Login| Sign Up| Help| Contact|

Patent Searching and Data

Document Type and Number:
WIPO Patent Application WO/2017/025918
Kind Code:
The present invention relates to 5-bromo-2,6-di-(1 H-pyrazol-1-yl)pyrimidin-4-amine, its pharmaceutically acceptable salts and co-crystals thereof and to pharmaceutical compositions comprising said compounds for use in the treatment of cancer.

Application Number:
Publication Date:
February 16, 2017
Filing Date:
August 10, 2016
Export Citation:
Click for automatic bibliography generation   Help
International Classes:
A61K31/506; A61K39/395; A61K45/06; A61P35/00; C07K16/28
Domestic Patent References:
Foreign References:
Other References:
AKIO OHTA ET AL: "A2A adenosine receptor protects tumors from antitumor T cells", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES, NATIONAL ACADEMY OF SCIENCES, US, vol. 103, no. 35, 29 August 2006 (2006-08-29), pages 13132 - 13137, XP007915452, ISSN: 0027-8424, [retrieved on 20060817], DOI: 10.1073/PNAS.0605251103
Attorney, Agent or Firm:
NOVARTIS AG (4056 Basel, CH)
Download PDF:

1- A combination product comprising a therapeutically effective amount of a compound of formula (I):

or a pharmaceutically acceptable salt or co-crystal thereof and one or more immunotherapeutic agents selected from the group consisting of an anti-CTLA4 antibody, an anti-PD-1 antibody and an anti-PD-Ll antibody.

2. A method of treating cancer comprising administering to a subject in need thereof, a therapeutically effective amount of a compound of formula (I):


or a pharmaceutically acceptable salt or co-crystal thereof; alone or in combination with one or more immunotherapeutic agents selected from the group consisting of anti-CTLA4 antibodies, anti-PD-1 antibodies and anti-PD-Ll antibodies.

3. A compound of Formula (I):

the combination product according to claim 1 for the treatment of cancer.

4. The method of claim 2 or the compound or combination product for use according to claim 3 wherein the cancer is lung cancer.

5. The method of claim 2 or the compound or combination product for use according to claim 3, wherein the cancer is non-small cell lung cancer.

6- The method according to claim 2, 4 or 5 or the compound or combination product for use according to claim 3, 4 or 5 wherein the immunotherapeutic agent is selected from the group consisting of: ipilimumab, tremelimumab, nivolumab, pembrolizumab, CT-011, AM P-224, M PDL3280A, MEDI4736 and M DX-1105.

7- The method according to claim 2, 4 or 5 or the compound or combination product for use according to claim 3, 4 or 5 wherein the immunotherapeutic agent is selected from the group consisting of MPDL3280A, MEDI4736 and MDX-1105.

8- The method according to claim 2, 4 or 5 or the compound or combination product for use according to claim 3, 4 or 5 wherein the immunotherapeutic agent is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab and AM P-224.

9- The method according to claim 2, 4 or 5 or the compound or combination product for use according to claim 3, 4 or 5 wherein the immunotherapeutic agent is an anti-PD-1 antibody.

10- The method or the compound or combination product for use according to claim 9 wherein the anti PD-1 antibody comprises:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 4, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a light chain variable region (VL) comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33; or (d) a VH comprising a VHCD 1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

11- The method or the compound or combination product for use according to claim 9 wherein the anti PD-1 antibody comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 70.

12- The method or the compound or combination product for use according to claim 9 wherein the anti-PD-1 antibody comprises: a heavy chain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

13- The method or the compound or combination product for use according to any one of claims 9-12 wherein the anti-PD-1 antibody molecule is administered at a dose of about 300 mg once every three weeks.

14- The method or the compound or combination product for use according to any one of claims 9-12 wherein the anti-PD-1 antibody molecule is administered at a dose of about 400 mg once every four weeks.

15- The method according to claim 2, 4 or 5 or the compound or combination product for use according to claim 3, 4 or 5 wherein the immunotherapeutic agent is an anti-PD-Ll antibody.

16- The method or the compound or combination product for use according to claim 15 wherein the anti PD-L1 antibody molecule comprises:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 228, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 225; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232.

17- The method or the compound or combination product for use according to claim 15 wherein the anti-PD-Ll antibody molecule comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 236 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 239.

18- The method or combination product for use according to any one of claims 2-17 wherein the combination of the immunotherapeutic agent is administered together in a single composition or administered separately in two or more different compositions forms.

19- The method or combination product for use according to any one of claims 2-17 wherein the immunotherapeutic agent is administered concurrently with, prior to, or subsequent to, the compound of Formula (I).




The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on May 5, 2016, is named PAT057215-US-PSP_SL.txt and is 207,763 bytes in size.


The present invention relates to 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine, its pharmaceutically acceptable salts and co-crystals thereof and to pharmaceutical compositions comprising said compounds for use in the treatment of cancer, particularly carcinomas, specifically for use in the treatment of lung cancer, and more specifically for use in the treatment of non-small cell lung cancer.

Other objectives of the present invention is to provide methods for the treatment of cancer, particularly carcinomas, specifically lung cancer, and more specifically of non-small cell lung cancer by administration of compound of formula (I), or by administration of a pharmaceutical composition or a combination product comprising compound of formula (I).


Cancer is a major public health problem in worldwide. It is currently the second leading cause of death in the United States and in several developed countries, and is expected to surpass heart diseases as the leading cause of death in the next few years. (Siegel L, et al, Cancer Statistics, 2015, CA Cancer J Clin 2015; 65:5-29. VC 2015 American Cancer Society and references therein).

Cancer is considers a complex disease that is dictated by both cancer cell-intrinsic and cell-extrinsic processes. Several studies conducted in various in vitro and animal models including, for example, lung metastasis, human lung adenocarcinoma cells, murine melanoma cells, murine ovarian cancer cells, murine breast cancer cells, have confirmed that targeting the adenosinergic system has tremendous potential to develop different treatments. A number of lines of evidence highlight the importance of adenosine as a critical regulatory autocrine and paracrine factor that accumulates in the neoplastic microenvironment. Extracellular adenosine, which is usually present at high concentrations in cancer tissues, is a crucial mediator in the alteration of immune cell functions in cancer. This is possibly because the tightly regulated adenosine receptor pathways of immune cells undergo substantial alterations in tumours, thereby switching the functions of these cells from immune surveillance and host defence to the promotion of cancer cell transformation and growth. (Antonioli L et al, Immunity, inflammation and cancer: a leading role for adenosine, Nature, 842, December 2013, Volume 13, and references therein).

As it is known tumors use numerous immunosuppressive mechanisms to facilitate tumor growth (Koebel CM. et al, Adaptive immunity maintains occult cancer in an equilibrium state, Nature. 2007, 450, 7171:903-907 and Schreiber D. et al, Cancer immunoediting: Integrating immunity's roles in cancer suppression and promotion, Science. 2011, 331, 6024:1565-1570). There are studies establishing that one such mechanism was mediated by the catabolism of extracellular AMP into immunosuppressive adenosine (Ohta A. et al, A2A adenosine receptor protects tumors from antitumor T cells. Proc Natl Acad Sci U S A. 2006; 103: 13132-13137 and Ohta A. et al, A2A adenosine receptor may allow expansion of T cells lacking effector functions in extracellular adenosine-rich microenvironments. J Immunol. 2009, 183, 9:5487-5493). Firstly, extracellular ATP will be converted to AMP by the ectoenzyme CD39. Further dephosphorylation of the AMP through the CD73 ectoenzyme will result in extracellular adenosine production.

During this process, activity of adenosine kinase is also suppressed causing the inhibition of salvage activity of this enzyme and an increase in adenosine levels. For example, under hypoxic conditions during inflammation or within tumor microenvironment, inhibition of adenosine kinase causes 15-20-fold increase in both extracellular as well as intracellular levels of adenosine (Decking UK. Et al, Hypoxia-induced inhibition of adenosine kinase potentiates cardiac adenosine release. Circ. Res. 1997; 81(2):154-164. doi: 10.1161/01.RES.81.2.154). The generated extracellular adenosine binds to four known cell surface receptors (Al, A2A, A2B, and A3) that are expressed on multiple immune subsets including T cells, natural killer (NK) cells, natural killer T cells, macrophages, dendritic cells, and myeloid-derived suppressor cells (M DSCs). The A2A and A2B receptor subtypes are essentially responsible for the immunosuppressive effects of adenosine. They share a common signalling pathway, both resulting in the activation of adenylate cyclase and the accumulation of intracellular cAMP. Several evidences have been further provided demonstrating that the intracellular cAMP is the signalling molecule that inhibits T-cell receptor signalling at early and late stages of T-cell receptor-triggered T-cell activating pathway. (Ohta A, Sitkovsky M, Role of G-protein-coupled adenosine receptors in downregulation of inflammation and protection from tissue damage, Nature, 2001, 414: 916-920).

It has been suggested that the elimination of A 2 a receptor genetically or the inhibition of A 2 a receptor signalling using A 2 a receptor antagonists prevents inhibition of anti-tumour T cells and improves tumour rejection (Ohta A. et al, A 2 a adenosine receptor protects tumors from antitumor T cells. Proc Natl Acad Sci U S A. 2006; 103: 13132-13137).

A 2 a receptor functions as a non-redundant negative regulator of activated T cells to protect normal tissues from excessive collateral inflammatory damage. It has been proposed that A 2 a receptor may also 'misguidedly' protect cancerous tissues. It was reasoned that if this were indeed the case, then the genetic inactivation or pharmacological antagonism of A 2 a receptor would prevent the inhibition of anti-tumour T cells and thereby improve tumour rejection by these de-inhibited T cells (Sitkovsky M. et al, Adenosine A 2 a receptor antagonists: blockade of adenosinergic effects and T regulatory cells, British Journal of Pharmacology, 2008, 153, S457-S464).

Lung cancer is the leading cause of cancer death around the world and it has been the most common cancer worldwide since 1985, both in terms of incidence and mortality. Globally, lung cancer is the largest contributor to new cancer diagnoses (12.4% of total new cancer cases) and to death from cancer (17.6% of total cancer deaths).

Lung cancer arises from the cells of the respiratory epithelium and can be divided into two broad categories. Small cell lung cancer (SCLC) is a highly malignant tumor derived from cells exhibiting neuroendocrine characteristics and accounts for 15% of lung cancer cases. Non-small cell lung cancer (NSCLC), which accounts for the remaining 85% of cases, is further divided into 3 major pathologic subtypes: adenocarcinoma, squamous cell carcinoma, and large cell carcinoma. Adenocarcinoma by itself accounts for 38.5% of all lung cancer cases, with squamous cell carcinoma accounting for 20% and large cell carcinoma accounting for 2.9%. In the past several decades, the incidence of adenocarcinoma has increased greatly, and adenocarcinoma has replaced squamous cell carcinoma as the most prevalent type of NSCLC. (De la Cruz, C et al, Lung Cancer: Epidemiology, Etiology, and Prevention, Clin Chest Med. 2011 December; 32(4)).

Particularly, in the case of NSCLC, disease stage determines the treatment, which includes surgery, radiation, platinum-based doublet chemotherapy and recently targeted therapies by interrupting signaling pathways responsible for cell proliferation and survival. Earlier stages of the disease benefit from systemic chemotherapy (platinum-doublet, taxanes, gemcitabine, pemetrexed) (Azzoli CG. et al, 2011 Focused Update of 2009 American Society of Clinical Oncology Clinical Practice Guideline Update on Chemotherapy for Stage IV Non-Small- Cell Lung Cancer, J Oncol Pract. 2012; 8:63-6 doi:10.1200/JOP.2011.000374), that results in modest efficacy, thus, multimodal therapeutic strategy has become an important treating option for NSCLC patients. In several studies, two or more drug combinations were proven to have superior efficacy but at the expense of added toxicity (Yoshida T. et al, Comparison of adverse events and efficacy between gefitinib and erlotinib in patients with non-small-cell lung cancer: a retrospective analysis, Med Oncol. 2013; 30:349).

Recently, several approaches are being developed to boost anticancer responses of T- cells and restore their ability to detect and attack cancer cells among them mAbs blocking the cytotoxic lymphocyte-associated antigen 4 (CTLA4) and the programmed cell death protein 1 (PD-l)-mediated T-cell events have been developed.

Ipilimumab, a fully human mAb against CTLA4, has shown a trend toward greater clinical benefit among patients with SQCLC (Lynch TJ. et al, Ipilimumab in combination with paclitaxel and carboplatin as first-line treatment in stage IIIB/IV non-small-cell lung cancer: Results from a randomized, double-blind, multicenter phase II study, J Clin Oncol.2012; 30: 2046-54). The PD-1 mAbs (MEDI4735, BMS-936558, BMS-936559) have demonstrated remarkable sustained tumour regressions in the heavily pre-treated advanced NSCLC patients (Brahmer JR. et al, Safety and activity of anti-PD-Ll antibody in patients with advanced cancer, N Engl J Med. 2012; 366: 2455-65).

There are studies showing the alterations provoking changes in the extracellular tumor microenvironment. One of such extracellular alterations is the increased adenosine concentrations, which impair T cell mediated rejection and support angiogenesis. The study showed a significant number of lung adenocarcinomas expressing adenosine A 2 a receptor, supporting tests of adenosine A 2 a receptor antagonists as anticancer therapies. (Mediavilla- Varela, M et al, Antagonism of adenosine A 2 a receptor expressed by lung adenocarcinoma tumor cells and cancer associated fibroblasts inhibits their growth, Cancer Biology & Therapy, September 2013, 14:9, 860-868).

Despite the development of new therapeutics, NSCLC still has a 5-year survival rate in only 14% implying the need for the continuing research for novel treatments (Spira A. et al, Multidisciplinary management of lung cancer, N Engl J Med. 2004; 350:379-92 doi: 10.1056/NEJMra035536).


There remains a need for new treatments and therapies for the treatment of cancer. International patent application WO 2011/121418 Al discloses a group of 4-aminopyrimidine derivatives as antagonists of the A 2 a receptors and their use in the treatment of conditions or diseases susceptible of amelioration by antagonism of said adenosine receptors. Although treatment of cancer is not specifically recited in WO 2011/121418 Al, the inventors have investigated the effectiveness of the compounds described in WO 2011/121418 Al in the treatment of cancer and have unexpectedly found that not all the A2A antagonists covered by the claims of WO 2011/121418 Al are effective in the treatment of cancer, particularly carcinomas, in particular lung cancer.

The inventors of the current invention have now surprisingly found that 5-bromo-2,6- di-(lH-pyrazol-l-yl)pyrimidin-4-am


is significantly more efficacious for the treatment of cancer, particularly carcinomas, more specifically lung cancer, and more specifically non-small cell lung cancer, in comparison with other adenosine A 2 a receptor antagonists disclosed in said patent application WO 2011/121418 Al. Additionally, the compound of formula (I) has demonstrated a synergistic effect with other immunotherapeutic agents to stimulate the immune system for the treatment of cancer.

In one aspect the present invention provides 5-bromo-2,6-di-(lH-pyrazol-l- yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salts and co-crystals thereof for use in the treatment of cancer, particularly carcinomas, more specifically lung cancer, and more specifically non-small cell lung cancer. 5-bromo-2,6-di-(lH-pyrazol-l- yl)pyrimidin-4-amine has the ability to boost the immune system and to block one of the evasion mechanism used by the tumors. Another advantage is given by the low toxicity profile of said compound, already tested in different animal models in comparison with classical chemotherapy and with other adenosine receptor antagonists known in the state of the art. Another differential point is the possibility to be administered orally.

The present invention relates to 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine, its pharmaceutically acceptable salts and co-crystals thereof, to pharmaceutical compositions comprising said compounds and to combinations of said compound with one or more immunotherapeutic agents useful in the treatment of cancer, for use in the treatment of cancer, particularly for use in the treatment of carcinomas, specifically for use in the treatment of lung cancer, and more specifically for use in the treatment of non-small cell lung cancer.

The invention further provides methods of treating, preventing, or ameliorating cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula I; or a pharmaceutically acceptable salt thereof. Furthermore, the invention provides methods of treating, preventing, or ameliorating cancer, comprising administering to a subject in need thereof an effective amount of a compound of Formula I; or a pharmaceutically acceptable salt thereof, with one or more immunotherapeutic agents as described herein.

In another embodiment, the invention provides a combination, in particular a pharmaceutical combination, comprising a therapeutically effective amount of the compound according to the definition of formula (I), or a pharmaceutically acceptable salt thereof or co- crystals thereof, and one or more immunotherapeutically active agent as described herein.

In another embodiment, the invention pertains to the use of a pharmaceutical combination, comprising a therapeutically acceptable amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof or co-crystals thereof, and one or more

immunotherapeutically active agent, for the manufacture of a medicament for treating cancer.

Kits, e.g. therapeutic kits, that include the immunotherapeutic agent and the compound of Formula (I), and instruction for use, are also disclosed.

In one embodiment, a combination described herein includes as immunotherapeutic agent, a PD-1 inhibitor. In some embodiments, the combination is used to treat a cancer, e.g., a cancer described herein, e.g., a solid tumor or a hematologic malignancy.

In one aspect of the embodiment, the PD-1 inhibitor is an anti-PD-1 antibody molecule which is selected from Nivolumab, Pembrolizumab and Pidilizumab.

In another aspect of above embodiment, the PD-1 inhibitor is anti-PD-1 antibody molecule which is disclosed in US 2015/0210769, published on July 30, 2015, entitled

"Antibody Molecules to PD-1 and Uses Thereof," incorporated by reference in its entirety.

In yet another embodiment, a combination described herein includes as

immunotherapeutic agent, a PD-L1 inhibitor. In some embodiments, the combination is used to treat a cancer, e.g., a cancer described herein, e.g., a solid tumor or a hematologic malignancy.

In one aspect of the above embodiment, the PD-L1 inhibitor is an anti- PD-L1 antibody selected from YW243.55.S70, MPDL3280A, MEDI-4736, MSB-0010718C, and MDX-1105.

In another aspect of the above embodiment, the PD-L1 inhibitor is an anti-PD-Ll antibody molecule disclosed in US 2016/0108123, filed October 13, 2015, entitled "Antibody Molecules to PD-L1 and Uses Thereof," incorporated by reference in its entirety. DESCRIPTION OF THE FIGURES

Figure la shows the anti-tumoral activity of orally administered Compound of formula (I) in two syngeneic mouse models of cancer, (mean lung nodules of 9-10 mice/group ± standard errors are shown; *: P < 0.05 by Student T test).

Figures lb and lc show the anti-tumoral activity of orally administered Compound A and Compound B in two syngeneic mouse models of cancer, (mean lung nodules of 9- 10 mice/group ± standard errors are shown; *: P < 0.05 by Student T test).

Figures 2 shows the ability of the combination of the compound of formula (I) and the anti-PD-Ll antibody to significantly increase the interferon gamma secretion of non- stimulated lung tumor cells.

Figure 3 shows that the interferon gamma secretion from lung tumor cells stimulated with IL-2 can be significantly increased by treatment with compound of formula (I). The effect is more pronounced when the cells are treated with the combination of compound of formula (I) and the anti-PD-1 antibody.

