Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
AMPLIFICATION-FREE METHODS FOR MEASURING MIRNA
Document Type and Number:
WIPO Patent Application WO/2023/089506
Kind Code:
A1
Abstract:
The present disclosure relates to oligonucleotides conjugated to a probe or a quencher, and the use of such oligonucleotides to measure the level of a miRNA present in a subject. In some aspects, the miRNA is associated with a disease or disorder. Also disclosed herein are methods of treating a subject identified as having abnormal level of a miRNA.

Inventors:
KIM DAE HOON (KR)
MIN HYUN SU (KR)
LIM YU NA (KR)
RO JU YE (KR)
Application Number:
PCT/IB2022/061047
Publication Date:
May 25, 2023
Filing Date:
November 17, 2022
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
BIORCHESTRA CO LTD (KR)
International Classes:
C12Q1/6883; A61K31/7088; A61K39/00; A61K48/00; C12Q1/6818
Domestic Patent References:
WO2014124046A12014-08-14
WO2017057823A12017-04-06
Foreign References:
US20210123051A12021-04-29
Other References:
ALASTAIR W. WARK, HYE JIN LEE, ROBERT M. CORN: "Multiplexed Detection Methods for Profiling MicroRNA Expression in Biological Samples", ANGEWANDTE CHEMIE INTERNATIONAL EDITION, vol. 47, no. 4, 11 January 2008 (2008-01-11), pages 644 - 652, XP055072684, ISSN: 14337851, DOI: 10.1002/anie.200702450
YU LING, LI HAITING, LIU WENHU, ZHANG LIGONG, TIAN QUN, LI HAIRONG, LI MIN: "Retracted: MiR‐485‐3p serves as a biomarker and therapeutic target of Alzheimer's disease via regulating neuronal cell viability and neuroinflammation by targeting AKT3", MOLECULAR GENETICS & GENOMIC MEDICINE, vol. 9, no. 1, 1 January 2021 (2021-01-01), pages e1548, XP093063010, ISSN: 2324-9269, DOI: 10.1002/mgg3.1548
Download PDF:
Claims:
WHAT IS CLAIMED IS: 1. A method of determining a level of a miRNA ("miRNA level") in a subject afflicted with a disease or condition, comprising detecting whether an expression level of a probe is increased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe. 2. A method of identifying a subject afflicted with a disease or disorder, comprising: (a) contacting a biological sample obtained from the subject with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe, wherein an increase in the expression of the probe compared to a corresponding expression level in a reference sample indicates that the subject is afflicted with the disease or disorder. 3. The method of claim 1 or 2, wherein the contacting of the biological sample with the first oligonucleotide occurs prior to the contacting of the biological sample with the second oligonucleotide. 4. The method of any one of claims 1 to 3, wherein the expression level of the probe is increased by at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50-fold, compared to the corresponding expression level in the reference sample.

5. The method of claim 4, wherein the increase in the expression level of the probe is correlated with an increase in the miRNA level. 6. The method of any one of claims 1 to 5, further comprising administering to the subject a treatment for the disease or disorder. 7. A method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having an increase in a level of a miRNA ("miRNA level") in a biological sample obtained from the subject, compared to a corresponding level in a reference sample, wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring an expression level of the probe, wherein the expression level of the probe is correlated with the miRNA level. 8. The method of any one of claims 1 to 7, wherein the reference sample is obtained from a subject who is not afflicted with the disease or disorder. 9. The method of any one of claims 1 to 8, which does not require an amplification step prior to the measuring step in (b). 10. The method of claim 9, wherein the amplification step comprises amplifying a miRNA present in the biological sample prior to the contacting step in (a). 11. The method of any one of claims 1 to 10, wherein the miRNA is associated with the disease or condition. 12. The method of any one of claims 1 to 11, wherein the disease or condition comprises a dementia, Alzheimer's disease, autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, amyotrophic lateral sclerosis (ALS), tauopathy, Huntington's disease, Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), pulmonary disease, inflammatory disease, or metabolic disease, or combinations thereof. 13. The method of any one of claims 1 to 12, wherein the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof. 14. The method of any one of claims 1 to 13, wherein the quencher comprises a dark quencher. 15. The method of any one of claims 1 to 14, wherein the biological sample comprises a saliva, tissue, cell, blood, serum, plasma, cerebrospinal fluid, intravitreal fluid, urine, or combinations thereof. 16. The method of any one of claims 1 to 15, wherein the miRNA comprises a miR-485-3p. 17. The method of claim 16, wherein the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide"). 18. The method of claim 17, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR- 485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length. 19. The method of claim 17 or 18, wherein the anti-miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti-miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence.

20. The method of any one of claims 17 to 19, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'- GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'- GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'- GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), and AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 30). 21. The method of any one of claims 17 to 19, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'- AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 75); 5'-TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'-CGTGTATGAC-3' (SEQ ID NO: 78), 5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89), and 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). 22. The method of any one of claims 17 to 19, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC - 3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 23. The method of claim 22, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 24. The method of claim 22 or 23, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions. 25. The method of claim 22 or 23, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 26. The method of claim 25, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). 27. The method of any one of claims 17 to 26, wherein the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide. 28. The method of claim 27, wherein the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof. 29. The method of any one of claims 17 to 28, wherein the anti-miR-485-3p oligonucleotide comprises a backbone modification.

30. The method of claim 29, wherein the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. 31. The method of any one of claims 6 to 30, wherein the treatment comprises an anti-miR- 485-3p oligonucleotide, which is not conjugated to a probe or a quencher ("miR-485-3p inhibitor"). 32. The method of claim 31, wherein the miR-485-3p inhibitor is administered to the subject by a viral vector. 33. The method of claim 32, wherein the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus. 34. The method of claim 33, wherein the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof. 35. The method of claim 31, wherein the miR-485-3p inhibitor is administered to the subject with a delivery agent. 36. The method of claim 35, wherein the delivery agent comprises a micelle, exosome, lipid nanoparticle, extracellular vesicle, synthetic vesicle, lipidoid, liposome, lipoplex, polymeric compound, peptide, protein, cell, nanoparticle mimic, nanotube, conjugate, or any combination thereof. 37. The method of claim 35 or 36, wherein the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble polymer moiety; CC is a cationic carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers.

38. The method of claim 37, wherein the miR-485-3p inhibitor and the cationic carrier unit are capable of associating with each other to form a micelle when mixed together. 39. The method of claim 38, wherein the association is via a covalent bond. 40. The method of claim 38, wherein the association is via a non-covalent bond. 41. The method of claim 40, wherein the non-covalent bond comprises an ionic bond. 42. The method of any one of claims 37 to 41, wherein the water-soluble polymer moiety comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof. 43. The method of any one of claims 37 to 42, wherein the water-soluble polymer moiety comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). 44. The method of any one of claims 37 to 43, wherein the water-soluble polymer moiety comprises: wherein n is 1-1000. 45. The method of claim 44, wherein the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. 46. The method of claim 44, wherein the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160.

47. The method of any one of claims 37 to 46, wherein the water-soluble polymer moiety is linear, branched, or dendritic. 48. The method of any one of claims 37 to 47, wherein the cationic carrier moiety comprises one or more basic amino acids. 49. The method of claim 48, wherein the cationic carrier moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at last about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 basic amino acids. 50. The method of claim 49, wherein the cationic carrier moiety comprises about 30 to about 50 basic amino acids. 51. The method of any one of claims 48 to 50, wherein the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. 52. The method of any one of claims 48 to 51, wherein the cationic carrier moiety comprises about 40 lysine monomers. 53. The method of any one of claims 37 to 52, wherein the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment. 54. The method of any one of claims 37 to 53, wherein the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof. 55. The method of claim 54, wherein the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10. 56. The method of claim 54, wherein the adjuvant moiety comprises nitroimidazole. 57. The method of claim 54, wherein the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. 58. The method of any one of claims 37 to 54, wherein the adjuvant moiety comprises an amino acid. 59. The method of claim 58, wherein the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH. 60. The method of any one of claims 37 to 59, wherein the adjuvant moiety comprises a vitamin. 61. The method of claim 60, wherein the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group. 62. The method of claim 60 or 61, wherein the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2. 63. The method of any one of claims 60 to 62, wherein the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. 64. The method of claim 63, wherein the vitamin is vitamin B3. 65. The method of claim 64, wherein the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3. 66. The method of claim 65, wherein the adjuvant moiety comprises about 10 vitamin B3. 67. The method of any one of claims 37 to 66, wherein the delivery agent comprises a water- soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. 68. A system for determining a level of a miRNA ("miRNA level") in a subject afflicted with a disease or disorder, comprising (i) a first oligonucleotide conjugated to a quencher and (ii) a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide is capable of specifically binding to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide is capable of specifically binding to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the quencher of the first oligonucleotide is capable of inhibiting the expression of the probe of the second oligonucleotide when the first and second oligonucleotides are bound to each other.

69. The system of claim 68, wherein the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof. 70. The system of claim 68 or 69, wherein the quencher comprises a BBQ-650. 71. The system of any one of claims 68 to 70, wherein the miRNA comprises a miR-485-3p. 72. The system of claim 71, wherein the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide"). 73. The system of claim 72, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR- 485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length. 74. The system of claim 72 or 73, wherein the anti-miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti-miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. 75. The system of any one of claims 72 to 74, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'-GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'- GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'-AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'- GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'-AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'- GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), and AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 30). 76. The system of any one of claims 72 to 74, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'- AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 75); 5'-TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'-CGTGTATGAC-3' (SEQ ID NO: 78), 5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89), and 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). 77. The system of any one of claims 72 to 74, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC - 3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 78. The system of claim 77, wherein the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 79. The system of claim 77 or 78, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions. 80. The system of claim 77 or 78, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). 81. The system of claim 80, wherein the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). 82. The system of any one of claims 72 to 81, wherein the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide. 83. The system of claim 82, wherein the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof. 84. The system of any one of claims 72 to 83, wherein the anti-miR-485-3p oligonucleotide comprises a backbone modification. 85. The system of claim 84, wherein the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. 86. A kit comprising the system of any one of claims 68 to 85, and instructions for use. 87. The kit of claim 86, wherein the first oligonucleotide and the second oligonucleotide are present in separate containers.

Description:
AMPLIFICATION-FREE METHODS FOR MEASURING MIRNA CROSS REFERENCE TO RELATED APPLICATION [0001] This PCT application claims the benefit of the filing date of U.S. Provisional Patent Application No. 63/280,528, filed November 17, 2021; which is incorporated herein by reference in its entirety. REFERENCE TO SEQUENCE LISTING SUBMITTED ELECTRONICALLY [0002] The content of the electronically submitted sequence listing in ASCII text file (Name: 4366_047PC01_Seqlisting_ST26; Size: 63,316 bytes; and Date of Creation: November 16, 2022) filed with the application is herein incorporated by reference in its entirety. FIELD OF THE DISCLOSURE [0003] The present disclosure relates to amplification-free systems that can be used to measure the level of a microRNA in a subject. The present disclosure also relates to the use of such systems to identify and/or treat subjects afflicted with a disease or disorder (e.g., cognitive disorders). BACKGROUND OF THE DISCLOSURE [0004] Cognitive disorders are common and growing cause of mortality and morbidity worldwide. The costs of AD are estimated at more than 800 billion USD globally. To date, there is still no known cure for many cognitive disorders. Available treatment options are generally limited to alleviating the various symptoms, as opposed to addressing the underlying causes of the disorders. In addition, no effective early diagnostic system is available, and therefore, any treatment options to help alleviate some of the symptoms associated with cognitive disorders are not made available until long after the onset of the disorder. And, the available methods of diagnosing cognitive disorders are often subjective (e.g., questionnaires), potentially harmful (e.g., use of radioactive isotopes for nuclear brain imaging), and/or prone to misdiagnosis (e.g., requiring amplification step which can result in amplification of irrelevant molecules). Therefore, new and more effective approaches to treating and/or diagnosing cognitive disorders are highly desirable. BRIEF SUMMARY OF THE DISCLOSURE [0005] Disclosed herein is a method of determining a level of a miRNA ("miRNA level") in a subject afflicted with a disease or condition, comprising detecting whether an expression level of a probe is increased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe. [0006] Also disclosed herein is a method of identifying a subject afflicted with a disease or disorder, comprising: (a) contacting a biological sample obtained from the subject with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe, wherein an increase in the expression of the probe compared to a corresponding expression level in a reference sample indicates that the subject is afflicted with the disease or disorder. [0007] In some aspects, the contacting of the biological sample with the first oligonucleotide occurs prior to the contacting of the biological sample with the second oligonucleotide. [0008] In some aspects, the expression level of the probe is increased by at least about 1- fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30- fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50- fold, compared to the corresponding expression level in the reference sample. In some aspects, the increase in the expression level of the probe is correlated with an increase in the miRNA level. [0009] In some aspects, the above methods further comprise administering to the subject a treatment for the disease or disorder. [0010] Provided herein is a method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having an increase in a level of a miRNA ("miRNA level") in a biological sample obtained from the subject, compared to a corresponding level in a reference sample, wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to the probe, wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring an expression level of the probe, wherein the expression level of the probe is correlated with the miRNA level. [0011] In some aspects, the reference sample is obtained from a subject who is not afflicted with the disease or disorder. [0012] In some aspects, the above methods does not require an amplification step prior to the measuring step in (b). In some aspects, the amplification step comprises amplifying a miRNA present in the biological sample prior to the contacting step in (a). [0013] In some aspects, the miRNA is associated with the disease or condition. In some aspects, the disease or condition comprises a dementia, Alzheimer's disease, autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, amyotrophic lateral sclerosis (ALS), tauopathy, Huntington's disease, Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), pulmonary disease, inflammatory disease, or metabolic disease, or combinations thereof. [0014] In some aspects, the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof. In some aspects, the quencher comprises a dark quencher. In some aspects, the biological sample comprises a saliva, tissue, cell, blood, serum, plasma, cerebrospinal fluid, intravitreal fluid, urine, or combinations thereof. [0015] In some aspects, the miRNA comprises a miR-485-3p. In some aspects, the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide"). [0016] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'-UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR-485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length. In some aspects, the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. [0017] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'- GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'- GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), and AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 30). [0018] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'- GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'- AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA- 3' (SEQ ID NO: 75); 5'-TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'-CGTGTATGAC-3' (SEQ ID NO: 78), 5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC- 3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89), and 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). [0019] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions. In some aspects, the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0020] In some aspects, the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide. In some aspects, the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof. [0021] In some aspects, the anti-miR-485-3p oligonucleotide comprises a backbone modification. In some aspects, the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. [0022] Where a method comprises a treating, in some aspects, the treatment comprises an anti-miR-485-3p oligonucleotide, which is not conjugated to a probe or a quencher ("miR-485- 3p inhibitor"). [0023] In some aspects, the miR-485-3p inhibitor is administered to the subject by a viral vector. In some aspects, the viral vector is an AAV, an adenovirus, a retrovirus, or a lentivirus. In some aspects, the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof. [0024] In some aspects, the miR-485-3p inhibitor is administered to the subject with a delivery agent. In some aspects, the delivery agent comprises a micelle, exosome, lipid nanoparticle, extracellular vesicle, synthetic vesicle, lipidoid, liposome, lipoplex, polymeric compound, peptide, protein, cell, nanoparticle mimic, nanotube, conjugate, or any combination thereof. [0025] In some aspects, the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble polymer moiety; CC is a cationic carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers. [0026] In some aspects, the miR-485-3p inhibitor and the cationic carrier unit are capable of associating with each other to form a micelle when mixed together. In some aspects, the association is via a covalent bond. In some aspects, the association is via a non-covalent bond. In some aspects, the non-covalent bond comprises an ionic bond. [0027] In some aspects, the water-soluble polymer moiety comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof. In some aspects, the water- soluble polymer moiety comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). [0028] In some aspects, the water-soluble polymer moiety comprises: wherein n is 1-1000. [0029] In some aspects, the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some aspects, the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160. [0030] In some aspects, the water-soluble polymer moiety is linear, branched, or dendritic. [0031] In some aspects, the cationic carrier moiety comprises one or more basic amino acids. In some aspects, the cationic carrier moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at last about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 40 lysine monomers. [0032] In some aspects, the adjuvant moiety of a cationic carrier unit is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment. In some aspects, the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof. [0033] In some aspects, the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10. [0034] In some aspects, the adjuvant moiety comprises nitroimidazole. In some aspects, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. In some aspects, the adjuvant moiety comprises an amino acid. [0035] In some aspects, the adjuvant moiety comprises wherein Ar is wherein each of Z1 and Z2 is H or OH. [0036] In some aspects, the adjuvant moiety comprises a vitamin. In some aspects, the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group. In some aspects, the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2. [0037] In some aspects, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some aspects, the vitamin is vitamin B3. [0038] In some aspects, the adjuvant moiety comprises at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3. [0039] In some aspects, the delivery agent comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. [0040] Also provided herein is a system for determining a level of a miRNA ("miRNA level") in a subject afflicted with a disease or disorder, comprising (i) a first oligonucleotide conjugated to a quencher and (ii) a second oligonucleotide conjugated to a probe, wherein the first oligonucleotide is capable of specifically binding to the miRNA to form a duplex when the miRNA is present, wherein the second oligonucleotide is capable of specifically binding to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and wherein the quencher of the first oligonucleotide is capable of inhibiting the expression of the probe of the second oligonucleotide when the first and second oligonucleotides are bound to each other. [0041] In some aspects, the probe comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof. In some aspects, the quencher comprises a BBQ-650. [0042] In some aspects, the miRNA comprises a miR-485-3p. In some aspects, the first oligonucleotide is capable of specifically binding to the miR-485-3p ("anti-miR-485-3p oligonucleotide"). [0043] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence comprising 5'- UGUAUGA-3' (SEQ ID NO: 2) and wherein the anti-miR-485-3p oligonucleotide comprises about 6 to about 30 nucleotides in length. In some aspects, the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, at least 20 nucleotides at the '5 of the nucleotide sequence; and/or wherein the anti- miR-485-3p oligonucleotide comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. [0044] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'- GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), 5'- GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15); 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'- CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), and AGAGAGGAGAGCCGUGUAUGAC (SEQ ID NO: 30). [0045] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'- GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'- CCGTGTATGA-3' (SEQ ID NO: 65), 5'-GCCGTGTATGA-3' (SEQ ID NO: 66), 5'- AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'-GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'- AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'-GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'- AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA- 3' (SEQ ID NO: 75); 5'-TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'-CGTGTATGAC-3' (SEQ ID NO: 78), 5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC- 3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89), and 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). [0046] In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR-485-3p oligonucleotide comprises a nucleotide sequence that is at least 90% identical to 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions. In some aspects, the anti-miR-485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, the anti-miR- 485-3p oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0047] In some aspects, the anti-miR-485-3p oligonucleotide comprises at least one modified nucleotide. In some aspects, the at least one modified nucleotide comprises a locked nucleic acid (LNA), unlocked nucleic acid (UNA), arabino nucleic acid (ABA), bridged nucleic acid (BNA), peptide nucleic acid (PNA), or any combination thereof. [0048] In some aspects, the anti-miR-485-3p oligonucleotide comprises a backbone modification. In some aspects, the backbone modification comprises a phosphorodiamidate morpholino oligomer (PMO) and/or phosphorothioate (PS) modification. [0049] Provided herein is a comprising any of the systems disclosed herein, and instructions for use. In some aspects, the first oligonucleotide and the second nucleotide of the kit are present in separate containers. BRIEF DESCRIPTION OF THE DRAWINGS/FIGURES [0050] FIG. 1 provides a schematic describing how the system described herein can measure the level of a miRNA in a biological sample (e.g., human saliva) from a subject. [0051] FIGs. 2A and 2B show the quenching effects of anti-miRNA oligonucleotides conjugated to a quencher described herein. FIG.2A provides a schematic of the experimental set-up. As shown, various concentrations (0-14 μM) of the anti-miRNA oligonucleotide conjugated to a quencher (BBQ-650) ("BBQ ASO") were used with a fixed concentration (10 μM) of the oligonucleotide conjugated to a fluorescent probe (Cy5.5) ("miRNA mimic"). FIG. 2B provides the fluorescence intensity (y-axis) observed at different ratios of the anti-miRNA oligonucleotide and miRNA mimic (x-axis). The specific anti-miRNA oligonucleotide to miRNA mimic ratios tested include: (i) 0:10, (ii) 2:10, (iii) 4:10, (iv) 6:10, (v) 8:10, (vi) 10:10, (vii) 12:10, and (viii) 14:10. [0052] FIGs.3A, 3B, 3C, and 3D show the ability of the oligonucleotides described herein (i.e., conjugated to a quencher or fluorescent probe) to detect sense oligonucleotides in a sample. The sense oligonucleotides were used to represent miRNA. FIGs. 3A and 3C provide schematics of the experimental set-up. As shown, a high (20 μM) (see FIG. 3A) or low (10 μM) (see FIG. 3C) fixed concentration of the anti-miRNA oligonucleotide conjugated to a quencher (BBQ-650) ("BBQ-ASO") were added to a sample comprising different concentrations (0-10 μM) of the sense oligonucleotides to allow the formation of a first