| Document |
Document Title |
|
WO/2019/052520A1 |
A quinoline derivative 1-[[[4-(4-fluoro-2-methyl-1H-indol-5-yl)oxy-6-methoxyquinoli
n-7-yl]oxy]methyl]cyclopropylamine as represented by the following formula (I) for treatment of neuroendocrine tumors. Also disclosed is an application o...
|
|
WO/2019/054485A1 |
[Problem] To provide an anti-aging agent or the like which is safe even when ingested over a long period of time, and which is capable of effectively preventing the progress of aging. [Solution] Nicotinamide mononucleotide is used as an ...
|
|
WO/2019/048541A1 |
The present invention relates to compounds of the general formula (I), and the pharmaceutically acceptable salts and solvates thereof, wherein Ar, Z and Y are as described herein and R1 is a group of the structure (formula (II)), wherein...
|
|
WO/2019/036811A1 |
A miR-1983 inhibitor comprising an anti-miR-1983 oligonucleotide that is complementary to at least part of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1), the part comprising at least nucleotides 2 to 8 of CTCACCTGGAGCATGTTTTCT (SEQ ID NO: 1).
|
|
WO/2019/036859A1 |
Provided are a GLP-1 analogue mGLP-1 having an amino acid sequence as shown in SEQ ID NO: 4, and a recombinant expression vector that can secrete and express GLP-1 in food-grade lactic acid bacteria and a protein expression system secret...
|
|
WO/2019/036503A1 |
The present invention provides novel pharmaceutical compositions comprising -(4-Chloro-2-(morpholin-4-yl)thiazol-5-yl)-7-(1-ethylpropyl)
-2,5-dimethylpyrazolo(1,5-a)pyrimidine and methods of using the same for the treatment of Congenital...
|
|
WO/2019/028503A1 |
The present invention relates to novel methods and therapies for treating, preventing or delaying the onset of type 1 diabetes. In one aspect, the invention provides a method of preventing, delaying the onset of, or delaying the progress...
|
|
WO/2019/032921A1 |
This application generally relates to the field of methods, systems and compositions for addressing diseases associated with apoptotic cell death, including autoimmune diseases and inflammatory diseases, and more particularly to such met...
|
|
WO/2019/029578A1 |
The invention provides novel pharmaceutical compositions of berberine or a derivative or analog of berberine, or a salt thereof, in combination with one or more omega-3 fatty acids or esters thereof, and methods of their use in treating ...
|
|
WO/2019/023791A1 |
An aqueous formulation comprising levothyroxine or a pharmaceutically acceptable salt thereof and one or more pharmaceutically acceptable excipients and methods of using such formulation to treat a subject.
|
|
WO/2019/024249A1 |
A placental extract biological gel preparation for treating premature ovarian failure, and a method of preparing same. The placental extract biological gel preparation is obtained from a gel base and placental extract, said extract servi...
|
|
WO/2019/024250A1 |
A placental extract and a preparation method therefor. The preparation method comprises: freezing placental tissue, extracting effective ingredients, and purifying said ingredients to obtain the final product. The placental extract may b...
|
|
WO/2019/023481A1 |
Compounds of Formula (I) are provided herein. Such compounds, as well as pharmaceutically acceptable salts and compositions thereof, are useful for treating diseases or conditions, including conditions characterized by excessive cellular...
|
|
WO/2019/017937A1 |
The invention includes compositions and methods related to multimodal therapies, e.g., for treating cardiovascular diseases and metabolic disorders. A multimodal therapy described herein provides and/or administers a plurality of agents ...
|
|
WO/2019/010583A1 |
Methods and uses for treating a neurodevelopmental disorder such as Rett Syndrome are provided. In particular, the present disclosure provides methods and uses relating to treating a subject with the neurodevelopmental disorder by target...
|
|
WO/2017/084631A9 |
A composition for preventing or treating pancreas fatty infiltration and relieving pancreatic lesions, diabetes or other related symptoms caused by the pancreas fatty infiltration, and a method.