Figures 4-7 show that neither the treatment of tumor cells stimulated with IL-2 with compound A or compound B, or with the corresponding combination of compounds A or B with anti-PD-Ll or anti-PD-1 antibodies is able to increase the amount of produced interferon gamma.

Figures 8a - 8g show results related to secretion of different interleukins (IL-5, IL-17, IL- lb, IL-13, IL-10, TNFct and MIP lb) to the medium, due to the stimulation with the compound of formula (I).

Figure 9 depicts the structural analysis of the humanized BAP049 clones (a, b, c, d and e represent various types of framework region sequences). The concentratiosn of the mAbs in the samples are also shown

Figure 10 depicts the ranking of humanized BAP049 clones based on FACS data, competition binding and structural analysis. The concentrations of the mAbs in the samples are also shown.

The following abbreviations are used in the legends of Figures 2-8:

Tu = Lung tumor cells (without treatment); IFNg = Interferon gamma; ILlb = Interleukin-lb; IL13 = lnterleukin-13; IL10 = lnterleukin-10; IL5 = lnterleukin-5; IL17 = lnterleukin-17; TNFa = Tumor Necrosis Factor alfa; MlPlb = Macrophage Inflammatory Protein lbeta. Anti-PD-Ll = human monoclonal antibody against the PD-L1 receptor Functional Grade Purified 100 μg purchased from eBioscience , #16-5983-82.

Anti-PD-1 = human monoclonal antibody against the PD-1 receptor Functional Grade Purified 100 μg purchased from eBioscience, #16-9989-82.


In one aspect the present invention relates to 5-bromo-2,6-di-(lH-pyrazol-l- yl)pyrimidin-4-amine of formula (I)


its pharmaceutically acceptable salts or co-crystals thereof for use in the treatment of cancer, particularly carcinomas specifically lung cancer, and more specifically non-small cell lung cancer.

In another aspect the present invention relates to the use of 5-bromo-2,6-di-(lH- pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salts or co- crystals thereof for the manufacture of a medicament for the treatment of cancer, particularly carcinomas, more specifically lung cancer, and more specifically non-small cell lung cancer.

In yet another aspect the present invention relates to the use of a pharmaceutical composition comprising 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salt or co-crystals thereof for use in the treatment of cancer, particularly carcinomas, specifically lung cancer, and more specifically non-small cell lung cancer.

In yet another aspect the present invention relates to the use of a pharmaceutical composition comprising 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salt or co-crystals thereof for the manufacture of a medicament for treating cancer, particularly carcinomas, specifically lung cancer, and more specifically non- small cell lung cancer.

In still another aspect the present invention relates to a pharmaceutical combination comprising 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salts or co-crystals thereof and one or more immunotherapeutic agent useful in the treatment of cancer

In yet another aspect the present invention relates to a combination as described herein for use in the treatment of cancer, particularly carcinomas, specifically lung cancer, and more specifically non-small cell lung cancer.

In still another aspect the present invention relates to the use of a pharmaceutical combination comprising 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salts or co-crystals thereof and one or more immunotherapeutic agent useful in the treatment of cancer, for the manufacture of a medicament for treating cancer.

In yet another aspect of the present invention refers to methods for the treatment of cancer, particularly carcinomas, specifically lung cancer, and more specifically non-small cell lung cancer, by administration of:

A compound of formula (I) or a pharmaceutically acceptable salts or co-crystals thereof, or

A pharmaceutical composition comprising compound of formula (I) or a pharmaceutically acceptable salts or co-crystals thereof, or

A combination product comprising compound of formula (I) or a pharmaceutically acceptable salt or co-crystals thereof.

In a preferred embodiment 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salt or co-crystals thereof, the combinations comprising said compounds and one or more immunotherapeutic agents useful in the treatment of cancer and the pharmaceutical compositions comprising said compounds are used in the treatment of lung cancer, more preferably non-small cell lung cancer.

In a preferred embodiment of the present invention, the combination product comprising compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof is for use in the treatment of lung cancer, specifically non-small cell lung cancer. In a more preferred embodiment of the present invention, the combination product comprising compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and an anti-PD-Ll antibody, such as MPDL3280A, MEDI4736, MDX-1105 or an anti-PD-Ll antibody described in US 2016/0108123-A1, is for use in the treatment of lung cancer, specifically non- small cell lung cancer. According to another embodiment of the present invention, the combination product comprising compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and an anti-PD-1 antibody, such as M DX-1106, M K3475, CT-011, AM P-224 or an anti-PD-1 antibody molecule as described in WO2015/112900, is for use in the treatment of lung cancer, specifically non-small cell lung cancer.

The present invention may be employed in respect of human or animal subject, more preferably a mammal, more preferably a human subject.


As used in the present document the term cancer is used to designate a group of diseases involving abnormal cell growth with the potential to invade or spread to other parts of the body. Cancers are classified by the type of cell that the tumor cells resemble and is therefore presumed to be the origin of the tumor. These types include carcinoma, sarcoma, lymphoma and leukemia, germ cell tumor and blastoma.

As used in the present document the term carcinoma is used to designate cancers derived from epithelial cells. This group includes many of the most common cancers, particularly in the aged, and include nearly all those developing in the breast, prostate, lung, pancreas, and colon.

For example the term "cancer" includes but is not limited to, a solid tumor, a hematological cancer (e.g., leukemia, lymphoma, myeloma, e.g., multiple myeloma), and a metastatic lesion. In one embodiment, the cancer is a solid tumor. Examples of solid tumors include malignancies, e.g., sarcomas and carcinomas, e.g., adenocarcinomas of the various organ systems, such as those affecting the lung, breast, ovarian, lymphoid, gastrointestinal (e.g., colon), anal, genitals and genitourinary tract (e.g., renal, urothelial, bladder cells, prostate), pharynx, CNS (e.g., brain, neural or glial cells), head and neck, skin (e.g., melanoma), and pancreas, as well as adenocarcinomas which include malignancies such as colon cancers, rectal cancer, renal-cell carcinoma, liver cancer, non-small cell lung cancer, cancer of the small intestine and cancer of the esophagus. The cancer may be at an early, intermediate, late stage or metastatic cancer.

In one embodiment, the cancer is chosen from a lung cancer (e.g., a non-small cell lung cancer (NSCLC) (e.g., a NSCLC with squamous and/or non-squamous histology, or a NSCLC adenocarcinoma)), a melanoma (e.g., an advanced melanoma), a renal cancer (e.g., a renal cell carcinoma), a liver cancer, a myeloma (e.g., a multiple myeloma), a prostate cancer, a breast cancer (e.g., a breast cancer that does not express one, two or all of estrogen receptor, progesterone receptor, or Her2/neu, e.g., a triple negative breast cancer), a colorectal cancer, a pancreatic cancer, a head and neck cancer (e.g., head and neck squamous cell carcinoma (H NSCC), anal cancer, gastro-esophageal cancer, thyroid cancer, cervical cancer, a

lymphoproliferative disease (e.g., a post-transplant lymphoproliferative disease) or a hematological cancer, T-cell lymphoma, B-cell lymphoma, a non-Hogdkin lymphoma, or a leukemia (e.g., a myeloid leukemia or a lymphoid leukemia).

In another embodiment, the cancer can be, e.g., a cancer described herein, such as lung cancer (squamous), lung cancer (adenocarcinoma), head and neck cancer, cervical cancer (squamous), stomach cancer, thyroid cancer, melanoma, nasopharyngeal cancer (e.g., differentiated or undifferentiated metastatic or locally recurrent nasopharyngeal carcinoma), or breast cancer.

In another embodiment, the cancer is chosen form a carcinoma (e.g., advanced or metastatic carcinoma), melanoma or a lung carcinoma, e.g., a non-small cell lung carcinoma.

In one embodiment, the cancer is a lung cancer, e.g., a non-small cell lung cancer or small cell lung cancer.

As used in the present document the term lung cancer (also known as carcinoma of the lung or pulmonary carcinoma) is used to designate malignant lung tumors characterized by uncontrolled cell growth in tissues of the lung.

As used in the present document the term non-small-cell lung carcinoma (NSCLC) is used to designate any type of lung cancer other than small cell lung carcinoma (SCLC).

As used in the present document the term immunotherapeutic treatment refers to a broad class of therapies designated to elicit immune-mediated destruction of tumor cells. In said therapies are used immunotherapeutic agents.

As used in the present document the term immunotherapeutic agents refer to compounds useful to carrying out immunotherapeutic treatment of cancer, such as agent selected from the group consisting of anti-CTLA4 antibodies, such as Ipilimumab and Tremelimumab, anti-PD-1 antibodies such as M DX-1106, M K3475, CT-011, AM P-224 or an anti- PD-1 antibody molecule as described in WO2015/112900; and anti-PD-Ll antibodies such as M EDI4736, M DX-1105 or an anti-PD-Ll antibody described in US 2016/0108123.

As used herein, the term "Programmed Death 1" or "PD-1" include isoforms, mammalian, e.g., human PD-1, species homologs of human PD-1, and analogs comprising at least one common epitope with PD-1. The amino acid sequence of PD-1, e.g., human PD-1, is known in the art, e.g., Shinohara T et al. (1994) Genomics 23(3):704-6; Finger L , et al. Gene (1997) 197(l-2):177-87.

As used herein, the term "Programmed Death Ligand 1" or "PD-L1" include isoforms, mammalian, e.g., human PD-L1, species homologs of human PD-1, and analogs comprising at least one common epitope with PD-L1. The amino acid sequence of PD-L1, e.g., human PD-1, is known in the art, e.g., Dong et al. (1999) Nat Med. 5(12):1365-9; Freeman et al. (2000) J Exp Med. 192(7):1027-34).

As used herein, the term co-crystals is used to designate crystalline materials composed of two or more molecules in the same crystal lattice, more particularly co-crystals formed by a molecule of 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine of formula (I), its pharmaceutically acceptable salt and a pharmaceutically acceptable mono- di- or tri-carboxylic acid such as mandelic, benzoic, acetic, l-hydroxy-2-naphthoic, pyroglutamic, benzoic, formic, hippuric, lactic, propionic, glucuronic, pyruvic, sorbic, butyric, valeric, caproic, caprylic, glycolic, salicylic, fumaric, maleic, malic, oxalic, succinic, tartaric, malonic, gluconic, glutaric, adipic, pimelic, glutamic, mesaconic, citraconic, itaconic, mucic, phthalic, oxalacetic, aspartic, glutamic, acetoacetic, levulinic, citric, isocitric, aconitic, propane-l,2,3-tricarboxylic, more preferably a pharmaceutically acceptable dicarboxylic acid such as fumaric, maleic, malic, oxalic, succinic, tartaric, malonic, gluconic, glutaric, adipic, pimelic, glutamic, mesaconic, citraconic, itaconic, mucic, phthalic, oxalacetic, aspartic, glutamic, acetoacetic and levulinic, and more specifically with succinic, fumaric and phthalic acids.

As used herein, the terms "salt" or "salts" refers to an acid addition or base addition salt of a compound of the invention. "Salts" include in particular "pharmaceutical acceptable salts". The term "pharmaceutically acceptable salts" refers to salts that retain the biological effectiveness and properties of the compounds of this invention and, which typically are not biologically or otherwise undesirable. In many cases, the compounds of the present invention are capable of forming acid and/or base salts by virtue of the presence of amino and/or carboxyl groups or groups similar thereto.

Pharmaceutically acceptable acid addition salts can be formed with inorganic acids and organic acids. Examples of inorganic acid include hydrochloric, sulphuric, phosphoric, diphosphoric, hydrobromic, hydroiodic and nitric acid and examples of organic acids include citric, fumaric, maleic, malic, mandelic, ascorbic, oxalic, succinic, tartaric, benzoic, acetic, methanesulphonic, ethanesulphonic, benzenesulphonic or p-toluenesulphonic acid. Pharmaceutically acceptable bases include alkali metal (e.g. sodium or potassium), alkali earth metal (e.g. calcium or magnesium) hydroxides, and organic bases, for example alkyl amines, arylalkyl amines and heterocyclic amines.

Other preferred salts according to the invention are quaternary ammonium compounds wherein an equivalent of an anion (X-) is associated with the positive charge of the N atom. X- may be an anion of various mineral acids such as, for example, chloride, bromide, iodide, sulphate, nitrate, phosphate, or an anion of an organic acid such as, for example, acetate, maleate, fumarate, citrate, oxalate, succinate, tartrate, malate, mandelate, trifluoroacetate, methanesulphonate and ptoluenesulphonate. X- is preferably an anion selected from chloride, bromide, iodide, sulphate, nitrate, acetate, maleate, oxalate, succinate or trifluoroacetate. More preferably, X- is chloride, bromide, trifluoroacetate or methanesulphonate.

As used herein the term "combination" refers to either a fixed combination in one dosage unit form, or a combined administration where a compound of Formula I and a combination partner (i.e. an immunotherapeutic agent) may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The single components may be packaged in a kit or separately. One or both of the components (e.g., powders or liquids) may be reconstituted or diluted to a desired dose prior to administration.

The terms "co-administration" or "combined administration" or the like as utilized herein are meant to encompass administration of the selected combination partner to a single subject in need thereof (e.g. a patient), and are intended to include treatment regimens in which the agents are not necessarily administered by the same route of administration or at the same time.

The term "pharmaceutical combination" and "combination product" are used interchangeably and refers to either a fixed combination in one dosage unit form, or non-fixed combination or a kit of parts for the combined administration where two or more therapeutic agents may be administered independently at the same time or separately within time intervals, especially where these time intervals allow that the combination partners show a cooperative, e.g. synergistic effect. The term "fixed combination" means that the compound of Formula I and a combination partner (i.e. immunotherapeutic agent), are both administered to a patient simultaneously in the form of a single entity or dosage. The term "non-fixed combination" means that the compound of Formula I and a combination partner (i.e. the immunotherapeutic agent), are both administered to a patient as separate entities either simultaneously, concurrently or sequentially with no specific time limits, wherein such administration provides therapeutically effective levels of the two compounds in the body of the patient. The latter also applies to cocktail therapy, e.g. the administration of three or more therapeutic agent. In a preferred embodiment, the pharmaceutical combination is a non-fixed combination.

The term "combination therapy" refers to the administration of two or more therapeutic agents to treat a cancer as described in the present disclosure. Such

administration encompasses co-administration of these therapeutic agents in a substantially simultaneous manner, such as in a single capsule having a fixed ratio of active ingredients. Alternatively, such administration encompasses co-administration in multiple, or in separate containers (e.g., tablets, capsules, powders, and liquids) for each active ingredient. Powders and/or liquids may be reconstituted or diluted to a desired dose prior to administration. In addition, such administration also encompasses use of each type of therapeutic agent in a sequential manner, either at approximately the same time or at different times. In either case, the treatment regimen will provide beneficial effects of the drug combination in treating the conditions or disorders described herein.

As used herein, the term "pharmaceutically acceptable carrier" or "pharmaceutically acceptable vehicle" are used interchangeably and includes any and all solvents, dispersion media, coatings, surfactants, antioxidants, preservatives (e.g., antibacterial agents, antifungal agents), isotonic agents, absorption delaying agents, salts, preservatives, drug stabilizers, binders, excipients, disintegration agents, lubricants, sweetening agents, flavoring agents, dyes, and the like and combinations thereof, as would be known to those skilled in the art (see, for example, Remington's Pharmaceutical Sciences, 18th Ed. Mack Printing Company, 1990, pp. 1289- 1329). Except insofar as any conventional carrier is incompatible with the active ingredient, its use in the therapeutic or pharmaceutical compositions is contemplated.

The term "a therapeutically effective amount" of a compound of the present invention (compound of Formula I) refers to an amount of the compound of Formula I that will elicit the biological or medical response of a subject, for example, reduction or inhibition of an enzyme or a protein activity, or ameliorate symptoms, alleviate conditions, slow or delay disease progression, or prevent a disease, etc. In one non-limiting embodiment, the term "a therapeutically effective amount" refers to the amount of the compound of Formula I that, when administered to a subject, is effective to (1) at least partially alleviate, inhibit, prevent and/or ameliorate a condition, or a disorder or a disease (i) mediated by A 2 a receptor or (ii) associated with A 2 a receptor activity, or (iii) characterized by activity (normal or abnormal) of A 2 a receptor; or (2) reduce or inhibit the activity of A 2 a receptor. In another non-limiting embodiment, the term "a therapeutically effective amount" refers to the amount of the compound of Formula I that, when administered to a cell, or a tissue, or a non-cellular biological material, or a medium, is effective to at least partially reducing or inhibiting the activity of A 2 a receptor; or at least partially reducing or inhibiting the expression of A 2 a receptor.

As used herein, the term "subject" refers to an animal. Typically, the animal is a mammal. A subject also refers to for example, primates (e.g., humans, male or female), cows, sheep, goats, horses, dogs, cats, rabbits, rats, mice, fish, birds and the like. In certain embodiments, the subject is a primate. In yet other embodiments, the subject is a human.

As used herein, the term "treat", "treating" or "treatment" of any disease or disorder refers in one embodiment, to ameliorating the disease or disorder (i.e., slowing or arresting or reducing the development of the disease or at least one of the clinical symptoms thereof). In another embodiment "treat", "treating" or "treatment" refers to alleviating or ameliorating at least one physical parameter including those which may not be discernible by the patient. In yet another embodiment, "treat", "treating" or "treatment" refers to modulating the disease or disorder, either physically, (e.g., stabilization of a discernible symptom), physiologically, (e.g., stabilization of a physical parameter), or both. In yet another embodiment, "treat", "treating" or "treatment" refers to preventing or delaying the onset or development or progression of the disease or disorder.

As used herein, a subject is "in need of" a treatment if such subject would benefit biologically, medically or in quality of life from such treatment.

Combination Therapy

In one embodiment, a pharmaceutical combination (or combination product) comprises a compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof, and one or more immunotherapeutic agents selected from the group consisting of anti-CTLA4 antibodies, such as Ipilimumab and Tremelimumab, anti-PD-1 antibodies such as M DX-1106 (nivolumab), M K3475 (pembrolizumab), CT-011 (pidilizumab), AM P-224 or an anti- PD-1 antibody molecule as described in WO2015/112900 (US2015/0210769); and anti-PD-Ll antibodies such as M PDL3280A, M EDI4736 and M DX-1105 or an anti-PD-Ll antibody molecules are disclosed in US 2016/0108123, filed October 13, 2015, entitled "Antibody Molecules to PD-L1 and Uses Thereof".

The components of the combination product are in the same formulation or in separate formulations.

In a preferred embodiment the combination product comprises a compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof, and one or more immunotherapeutic agent useful in the treatment of cancer, specifically in immunotherapeutic treatment of cancer, such agent is selected from the group consisting of anti-PD-lPD-1 antibodies such as M DX-1106, MK3475, CT-011, AMP-224 or an anti-PD-1 antibody molecule as described in WO2015/112900 (US2015/0210769); and anti-PD-Ll antibodies such as M PDL3280A, MEDI4736, M DX-1105 or an anti-PD-Ll antibody molecules are disclosed in US 2016/0108123.