duplex. Then, the same high or low fixed concentration of the oligonucleotide conjugated to a fluorescent probe (Cy5.5) ("miRNA mimic") were added to the sample to allow any unbound BBQ-ASO to form a duplex with the miRNA mimic ("second duplex"). FIG.3B provides the fluorescence intensity (y-axis) observed as a function of the concentration of the sense oligonucleotide (x-axis) using the high fixed concentration (20 μM) for both the anti-miRNA oligonucleotide and the miRNA mimic. FIG. 3D provides the fluorescence intensity (y-axis) observed as a function of the concentration of the sense oligonucleotide (x-axis) using the low fixed concentration (10 μM) for both the anti-miRNA oligonucleotide and the miRNA mimic. DETAILED DESCRIPTION OF THE DISCLOSURE [0053] The present disclosure is generally directed to systems (e.g., diagnostic systems) comprising multiple oligonucleotides (e.g., two or more) and the use of such systems to measure the expression level of a microRNA ("miRNA") in a subject. Unlike the more traditional systems available in the art (e.g., reverse transcriptase polymerase chain reaction (RT-PCR)), the systems and methods provided herein do not require an amplification step. Therefore, compared to approaches known in the art, the systems and methods described herein are capable of measuring miRNA levels much more quickly and with greater accuracy (e.g., less risk of false reads resulting from amplified contaminants). Additionally, because the individual steps can be performed at room temperature (contrary to assays such as the RT- PCR), the systems and methods provided herein do not require a separate device to regulate temperature, which, in some aspects, can be costly. Such qualities allow for much greater ability to identify and treat subjects afflicted with a disease or disorder associated with abnormal miRNA expression levels. Additional aspects of the present disclosure are provided throughout the present application. [0054] Before the present disclosure is described in greater detail, it is to be understood that this disclosure is not limited to the particular compositions or process steps described, as such can, of course, vary. As will be apparent to those of skill in the art upon reading this disclosure, each of the individual aspects described and illustrated herein has discrete components and features which can be readily separated from or combined with the features of any of the other several aspects without departing from the scope or spirit of the present disclosure. Any recited method can be carried out in the order of events recited or in any other order which is logically possible. [0055] The headings provided herein are not limitations of the various aspects of the disclosure, which can be defined by reference to the specification as a whole. It is also to be understood that the terminology used herein is for the purpose of describing particular aspects only, and is not intended to be limiting, since the scope of the present disclosure will be limited only by the appended claims. I. Terms [0056] In order that the present disclosure can be more readily understood, certain terms are first defined. As used in this application, except as otherwise expressly provided herein, each of the following terms shall have the meaning set forth below. Additional definitions are set forth throughout the application. [0057] It is to be noted that the term "a" or "an" entity refers to one or more of that entity; for example, "a nucleotide sequence," is understood to represent one or more nucleotide sequences. As such, the terms "a" (or "an"), "one or more," and "at least one" can be used interchangeably herein. It is further noted that the claims can be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as "solely," "only" and the like in connection with the recitation of claim elements, or use of a negative limitation. [0058] Furthermore, "and/or" where used herein is to be taken as specific disclosure of each of the two specified features or components with or without the other. Thus, the term "and/or" as used in a phrase such as "A and/or B" herein is intended to include "A and B," "A or B," "A" (alone), and "B" (alone). Likewise, the term "and/or" as used in a phrase such as "A, B, and/or C" is intended to encompass each of the following aspects: A, B, and C; A, B, or C; A or C; A or B; B or C; A and C; A and B; B and C; A (alone); B (alone); and C (alone). [0059] It is understood that wherever aspects are described herein with the language "comprising," otherwise analogous aspects described in terms of "consisting of" and/or "consisting essentially of" are also provided. The term “comprising,” which is used interchangeably with “including,” “containing,” or “characterized by,” is inclusive or open- ended language and does not exclude additional, unrecited elements or method steps. The phrase “consisting of” excludes any element, step, or ingredient not specified in the claim. The phrase “consisting essentially of” limits the scope of a claim to the specified materials or steps and those that do not materially affect the basic and novel characteristics of the claimed subject matter. The present disclosure contemplates aspects of the disclosed compositions and methods corresponding to the scope of each of these phrases. Thus, a composition or method comprising recited elements or steps contemplates particular aspects in which the composition or method consists essentially of or consists of those elements or steps. [0060] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure is related. For example, the Concise Dictionary of Biomedicine and Molecular Biology, Juo, Pei-Show, 2nd ed., 2002, CRC Press; The Dictionary of Cell and Molecular Biology, 3rd ed., 1999, Academic Press; and the Oxford Dictionary Of Biochemistry And Molecular Biology, Revised, 2000, Oxford University Press, provide one of skill with a general dictionary of many of the terms used in this disclosure. [0061] Units, prefixes, and symbols are denoted in their Système International de Unites (SI) accepted form. Numeric ranges are inclusive of the numbers defining the range. Where a range of values is recited, it is to be understood that each intervening integer value, and each fraction thereof, between the recited upper and lower limits of that range is also specifically disclosed, along with each subrange between such values. The upper and lower limits of any range can independently be included in or excluded from the range, and each range where either, neither or both limits are included is also encompassed within the disclosure. Thus, ranges recited herein are understood to be shorthand for all of the values within the range, inclusive of the recited endpoints. For example, a range of 1 to 10 is understood to include any number, combination of numbers, or sub-range from the group consisting of 1, 2, 3, 4, 5, 6, 7, 8, 9, and 10. [0062] Where a value is explicitly recited, it is to be understood that values which are about the same quantity or amount as the recited value are also within the scope of the disclosure. Where a combination is disclosed, each subcombination of the elements of that combination is also specifically disclosed and is within the scope of the disclosure. Conversely, where different elements or groups of elements are individually disclosed, combinations thereof are also disclosed. Where any element of a disclosure is disclosed as having a plurality of alternatives, examples of that disclosure in which each alternative is excluded singly or in any combination with the other alternatives are also hereby disclosed; more than one element of a disclosure can have such exclusions, and all combinations of elements having such exclusions are hereby disclosed. [0063] Nucleotides are referred to by their commonly accepted single-letter codes. Unless otherwise indicated, nucleotide sequences are written left to right in 5' to 3' orientation. Nucleotides are referred to herein by their commonly known one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Accordingly, 'a' represents adenine, 'c' represents cytosine, 'g' represents guanine, 't' represents thymine, and 'u' represents uracil. [0064] Amino acid sequences are written left to right in amino to carboxy orientation. Amino acids are referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. [0065] The term "about" is used herein to mean approximately, roughly, around, or in the regions of. When the term "about" is used in conjunction with a numerical range, it modifies that range by extending the boundaries above and below the numerical values set forth. In general, the term "about" can modify a numerical value above and below the stated value by a variance of, e.g., 10 percent, up or down (higher or lower). [0066] As used herein, the term "adeno-associated virus" (AAV), includes but is not limited to, AAV type 1, AAV type 2, AAV type 3 (including types 3A and 3B), AAV type 4, AAV type 5, AAV type 6, AAV type 7, AAV type 8, AAV type 9, AAV type 10, AAV type 11, AAV type 12, AAV type 13, AAVrh.74, snake AAV, avian AAV, bovine AAV, canine AAV, equine AAV, ovine AAV, goat AAV, shrimp AAV, those AAV serotypes and clades disclosed by Gao et al. (J. Virol.78:6381 (2004)) and Moris et al. (Virol.33:375 (2004)), and any other AAV now known or later discovered. See, e.g., FIELDS et al. VIROLOGY, volume 2, chapter 69 (4th ed., Lippincott-Raven Publishers). In some aspects, an "AAV" includes a derivative of a known AAV. In some aspects, an "AAV" includes a modified or an artificial AAV. [0067] The terms "administration," "administering," and grammatical variants thereof refer to introducing a composition, such as a miRNA inhibitor described herein (e.g., miRNA- 485-3p inhibitor), into a subject via a pharmaceutically acceptable route. The introduction of a composition, such as a micelle comprising a miRNA inhibitor described herein, into a subject is by any suitable route, including intratumorally, orally, pulmonarily, intranasally, parenterally (intravenously, intra-arterially, intramuscularly, intraperitoneally, or subcutaneously), rectally, intralymphatically, intrathecally, periocularly or topically. Administration includes self-administration and the administration by another. A suitable route of administration allows the composition or the agent to perform its intended function. For example, if a suitable route is intravenous, the composition is administered by introducing the composition or agent into a vein of the subject. [0068] As used herein, the term "approximately," as applied to one or more values of interest, refers to a value that is similar to a stated reference value. In some aspects, the term "approximately" refers to a range of values that fall within 10%, 9%, 8%, 7%, 6%, 5%, 4%, 3%, 2%, 1%, or less in either direction (greater than or less than) of the stated reference value unless otherwise stated or otherwise evident from the context (except where such number would exceed 100% of a possible value). [0069] As used herein, the term "afflicted with" can be used interchangeably with the term "suffering from" and refers to the state of having a disease or condition, such as that associated with abnormal level and/or activity of a miRNA (e.g., cognitive disorder disclosed herein). In some aspects, a subject afflicted with a disease or condition (e.g., cognitive disorder) exhibits one or more symptoms associated with the disease or condition (e.g., cognitive disorder (e.g., loss of memory for Alzheimer's disease patients)). However, as will be apparent to those skilled in the art, a subject does not need to exhibit one or more symptoms to be afflicted with a disease or disorder disclosed herein (e.g., can have a genetic predisposition to the disease or disorder). [0070] As used herein, the term "associated with" refers to a close relationship between two or more entities or properties. For instance, when used to describe a disease or condition that can be diagnosed with the present disclosure (e.g., disease or condition associated with an abnormal level of a miRNA, e.g., miR-485-3p), the term "associated with" refers to an increased likelihood that a subject suffers from (i.e., afflicted with) the disease or condition when the subject exhibits an abnormal miRNA (e.g., miR-485-3p) expression level. In some aspects, the abnormal expression causes the disease or condition. In some aspects, the abnormal expression does not necessarily cause but is correlated with the disease or condition. Non-limiting examples of suitable methods that can be used to determine whether a subject exhibits an abnormal expression of a protein and/or gene associated with a disease or condition are provided elsewhere in the present disclosure. [0071] As used herein, the term "abnormal level" refers to a level (expression and/or activity) that differs (e.g., increased or decreased) from a reference subject, e.g., who does not suffer from a disease or condition described herein (e.g., cognitive disorder). In some aspects, an abnormal level (e.g., of a miRNA, e.g., miR-485-3p) refers to a level that is increased by at least about 0.1-fold, at least about 0.2-fold, at least about 0.3-fold, at least about 0.4-fold, at least about 0.5-fold, at least about 0.6-fold, at least about 0.7-fold, at least about 0.8-fold, at least about 0.9-fold, at least about 1-fold, at least about 2-fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 10-fold, at least about 20-fold, at least about 30-fold, at least about 40-fold, at least about 50-fold, at least about 75-fold, at least about 100- fold, at least about 200-fold, at least about 300-fold, at least about 400-fold, at least about 500- fold, at least about 750-fold, or at least about 1,000-fold or more compared to the corresponding level in a reference subject (e.g., subject who does not suffer from a disease or condition described herein). In some aspects, an abnormal level (e.g., of a miRNA, e.g., miR- 485-3p) refers to a level that is decreased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% compared to the corresponding level in a reference subject (e.g., subject who does not suffer from a disease or condition described herein). [0072] As used herein, the term "cognitive disorder" refers to any disorder that affects mental processes, including, but not limited to, impairments in memory, learning, awareness, attention, communication, motor coordination, and/or intellectual capacity. In some aspects, the cognitive disorder is Alzheimer’s disease (AD) and/or Mild Cognitive Impairment (MCI). In some aspects, a “cognitive disorder” refers to AD, MCI, amnesia, corticobasal syndrome, dementia, Lewy body dementia (LBD), frontotemporal dementia, primary progressive aphasia, progressive non-fluent aphasia, progressive supranuclear palsy, pseudosenility, semantic dementia, severe cognitive impairment, subcortical dementia, vascular dementia, amyotrophic lateral sclerosis (ALS), and/or logopenic progressive aphasia. In some aspects, the cognitive disorder is associated with amyloid-β accumulation. [0073] As used herein, the term "conserved" refers to nucleotides or amino acid residues of a polynucleotide sequence or polypeptide sequence, respectively, that are those that occur unaltered in the same position of two or more sequences being compared. Nucleotides or amino acids that are relatively conserved are those that are conserved amongst more related sequences than nucleotides or amino acids appearing elsewhere in the sequences. [0074] In some aspects, two or more sequences are said to be "completely conserved" or "identical" if they are 100% identical to one another. In some aspects, two or more sequences are said to be "highly conserved" if they are at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be "highly conserved" if they are about 70% identical, about 80% identical, about 90% identical, about 95%, about 98%, or about 99% identical to one another. In some aspects, two or more sequences are said to be "conserved" if they are at least 30% identical, at least 40% identical, at least 50% identical, at least 60% identical, at least 70% identical, at least 80% identical, at least 90% identical, or at least 95% identical to one another. In some aspects, two or more sequences are said to be "conserved" if they are about 30% identical, about 40% identical, about 50% identical, about 60% identical, about 70% identical, about 80% identical, about 90% identical, about 95% identical, about 98% identical, or about 99% identical to one another. Conservation of sequence can apply to the entire length of a polynucleotide or polypeptide or can apply to a portion, region or feature thereof. [0075] The term "derived from," as used herein, refers to a component that is isolated from or made using a specified molecule or organism, or information (e.g., amino acid or nucleic acid sequence) from the specified molecule or organism. For example, a nucleic acid sequence that is derived from a second nucleic acid sequence can include a nucleotide sequence that is identical or substantially similar to the nucleotide sequence of the second nucleic acid sequence. In the case of nucleotides or polypeptides, the derived species can be obtained by, for example, naturally occurring mutagenesis, artificial directed mutagenesis or artificial random mutagenesis. The mutagenesis used to derive nucleotides or polypeptides can be intentionally directed or intentionally random, or a mixture of each. The mutagenesis of a nucleotide or polypeptide to create a different nucleotide or polypeptide derived from the first can be a random event (e.g., caused by polymerase infidelity) and the identification of the derived nucleotide or polypeptide can be made by appropriate screening methods, e.g., as discussed herein. In some aspects, a nucleotide or amino acid sequence that is derived from a second nucleotide or amino acid sequence has a sequence identity of at least about 50%, at least about 51%, at least about 52%, at least about 53%, at least about 54%, at least about 55%, at least about 56%, at least about 57%, at least about 58%, at least about 59%, at least about 60%, at least about 61%, at least about 62%, at least about 63%, at least about 64%, at least about 65%, at least about 66%, at least about 67%, at least about 68%, at least about 69%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% to the second nucleotide or amino acid sequence, respectively, wherein the first nucleotide or amino acid sequence retains the biological activity of the second nucleotide or amino acid sequence. [0076] As used herein, a "coding region" or "coding sequence" is a portion of polynucleotide which consists of codons translatable into amino acids. Although a "stop codon" (TAG, TGA, or TAA) is typically not translated into an amino acid, it can be considered to be part of a coding region, but any flanking sequences, for example promoters, ribosome binding sites, transcriptional terminators, introns, and the like, are not part of a coding region. The boundaries of a coding region are typically determined by a start codon at the 5' terminus, encoding the amino terminus of the resultant polypeptide, and a translation stop codon at the 3' terminus, encoding the carboxyl terminus of the resulting polypeptide. [0077] The terms "complementary" and "complementarity" refer to two or more oligomers (i.e., each comprising a nucleobase sequence), or between an oligomer and a target gene, that are related with one another by Watson-Crick base-pairing rules. For example, the nucleobase sequence "T-G-A (5' ^3')," is complementary to the nucleobase sequence "A-C- T (3' ^ 5')." Complementarity can be "partial," in which less than all of the nucleobases of a given nucleobase sequence are matched to the other nucleobase sequence according to base pairing rules. For example, in some aspects, complementarity between a given nucleobase sequence and the other nucleobase sequence can be about 70%, about 75%, about 80%, about 85%, about 90%, or about 95%. Accordingly, in some aspects, the term "complementary" refers to at least about 80%, at least about 85%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, or at least about 99% match or complementarity to a target nucleic acid sequence (e.g., miR-485 nucleic acid sequence). Or, there can be "complete" or "perfect" (100%) complementarity between a given nucleobase sequence and the other nucleobase sequence to continue the example. In some aspects, the degree of complementarity between nucleobase sequences has significant effects on the efficiency and strength of hybridization between the sequences. [0078] As used herein, the term "diagnosing" (and derivatives thereof) refers to methods that can be used to determine or predict whether a subject is afflicted with, suffering from, or at a risk (e.g., genetically predisposed) for a given disease or condition, thereby identifying a subject who is suitable for a treatment. In some aspects, the treatment can be therapeutic (e.g., administered to a subject exhibiting one or more symptoms associated with the disease or disorder). In some aspects, the treatment can be prophylactic (e.g., administered to an at-risk subject to prevent and/or reduce the onset of the disease or disorder). As described herein, a skilled artisan can make a diagnosis on the basis of one or more diagnostic marker (e.g., miR- 485-3p), where the presence, absence, amount, or change in the amount of the diagnostic marker is indicative of the presence, severity, or absence of the condition. In some aspects, an abnormal level (e.g., increased or decreased compared to a reference control) of the diagnostic marker (e.g., miR-485-3p expression) can be indicative of a disease or disorder, such as those described herein. For example, in some aspects, an increase in miR-485-3p expression (e.g., in a biological sample from the subject) is indicative of a cognitive disorder (e.g., Alzheimer's disease). The term "diagnosis" does not refer to the ability to determine the presence or absence of a particular disease or disorder with 100% accuracy, or even that a given course or outcome is more likely to occur than not. Instead, the skilled artisan will understand that the term "diagnosis" refers to an increased probability that a certain disease or disorder is present in the subject. In some aspects, the term "diagnosis" includes one or more diagnostic methods of identifying a subject who has a cognitive disorder (e.g., those described herein). [0079] The term "downstream" refers to a nucleotide sequence that is located 3' to a reference nucleotide sequence. In some aspects, downstream nucleotide sequences relate to sequences that follow the starting point of transcription. For example, the translation initiation codon of a gene is located downstream of the start site of transcription. [0080] As used herein, the term "duplex" refers to a double stranded structure formed by two complementary or substantially complementary polynucleotides that form base pairs with one another, including Watson-Crick base pairs and U-G wobble pairs that allow for a stabilized double stranded structure between polynucleotide strands that are at least partially complementary. The strands of a duplex need not be perfectly complementary for a duplex to form, i.e., a duplex can include one or more base mismatches. [0081] The terms "excipient" and "carrier" are used interchangeably and refer to an inert substance added to a pharmaceutical composition to further facilitate administration of a compound, e.g., a miRNA inhibitor described herein (e.g., miR-485-3p inhibitor). [0082] The term "expression," as used herein, refers to a process by which a polynucleotide produces a gene product, e.g., RNA or a polypeptide. It includes without limitation transcription of the polynucleotide into micro RNA binding site, small hairpin RNA (shRNA), small interfering RNA (siRNA), or any other RNA product. It includes, without limitation, transcription of the polynucleotide into messenger RNA (mRNA), and the translation of mRNA into a polypeptide. Expression produces a "gene product." As used herein, a gene product can be, e.g., a nucleic acid, such as an RNA produced by transcription of a gene. As used herein, a gene product can be either a nucleic acid, RNA or miRNA produced by the transcription of a gene, or a polypeptide which is translated from a transcript. Gene products described herein further include nucleic acids with post transcriptional modifications, e.g., polyadenylation or splicing, or polypeptides with post translational modifications, e.g., phosphorylation, methylation, glycosylation, the addition of lipids, association with other protein subunits, or proteolytic cleavage. As used herein, the term "expression" can be used interchangeable with the term "level." For instance, in some aspects, the term "miR-485-3p expression" can be synonymous with the term "miR-485-3p level." [0083] As used herein, the term "homology" refers to the overall relatedness between polymeric molecules, e.g. between nucleic acid molecules. Generally, the term "homology" implies an evolutionary relationship between two molecules. Thus, two molecules that are homologous will have a common evolutionary ancestor. In the context of the present disclosure, the term homology encompasses both to identity and similarity. [0084] In some aspects, polymeric molecules are considered to be "homologous" to one another if at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or at least about 99% of the monomers in the molecule are identical (exactly the same monomer) or are similar (conservative substitutions). The term "homologous" necessarily refers to a comparison between at least two sequences (e.g., polynucleotide sequences). [0085] In the context of the present disclosure, substitutions (even when they are referred to as amino acid substitution) are conducted at the nucleic acid level, i.e., substituting an amino acid residue with an alternative amino acid residue is conducted by substituting the codon encoding the first amino acid with a codon encoding the second amino acid. [0086] As used herein, the term "identity" refers to the overall monomer conservation between polymeric molecules, e.g., between polynucleotide molecules. The term "identical" without any additional qualifiers, e.g., polynucleotide A is identical to polynucleotide B, implies the polynucleotide sequences are 100% identical (100% sequence identity). Describing two sequences as, e.g., "70% identical," is equivalent to describing them as having, e.g., "70% sequence identity." [0087] Calculation of the percent identity of two polypeptide or polynucleotide sequences, for example, can be performed by aligning the two sequences for optimal comparison purposes (e.g., gaps can be introduced in one or both of a first and a second polypeptide or polynucleotide sequences for optimal alignment and non-identical sequences can be disregarded for comparison purposes). In some aspects, the length of a sequence aligned for comparison purposes is at least 30%, at least 40%, at least 50%, at least 60%, at least 70%, at least 80%, at least 90%, at least 95%, or 100% of the length of the reference sequence. The amino acids at corresponding amino acid positions, or bases in the case of polynucleotides, are then compared. [0088] When a position in the first sequence is occupied by the same amino acid or nucleotide as the corresponding position in the second sequence, then the molecules are identical at that position. The percent identity between the two sequences is a function of the number of identical positions shared by the sequences, taking into account the number of gaps, and the length of each gap, which needs to be introduced for optimal alignment of the two sequences. The comparison of sequences and determination of percent identity between two sequences can be accomplished using a mathematical algorithm. [0089] Suitable software programs that can be used to align different sequences (e.g., polynucleotide sequences) are available from various sources. One suitable program to determine percent sequence identity is bl2seq, part of the BLAST suite of program available from the U.S. government's National Center for Biotechnology Information BLAST web site (blast.ncbi.nlm.nih.gov). Bl2seq performs a comparison between two sequences using either the BLASTN or BLASTP algorithm. BLASTN is used to compare nucleic acid sequences, while BLASTP is used to compare amino acid sequences. Other suitable programs are, e.g., Needle, Stretcher, Water, or Matcher, part of the EMBOSS suite of bioinformatics programs and also available from the European Bioinformatics Institute (EBI) at worldwideweb.ebi.ac.uk/Tools/psa. [0090] Sequence alignments can be conducted using methods known in the art such as MAFFT, Clustal (ClustalW, Clustal X or Clustal Omega), MUSCLE, etc. [0091] Different regions within a single polynucleotide or polypeptide target sequence that aligns with a polynucleotide or polypeptide reference sequence can each have their own percent sequence identity. It is noted that the percent sequence identity value is rounded to the nearest tenth. For example, 80.11, 80.12, 80.13, and 80.14 are rounded down to 80.1, while 80.15, 80.16, 80.17, 80.18, and 80.19 are rounded up to 80.2. It also is noted that the length value will always be an integer. [0092] In some aspects, the percentage identity (%ID) or of a first amino acid sequence (or nucleic acid sequence) to a second amino acid sequence (or nucleic acid sequence) is calculated as %ID = 100 x (Y/Z), where Y is the number of amino acid residues (or nucleobases) scored as identical matches in the alignment of the first and second sequences (as aligned by visual inspection or a particular sequence alignment program) and Z is the total number of residues in the second sequence. If the length of a first