, mediante la herramienta bioinformática "ORF Finder". Finalmente, el marco abierto de lectura encontrado se comparó con la base de datos proteica. La comparación con otros organismos permitió definir el codón de inicio de la traducción ATG en la posición 6.206 y el codón de término de la traducción TAA en la posición 7.848. Una vez definido el codón de inicio de la traducción, se tomó 1.000 pb de la región rio arriba de éste y mediante un análisis visual, ayudado de herramientas bioinformáticas de predicción y análisis de promotores eucarióticos, se pudo ubicar una potencial caja TATA y el sitio de inicio de la transcripción 30 pb rio abajo de ésta. Estos análisis permitieron definir la estructura del promotor del gen TEF-Ia y su potencial región minima de funcionamiento.

Elección de región terminadora. Se buscó en la base de datos las secuencias de todos los genes publicados de X. dendrorhous. Sin embargo, sólo en 4 de los 12 genes publicados [actina (ACT) (X89898), gliceraldehido 3-fosfato deshidrogenasa (GPD) (Y08366), isopentenil difosfato isomerasa (idi) (Y15811) , imidazol glicerol fosfato hidratasa (HIS3) (AF114492) u otros. Para el clonamiento del terminador del gen GPD, se diseñó un juego de partidores (gpdT-F y gpdT-R) a partir de la secuencia publicada en la base de datos (Y08366) . Estos partidores que amplifican al menos 100 pb, en este caso permiten amplificar 386 pb de la región 3' del gen GPD a partir del codón de término de la traducción. Mediante PCR, se amplificó el terminador del gen GPD desde ADN genómico de X. dendrorhous obteniendo un amplificado único que posteriormente se purificó y clonó en el plasmidio pBS pre-digerido con la enzima BcoRV. El clon resultante pB-Ter se secuenció completamente.

Selección del marcador de resistencia. Para determinar el potencial de la higromicina B como método de selección, primero se determinó la sensibilidad a éste antibiótico en medio YM liquido y sólido de la cepa silvestre de X. dendrorhous. Estas evaluaciones arrojo que la cepa silvestre es altamente sensible a bajas concentraciones de higromicina B {tabla 1) y confirman que la utilización de este antibiótico deberla ser un buen método de selección. Por este motivo se procedió a clonar el gen hph a partir del plasmidio comercial pBS4 que porta dicho gen como sistema de selección. Debido a que el primer paso de selección de transformantes se realiza en medio sólido, se estableció la concentración de trabajo de higromicina B a 10 μg/ml. Tabla 1.

H&BSBQ IXÍ Media Sólido

Concenrfracϊóπ Crecimiento'" Concentracϊόst Creefei-teπt-P íraltal)

Q +* £3 * i.a 2,5 *

3.1 S -S-

6,3 - 7,5

12,5 - 10 -

25 - 12.5

SQ - 15 -

100 -

™ -M- cnssβriieπtα igual; que el cαntol HΠ -ajiEbiαfcα, -* crecátíentα menor que contal sin anϊbiόJictj, -sn cfeάmienEα.

W -9- prasEiícϊa de cotonías, - ausendaiíe cdoniai.

Construcción del cásete de resistencia a higromicina

B. La construcción del cásete de resistencia a higromicina B de X. dendrorhous, se realizó siguiendo el esquema de la figura 5. Para ello, se amplificó mediante PCR la región promotora del gen TEF-Ia 1 el gen de resistencia a higromicina B y la región terminadora de la transcripción del gen GPD. Los productos de PCR se chequearon por electroforesis en un ' gel de agarosa, purificándose la banda de interés.

Cantidades equimolares del fragmento correspondiente al promotor del gen TEF-Ia y al fragmento del gen de resistencia, se mezclaron para su posterior elongación. Después del protocolo de elongación, el producto fue amplificado con los partidores PEF-F-EV e HygτR-gpdT. La reacción de PCR se chequeó por electroforesis en un gel de agarosa y se purificó la banda de interés. Luego, este fragmento se mezcló con el fragmento de la región terminadora del gen GPD y se realizó el protocolo de elongación. Después del protocolo de elongación, el producto se amplificó con los partidores PEF-F-EV y gpdT-R- EV. La reacción de PCR fue chequeada por electroforesis en un gel de agarosa y se purificó la banda de interés. Luego, el cásete completo se clonó en el plasmidio pBS pre-digerido con la enzima de restricción BcoRV obteniéndose el plasmidio pMN- Hyg, el que se secuenció completamente.