Example of anti PD-L1 antibody molecule

In one embodiment, the combination product comprises a compound of Formula (I) or a pharmaceutically acceptable salt or co-crystal thereof, and an anti-PD-Ll antibody molecule such as those described herein.

Programmed Death Ligand 1 (PD-L1) has been described as a ligand for the immunoinhibitory receptor Programmed Death 1 (PD-1). Binding of PD-L1 to PD-1 leads to the inhibition of T cell receptor-mediated lymphocyte proliferation and cytokine secretion (Freeman et al. (2000) J Exp Med 192:1027-34). Thus, blocking of PD-L1 can lead to enhancement of antitumor immunity.

Several cell types express PD-L1. For example, PD-L1 is expressed on activated T cells, dendritic cells (DCs), natural killer (NK) cells, macrophages, B cells, monocytes, and vascular endothelium cells. PD-L1 is expressed in many cancers, including human lung, ovarian and colon carcinoma and various myelomas, (Iwai et al. (2002) PNAS 99:12293-7; Ohigashi et al. (2005) Clin Cancer Res 11:2947-53; Okazaki et al. (2007) Intern. Immun. 19:813-24; Thompson et al. (2006) Cancer Res. 66:3381-5). PD-L1 expression strongly correlates with unfavorable prognosis in various types of cancer including kidney, ovarian, bladder, breast, gastric and pancreatic cancer.

Many tumor infiltrating T lymphocytes predominantly express PD-1 compared to T lymphocytes in normal tissues and peripheral blood T lymphocytes. This indicates that up- regulation of PD-1 on tumor-reactive T cells can contribute to impaired antitumor immune responses (Ahmadzadeh et al. (2009) Blood 114:1537-44). Thus, PD-L1 signaling mediated by PD-L1 expressing tumor cells interacting with PD-1 expressing T cells may lead to attenuation of T cell activation and evasion of immune surveillance (Sharpe et al. (2002) Nat Rev Immunol. 2:116-26; Keir et al. (2008) Annu Rev Immunol. 26:677-704). PD-1 blockade can inhibit hematogenous spread of poorly immunogenic tumor cells by enhanced recruitment of effector T cells (Iwai et al. (2005) Int. Immunol. 17:133-144).

Anti-PD-Ll can enhance T-cell immunity, e.g., through blocking both its inhibitory interactions with PD-1 and B7-1. Anti-PD-1 can also allow for immune regulation via PD-L2/PD- 1. Both PD-1 and B7-1 are expressed on T cells, B cells, DCs, and macrophages, which provides potential for bidirectional interactions between B7-1 and PD-L1 on these cell types. PD-L1 on non-hematopoietic cells may interact with B7-1 as well as PD-1 on T cells.

In some embodiments, the anti-PD-Ll antibody molecule is chosen from

YW243.55.S70, MPDL3280A, M EDI-4736, MSB-0010718C, or MDX-1105.

In some embodiments, the anti-PD-Ll antibody is MSB0010718C. MSB0010718C (also referred to as A09-246-2; Merck Serono) is a monoclonal antibody that binds to PD- Ll. MSB0010718C and other humanized anti-PD-Ll antibodies are disclosed in

WO2013/079174, and having a sequence disclosed herein (or a sequence substantially identical or similar thereto, e.g., a sequence at least 85%, 90%, 95% identical or higher to the sequence specified). The heavy and light chain amino acid sequences of MSB0010718C include at least the following:

Heavy chain (SEQ ID NO: 24 as disclosed in WO2013/079174)


Light chain (SEQ ID NO: 25 as disclosed in WO2013/079174)


In one embodiment, the PD-L1 inhibitor is YW243.55.S70. The YW243.55.S70 antibody is an anti-PD-Ll described in WO 2010/077634 (heavy and light chain variable region sequences shown in SEQ ID NOs. 20 and 21, respectively), and having a sequence disclosed therein (or a sequence substantially identical or similar thereto, e.g., a sequence at least 85%, 90%, 95% identical or higher to the sequence specified). In one embodiment, the PD-L1 inhibitor is M DX-1105. M DX-1105, also known as BMS- 936559, is an anti-PD-Ll antibody described in WO2007/005874, and having a sequence disclosed therein (or a sequence substantially identical or similar thereto, e.g., a sequence at least 85%, 90%, 95% identical or higher to the sequence specified).

In one embodiment, the PD-L1 inhibitor is M DPL3280A (Genentech / Roche).

M DPL3280A is a human Fc optimized IgGl monoclonal antibody that binds to PD-L1.

M DPL3280A and other human monoclonal antibodies to PD-L1 are disclosed in U.S. Patent No. : 7,943,743 and U.S Publication No. : 20120039906.

In another embodiment, the PD-L1 inhibitor is an anti-PD-Ll antibody molecule disclosed in US 2016/0108123, filed October 13, 2015, entitled "Antibody Molecules to PD-L1 and Uses Thereof," incorporated by reference in its entirety.

In one embodiment, the anti-PD-Ll antibody molecule includes at least one or two heavy chain variable domains (optionally including a constant region), at least one or two light chain variable domains (optionally including a constant region), or both, comprising the amino acid sequence of any of BAP058-hum01, BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058-hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058-hum09, BAP058- hum lO, BAP058-hum ll, BAP058-hum l2, BAP058-hum l3, BAP058-hum l4, BAP058-huml5, BAP058-hum l6, BAP058-hum l7, BAP058-Clone-K, BAP058-Clone-L, BAP058-Clone-M, BAP058- Clone-N, or BAP058-Clone-O; or as described in Table 1 of US 2016/0108123, or encoded by the nucleotide sequence in Table 1; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-Ll antibody molecule includes at least one, two, or three complementarity determining regions (CDRs) from a heavy chain variable region and/or a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP058-hum01, BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058- hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058-hum09, BAP058-humlO, BAP058-hum ll, BAP058-hum l2, BAP058-hum l3, BAP058-hum l4, BAP058-huml5, BAP058- hum l6, BAP058-hum l7, BAP058-Clone-K, BAP058-Clone-L, BAP058-Clone-M, BAP058-Clone-N, or BAP058-Clone-O; or as described in Table 1 of US 2016/0108123, or encoded by the nucleotide sequence in Table 1 of US 2016/0108123; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences. In yet another embodiment, the anti-PD-Ll antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a heavy chain variable region comprising an amino acid sequence shown in Table 1 of US 2016/0108123, or encoded by a nucleotide sequence shown in Table 1 of US 2016/0108123. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table 1 of US 2016/0108123, or encoded by a nucleotide sequence shown in Table 1 of US 2016/0108123.

In yet another embodiment, the anti-PD-Ll antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a light chain variable region comprising an amino acid sequence shown in Table 1 of US 2016/0108123, or encoded by a nucleotide sequence shown in Table 1. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table 1 of US 2016/0108123, or encoded by a nucleotide sequence shown in Table 1 of US 2016/0108123. In certain embodiments, the anti-PD-Ll antibody molecule includes a substitution in a light chain CDR, e.g., one or more substitutions in a CDR1, CDR2 and/or CDR3 of the light chain.

In another embodiment, the anti-PD-Ll antibody molecule includes at least one, two, three, four, five or six CDRs (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table 1, or encoded by a nucleotide sequence shown in Table 1 of US 2016/0108123. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table 1 of US 2016/0108123, or encoded by a nucleotide sequence shown in Table 1 of US 2016/0108123.

In one embodiment, the anti-PD-Ll antibody molecule includes at least one, two or three CDRs or hypervariable loops from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP058-hum01, BAP058-hum02, BAP058-hum03, BAP058-hum04, BAP058-hum05, BAP058-hum06, BAP058-hum07, BAP058-hum08, BAP058- hum09, BAP058-humlO, BAP058-humll, BAP058-huml2, BAP058-huml3, BAP058-huml4, BAP058-huml5, BAP058-huml6, BAP058-huml7, BAP058-Clone-K, BAP058-Clone-L, BAP058- Clone-M, BAP058-Clone-N, or BAP058-Clone-O, according to the Kabat and Chothia definition [e.g., at least one, two, or three CDRs or hypervariable loops according to the Kabat and Chothia definition as set out in Table 1 of US 2016/0108123); or encoded by the nucleotide sequence in Table 1 of US 2016/0108123; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three CDRs or hypervariable loops according to Kabat and/or Chothia shown in Table 1 of US 2016/0108123.

In one embodiment, the anti-PD-Ll antibody molecule can include VH CDR1 according to Kabat et al. ((1991), "Sequences of Proteins of Immunological Interest," 5th Ed. Public Health Service, National Institutes of Health, Bethesda, M D) or VH hypervariable loop 1 according to Chothia et al. (1992) J. Mol. Biol. 227:799-817, or a combination thereof, e.g., as shown in Table 1 of US 2016/0108123. In one embodiment, the combination of Kabat and Chothia CDR of VH CDR1 comprises the amino acid sequence GYTFTSYWMY (SEQ ID NO: 244), or an amino acid sequence substantially identical thereto (e.g., having at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions)). The anti-PD-Ll antibody molecule can further include, e.g., VH CDRs 2-3 according to Kabat et al. and VL CDRs 1-3 according to Kabat et al., e.g., as shown in Table 1 of US 2016/0108123.

In a preferred embodiment, the anti PD-L1 antibody molecule for use in the invention comprises:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 228, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a light chain variable region (VL) comprising a VLCDRl amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 225; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235; or (d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244; a VHCDR2

amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO:

227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232.

In one aspect of the previous embodiment, the anti-PD-Ll antibody molecule for use in the invention comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 236 and a light chain variable domain comprising the amino acid sequence of

SEQ ID NO: 239.

In one aspect of the previous embodiment, the anti-PD-Ll antibody molecule for use in the invention comprises a heavy chain comprising the amino acid sequence of SEQ ID NO:

243 and a light chain comprising the amino acid sequence of SEQ ID NO: 241.

Table A. Amino acid and nucleotide sequences for humanized anti-PD-Ll mAb BAP058- hum013. The amino acid and nucleotide sequences of the heavy and light chain CDRs, the

heavy and light chain variable regions, and the heavy and light chains are shown.


SEQ ID NO: 244 (Chothia and Kabat HCDR1 GYTFTSYWMY


SEQ ID NO: 225 (Kabat) HCDR1 SYWMY



SEQ ID NO: 228 (Chothia) HCDR1 GYTFTSY

SEQ ID NO: 229 (Chothia) HCDR2 DPNSGS

























































SEQ I D NO: 233 (Chothia) LCDR1 SQDVGTA

SEQ I D NO: 234 (Chothia) LCDR2 WAS

SEQ I D NO: 235 (Chothia) LCDR3 YNSYPL



















Examples of anti PD-1 antibody molecule

In a preferred embodiment, the combination product comprises a compound of

Formula (I) or a pharmaceutically acceptable salt or co-crystal thereof, and an anti-PD-1 antibody molecule such as those described herein.

PD-1 is a CD28/CTLA-4 family member expressed, e.g., on activated CD4 + and CD8 + T

cells, T regs , and B cells. It negatively regulates effector T cell signaling and function. PD-1 is

induced on tumor-infiltrating T cells, and can result in functional exhaustion or dysfunction

(Keir ef o/. (2008) Annu. Rev. Immunol. 26:677-704; Pardoll et al. (2012) Nat Rev Cancer

12(4):252-64). PD-1 delivers a coinhibitory signal upon binding to either of its two ligands,

Programmed Death- Ligand 1 (PD-L1) or Programed Death- Ligand 2 (PD-L2). PD-L1 is

expressed on a number of cell types, including T cells, Natural killer (NK) cells, macrophages, dendritic cells (DCs), B cells, epithelial cells, vascular endothelial cells, as well as many types of tumors. High expression of PD-L1 on murine and human tumors has been linked to poor

clinical outcomes in a variety of cancers (Keir et al. (2008) Annu. Rev. Immunol. 26:677-704;

Pardoll et al. (2012) Nat Rev Cancer 12(4):252-64). PD-L2 is expressed on dendritic cells,

macrophages, and some tumors. Blockade of the PD-1 pathway has been pre-clinically and

clinically validate for cancer immunotherapy. Both preclinical and clinical studies have

demonstrated that anti-PD-1 blockade can restore activity of effector T cells and results in

robust anti-tumor response. For example, blockade of PD-1 pathway can restore

exhausted/dysfunctional effector T cell function (e.g. proliferation, IFN-g secretion, or cytolytic function) and/or inhibit T reg cell function (Keir et al. (2008) Annu. Rev. Immunol. 26:677-704;

Pardoll et al. (2012) Nat Rev Cancer 12(4):252-64). Blockade of the PD-1 pathway can be

effected with an antibody, an antigen binding fragment thereof, an immunoadhesin, a fusion protein, or oligopeptide of PD-1, PD-L1 and/or PD-L2.

In one embodiment, the PD-1 inhibitor is an anti-PD-1 antibody chosen from

Nivolumab, Pembrolizumab or Pidilizumab.

In some embodiments, the anti-PD-1 antibody is Nivolumab. Alternative names for

Nivolumab include MDX- 1106, MDX-1106-04, ONO-4538, or BMS-936558. In some embodiments, the anti-PD- 1 antibody is Nivolumab (CAS Registry Number: 946414-94-4). Nivolumab is a fully human lgG4 monoclonal antibody which specifically blocks PD- 1. Nivolumab (clone 5C4) and other human monoclonal antibodies that specifically bind to PD- 1 are disclosed in US 8,008,449 and WO2006/121168. In one embodiment, the inhibitor of PD-1 is Nivolumab, and having a sequence disclosed herein (or a sequence substantially identical or similar thereto, e.g., a sequence at least 85%, 90%, 95% identical or higher to the sequence specified).

The heavy and light chain amino acid sequences of Nivolumab are as follows:

Heavy chain








Light chain


In some embodiments, the anti-PD-1 antibody is Pembrolizumab. Pembrolizumab (also referred to as Lambrolizumab, MK-3475, M K03475, SCH-900475 or KEYTRUDA ® ; Merck) is a humanized lgG4 monoclonal antibody that binds to PD-1. Pembrolizumab and other humanized anti-PD-1 antibodies are disclosed in Hamid, O. et al. (2013) New England Journal of Medicine 369 (2): 134-44, US 8,354,509 and WO2009/114335. The heavy and light chain amino acid sequences of Pembrolizumab are as follows:

Heavy chain (SEQ ID NO: 249)








Ligh chain (SEQ ID NO: 250)



In one embodiment, the inhibitor of PD-1 is Pembrolizumab disclosed in, e.g., US 8,354,509 and WO 2009/114335, and having a sequence disclosed herein (or a sequence substantially identical or similar thereto, e.g., a sequence at least 85%, 90%, 95% identical or higher to the sequence specified).

In some embodiments, the anti-PD-1 antibody is Pidilizumab. Pidilizumab (CT-011; Cure Tech) is a humanized IgGlk monoclonal antibody that binds to PD-1. Pidilizumab and other humanized anti-PD-1 monoclonal antibodies are disclosed in WO2009/101611.

Other anti-PD-1 antibodies include AM P 514 (Amplimmune), among others, e.g., anti- PD-1 antibodies disclosed in US 8,609,089, US 2010028330, and/or US 20120114649.

In some embodiments, the PD-1 inhibitor is an immunoadhesin (e.g., an

immunoadhesin comprising an extracellular or PD-1 binding portion of PD-LI or PD-L2 fused to a constant region (e.g., an Fc region of an immunoglobulin sequence). In some embodiments, the PD-1 inhibitor is AM P-224 (B7-DCIg; Amplimmune; e.g., disclosed in WO2010/027827 and WO2011/066342), is a PD-L2 Fc fusion soluble receptor that blocks the interaction between PD-1 and B7-H1.

In a more preferred embodiment, the anti-PD-1 antibody is an anti-PD-1 antibody molecule as described in WO2015/112900 (US2015/0210769), published on July 30, 2015, entitled "Antibody Molecules to PD-1 and Uses Thereof," incorporated by reference in its entirety. In some embodiments, the anti-PD-1 antibody molecule (e.g., an isolated or recombinant antibody molecule) has one or more of the following properties:

(i) binds to PD-1, e.g., human PD-1, with high affinity, e.g., with an affinity constant of at least about 10 7 M 1 , typically about 10 8 M 1 , and more typically, about 10 9 M 1 to 10 10 M 1 or stronger;

(ii) does not substantially bind to CD28, CTLA-4, ICOS or BTLA;

(iii) inhibits or reduces binding of PD-1 to a PD-1 ligand, e.g., PD-L1 or PD-L2, or both;

(iv) binds specifically to an epitope on PD-1, e.g., the same or similar epitope as the epitope recognized by murine monoclonal antibody BAP049 or a chimeric antibody BAP049, e.g., BAP049-chi or BAP049-chi-Y;

(v) shows the same or similar binding affinity or specificity, or both, as any of BAP049- humOl, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-humll, BAP049- hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E;

(vi) shows the same or similar binding affinity or specificity, or both, as an antibody molecule (e.g., an heavy chain variable region and light chain variable region) described in Table B;

(vii) shows the same or similar binding affinity or specificity, or both, as an antibody molecule (e.g., an heavy chain variable region and light chain variable region) having an amino acid sequence shown in Table B;

(viii) shows the same or similar binding affinity or specificity, or both, as an antibody molecule (e.g., an heavy chain variable region and light chain variable region) encoded by the nucleotide sequence shown in Table B;

(ix) inhibits, e.g., competitively inhibits, the binding of a second antibody molecule to PD-1, wherein the second antibody molecule is an antibody molecule described herein, e.g., an antibody molecule chosen from, e.g., any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049- Clone-D, or BAP049-Clone-E;

(x) binds the same or an overlapping epitope with a second antibody molecule to PD-1, wherein the second antibody molecule is an antibody molecule described herein, e.g., an antibody molecule chosen from, e.g., any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049- Clone-D, or BAP049-Clone-E;

(xi) competes for binding, and/or binds the same epitope, with a second antibody molecule to PD-1, wherein the second antibody molecule is an antibody molecule described herein, e.g., an antibody molecule chosen from, e.g., any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049- hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049- Clone-C, BAP049-Clone-D, or BAP049-Clone-E;

(xii) has one or more biological properties of an antibody molecule described herein, e.g., an antibody molecule chosen from, e.g., any of BAP049-hum01, BAP049-hum02, BAP049- hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049- huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E;

(xiii) has one or more pharmacokinetic properties of an antibody molecule described herein, e.g., an antibody molecule chosen from, e.g., any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049- hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049- Clone-C, BAP049-Clone-D, or BAP049-Clone-E;

(xiv) inhibits one or more activities of PD-1, e.g., results in one or more of: an increase in tumor infiltrating lymphocytes, an increase in T-cell receptor mediated proliferation, or a decrease in immune evasion by cancerous cells;

(xv) binds human PD-1 and is cross-reactive with cynomolgus PD-1;

(xvi) binds to one or more residues within the C strand, CC loop, C strand, or FG loop of PD-1, or a combination two, three or all of the C strand, CC loop, C strand or FG loop of PD- 1, e.g., wherein the binding is assayed using ELISA or Biacore; or

(xvii) has a VL region that contributes more to binding to PD-1 than a VH region.