sequence is longer than the second sequence, the percent identity of the first sequence to the second sequence will be higher than the percent identity of the second sequence to the first sequence. [0093] One skilled in the art will appreciate that the generation of a sequence alignment for the calculation of a percent sequence identity is not limited to binary sequence-sequence comparisons exclusively driven by primary sequence data. It will also be appreciated that sequence alignments can be generated by integrating sequence data with data from heterogeneous sources such as structural data (e.g., crystallographic protein structures), functional data (e.g., location of mutations), or phylogenetic data. A suitable program that integrates heterogeneous data to generate a multiple sequence alignment is T-Coffee, available at www.tcoffee.org, and alternatively available, e.g., from the EBI. It will also be appreciated that the final alignment used to calculate percent sequence identity can be curated either automatically or manually. [0094] As used herein, the terms "isolated," "purified," "extracted," and grammatical variants thereof are used interchangeably and refer to the state of a preparation of desired composition of the present disclosure, e.g., a miRNA inhibitor described herein (e.g., miRNA- 485-3p inhibitor), that has undergone one or more processes of purification. In some aspects, isolating or purifying as used herein is the process of removing, partially removing (e.g., a fraction) of a composition of the present disclosure, e.g., a miRNA inhibitor, from a sample containing contaminants. [0095] In some aspects, an isolated composition has no detectable undesired activity or, alternatively, the level or amount of the undesired activity is at or below an acceptable level or amount. In some aspects, an isolated composition has an amount and/or concentration of desired composition of the present disclosure, at or above an acceptable amount and/or concentration and/or activity. In some aspects, the isolated composition is enriched as compared to the starting material from which the composition is obtained. This enrichment can be by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, at least about 99.9%, at least about 99.99%, at least about 99.999%, at least about 99.9999%, or greater than 99.9999% as compared to the starting material. [0096] In some aspects, isolated preparations are substantially free of residual biological products. In some aspects, the isolated preparations are 100% free, at least about 99% free, at least about 98% free, at least about 97% free, at least about 96% free, at least about 95% free, at least about 94% free, at least about 93% free, at least about 92% free, at least about 91% free, or at least about 90% free of any contaminating biological matter. Residual biological products can include abiotic materials (including chemicals) or unwanted nucleic acids, proteins, lipids, or metabolites. [0097] The term "linked" as used herein refers to a first amino acid sequence or polynucleotide sequence covalently or non-covalently joined to a second amino acid sequence or polynucleotide sequence, respectively. The first amino acid or polynucleotide sequence can be directly joined or juxtaposed to the second amino acid or polynucleotide sequence or alternatively an intervening sequence can covalently join the first sequence to the second sequence. The term "linked" means not only a fusion of a first polynucleotide sequence to a second polynucleotide sequence at the 5'-end or the 3'-end, but also includes insertion of the whole first polynucleotide sequence (or the second polynucleotide sequence) into any two nucleotides in the second polynucleotide sequence (or the first polynucleotide sequence, respectively). The first polynucleotide sequence can be linked to a second polynucleotide sequence by a phosphodiester bond or a linker. The linker can be, e.g., a polynucleotide. [0098] A "miRNA inhibitor," as used herein, refers to a compound that can decrease, alter, and/or modulate miRNA expression, function, and/or activity. The miRNA inhibitor can be a polynucleotide sequence that is at least partially complementary to the target miRNA nucleic acid sequence, such that the miRNA inhibitor hybridizes to the target miRNA sequence. In some aspects, a miRNA inhibitor comprises an anti-miRNA oligonucleotide described herein that is not conjugated to a probe or a quencher. A non-limiting example of a miRNA inhibitor is a miR-485-3p inhibitor described herein. [0099] The terms "miRNA," "miR," and "microRNA" are used interchangeably and refer to a microRNA molecule found in eukaryotes that is involved in RNA-based gene regulation. The term will be used to refer to the single-stranded RNA molecule processed from a precursor. In some aspects, the term "antisense oligomers" can also be used to describe the microRNA molecules of the present disclosure. Names of miRNAs and their sequences related to the present disclosure are provided herein. MicroRNAs recognize and bind to target mRNAs through imperfect base pairing leading to destabilization or translational inhibition of the target mRNA and thereby downregulate target gene expression. Conversely, targeting miRNAs via molecules comprising a miRNA binding site (generally a molecule comprising a sequence complementary to the seed region of the miRNA) can reduce or inhibit the miRNA- induced translational inhibition leading to an upregulation of the target gene. [0100] The terms "mismatch" or "mismatches" refer to one or more nucleobases (whether contiguous or separate) in an oligomer nucleobase sequence (e.g., anti-miRNA oligonucleotides and/or miRNA mimics described herein) that are not matched to a target nucleic acid sequence (e.g., miRNA, e.g., miR-485-3p) according to base pairing rules. While perfect complementarity is often desired, in some aspects, one or more (e.g., 6, 5, 4, 3, 2, or 1 mismatches) can occur with respect to the target nucleic acid sequence. Variations at any location within the oligomer are included. In some aspects, antisense oligomers of the disclosure (e.g., anti-miRNA oligonucleotides described herein) include variations in nucleobase sequence near the termini, variations in the interior, and if present are typically within about 6, 5, 4, 3, 2, or 1 subunits of the 5' and/or 3' terminus. In some aspects, one, two, or three nucleobases can be removed and still provide on-target binding. [0101] As used herein, the terms "modulate," "modify," and grammatical variants thereof, generally refer when applied to a specific concentration, level, expression, function or behavior, to the ability to alter, by increasing or decreasing, e.g., directly or indirectly promoting/stimulating/up-regulating or interfering with/inhibiting/down-regulating the specific concentration, level, expression, function or behavior, such as, e.g., to act as an antagonist or agonist. In some instances, a modulator can increase and/or decrease a certain concentration, level, activity or function relative to a control, or relative to the average level of activity that would generally be expected or relative to a control level of activity. In some aspects, a miRNA inhibitor disclosed herein (e.g., miR-485-3p inhibitor) can modulate (e.g., decrease, alter, or abolish) miRNA expression, function, and/or activity. [0102] "Nucleic acid," "nucleic acid molecule," "nucleotide sequence," "polynucleotide," and grammatical variants thereof are used interchangeably and refer to the phosphate ester polymeric form of ribonucleosides (adenosine, guanosine, uridine or cytidine; "RNA molecules") or deoxyribonucleosides (deoxyadenosine, deoxyguanosine, deoxythymidine, or deoxycytidine; "DNA molecules"), or any phosphoester analogs thereof, such as phosphorothioates and thioesters, in either single stranded form, or a double-stranded helix. Single stranded nucleic acid sequences refer to single-stranded DNA (ssDNA) or single- stranded RNA (ssRNA). Double stranded DNA-DNA, DNA-RNA and RNA-RNA helices are possible. The term nucleic acid molecule, and in particular DNA or RNA molecule, refers only to the primary and secondary structure of the molecule, and does not limit it to any particular tertiary forms. Thus, this term includes double-stranded DNA found, inter alia, in linear or circular DNA molecules (e.g., restriction fragments), plasmids, supercoiled DNA and chromosomes. In discussing the structure of particular double-stranded DNA molecules, sequences can be described herein according to the normal convention of giving only the sequence in the 5' to 3' direction along the non-transcribed strand of DNA (i.e., the strand having a sequence homologous to the mRNA). A "recombinant DNA molecule" is a DNA molecule that has undergone a molecular biological manipulation. DNA includes, but is not limited to, cDNA, genomic DNA, plasmid DNA, synthetic DNA, and semi-synthetic DNA. A "nucleic acid composition" of the disclosure comprises one or more nucleic acids as described herein. [0103] The terms "pharmaceutically acceptable carrier," "pharmaceutically acceptable excipient," and grammatical variations thereof, encompass any of the agents approved by a regulatory agency of the U.S. Federal government or listed in the U.S. Pharmacopeia for use in animals, including humans, as well as any carrier or diluent that does not cause the production of undesirable physiological effects to a degree that prohibits administration of the composition to a subject and does not abrogate the biological activity and properties of the administered compound. Included are excipients and carriers that are useful in preparing a pharmaceutical composition and are generally safe, non-toxic, and desirable. [0104] As used herein, the term "pharmaceutical composition" refers to one or more of the compounds described herein, such as, e.g., a miRNA inhibitor, mixed or intermingled with, or suspended in one or more other chemical components, such as pharmaceutically acceptable carriers and excipients. One purpose of a pharmaceutical composition is to facilitate administration of preparations comprising a miRNA inhibitor to a subject. [0105] The term "polynucleotide," as used herein, refers to polymers of nucleotides of any length, including ribonucleotides, deoxyribonucleotides, analogs thereof, or mixtures thereof. [0106] In some aspects, the term refers to the primary structure of the molecule. Thus, the term includes triple-, double- and single-stranded deoxyribonucleic acid ("DNA"), as well as triple-, double- and single-stranded ribonucleic acid ("RNA"). It also includes modified, for example by alkylation, and/or by capping, and unmodified forms of the polynucleotide. [0107] In some aspects, the term "polynucleotide" includes polydeoxyribonucleotides (containing 2-deoxy-D-ribose), polyribonucleotides (containing D-ribose), including tRNA, rRNA, shRNA, siRNA, miRNA and mRNA, whether spliced or unspliced, any other type of polynucleotide which is an N- or C-glycoside of a purine or pyrimidine base, and other polymers containing normucleotidic backbones, for example, polyamide (e.g., peptide nucleic acids "PNAs") and polymorpholino polymers, and other synthetic sequence-specific nucleic acid polymers providing that the polymers contain nucleobases in a configuration which allows for base pairing and base stacking, such as is found in DNA and RNA. [0108] In some aspects of the present disclosure, a polynucleotide can be, e.g., an oligonucleotide, such as an antisense oligonucleotide. In some aspects, the oligonucleotide is an RNA. In some aspects, the RNA is a synthetic RNA. In some aspects, the synthetic RNA comprises at least one unnatural nucleobase. In some aspects, all nucleobases of a certain class have been replaced with unnatural nucleobases (e.g., all uridines in a polynucleotide disclosed herein can be replaced with an unnatural nucleobase, e.g., 5-methoxyuridine). [0109] The terms "polypeptide," "peptide," and "protein" are used interchangeably herein to refer to polymers of amino acids of any length. The polymer can comprise modified amino acids. The terms also encompass an amino acid polymer that has been modified naturally or by intervention; for example, disulfide bond formation, glycosylation, lipidation, acetylation, phosphorylation, or any other manipulation or modification, such as conjugation with a labeling component. Also included within the definition are, for example, polypeptides containing one or more analogs of an amino acid (including, for example, unnatural amino acids such as homocysteine, ornithine, p-acetylphenylalanine, D-amino acids, and creatine), as well as other modifications known in the art. The term "polypeptide," as used herein, refers to proteins, polypeptides, and peptides of any size, structure, or function. [0110] Polypeptides include gene products, naturally occurring polypeptides, synthetic polypeptides, homologs, orthologs, paralogs, fragments and other equivalents, variants, and analogs of the foregoing. [0111] A polypeptide can be a single polypeptide or can be a multi-molecular complex such as a dimer, trimer or tetramer. They can also comprise single chain or multichain polypeptides. Most commonly disulfide linkages are found in multichain polypeptides. The term polypeptide can also apply to amino acid polymers in which one or more amino acid residues are an artificial chemical analogue of a corresponding naturally occurring amino acid. In some aspects, a "peptide" can be less than or equal to about 50 amino acids long, e.g., about 5, about 10, about 15, about 20, about 25, about 30, about 35, about 40, about 45, or about 50 amino acids long. [0112] The terms "prevent," "preventing," and variants thereof as used herein, refer partially or completely delaying onset of an disease, disorder and/or condition; partially or completely delaying onset of one or more symptoms, features, or clinical manifestations of a particular disease, disorder, and/or condition; partially or completely delaying onset of one or more symptoms, features, or manifestations of a particular disease, disorder, and/or condition; partially or completely delaying progression from a particular disease, disorder and/or condition; and/or decreasing the risk of developing pathology associated with the disease, disorder, and/or condition. In some aspects, preventing an outcome is achieved through prophylactic treatment. [0113] As used herein, the terms "promoter" and "promoter sequence" are interchangeable and refer to a DNA sequence capable of controlling the expression of a coding sequence or functional RNA. In general, a coding sequence is located 3' to a promoter sequence. Promoters can be derived in their entirety from a native gene, or be composed of different elements derived from different promoters found in nature, or even comprise synthetic DNA segments. It is understood by those skilled in the art that different promoters can direct the expression of a gene in different tissues or cell types, or at different stages of development, or in response to different environmental or physiological conditions. Promoters that cause a gene to be expressed in most cell types at most times are commonly referred to as "constitutive promoters." Promoters that cause a gene to be expressed in a specific cell type are commonly referred to as "cell-specific promoters" or "tissue-specific promoters." Promoters that cause a gene to be expressed at a specific stage of development or cell differentiation are commonly referred to as "developmentally-specific promoters" or "cell differentiation-specific promoters." Promoters that are induced and cause a gene to be expressed following exposure or treatment of the cell with an agent, biological molecule, chemical, ligand, light, or the like that induces the promoter are commonly referred to as "inducible promoters" or "regulatable promoters." It is further recognized that since in most cases the exact boundaries of regulatory sequences have not been completely defined, DNA fragments of different lengths can have identical promoter activity. [0114] The promoter sequence is typically bounded at its 3' terminus by the transcription initiation site and extends upstream (5' direction) to include the minimum number of bases or elements necessary to initiate transcription at levels detectable above background. Within the promoter sequence will be found a transcription initiation site (conveniently defined for example, by mapping with nuclease S1), as well as protein binding domains (consensus sequences) responsible for the binding of RNA polymerase. In some aspects, a promoter that can be used with the present disclosure includes a tissue specific promoter. [0115] As used herein, "prophylactic" refers to a therapeutic or course of action used to prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition. [0116] As used herein, a "prophylaxis" refers to a measure taken to maintain health and prevent the onset of a disease or condition, or to prevent or delay a symptom associated with a disease or condition. [0117] As used herein, the term "quencher" refers to any substance that can reduce and/or inhibit a detectable signal produced by a probe. As used herein, the term "probe" refers to any moiety that can exhibit a detectable signal, which signal can be suppressed by a quencher. This attenuation of the detectable signal is also referred to herein as "quenching." As demonstrated herein, in some aspects, the probe comprises a fluorophore and the detectable signal comprises a fluorescence (or light). In such aspects, excitation of the fluorophore in the presence of the quencher can lead to an emission signal that is reduced in intensity or even completely absent. In some aspects, the quenching can occur through energy transfer between the excited fluorophore and the quencher. Non-limiting examples of quenchers and probes (e.g., fluorophores) that are useful for the present disclosure are provided elsewhere herein. [0118] As used herein, the terms "regulatory region" and "gene regulatory region" are interchangeable and refer to nucleotide sequences located upstream (5' non-coding sequences), within, or downstream (3' non-coding sequences) of a coding region, and which influence the transcription, RNA processing, stability, or translation of the associated coding region. Regulatory regions can include promoters, translation leader sequences, introns, polyadenylation recognition sequences, RNA processing sites, effector binding sites, or stem- loop structures. If a coding region is intended for expression in a eukaryotic cell, a polyadenylation signal and transcription termination sequence will usually be located 3' to the coding sequence. [0119] As used herein, the term "similarity" refers to the overall relatedness between polymeric molecules, e.g. between polynucleotide molecules (e.g. miRNA molecules). Calculation of percent similarity of polymeric molecules to one another can be performed in the same manner as a calculation of percent identity, except that calculation of percent similarity takes into account conservative substitutions as is understood in the art. It is understood that percentage of similarity is contingent on the comparison scale used, i.e., whether the nucleic acids are compared, e.g., according to their evolutionary proximity, charge, volume, flexibility, polarity, hydrophobicity, aromaticity, isoelectric point, antigenicity, or combinations thereof. [0120] The terms "subject," "patient," "individual," and "host," and variants thereof are used interchangeably herein and refer to any mammalian subject, including without limitation, humans, domestic animals (e.g., dogs, cats and the like), farm animals (e.g., cows, sheep, pigs, horses and the like), and laboratory animals (e.g., monkey, rats, mice, rabbits, guinea pigs and the like) for whom diagnosis, treatment, or therapy is desired, particularly humans. The methods described herein are applicable to both human therapy and veterinary applications. [0121] As used herein, the term "therapeutically effective amount" is the amount of reagent or pharmaceutical compound comprising a compound (e.g., miRNA inhibitor described herein) that is sufficient to a produce a desired therapeutic effect, pharmacologic and/or physiologic effect on a subject in need thereof. A therapeutically effective amount can be a "prophylactically effective amount" as prophylaxis can be considered therapy. [0122] The terms "treat," "treatment," or "treating," as used herein refers to, e.g., the reduction in severity of a disease or condition; the reduction in the duration of a disease course; the amelioration or elimination of one or more symptoms associated with a disease or condition (e.g., diabetes); the provision of beneficial effects to a subject with a disease or condition, without necessarily curing the disease or condition. The term also includes prophylaxis or prevention of a disease or condition or its symptoms thereof. [0123] The term "upstream" refers to a nucleotide sequence that is located 5' to a reference nucleotide sequence. [0124] A "vector" refers to any vehicle for the cloning of and/or transfer of a nucleic acid into a host cell. A vector can be a replicon to which another nucleic acid segment can be attached so as to bring about the replication of the attached segment. A "replicon" refers to any genetic element (e.g., plasmid, phage, cosmid, chromosome, virus) that functions as an autonomous unit of replication in vivo, i.e., capable of replication under its own control. The term "vector" includes both viral and nonviral vehicles for introducing the nucleic acid into a cell in vitro, ex vivo or in vivo. A large number of vectors are known and used in the art including, for example, plasmids, modified eukaryotic viruses, or modified bacterial viruses. Insertion of a polynucleotide into a suitable vector can be accomplished by ligating the appropriate polynucleotide fragments into a chosen vector that has complementary cohesive termini. [0125] Vectors can be engineered to encode selectable markers or reporters that provide for the selection or identification of cells that have incorporated the vector. Expression of selectable markers or reporters allows identification and/or selection of host cells that incorporate and express other coding regions contained on the vector. Examples of selectable marker genes known and used in the art include: genes providing resistance to ampicillin, streptomycin, gentamycin, kanamycin, hygromycin, bialaphos herbicide, sulfonamide, and the like; and genes that are used as phenotypic markers, i.e., anthocyanin regulatory genes, isopentanyl transferase gene, and the like. Examples of reporters known and used in the art include: luciferase (Luc), green fluorescent protein (GFP), chloramphenicol acetyltransferase (CAT), β-galactosidase (LacZ), β-glucuronidase (Gus), and the like. Selectable markers can also be considered to be reporters. II. Diagnostic Methods [0126] Disclosed herein are methods of diagnosing a disease or condition in a subject in need thereof, comprising determining the level of a miRNA ("miRNA level") in a biological sample obtained from the subject. As demonstrated herein, the diagnostic methods of the present disclosure differ from the more traditional methods (e.g., RT-PCR) in that no amplification step is required. Applicant has identified that through the use of oligonucleotides conjugated to probes and quenchers, it is possible to measure the level of a miRNA in a biological sample without the need to first amplify the miRNA present in the biological sample prior to the measuring. As a result, the diagnostic methods described herein are capable of more accurately and rapidly diagnosing a disease or condition compared to more traditional approaches in the art. [0127] Accordingly, in some aspects, provided herein is a method of determining a miRNA level in a subject afflicted with a disease or condition comprising detecting whether an expression level of a probe is increased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, (i) wherein the first oligonucleotide specifically binds to the miRNA (also referred to herein as "anti-miRNA oligonucleotide") to form a duplex when the miRNA is present in the biological sample, (ii) wherein the second oligonucleotide specifically binds to the first oligonucleotide (also referred to herein as "miRNA mimic") when the first oligonucleotide is not part of the duplex, and (iii) wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe. [0128] In some aspects, also provided herein is a method of identifying a subject afflicted with a disease or disorder comprising: (a) contacting a biological sample obtained from the subject with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleotide conjugated to a probe (i.e., miRNA mimic), (i) wherein the anti-miRNA oligonucleotide specifically binds to a miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the miRNA mimic specifically binds to the anti-miRNA oligonucleotide when the anti-miRNA oligonucleotide is not part of the duplex, and (iii) wherein the binding of the miRNA mimic to the anti-miRNA oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe, wherein an increase in the expression of the probe compared to a corresponding expression level in a reference sample indicates that the subject is afflicted with the disease or disorder. [0129] In some aspects, the contacting of the biological sample with the first oligonucleotide (i.e., anti-miRNA oligonucleotide) occurs prior to the contacting of the biological sample with the second oligonucleotide (i.e., miRNA mimic). As is apparent from the present disclosure, in some aspects, this allows the anti-miRNA oligonucleotide molecules to sufficiently bind to any miRNA molecules present in the biological sample without any interference from the miRNA mimic molecules. Accordingly, in some aspects, the anti-miRNA oligonucleotide is contacted with the biological sample at least about one minute, at least about two minutes, at least about three minutes, at least about four minutes, at least about five minutes, at least about six minutes, at least about seven minutes, at least about eight minutes, at least about nine minutes, at least about 10 minutes, at least about 15 minutes, at least about 20 minutes, at least about 25 minutes, at least about 30 minutes, at least about 45 minutes, or at least about 60 minutes prior to the contacting of the biological sample with the miRNA mimic. In some aspects, the biological sample is contacted with the anti-miRNA oligonucleotide at least about 10 minutes before the biological sample is contacted with the miRNA mimic. [0130] In some aspects, the biological sample can be contacted with the first and second oligonucleotides concurrently with the proviso that the first oligonucleotide (i.e., anti-miRNA oligonucleotide) preferentially binds to the miRNA of interest (e.g., present in the biological sample) as compared to the second oligonucleotide (i.e., miRNA mimic). For instance, in some aspects, as between the miRNA of interest and the second oligonucleotide, the first oligonucleotide binds to the miRNA of interest with greater binding affinity. In some aspects, the binding affinity between the first oligonucleotide and the miRNA of interest is greater than about one-fold, greater than about two-fold, greater than about three-fold, greater than about four-fold, greater than about five-fold, greater than about ten-fold, greater than about 15-fold, greater than about 20-fold, greater than about 25-fold, greater than about 30-fold, greater than about 35-fold, greater than about 40-fold, greater than about 45-fold, or greater than about 50- fold, compared to the binding affinity between the first oligonucleotide and the second oligonucleotide. [0131] As described herein, contrary to traditional methods which amplify the target miRNA molecule and then measure the amount of amplified miRNA present in a sample, the methods described herein can determine the amount of miRNA present in a sample (without the need for amplification) by measuring a detectable signal (e.g., fluorescence intensity) exhibited by a probe described herein. As illustrated in FIG.1 and further described elsewhere in the present disclosure, the amount of detectable signal from the probe measured can be correlated to the amount of miRNA present in the biological sample. For instance, in some aspects, the amount of detectable signal measured and the amount of miRNA present in the biological sample are directly correlated (i.e., a sample with increased miRNA level would be associated with higher detectable signal). [0132] In some aspects, the expression level of the probe (i.e., amount of detectable signal measured) is greater than about one-fold, greater than about two-fold, greater than about three- fold, greater than about four-fold, greater than about five-fold, greater than about ten-fold, greater than about 15-fold, greater than about 20-fold, greater than about 25-fold, greater than about 30-fold, greater than about 35-fold, greater than about 40-fold, greater than about 45- fold, or greater than about 50-fold, compared to the corresponding expression level in the reference sample. In some aspects, the reference sample is the corresponding biological sample obtained from a subject who is not afflicted with the disease or disorder. In some aspects, the reference sample is the corresponding biological sample obtained from the subject prior to being afflicted with the disease or disorder. As is apparent from the present disclosure, in some aspects, where the expression level of the probe is greater than the corresponding expression level in the reference sample, the subject is afflicted with the disease or disorder, wherein the disease or disorder is associated with an increased expression of the