|
|
WO/2019/002015A1 |
The invention relates to novel steroidal 17-beta heteroaryl compounds as AKR1C3 inhibitors, to the use thereof for the treatment and/or prophylaxis of diseases and to the use thereof for the production of medicaments for treatment and/or...
|
|
WO/2019/004088A1 |
The present invention addresses the problem of providing a mucoadhesive oral preparation which shows a high drug absorption rate and a high drug release speed. As a means for solving this problem, provided is a mucoadhesive oral preparat...
|
|
WO/2018/234255A1 |
The invention relates to the use of at least one strain of Lactobacillus plantarum in a method for increasing the numbers of Oscillospira spp. in a subject and preferably maintaining the increased numbers, the method comprising administe...
|
|
WO/2018/230588A1 |
As a cell-sealing device with which it is possible to seal a larger cell mass due to sufficient oxygen being supplied to cells in an implant part, there is provided a cell-sealing device in which a plurality of capsule-form structures, i...
|
|
WO/2018/224736A2 |
The invention relates to compounds of formula (I) and pharmaceutically acceptable salts thereof (I) wherein R1 to R4 are as defined in the claims. The invention further relates to their use as inhibitors of 17β-HSD1 and in treatment or ...
|
|
WO/2018/220623A1 |
Disclosed is a three-dimensional (3D) cell cluster comprising transdifferentiated adult mammalian non-pancreatic beta cells having a mature pancreatic beta cell phenotype and function, wherein the transdifferentiated cells have an enhanc...
|
|
WO/2018/221679A1 |
This 6H-thieno[2,3-e][1,2,4]triazolo[3,4-c][1,2,4]triazepine derivative or a salt thereof has BRD4 inhibitory activity and is therefore useful as a drug, especially as an agent to prevent and/or treat diseases involving BRD4.
|
|
WO/2018/209415A1 |
The present invention falls within the fields of pharmacy, medicine, chemistry and biotechnology. The compound of the present invention is a peptide and has shown surprising stability and ease of handling in comparison to the most simila...
|
|
WO/2018/210207A1 |
A compound as represented by formula (I), and optical isomers, solvates, pharmaceutically-acceptable salts, or prodrugs thereof. The present invention has urate transporter 1 (URAT1) inhibitory activity, can be used for treatment of gout...
|
|
WO/2018/213772A1 |
Methods of treating a testosterone deficiency or its symptoms with a pharmaceutical formulation of testosterone esters are provided. The methods are designed to provide optimum plasma testosterone levels over an extended period.
|
|
WO/2018/206959A1 |
The present invention relates to orexin receptor antagonists, pharmaceutical compositi comprising the antagonists, methods of making the antagonists, their use for the modulation of the orexin receptor, and to use of the antagonists as m...
|
|
WO/2018/206956A1 |
The present invention relates to orexin receptor antagonists, pharmaceutical compositions comprising the antagonists, methods of making the antagonists, their use for the modulation of the orexin receptor, and to use of the antagonists a...
|
|
WO/2018/207171A1 |
The present invention discloses bimodal modified release fixed-dose combination (FDC) compositions and therapeutic methods for treatment of cancer by administration to a patient in need thereof of a FDC composition comprising a first act...
|
|
WO/2018/203048A1 |
The invention relates to a silyl-containing polymer that is used, together with a tackifying resin to form an adhesive composition capable of storing and delivering drugs to the skin of a user. Typically the composition is formed into a ...
|
|
WO/2018/199166A1 |
The purpose of the present invention is to provide: compounds having a TrkA inhibiting effect, or pharmacologically acceptable salts thereof, or solvates of these; pharmaceutical compositions characterized by containing these as an activ...
|
|
WO/2018/197698A1 |
The present invention provides novel softgel capsules of a women health care hormone, as well as to a process for the preparation thereof. In particular, the present invention relates to novel softgel capsules of a women health care horm...
|
|
WO/2018/189212A1 |
The invention relates to non-deliquescent acid addition salts of elagolix with strong acids, for example selected from the group consisting of sulfuric acid and hydrochloric acid, to processes for their preparation and to a pharmaceutica...