In some embodiments, the antibody molecule binds to PD-1 with high affinity, e.g., with a K D that is about the same, or at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% higher or lower than the K D of a murine or chimeric anti-PD-1 antibody molecule, e.g., a murine or chimeric anti-PD-1 antibody molecule described herein. In some embodiments, the K D of the murine or chimeric anti-PD-1 antibody molecule is less than about 0.4, 0.3, 0.2, 0.1, or 0.05 nM, e.g., measured by a Biacore method. In some embodiments, the K D of the murine or chimeric anti-PD-1 antibody molecule is less than about 0.2 nM, e.g., about 0.135 nM. In other embodiments, the K D of the murine or chimeric anti PD-1 antibody molecule is less than about 10, 5, 3, 2, or 1 nM, e.g., measured by binding on cells expressing PD-1 [e.g., 300.19 cells). In some embodiments, the K D of the murine or chimeric anti PD-1 antibody molecule is less than about 5 nM, e.g., about 4.60 nM (or about 0.69 μg/mL).

In some embodiments, the anti-PD-1 antibody molecule binds to PD-1 with a K off slower than 1 X 10 "4 , 5 X 10 "5 , or 1 X 10 "5 s "1 , e.g., about 1.65 X 10 "5 s \ In some embodiments, the anti-PD-1 antibody molecule binds to PD-1 with a K otl faster than 1 X 10 4 , 5 X 10 4 , 1 X 10 5 , or 5 X 10 5 M V 1 , e.g., about 1.23 X 10 5 M V 1 .

In some embodiments, the expression level of the antibody molecule is higher, e.g., at least about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold higher, than the expression level of a murine or chimeric antibody molecule, e.g., a murine or chimeric anti-PD-1 antibody molecule described herein. In some embodiments, the antibody molecule is expressed in CHO cells.

In some embodiments, the anti-PD-1 antibody molecule reduces one or more PD-1- associated activities with an IC 50 (concentration at 50% inhibition) that is about the same or lower, e.g., at least about 10%, 20%, 30%, 40%, 50%, 60%, 70%, 80% or 90% lower, than the IC 50 of a murine or chimeric anti-PD-1 antibody molecule, e.g., a murine or chimeric anti-PD-1 antibody molecule described herein. In some embodiments, the IC 50 of the murine or chimeric anti-PD-1 antibody molecule is less than about 6, 5, 4, 3, 2, or 1 nM, e.g., measured by binding on cells expressing PD-1 [e.g., 300.19 cells). In some embodiments, the IC 50 of the murine or chimeric anti-PD-1 antibody molecule is less than about 4 nM, e.g., about 3.40 nM (or about 0.51 μg/mL). In some embodiments, the PD-l-associated activity reduced is the binding of PD- Ll and/or PD-L2 to PD-1. In some embodiments, the anti-PD-1 antibody molecule binds to peripheral blood mononucleated cells (PBMCs) activated by Staphylococcal enterotoxin B (SEB). In other embodiments, the anti-PD-1 antibody molecule increases the expression of IL-2 on whole blood activated by SEB. For example, the anti-PD-1 antibody increases the expression of IL-2 by at least about 2, 3, 4, or 5-fold, compared to the expression of IL-2 when an isotype control [e.g., lgG4) is used.

In some embodiments, the anti-PD-1 antibody molecule has improved stability, e.g., at least about 0.5, 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10-fold more stable in vivo or in vitro, than a murine or chimeric anti-PD-1 antibody molecule, e.g., a murine or chimeric anti-PD-1 antibody molecule described herein. In one embodiment, the anti PD-1 antibody molecule is a humanized antibody molecule and has a risk score based on T cell epitope analysis of 300 to 700, 400 to 650, 450 to 600, or a risk score as described herein.

In another embodiment, the anti-PD-1 antibody molecule comprises at least one antigen-binding region, e.g., a variable region or an antigen-binding fragment thereof, from an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049- hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml2, BAP049- hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, three or four variable regions from an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049- hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-huml5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one or two heavy chain variable regions from an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049- hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-huml5, BAP049- hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049- Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one or two light chain variable regions from an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049- hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-huml5, BAP049- hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049- Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule includes a heavy chain constant region for an lgG4, e.g., a human lgG4. In one embodiment, the human lgG4 includes a substitution at position 228 according to EU numbering (e.g., a Ser to Pro substitution). In still another embodiment, the anti-PD-1 antibody molecule includes a heavy chain constant region for an IgGl, e.g., a human IgGl. In one embodiment, the human IgGl includes a substitution at position 297 according to EU numbering (e.g., an Asn to Ala substitution). In one embodiment, the human IgGl includes a substitution at position 265 according to EU numbering, a substitution at position 329 according to EU numbering, or both (e.g., an Asp to Ala substitution at position 265 and/or a Pro to Ala substitution at position 329). In one embodiment, the human IgGl includes a substitution at position 234 according to EU numbering, a substitution at position 235 according to EU numbering, or both (e.g., a Leu to Ala substitution at position 234 and/or a Leu to Ala substitution at position 235). In one embodiment, the heavy chain constant region comprises an amino sequence set forth in Table D, or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) thereto.

In yet another embodiment, the anti-PD-1 antibody molecule includes a kappa light chain constant region, e.g., a human kappa light chain constant region. In one embodiment, the light chain constant region comprises an amino sequence set forth in Table D, or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) thereto.

In another embodiment, the anti-PD-1 antibody molecule includes a heavy chain constant region for an lgG4, e.g., a human lgG4, and a kappa light chain constant region, e.g., a human kappa light chain constant region, e.g., a heavy and light chain constant region comprising an amino sequence set forth in Table D, or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) thereto. In one embodiment, the human lgG4 includes a substitution at position 228 according to EU numbering (e.g., a Ser to Pro substitution). In yet another embodiment, the anti-PD-1 antibody molecule includes a heavy chain constant region for an IgGl, e.g., a human IgGl, and a kappa light chain constant region, e.g., a human kappa light chain constant region, e.g., a heavy and light chain constant region comprising an amino sequence set forth in Table D, or a sequence substantially identical [e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) thereto. In one embodiment, the human IgGl includes a substitution at position 297 according to EU numbering (e.g., an Asn to Ala substitution). In one embodiment, the human IgGl includes a substitution at position 265 according to EU numbering, a substitution at position 329 according to EU numbering, or both (e.g., an Asp to Ala substitution at position 265 and/or a Pro to Ala substitution at position 329). In one embodiment, the human IgGl includes a substitution at position 234 according to EU numbering, a substitution at position 235 according to EU numbering, or both (e.g., a Leu to Ala substitution at position 234 and/or a Leu to Ala substitution at position 235).

In another embodiment, the anti-PD-1 antibody molecule includes a heavy chain variable domain and a constant region, a light chain variable domain and a constant region, or both, comprising the amino acid sequence of BAP049-Clone-A, BAP049-Clone-B, BAP049- Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three complementarity determining regions (CD s) from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049- hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049- Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a heavy chain variable region comprising an amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three CDRs from a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049- hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical [e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequence.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three CDRs (or collectively all of the CDRs) from a light chain variable region comprising an amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B. In certain embodiments, the anti-PD-1 antibody molecule includes a substitution in a light chain CDR, e.g., one or more substitutions in a CDR1, CDR2 and/or CDR3 of the light chain. In one embodiment, the anti-PD-1 antibody molecule includes a substitution in the light chain CDR3 at position 102 of the light variable region, e.g., a substitution of a cysteine to tyrosine, or a cysteine to serine residue, at position 102 of the light variable region according to Table B (e.g., SEQ. I D NO: 16 or 24 for murine or chimeric, unmodified; or any of SEQ I D NOs: 34, 42, 46, 54, 58, 62, 66, 70, 74, or 78 for a modified sequence).

In another embodiment, the anti-PD-1 antibody molecule includes at least one, two, three, four, five or six CDRs (or collectively all of the CDRs) from a heavy and light chain variable region comprising an amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B. In one embodiment, one or more of the CDRs (or collectively all of the CDRs) have one, two, three, four, five, six or more changes, e.g., amino acid substitutions or deletions, relative to the amino acid sequence shown in Table B, or encoded by a nucleotide sequence shown in Table B.

In one embodiment, the anti-PD-1 antibody molecule includes all six CDRs from an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049- hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049- huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B, or closely related CD s, e.g., CDRs which are identical or which have at least one amino acid alteration, but not more than two, three or four alterations [e.g., substitutions, deletions, or insertions, e.g., conservative substitutions). In one embodiment, the anti-PD-1 antibody molecule may include any CDR described herein. In certain embodiments, the anti-PD-1 antibody molecule includes a substitution in a light chain CDR, e.g., one or more substitutions in a CDR1, CDR2 and/or CDR3 of the light chain. In one embodiment, the anti-PD-1 antibody molecule includes a substitution in the light chain CDR3 at position 102 of the light variable region, e.g., a substitution of a cysteine to tyrosine, or a cysteine to serine residue, at position 102 of the light variable region according to Table B (e.g., SEQ ID NO: 16 or 24 for murine or chimeric, unmodified; or any of SEQ ID NOs: 34, 42, 46, 54, 58, 62, 66, 70, 74, or 78 for a modified sequence).

In another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three CDRs according to Kabat et al. (e.g., at least one, two, or three CDRs according to the Kabat definition as set out in Table B) from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049- hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049- Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three CDRs according to Kabat et al. shown in Table B.

In another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three CDRs according to Kabat et al. (e.g., at least one, two, or three CDRs according to the Kabat definition as set out in Table B) from a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049- hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049- Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three CD s according to Kabat et al. shown in Table B.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, three, four, five, or six CDRs according to Kabat et al. (e.g., at least one, two, three, four, five, or six CDRs according to the Kabat definition as set out in Table B) from the heavy and light chain variable regions of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049- hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049- Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, three, four, five, or six CDRs according to Kabat et al. shown in Table B.

In yet another embodiment, the anti-PD-1 antibody molecule includes all six CDRs according to Kabat et al. (e.g., all six CDRs according to the Kabat definition as set out in Table B) from the heavy and light chain variable regions of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049- huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to all six CDRs according to Kabat et al. shown in Table B. In one embodiment, the anti-PD-1 antibody molecule may include any CD described herein.

In another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three Chothia hypervariable loops (e.g., at least one, two, or three hypervariable loops according to the Chothia definition as set out in Table B) from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049- hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml2, BAP049- hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or at least the amino acids from those hypervariable loops that contact PD-1; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three hypervariable loops according to Chothia et al. shown in Table B.

In another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three Chothia hypervariable loops (e.g., at least one, two, or three hypervariable loops according to the Chothia definition as set out in Table B) of a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049- hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml2, BAP049- hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or at least the amino acids from those hypervariable loops that contact PD-1; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three hypervariable loops according to Chothia et al. shown in Table B.

In yet another embodiment, the anti-PD-1 antibody molecule includes at least one, two, three, four, five, or six hypervariable loops (e.g., at least one, two, three, four, five, or six hypervariable loops according to the Chothia definition as set out in Table B) from the heavy and light chain variable regions of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049- humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or at least the amino acids from those hypervariable loops that contact PD-1; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, three, four, five or six hypervariable loops according to Chothia et al. shown in Table B.

In one embodiment, the anti-PD-1 antibody molecule includes all six hypervariable loops (e.g., all six hypervariable loops according to the Chothia definition as set out in Table B) of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049- hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049- Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E, or closely related

hypervariable loops, e.g., hypervariable loops which are identical or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions); or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to all six hypervariable loops according to Chothia et al. shown in Table B. In one embodiment, the anti-PD-1 antibody molecule may include any hypervariable loop described herein.

In still another embodiment, the anti-PD-1 antibody molecule includes at least one, two, or three hypervariable loops that have the same canonical structures as the

corresponding hypervariable loop of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049- hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049- huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049- Clone-E, e.g., the same canonical structures as at least loop 1 and/or loop 2 of the heavy and/or light chain variable domains of an antibody described herein. See, e.g., Chothia et al., (1992) J. Mol. Biol. 227:799-817; Tomlinson et al., (1992) J. Mol. Biol. 227:776-798 for descriptions of hypervariable loop canonical structures. These structures can be determined by inspection of the tables described in these references. In certain embodiments, the anti-PD-1 antibody molecule includes a combination of CDRs or hypervariable loops defined according to the Kabat et al. and Chothia et al.

In one embodiment, the anti-PD-1 antibody molecule includes at least one, two or three CDRs or hypervariable loops from a heavy chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-humlO, BAP049-humll, BAP049-huml2, BAP049-huml3, BAP049-huml4, BAP049-huml5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049- Clone-D, or BAP049-Clone-E, according to the Kabat and Chothia definition (e.g., at least one, two, or three CDRs or hypervariable loops according to the Kabat and Chothia definition as set out in Table B); or encoded by the nucleotide sequence in Table B; or a sequence substantially identical (e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical) to any of the aforesaid sequences; or which have at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions) relative to one, two, or three CDRs or hypervariable loops according to Kabat and/or Chothia shown in Table B.

For example, the anti-PD-1 antibody molecule can include VH CDR1 according to Kabat et al. or VH hypervariable loop 1 according to Chothia et al., or a combination thereof, e.g., as shown in Table B. In one embodiment, the combination of Kabat and Chothia CDR of VH CDR1 comprises the amino acid sequence GYTFTTYWMH (SEQ ID NO: 224), or an amino acid sequence substantially identical thereto (e.g., having at least one amino acid alteration, but not more than two, three or four alterations (e.g., substitutions, deletions, or insertions, e.g., conservative substitutions)). The anti-PD-1 antibody molecule can further include, e.g., VH CDRs 2-3 according to Kabat et al. and VL CDRs 1-3 according to Kabat et al., e.g., as shown in Table B. Accordingly, in some embodiments, framework regions are defined based on a combination of CDRs defined according to Kabat et al. and hypervariable loops defined according to Chothia et al. For example, the anti-PD-1 antibody molecule can include VH FR1 defined based on VH hypervariable loop 1 according to Chothia et al. and VH FR2 defined based on VH CDRs 1-2 according to Kabat et al., e.g., as shown in Table B. The anti-PD-1 antibody molecule can further include, e.g., VH FRs 3-4 defined based on VH CDRs 2-3 according to Kabat et al. and VL FRs 1-4 defined based on VL CDRs 1-3 according to Kabat et al.

The anti-PD-1 antibody molecule can contain any combination of CDRs or

hypervariable loops according to the Kabat and Chothia definitions. In one embodiment, the anti-PD-1 antibody molecule includes at least one, two or three CDRs from a light chain variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049- humOl, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-humll, BAP049- hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E, according to the Kabat and Chothia definition [e.g., at least one, two, or three CDRs according to the Kabat and Chothia definition as set out in Table B).

In an embodiment, e.g., an embodiment comprising a variable region, a CDR [e.g., Chothia CDR or Kabat CDR), or other sequence referred to herein, e.g., in Table B, the antibody molecule is a monospecific antibody molecule, a bispecific antibody molecule, or is an antibody molecule that comprises an antigen binding fragment of an antibody, e.g., a half antibody or antigen binding fragment of a half antibody. In certain embodiments the antibody molecule is a bispecific antibody molecule having a first binding specificity for PD-1 and a second binding specificity for TIM -3, LAG-3, CEACAM (e.g., CEACAM-1 and/or CEACAM-5), PD- Ll or PD-L2.

In one embodiment, the anti-PD-1 antibody molecule includes:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ I D NO: 4, a VHCDR2 amino acid sequence of SEQ I D NO: 5, and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33;

(b) a VH comprising a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ I D NO: 224, a VHCDR2 amino acid sequence of SEQ I D NO: 5, and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ I D NO: 13, a VLCDR2 amino acid sequence of SEQ I D NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ I D NO: 2; and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ I D NO: 10, a VLCDR2 amino acid sequence of SEQ I D NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32. In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 4, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33.

In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33.

In one embodiment, the anti-PD-1 antibody molecule comprises a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

In one embodiment, the antibody molecule is a humanized antibody molecule. In another embodiment, the antibody molecule is a monospecific antibody molecule. In yet another embodiment, the antibody molecule is a bispecific antibody molecule.

In one embodiment, the anti-PD-1 antibody molecule includes:

(i) a heavy chain variable region (VH) including a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and

(ii) a light chain variable region (VL) including a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

In another embodiment, the anti-PD-1 antibody molecule includes:

(i) a heavy chain variable region (VH) including a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and (ii) a light chain variable region (VL) including a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33.

In one embodiment, the anti-PD-1 antibody molecule comprises the VHCDRl amino acid sequence of SEQ ID NO: 1. In another embodiment, the anti-PD-1 antibody molecule comprises the VHCDRl amino acid sequence of SEQ ID NO: 4. In yet another embodiment, the anti-PD-1 antibody molecule comprises the VHCDRl amino acid sequence of SEQ I D NO: 224.

In one embodiment, the light or the heavy chain variable framework (e.g., the region encompassing at least FR1, FR2, FR3, and optionally FR4) of the anti-PD-1 antibody molecule can be chosen from : (a) a light or heavy chain variable framework including at least 80%, 85%, 87% 90%, 92%, 93%, 95%, 97%, 98%, or preferably 100% of the amino acid residues from a human light or heavy chain variable framework, e.g., a light or heavy chain variable framework residue from a human mature antibody, a human germline sequence, or a human consensus sequence; (b) a light or heavy chain variable framework including from 20% to 80%, 40% to 60%, 60% to 90%, or 70% to 95% of the amino acid residues from a human light or heavy chain variable framework, e.g., a light or heavy chain variable framework residue from a human mature antibody, a human germline sequence, or a human consensus sequence; (c) a non- human framework (e.g., a rodent framework); or (d) a non-human framework that has been modified, e.g., to remove antigenic or cytotoxic determinants, e.g., deimmunized, or partially humanized. In one embodiment, the light or heavy chain variable framework region

(particularly FR1, FR2 and/or FR3) includes a light or heavy chain variable framework sequence at least 70, 75, 80, 85, 87, 88, 90, 92, 94, 95, 96, 97, 98, 99% identical or identical to the frameworks of a VL or VH segment of a human germline gene.

In certain embodiments, the anti-PD-1 antibody molecule comprises a heavy chain variable domain having at least one, two, three, four, five, six, seven, ten, fifteen, twenty or more changes, e.g., amino acid substitutions or deletions, from an amino acid sequence of BAP049-chi-HC, e.g., the amino acid sequence of the FR region in the entire variable region, e.g., SEQ ID NO: 18, 20, 22 or 30. In one embodiment, the anti-PD-1 antibody molecule comprises a heavy chain variable domain having one or more of: E at position 1, V at position 5, A at position 9, V at position 11, K at position 12, K at position 13, E at position 16, L at position 18, R at position 19, I or V at position 20, G at position 24, I at position 37, A or S at position 40, T at position 41, S at position 42, R at position 43, M or L at position 48, V or F at position 68, T at position 69, I at position 70, S at position 71, A or R at position 72, K or N at position 74, T or K at position 76, S or N at position 77, L at position 79, L at position 81, E or Q at position 82, M at position 83, S or N at position 84, R at position 87, A at position 88, or T at position 91 of amino acid sequence of BAP049-chi-HC, e.g., the amino acid sequence of the FR in the entire variable region, e.g., SEQ ID NO: 18, 20, 22 or 30.