miRNA. [0133] As described elsewhere in the present disclosure, certain diseases or conditions can be associated with a decreased level of a miRNA. In some aspects, the systems and methods provided herein can also be useful in identifying subjects suffering from or afflicted with such diseases or conditions. Accordingly, the disclosures provided above are not limited to diseases or conditions associated with increased miRNA expression. [0134] In some aspects, provided herein is a method of determining a miRNA level in a subject in need thereof, wherein the method comprises detecting whether an expression level of a probe is decreased in a biological sample obtained from the subject compared to a corresponding expression level in a reference sample (e.g., obtained from a healthy subject) by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleotide conjugated to a probe (i.e., miRNA mimic), (i) wherein the anti-miRNA oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the miRNA mimic specifically binds to the anti-miRNA oligonucleotide when the anti-miRNA oligonucleotide is not part of the duplex, and (iii) wherein the binding of the miRNA mimic to the anti-miRNA oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring the expression level of the probe. [0135] In some aspects, a decrease in the expression of the probe compared to the corresponding expression level in the reference sample indicates that the subject is suffering from or at risk of developing a disease or condition which is associated with the decreased expression of the miRNA. As described herein, in some aspects, the reference sample is the corresponding biological sample obtained from a subject who is not afflicted with the disease or disorder. In some aspects, the reference sample is the corresponding biological sample obtained from the subject prior to being afflicted with the disease or disorder. In some aspects, compared to the reference sample, the expression level of the probe (i.e., amount of detectable signal measured) is decreased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or at least about 100%. [0136] Any suitable biological sample known in the art can be used with the present disclosure. Non-limiting examples of suitable biological samples include: a saliva, tissue, cell, blood, serum, plasma, cerebrospinal fluid, intravitreal fluid, urine, or combinations thereof. Methods of obtaining such biological samples are known in the art. In some aspects, the biological sample is derived from an epithelial cell of the subject. In some aspects, the epithelial cell comprises oral epithelial cells, e.g., such as those that can be obtained through a swab sample. In some aspects, the biological sample is derived from a subject's serum and/or plasma. II.A. Oligonucleotides II.A.1. First Oligonucleotide [0137] As is apparent from the present disclosure, a first oligonucleotide useful for the present disclosure is not particularly limited as long as the first oligonucleotide is capable of specifically binding to a target miRNA to form a duplex (i.e., hybridizes to the miRNA of interest). Such a first oligonucleotide is also referred to herein as "anti-miRNA oligonucleotide." In some aspects, the anti-miRNA oligonucleotide comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miRNA binding site, wherein the nucleotide molecule does not encode a protein. Accordingly, in some aspects, the miRNA binding site is at least partially complementary to the target miRNA nucleic acid sequence, such that the anti-miRNA oligonucleotide is capable of hybridizing to the miRNA nucleic acid sequence. For instance, in some aspects, the anti-miRNA oligonucleotide has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of the target miRNA. In some aspects, the anti-miRNA oligonucleotide is fully complementary to the nucleic acid sequence of the target miRNA. [0138] In some aspects, the anti-miRNA oligonucleotide can be designed to target (e.g., specifically bind to) any suitable miRNAs known in the art. As is apparent from the present disclosure, in some aspects, an anti-miRNA oligonucleotide can be designed to specifically target a miRNA that is associated with a certain disease or disorder (e.g., increased or decreased expression in a subject afflicted with a disease compared to the expression in a subject not afflicted with the disease). Such miRNAs are known, and non-limiting examples are described in, e.g., Ardekani et al., Avicenna J Med Biotechnol 2(4): 151-179 (Oct/Dec 2010); U.S. Pat. No. 10,844,380; and U.S. Publ. No. 2020/0392576; each of which is incorporated herein by reference in its entirety. Such non-limiting examples include: miR-134-5p, miR-155-5p, miR- 132-3p, miR-132-5p, miR-129-1-3p, miR-129-2-3p, miR-129-5p, miR-211-3p, miR-211-5p, miR-324-3p, miR-324-5p, miR-92a-1-5p, miR-92a-2-5p, miR-92a-3p, miR-101-2-5p, miR- 101-3p, miR-101-5p, miR-135a-2-3p, miR-135a-3p, miR-135a-5p, miR-135b-3p, miR-135b- 5p, miR-21-3p, miR-21-5p, miR-31-3p, miR-31-5p, miR-146a-3p, miR-146a-5p, miR-146b- 3p, miR-146b-5p, miR-124-3p, miR-124-5p, miR-122-3p, miR-122-5p, miR-122b-3p, miR- 122b-5p, miR-149-3p, miR-149-5p, miR-132-3p, miR-132-5p, miR-324-3p, miR-324-5p, miR-6124, miR-22-3p, miR-22-5p, miR-23b-3p, miR-23b-5p, miR-34a-3p, miR-34a-5p, miR- 96-3p, miR-96-5p, miR-128-1-5p, miR-128-2-5p, miR-128-3p, miR-129-1-3p, miR-129-2-3p, miR-129-5p, miR-181a-2-3p, miR-181a-3p, miR-181a-5p, miR-324-3p, miR-324-5p, miR- 219a-1-3p, miR-219a-2-3p, miR-219a-5p, miR-219b-3p, miR-219b-5p, miR-211-3p, miR- 211-5p, miR-210-3p, miR-210-5p, miR-204-3p, miR-204-5p, miR-203a-3p, miR-203a-5p, miR-203b-3p, miR-203b-5p, miR-199a-3p, miR-199a-5p, and miR-184. [0139] In some aspects, a miRNA that can be targeted using an anti-miRNA oligonucleotide described herein comprises a miR-485-3p. Accordingly, in some aspects, an anti-miRNA oligonucleotide (i.e., first oligonucleotide) comprises a nucleotide sequence encoding a nucleotide molecule that comprises at least one miR-485-3p binding site, wherein the nucleotide molecule does not encode a protein (also referred to herein as "anti-miR-485- 3p oligonucleotide"). As described herein, in some aspects, the miR-485-3p binding site is at least partially complementary to the target miRNA nucleic acid sequence (i.e., miR-485-3p), such that the anti-miR-485-3p oligonucleotide hybridizes to the miR-485-3p nucleic acid sequence. [0140] While the disclosures provided herein are generally described in the context of miR- 485-3p (e.g., anti-miR485-3p oligonucleotide), it will be apparent to those skilled in the art that relevant disclosures can equally apply to other suitable miRNA molecules known in the art (e.g., those associated with certain diseases or disorders). [0141] In some aspects, the miRNA binding site of an anti-miR-485-3p oligonucleotide disclosed herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence of a miR-485-3p. In some aspects, the miR-485-3p binding site is fully complementary to the nucleic acid sequence of a miR-485-3p. [0142] The miR-485-3p hairpin precursor can generate miR-485-3p. The human mature miR-485-3p has the sequence 5'- GUCAUACACGGCUCUCCUCUCU-3' (SEQ ID NO: 1; miRBase Acc. No. MIMAT0002176). A 5' terminal subsequence of miR-485-3p 5'- UCAUACA-3' (SEQ ID NO: 49) is the seed sequence. [0143] As will be apparent to those in the art, the human mature miR-485-3p has significant sequence similarity to that of other species. For instance, the mouse mature miR-485-3p differs from the human mature miR-485-3p by a single amino acid at each of the 5'- and 3'- ends (i.e., has an extra "A" at the 5'-end and missing "C" at the 3'-end). The mouse mature miR-485-3p has the following sequence: 5'-AGUCAUACACGGCUCUCCUCUC-3' (SEQ ID NO: 34; miRBase Acc. No. MIMAT0003129; underlined portion corresponds to overlap to human mature miR-485-3p). Because of the similarity in sequences, in some aspects, an anti-miR- 485-3p oligonucleotide disclosed herein is capable of binding miR-485-3p from one or more species, e.g., human and mouse. Accordingly, in some aspects, the diagnostic methods described herein can be used to determine the level of miR-485-3p from various mammalian subjects (e.g., human and mouse). [0144] In some aspects, the miRNA binding site of an anti-miRNA oligonucleotide described herein (e.g., anti-miRNA-485-3p oligonucleotide) is a single-stranded polynucleotide sequence that is complementary (e.g., fully complementary) to a sequence of a target miRNA (e.g., miRNA-485-3p) (or a subsequence thereof). In some aspects, the miRNA subsequence comprises the seed sequence. Accordingly, in some aspects, the miR-485-3p binding site of an anti-miRNA oligonucleotide described herein has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence complementarity to the nucleic acid sequence set forth in SEQ ID NO: 49. In some aspects, the miR-485-3p binding site is complementary to miR-485-3p except for 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. In some aspects, the miR-485-3p binding site is fully complementary to the nucleic acid sequence set forth in SEQ ID NO: 1. [0145] The seed region of a miRNA forms a tight duplex with the target mRNA. Most miRNAs imperfectly base-pair with the 3' untranslated region (UTR) of target mRNAs, and the 5' proximal "seed" region of miRNAs provides most of the pairing specificity. Without being bound to any one theory, it is believed that the first nine miRNA nucleotides (encompassing the seed sequence) provide greater specificity whereas the miRNA ribonucleotides 3' of this region allow for lower sequence specificity and thus tolerate a higher degree of mismatched base pairing, with positions 2-7 being the most important. Accordingly, in some aspects of the present disclosure, a miRNA binding site (e.g., miR-485-3p binding site) comprises a subsequence that is fully complementary (i.e., 100% complementary) over the entire length of the seed sequence of the target miRNA (e.g., miRNA-485-3p). [0146] miRNA sequences and miRNA binding sequences that can be used in the context of the disclosure include, but are not limited to, all or a portion of those sequences in the sequence listing provided herein, as well as the miRNA precursor sequence, or complement of one or more of these miRNAs. Any aspects of the disclosure involving specific miRNAs or miRNA binding sites by name is contemplated also to cover miRNAs or complementary sequences thereof whose sequences are at least about at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 71%, at least about 72%, at least about 73%, at least about 74%, at least about 75%, at least about 76%, at least about 77%, at least about 78%, at least about 79%, at least about 80%, at least about 81%, at least about 82%, at least about 83%, at least about 84%, at least about 85%, at least about 86%, at least about 87%, at least about 88%, at least about 89%, at least about 90%, at least about 91%, at least about 92%, at least about 93%, at least about 94%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mature sequence of the specified miRNA sequence or complementary sequence thereof. [0147] In some aspects, miRNA binding sequences of the present disclosure can include additional nucleotides at the 5′, 3′, or both 5′ and 3′ ends of those sequences in the sequence listing provided herein, as long as the modified sequence is still capable of specifically binding to the target miRNA (e.g., miR-485-3p). In some aspects, miRNA binding sequences of the present disclosure can differ in at least 1, 2, 3, 4, 5, 6, 7, 8, 9, 10 or more nucleotides with respect to those sequence in the sequence listing provided, as long as the modified sequence is still capable of specifically binding to the target miRNA (e.g., miR-485-3p). [0148] It is also specifically contemplated that any disclosures provided herein with respect to miRNA binding molecules or miRNA can be implemented with respect to synthetic miRNAs binding molecules. It is also understood that the disclosures related to RNA sequences in the present disclosure are equally applicable to corresponding DNA sequences. [0149] In some aspects, an anti-miRNA oligonucleotide described herein (e.g., an anti- miR-485-3p oligonucleotide) comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 5' of the nucleotide sequence. In some aspects, an anti-miRNA oligonucleotide (e.g., an anti-miR-485-3p oligonucleotide) comprises at least 1 nucleotide, at least 2 nucleotides, at least 3 nucleotides, at least 4 nucleotides, at least 5 nucleotides, at least 6 nucleotides, at least 7 nucleotides, at least 8 nucleotides, at least 9 nucleotides, at least 10 nucleotides, at least 11 nucleotides, at least 12 nucleotides, at least 13 nucleotides, at least 14 nucleotides, at least 15 nucleotides, at least 16 nucleotides, at least 17 nucleotides, at least 18 nucleotides, at least 19 nucleotides, or at least 20 nucleotides at the 3' of the nucleotide sequence. [0150] In some aspects, an anti-miRNA oligonucleotide disclosed herein (e.g., an anti- miR-485-3p oligonucleotide) is about 6 to about 30 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 7 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 8 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 9 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide of the present disclosure is 10 nucleotides in length. In some aspects, an anti- miRNA oligonucleotide is 11 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 12 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 13 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 14 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide disclosed herein is 15 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 16 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide of the present disclosure is 17 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 18 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 19 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 20 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide of the present disclosure is 21 nucleotides in length. In some aspects, an anti-miRNA oligonucleotide is 22 nucleotides in length. [0151] In some aspects, an anti-miRNA oligonucleotide disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to a sequence selected from SEQ ID NOs: 2 to 30. In some aspects, an anti-miRNA oligonucleotide comprises a nucleotide sequence selected from the group consisting of SEQ ID NOs: 2 to 30, wherein the nucleotide sequence can optionally comprise 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10 mismatches. [0152] In some aspects, an anti-miRNA oligonucleotide comprises 5'-UGUAUGA-3' (SEQ ID NO: 2), 5'-GUGUAUGA-3' (SEQ ID NO: 3), 5'-CGUGUAUGA-3' (SEQ ID NO: 4), 5'- CCGUGUAUGA-3' (SEQ ID NO: 5), 5'-GCCGUGUAUGA-3' (SEQ ID NO: 6), 5'- AGCCGUGUAUGA-3' (SEQ ID NO: 7), 5'-GAGCCGUGUAUGA-3' (SEQ ID NO: 8), 5'- AGAGCCGUGUAUGA-3' (SEQ ID NO: 9), 5'-GAGAGCCGUGUAUGA-3' (SEQ ID NO: 10), 5'-GGAGAGCCGUGUAUGA-3' (SEQ ID NO: 11), 5'-AGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 12), 5'-GAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 13), 5'- AGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 14), or 5'- GAGAGGAGAGCCGUGUAUGA-3' (SEQ ID NO: 15). [0153] In some aspects, an anti-miRNA oligonucleotide has 5'-UGUAUGAC-3' (SEQ ID NO: 16), 5'-GUGUAUGAC-3' (SEQ ID NO: 17), 5'-CGUGUAUGAC-3' (SEQ ID NO: 18), 5'-CCGUGUAUGAC-3' (SEQ ID NO: 19), 5'-GCCGUGUAUGAC-3' (SEQ ID NO: 20), 5'- AGCCGUGUAUGAC-3' (SEQ ID NO: 21), 5'-GAGCCGUGUAUGAC-3' (SEQ ID NO: 22), 5'-AGAGCCGUGUAUGAC-3' (SEQ ID NO: 23), 5'-GAGAGCCGUGUAUGAC-3' (SEQ ID NO: 24), 5'-GGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 25), 5'- AGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 26), 5'-GAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 27), 5'-AGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 28), 5'- GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29), or 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0154] In some aspects, an anti-miRNA oligonucleotide has a sequence selected from the group consisting of: 5'-TGTATGA-3' (SEQ ID NO: 62), 5'-GTGTATGA-3' (SEQ ID NO: 63), 5'-CGTGTATGA-3' (SEQ ID NO: 64), 5'-CCGTGTATGA-3' (SEQ ID NO: 65), 5'- GCCGTGTATGA-3' (SEQ ID NO: 66), 5'-AGCCGTGTATGA-3' (SEQ ID NO: 67), 5'- GAGCCGTGTATGA-3' (SEQ ID NO: 68), 5'-AGAGCCGTGTATGA-3' (SEQ ID NO: 69), 5'-GAGAGCCGTGTATGA-3' (SEQ ID NO: 70), 5'-GGAGAGCCGTGTATGA-3' (SEQ ID NO: 71), 5'-AGGAGAGCCGTGTATGA-3' (SEQ ID NO: 72), 5'- GAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 73), 5'-AGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 74), 5'-GAGAGGAGAGCCGTGTATGA-3' (SEQ ID NO: 75); 5'- TGTATGAC-3' (SEQ ID NO: 76), 5'-GTGTATGAC-3' (SEQ ID NO: 77), 5'- CGTGTATGAC-3' (SEQ ID NO: 78), 5'-CCGTGTATGAC-3' (SEQ ID NO: 79), 5'- GCCGTGTATGAC-3' (SEQ ID NO: 80), 5'-AGCCGTGTATGAC-3' (SEQ ID NO: 81), 5'- GAGCCGTGTATGAC-3' (SEQ ID NO: 82), 5'-AGAGCCGTGTATGAC-3' (SEQ ID NO: 83), 5'-GAGAGCCGTGTATGAC-3' (SEQ ID NO: 84), 5'-GGAGAGCCGTGTATGAC-3' (SEQ ID NO: 85), 5'-AGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 86), 5'- GAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 87), 5'-AGAGGAGAGCCGTGTATGAC- 3' (SEQ ID NO: 88), 5'-GAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 89); and 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). [0155] In some aspects, an anti-miRNA oligonucleotide disclosed herein comprises a nucleotide sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% identical to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88). In some aspects, an anti-miRNA oligonucleotide comprises a nucleotide sequence that has at least 90% similarity to 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88). In some aspects, an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88) with one substitution or two substitutions. In some aspects, an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 28) or 5'- AGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 88). [0156] In some aspects, the sequence of an anti-miRNA oligonucleotide is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% sequence identity to 5'-AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC-3' (SEQ ID NO: 90). In some aspects, an anti-miRNA oligonucleotide has a sequence that has at least 90% similarity to 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90) with one substitution or two substitutions. In some aspects, an anti-miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30) or 5'- AGAGAGGAGAGCCGTGTATGAC -3' (SEQ ID NO: 90). In some aspects, an anti- miRNA oligonucleotide comprises the nucleotide sequence 5'- AGAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 30). [0157] In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and at least one, at least two, at least three, at least four or at least five additional nucleic acid at the N terminus, at least one, at least two, at least three, at least four, or at least five additional nucleic acid at the C terminus, or both. In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one additional nucleic acid at the N terminus and/or one additional nucleic acid at the C terminus. In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one or two additional nucleic acids at the N terminus and/or one or two additional nucleic acids at the C terminus. In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises the sequence disclosed herein, e.g., any one of SEQ ID NOs: 2 to 30, and one to three additional nucleic acids at the N terminus and/or one to three additional nucleic acids at the C terminus. In some aspects, an anti-miRNA oligonucleotide comprises 5'-GAGAGGAGAGCCGUGUAUGAC-3' (SEQ ID NO: 29). In some aspects, an anti-miRNA oligonucleotide comprises 5'- AGAGAGGAGAGCCGUGUAUGAC -3' (SEQ ID NO: 30). [0158] In some aspects, an anti-miRNA oligonucleotide of the present disclosure comprises one miRNA (e.g., miR-485-3p) binding site. In some aspects, an anti-miRNA oligonucleotide disclosed herein comprises at least two miRNA (e.g., miR-485-3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises three miRNA (e.g., miR-485- 3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises four miRNA (e.g., miR-485-3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises five miRNA (e.g., miR-485-3p) binding sites. In some aspects, an anti-miRNA oligonucleotide comprises six or more miRNA (e.g., miR-485-3p) binding sites. In some aspects, all the miRNA binding sites are identical. In some aspects, all the miRNA binding sites are different. In some aspects, at least one of the miRNA binding sites is different. II.A.2. Second Oligonucleotide [0159] A second oligonucleotide useful for the present disclosure is also not particularly limited so long as the oligonucleotide is capable of specifically binding to the anti-miRNA oligonucleotide (i.e., first oligonucleotide described herein) when the anti-miRNA oligonucleotide is not part of a duplex (i.e., not bound to the target miRNA). Such an oligonucleotide is referred to herein as the "miRNA mimic." For instance, in some aspects, the miRNA mimic has at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% sequence identity to the target miRNA, such that the anti- miRNA is capable of binding to the miRNA mimic. [0160] As described herein, in some aspects, the target miRNA comprises miR-485-3p. Accordingly, the miRNA mimic useful for the present disclosure comprises a nucleic acid sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the human miR-485-3p sequence set forth in SEQ ID NO: 1. In some aspects, the miRNA mimic comprises the nucleic acid sequence set forth in SEQ ID NO: 1. In some aspects, the miRNA mimic consists of the nucleic acid sequence set forth in SEQ ID NO: 1. In some aspects, the miRNA mimic consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 1. [0161] As described herein, in some aspects, the target miRNA comprises miR-485-3p. Accordingly, the miRNA mimic useful for the present disclosure comprises a nucleic acid sequence that is at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or about 100% identical to the mouse miR-485-3p sequence set forth in SEQ ID NO: 34. In some aspects, the miRNA mimic comprises the nucleic acid sequence set forth in SEQ ID NO: 34. In some aspects, the miRNA mimic consists of the nucleic acid sequence set forth in SEQ ID NO: 34. In some aspects, the miRNA mimic consists essentially of the nucleic acid sequence set forth in SEQ ID NO: 34. II.A.3. Chemical Modifications [0162] In some aspects, a first and/or second oligonucleotide disclosed herein comprises at least one chemically modified nucleoside and/or nucleotide. Such oligonucleotides can also be referred to herein as "modified oligonucleotides." [0163] A "nucleoside" refers to a compound containing a sugar molecule (e.g., a pentose or ribose) or a derivative thereof in combination with an organic base (e.g., a purine or pyrimidine) or a derivative thereof (also referred to herein as "nucleobase"). A "nucleotide" refers to a nucleoside including a phosphate group. Modified nucleotides can be synthesized by any useful method, such as, for example, chemically, enzymatically, or recombinantly, to include one or more modified or non-natural nucleosides. [0164] An oligonucleotide described herein (e.g., an anti-miRNA oligonucleotide and/or miRNA mimic) can comprise a region or regions of linked nucleosides. Such regions can have variable backbone linkages. The linkages can be standard phosphodiester linkages, in which case the oligonucleotides would comprise regions of nucleotides. [0165] The modified oligonucleotides disclosed herein can comprise various distinct modifications. In some aspects, the modified oligonucleotides contain one, two, or more (optionally different) nucleoside or nucleotide modifications. In some aspects, a modified oligonucleotide can exhibit one or more desirable properties, e.g., improved thermal or chemical stability, reduced immunogenicity, reduced degradation, increased binding to the target microRNA, reduced non-specific binding to other microRNA or other molecules, as compared to an unmodified oligonucleotide. [0166] In some aspects, an oligonucleotide described herein (e.g., anti-miRNA oligonucleotide, miRNA mimic, or both) is chemically modified. As used herein, in reference to an oligonucleotide, the terms "chemical modification" or, as appropriate, "chemically modified" refer to modification with respect to adenosine (A), guanosine (G), uridine (U), thymidine (T) or cytidine (C) ribo- or deoxyribonucleosides in one or more of their position, pattern, percent or population, including, but not limited to, its nucleobase, sugar, backbone, or any combination thereof. [0167] In some aspects, an oligonucleotide described herein (e.g., anti-miRNA oligonucleotide, miRNA mimic, or both) can have a uniform chemical modification of all or any of the same nucleoside type or a population of modifications produced by downward titration of the same starting modification in all or any of the same nucleoside type, or a measured percent of a chemical modification of all any of the same nucleoside type but with random incorporation In some aspects, the oligonucleotide described herein (e.g., anti-miRNA oligonucleotide, miRNA mimic, or both) can have a uniform chemical modification of two, three, or four of the same nucleoside type throughout the entire oligonucleotide (such as all uridines and/or all cytidines, etc. are modified in the same way). [0168] Modified nucleotide base pairing encompasses not only the standard adenine- thymine, adenine-uracil, or guanine-cytosine base pairs, but also base pairs formed between nucleotides and/or modified nucleotides comprising non-standard or modified bases, wherein the arrangement of hydrogen bond donors and hydrogen bond acceptors permits hydrogen bonding between a non-standard base and a standard base or between two complementary non- standard base structures. One example of such non-standard base pairing is the base pairing between the modified nucleobase inosine and adenine, cytosine or uracil. Any combination of base/sugar or linker can be incorporated into polynucleotides of the present disclosure. [0169] The skilled artisan will appreciate that, except where otherwise noted, nucleotide sequences set forth in the instant application will recite "T"s in a representative DNA sequence but where the sequence represents RNA, the "T"s would be substituted for "U"s. For example, TD's of the present disclosure can be administered as RNAs, as DNAs, or as hybrid molecules comprising both RNA and DNA units. [0170] In some aspects, oligonucleotides described herein (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) include a combination of at least two (e.g., 2, 3, 4, 5, 6, 7, 8, 8, 10, 11, 12, 13, 14, 15, 16, 17, 18, 18, 20 or more) modified nucleobases. [0171] In some aspects, the nucleobases, sugar, backbone linkages, or any combination thereof in an oligonucleotide are modified by at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99%, or 100%. (i) Base Modification [0172] In some aspects, the chemical modification is at nucleobases in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both). In some aspects, the at least one chemically modified nucleoside is a modified uridine (e.g., pseudouridine (ψ), 2-thiouridine (s2U), 1-methyl-pseudouridine (m1ψ), 1-ethyl-pseudouridine (e1ψ), or 5-methoxy-uridine (mo5U)), a modified cytosine (e.g., 5-methyl-cytidine (m5C)) a modified adenosine (e.g., 1-methyl-adenosine (m1A), N6-methyl-adenosine (m6A), or 2- methyl-adenine (m2A)), a modified guanosine (e.g., 7-methyl-guanosine (m7G) or 1-methyl- guanosine (m1G)), or a combination thereof. [0173] In some aspects, an oligonucleotide useful for the present disclosure (e.g., an anti- miRNA oligonucleotide, miRNA mimic, or both described herein) is uniformly modified (e.g., fully modified, modified throughout the entire sequence) for a particular modification. For example, an oligonucleotide can be uniformly modified with the same type of base modification, e.g., 5-methyl-cytidine (m5C), meaning that all cytosine residues in the oligonucleotide sequence are replaced with 5-methyl-cytidine (m5C). Similarly, an oligonucleotide described herein can be uniformly modified for any type of nucleoside residue present in the sequence by replacement with a modified nucleoside such as any of those set forth above. [0174] In some aspects, oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) include a combination of at least two (e.g., 2, 3, 4 or more) of modified nucleobases. In some aspects, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of a type of nucleobases in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) are modified nucleobases. (ii) Backbone modifications [0175] In some aspects, oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can include any useful linkage between the nucleosides. Such linkages, including backbone modifications, that are useful in the composition of the present disclosure include, but are not limited to the following: 3'-alkylene phosphonates, 3'-amino phosphoramidate, alkene containing backbones, aminoalkylphosphoramidates, aminoalkylphosphotriesters, boranophosphates, -CH 2 -O- N(CH3)-CH 2 -, -CH 2 -N(CH3)-N(CH3)-CH 2 -, -CH 2 -NH-CH 2 -, chiral phosphonates, chiral phosphorothioates, formacetyl and thioformacetyl backbones, methylene (methylimino), methylene formacetyl and thioformacetyl backbones, methyleneimino and methylenehydrazino backbones, morpholino linkages, -N(CH3)-CH 2 -CH 2 -, oligonucleosides with heteroatom internucleoside linkage, phosphinates, phosphoramidates, phosphorodithioates, phosphorothioate internucleoside linkages, phosphorothioates, phosphotriesters, PNA, siloxane backbones, sulfamate backbones, sulfide sulfoxide and sulfone backbones, sulfonate and sulfonamide backbones, thionoalkylphosphonates, thionoalkylphosphotriesters, and thionophosphoramidates.