Obtención de un módulo para recorαbinaαión homologa en X. dendrorhous. Se chequeó la funcionalidad del cásete de resistencia a higromicina B en X. dendrorhous, mediante la mutación por deleción y reemplazo el gen crtl, que participa en la ruta de biosintesis de astaxantina. De esta manera, se lograrla un doble fenotipo marcador para la selección de transformantes, ya que estos presentarían resistencia a higromicina B y cambio de color. Para ello, por un lado se utilizó el plasmidio pL22ΔEV, que tiene como inserto un fragmento de ADN genómico de 2.432 pb al cual se le ha eliminado un fragmento .EcoRV de 1.128 pb correspondiente a parte del gen crtl. Este plasmidio habla sido utilizado previamente para transformar la cepa silvestre (crtl / crtl) de X. dendrorhous, obteniendo el transformante heterocigoto T5

{crtl / crtl ) que presentaba niveles de pigmentación menores a los de su cepa parental, indicando la dependencia de la dosis génica en la biosíntesis de astaxantina (León, 2000) .

El clon pMN-Hyg, obtenido como se mencionó precedentemente, se digirió con la enzima EcoRV, liberándose el cásete de resistencia a higromicina B de X. dendrorhous. El fragmento de 1.912 pb resultante se purificó desde gel de agarosa y luego se introdujo en el sitio .EcoRV del plasmidio pL22ΔEV, obteniéndose el plasmidio pIH. Una representación gráfica de dicho proceso se muestra en la figura 6. Posteriormente, la orientación del inserto se chequeó mediante su patrón de restricción y PCR.

Transformación de X. dendrorhous. La transformación de X. dendrorhous se realizó mediante electroporación, utilizado como cepas receptoras de transformación la cepa silvestre y la cepa heterocigota T5. El ADN utilizado como dador correspondió al plasmidio pIH pre-digerido con las enzimas de restricción Xhol y Smal (figura 6) . Se utilizaron 60 μl de células electrocompetentes, a las que se les agregó los 10 μl del ADN digerido (15 μg) . Posterior a la electroporación, las células se resuspendieron en 1 mi de medio YM y se incubaron por 5 h a 22 0 C. Después de este periodo de incubación, se plaquearon 100 μl en placas YM con higromicina a una concentración final de 10 μg/ml. Después de 4 dias, se

R observó la presencia de colonias transformantes Hyg en la placa.

A partir de la transformación de la cepa silvestre de X. dendrorhous, se obtuvo clones transformantes resistentes a higromicina B, con una pigmentación similar al T5 y menos intensa que la cepa silvestre. En la transformación de la cepa T5 se obtuvieron 2 tipos, de colonias resistentes a higromicina B. Por un lado, se obtuvieron colonias cuya pigmentación fue similar a la cepa T5 y por otro lado se obtuvieron colonias albinas (figura 7) . Las colonias transformantes se aislaron para su posterior análisis.

Para el análisis a los clones transformantes se les extrajo ADN genómico y mediante PCR se chequeó la presencia del cásete de resistencia a higromicina B y su inserción correcta en el genoma de X. dendrorhous. Para la amplificación del cásete de resistencia al antibiótico, se utilizaron 2 juegos de partidores, uno correspondiente al cásete completo (PEF-F y gpdT-R) y otro correspondiente sólo al gen de resistencia (Hyg- F e Hyg-R) . Se obtuvo como amplificado, para el cásete completo, un fragmento de aproximadamente 1,9 kb, y del gen de resistencia, un fragmento de aproximadamente 1,1 kb, comprobando la inserción del cásete de higromicina B en el genoma de X. dendrorhous. Además, para chequear si la inserción del cásete en el locus crtl era correcta, se amplificó con los partidores C13D5 y pha4(8R) ubicados fuera de la deleción EcoRV y los partidores Hyg-R e Hyg-F ubicados en el cásete. Los tamaños de los productos de amplificación esperados fueron de 2.283 pb para la reacción C13D5 - Hyg-R y 2.990 pb para la reacción pha4(8R) - Hyg-F. Los resultados de las reacciones de PCR demostraron la presencia y correcta inserción del cásete en el locus crtl. Esto, sumado al hecho de la resistencia a higromicina otorgada a X. dendrorhous por parte del cásete, demuestra la funcionalidad de éste.

Finalmente, para demostrar que esta herramienta permite modificar de manera controlada la sintesis de carotenoides en X. dendrorhous, se realizaron análisis en la pigmentación de los clones resultantes. La comparación visual entre los clones transformantes y sus respectivas cepas parentales, mostraban diferencias en su pigmentación. Por este motivo, se les extrajo pigmentos a las cepas parentales (silvestre y T5) y a las cepas transformantes (T21H y T5-3H) , los cuales se separaron mediante HLPC y se analizaron por su espectro de absorción.