Alternatively, or in combination with the heavy chain substitutions of BAP049-chi-HC described herein, the anti-PD-1 antibody molecule comprises a light chain variable domain having at least one, two, three, four, five, six, seven, ten, fifteen, twenty or more amino acid changes, e.g., amino acid substitutions or deletions, from an amino acid sequence of BAP049- chi-LC, e.g., the amino acid sequence shown in SEQ ID NO: 24 or 26. In one embodiment, the anti-PD-1 antibody molecule comprises a heavy chain variable domain having one or more of: E at position 1, V at position 2, Q at position 3, L at position 4, T at position 7, D or L or A at position 9, F or T at position 10, Q at position 11, S or P at position 12, L or A at position 13, S at position 14, P or L or V at position 15, K at position 16, Q or D at position 17, R at position 18, A at position 19, S at position 20, 1 or L at position 21, T at position 22, L at position 43, K at position 48, A or S at position 49, R or Q at position 51, Y at position 55, 1 at position 64, S or P at position 66, S at position 69, Y at position 73, G at position 74, E at position 76, F at position 79, N at position 82, N at position 83, L or I at position 84, E at position 85, S or P at position 86, D at position 87, A or F or I at position 89, T or Y at position 91, F at position 93, or Y at position 102 of the amino acid sequence of BAP049-chi-LC, e.g., the amino acid sequence SEQ I D NO: 24 or 26.

In other embodiments, the anti-PD-1 antibody molecule includes one, two, three, or four heavy chain framework regions (e.g., a VHFW amino acid sequence shown in Table C, or encoded by the nucleotide sequence shown in Table C), or a sequence substantially identical thereto.

In yet other embodiments, the anti-PD-1 antibody molecule includes one, two, three, or four light chain framework regions (e.g., a VLFW amino acid sequence shown in Table C, or encoded by the nucleotide sequence shown in Table C), or a sequence substantially identical thereto.

In other embodiments, the anti-PD-1 antibody molecule includes one, two, three, or four heavy chain framework regions (e.g., a VHFW amino acid sequence shown in Table C, or encoded by the nucleotide sequence shown in Table C), or a sequence substantially identical thereto; and one, two, three, or four light chain framework regions (e.g., a VLFW amino acid sequence shown in Table C, or encoded by the nucleotide sequence shown in Table C), or a sequence substantially identical thereto. In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework region 1 (VHFW1) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml5, BAP049- hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049- Clone-E (e.g., SEQ I D NO: 147). In some embodiments, the antibody molecule comprises the heavy chain framework region 1 (VHFW1) of BAP049-hum l4 or BAP049-huml5 (e.g., SEQ ID NO: 151).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework region 2 (VHFW2) of BAP049-hum01, BAP049-hum02, BAP049-hum05, BAP049- hum06, BAP049-hum07, BAP049-hum09, BAP049-hum ll, BAP049-hum l2, BAP049-huml3, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, or BAP049-Clone-E (e.g., SEQ ID NO: 153). In some embodiments, the antibody molecule comprises the heavy chain framework region 2 (VH FW2) of BAP049-hum03, BAP049-hum04, BAP049-hum08, BAP049-hum lO, BAP049- hum l4, BAP049-hum l5, or BAP049-Clone-D (e.g., SEQ I D NO: 157). In some embodiments, the antibody molecule comprises the heavy chain framework region 2 (VHFW2) of BAP049-hum l6 (e.g., SEQ ID NO: 160).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework region 3 (VHFW3) of BAP049-hum01, BAP049-hum02, BAP049-hum05, BAP049- hum06, BAP049-hum07, BAP049-hum09, BAP049-hum ll, BAP049-hum l2, BAP049-huml3, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, or BAP049-Clone-E (e.g., SEQ ID NO: 162). In some embodiments, the antibody molecule comprises the heavy chain framework region 3 (VH FW3) of BAP049-hum03, BAP049-hum04, BAP049-hum08, BAP049-hum lO, BAP049- hum l4, BAP049-hum l5, BAP049-hum l6, or BAP049-Clone-D (e.g., SEQ I D NO: 166).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework region 4 (VH FW4) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049- hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 169).

In some embodiments, the anti-PD-1 antibody molecule comprises the light chain framework region 1 (VLFW1) of BAP049-hum08, BAP049-hum09, BAP049-hum l5, BAP049- hum l6, or BAP049-Clone-C (e.g., SEQ ID NO: 174). In some embodiments, the antibody molecule comprises the light chain framework region 1 (VLFWl) of BAP049-hum01, BAP049- hum04, BAP049-hum05, BAP049-hum07, BAP049-hum lO, BAP049-hum ll, BAP049-huml4, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 177). In some embodiments, the antibody molecule comprises the light chain framework region 1 (VLFWl) of BAP049-hum06 (e.g., SEQ ID NO: 181). In some embodiments, the antibody molecule comprises the light chain framework region 1 (VLFWl) of BAP049-hum l3 (e.g., SEQ I D NO: 183). In some embodiments, the antibody molecule comprises the light chain framework region 1 (VLFWl) of BAP049-hum02, BAP049-hum03, or BAP049-huml2 (e.g., SEQ I D NO: 185).

In some embodiments, the anti-PD-1 antibody molecule comprises the light chain framework region 2 (VLFW2) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum06, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 187). In some embodiments, the antibody molecule comprises the light chain framework region 2 (VLFW2) of BAP049-hum04, BAP049-hum05, BAP049-hum07, BAP049-hum l3, or BAP049-Clone-C (e.g., SEQ I D NO: 191). In some embodiments, the antibody molecule comprises the light chain framework region 2 (VLFW2) of BAP049-hum l2 (e.g., SEQ ID NO: 194).

In some embodiments, the anti-PD-1 antibody molecule comprises the light chain framework region 3 (VLFW3) of BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ I D NO: 196). In some embodiments, the antibody molecule comprises the light chain framework region 3 (VLFW3) of BAP049-hum02 or BAP049-hum03 (e.g., SEQ ID NO: 200). In some embodiments, the antibody molecule comprises the light chain framework region 3 (VLFW3) of BAP049-hum01 or BAP049-Clone-A (e.g., SEQ I D NO: 202). In some embodiments, the antibody molecule comprises the light chain framework region 3 (VLFW3) of BAP049- hum04, BAP049-hum05, or BAP049-Clone-B (e.g., SEQ I D NO: 205).

In some embodiments, the anti-PD-1 antibody molecule comprises the light chain framework region 4 (VLFW4) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049- hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049- hum 15, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 208).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum01, BAP049-hum02, BAP049-hum05, BAP049-hum06, BAP-hum07, BAP049-hum09, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-Clone- A, BAP049-Clone-B, BAP049-Clone-C, or BAP049-Clone-E (e.g., SEQ I D NO: 147 (VH FW1), SEQ I D NO: 153 (VH FW2), and SEQ I D NO: 162 (VHFW3)). In some embodiments, the antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum03, BAP049- hum04, BAP049-hum08, BAP049-hum lO, or BAP049-Clone-D (e.g., SEQ I D NO: 147 (VHFW1), SEQ I D NO: 157 (VHFW2), and SEQ ID NO: 166 (VHFW3)). In some embodiments, the antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-huml4 or BAP049- hum l5 (e.g., SEQ I D NO: 151 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166

(VH FW3)). In some embodiments, the antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l6 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 160 (VH FW2), and SEQ ID NO: 166 (VH FW3)). In some embodiments, the antibody molecule further comprises the heavy chain framework region 4 (VHFW4) of BAP049-hum01, BAP049- hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-huml2, BAP049- hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 169).

In some embodiments, the anti-PD-1 antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum01 or BAP049-Clone-A (e.g., SEQ ID NO: 177 (VLFW1), SEQ I D NO: 187 (VLFW2), and SEQ ID NO: 202 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum02 or BAP049- hum03 (e.g., SEQ I D NO: 185 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 200 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum04, BAP049-hum05, or BAP049-Clone-B (e.g., SEQ I D NO: 177 (VLFW1), SEQ ID NO: 191 (VLFW2), and SEQ I D NO: 205 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum06 (e.g., SEQ ID NO: 181 (VLFW1), SEQ I D NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum07 (e.g., SEQ ID NO: 177 (VLFW1), SEQ ID NO: 191 (VLFW2), and SEQ ID NO: 196 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum08, BAP049-hum09, BAP049-hum l5, BAP049-hum l6, or BAP049-Clone-C (e.g., SEQ I D NO: 174 (VLFWl), SEQ I D NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum lO, BAP049-hum ll, BAP049-hum l4, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ I D NO: 177 (VLFWl), SEQ I D NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum l2 (e.g., SEQ ID NO: 185 (VLFWl), SEQ ID NO: 194 (VLFW2), and SEQ I D NO: 196 (VLFW3)). In some embodiments, the antibody molecule comprises the light chain framework regions 1-3 of BAP049-hum l3 (e.g., SEQ ID NO: 183 (VLFWl), SEQ I D NO: 191 (VLFW2), and SEQ I D NO: 196 (VLFW3)). In some embodiments, the antibody molecule further comprises the light chain framework region 4 (VLFW4) of BAP049-hum01, BAP049-hum02, BAP049- hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-huml3, BAP049- hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 208).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum01 or BAP049-Clone-A (e.g., SEQ ID NO: 147 (VHFW1), SEQ I D NO: 153 (VHFW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049-hum01 or BAP049-Clone-A (e.g., SEQ ID NO: 177 (VLFWl), SEQ ID NO: 187 (VLFW2), and SEQ ID NO: 202 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum02 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 153 (VH FW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum02 (e.g., SEQ I D NO: 185 (VLFWl), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 200 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum03 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum03 (e.g., SEQ I D NO: 185 (VLFWl), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 200 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum04 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum04 (e.g., SEQ I D NO: 177 (VLFWl), SEQ ID NO: 191 (VLFW2), and SEQ I D NO: 205 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum05 or BAP049-Clone-B (e.g., SEQ ID NO: 147 (VH FW1), SEQ I D NO: 153 (VH FW2), and SEQ ID NO: 162 (VHFW3)) and the light chain framework regions 1-3 of BAP049-hum05 or BAP049-Clone-B (e.g., SEQ I D NO: 177 (VLFW1), SEQ ID NO: 191 (VLFW2), and SEQ ID NO: 205 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum06 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 153 (VH FW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum06 (e.g., SEQ I D NO: 181 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum07 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 153 (VH FW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum07 (e.g., SEQ I D NO: 177 (VLFW1), SEQ ID NO: 191 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum08 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum08 (e.g., SEQ I D NO: 174 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum09 or BAP049-Clone-C (e.g., SEQ ID NO: 147 (VHFW1), SEQ I D NO: 153 (VHFW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049-hum09 or BAP049-Clone-C (e.g., SEQ I D NO: 174 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum lO or BAP049-Clone-D (e.g., SEQ ID NO: 147 (VHFW1), SEQ I D NO: 157 (VHFW2), and SEQ I D NO: 166 (VHFW3)) and the light chain framework regions 1-3 of BAP049-hum lO or BAP049-Clone-D (e.g., SEQ ID NO: 177 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum ll or BAP049-Clone-E (e.g., SEQ ID NO: 147 (VHFW1), SEQ I D NO: 153 (VHFW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049-hum ll or BAP049-Clone-E (e.g., SEQ I D NO: 177 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ ID NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l2 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 153 (VH FW2), and SEQ ID NO: 162 (VHFW3)) and the light chain framework regions 1-3 of BAP049- hum l2 (e.g., SEQ I D NO: 185 (VLFW1), SEQ ID NO: 194 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l3 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 153 (VH FW2), and SEQ ID NO: 162 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum l3 (e.g., SEQ I D NO: 183 (VLFW1), SEQ ID NO: 191 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l4 (e.g., SEQ ID NO: 151 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum l4 (e.g., SEQ I D NO: 177 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l5 (e.g., SEQ ID NO: 151 (VH FW1), SEQ ID NO: 157 (VH FW2), and SEQ ID NO: 166 (VHFW3)) and the light chain framework regions 1-3 of BAP049- hum l5 (e.g., SEQ I D NO: 174 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule comprises the heavy chain framework regions 1-3 of BAP049-hum l6 (e.g., SEQ ID NO: 147 (VH FW1), SEQ ID NO: 160 (VH FW2), and SEQ ID NO: 166 (VH FW3)) and the light chain framework regions 1-3 of BAP049- hum l6 (e.g., SEQ I D NO: 174 (VLFW1), SEQ ID NO: 187 (VLFW2), and SEQ I D NO: 196 (VLFW3)).

In some embodiments, the anti-PD-1 antibody molecule further comprises the heavy chain framework region 4 (VH FW4) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049- Clone-D, or BAP049-Clone-E (e.g., SEQ ID NO: 169) and the light chain framework region 4 (VLFW4) of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049- hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-huml6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E (e.g., SEQ I D NO: 208).

In some embodiments, the anti-PD-1 antibody molecule comprises a heavy chain framework region having a combination of framework regions FW1, FW2 and FW3 as show in FIGs. 9 or 10. In other embodiment, the antibody molecule comprises a light chain framework region having a combination of framework regions FW1, FW2 and FW3 as show in FIGs. 9 or 10. In yet other embodiments, the antibody molecule comprises a heavy chain framework region having a combination of framework regions FW1, FW2 and FW3 as show in FIGs. 9 or 10, and a light chain framework region having a combination of framework regions FW1, FW2 and FW3 as showin in FIGs. 9 or 10.

In one embodiment, the heavy or light chain variable domain, or both, of the anti-PD-1 antibody molecule includes an amino acid sequence, which is substantially identical to an amino acid disclosed herein, e.g., at least 80%, 85%, 90%, 92%, 95%, 97%, 98%, 99% or higher identical to a variable region of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-humlO, BAP049- hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E; or as described in Table B, or encoded by the nucleotide sequence in Table B; or which differs at least 1 or 5 residues, but less than 40, 30, 20, or 10 residues, from a variable region of an antibody described herein.

In one embodiment, the heavy or light chain variable region, or both, of the anti-PD-1 antibody molecule includes an amino acid sequence encoded by a nucleic acid sequence described herein or a nucleic acid that hybridizes to a nucleic acid sequence described herein (e.g., a nucleic acid sequence as shown in Tables 1 and 2) or its complement, e.g., under low stringency, medium stringency, or high stringency, or other hybridization condition described herein.

In another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, three, or four antigen-binding regions, e.g., variable regions, having an amino acid sequence as set forth in Table B, or a sequence substantially identical thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, or which differs by no more than 1, 2, 5, 10, or 15 amino acid residues from the sequences shown in Table B. In another embodiment, the anti-PD-1 antibody molecule includes a VH and/or VL domain encoded by a nucleic acid having a nucleotide sequence as set forth in Table B, or a sequence substantially identical thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, or which differs by no more than 3, 6, 15, 30, or 45 nucleotides from the sequences shown in Table B. In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, or three CDRs from a heavy chain variable region having an amino acid sequence as set forth in Table B, or a sequence substantially homologous thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, and/or having one, two, three or more substitutions, insertions or deletions, e.g., conserved substitutions). In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, or three CDRs from a light chain variable region having an amino acid sequence as set forth in Table B, or a sequence substantially homologous thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, and/or having one, two, three or more substitutions, insertions or deletions, e.g., conserved substitutions). In yet another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, three, four, five or six CDRs from heavy and light chain variable regions having an amino acid sequence as set forth in Table B), or a sequence substantially homologous thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, and/or having one, two, three or more substitutions, insertions or deletions, e.g., conserved substitutions).

In one embodiment, the anti-PD-1 antibody molecule comprises at least one, two, or three CDRs and/or hypervariable loops from a heavy chain variable region having an amino acid sequence of an antibody described herein, e.g., an antibody chosen from any of BAP049- humOl, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049-hum09, BAP049-hum lO, BAP049-humll, BAP049- hum l2, BAP049-hum l3, BAP049-hum l4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049-Clone-D, or BAP049-Clone-E, as summarized in Table B, or a sequence substantially identical thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, and/or having one, two, three or more substitutions, insertions or deletions, e.g., conserved substitutions). In another embodiment, the anti-PD-1 antibody molecule comprises at least one, two, or three CDRs and/or hypervariable loops from a light chain variable region having an amino acid sequence of an antibody described herein, e.g., an antibody chosen from any of BAP049-hum01, BAP049-hum02, BAP049-hum03, BAP049-hum04, BAP049-hum05, BAP049-hum06, BAP049-hum07, BAP049-hum08, BAP049- hum09, BAP049-hum lO, BAP049-hum ll, BAP049-hum l2, BAP049-hum l3, BAP049-huml4, BAP049-hum l5, BAP049-hum l6, BAP049-Clone-A, BAP049-Clone-B, BAP049-Clone-C, BAP049- Clone-D, or BAP049-Clone-E, as summarized in Table B, or a sequence substantially identical thereto (e.g., a sequence at least about 85%, 90%, 95%, 99% or more identical thereto, and/or having one, two, three or more substitutions, insertions or deletions, e.g., conserved substitutions). In one embodiment, the anti-PD-1 antibody molecule comprises all six CD s and/or hypervariable loops described herein, e.g., described in Table B.

In one embodiment, the anti-PD-1 antibody molecule has a variable region that is identical in sequence, or which differs by 1, 2, 3, or 4 amino acids from a variable region described herein [e.g., an FR region disclosed herein).

In one embodiment, the anti-PD-1 antibody molecule is a full antibody or fragment thereof (e.g., a Fab, F(ab') 2 , Fv, or a single chain Fv fragment (scFv)). In certain embodiments, the anti-PD-1 antibody molecule is a monoclonal antibody or an antibody with single specificity. The anti-PD-1 antibody molecule can also be a humanized, chimeric, camelid, shark, or an in wiro-generated antibody molecule. In one embodiment, the anti-PD-1 antibody molecule thereof is a humanized antibody molecule. The heavy and light chains of the anti-PD- 1 antibody molecule can be full-length (e.g., an antibody can include at least one, and preferably two, complete heavy chains, and at least one, and preferably two, complete light chains) or can include an antigen-binding fragment (e.g., a Fab, F(ab') 2 , Fv, a single chain Fv fragment, a single domain antibody, a diabody (dAb), a bivalent antibody, or bispecific antibody or fragment thereof, a single domain variant thereof, or a camelid antibody).