[0176] In some aspects, the presence of a backbone linkage disclosed above increase the stability and resistance to degradation of an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both). [0177] In some aspects, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of the backbone linkages in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) are modified (e.g., all of them are phosphorothioate). [0178] In some aspects, a backbone modification that can be included in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) comprises phosphorodiamidate morpholino oligomer (PMO), phosphorothioate (PS) modification, or both. (iii) Sugar modifications [0179] The modified nucleosides and nucleotides which can be incorporated into oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can be modified on the sugar of the nucleic acid. Accordingly, in some aspects, a miR-485 inhibitor described herein comprises a nucleic acid which comprises at least one nucleoside analog (e.g., a nucleoside with a sugar modification). In some aspects, the sugar modification increases the affinity of the binding of an anti-miRNA oligonucleotide to a target miRNA nucleic acid sequence. Incorporating affinity-enhancing nucleotide (or nucleoside) analogues, such as LNA or 2'-substituted sugars, can allow the length and/or the size of an oligonucleotide (e.g., an anti-miRNA oligonucleotide, , miRNA mimic, or both) to be reduced. [0180] In some aspects, at least about 5%, at least 10%, at least 15%, at least 20%, at least 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 96%, at least about 97%, at least about 98%, at least about 99% or 100% of the nucleotides in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) contain sugar modifications (e.g., LNA). [0181] In some aspects, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, or 22 nucleotide units in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) are sugar modified (e.g., LNA). [0182] Generally, RNA includes the sugar group ribose, which is a 5-membered ring having an oxygen. Exemplary, non-limiting modified nucleotides include replacement of the oxygen in ribose (e.g., with S, Se, or alkylene, such as methylene or ethylene); addition of a double bond (e.g., to replace ribose with cyclopentenyl or cyclohexenyl); ring contraction of ribose (e.g., to form a 4-membered ring of cyclobutane or oxetane); ring expansion of ribose (e.g., to form a 6- or 7-membered ring having an additional carbon or heteroatom, such as for anhydrohexitol, altritol, mannitol, cyclohexanyl, cyclohexenyl, and morpholino that also has a phosphoramidate backbone); multicyclic forms (e.g., tricyclo; and "unlocked" forms, such as glycol nucleic acid (GNA) (e.g., R-GNA or S-GNA, where ribose is replaced by glycol units attached to phosphodiester bonds), threose nucleic acid (TNA, where ribose is replace with α- L-threofuranosyl-(3′→2′)) , and peptide nucleic acid (PNA, where 2-amino-ethyl-glycine linkages replace the ribose and phosphodiester backbone). The sugar group can also contain one or more carbons that possess the opposite stereochemical configuration than that of the corresponding carbon in ribose. Thus, oligonucleotides described herein (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can include nucleotides containing, e.g., arabinose, as the sugar. [0183] In some aspects, the 2′ hydroxyl group (OH) of ribose can be modified or replaced with a number of different substituents. Exemplary substitutions at the 2′-position include, but are not limited to, H, halo, optionally substituted C 1-6 alkyl; optionally substituted C 1-6 alkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 3-8 cycloalkyl; optionally substituted C 3-8 cycloalkoxy; optionally substituted C 6-10 aryloxy; optionally substituted C 6-10 aryl- C 1-6 alkoxy, optionally substituted C 1-12 (heterocyclyl)oxy; a sugar (e.g., ribose, pentose, or any described herein); a polyethyleneglycol (PEG), -O(CH 2 CH 2 O) n CH 2 CH 2 OR, where R is H or optionally substituted alkyl, and n is an integer from 0 to 20 (e.g., from 0 to 4, from 0 to 8, from 0 to 10, from 0 to 16, from 1 to 4, from 1 to 8, from 1 to 10, from 1 to 16, from 1 to 20, from 2 to 4, from 2 to 8, from 2 to 10, from 2 to 16, from 2 to 20, from 4 to 8, from 4 to 10, from 4 to 16, and from 4 to 20); "locked" nucleic acids (LNA) in which the 2′-hydroxyl is connected by a C 1-6 alkylene or C 1-6 heteroalkylene bridge to the 4'-carbon of the same ribose sugar, where exemplary bridges include methylene, propylene, ether, amino bridges, aminoalkyl, aminoalkoxy, amino, and amino acid. [0184] In some aspects, nucleotide analogues present in an oligonucleotide of the present disclosure (e.g., an anti-miRNA oligonucleotide) comprise, e.g., 2'-O-alkyl-RNA units, 2'- OMe-RNA units, 2'-O-alkyl-SNA, 2'-amino-DNA units, 2'-fluoro-DNA units, LNA units, arabino nucleic acid (ANA) units, 2'-fluoro-ANA units, HNA units, INA (intercalating nucleic acid) units, 2'MOE units, or any combination thereof. In some aspects, the LNA is, e.g., oxy- LNA (such as beta-D-oxy-LNA, or alpha-L-oxy-LNA), amino-LNA (such as beta-D-amino- LNA or alpha-L-amino-LNA), thio-LNA (such as beta-D-thio-LNA or alpha-L-thio-LNA), ENA (such a beta-D-ENA or alpha-L-ENA), or any combination thereof. In some aspects, nucleotide analogues that can be included in a polynucleotide of the present disclosure (e.g., anti-miRNA oligonucleotide) comprises a locked nucleic acid (LNA), an unlocked nucleic acid (UNA), an arabino nucleic acid (ABA), a bridged nucleic acid (BNA), and/or a peptide nucleic acid (PNA). In some aspects, nucleoside analog comprises a LNA; 2'-0-alkyl-RNA; 2'-amino- DNA; 2'-fluoro-DNA; arabino nucleic acid (ANA); 2'-fluoro-ANA, hexitol nucleic acid (HNA), intercalating nucleic acid (INA), constrained ethyl nucleoside (cEt), 2'-0-methyl nucleic acid (2'-OMe), 2'-0- methoxyethyl nucleic acid (2'-MOE), or any combination thereof. [0185] In some aspects, oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can comprise both modified RNA nucleotide analogues (e.g., LNA) and DNA units. In some aspects, an oligonucleotide (e.g., an anti- miRNA oligonucleotide, miRNA mimic, or both) is a gapmer. See, e.g., U.S. Pat. Nos. 8,404,649; 8,580,756; 8,163,708; 9,034,837; all of which are herein incorporated by reference in their entireties. In some aspects, an oligonucleotide (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) a micromir. See U.S. Pat. Appl. Publ. No. US20180201928, which is herein incorporated by reference in its entirety. [0186] In some aspects, oligonucleotides of the present disclosure (e.g., an anti-miRNA oligonucleotide, miRNA mimic, or both) can include modifications to prevent rapid degradation by endo- and exo-nucleases. Modifications include, but are not limited to, for example, (a) end modifications, e.g., 5' end modifications (phosphorylation, dephosphorylation, conjugation, inverted linkages, etc.), 3' end modifications (conjugation, DNA nucleotides, inverted linkages, etc.), (b) base modifications, e.g., replacement with modified bases, stabilizing bases, destabilizing bases, or bases that base pair with an expanded repertoire of partners, or conjugated bases, (c) sugar modifications (e.g., at the 2' position or 4' position) or replacement of the sugar, as well as (d) internucleoside linkage modifications, including modification or replacement of the phosphodiester linkages. II.B. Probes and Quenchers [0187] As is apparent from the present disclosure, the probes and quenchers that can be used with the present disclosure are not particularly limited, as long as the probe exhibits a detectable signal (e.g., fluorescence) and the quencher is able to reduce and/or inhibit the detection of the detectable signal. In some aspects, a probe that can be used with the present disclosure comprises a fluorescent marker, radioisotope, bioluminescent compound, chemiluminescent compound, enzyme, or combinations thereof. In some aspects, the probe has been modified with a suitable linking group for conjugation to the miRNA mimic (i.e., second oligonucleotide). While the present disclosure generally provides that the quencher is conjugated to a first oligonucleotide (i.e., an anti-miRNA oligonucleotide) and that the probe is conjugated to a second oligonucleotide (i.e., miRNA mimic), it will be apparent to those skilled in the art that the quencher can be conjugated to the second oligonucleotide and the probe can be conjugated to the first oligonucleotide without any negative effects. [0188] As demonstrated herein, in some aspects, a probe useful for the present disclosure is a fluorescent marker (also referred to herein as "fluorophore"). The fluorophore can be a non-protein organic fluorophore or a fluorescent protein. Non-limiting exemplary families of non-protein organic fluorophores include: Xanthene derivatives (such as fluorescein, rhodamine, Oregon green, eosin, and Texas red), cyanine derivatives (such as cyanine, indocarbocyanine, oxacarbocyanine, thiacarbocyanine, and merocyanine), squaraine derivatives and ring-substituted squaraines (including Seta, SeTau, and Square dyes), naphthalene derivatives (such as dansyl and prodan derivatives), coumarin derivatives, oxadiazole derivatives (such as pyridyloxazole, nitrobenzoxadiazole and benzoxadiazole), anthracene derivatives (such as anthraquinones, including DRAQ5, DRAQ7 and CyTRAK Orange), pyrene derivatives (such as cascade blue), oxazine derivatives (such as Nile red, Nile blue, cresyl violet, and oxazine 170), acridine derivatives (such as proflavin, acridine orange, and acridine yellow), arylmethine derivatives (such as auramine, crystal violet, and malachite green), and tetrapyrrole derivatives (such as porphin, phthalocyanine, and bilirubin). [0189] Non-limiting examples of such probes are known in the art and include LC ® Red640, LC ® Red705, ALEXA FLUOR™ 633, ALEXA FLUOR™ 647, ALEXA FLUOR™ 660, ALEXA FLUOR™ 680, ALEXA FLUOR™ 700, ALEXA FLUOR™ 750, BODIPY™ 630/650-X, BODIPY™ 650/665-X, Cy5, Cy5.5, R6G, ALEXA FLUOR™ 594, ALEXA FLUOR™ 568, ALEXA FLUOR™ 555, ALEXA FLUOR™ 546, TAMRA (tetramethylrhodamine), RHODAMINE RED™-X, BODIPY™ 564/570, BODIPY™ TMR- X, BODIPY™ TR-X, BODIPY™ 581/591, BODIPY™ 630/650-X, REDMOND RED ® , Cal Fluor dyes (e.g., Cal Fluor Gold 540, Orange 560, Red 590, Red 610, and Red 635), ROX (carboxyrhodamine), Cy3, Cy3.5, QUASAR ® dyes (e.g., Quasar 705, Quasar 670, and Quasar 570), Pulsar 650, SYBR green, 5-carboxyfluorescein (5-FAMTm available from Applied Biosystems of Foster City, Calif.), 6-carboxyfluorescein (6-FAM), tetrachloro-6- carboxyfluorescein (TET), 2,7-dimethoxy-4,5-dichloro-6-carboxyfluorescein, hexachloro-6- carboxyfluorescein (HEX), 6-carboxy-2′,4,7,7′-tetrachlorofluorescein (6-TETTm), carboxy- X-rhodamine (ROX), 6-carboxy-4′,5′-dichloro-2′,7′-dimethoxyfluorescein (6-JOETM), and combinations thereof. In some aspects, the probe comprises Cy5.5. [0190] As is apparent from the present disclosure, the selection of a suitable quencher for conjugating to an anti-miRNA oligonucleotide (i.e., first oligonucleotide) of the present disclosure depends on the selection of the particular probe (e.g., quencher should be able to suppress the detection of the probe when the probe and the quencher are in close proximity). Generally, an absorbance band of the quencher should substantially overlap with the emission band of the probe (e.g., fluorophore), such that the emission signal is reduced and/or inhibited when the quencher and the probe are in close proximity. In some aspects, the probe and the quencher are selected, such that there is donor-acceptor (i.e., probe-quencher) energy transfer when the probe is excited. In choosing such probe-quencher pair, in some aspects, the efficiency of the energy transfer ("fluorescence resonance energy transfer" or "FRET") is at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% or more. [0191] In some aspects, a quencher that can be used with the present disclosure comprises a dark quencher. As used herein, "dark quenchers" refers to substances that can absorb excitation energy from a probe (e.g., fluorophore) and dissipates the energy as heat. Accordingly, dark quenchers can be useful when used in combination with fluorescent probes. Non-limiting examples of dark quenchers that are suitable for the present disclosure include dimethylaminoazobenzenesulfonic acid (dabsyl), Black Hole Quencher (BHQ™), QXL ® quenchers (e.g., QXL 570, QXL 670), IOWA BLACK ® quenchers (e.g., Iowa Black FQ, Iowa Black RQ), IRDYE ® QC-1, BLACKBERRY ® Quencher (BBQ-650), and combinations thereof. [0192] In some aspects, the quencher is BBQ-650, and the probe is selected from LC ® Red640, LC ® Red705, Alexa Fluor™ 633, Alexa Fluor™ 647, Alexa Fluor™ 660, Alexa Fluor™ 680, Alexa Fluor™ 700, Alexa Fluor™ 750, BODIPY™ 630/650-X, BODIPY™ 650/665-X, Cy5, Cy5.5, or combinations thereof. In some aspects, the quencher is BBQ-650 and the probe is LC ® Red640. In some aspects, the quencher is BBQ-650 and the probe is LC ® Red705. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 633. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 647. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 660. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 680. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 700. In some aspects, the quencher is BBQ-650 and the probe is Alexa Fluor™ 750. In some aspects, the quencher is BBQ-650 and the probe is BODIPY™ 630/650-X. In some aspects, the quencher is BBQ-650 and the probe is BODIPY™ 650/665- X. In some aspects, the quencher is BBQ-650 and the probe is Cy5. In some aspects, the quencher is BBQ-650 and the probe is Cy5.5. [0193] In some aspects, the quencher is BHQ-2, and the probe is selected from R6G, Alexa Fluor™ 594, Alexa Fluor™ 568, Alexa Fluor™ 555, Alexa Fluor™ 546, TAMRA (tetramethylrhodamine), Rhodamine Red™-X, BODIPY™ 564/570, BODIPY™ TMR-X, BODIPY™ TR-X, BODIPY™ 581/591, BODIPY™ 630/650-X, Redmond Red ® , Cal Fluor Red ® 590, Cal Fluor Red ® 610, Cal Fluor Red ® 635, ROX (carboxyrhodamine), Cy3, Cy3.5, Pulsar 650, or combinations thereof. In some aspects, the quencher is BHQ-2, and the probe is R6G. In some aspects, the quencher is BHQ-2, and the probe is Alexa Fluor™ 594. In some aspects, the quencher is BHQ-2, and the probe is Alexa Fluor™ 568. In some aspects, the quencher is BHQ-2, and the probe is Alexa Fluor™ 555. In some aspects, the quencher is BHQ- 2, and the probe is Alexa Fluor™ 546. In some aspects, the quencher is BHQ-2, and the probe is TAMRA (tetramethylrhodamine). In some aspects, the quencher is BHQ-2, and the probe is Rhodamine Red™-X. In some aspects, the quencher is BHQ-2, and the probe is BODIPY™ 564/570. In some aspects, the quencher is BHQ-2, and the probe is BODIPY™ TMR-X. In some aspects, the quencher is BHQ-2, and the probe is BODIPY™ TR-X. In some aspects, the quencher is BHQ-2, and the probe is BODIPY™ 581/591. In some aspects, the quencher is BHQ-2, and the probe is BODIPY™ 630/650-X. In some aspects, the quencher is BHQ-2, and the probe is Redmond Red ® . In some aspects, the quencher is BHQ-2, and the probe is Cal Fluor Red ® 590. In some aspects, the quencher is BHQ-2, and the probe is Cal Fluor Red ® 610. In some aspects, the quencher is BHQ-2, and the probe is Cal Fluor Red ® 635. In some aspects, the quencher is BHQ-2, and the probe is ROX (carboxyrhodamine). In some aspects, the quencher is BHQ-2, and the probe is Cy3. In some aspects, the quencher is BHQ-2, and the probe is Cy3.5. In some aspects, the quencher is BHQ-2, and the probe is Pulsar 650. [0194] In some aspects, the fluorophore and/or quencher can include substituents enhancing a desirable property, e.g., solubility in water, cell permeability, or an altered absorption and emission spectrum, relative to the "parent" compound (i.e., the fluorophore and/or quencher without the substituents). [0195] Means of detecting fluorescent labels are well known to those of skill in the art. Thus, for example, fluorescent labels can be detected by exciting the fluorophore with the appropriate wavelength of light and detecting the resulting fluorescence. The fluorescence can be detected visually, by means of photographic film, by the use of electronic detectors such as charge coupled devices (CCDs) or photomultipliers and the like. Similarly, enzymatic labels can be detected by providing the appropriate substrates for the enzyme and detecting the resulting reaction product. In some aspects, the signal from the probe can be detected using a biomolecular imager (e.g., gel doc). In some aspects, the signal from the probe can be detected using a specific wavelength (e.g., ELISA assay). III. Methods of Treatment [0196] Disclosed herein are also methods of treating (e.g., controlling, ameliorating, or reducing one or more symptoms of) a disease or disorder in a subject in need thereof based on the diagnosis described herein. Accordingly, in some aspects, methods disclosed herein comprise administering a therapy to a subject identified as being afflicted with a disease or disorder described herein. In some aspects, the therapy is capable of treating, controlling, ameliorating, or reducing one or more symptoms of the disease or disorder. [0197] In some aspects, the therapy can comprise any agent (e.g., therapeutic agent) that can treat, control, ameliorate, or reduce one or more symptoms associated with a disease or disorder disclosed herein. For instance, in some aspects, a disease or disorder that can be treated with the present disclosure comprises a cognitive disorder. Non-limiting examples of symptoms associated with a cognitive disorder described herein include: memory loss, frequently asking the same question or repeating the same story over and over, difficulty recognizing familiar people and places, having trouble exercising judgment (e.g., knowing what to do in an emergency), change in mood or behavior, vision problems, difficulty planning and carrying out tasks (e.g., following a recipe or keeping track of monthly bills), and combinations thereof. [0198] In some aspects, the therapy comprises a compound that is capable of modulating the activity of the target miRNA. In some aspects, the compound is capable of inhibiting or reducing the activity and/or expression of the target miRNA (also referred to herein as "miRNA inhibitor"). For instance, as described herein, in some aspects, a target miRNA comprises miR- 485-3p, and the disease or disorder is associated with increased miR-485-3p expression and/or activity. Accordingly, in such aspects, the therapy can comprise a compound that inhibits or reduces the expression and/or activity of miR-485-3p. Such compounds are also referred to herein as "mir-485 inhibitor" or "miR-485-3p inhibitor." As will be apparent to those skilled in the art, a compound that is capable of modulating the expression and/or activity of a target miRNA comprises any of the anti-miRNA oligonucleotides described herein. For instance, in some aspects, a miR-485-3p inhibitor comprises an anti-miR-485-3p oligonucleotide described herein. Accordingly, in some aspects, certain disclosures relating to an anti-miRNA oligonucleotide provided herein are equally applicable to miRNA inhibitors of the present disclosure (e.g., miR-485-3p inhibitor). [0199] Accordingly, in some aspects, the present disclosure is related to a method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having an increase in the level of a miRNA ("miRNA level") in a biological sample obtained from the subject, compared to a corresponding level in a reference sample (e.g., biological sample obtained from (i) a subject who is not afflicted with the disease or disorder, (ii) the subject prior to being afflicted with the disease or disorder, or (iii) both (i) and (ii)) , wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher and a second oligonucleotide conjugated to a probe, (i) wherein the first oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the second oligonucleotide specifically binds to the first oligonucleotide when the first oligonucleotide is not part of a duplex, and (iii) wherein the binding of the second oligonucleotide to the first oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring an expression level of the probe, wherein the expression level of the probe is correlated with the miRNA level. [0200] As described herein, in some aspects, the methods provided herein can be used to treat a disease or condition associated with a decreased miRNA level. Accordingly, in some aspects, the present disclosure is related to a method of treating a disease or disorder in a subject in need thereof, comprising administering a treatment for the disease or disorder to the subject identified as having a decrease in the level of a miRNA in a biological sample obtained from the subject, compared to a corresponding level in a reference sample (e.g., biological sample obtained from (i) a subject who is not afflicted with the disease or disorder, (ii) the subject prior to being afflicted with the disease or disorder, or (iii) both (i) and (ii)) , wherein the miRNA level is measured by: (a) contacting the biological sample with a first oligonucleotide conjugated to a quencher (i.e., anti-miRNA oligonucleotide) and a second oligonucleotide conjugated to a probe (i.e., miRNA mimic), (i) wherein the anti-miRNA oligonucleotide specifically binds to the miRNA to form a duplex when the miRNA is present in the biological sample, (ii) wherein the miRNA mimic specifically binds to the anti-miRNA oligonucleotide when the anti-miRNA oligonucleotide is not part of a duplex, and (iii) wherein the binding of the miRNA mimic to the anti-miRNA oligonucleotide results in the quencher inhibiting the expression of the probe; and (b) measuring an expression level of the probe, wherein the expression level of the probe is correlated with the miRNA level. [0201] As described herein, in some aspects, the treatment comprises a miRNA inhibitor (e.g., miR-485-3p inhibitor). In some aspects, administering a miRNA inhibitor to a subject (e.g., identified as having a disease or disorder) decreases the activity of the target miRNA (e.g., miRNA-485-3p) in the subject by at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% or more, compared to a reference (e.g., target miRNA activity in a corresponding subject not treated with the miRNA inhibitor). [0202] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject described herein decreases the expression and/or level of the target miRNA (e.g., miR- 485-3p) in the subject by at least about 5%, at least about 6%, at least about 7%, at least about 8%, at least about 9%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, or at least about 95% or more, compared to a reference (e.g., target miRNA expression and/or level in a corresponding subject not treated with the miRNA inhibitor). [0203] Where the disease or condition is associated with a decrease in the level of a miRNA, a treatment comprises an agent that increases the level and/or activity of the miRNA when administered to a subject (e.g., identified as having the disease or condition using a method provided herein). In some aspects, administering such an agent to a subject increases the level and/or activity of the miRNA in the subject by at least about 1-fold, at least about 2- fold, at least about 3-fold, at least about 4-fold, at least about 5-fold, at least about 6-fold, at least about 7-fold, at least about 8-fold, at least about 9-fold, at least about 10-fold, at least about 15-fold, at least about 20-fold, at least about 25-fold, at least about 30-fold, at least about 35-fold, at least about 40-fold, at least about 45-fold, or at least about 50-fold, compared to the corresponding expression level in a reference sample (e.g., obtained from a corresponding subject that did not receive an administration of the agent). In some aspects, after the administration, the level of the miRNA in the subject is at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or about 100% of the level of the miRNA in a reference sample (e.g., obtained from a corresponding subject who is not suffering from the disease or disorder). [0204] As is apparent from the present disclosure, any disease or disorder that is associated with abnormal expression and/or activity (e.g., increased or decreased) of a miRNA can be treated using the methods described herein. Non-limiting examples of such diseases or disorders include: a dementia, Alzheimer's disease, autism spectrum disorder, mental retardation, seizure, stroke, Parkinson's disease, spinal cord injury, amyotrophic lateral sclerosis (ALS), tauopathy, Huntington's disease, Spinal muscular atrophy (SMA), Dementia with Lewy bodies (DLB), CAA cerebral amyloid angiopathy (CAA), CDB corticobasal degeneration (CDB), Frontotemporal lobar degeneration due to FUS pathology (FTLD-fus), Frontotemporal lobar degeneration due to tau pathology (FTLD-tau), Frontotemporal lobar degeneration due to TDP 43 (FTLD-tdp), Multiple system atrophy (MSA), Progressive supranuclear palsy (PSP), pulmonary disease, inflammatory disease, or metabolic disease, or combinations thereof. [0205] In some aspects, modulating (e.g., decreasing) the activity and/or expression of a miRNA (e.g., miR-485-3p) can reduce an amyloid beta (Aβ) plaque load in the subject identified as being afflicted with a disease or disorder described herein (e.g., cognitive disorder), compared to a reference (e.g., amyloid beta (Aβ) plaque load in the subject prior to the administering or amyloid beta (Aβ) plaque load in a corresponding subject not treated with the miRNA inhibitor). As used herein, "amyloid beta plaque" refers to all forms of aberrant deposition of amyloid beta including large aggregates and small associations of a few amyloid beta peptides and can contain any variation of the amyloid beta peptides. Amyloid beta (Aβ) plaque is known to cause neuronal changes, e.g., aberrations in synapse composition, synapse shape, synapse density, loss of synaptic conductivity, changes in dendrite diameter, changes in dendrite length, changes in spine density, changes in spine area, changes in spine length, or changes in spine head diameter. In some aspects, administering a miRNA inhibitor (e.g., miR- 485-3p inhibitor) described herein reduces an amyloid beta plaque load in a subject (e.g., identified as suffering from a disease or disorder described herein, e.g., cognitive