En el caso del clon T21H, que es heterocigoto para el

gen crtl (crtl / crtli-.hph), se observó una disminución de todos los pigmentos, en comparación con la cepa silvestre. Para el caso del clon T5-3H, que es homocigoto recesivo para el gen

crtl ( crtl/ crtl ::hph) , no se observó la presencia de pigmentos, indicando el bloqueo de la ruta de biosintesis de astaxantina en el paso desde fitoeno a licopeno (figura 8).

Ejemplo 2. Intervención de la ruta biosintética de carotenoides en X. dendrorhous.

El método de doble recombinación descrito en la presente invención fue empleado para obtener mutantes homocigotos para una deleción del gen crtl mediante la inserción de un cásete de resistencia a higromicina B. Para esto células de cepas silvestres de X. dendrorhous fueron transformadas con el plasmidio pX.crtl: :hph. Se obtuvieron 15 colonias pálidas heterocigotos resistentes a 10 μg/ml de higromicina B. El análisis genético de dichas colonias mediante PCR empleando partidores para los genes crtl y hph junto con la secuenciación del ADN, muestra que todas ellas tienen el gen hph en el locus del gen crtl en comparación con un alelo de la cepa silvestre de crtl. Una colonia heterocigoto resistente a higromicina B, denominada T-I21H, que muestra un genotipo crtl + / crtl:: hph fue crecida en un medio YM conteniendo 10 μg/ml de higromicina B por 3 dias. Luego una alícuota de dicho cultivo fue diluido 100 veces cultivado en medio YM con 50 μg/ml de higromicina B, durante 5 dias a 22 0 C. Se observó una transición a cultivos menos coloreados. Una muestra de dicho cultivo se plaqueo en medio YM solido, donde se observó que más del 90 % de las colonias desarrolladas eran blancas y resistentes a higromicina B. ün análisis genético mediante PCR muestra que estas colonias (representadas por T-I21H1H) fueron homocigotos para la mutación de la inserción del gen hph en el locus crtl; ellas contenían el alelo crtl " : :hph en ambos cromosomas hom ó logos {crtl"::hph / crtl " ::hph). Un análisis del contenido de pigmentos mediante HPLC mostró que estas solamente producen fitoeno (Figura 10 b y c) , el cual se acumula debido a la ausencia de la enzima fitoeno desaturasa que previene su conversión a licopeno (figura 11) .

Ejemplo 3. Intervención de la ruta biosintética de carotenoides en X. dendrorhous, mediante la intervención de los genes crtYB y crtS.

Empleando el método de recornbinación doble (MRD) se obtuvieron mutantes de los genes crtYB y crtS, en los cuales se insertó un cásete de resistencia para higromicina B en cada gen. La cepa silvestre ATCC 24230 de X. dendrorhous se transformó, en paralelo, con el cásete crtYB::hph desde el plasmidio pXD-crtYB:: hph, y con el cásete crtSzihph desde el plasmidio pXD-crtS:: hph. Se obtuvieron 5 transformantes

+ -: heterocigotos del gen crtYB (crtYB /crtYB :hph) y 12

heterocigotos transformantes para el gen crtS [crtS /crtS ::hph). Una colonia de cada transformante (T-YBHl y T-SHl, respectivamente) fue seleccionada y crecida en condiciones conforme a la presente invención para enriquecer la recombinación mitótica. Se obtuvieron miles de colonias albinas (crtYB -/-, no producen pigmentos) o amarillas (crtS -/-, acumulan β-caroteno) , respectivamente. Se obtuvo resultados equivalentes en los mutantes del gen crtl, en genes crtYB y crtS, donde más del 90% de las colonias fue homocigoto después de la aplicación del MRD.

Adicionalmente, cepas silvestres, heterocigotos y homocigotos afectadas en los genes crtl, crtYB y crtS fueron analizados mediante HPLC respecto de su producción cellular y la composición de carotenoides. En todas las cepas heterocigotos, T-I21H (crtl +/-) , T-YBHl (crtYB +/-) y T-SHl (crtS +/-) , la producción de carotenoides totales es menor que en la cepa silvestre, sin embargo su composición fue similar (Figura 10 b, d y f) . Por otro lado, ambos homocigotos T-I21H1H {crtl -/-) y T-YBHH2 {crtYB -/-) no producen pigmentos coloreados y son de fenotipo albino (Figura 10 c y e) y T-SHH2 {crtS -/-) produce β-caroteno y fue de fenotipo amarillo (Figura 10 g) . Sin embargo, el homocigoto crtl -/- produce y acumula el carotenoide no coloreado fitoeno porque este mutante no sintetiza la enzima fitoeno desaturasa que transforma fitoeno a licopeno. Sin embargo, en la cepa homocigota crtYB - /-, el fenotipo albino es producto de la incapacidad de sintetizar fitoeno debido a la perdida de la enzima fitoeno sintasa. Además, la cepa homocigoto crtS-/- produce y acumula β-caroteno.

////