In yet other embodiments, the anti-PD-1 antibody molecule has a heavy chain constant region ( Fc) chosen from, e.g., the heavy chain constant regions of IgGl, lgG2, lgG3, lgG4, IgM, IgAl, lgA2, IgD, and IgE; particularly, chosen from, e.g., the heavy chain constant regions of IgGl, lgG2, lgG3, and lgG4, more particularly, the heavy chain constant region of IgGl or lgG2 (e.g., human IgGl, lgG2 or lgG4). In one embodiment, the heavy chain constant region is human IgGl. In another embodiment, the anti-PD-1 antibody molecule has a light chain constant region chosen from, e.g., the light chain constant regions of kappa or lambda, preferably kappa (e.g., human kappa). In one embodiment, the constant region is altered, e.g., mutated, to modify the properties of the anti-PD-1 antibody molecule (e.g., to increase or decrease one or more of: Fc receptor binding, antibody glycosylation, the number of cysteine residues, effector cell function, or complement function). For example, the constant region is mutated at positions 296 (M to Y), 298 (S to T), 300 (T to E), 477 (H to K) and 478 (N to F) to alter Fc receptor binding (e.g., the mutated positions correspond to positions 132 (M to Y), 134 (S to T), 136 (T to E), 313 (H to K) and 314 (N to F) of SEQ I D NOs: 212 or 214; or positions 135 (M to Y), 137 (S to T), 139 (T to E), 316 (H to K) and 317 (N to F) of SEQ ID NOs: 215, 216, 217 or 218). In another embodiment, the heavy chain constant region of an lgG4, e.g., a human lgG4, is mutated at position 228 according to EU numbering (e.g., S to P), e.g., as shown in Table D. In certain embodiments, the anti-PD-1 antibody molecules comprises a human lgG4 mutated at position 228 according to EU numbering (e.g., S to P), e.g., as shown in Table D; and a kappa light chain constant region, e.g., as shown in Table D. In still another embodiment, the heavy chain constant region of an IgGl, e.g., a human IgGl, is mutated at one or more of position 297 according to EU numbering (e.g., N to A), position 265 according to EU numbering (e.g., D to A), position 329 according to EU numbering (e.g., P to A), position 234 according to EU numbering (e.g., L to A), or position 235 according to EU numbering (e.g., L to A), e.g., as shown in Table D. In certain embodiments, the anti-PD-1 antibody molecules comprises a human IgGl mutated at one or more of the aforesaid positions, e.g., as shown in Table D; and a kappa light chain constant region, e.g., as shown in Table D.

In one embodiment, the anti-PD-1 antibody molecule is isolated or recombinant.

In one embodiment, the anti-PD-1 antibody molecule is a humanized antibody molecule.

In one embodiment, the anti-PD-1 antibody molecule has a risk score based on T cell epitope analysis of less than 700, 600, 500, 400 or less.

In one embodiment, the anti-PD-1 antibody molecule is a humanized antibody molecule and has a risk score based on T cell epitope analysis of 300 to 700, 400 to 650, 450 to 600, or a risk score as described herein.

In one embodiment, the anti-PD-1 antibody molecule includes:

(a) a heavy chain variable region (VH) comprising a VHCD 1 amino acid sequence of SEQ I D NO: 4, a VHCDR2 amino acid sequence of SEQ I D NO: 5, and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33;

(b) a VH comprising a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ I D NO: 224, a VHCDR2 amino acid sequence of SEQ I D NO: 5, and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ I D NO: 13, a VLCDR2 amino acid sequence of SEQ I D NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ I D NO: 2; and a VHCDR3 amino acid sequence of SEQ I D NO: 3; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

In certain embodiments, the anti-PD-1 antibody molecule comprises:

(i) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and

(ii) a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32.

In other embodiments, the anti-PD-1 antibody molecule comprises:

(i) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence chosen from SEQ ID NO: 1, SEQ ID NO: 4 or SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and

(ii) a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33.

In embodiments of the aforesaid antibody molecules, the VHCDR1 comprises the amino acid sequence of SEQ ID NO: 1. In other embodiments, the VHCDR1 comprises the amino acid sequence of SEQ ID NO: 4. In yet other embodiments, the VHCDR1 amino acid sequence of SEQ ID NO: 224.

In embodiments, the aforesaid antibody molecules have a heavy chain variable region comprising at least one framework (FW) region comprising the amino acid sequence of any of SEQ ID NOs: 147, 151, 153, 157, 160, 162, 166, or 169, or an amino acid sequence at least 90% identical thereto, or having no more than two amino acid substitutions, insertions or deletions compared to the amino acid sequence of any of SEQ ID NOs: 147, 151, 153, 157, 160, 162, 166, or 169.

In other embodiments, the aforesaid antibody molecules have a heavy chain variable region comprising at least one framework region comprising the amino acid sequence of any of SEQ ID NOs: 147, 151, 153, 157, 160, 162, 166, or 169.

In yet other embodiments, the aforesaid antibody molecules have a heavy chain variable region comprising at least two, three, or four framework regions comprising the amino acid sequences of any of SEQ ID NOs: 147, 151, 153, 157, 160, 162, 166, or 169.

In other embodiments, the aforesaid antibody molecules comprise a VHFW1 amino acid sequence of SEQ ID NO: 147 or 151, a VHFW2 amino acid sequence of SEQ ID NO: 153, 157, or 160, and a VHFW3 amino acid sequence of SEQ ID NO: 162 or 166, and, optionally, further comprising a VHFW4 amino acid sequence of SEQ ID NO: 169.

In other embodiments, the aforesaid antibody molecules have a light chain variable region comprising at least one framework region comprising the amino acid sequence of any of SEQ ID NOs: 174, 177, 181, 183, 185, 187, 191, 194, 196, 200, 202, 205, or 208, or an amino acid sequence at least 90% identical thereto, or having no more than two amino acid substitutions, insertions or deletions compared to the amino acid sequence of any of 174, 177, 181, 183, 185, 187, 191, 194, 196, 200, 202, 205, or 208.

In other embodiments, the aforesaid antibody molecules have a light chain variable region comprising at least one framework region comprising the amino acid sequence of any of SEQ ID NOs: 174, 177, 181, 183, 185, 187, 191, 194, 196, 200, 202, 205, or 208.

In other embodiments, the aforesaid antibody molecules have a light chain variable region comprising at least two, three, or four framework regions comprising the amino acid sequences of any of SEQ ID NOs: 174, 177, 181, 183, 185, 187, 191, 194, 196, 200, 202, 205, or 208.

In other embodiments, the aforesaid antibody molecules comprise a VLFW1 amino acid sequence of SEQ ID NO: 174, 177, 181, 183, or 185, a VLFW2 amino acid sequence of SEQ ID NO: 187, 191, or 194, and a VLFW3 amino acid sequence of SEQ ID NO: 196, 200, 202, or 205, and, optionally, further comprising a VLFW4 amino acid sequence of SEQ ID NO: 208.

In other embodiments, the aforesaid antibodies comprise a heavy chain variable domain comprising an amino acid sequence at least 85% identical to any of SEQ ID NOs: 38, 50, 82, or 86.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38, 50, 82, or 86.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising an amino acid sequence at least 85% identical to any of SEQ ID NOs: 42, 46, 54, 58, 62, 66, 70, 74, or 78.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 42, 46, 54, 58, 62, 66, 70, 74, or 78.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40. In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 91.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 50.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 52 or SEQ ID NO: 102.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 82.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 84.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 86.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 88.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 42.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 44.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 46.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 48.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 54.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 56.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 58.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 60.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 62.

In other embodiments, the aforesaid antibodies comprise a light chain comprising the amino acid sequence of SEQ ID NO: 64. In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 66.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 70.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 74.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 76.

In other embodiments, the aforesaid antibody molecules comprise a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 78.

In other embodiments, the aforesaid antibody molecules comprise a light chain comprising the amino acid sequence of SEQ ID NO: 80.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 42.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 66.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 70.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 70.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 46.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 46. In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 54.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 54.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 58.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 62.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 50 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 66.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 74.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 38 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 78.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 82 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 70.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 82 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 66.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 86 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 66.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain comprising the amino acid sequence of SEQ ID NO: 44. In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain comprising the amino acid sequence of SEQ ID NO: 56.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 102 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 44.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 48.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 52 and a light chain comprising the amino acid sequence of SEQ ID NO: 48.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 52 and a light chain comprising the amino acid sequence of SEQ ID NO: 56.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 56.

In other embodiments, the aforesaid antibodies comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 60.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 64. In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 52 and a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 52 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 76.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 40 and a light chain comprising the amino acid sequence of SEQ ID NO: 80.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 84 and a light chain comprising the amino acid sequence of SEQ ID NO: 72.

In other embodiments, the aforesaid antibodies comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 84 and a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules comprise a heavy chain comprising the amino acid sequence of SEQ ID NO: 88 and a light chain comprising the amino acid sequence of SEQ ID NO: 68.

In other embodiments, the aforesaid antibody molecules are chosen from a Fab, F(ab')2, Fv, or a single chain Fv fragment (scFv).

In other embodiments, the aforesaid antibody molecules comprise a heavy chain constant region selected from IgGl, lgG2, lgG3, and lgG4.

In other embodiments, the aforesaid antibody molecules comprise a light chain constant region chosen from the light chain constant regions of kappa or lambda. In other embodiments, the aforesaid antibody molecules comprise a human lgG4 heavy chain constant region with a mutation at position 228 according to EU numbering or position 108 of SEQ ID NO: 212 or 214 and a kappa light chain constant region.

In other embodiments, the aforesaid antibody molecules comprise a human lgG4 heavy chain constant region with a Serine to Proline mutation at position 228 according to EU numbering or position 108 of SEQ ID NO: 212 or 214 and a kappa light chain constant region.

In other embodiments, the aforesaid antibody molecules comprise a human IgGl heavy chain constant region with an Asparagine to Alanine mutation at position 297 according to EU numbering or position 180 of SEQ ID NO: 216 and a kappa light chain constant region.

In other embodiments, the aforesaid antibody molecules comprise a human IgGl heavy chain constant region with an Aspartate to Alanine mutation at position 265 according to EU numbering or position 148 of SEQ ID NO: 217, and Proline to Alanine mutation at position 329 according to EU numbering or position 212 of SEQ ID NO: 217 and a kappa light chain constant region.

In other embodiments, the aforesaid antibody molecules comprise a human IgGl heavy chain constant region with a Leucine to Alanine mutation at position 234 according to EU numbering or position 117 of SEQ ID NO: 218, and Leucine to Alanine mutation at position 235 according to EU numbering or position 118 of SEQ ID NO: 218 and a kappa light chain constant region.

In other embodiments, the aforesaid antibody molecules are capable of binding to human PD-1 with a dissociation constant (K D ) of less than about 0.2 nM.

In some embodiments, the aforesaid antibody molecules bind to human PD-1 with a K D of less than about 0.2 nM, 0.15 nM, 0.1 nM, 0.05 nM, or 0.02 nM, e.g., about 0.13 nM to 0.03 nM, e.g., about 0.077 nM to 0.088 nM, e.g., about 0.083 nM, e.g., as measured by a Biacore method.

In other embodiments, the aforesaid antibody molecules bind to cynomolgus PD-1 with a K D of less than about 0.2 nM, 0.15 nM, 0.1 nM, 0.05 nM, or 0.02 nM, e.g., about 0.11 nM to 0.08 nM, e.g., about 0.093 nM, e.g., as measured by a Biacore method.

In certain embodiments, the aforesaid antibody molecules bind to both human PD-1 and cynomolgus PD-1 with similar K D , e.g., in the nM range, e.g., as measured by a Biacore method. In some embodiments, the aforesaid antibody molecules bind to a human PD-l-lg fusion protein with a K D of less than about 0.1 nM, 0.075 nM, 0.05 nM, 0.025 nM, or 0.01 nM, e.g., about 0.04 nM, e.g., as measured by ELISA.

In some embodiments, the aforesaid antibody molecules bind to Jurkat cells that express human PD-1 (e.g., human PD-l-transfected Jurkat cells) with a K D of less than about 0.1 nM, 0.075 nM, 0.05 nM, 0.025 nM, or 0.01 nM, e.g., about 0.06 nM, e.g., as measured by FACS analysis.

In some embodiments, the aforesaid antibody molecules bind to cynomolgus T cells with a K D of less than about InM, 0.75 nM, 0.5 nM, 0.25 nM, or 0.1 nM, e.g., about 0.4 nM, e.g., as measured by FACS analysis.

In some embodiments, the aforesaid antibody molecules bind to cells that express cynomolgus PD-1 (e.g., cells transfected with cynomolgus PD-1) with a K D of less than about InM, 0.75 nM, 0.5 nM, 0.25 nM, or 0.01 nM, e.g., about 0.6 nM, e.g., as measured by FACS analysis.

In certain embodiments, the aforesaid antibody molecules are not cross-reactive with mouse or rat PD-1. In other embodiments, the aforesaid antibodies are cross-reactive with rhesus PD-1. For example, the cross-reactivity can be measured by a Biacore method or a binding assay using cells that expresses PD-1 (e.g., human PD-l-expressing 300.19 cells). In other embodiments, the aforesaid antibody molecules bind an extracellular Ig-like domain of PD-1.

In other embodiments, the aforesaid antibody molecules are capable of reducing binding of PD-1 to PD-Ll, PD-L2, or both, or a cell that expresses PD-Ll, PD-L2, or both. In some embodiments, the aforesaid antibody molecules reduce (e.g., block) PD-Ll binding to a cell that expresses PD-1 (e.g., human PD-l-expressing 300.19 cells) with an IC50 of less than about 1.5 nM, 1 n M, 0.8 nM, 0.6 nM, 0.4 nM, 0.2 nM, or 0.1 nM, e.g., between about 0.79 nM and about 1.09 nM, e.g., about 0.94 n M, or about 0.78 nM or less, e.g., about 0.3 nM. In some embodiments, the aforesaid antibodies reduce (e.g., block) PD-L2 binding to a cell that expresses PD-1 (e.g., human PD-l-expressing 300.19 cells) with an IC50 of less than about 2 nM, 1.5 nM, 1 n M, 0.5 nM, or 0.2 nM, e.g., between about 1.05 nM and about 1.55 nM, or about 1.3 nM or less, e.g., about 0.9 nM .

In other embodiments, the aforesaid antibody molecules are capable of enhancing an antigen-specific T cell response.

In embodiments, the antibody molecule is a monospecific antibody molecule or a bispecific antibody molecule. In embodiments, the antibody molecule has a first binding specificity for PD-1 and a second binding specificity for TI M-3, LAG-3, CEACAM (e.g., CEACAM-

1, CEACAM-3, and/or CEACAM-5), PD-Ll or PD-L2. In embodiments, the antibody molecule comprises an antigen binding fragment of an antibody, e.g., a half antibody or antigen binding fragment of a half antibody.

In some embodiments, the aforesaid antibody molecules increase the expression of I L- 2 from cells activated by Staphylococcal enterotoxin B (SEB) (e.g., at 25 μg/mL) by at least about 2, 3, 4, 5-fold, e.g., about 2 to 3-fold, e.g., about 2 to 2.6-fold, e.g., about 2.3-fold, compared to the expression of IL-2 when an isotype control (e.g., lgG4) is used, e.g., as measured in a SEB T cell activation assay or a human whole blood ex vivo assay.

In some embodiments, the aforesaid antibody molecules increase the expression of IFN-γ from T cells stimulated by anti-CD3 (e.g., at 0.1 μ§/ιηΙ-) by at least about 2, 3, 4, 5-fold, e.g., about 1.2 to 3.4-fold, e.g., about 2.3-fold, compared to the expression of IFN-γ when an isotype control (e.g., lgG4) is used, e.g., as measured in an IFN-γ activity assay.

In some embodiments, the aforesaid antibody molecules increase the expression of IFN-γ from T cells activated by SEB (e.g., at 3 pg/mL) by at least about 2, 3, 4, 5-fold, e.g., about 0.5 to 4.5-fold, e.g., about 2.5-fold, compared to the expression of IFN-γ when an isotype control (e.g., lgG4) is used, e.g., as measured in an IFN-γ activity assay.

In some embodiments, the aforesaid antibody molecules increase the expression of IFN-γ from T cells activated with an CMV peptide by at least about 2, 3, 4, 5-fold, e.g., about 2 to 3.6-fold, e.g., about 2.8-fold, compared to the expression of IFN-γ when an isotype control (e.g., lgG4) is used, e.g., as measured in an IFN-γ activity assay.

In some embodiments, the aforesaid antibody molecules increase the proliferation of CD8 + T cells activated with an CMV peptide by at least about 1, 2, 3, 4, 5-fold, e.g., about 1.5- fold, compared to the proliferation of CD8 + T cells when an isotype control (e.g., lgG4) is used, e.g., as measured by the percentage of CD8+ T cells that passed through at least n (e.g., n = 2 or 4) cell divisions.

In certain embodiments, the aforesaid antibody molecules has a Cmax between about 100 μg/mL and about 500 μg/mL, between about 150 μg/mL and about 450 μg/mL, between about 250 μg/mL and about 350 μg/mL, or between about 200 μg/mL and about 400 μg/mL, e.g., about 292.5 μg/mL, e.g., as measured in monkey.

In certain embodiments, the aforesaid antibody molecules has a T 1 2 between about 250 hours and about 650 hours, between about 300 hours and about 600 hours, between about 350 hours and about 550 hours, or between about 400 hours and about 500 hours, e.g., about 465.5 hours, e.g., as measured in monkey.

In some embodiments, the aforesaid antibody molecules bind to PD-1 with a Kd slower than 5 X 10 "4 , 1 X 10 "4 , 5 X 10 "5 , or 1 X 10 "5 s \ e.g., about 2.13 X 10 "4 s \ e.g., as measured by a Biacore method. In some embodiments, the aforesaid antibody molecules bind to PD-1 with a Ka faster than 1 X 10 4 , 5 X 10 4 , 1 X 10 5 , or 5 X 10 5 M ' V 1 , e.g., about 2.78 X 10 5 M ' V 1 , e.g., as measured by a Biacore method.

In some embodiments, the aforesaid anti-PD-1 antibody molecules bind to one or more residues within the C strand, CC loop, C strand and FG loop of PD-1. The domain structure of PD-1 is described, e.g., in Cheng et al., "Structure and Interactions of the Human Programmed Cell Death 1 Receptor" J. Biol. Chem. 2013, 288:11771-11785. As described in Cheng et. al., the C strand comprises residues F43-M50, the CC loop comprises S51-N54, the C strand comprises residues Q55-F62, and the FG loop comprises residues L108-I114 (amino acid numbering according to Chang et al. supra). Accordingly, in some embodiments, an anti-PD-1 antibody as described herein binds to at least one residue in one or more of the ranges F43- M50, S51-N54, Q55-F62, and L108-I114 of PD-1. In some embodiments, an anti-PD-1 antibody as described herein binds to at least one residue in two, three, or all four of the ranges F43- M50, S51-N54, Q55-F62, and L108-I114 of PD-1. In some embodiments, the anti-PD-1 antibody binds to a residue in PD-1 that is also part of a binding site for one or both of PD-L1 and PD-L2.

In another aspect, the invention provides an isolated nucleic acid molecule encoding any of the aforesaid antibody molecules, vectors and host cells thereof.

An isolated nucleic acid encoding the antibody heavy chain variable region or light chain variable region, or both, of any the aforesaid antibody molecules is also provided.