disorder) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., subjects that did not receive an administration of the miRNA inhibitor). [0206] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein, e.g., cognitive disorder) reduces the occurrence or risk of occurrence of one or more symptoms of a disease or disorder by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0207] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) reduces memory loss compared to a reference (e.g., memory loss in the subject prior to the administering or memory loss in a corresponding subject not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) reduces memory loss or the risk of occurrence of memory loss by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0208] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) improves memory retention compared to a reference (e.g., memory retention in the subject prior to the administering or memory retention in a corresponding subject that was not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) improves and/or increases memory retention by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0209] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) improves spatial working memory compared to a reference (e.g., spatial working memory in the subject prior to the administering or spatial working memory in a corresponding subject that was not treated with the miRNA inhibitor). As used herein, the term "spatial working memory" refers to the ability to keep spatial information activity in working memory over a short period of time. In some aspects, spatial working memory is improved and/or increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0210] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) increases the phagocytic activity of scavenger cells (e.g., glial cells) in the subject compared to a reference (e.g., phagocytic activity in the subject prior to the administering or phagocytic activity in a corresponding subject not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) increases dendritic spine density of a neuron in the subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0211] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) increases neurogenesis compared to a reference (e.g., neurogenesis in the subject prior to the administering or neurogenesis in a corresponding subject not treated with the miRNA inhibitor). As used herein, the term "neurogenesis" refers to the process by which neurons are created. Neurogenesis encompasses proliferation of neural stem and progenitor cells, differentiation of these cells into new neural cell types, as well as migration and survival of the new cells. The term is intended to cover neurogenesis as it occurs during normal development, predominantly during pre-natal and peri-natal development, as well as neural cells regeneration that occurs following disease, damage or therapeutic intervention. Adult neurogenesis is also termed "nerve" or "neural" regeneration. In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) increases neurogenesis in the subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0212] In some aspects, increasing and/or inducing neurogenesis is associated with increased proliferation, differentiation, migration, and/or survival of neural stem cells and/or progenitor cells. Accordingly, in some aspects, administering a miRNA inhibitor (e.g., miR- 485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) can increase the proliferation of neural stem cells and/or progenitor cells in the subject. In some aspects, the proliferation of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). In some aspects, the survival of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0213] In some aspects, increasing and/or inducing neurogenesis is associated with an increased number of neural stem cells and/or progenitor cells. In some aspects, the number of neural stem cells and/or progenitor cells is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0214] In some aspects, increasing and/or inducing neurogenesis is associated with increased axon, dendrite, and/or synapse development. In some aspects, axon, dendrite, and/or synapse development is increased by at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0215] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) prevents and/or inhibits the development of an amyloid beta plaque load in the subject. In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) delays the onset of the development of an amyloid beta plaque load in the subject. In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) lowers the risk of developing an amyloid beta plaque load. [0216] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) increases dendritic spine density of a neuron in the subject compared to a reference (e.g., dendritic spine density of a neuron in the subject prior to the administering or dendritic spine density of a neuron in a corresponding subject that was not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) increases dendritic spine density of a neuron in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0217] In some aspects, administering a miRNA inhibitor to a subject (e.g., identified as suffering from a disease or disorder described herein) decreases the loss of dendritic spines of a neuron in the subject compared to a reference (e.g., loss of dendritic spines of a neuron in the subject prior to the administering or loss of dendritic spines of a neuron in a corresponding subject that was not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) decreases the loss of dendritic spines of a neuron in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0218] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) decreases neuroinflammation in the subject compared to a reference (e.g., neuroinflammation in the subject prior to the administering or neuroinflammation in a corresponding subject that was not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) decreases neuroinflammation by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). In some aspects, decreased neuroinflammation comprises glial cells producing decreased amounts of inflammatory mediators. Accordingly, in some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) decreases the amount of inflammatory mediators produced by glial cells by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). In some aspects, an inflammatory mediator produced by glial cells comprises TNF-α. In some aspects, the inflammatory mediator comprises IL-1β. In some aspects, an inflammatory mediator produced by glial cells comprises both TNF-α and IL-1β. [0219] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) increases autophagy in the subject. As used herein, the term "autophagy" refers to cellular stress response and a survival pathway that is responsible for the degradation of long-lived proteins, protein aggregates, as well as damaged organelles in order to maintain cellular homeostasis. In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) increases autophagy by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, or at least about 300% or more, compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0220] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as having a cognitive disorder) improves synaptic function in the subject compared to a reference (e.g., synaptic function in the subject prior to the administering). As used herein, the term "synaptic function," refers to the ability of the synapse of a cell (e.g., a neuron) to pass an electrical or chemical signal to another cell (e.g., a neuron). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) improves synaptic function in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, at least about 150%, at least about 200%, at least about 250%, or at least about 300% or more compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0221] In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) to a subject (e.g., identified as suffering from a disease or disorder described herein) can prevent, delay, and/or ameliorate the loss of synaptic function in the subject compared to a reference (e.g., loss of synaptic function in the subject prior to the administering or loss of synaptic function in a corresponding subject that was not treated with the miRNA inhibitor). In some aspects, administering a miRNA inhibitor (e.g., miR-485-3p inhibitor) prevents, delays, and/or ameliorates the loss of synaptic function in a subject (e.g., identified as suffering from a disease or disorder described herein) by at least about 5%, at least about 10%, at least about 15%, at least about 20%, at least about 25%, at least about 30%, at least about 35%, at least about 40%, at least about 45%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, or about 100% compared to a reference (e.g., corresponding subjects that did not receive an administration of the miRNA inhibitor). [0222] In some aspects, a miRNA inhibitor (e.g., miR-485-3p inhibitor) disclosed herein can be administered by any suitable route known in the art. In some aspects, a miRNA inhibitor is administered parenthetically, intramuscularly, subcutaneously, ophthalmic, intravenously, intraperitoneally, intradermally, intraorbitally, intracerebrally, intracranially, intracerebroventricularly, intraspinally, intraventricular, intrathecally, intracistemally, intracapsularly, intratumorally, or any combination thereof. [0223] In some aspects, a miRNA inhibitor (e.g., miR-485-3p inhibitor) can be used in combination with one or more additional therapeutic agents. In some aspects, the additional therapeutic agent and the miRNA inhibitor are administered concurrently. In some aspects, the additional therapeutic agent and the miRNA inhibitor are administered sequentially. [0224] In some aspects, the administration of a miRNA inhibitor (e.g., miR-485-3p inhibitor) disclosed herein does not result in any adverse effects. In some aspects, miRNA inhibitors of the present disclosure does not adversely affect body weight when administered to a subject. In some aspects, miRNA inhibitors disclosed herein do not result in increased mortality or cause pathological abnormalities when administered to a subject. IV. Diagnostic Systems [0225] Disclosed herein are diagnostic systems (e.g., kits or products of manufacture) that can be used to measure miRNA expression levels in a subject. More specifically, as further described elsewhere in the present disclosure, the diagnostic systems of the present disclosure comprise (i) a first oligonucleotide conjugated to a quencher (e.g., anti-miRNA oligonucleotides described herein) and (ii) a second oligonucleotide conjugated to a probe (e.g., miRNA mimics described herein). In some aspects, the diagnostic system further comprises an instruction for use. As is apparent from the present disclosure, in some aspects, the first oligonucleotide can be conjugated to a probe, and the second oligonucleotide can be conjugated to a quencher. [0226] As described herein, the diagnostic systems of the present disclosure differ from the more traditional approaches in the art (e.g., RT-PCR) in that amplification of the miRNA is not required. Accordingly, the diagnostic systems described herein require less reagents and complex equipment, and therefore, in some aspects, can be used as a point-of-care diagnostic system. As used herein, the term "point-of-care" or "POC" system refers to diagnostic systems (e.g., portable devices) that allow patients, physicians, and/or medical staff to accurately achieve real-time, lab-quality diagnostic results at or near the point of care (i.e., at the time and place of patient care). Because a POC system does not require, for instance, any material (e.g., biological sample) to be shipped to an outside medical laboratory, the results can be obtained within second or minutes instead of hours or days. Additionally, as is apparent from the present disclosure, the diagnostic systems described herein can be used as a home diagnostic system, where a subject can diagnose, monitor the progression of a disease, and/or assess the efficacy of a treatment in the privacy of the subject's home. [0227] In addition to the first and second oligonucleotides described herein, in some aspects, a diagnostic system of the present disclosure comprises a container in which a subject provides his or her biological sample. In some aspects, the biological sample can be readily obtained without the need for a medical professional, such as saliva or urine. Non-limiting examples of other biological samples that are useful for the present disclosure include tissue, cell, blood, serum, cerebrospinal fluid, intravitreal fluid, or combinations thereof. In some aspects, the diagnostic system further comprises one or more additional storage devices which comprise the first and/or second oligonucleotides of the present disclosure. In such aspects, the content of the one or more additional storage devices (i.e., the first and/or second oligonucleotides described herein) can be readily combined with the biological sample present in the container. For instance, in some aspects, the first and/or second oligonucleotides from the one or more additional storage devices can be added to the container containing the biological sample, such that biological sample is contacted with the first and/or second oligonucleotides. In some aspects, the first and/or second oligonucleotides are present in the container prior to the subject providing his or her biological sample, such that a separate adding step (from the one or more additional storage devices to the container) is not required. Unless indicated otherwise, the terms "container" and "storage device" can be used interchangeably. [0228] In some aspects, a diagnostic system described herein further comprises a detecting device to measure the expression level of the probe. The detecting device comprises any suitable detecting device known in the art that can measure the detectable signal exhibited by the probe (i.e., expression level of the probe). For example, in some aspects, the detecting device can comprise any detector capable of reading fluorescence wavelength values (e.g., microplate-reader as used in Example 2). [0229] As is apparent from the present disclosure, in some aspects, the diagnostic systems described herein can be used as part of a companion diagnostic. As used herein, the term "companion diagnostic" refers to a diagnostic method or diagnostic system that can be used to determine the safe and effective use of a therapeutic agent (e.g., miRNA inhibitors described herein). In some aspects, a companion diagnostic is used to customize dosage of a therapeutic agent (e.g., miRNA inhibitors described herein) for a given subject, identify appropriate subpopulations for treatment, and/or identify populations who should not receive a particular treatment because of an increased risk of a serious side effect. [0230] Accordingly, in some aspects, if a subject is determined to have an elevated miRNA level compared to a reference (e.g., subject who is not afflicted with a disease or disorder described herein) using the methods and diagnostic systems described herein, the subject receives a treatment described herein (e.g., miRNA inhibitor). [0231] Where the subject had previously received at least one dose of a treatment (e.g., miRNA inhibitor), the treatment regimen can be adjusted or maintained depending on the subject's miRNA level (which can be determined using the methods and diagnostic systems described herein) after the treatment. For instance, in some aspects, if the miRNA level is elevated compared to a corresponding level in the subject prior to the treatment, the treatment regimen is adjusted. In such aspects, adjusting the treatment regimen can comprise (i) administering a higher dose of the treatment to the subject; (ii) administering the treatment (at the same dose or different dose) to the subject more frequently; (iii) administering a different treatment to the subject (alone or in combination with the original treatment); or (iv) any combination of (i), (ii), and (iii). In some aspects, if the miRNA level is determined to be reduced compared to a corresponding level in the subject prior to the treatment, the treatment regimen for the subject is maintained or stopped. In some aspects, if the miRNA level is determined to be the same (or ± within a standard error), the treatment regimen for the subject is adjusted or maintained. In such aspects, adjusting the treatment regimen can comprise (i) administering a higher dose of the treatment to the subject; (ii) administering the treatment (at the same dose or different dose) to the subject more frequently; (iii) administering a different treatment to the subject (alone or in combination with the original treatment); or (iv) any combination of (i), (ii), and (iii). V. Vectors and Delivery Systems [0232] As described herein, in some aspects, a subject identified as being afflicted with a disease or disorder using the methods and diagnostic systems described herein receives a treatment, which is suitable for treating the disease or disorder. In some aspects, the treatment comprises a miRNA inhibitor (e.g., miR-485-3p inhibitor). In some aspects, the treatment can be administered to the subject using any suitable delivery system known in the art. In some aspects, the delivery system is a vector. Accordingly, in some aspects, the present disclosure provides a vector comprising a miRNA inhibitor described herein. [0233] In some aspects, the vector is viral vector. In some aspects, the viral vector is an adenoviral vector or an adeno-associated viral vector. In some aspects, the viral vector is an AAV that has a serotype of AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, or any combination thereof. In some aspects, the adenoviral vector is a third generation adenoviral vector. ADEASY™ is by far the most popular method for creating adenoviral vector constructs. The system consists of two types of plasmids: shuttle (or transfer) vectors and adenoviral vectors. The transgene of interest is cloned into the shuttle vector, verified, and linearized with the restriction enzyme PmeI. This construct is then transformed into ADEASIER-1 cells, which are BJ5183 E. coli cells containing PADEASY™. PADEASY™ is a ∼33Kb adenoviral plasmid containing the adenoviral genes necessary for virus production. The shuttle vector and the adenoviral plasmid have matching left and right homology arms which facilitate homologous recombination of the transgene into the adenoviral plasmid. One can also co-transform standard BJ5183 with supercoiled PADEASY™ and the shuttle vector, but this method results in a higher background of non-recombinant adenoviral plasmids. Recombinant adenoviral plasmids are then verified for size and proper restriction digest patterns to determine that the transgene has been inserted into the adenoviral plasmid, and that other patterns of recombination have not occurred. Once verified, the recombinant plasmid is linearized with PacI to create a linear dsDNA construct flanked by ITRs.293 or 911 cells are transfected with the linearized construct, and virus can be harvested about 7-10 days later. In addition to this method, other methods for creating adenoviral vector constructs known in the art at the time the present application was filed can be used to practice the methods disclosed herein. [0234] In some aspects, the viral vector is a retroviral vector, e.g., a lentiviral vector (e.g., a third or fourth generation lentiviral vector). Lentiviral vectors are usually created in a transient transfection system in which a cell line is transfected with three separate plasmid expression systems. These include the transfer vector plasmid (portions of the HIV provirus), the packaging plasmid or construct, and a plasmid with the heterologous envelop gene (env) of a different virus. The three plasmid components of the vector are put into a packaging cell which is then inserted into the HIV shell. The virus portions of the vector contain insert sequences so that the virus cannot replicate inside the cell system. Current third generation lentiviral vectors encode only three of the nine HIV-1 proteins (Gag, Pol, Rev), which are expressed from separate plasmids to avoid recombination-mediated generation of a replication- competent virus. In fourth generation lentiviral vectors, the retroviral genome has been further reduced (see, e.g., TAKARA ® LENTI-X™ fourth-generation packaging systems). [0235] Any AAV vector known in the art can be used in the methods disclosed herein. The AAV vector can comprise a known vector or can comprise a variant, fragment, or fusion thereof. In some aspects, the AAV vector is selected from the group consisting of AAV type 1 (AAV1), AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, bovine AAV, shrimp AAV, snake AAV, and any combination thereof. [0236] In some aspects, the AAV vector is derived from an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof. [0237] In some aspects, the AAV vector is a chimeric vector derived from at least two AAV vectors selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof. [0238] In some aspects, the AAV vector comprises regions of at least two different AAV vectors known in the art. [0239] In some aspects, the AAV vector comprises an inverted terminal repeat from a first AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, or any derivative thereof) and a second inverted terminal repeat from a second AAV (e.g., AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, or any derivative thereof). [0240] In some aspects, the AAV vector comprises a portion of an AAV vector selected from the group consisting of AAV1, AAV2, AAV3A, AAV3B, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, AAV10, AAV11, AAV12, AAV13, AAVrh.74, avian AAV, bovine AAV, canine AAV, equine AAV, goat AAV, primate AAV, non-primate AAV, ovine AAV, shrimp AAV, snake AAV, and any combination thereof. In some aspects, the AAV vector comprises AAV2. [0241] In some aspects, the AAV vector comprises a splice acceptor site. In some aspects, the AAV vector comprises a promoter. Any promoter known in the art can be used in the AAV vector of the present disclosure. In some aspects, the promoter is an RNA Pol III promoter. In some aspects, the RNA Pol III promoter is selected from the group consisting of the U6 promoter, the H1 promoter, the 7SK promoter, the 5S promoter, the adenovirus 2 (Ad2) VAI promoter, and any combination thereof. In some aspects, the promoter is a cytomegalovirus immediate-early gene (CMV) promoter, an EF1a promoter, an SV40 promoter, a PGK1 promoter, a Ubc promoter, a human beta actin promoter, a CAG promoter, a TRE promoter, a UAS promoter, a Ac5 promoter, a polyhedrin promoter, a CaMKIIa promoter, a GAL1 promoter, a GAL10 promoter, a TEF promoter, a GDS promoter, a ADH1 promoter, a CaMV35S promoter, or a Ubi promoter. In some aspects, the promoter comprises the U6 promoter. [0242] In some aspects, the AAV vector comprises a constitutively active promoter (constitutive promoter). In some aspects, the constitutive promoter is selected from the group consisting of hypoxanthine phosphoribosyl transferase (HPRT), adenosine deaminase, pyruvate kinase, beta-actin promoter, cytomegalovirus (CMV), simian virus (e.g., SV40), papilloma virus, adenovirus, human immunodeficiency virus (HIV), Rous sarcoma virus, a retrovirus long terminal repeat (LTR), Murine stem cell virus (MSCV) and the thymidine kinase promoter of herpes simplex virus. [0243] In some aspects, the promoter is an inducible promoter. In some aspects, the inducible promoter is a tissue specific promoter. In some aspects, the tissue specific promoter drives transcription of the coding region of the AAV vector in a neuron, a glial cell, or in both a neuron and a glial cell. [0244] In some aspects, the AAV vector comprises one or more enhancers. In some aspects, the one or more enhancer are present in the AAV alone or together with a promoter disclosed herein. In some aspects, the AAV vector comprises a 3'-UTR poly(A) tail sequence. In some aspects, the 3'-UTR poly(A) tail sequence is selected from the group consisting of bGH poly(A), actin poly(A), hemoglobin poly(A), and any combination thereof. In some aspects, the 3'-UTR poly(A) tail sequence comprises bGH poly(A). [0245] In some aspects, a miRNA inhibitor (e.g., miR-485-3p inhibitor) disclosed herein is administered with a delivery agent. Non-limiting examples of delivery agents that can be used include a lipidoid, a liposome, a lipoplex, a lipid nanoparticle, an extracellular vesicle (e.g., exosome), a synthetic vesicle, a polymeric compound, a peptide, a protein, a cell, a nanoparticle mimic, a nanotube, a micelle, a viral vector, a conjugate, or combinations thereof. V.A. Carrier Units [0246] Thus, in some aspects, the present disclosure also provides a composition comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) and a delivery agent. In some aspects, the delivery agent comprises a carrier unit, e.g., that can self- assemble into micelles or be incorporated into micelles. Therefore, the present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (i.e., miR-485-3p inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other. In some aspects, a miR-485-3p inhibitor provided herein can be administered (e.g., to a subject suffering from a disease or disorder based on the diagnosis described herein) using a carrier unit. As described herein, in some aspects, carrier units of the present disclosure comprise a water-soluble biopolymer moiety (e.g., PEG), a charged carrier moiety, a crosslinking moiety, and an adjuvant moiety. In some aspects, the charged carrier moiety is cationic (e.g., a polylysine). The resulting carrier unit:payload (i.e., miR-485-3p inhibitor) complex can have a "head" comprising the water-soluble biopolymer moiety and a "tail" comprising the cationic carrier moiety electrostatically bound to the payload. Additional aspects of carrier units (e.g., cationic carrier units) useful for the present disclosure are provided further below and also described in, e.g., WO2022144811A1 and WO2022144812A1, each of which is incorporated herein by reference in its entirety. [0247] Carrier unit:payload complexes can self-associate, alone or in combination with other