|
|
WO/2018/189213A1 |
The invention relates to an amorphous solid dispersion comprising elagolix sodium and at least one silicon-based inorganic compound and to a process for preparing the same. Furthermore, it relates to a pharmaceutical composition comprisi...
|
|
WO/2018/191522A1 |
The present disclosure provides methods of treating polycystic ovary syndrome (PCOS) with tetrahydro-iso-alpha acid (THIAA) derivatives and substantially enantiomerically pure compositions and pharmaceutical formulations thereof, in part...
|
|
WO/2018/184523A1 |
A composition comprising a grape seed extract and a black tea extract. The composition can increase testosterone secretion more effectively than a single component, and can be used for preparing pharmaceutical compositions, foods, health...
|
|
WO/2018/185131A2 |
This invention is in the field of protein conjugates. More specifically the invention relates to oligomer extended insulins with covalently attached Fc monomer polypeptides, for use in the treatment of a metabolic disorder or condition, ...
|
|
WO/2018/184115A1 |
Compounds comprising quinazolinone derivatives and methods of identification and use of imaging agents. The compounds have the general formula I: wherein R2 is selected from halogen, halosubstituted alkyl, alkyl, hydroxyl-alkyl, and amin...
|
|
WO/2018/186366A1 |
The present invention addresses the problem of providing a novel cyclin-dependent kinase 8 and/or 19 inhibitor that is useful as an anticancer agent. The present invention relates to a cyclin-dependent kinase 8 and/or 19 inhibitor that c...
|
|
WO/2018/186953A1 |
Described are macro-capsules and barriers that can be used to prepare therapeutic cell implants, methods of encapsulating therapeutic cells, and methods of using the encapsulated cells in the treatment of disease.
|
|
WO/2018/177993A1 |
The invention relates, inter alia, to compounds of general formula (I). The invention also relates to methods for synthesizing the compounds of formula (I). The compounds according to the invention are in particular suitable for controll...
|
|
WO/2018/177381A1 |
The invention relates to the field of pharmaceutical chemistry, and particularly relates to a compound represented by formula (I), a preparation method thereof, and a medical use thereof. In the compound represented by formula (I), a lac...
|
|
WO/2018/174283A1 |
Provided is a sustained-release formulation of evocalcet or a pharmacologically acceptable salt thereof. A polyethylene glycol derivative of evocalcet or a pharmacologically acceptable salt thereof is used.
|
|
WO/2018/168879A1 |
[Problem] To provide a composition having an estrogen-like action which comprises a hot water extract of Sparassis crispa mycelia.
|
|
WO/2018/166468A1 |
Disclosed are an IgG-like long-acting immune fusion protein and the use thereof. The IgG-like long-acting immune fusion protein consists of an effector molecule and a constant region of an IgG antibody, and the effector molecule is linke...
|
|
WO/2018/166494A1 |
The present disclosure relates to the use of a compound as shown in formula (I), a stereoisomer thereof, or a pharmaceutically acceptable salt thereof in the preparation of a drug for treating diabetes mellitus, or the use of same in the...
|
|
WO/2018/165933A1 |
Polypeptide for regulating saccharometabolism and uses thereof in the preparation of drugs for treating diseases related to saccharometabolism. The polypeptide can reduce blood sugar, can promote insulin secretion, can be used in the pre...
|
|
WO/2018/159522A1 |
Provided is a food composition for preventing or alleviating metabolic syndrome, the food composition containing, as active ingredients, a 67 kDa laminine receptor (67LR) agonist and a sulfur-containing compound found from an allium plan...
|
|
WO/2018/157202A1 |
The present invention is a delivery system for sublingual and/or buccal delivery comprising at least one functional oil (i.e. acting as an oil delivery base); at least one surfactant; and at least one pharmaceutically active agent. The i...
|
|
WO/2018/155622A1 |
By suppressing the loss of living cells or living tissue during the production of a PVA gel that contains living cells or living tissue, the present invention addresses the problem of supplying a cell- or tissue-embedding device that has...
|