In one embodiment, the isolated nucleic acid encodes heavy chain CDRs 1-3, wherein said nucleic acid comprises a nucleotide sequence of SEQ ID NO: 108-112, 223, 122-126, 133- 137, or 144-146.

In another embodiment, the isolated nucleic acid encodes light chain CDRs 1-3, wherein said nucleic acid comprises a nucleotide sequence of SEQ ID NO: 113-120, 127-132, or 138-143.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a heavy chain variable domain, wherein said nucleotide sequence is at least 85% identical to any of SEQ ID NO: 39, 51, 83, 87, 90, 95, or 101.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a heavy chain variable domain, wherein said nucleotide sequence comprises any of SEQ ID NO: 39, 51, 83, 87, 90, 95, or 101.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a heavy chain, wherein said nucleotide sequence is at least 85% identical to any of SEQ ID NO: 41, 53, 85, 89, 92, 96, or 103.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a heavy chain, wherein said nucleotide sequence comprises any of SEQ ID NO: 41, 53, 85, 89, 92, 96, or 103. In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a light chain variable domain, wherein said nucleotide sequence is at least 85% identical to any of SEQ I D NO: 45, 49, 57, 61, 65, 69, 73, 77, 81, 94, 98, 100, 105, or 107.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a light chain variable domain, wherein said nucleotide sequence comprises any of SEQ ID NO: 45, 49, 57, 61, 65, 69, 73, 77, 81, 94, 98, 100, 105, or 107.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a light chain, wherein said nucleotide sequence is at least 85% identical to any of SEQ ID NO: 45, 49, 57, 61, 65, 69, 73, 77, 81, 94, 98, 100, 105 or 107.

In other embodiments, the aforesaid nucleic acid further comprises a nucleotide sequence encoding a light chain, wherein said nucleotide sequence comprises any of SEQ ID NO: 45, 49, 57, 61, 65, 69, 73, 77, 81, 94, 98, 100, 105 or 107.

In certain embodiments, one or more expression vectors and host cells comprising the aforesaid nucleic acids are provided.

A method of producing an antibody molecule or fragment thereof, comprising culturing the host cell as described herein under conditions suitable for gene expression is also provided.

In one aspect, the invention features a method of providing an antibody molecule described herein. The method includes: providing a PD-1 antigen (e.g., an antigen comprising at least a portion of a PD-1 epitope); obtaining an antibody molecule that specifically binds to the PD-1 polypeptide; and evaluating if the antibody molecule specifically binds to the PD-1 polypeptide, or evaluating efficacy of the antibody molecule in modulating, e.g., inhibiting, the activity of the PD-1. The method can further include administering the antibody molecule to a subject, e.g., a human or non-human animal.

In another aspect, the invention provides, compositions, e.g., pharmaceutical compositions, which include a pharmaceutically acceptable carrier, excipient or stabilizer, and at least one of the therapeutic agents, e.g., anti-PD-1 antibody molecules described herein. In one embodiment, the composition, e.g., the pharmaceutical composition, includes a combination of the antibody molecule and one or more agents, e.g., a therapeutic agent or other antibody molecule, as described herein. In one embodiment, the antibody molecule is conjugated to a label or a therapeutic agent. Table B. Amino acid and nucleotide sequences for murine, chimeric and humanized PD-1 antibody molecules. The antibody molecules include murine mAb BAP049, chimeric mAbs

BAP049-chi and BAP049-chi-Y, and humanized mAbs BAP049-hum01 to BAP049-huml6 and BAP049-Clone-A to BAP049-Clone-E. The amino acid and nucleotide sequences of the heavy and light chain CDRs, the heavy and light chain variable regions, and the heavy and light chains are shown.


































1 BAP049 LC


1 SEQID NO: 11 (Kabat) LCD 2 WASTRES



1 SEQID NO: 14 (Chothia) LCDR2 WAS

1 SEQID NO: 15 (Chothia) LCDR3 DYSYPC














1 BAP049-chi HC
















































































































































BAP049-chi LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 15 (Chothia) LCDR3 DYSYPC







































BAP049-chi-Y HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG



































































































































BAP049-chi-Y LC





SEQID NO: 14 (Chothia) LCDR2 WAS











































BAP049-hum01 HC

SEQ I D NO: 1 (Kabat) HCD 1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG




























































































































BAP049-hum02 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY










































BAP049-hum03 HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG












































































































BAP049-hum04 HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG







































































BAP049-hum04 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WAST RES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY









































BAP049-hum05 HC







































































BAP049-hum05 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES


SEQ I D NO: 13 (Chothia) LCDRl SQSLLDSG NQKN F SEQ I D NO: 14 (Chothia) LCD 2 WAS

SEQ I D NO: 33 (Chothia) LCD 3 DYSYPY









































BAP049-hum06 HC















































































SEQID NO 14 (Chothia) LCDR2 WAS


























BAP049-hum07 HC

SEQ ID NO: 1 (Kabat) HCD 1 TYWM H








































































BAP049-hum07 LC





SEQID NO: 14 (Chothia) LCDR2 WAS







































BAP049-hum08 HC



















































































































































BAP049-hum09 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY







































BAP049-humlO HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG






































































































BAP049-humll HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG







































































BAP049-humll LC


SEQ I D NO: 11 ( Kabat) LCD 2 WAST RES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY









































BAP049-huml2 HC







































































BAP049-huml2 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES


SEQ I D NO: 13 (Chothia) LCDRl SQSLLDSG NQKN F SEQ I D NO: 14 (Chothia) LCD 2 WAS

SEQ I D NO: 33 (Chothia) LCD 3 DYSYPY









































BAP049-huml3 HC















































































SEQID NO 14 (Chothia) LCDR2 WAS


























BAP049-huml4 HC

SEQ I D NO: 1 (Kabat) HCD 1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG






























































BAP049-huml4 LC





SEQID NO: 14 (Chothia) LCDR2 WAS







































BAP049-huml5 HC

SEQ I D NO: 1 (Kabat) HCD 1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG













































































































































BAP049-huml6 LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY







































BAP049-Clone-A HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG













































































































BAP049-Clone-B HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG








































































BAP049-Clone-B LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS

SEQ I D NO: 33 (Chothia) LCDR3 DYSYPY



































BAP049-Clone-C HC

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H



SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG







































































BAP049-Clone-C LC


SEQ I D NO: 11 ( Kabat) LCD 2 WASTRES



SEQ I D NO: 14 (Chothia) LCDR2 WAS





















































































































BAP049-Clone-D LC




SEQ I D NO: 14 (Chothia) LCD 2 WAS

SEQ I D NO: 33 (Chothia) LCD 3 DYSYPY










































BAP049-Clone-E HC

SEQ I D NO: 224 (Chothia/Kabat

combined) HCD 1 GYTFTTYWM H

SEQ I D NO: 1 (Kabat) HCDR1 TYWM H




SEQ I D NO: 5 (Chothia) HCDR2 YPGTGG





































































BAP049-Clone-E LC





SEQID NO: 14 (Chothia) LCDR2 WAS






















































BAP049-chi HC


SEQID NO: 109 (Kabat) HCDR2






1 BAP049-chi LC






! SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

1 SEQ ID NO: 117 (Chothia) LCDR2 TGGGCATCC


1 BAP049-chi Y HC








1 BAP049-chi Y LC






! SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC


1 BAP049-hum01 HC








1 BAP049-hum01 LC






j SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

1 SEQ ID NO: 117 (Chothia) LCDR2 TGGGCATCC


1 BAP049-hum02 HC








1 BAP049-hum02 LC





! SEQID 116 (Chothia) LCDR1 GAACTTC

1 SEQID 117 (Chothia) LCD 2


! BAP049-hum03 HC




1 SEQID 110 (Kabat) HCDR3 TG G G G GG

SEQID 111 (Chothia) HCDR1

SEQID 112 (Chothia) HCDR2

SEQID 110 (Chothia) HCDR3

BAP049-hum03 LC j SEQID 113 (Kabat) LCDR1

SEQID 114 (Kabat) LCDR2

SEQID 119 (Kabat) LCDR3

! SEQID 116 (Chothia) LCDR1

SEQID 117 (Chothia) LCDR2

1 SEQID 120 (Chothia) LCDR3

BAP049-hum04 HC

SEQID 108 (Kabat) HCDR1


j SEQID 109 (Kabat) HCDR2

SEQID 110 (Kabat) HCDR3

1 SEQID 111 (Chothia) HCDR1

SEQID 112 (Chothia) HCDR2

SEQID 110 (Chothia) HCDR3 BAP049-hum04 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-hum05 HC








BAP049-hum05 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-hum06 HC







BAP049-hum06 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-hum07 HC








BAP049-hum07 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC










BAP049-hum08 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-hum09 HC








BAP049-hum09 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC 1 SEQ ID NO: 117 (Chothia) LCD 2 TGGGCATCC


1 BAP049-humlO HC








! BAP049-humlO LC






! SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

1 SEQ ID NO: 117 (Chothia) LCDR2 TGGGCATCC


1 BAP049-humll HC








1 BAP049-humll LC





SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

SEQ ID NO: 117 (Chothia) LCD 2 TGGGCATCC


BAP049-huml2 HC








BAP049-huml2 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-huml3 HC







BAP049-huml3 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-huml4 HC








BAP049-huml4 LC






SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC



BAP049-huml5 HC







! BAP049-huml5 LC






! SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

1 SEQ ID NO: 117 (Chothia) LCDR2 TGGGCATCC


1 BAP049-huml6 HC








1 BAP049-huml6 LC






j SEQ ID NO: 116 (Chothia) LCDR1 GAACTTC

1 SEQ ID NO: 117 (Chothia) LCDR2 TGGGCATCC


SEQID NO: 141 (Chothia) LCD 1 GAACTTC



BAP049-Clone-C HC








BAP049-Clone-C LC






SEQID NO: 130 (Chothia) LCDR1 AACTTC



BAP049-Clone-D HC













SEQ ID NO: 130 (Chothia) LCDR1 AACTTC



BAP049-Clone-E HC








BAP049-Clone-E LC






SEQ ID NO: 141 (Chothia) LCDR1 GAACTTC



Table C. Amino acid and nucleotide sequences of the heavy and light chain framework regions for humanized anti-PD-1 mAbs BAP049-hum01 to BAP049-huml6 and BAP049-Clone-A to


Amino Acid Sequence Nucleotide Sequence







T (SEQ ID NO: 152)


(type a) (SEQ ID NO: 153) ATGGGT (SEQ ID NO: 154)




(type b) (SEQ ID NO: 157) TGGGT (SEQ ID NO: 158)



(type c) (SEQ ID NO: 160) ATGGGT (SEQ ID NO: 161)
















NO: 175)




NO: 178)





NO: 182)



NO: 184)



NO: 186)


(type a) (SEQ ID NO: 187) TCATCTAT (SEQ ID NO: 188)



(type b) (SEQ ID NO: 191) TGATCTAT (SEQ I D NO: 192)



(type c) (SEQ ID NO: 194) TGATCTAT (SEQ I D NO: 195)


















NO: 209)


TTCGGTCAAGGCACTAAGGTCGAGATTAAG (SEQ ID NO: 211) Table D. Constant region amino acid sequences of human IgG heavy chains and human kappa light chain

HC lgG4 (S228P) mutant constant region amino acid sequence (EU Numbering)


LC Human kappa constant region amino acid sequence


HC lgG4 (S228P) mutant constant region amino acid sequence lacing C-terminal lysine (K) (EU Numbering)


HC IgGl wild type


HC IgGl (N297A) mutant constant region amino acid sequence (EU Numbering)


HC IgGl (D265A, P329A) mutant constant region amino acid sequence (EU Numbering)


HC IgGl (L234A, L235A) mutant constant region amino acid sequence (EU Numbering)


Therapeutic kits

In one embodiment, the invention provides a kit comprising two or more separate pharmaceutical compositions, at least one of which contains a compound of formula (I). In one embodiment, the kit comprises means for separately retaining said compositions, such as a container, divided bottle, or divided foil packet. An example of such a kit is a blister pack, as typically used for the packaging of tablets, capsules and the like.

The kit of the invention may be used for administering different dosage forms, for example, oral and parenteral, for administering the separate compositions at different dosage intervals, or for titrating the separate compositions against one another. To assist compliance, the kit of the invention typically comprises directions for administration.

In the combination therapies of the invention, the compound of Formula I and the other immunotherapeutic agent may be manufactured and/or formulated by the same or different manufacturers. Moreover, the compound of the invention and the other therapeutic may be brought together into a combination therapy: (i) prior to release of the combination product to physicians (e.g. in the case of a kit comprising the compound of the invention and the other therapeutic agent); (ii) by the physician themselves (or under the guidance of the physician) shortly before administration; (iii) in the patient themselves, e.g. during sequential administration of the compound of the invention and the other therapeutic agent.

Accordingly, the invention provides the use of a compound of formula (I) for treating cancer, wherein the medicament is prepared for administration with another

immunotherapeutic agent. The invention also provides the use of an immunotherapeutic agent for treating cancer, wherein the medicament is administered with a compound of formula (I). The invention also provides a compound of formula (I) for use in a method of treating cancer, wherein the compound of formula (I) is prepared for administration with another immunotherapeutic agent. The invention also provides another immunotherapeutic agent for use in a method of treating cancer, wherein the other immunotherapeutic agent is prepared for administration with a compound of formula (I). The invention also provides a compound of formula (I) for use in a method of treating cancer, wherein the compound of formula (I) is administered with another immunotherapeutic agent. The invention also provides another immunotherapeutic agent for use in a method of treating cancer, wherein the other therapeutic agent is administered with a compound of formula (I).

The invention also provides the use of a compound of formula (I) for treating cancer, wherein the patient has previously (e.g. within 24 hours) been treated with another immunotherapeutic agent. The invention also provides the use of another immunotherapeutic agent for treating cancer, wherein the patient has previously (e.g. within 24 hours) been treated with a compound of formula (I).

Pharmaceutical composition, combination, dosage and administration

In one embodiment, pharmaceutical composition comprises an effective amount of compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and a pharmaceutically acceptable vehicle or carrier.

In another embodiment, the invention pertains to a pharmaceutical combination, comprising a therapeutically acceptable amount of a compound of Formula (I), or a pharmaceutically acceptable salt thereof, and one or more immunotherapeutically active agent, for the manufacture of a medicament for treating cancer.

In one embodiment, the composition comprises at least two pharmaceutically acceptable carriers, such as those described herein. Preferably, pharmaceutically acceptable carriers are sterile. The pharmaceutical composition can be formulated for particular routes of administration such as oral administration, parenteral administration, and rectal

administration, intravenous administration etc. In addition, the pharmaceutical compositions of the present invention can be made up in a solid form (including without limitation capsules, tablets, pills, granules, powders or suppositories), or in a liquid form (including without limitation solutions, suspensions or emulsions). The pharmaceutical compositions can be subjected to conventional pharmaceutical operations such as sterilization and/or can contain conventional inert diluents, lubricating agents, or buffering agents, as well as adjuvants, such as preservatives, stabilizers, wetting agents, emulsifiers and buffers, etc. Typically, the pharmaceutical compositions are tablets or gelatin capsules comprising the active ingredient together with one or more of: a) diluents, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose and/or glycine; b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt and/or polyethyleneglycol; for tablets also c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth,

methylcellulose, sodium carboxymethylcellulose and/or polyvinylpyrrolidone; if desired d) disintegrants, e.g., starches, agar, alginic acid or its sodium salt, or effervescent mixtures; and e) absorbents, colorants, flavors and sweeteners.

Tablets may be either film coated or enteric coated according to methods known in the art.

Suitable compositions for oral administration include an effective amount of a compound of the invention in the form of tablets, lozenges, aqueous or oily suspensions, dispersible powders or granules, emulsion, hard or soft capsules, or syrups or elixirs. Compositions intended for oral use are prepared according to any method known in the art for the manufacture of pharmaceutical compositions and such compositions can contain one or more agents selected from the group consisting of sweetening agents, flavoring agents, coloring agents and preserving agents in order to provide pharmaceutically elegant and palatable preparations. Tablets may contain the active ingredient in admixture with nontoxic pharmaceutically acceptable excipients which are suitable for the manufacture of tablets. These excipients are, for example, inert diluents, such as calcium carbonate, sodium carbonate, lactose, calcium phosphate or sodium phosphate; granulating and disintegrating agents, for example, corn starch, or alginic acid; binding agents, for example, starch, gelatin or acacia; and lubricating agents, for example magnesium stearate, stearic acid or talc. The tablets are uncoated or coated by known techniques to delay disintegration and absorption in the gastrointestinal tract and thereby provide a sustained action over a longer period. For example, a time delay material such as glyceryl monostearate or glyceryl distearate can be employed. Formulations for oral use can be presented as hard gelatin capsules wherein the active ingredient is mixed with an inert solid diluent, for example, calcium carbonate, calcium phosphate or kaolin, or as soft gelatin capsules wherein the active ingredient is mixed with water or an oil medium, for example, peanut oil, liquid paraffin or olive oil. Certain injectable compositions are aqueous isotonic solutions or suspensions, and suppositories are advantageously prepared from fatty emulsions or suspensions. Said compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances. Said compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1-75%, or contain about 1-50%, of the active ingredient.

In a preferred embodiment, the compound of formula (I) or pharmaceutically acceptable salt or co-crystals thereof for use in the treatment of cancer are for administration by parenteral or oral route, preferably by oral route.

The pharmaceutical composition or combination of the present invention can be in unit dosage of about 1-1000 mg of active ingredient(s) for a subject of about 50-70 kg, or about 1-650 mg or about 1-350 mg or about 1-200 mg of active ingredients. The

therapeutically effective dosage of a compound, the pharmaceutical composition, or the combinations thereof, is dependent on the species of the subject, the body weight, age and individual condition, the disorder or disease or the severity thereof being treated. A physician, clinician or veterinarian of ordinary skill can readily determine the effective amount of each of the active ingredients necessary to prevent, treat or inhibit the progress of the disorder or disease.

The above-cited dosage properties are demonstrable in vitro and in vivo tests using advantageously mammals, e.g., mice, rats, dogs, monkeys or isolated organs, tissues and preparations thereof. The compounds of the present invention (Compound of Formula I) can be applied in vitro in the form of solutions, e.g., aqueous solutions, and in vivo either enterally, parenterally, advantageously intravenously, e.g., as a suspension or in aqueous solution. The dosage in vitro may range between about 10 "3 molar and 10 "9 molar concentrations. A therapeutically effective amount in vivo may range depending on the route of administration, between about 0.1-500 mg/kg, or between about 1-100 mg/kg, or between 1-lOmg/Kg. In certain embodiment, the compound of Formula I is administered orally at a dose of about 1 to 30 mg/kg, e.g., about 1 to 25 mg/kg, about 1 to 20 mg/kg, about 1 to 6 mg/kg. The dosing schedule can vary from e.g., once a day to twice a day. In one embodiment, the compound of Formula I is administered at a dose from about 80mg, 160mg, 320mg or 640mg twice a day for a subject of about 50-70Kg. Dosage and administration of the immunotherapeutic agent.