molecules, to yield micelles in which the payload (i.e., miR-485-3p inhibitor) is located in the core of the micelle and the water-soluble biopolymer moiety is facing the solvent. The term "micelles of the present disclosure" encompasses not only classic micelles but also small particles, small micelles, micelles, rod-like structures, or polymersomes. Given that polymersomes comprise a luminal space, it is to be understood that all the disclosures related to the "core" of classic micelles are equally applicable to the luminal space in polymersomes comprising carrier units of the present disclosure. [0248] The carrier units of the present disclosure can also comprise a targeting moiety (e.g., a targeting ligand) covalently linked to the water-soluble biopolymer moiety via one or more optional linkers. Non-limiting examples of targeting moieties are provided elsewhere in the present disclosure. Once a micelle is formed, the targeting moiety can be located on the surface of the micelle and can deliver the micelle to a specific target tissue, to a specific cell type, and/or facilitate transport across a physiological barrier (e.g., cell plasma membrane). In some aspects, the micelles of the present disclosure can comprises more than one type of targeting moieties. [0249] The carrier units of the present disclosure can also comprise an adjuvant moiety (AM) covalently linked to the charged cationic carrier moiety. The adjuvant moiety can have, e.g., a therapeutic, a co-therapeutic effect, or positively affect the homeostasis of the target cell or target tissue. In some aspects, the AM comprises one or more amino acids. In some aspects, the AM comprises one or more amino acids linked to an adjuvant molecule (e.g., a vitamin). In some aspects, the AM comprises one or more lysine residues covalently bound to an adjuvant molecule (e.g., a vitamin). Adjuvant moiety (AM) can also be referred to as a hydrophobic moiety (HM). [0250] In some aspects, the delivery agent comprises a cationic carrier unit comprising [WP]-L1-[CC]-L2-[AM] (formula I) or [WP]-L1-[AM]-L2-[CC] (formula II) wherein WP is a water-soluble biopolymer moiety; CC is a positively charged (i.e., cationic) carrier moiety; AM is an adjuvant moiety; and, L1 and L2 are independently optional linkers, and wherein when mixed with a nucleic acid at an ionic ratio of about 1:1, the cationic carrier unit forms a micelle. Accordingly, in some aspects, the miRNA inhibitor and the cationic carrier unit are capable of associating with each other (e.g., via a covalent bond or a non-covalent bond) to form a micelle when mixed together. [0251] In some aspects, a delivery agent useful for the present disclosure comprises cationic carrier units of Schema I through Schema VI: [CC]-L1-[CM]-L2-[AM] (Schema I); [CC]-L1-[AM]-L2-[CM] (Schema II); [AM]-L1-[CM]-L2-[CC] (Schema III); [AM]-L1-[CC]-L2-[CM] (Schema IV); [CM]-L1-[CC]-L2-[AM] (Schema V); or [CM]-L1-[AM]-L2-[CC] (Schema VI); wherein CC is a cationic carrier moiety, e.g., a polylysine; CM is a crosslinking moiety; AM is an adjuvant moiety, e.g., vitamin, e.g., vitamin B3; and, L1 and L2 are independently optional linkers. [0252] In some aspects, the cationic carrier unit further comprises a water-soluble polymer (WP). In some aspects, the water-soluble polymer is attached to [CC], [AM], and/or [CM]. In some aspects, the water-soluble polymer is attached to the N terminus of [CC], [AM], or [CM]. In some aspects, the water-soluble polymer is attached to the N terminus of [CC]. In some aspects, the water-soluble polymer is attached to the C terminus of [CC], [AM], or [CM]. In some aspects, the water-soluble polymer is attached to the C terminus of [CC]. [0253] In some aspects, the cationic carrier unit comprises: [WP]-L3-[CC]-L1-[CM]-L2-[AM] (Schema I’); [WP]-L3-[CC]-L1-[AM]-L2-[CM] (Schema II’); [WP]-L3-[AM]-L1-[CM]-L2-[CC] (Schema III’); [WP]-L3-[AM]-L1-[CC]-L2-[CM] (Schema IV’); [WP]-L3-[CM]-L1-[CC]-L2-[AM] (Schema V’); or [WP]-L3-[CM]-L1-[AM]-L2-[CC] (Schema VI’). [0254] In some aspects of the constructs of Schema I’ to VI’ shown above, the [WP] component can be connected to at least one targeting moiety, i.e., [T] n -[WP]-… wherein n is an integer, e.g., 1, 2 or 3. [0255] In some aspects, the carrier unit can comprise the CC, CM, and AM moieties in a linear fashion. In some aspects, the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety. Non-limiting examples of such carrier units are illustrated in WO2022219606A1, which is incorporated herein by reference in its entirety. [0256] In some aspects, the carrier units can comprises the CC, CM, and AM moieties organized in a branched scaffold arrangement, for example, with (i) a polymeric CC moiety comprising positively charged units (e.g., polylysines) and (ii) a CMs (e.g., lysine linked to a crosslinking agent, e.g., lysine-thiol) attached to the N or C terminus of the CC moiety and (iii) a AM (e.g., lysine linked to an adjuvant agent, e.g., lysine linked to Vitamin B3) attached to the N or C terminus of the CM moiety. [0257] When cationic carrier units of the present disclosure are mixed with an anionic payload (e.g., a nucleic acid) at an ionic ratio of about 20:1, i.e., the number of negative charges in the anionic payload is about 20 times higher than the number of positive charges in the cationic carrier moiety, to about 20:1, i.e., the number of positive charges in the cationic carrier moiety is about ten times higher than the number of negative charges in the anionic payload, the neutralization of negative charges in the anionic payload by positive charges in the cationic carrier moiety mainly via electrostatic interaction leads to the formation of a cationic carrier unit:anionic payload complex having an unaltered hydrophilic portion (comprising the WP moiety) and a substantially more hydrophobic portion (resulting from the association between the cationic carrier moiety plus hydrophobic moiety and the anionic payload). [0258] In some aspects, the adjuvant moiety can contribute its own positive charges to the positive charges of the cationic carrier moiety, which would interact with the negative charges of the anionic payload (e.g., polynucleotides disclosed herein). It is to be understood that references to the interactions (e.g., electrostatic interactions) between a cationic carrier moiety and an anionic payload (e.g., polynucleotides disclosed herein) also encompass interactions between the charges of a cationic carrier moiety plus adjuvant moiety and the charges of an anionic payload. [0259] The increase in the hydrophobicity of the cationic carrier moiety of the cationic carrier unit due to the neutralization of its positive charges via electrostatic interaction with the negative charges of the anionic payload results in an amphipathic complex. Such amphipathic complexes can self-organize, alone or combination with other amphipathic components, into micelles. The resulting micelles comprise the WP moieties facing the solvent (i.e., the WP moieties are facing the external surface of the micelle), whereas the CC and AM moieties as well as the associate payload (e.g., a nucleotide sequence, e.g., RNA, DNA, or any combination thereof) are in the core of the micelle. [0260] In some aspects, the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. In some aspects, the composition comprises a water-soluble biopolymer moiety with about 100 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 100 lysines (e.g., about 80 lysines), and an adjuvant moiety with about 5 to about 50 vitamin B3 (e.g., about 35 vitamin B3). [0261] In some aspects, the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3). In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer. In some aspects, the thiol groups in the composition form disulfide bonds. In some aspects, the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 1 to about 20 lysines, each having a thiol group (e.g., about 5 lysines, each with a thiol group), and (iv) about 5 to 50 lysines fused to vitamin B3 (e.g., about 35 lysines, each fused to vitamin B3). In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer. In some aspects, the thiol groups in the composition form disulfide bonds. [0262] In some aspects, the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miR-485 inhibitor (e.g., SEQ ID NO: 30), wherein the miR-485 inhibitor is encapsulated within the micelle. In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units. In some aspects, the thiol groups in the micelle form disulfide bonds. In some aspects, the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units (e.g., about 114 units), (ii) about 30 to about 100 lysines with an amine group (e.g., about 40 lysines), (iii) about 3 to about 50 lysines, each having a thiol group (e.g., about 35 lysines, each with a thiol group), and (iv) about 2 to about 20 lysines fused to vitamin B3 (e.g., about 5 lysines, each fused to vitamin B3), and (2) an isolated polynucleotide described herein (e.g., miR-485 inhibitor), wherein the isolated polynucleotide is encapsulated within the micelle. In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units. In some aspects, the thiol groups in the micelle form disulfide bonds. [0263] In some aspects, the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethylenimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 20 lysines, each of which is linked to a vitamin B3 unit. [0264] In some aspects, the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 10 lysines, each of which is linked to a vitamin B3 unit. [0265] In some aspects, the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n wherein n is between about 30 and about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 5 to about 10 lysines, each of which is linked to a vitamin B3 unit. [0266] In some aspects, the cationic carrier unit comprises: (a) a WP moiety, wherein the water-soluble biopolymer is a polyethylene glycol (PEG) of formula III (see below), wherein n is between about 120 to about PEG 130 (e.g., PEG is a PEG5000 or a PEG6000); (b) a CC moiety, wherein the cationic carrier moiety comprises, e.g., about 20 to about 100 lysines (e.g., a linear poly(L-lysine)n, wherein n is between about 30 and about 40, e.g., about 40), a polyethyleneimine (PEI), or chitosan; (c) a CM moiety, wherein the crosslinking moiety comprises about 10 to about 50 lysines, each of which is linked to a crosslinking agent, e.g., 10-40 lysine-thiol, e.g., 35 lysine-thiol, and (d) an AM moiety, wherein the adjuvant moiety has about 1 to about 5 lysines, each of which is linked to a vitamin B3 unit. [0267] In some aspects, the cationic carrier unit further comprises at least one targeting moiety attached to the WP moiety of the cationic carrier unit. In some aspects, the number and/or density of targeting moieties displayed on the surface of the micelle can be modulated by using a specific ratio of cationic carrier units having targeting moieties to cationic carrier units not having targeting moieties. In some aspects, the ratio of cationic carrier units having a targeting moiety to cationic carrier units not having a targeting moiety is at least about 1:5, at least about 1:10, at least about 1:20, at least about 1:30, at least about 1:40, at least about 1:50, at least about 1:60, at least about 1:70, at least about 1:80, at least about 1:90, at least about 1:100, at least about 1:120, at least about 1:140, at least about 1:160, at least about 1:180, at least about 1:200, at least about 1:250, at least about 1:300, at least about 1:350, at least about 1:400, at least about 1:450, at least about 1:500, at least about 1:600, at least about 1:700, at least about 1:800, at least about 1:900, or at least about 1:1000. [0268] In some aspects, the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water soluble polymer which is PEG, (iii) a cationic carrier moiety comprising cationic polymer blocks which are lysine (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (v) an adjuvant moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3. [0269] In some aspects, the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water soluble polymer which is PEG, wherein n= 100 – 200, e.g., 100 – 150, e.g., 120- 130, (iii) a cationic carrier moiety comprising cationic polymer blocks, e.g., polylysine, (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (iv) an adjuvant moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3. [0270] In some aspects, the cationic carrier unit comprises (i) a targeting moiety (A) which targets the transporter LAT1 (e.g., phenylalanine), (ii) a water soluble polymer which is PEG, wherein n= 100 – 200, e.g., 100 – 150, e.g., 120- 130, (iii) a cationic carrier moiety comprising cationic polymer blocks, e.g., 10-100 lysines, e.g., 10-50 lysines, e.g., 30-40 lysines, (iv) a crosslinking moiety comprising crosslinking polymer blocks which are lysines linked to crosslinking moieties, and (iv) an adjuvant moiety comprising hydrophobic polymer blocks which are lysines linked to vitamin B3. [0271] In some aspects, the vitamin B3 unit are introduced into the side chains of the AM moiety, e.g., by a coupling reaction between NH 2 groups in the lysines and COOH groups of vitamin B3, in the presence of suitable conjugation reagents, for example, 1-ethyl-3-(3- dimethylaminopropyl)-carbodiimide (EDC) and N-hydroxy succinimide (NHS). [0272] The present disclosure provides composition comprising a carrier unit (e.g., a cationic carrier unit) of the present disclosure. In some aspects, the present disclosure provides complexes comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure non-covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically. In some aspects, the present disclosure provides conjugates comprising a carrier unit (e.g., a cationic carrier unit unit) of the present disclosure covalently attached to a payload (e.g., an anionic payload such a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), wherein the carrier unit and the payload interact electrostatically. In some aspects, the carrier unit and the payload can be linked via a cleavable linker. In some aspects, the carrier unit and the payload, in addition to interacting electrostatically, can interact covalently (e.g., after electrostatic interaction the carrier unit and the payload can be "locked" via a disulfide bond or a cleavable bond). [0273] In some aspects, the association is a covalent bond, a non-covalent bond, or an ionic bond. In some aspects, the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miR-485 inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miR-485 inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1. In some aspects, the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (i.e., miR-485 inhibitor) from enzymatic degradation. See PCT Publication No. WO2020/261227, which is herein incorporated by reference in its entirety. [0274] In some aspects, the cationic carrier unit comprises a water-soluble polymer comprising a PEG with about 100 to about 130 units (e.g., about 114 units), a cationic carrier moiety comprising a polylysine with about 20 to about 60 lysine units, (e.g., about 40 lysines) a crosslinking moiety comprising about 3 to about 40 lysine-thiol units (e.g., about 35 lysines, each with a thiol group), and an adjuvant moiety comprising about 1 to about 50 lysines linked to a vitamin B3 units (e.g., about 5 lysines, each fused to vitamin B3). [0275] In some aspects, composition comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) interacts with the cationic carrier unit via an ionic bond. For instance, in some aspects, the cationic carrier unit is associated with a negatively charged payload (e.g., a nucleotide sequence, e.g., an RNA, DNA, or any combination thereof), which interacts with the cationic carrier unit via at least one ionic bond (i.e., via electrostatic interaction) with the cationic carrier moiety of the cationic carrier unit. V.B. Water-Soluble Biopolymer Moiety [0276] As described herein, a cationic carrier unit that be used in delivering a miR-485 inhibitor (e.g., to a subject suffering from an age-associated disease or condition) comprises a water-soluble biopolymer moiety. The term "water-soluble biopolymer" as used herein refers to a biocompatible, biologically inert, non-immunogenic, non-toxic, and hydrophilic polymer, e.g., PEG. [0277] In some aspects, the water-soluble polymer comprises poly(alkylene glycols), poly(oxyethylated polyol), poly(olefinic alcohol), poly(vinylpyrrolidone), poly(hydroxyalkylmethacrylamide), poly(hydroxyalkylmethacrylate), poly(saccharides), poly(α-hydroxy acid), poly(vinyl alcohol), polyglycerol, polyphosphazene, polyoxazolines ("POZ") poly(N-acryloylmorpholine), or any combinations thereof. In some aspects, the water- soluble polymer comprises polyethylene glycol ("PEG"), polyglycerol, or poly(propylene glycol) ("PPG"). In some aspects, the water-soluble polymer comprises: , (formula III), wherein n is 1-1000. [0278] In some aspects, the n of the water-soluble polymer (e.g., PEG) has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. [0279] In some aspects, n is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990, or about 1000. [0280] In some aspects, n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165. [0281] In some aspects, the n is at least about 110, at least about 111, at least about 112, at least about 113, at least about 114, at least about 115, at least about 116, at least about 117, at least about 118, at least about 119, at least about 120, at least about 121, at least about 122, at least about 123, at least about 124, at least about 125, at least about 126, at least about 127, at least about 128, at least about 129, at least about 130, at least about 131, at least about 132, at least about 133, at least about 134, at least about 135, at least about 136, at least about 137, at least about 138, at least about 139, at least about 140, or at least about 141. In some aspects, the n is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 140 to about 150, about 150 to about 160. [0282] As described herein, in some aspects, the water-soluble polymer moiety is PEG. In some aspects, the PEG is a branched PEG. In some aspects, the PEG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPEG) is a PEG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography. In certain formulae, a monodisperse PEG moiety is assigned the abbreviation mdPEG. [0283] In some aspects, the PEG is a Star PEG. Star PEGs have 10 to 100 PEG chains emanating from a central core group. In some aspects, the PEG is a Comb PEGs. Comb PEGs have multiple PEG chains normally grafted onto a polymer backbone. [0284] In some aspects, the PEG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol. [0285] In some aspects, the PEG is PEG 100 , PEG 200 , PEG 300 , PEG 400 , PEG 500 , PEG 600 , PEG 700 , PEG 800 , PEG 900 , PEG 1000 , PEG 1100 , PEG 1200 , PEG 1300 , PEG 1400 , PEG 1500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 1600 , PEG 1700 , PEG 1800 , PEG 1900 , PEG 2000 , PEG 2100 , PEG 2200 , PEG 2300 , PEG 2400 , PEG 2500 , PEG 2600 , PEG 2700 , PEG 2800 , PEG 2900 , PEG 3000 , PEG 3100 , PEG 3200 , PEG 3300 , PEG 3400 , PEG 3500 , PEG 3600 , PEG 3700 , PEG 3800 , PEG 3900 , PEG 4000 , PEG 4100 , PEG 4200 , PEG 4300 , PEG 4400 , PEG 4500 , PEG 4600 , PEG 4700 , PEG 4800 , PEG 4900 , PEG 5000 , PEG 5100 , PEG 5200 , PEG 5300 , PEG 5400 , PEG 5500 , PEG 5600 , PEG 5700 , PEG 5800 , PEG 5900 , PEG 6000 , PEG 6100 , PEG 6200 , PEG 6300 , PEG 6400 , PEG 6500 , PEG 6600 , PEG 6700 , PEG 6800 , PEG 6900 , PEG 7000 , PEG 7100 , PEG 7200 , PEG 7300 , PEG 7400 , PEG 7500 , PEG 7600 , PEG 7700 , PEG 7800 , PEG 7900 , or PEG 8000 . In some aspects, the PEG is PEG5000. In some aspects, the PEG is PEG 6000 . In some aspects, the PEG is PEG 4000 . [0286] In some aspects, the PEG is monodisperse. [0287] In some aspects, the water-soluble biopolymer moiety is a polyglycerol (PG) described by the formula ((R 3 —O—(CH 2 —CHOH—CH 2 O) n —) with R 3 being hydrogen, methyl or ethyl, and n having a value from 3 to 200. In some aspects, the water-soluble biopolymer moiety is a branched polyglycerol described by the formula (R 3 —O—(CH 2 — CHOR 5 —CH 2 —O) n —) with R 5 being hydrogen or a linear glycerol chain described by the formula (R 3 —O—(CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl. In some aspects, the water-soluble biopolymer moiety is a hyperbranched polyglycerol described by the formula (R 3 —O—(CH 2 —CHOR 5 —CH 2 —O) n —) with R 5 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 6 —CH 2 —O) n —), with R 6 being hydrogen or a glycerol chain described by the formula (R 3 —O—(CH 2 —CHOR 7 —CH 2 — O) n —), with R 7 being hydrogen or a linear glycerol chain described by the formula (R 3 —O— (CH 2 —CHOH—CH 2 —O) n —) and R 3 being hydrogen, methyl or ethyl. Hyperbranched glycerol and methods for its synthesis are described in Oudshorn et al. (2006) Biomaterials 27:5471-5479; Wilms et al. (20100 Acc. Chem. Res.43, 129-41, and references cited therein. [0288] In some aspects, the PG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol. [0289] In some aspects, the PG is PG 100 , PG 200 , PG 300 , PG 400 , PG 500 , PG 600 , PG 700 , PG 800 , PG 900 , PG 1000 , PG 1100 , PG 1200 , PG 1300 , PG 1400 , PG 1500 , PG 1600 , PG 1700 , PG 1800 , PG 1900 , PG 2000 , PG 2100 , PG 2200 , PG 2300 , PG 2400 , PG 2500 , PG 1600 , PG 1700 , PG 1800 , PG 1900 , PG 2000 , PG 2100 , PG 2200 , PG 2300 , PG 2400 , PG 2500 , PG 2600 , PG 2700 , PG 2800 , PG 2900 , PG 3000 , PG 3100 , PG 3200 , PG 3300 , PG 3400 , PG 3500 , PG 3600 , PG 3700 , PG 3800 , PG 3900 , PG 4000 , PG 4100 , PG 4200 , PG 4300 , PG 4400 , PG 4500 , PG 4600 , PG 4700 , PG 4800 , PG 4900 , PG 5000 , PG 5100 , PG 5200 , PG 5300 , PG 5400 , PG 5500 , PG 5600 , PG 5700 , PG 5800 , PG 5900 , PG 6000 , PG 6100 , PG 6200 , PG 6300 , PG 6400 , PG 6500 , PG 6600 , PG 6700 , PG 6800 , PG 6900 , PG 7000 , PG 7100 , PG 7200 , PG 7300 , PG 7400 , PG 7500 , PG 7600 , PG 7700 , PG 7800 , PG 7900 , or PG 8000. In some aspects, the PG is PG 5000. In some aspects, the PG is PG 6000 . In some aspects, the PG is PG 4000 . [0290] In some aspects, the PG is monodisperse. [0291] In some aspects, the water-soluble biopolymer comprises poly(propylene glycol) ("PPG"). In some aspects, PPG is characterized by the following formula, with n having a value from 1 to 1000. [0292] In some aspects, the n of the PPG has a value of 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17,18,19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54, 55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, 80, 81, 82, 83, 84, 85, 86, 87, 88, 89, 90, 91, 92, 93, 94, 95, 96, 97, 98, 99, 100, 101, 102, 103, 104, 105, 106, 107, 108, 109, 110, 111, 112, 113, 114, 115, 116, 117, 118, 119, 120, 121, 122, 123, 124, 125, 126, 127, 128, 129, 130, 131, 132, 133, 134, 135, 136, 137, 138, 139, 140, 141, 142, 143, 144, 145, 146, 147, 148, 149, 150, 151, 152, 153, 154, 155, 156, 157, 158, 159, 160, 161, 162, 163, 164, 165, 166, 167, 168, 169, 170, 171, 172, 173, 174, 175, 176, 177, 178, 179, 189, 181, 182, 183, 184, 185, 186, 187, 188, 189, 190, 191, 192, 193, 194, 195, 196, 197, 198, 199, or 200. [0293] In some aspects, n of the PPG is at least about 10, at least about 20, at least about 30, at least about 40, at least about 50, at least about 60, at least about 70, at least about 80, at least about 90, at least about 100, at least about 110, at least 120, at least about 130, at least about 140, at least about 150, at least about 160, at least about 170, at least about 180, at least about 190, at least about 200, at least about 210, at least about 220, at least about 230, at least about 240, at least about 250, at least about 260, at least about 270, at least about 280, at least about 290, at least about 300, at least about 310, at least about 320, at least about 330, at least about 340, at least about 350, at least about 360, at least about 370, at least about 380, at least about 390, at least about 400, at least about 410, at least about 420, at least about 430, at least about 440, at least about 450, at least about 460, at least about 470, at least about 480, at least about 490, at least about 500, at least about 510, at least about 520, at least about 530, at least about 540, at least about 550, at least about 560, at least about 670, at least about 580, at least about 590, at least about 600, at least about 610, at least about 620, at least about 630, at least about 640, at least about 650, at least about 660, at least about 670, at least about 680, at least about 690, at least about 700, at least about 710, at least about 720, at least about 730, at least about 740, at least about 750, at least about 760, at least about 770, at least about 780, at least about 790, at least about 800, at least about 810, at least about 820, at least about 830, at least about 840, at least about 850, at least about 860, at least about 870, at least about 880, at least about 890, at least about 900, at least about 910, at least about 920, at least about 930, at least about 940, at least about 950, at least about 960, at least about 970, at least about 980, at least about 990, or about 1000. [0294] In some aspects, the n of the PPG is about 80 to about 90, about 90 to about 100, about 100 to about 110, about 110 to about 120, about 120 to about 130, about 130 to about 140, about 140 to about 150, about 150 to about 160, about 85 to about 95, about 95 to about 105, about 105 to about 115, about 115 to about 125, about 125 to about 135, about 135 to about 145, about 145 to about 155, about 155 to about 165, about 80 to about 100, about 100 to about 120, about 120 to about 140, about 140 to about 160, about 85 to about 105, about 105 to about 125, about 125 to about 145, or about 145 to about 165. [0295] In some aspects, the PPG is a branched PPG. Branched PPGs have three to ten PPG chains emanating from a central core group. In some aspects, the PPG moiety is a monodisperse polyethylene glycol. In the context of the present disclosure, a monodisperse polyethylene glycol (mdPPG) is a PPG that has a single, defined chain length and molecular weight. mdPEGs are typically generated by separation from the polymerization mixture by chromatography. In certain formulae, a monodisperse PPG moiety is assigned the abbreviation mdPPG. [0296] In some aspects, the PPG is a