The immunotherapeutic agent (Such as an anti-PD-1 antibody molecule or an anti-PD- Ll molecule antibody) can be administered to the subject systemically (e.g., orally, parenterally, subcutaneously, intravenously, rectally, intramuscularly, intraperitoneally, intranasally, transdermal^, or by inhalation or intracavitary installation), topically, or by application to mucous membranes, such as the nose, throat and bronchial tubes.

Dosages and therapeutic regimens of the immunotherapeutic agent (e.g.anti-PD-1 antibody molecule or anti PD-L1 antibody molecule) can be determined by a skilled artisan. In certain embodiments, the immunotherapeutic agent (e.g. anti-PD-1 antibody molecule) is administered by injection (e.g., subcutaneously or intravenously) at a dose of about 1 to 30 mg/kg, e.g., about 5 to 25 mg/kg, about 10 to 20 mg/kg, about 1 to 5 mg/kg, or about 3 mg/kg. The dosing schedule can vary from e.g., once a week to once every 2, 3, or 4 weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 10 to 20 mg/kg every other week. In another embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 1 to 10 mg/Kg, or from about 1 to 5mg/Kg or about 3mg/kg every 4 weeks.

For example, the anti-PD-1 antibody molecule is administered or used at a flat or fixed dose. In some embodiments, the anti-PD-1 antibody molecule is administered by injection (e.g., subcutaneously or intravenously) at a dose (e.g., a flat dose) of about 200 mg to 500 mg, e.g., about 250 mg to 450 mg, about 300 mg to 400 mg, about 250 mg to 350 mg, about 350 mg to 450 mg, or about 300 mg or about 400 mg. The dosing schedule (e.g., flat dosing schedule) can vary from e.g., once a week to once every 2, 3, 4, 5, or 6 weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 300 mg to 400 mg once every three weeks or once every four weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 300 mg once every three weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 400 mg once every four weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 300 mg once every four weeks. In one embodiment, the anti-PD-1 antibody molecule is administered at a dose from about 400 mg once every three weeks.

In another embodiment, the anti-PD-1 antibody molecule is administered at a flat dose of about 300mg to 400mg once every three weeks or once every four weeks. In a subset of this embodiment, the anti-PD-1 antibody molecule is administered at a flat dose of about 400mg every four weeks. In yet another subset of this embodiment, the anti-PD-1 antibody molecule is administered at a flat dose of about 300mg every three weeks.

In one embodiment of the present invention the compound of formula (I), its pharmaceutically acceptable salts or its co-crystals and the immunotherapeutic agents useful in the treatment of cancer form part of the same composition.

In another embodiment of the present invention the compound of formula (I), its pharmaceutically acceptable salts or its co-crystals and the immunotherapeutic agents useful in the treatment of cancer form part of separate compositions for administration simultaneously or sequentially.

In one embodiment, the compound of Formula I may be administered either simultaneously with, or before or after, one or more immunotherapeutic agents (e.g. anti CTLA4 antibodies, anti-PD-1 antibodies and anti-PD-Ll antibodies). The compound of Formula I may be administered separately, by the same or different route of administration, or together in the same pharmaceutical composition as the immunotherapeutic agents. A preferred immunotherapeutic agent is, for example, an antibody, which is therapeutically active or enhances the therapeutic activity when administered to a patient in combination with a compound of Formula I.

In yet another embodiment, the compound of Formula (I) and the immunotherapeutic agent can be administered simultaneously or sequentially in any order. Any combination and sequence of the compound of Formula (I) and the immunotherapeutic agent (e.g., as described herein) can be used. The compound of Formula (I) and/or immunotherapeutic agent can be administered during periods of active disorder, or during a period of remission or less active disease. The immunotherapeutic agent can be administered before the treatment with compound of Formula (I), concurrently with the treatment, post-treatment, or during remission of the disorder.

In a preferred embodiment, the compound of Formula I is administered (fasting) twice daily, prior to the administration of the immunotherapeutic agent (for example an anti-PD-1 antibody molecule as described herein).

In one embodiment, the invention provides a product comprising a compound of formula (I) and at least one other immunotherapeutic agent as a combined preparation for simultaneous, separate or sequential use in therapy. In one embodiment, the therapy is the treatment of a disease or condition mediated by the A 2 a receptor. Products provided as a combined preparation include a composition comprising the compound of formula (I) and the immunotherapeutic agent(s) together in the same pharmaceutical composition, or the compound of formula (I) and the other therapeutic agent(s) (e.g. anti CTLA4 antibodies, anti- PD-1 antibodies and anti-PD-Ll antibodies in separate form), e.g. in the form of a kit.

In one embodiment, the invention provides a pharmaceutical composition comprising a compound of formula (I) and the immunotherapeutic agent(s) (e.g. anti CTLA4 antibodies, anti-PD-1 antibodies and anti-PD-Ll antibodies). Optionally, the pharmaceutical composition may comprise a pharmaceutically acceptable carrier, as described above.

Enumerated embodiments of the invention are described below:

1- Compound of formula (I)

or a pharmaceutically acceptable salt or co-crystal thereof, for use in the treatment of cancer.

2- Compound for use according to embodiment 1 wherein the cancer is lung cancer.

3- Compound for use according to embodiment 2 wherein the lung cancer is non-small cell lung cancer.

4- Compound for use according to any one of embodiments 1 to 3 wherein said compound is administered by parenteral or oral route.

5- Compound for use according to embodiment 4 wherein said compound is administered by oral route.

6- A combination product comprising a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and one or more immunotherapeutic agents selected from the group consisting of an anti-CTLA4 antibody, an anti-PD-1 antibody and an anti-PD-Ll antibody.

7- The combination as defined in embodiment 6 for use in the treatment of cancer.

8. The combination for use according to embodiment 7 wherein cancer is lung cancer.

9- The combination for use according to embodiment 8 wherein lung cancer is non-small cell lung cancer.

10- The combination for use according to any one of embodiments 6 to 9 wherein the immunotherapeutic agent is selected from the group consisting of ipilimumab, tremelimumab, nivolumab, pembrolizumab, CT-011, AMP-224, M PDL3280A, MEDI4736 and MDX-1105. 11- Combination for use according to embodiment 10 wherein immunotherapeutic agent is selected from the group consisting of MPDL3280A, MEDI4736 and M DX-1105.

12- Combination for use according to embodiment 10 wherein immunotherapeutic agent is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab and AMP-224.

13- The combination for use according to embodiment 6 wherein the immunotherapeutic agent is an anti-PD-1 antibody.

14- The combination for use according to embodiment 13 wherein the anti PD-1 antibody comprises:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 4, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a light chain variable region (VL) comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32,

15- The combination for use according to embodiment 13 wherein the anti-PD-1 antibody comprises:

(a) a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 72.

16- A combination for use according to any one of embodiments 13 to 15 wherein the anti-PD- 1 antibody molecule is administered at a dose of about 300 mg once every three weeks 17- A combination for use according to any one of embodiments 13 to 15 wherein the anti-PD- 1 antibody molecule is administered at a dose of about 400 mg once every four weeks.

18- The combination for use according to embodiment 6 wherein the immunotherapeutic agent is an anti-PD-Ll antibody.

19- The combination for use according to embodiment 18 wherein the anti PD-L1 antibody molecule comprises:

(a) a heavy chain variable region (VH) comprising a VHCD 1 amino acid sequence of SEQ ID NO: 228, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a light chain variable region (VL) comprising a VLCDR1 amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 225; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDR1 amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232.

20- The combination for use according to embodiment 18 wherein the anti-PD-Ll antibody molecule comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 236 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 239.

21- A pharmaceutical composition comprising a compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and a pharmaceutically acceptable vehicle or carrier for use in the treatment of cancer.

22- Composition for use according to embodiment 21 wherein the cancer is lung cancer. 23- Composition for use according to embodiment 22 wherein lung cancer is non-small cell lung cancer.

24- Use of a compound of formula

or a pharmaceutically acceptable salt or co-crystal thereof, for the manufacture of a medicament for treating cancer.

25- Use according to embodiment 24 wherein the cancer is lung cancer.

26- Use according to embodiment 25 wherein the lung cancer is non-small cell lung cancer.

27- Use according to any one of embodiments 24 to 26 wherein said compound is administered by parenteral or oral route.

28- Use according to embodiment 27 wherein said compound is administered by oral route.

29- Use of combination product comprising a therapeutically effective amount of a compound of formula (I) or a pharmaceutically acceptable salt or co-crystal thereof and one or more immunotherapeutic agents selected from the group consisting of an anti-CTLA4 antibody, an anti-PD-1 antibody and an anti-PD-Ll antibody, for the manufacture of a medicament for treating cancer.

30- Use according to embodiment 29 wherein cancer is lung cancer.

31- Use according to embodiment 30 wherein lung cancer is non-small cell lung cancer.

32- Use according to any one of embodiments 29 to 31 wherein the immunotherapeutic agent is selected from the group consisting of ipilimumab, tremelimumab, nivolumab, pembrolizumab, CT-011, AM P-224, MPDL3280A, MEDI4736 and MDX-1105.

33- Use according to embodiment 32 wherein immunotherapeutic agent is selected from the group consisting of MPDL3280A, M EDI4736 and MDX-1105.

34- Use according to embodiment 32 wherein immunotherapeutic agent is selected from the group consisting of nivolumab, pembrolizumab, pidilizumab and AMP-224.

35- Use according to embodiment 29 wherein the immunotherapeutic agent is an anti-PD-1 antibody.

36- Use according to embodiment 35 wherein the anti PD-1 antibody comprises:

(a) a heavy chain variable region (VH) comprising a VHCD 1 amino acid sequence of SEQ ID NO: 4, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a light chain variable region (VL) comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 1; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224, a VHCDR2 amino acid sequence of SEQ ID NO: 5, and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 13, a VLCDR2 amino acid sequence of SEQ ID NO: 14, and a VLCDR3 amino acid sequence of SEQ ID NO: 33; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 224; a VHCDR2 amino acid sequence of SEQ ID NO: 2; and a VHCDR3 amino acid sequence of SEQ ID NO: 3; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 10, a VLCDR2 amino acid sequence of SEQ ID NO: 11, and a VLCDR3 amino acid sequence of SEQ ID NO: 32,

37- Use according to embodiment 35 wherein the anti-PD-1 antibody comprises:

(a) a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 91 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 72.

38- Use according to any one of embodiments 35 to 37 wherein the anti-PD-1 antibody molecule is administered at a dose of about 300 mg once every three weeks

39- Use according to any one of embodiments 35 to 37 wherein the anti-PD-1 antibody molecule is administered at a dose of about 400 mg once every four weeks

40- Use according to embodiment 29 wherein the immunotherapeutic agent is an anti-PD-Ll antibody.

41- Use according to embodiment 40 wherein the anti PD-L1 antibody molecule comprises:

(a) a heavy chain variable region (VH) comprising a VHCDR1 amino acid sequence of SEQ ID NO: 228, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a light chain variable region (VL) comprising a VLCDRl amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235;

(b) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 225; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232;

(c) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244, a VHCDR2 amino acid sequence of SEQ ID NO: 229, and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 233, a VLCDR2 amino acid sequence of SEQ ID NO: 234, and a VLCDR3 amino acid sequence of SEQ ID NO: 235; or

(d) a VH comprising a VHCDR1 amino acid sequence of SEQ ID NO: 244; a VHCDR2 amino acid sequence of SEQ ID NO: 226; and a VHCDR3 amino acid sequence of SEQ ID NO: 227; and a VL comprising a VLCDRl amino acid sequence of SEQ ID NO: 230, a VLCDR2 amino acid sequence of SEQ ID NO: 231, and a VLCDR3 amino acid sequence of SEQ ID NO: 232.

42- Use according to embodiment 40 wherein the anti-PD-Ll antibody molecule comprises a heavy chain variable domain comprising the amino acid sequence of SEQ ID NO: 236 and a light chain variable domain comprising the amino acid sequence of SEQ ID NO: 239.

43- Combination for use according to any one of embodiments 6-20 or use of combination according to any one of embodiments 29-42 wherein the combination of the

immunotherapeutic agent is administered together in a single composition or administered separately in two or more different compositions forms.

44- Combination for use according to any one of embodiments 6-20 or use of combination according to any one of embodiments 29-42 wherein the immunotherapeutic agent is administered concurrently with, prior to, or subsequent to, the compound of Formula (I).


The compound of formula (I) of the present invention can be prepared by using the procedure disclosed in patent application WO 2011/121418 Al, which is incorporated to the present application by reference. Particular compounds used in the following assays are the following:

Compound of formula (I) of the present invention, Example 1 of WO 2011/121418 Al: 5-bromo-2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine. Compound A of the present invention, Example 46 of WO 2011/121418 Al: 5-chloro- 2,6-di-(lH-pyrazol-l-yl)pyrimidin-4-amine.

Compound B of the present invention, Example 48 of WO 2011/121418 Al: 4-amino- 2,6-di-(lH-pyrazol-l-yl)pyrimidine-5-carbonitrile.

As disclosed in patent application WO 2011/121418 Al said compounds have the following binding affinities at hA2A adenosine receptor.

1- Anti-tumor activity of Compound of formula (I) in mice

Wild type C57BI/6 female mice were purchased from Charles River and maintained at the Centre de Recherche du Centre Hospitalier de I'Universite de Montreal. All experiments were carried out in accordance with guidelines set out by the Animal Experimental Ethics Committee. Syngeneic C57B1/6 mice were injected with (i) 3 x 10 5 B16-CD73+ tumor cells intravenously and treated daily for 15 days with vehicle control or Compound of formula (I) at 15 mg/kg/day by oral gavage, or (ii) 2 x 10 5 MCA205 tumor cells intravenously and treated daily for 7 days with vehicle control or Compound of formula (I) at 30 mg/kg/day by oral gavage. Vehicle consisted of 0.1% Tween 80 and 0.5% sodium carboxymethylcellulose (NaCMC) in water. Mice were euthanized at day 15, lungs harvested and tumor nodules counted under dissecting microscope.

As shown in Figure la, oral administration of Compound of formula (I) significantly reduced tumor burden (lung nodule and lung metastasis) of mice injected intravenously with B16- CD73+ or MCA205 tumor cells.

Oral administration of compounds A and B (both at 30mg/Kg/day) under similar conditions at the Faculty of Pharmacy at the University of Barcelona produced no significant reduction of number of lung nodules as shown in Figures lb and lc. 2- Ex vivo study of the efficacy of Compound of formula (I) alone and in combination with anti-PD-1 and anti-PDL-1 antibodies in Human lung tumour explants from patient

Ex vivo experiments were done directly using human resistant lung tumours. Freshly resected NSCLC tumors were obtained through the Tissue Core at Moffitt Cancer Center. The tumor was disaggregated for 2 hours in a Collagenase/DNase solution in the presence of complete protease inhibitors (Roche). Total cells (Tu) were counted. 200,000 cells/well were incubated during 3 days and stimulated with IL-2 (6,000 units/ml), Compound of formula (I) (ΙμΜ), Compound A (ΙμΜ), Compound B (ΙμΜ), anti-PD-Ll antibody (10 mg/ml), anti-PD-1 (10 mg/ml) or combination of Compound of formula (I) with anti-PD-Ll antibody (human monoclonal antibody against the PD-L1 receptor Functional Grade Purified 100 μg purchased from eBioscience, #16-5983-82) (10 mg/ml) and anti-PD-1 antibody (human monoclonal antibody against the PD-1 receptor Functional Grade Purified 100 μg purchased from eBioscience, #16-9989-82) (10 mg/ml), respectively. IL-2 has been used in some experiments in order to stimulate the IFN-γ production in these very resistant tumor cells. As was expected with no manipulation or with the addition of small amounts of IL-2, the T cells displayed little to no activity. Adding in either anti-PD-Ll or the compound of formula (I) partially restored TIL reactivity (as determined by measuring IFNg concentration) in some of the samples, and the combination improved TIL function (as determined by measuring IFNg concentration) in additive way. IFNg (IFN-γ ELISA R&D Systems) was determinated as a measure of T cell reactivity to autologous tumor cells. Results are shown in Figures 2 to 7.

In other tumors the addition of either anti-PD-Ll or compound of formula (I) had no effect on TIL function (as determined by measuring IFNg concentration), but the combination was synergistically capable of restoring TIL function.

The compounds A and B were tested using similar experimental conditions, with the exception that the freshly resected NSCLC tumors were obtained from the Hospital Clinico in Barcelona. Both compounds were not able to increase the secretion of IFNg of tumor cells, neither alone nor in combination with an anti-PD-Ll or an anti-PD-1 antibody.

3- Analysis of interleukins secretion of resistant human lung tumor explants after treatment with Compound of formula (I)

Supernatants from ex vivo experiments are taken to the Bioplex assay in order to measure the concentration of different interleukins. Figure 8 a - g show the results obtained in each case. The compound of formula (I) was able to significantly increase the secretion of different interleukins to the medium, specifically of IL5 (Interleukin 5), IL17 (Interleukin 17), ILlb (Interleukin lb), IL13 (Interleukin 13), IL10 (Interleukin 10), tumor necrosis factor a (TNFa), and M lPlb. This is considered a clear signal of immune stimulation of the infiltrating lymphocytes presents in the tumors.

The combination of compound of formula (I) with either an anti PDL-1 or an anti-PD-1 antibody increased the secretion of different interleukins of these tumors synergistically.

4. Study Design, combination of compound of Formula (I) with an anti-PD-1 antibody

Patients in this study will be males or females 18 years of age or older and have histologically or cytologically confirmed advanced or metastatic NSCLC with at least one measurable lesion. A compound of Formula I will be administered orally to the patient twice daily, fasting, at a dose of 80mg, 160mg, 320 mg or 640mg throughout a cycle of 28 days. An anti-PD-1 antibody will be administered at a dose of about 300mg or about 400mg once every 3 week or once every 4 weeks. The anti-PD-1 antibody will be administered via IV infusion over a period of 30 minutes to 2h. The compound of Formula I will be administered fasting immediately prior to the infusion with the anti-PD-1 antibody.

In order to determine efficacy, baseline evaluations will be performed as closely as possible to the beginning of treatment and never more than 4 weeks before the beginning of the treatment. In addition to a baseline scan, confirmatory scans will be obtained 4-6 weeks following initial documentation of objective response. Response and progression will be evaluated in this study using the new international criteria proposed by the revised Response Evaluation Criteria in Solid Tumors (RECIST) guideline (version 1.1; Eisenhauer EA, Therasse P, Bogaerts J, et al. New response evaluation criteria in solid tumours: revised RECIST guideline (version 1.1). Eur J Cancer 2009;45:228-47). Changes in the largest diameter (unidimensional measurement) of the tumor lesions and the shortest diameter in the case of malignant lymph nodes are used (Schwartz LH, Bogaerts J, Ford R, et al. Evaluation of lymph nodes with RECIST 1.1. Eur J Cancer 2009;45:261-7).

All The same method of assessment and the same technique will be used to characterize each identified and reported lesion at baseline and during follow-up. Imaging-based evaluation such as Chest x-ray, conventional CT and M RI will be used.