Star PPG. Star PPGs have 10 to 100 PPG chains emanating from a central core group. In some aspects, the PPG is a Comb PPGs. Comb PPGs have multiple PPG chains normally grafted onto a polymer backbone. [0297] In some aspects, the PPG has a molar mass between about 1000 g/mol and about 2000 g/mol, between about 2000 g/mol and about 3000 g/mol, between about 3000 g/mol to about 4000 g/mol, between about 4000 g/mol and about 5000 g/mol, between about 5000 g/mol and about 6000 g/mol, between about 6000 g/mol and about 7000 g/mol, or between 7000 g/mol and about 8000 g/mol. [0298] In some aspects, the PPG is PPG 100 , PPG 200 , PPG 300 , PPG 400 , PPG 500 , PPG 600 , PPG 700 , PPG 800 , PPG 900 , PPG 1000 , PPG 1100 , PPG 1200 , PPG 1300 , PPG 1400 , PPG 1500 , PPG 1600 , PPG 1700 , PPG 1800 , PPG 1900 , PPG 2000 , PPG 2100 , PPG 2200 , PPG 2300 , PPG 2400 , PPG 2500 , PPG 1600 , PPG 1700 , PPG 1800 , PPG 1900 , PPG 2000 , PPG 2100 , PPG 2200 , PPG 2300 , PPG 2400 , PPG 2500 , PPG 2600 , PPG 2700 , PPG 2800 , PPG 2900 , PPG 3000 , PPG 3100 , PPG 3200 , PPG 3300 , PPG 3400 , PPG 3500 , PPG 3600 , PPG 3700 , PPG 3800 , PPG 3900 , PPG 4000 , PPG 4100 , PPG 4200 , PPG 4300 , PPG 4400 , PPG 4500 , PPG 4600 , PPG 4700 , PPG 4800 , PPG 4900 , PPG 5000 , PPG 5100 , PPG 5200 , PPG 5300 , PPG 5400 , PPG 5500 , PPG 5600 , PPG 5700 , PPG 5800 , PPG 5900, PPG 6000, PPG 6100, PPG 6200, PPG 6300, PPG 6400, PPG 6500, PPG 6600, PPG 6700, PPG 6800, PPG 6900, PPG 7000, PPG 7100, PPG 7200, PPG 7300, PPG 7400, PPG 7500, PPG 7600, PPG 7700, PPG 7800, PPG 7900, or PPG 8000. In some aspects, the PPG is PPG 5000 . In some aspects, the PPG is PPG 6000 . In some aspects, the PPG is PPG4000. [0299] In some aspects, the PPG is monodisperse. [0300] In some aspects, the water-soluble polymer is linear, branched, or dendritic. V.C. Cationic Carrier [0301] As is apparent from the present disclosure, in some aspects, a cationic carrier unit useful for the present disclosure comprises a cationic carrier moiety. The term "cationic carrier" refers to a moiety or portion of a cationic carrier unit of the present disclosure comprising a plurality of positive charges that can interact and bind electrostatically an anionic payload (or an anionic carrier attached to a payload). In some aspects, the number of positive charges or positively charged groups on the cationic carrier is similar to the number of negative charges or negatively charged groups on the anionic payload (or an anionic carrier attached to a payload). In some aspects, the cationic carrier comprises a biopolymer, e.g., a peptide (e.g., a polylysine). [0302] In some aspects, the cationic carrier moiety comprises one or more basic amino acids. In some aspects, the cationic carrier moiety comprises at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, or at least 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, at least 80, at least 81, at least 82, at least 83, at least 84, at least 85, at least 86, at least 87, at least 88, at least 89, at least 90, at least 91, at least 92, at least 93, at least 94, at least 95, at least 96, at least 97, at least 98, at least 99, or at least about 100. In some aspects, the cationic carrier moiety comprises about 30 to about 50 basic amino acids. In some aspects, the cationic carrier moiety comprises about 30 to about 40 basic amino acids. In some aspects, the cationic carrier moiety comprises about 60, about 70, about 80, about 90, or about 100 basic amino acids. In some aspects, the cationic carrier moiety comprises about 80 basic amino acids. In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the cationic carrier moiety comprises about 40 lysine monomers. [0303] In some aspects, the cationic carrier unit comprises at least about 40 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 45 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 50 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 55 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 60 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 65 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 70 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 75 basic amino acids, e.g., lysines. In some aspects, the cationic carrier unit comprises at least about 80 basic amino acids, e.g., lysines. [0304] In some aspects, the cationic carrier unit comprises about 100 to about 1000, about 100 to about 900, about 100 to about 800, about 100 to about 700, about 100 to about 600, about 100 to about 500, about 100 to about 400, about 100 to about 300, about 100 to about 200, about 200 to about 1000, about 200 to about 900, about 200 to about 800, about 200 to about 700, about 200 to about 600, about 200 to about 500, about 200 to about 400, about 200 to about 300, about 300 to about 1000, about 300 to about 900, about 300 to about 800, about 300 to about 700, about 300 to about 600, about 300 to about 500, about 300 to about 400, about 400 to about 1000, about 400 to about 900, about 400 to about 800, about 400 to about 700, about 400 to about 600, about 400 to about 500, about 500 to about 1000, about 500 to about 900, about 500 to about 800, about 500 to about 700, about 500 to about 600, about 600 to about 1000, about 600 to about 900, about 600 to about 800, about 600 to about 700, about 700 to about 1000, about 700 to about 900, about 700 to about 800, about 800 to about 1000, about 800 to about 900, or about 900 to about 1000 basic amino acids, e.g., lysines. [0305] In some aspects, the number of basic amino acids, e.g., lysine, arginine, histidine, or combinations thereof, can be adjusted based on the length of the anionic payload. For example, an anionic payload with a longer sequence can be paired with higher number of basic amino acids, e.g., lysines. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit can be calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is at least about 1, at least about 2, at least about 3, at least about 4, at least about 5, at least about 6, at least about 7, at least about 8, at least about 9, at least about 10, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20. In some aspects, the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is between about 1 to about 20, about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 10, e.g., about 3 to about 4, about 4 to about 5, about 5 to about 6, about 6 to about 7, or about 7 to about 8. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 1 to about 2. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 3 to about 4. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 2 to about 3. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 4 to about 5. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 5 to about 6. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 6 to about 7. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 7 to about 8. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 8 to about 9. In some aspects, the number of basic amino acids, e.g., lysines, in the cationic carrier unit is calculated so that the molar ratio of protonated amine in polymer to phosphate in an anionic payload, e.g., mRNA (N/P ratio) is about 9 to about 10. [0306] A person of skill in the art would understand that since a role of the cationic carrier moiety is to neutralize negative charges on the payload (e.g., negative changes in the phosphate backbone of an mRNA) via electrostatic interaction, in some aspects (e.g., when the payload is a nucleic acid such as an antimir), the length of the cationic carrier, number of positively charged groups on the cationic carrier, and distribution and orientation of charges present on the cationic carrier will depend on the length and charge distribution on the payload molecule. [0307] In some aspects, the basic amino acid comprises arginine, lysine, histidine, or any combination thereof. In some aspects, the basic amino acid is a D-amino acid. In some aspects, the basic amino acid is an L-amino acid. In some aspects, the positively charged carrier comprises D-amino acids and L-amino acids. In some aspects, the basic amino acid comprises at least one unnatural amino acid or a derivative thereof. In some aspects, the basic amino acid is arginine, lysine, histidine, L-4-aminomethyl-phenylalanine, L-4-guanidine-phenylalanine, L-4-aminomethyl-N-isopropyl-phenylalanine, L-3-pyridyl-alanine, L-trans-4- aminomethylcyclohexyl-alanine, L-4-piperidinyl-alanine, L-4-aminocyclohexyl-alanine, 4- guanidinobutyric acid, L-2-amino-3-guanidinopropionic acid, DL-5-hydroxylysine, pyrrolysine, 5-hydroxy-L-lysine, methyllysine, hypusine, or any combination thereof. [0308] In some aspects, the cationic carrier comprises a polymer or copolymer comprising at least three, at least four, at least five, at least six, at least seven, at least eight, at least nine, at least ten, at least 11, at least 12, at least 13, at least 14, at last 15, at least 16, at least 17, at least 18, at least 19, at least 20, at least 21, at least 22, at least 23, at least 24, at least 25, at least 26, at least 27, at least 28, at least 29, at least 30, at least 31, at least 32, at least 33, at least 34, at least 35, at least 36, at least 37, at least 38, at least 39, at least 40, at least 41, at least 42, at least 43, at least 44, at least 45, at least 46, at least 47, at least 48, at least 49, at least 50, at least 51, at least 52, at least 53, at least 54, at least 55, at least 56, at least 57, at least 58, at least 59, at least 60, at least 61, at least 62, at least 63, at least 64, at least 65, at least 66, at least 67, at least 68, at least 69, at least 70, at least 71, at least 72, at least 73, at least 74, at least 75, at least 76, at least 77, at least 78, at least 79, or at least 80 cationic groups (e.g., amino groups). In some aspects, the cationic carrier comprises a polymer or copolymer comprising between about 5 and about 10 cationic groups, between about 10 and about 15 cationic groups, between about 15 and about 20 cationic groups, between about 20 and about 25 cationic groups, between about 25 and about 30 cationic groups, between about 30 and about 35 cationic groups, between about 35 and about 40 cationic groups, between about 40 and about 45 cationic groups, between about 45 and about 50 cationic groups, between about 50 and about 55 cationic groups, between about 55 and about 60 cationic groups, between about 60 and about 65 cationic groups, between about 65 and about 70 cationic groups, between about 70 and about 75 cationic groups, or between about 45 and about 50 cationic groups (e.g., amino groups). In some aspects, the cationic carrier comprises a polymer or copolymer comprising between 30 and about 50 cationic groups (e.g., amino groups). In some aspects, the cationic carrier comprises a polymer or copolymer comprising between 70 and about 80 cationic groups (e.g., amino groups). In some aspects, the polymer or copolymer is an acrylate, a polyalcohol, or a polysaccharide. [0309] In some aspects, the cationic carrier moiety binds to a single payload molecule. In some aspects, a cationic carrier moiety can bind to multiple payload molecules, which can be identical or different. [0310] In some aspects, the positive charges of the cationic carrier moiety and negative charges of a nucleic acid payload are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1. In some aspects, the negative charges of a nucleic acid payload and the positive charges of the cationic carrier moiety are at an ionic ratio of about 20:1, about 19:1, about 18:1, about 17:1, about 16:1, about 15:1, about 14:1, about 13:1, about 12:1, about 11:1, about 10:1, about 9:1, about 8:1 about 7:1, about 6:1 about 5:1, about 4:1, about 3:1, about 2:1, or about 1:1. [0311] In some aspects, the anionic payload comprises a nucleotide sequence having about 10 to about 1000 (e.g., about 100 to about 1000) in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 2 to about 10, e.g., about 2 to about 9, about 2 to about 8, about 2 to about 7, about 2 to about 6, about 2 to about 5, about 2 to about 4, about 2 to about 3, e.g., e.g., about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10. In some aspects, an N/P ratio of the cationic carrier moiety and the anionic payload of about 10 to about 1000 nucleotides in length is between about 1 and about 10, e.g., about 1, about 2, about 3, about 4, about 5, about 6, about 7, about 8, about 9, or about 10. [0312] In some aspects, the anionic payload comprises a nucleotide sequence having about 1000 to about 2000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 12, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, or about 12. In some aspects, the N/P ratio of the cationic carrier moiety and the anionic payload is between about 4 and about 7, e.g., about 4, about 5, about 6, or about 7. [0313] In some aspects, the anionic payload comprises a nucleotide sequence having about 2000 to about 3000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 16, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16. In some aspects, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is between about 6 and about 9, e.g., about 6, about 7, about 8, or about 9. [0314] In some aspects, the anionic payload comprises a nucleotide sequence having about 3000 to about 4000 in length, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is about 3 to about 20, e.g., about 3, about 4, about 5, about 6, about 7, about 8, about 9, about 10, about 11, about 12, about 13, about 14, about 15, about 16, about 17, about 18, about 19, or about 20. In some aspects, wherein the N/P ratio of the cationic carrier moiety and the anionic payload is between about 7 and about 10, e.g., about 7, about 8, about 9, or about 10. [0315] In some aspects, the cationic carrier moiety has a free terminus wherein the end group is a reactive group. In some aspects, the cationic carrier moiety has a free terminus (e.g., the C-terminus in a poly-lysine cationic carrier moiety) wherein the end group is an amino (- NH 2 ) group. In some aspects, the cationic carrier moiety has a free terminus wherein the end group is an sulfhydryl group. In some aspects, the reactive group of the cationic carrier moiety is attached to an adjuvant moiety, e.g., a vitamin B3. [0316] In some aspects, the cationic carrier unit is capable of protecting the miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) from enzymatic degradation. See PCT Publication No. WO 2020/261227, which is herein incorporated by reference in its entirety. V.D. Crosslinking Moiety [0317] In some aspects, the cationic carrier units of the present disclosure comprise at least one crosslinking moiety. The term "crosslinking moiety" refers to a moiety or portion of a polymer block comprising a plurality of agents that are capable of forming crosslinks. In some aspects, the number of agents that are capable of forming crosslinks comprises an amino acid with a side chain of a crosslinking agent. In some aspects, the CM comprises a biopolymer, e.g., a peptide (e.g., a polylysine) linked to a crosslinking agent. [0318] In some aspects, the crosslinking moiety comprises one or more amino acids (e.g., lysine, arginine, histidine, or a combination thereof). In some aspects, the crosslinking moiety comprises at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, at least about 20, at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 amino acids, e.g., lysine, arginine, or combinations thereof, each of which is linked to a crosslinking agent. [0319] In some aspects, the crosslinking moiety comprises at least about 10 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 11 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 12 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 13 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 14 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 15 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 16 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 17 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 18 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 19 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. In some aspects, the crosslinking moiety comprises at least about 20 amino acids, e.g., lysines, each of which is linked to a crosslinking agent. [0320] In some aspects, a crosslinking agent is a thiol. In some aspects, a crosslinking agent is a thiol derivative. V.E. Adjuvant Moiety [0321] As described herein, in some aspects, a cationic carrier unit useful for the present disclosure comprises at least one adjuvant moiety. The term "adjuvant moiety", as used herein, refers to a molecular entity that can, e.g., (i) complement the therapeutic or prophylactic activity of the payload, (ii) modulate the therapeutic or prophylactic activity of the payload, (iii) function as a therapeutic and/or prophylactic agent in the target tissue or target cells, (iv) facilitate the transport of the cationic carrier unit across a physiological barrier, e.g., the BBB and/or the plasma membrane, (v) improve the homeostasis of the target tissue or target cell, (vi) contribute positively charges groups to the cationic carried moiety, or (vii) any combination thereof. In some aspects, the adjuvant moiety is capable of modulating an immune response, an inflammatory response, and/or a tissue microenvironment. [0322] In some aspects, the adjuvant moiety comprises an imidazole derivative, an amino acid, a vitamin, or any combination thereof. In some aspects, the adjuvant moiety comprises, e.g., an amino acid linked to an imidazole derivative, a vitamin, or any combination thereof. In some aspects, the adjuvant moiety comprises: wherein each of G1 and G2 is H, an aromatic ring, or 1-10 alkyl, or G1 and G2 together form an aromatic ring, and wherein n is 1-10. [0323] In some aspects, the adjuvant moiety comprises nitroimidazole. In some aspects, the adjuvant moiety comprises metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. In some aspects, the adjuvant moiety comprises an amino acid. For instance, in some aspects, the adjuvant moiety comprises an amino acid (e.g., lysine) linked to nitroimidazole. In some aspects, the adjuvant moiety comprises an amino acid (e.g., lysine) linked to metronidazole, tinidazole, nimorazole, dimetridazole, pretomanid, ornidazole, megazol, azanidazole, benznidazole, or any combination thereof. [0324] In some aspects, the adjuvant moiety comprises

wherein Ar is wherein each of Z1 and Z2 is H or OH. [0325] In some aspects, the adjuvant moiety comprises a vitamin. For instance, in some aspects, the adjuvant moiety comprises an amino acid (e.g., lysine) linked to a vitamin. In some aspects, the vitamin comprises a cyclic ring or cyclic hetero atom ring and a carboxyl group or hydroxyl group. In some aspects, the vitamin comprises: wherein each of Y1 and Y2 is C, N, O, or S, and wherein n is 1 or 2. [0326] In some aspects, the vitamin is selected from the group consisting of vitamin A, vitamin B1, vitamin B2, vitamin B3, vitamin B6, vitamin B7, vitamin B9, vitamin B12, vitamin C, vitamin D2, vitamin D3, vitamin E, vitamin M, vitamin H, and any combination thereof. In some aspects, the vitamin is vitamin B3. [0327] In some aspects, the adjuvant moiety comprises at least about one, at least about two, at least about three, at least about four, at least about five, at least about six, at least about seven, at least about eight, at least about nine, at least about ten, at least about 11, at least about 12, at least about 13, at least about 14, at least about 15, at least about 16, at least about 17, at least about 18, at least about 19, or at least about 20 vitamin B3. In some aspects, the adjuvant moiety comprises at least about 21, at least about 22, at least about 23, at least about 24, at least about 25, at least about 26, at least about 27, at least about 28, at least about 29, at least about 30, at least about 31, at least about 32, at least about 33, at least about 34, at least about 35, at least about 36, at least about 37, at least about 38, at least about 39, at least about 40, at least about 41, at least about 42, at least about 43, at least about 44, at least about 45, at least about 46, at least about 47, at least about 48, at least about 49, or at least about 50 vitamin B3. In some aspects, the adjuvant moiety comprises about 10 vitamin B3. [0328] In some aspects, the composition comprises a water-soluble biopolymer moiety with about 120 to about 130 PEG units, a cationic carrier moiety comprising a poly-lysine with about 30 to about 40 lysines, and an adjuvant moiety with about 5 to about 10 vitamin B3. [0329] In some aspects, the composition comprises (i) a water-soluble biopolymer moiety with about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3). In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the water soluble polymer. In some aspects, the thiol groups in the composition form disulfide bonds. [0330] In some aspects, the composition comprises (1) a micelle comprising (i) about 100 to about 200 PEG units, (ii) about 30 to about 40 lysines with an amine group (e.g., about 32 lysines), (iii) about 15 to 20 lysines, each having a thiol group (e.g., about 16 lysines, each with a thiol group), and (iv) about 30 to 40 lysines fused to vitamin B3 (e.g., about 32 lysines, each fused to vitamin B3), and (2) a miRNA inhibitor (e.g., SEQ ID NO: 30), wherein the miRNA inhibitor is encapsulated within the micelle. In some aspects, the composition further comprises a targeting moiety, e.g., a LAT1 targeting ligand, e.g., phenyl alanine, linked to the PEG units. In some aspects, the thiol groups in the micelle form disulfide bonds. [0331] The present disclosure also provides a micelle comprising a miRNA inhibitor of the present disclosure (e.g., miR-485-3p inhibitor) wherein the miRNA inhibitor and the delivery agent are associated with each other. [0332] In some aspects, the association is a covalent bond, a non-covalent bond, or an ionic bond. In some aspects, the positive charge of the cationic carrier moiety of the cationic carrier unit is sufficient to form a micelle when mixed with the miRNA inhibitor disclosed herein in a solution, wherein the overall ionic ratio of the positive charges of the cationic carrier moiety of the cationic carrier unit and the negative charges of the miRNA inhibitor (or vector comprising the inhibitor) in the solution is about 1: 1. [0333] In some aspects, the adjuvant moiety comprises about 1 amino acid (e.g., lysine), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 2 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 3 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 4 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 5 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 6 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 7 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 8 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 9 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 10 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 11 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 12 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 13 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 14 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 15 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 16 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 17 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 18 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 19 amino acids (e.g., lysines), each of which is linked to vitamin B3. In some aspects, the adjuvant moiety comprises about 20 amino acids (e.g., lysines), each of which is linked to vitamin B3. V.F. Targeting Moiety [0334] As described herein, in some aspects, a cationic carrier unit useful for the present disclosure comprises a targeting moiety. In some aspects, the targeting moiety is linked to the water-soluble polymer, e.g., via a linker. As used herein, the term "targeting moiety" refers to a biorecognition molecule that binds to a specific biological substance or site. In some aspects, the targeting moiety is specific for a certain target molecule (e.g., a ligand targeting a receptor, or an antibody targeting a surface protein), tissue (e.g., a molecule that would preferentially carry the micelle to a specific organ or tissue, e.g., liver, brain, or endothelium), or facilitate transport through a physiological barrier (e.g., a peptide or other molecule that can facilitate transport across the brain blood barrier or plasma membrane). [0335] For targeting a payload (e.g., miR-485 inhibitor) according to the present disclosure, a targeting moiety can be coupled to a cationic carrier unit, and therefore, to the external surface of a micelle, whereas the micelle has the payload entrapped within its core. [0336] In some aspects, the targeting moiety is a targeting moiety capable of targeting the micelle of the present disclosure to a tissue. In some aspects, the tissue is brain, liver, kidney, lung, ovary, pancreas, thyroid, breast, stomach, or any combination thereof. [0337] In some aspects, the tissue is a tissue in the central nervous system, e.g., neural tissue. In some aspects, the targeting moiety targeting the central nervous system is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1). LAT1 (SLC7A5) is a transporter for both the uptake of large neutral amino acids and a number of pharmaceutical drugs. LAT1 can transport drugs such as L-dopa or gabapentin. [0338] In some aspects, a targeting moiety comprises glucose, e.g., D-glucose, which can bind to Glucose transporter 1 (or GLUT1) and cross BBB. GLUT1, also known as solute carrier family 2, facilitated glucose transporter member 1 (SLC2A1), is a uniporter protein that in humans is encoded by the SLC2A1 gene. GLUT1 facilitates the transport of glucose across the plasma membranes of mammalian cells. This gene encodes a major glucose transporter in the mammalian blood-brain barrier. [0339] In some aspects, a targeting moiety comprises galactose, e.g., D-galactose, which can bind to GLUT1 transporter to cross BBB. In some aspects, a targeting moiety comprises glutamic acid, which can bind to acetylcholinesterase inhibitor (AChEI) and/or EAATs inhibitors and cross BBB. Acetylcholinesterase is the enzyme that is the primary member of the cholinesterase enzyme family. An acetylcholinesterase inhibitor (AChEI) is the inhibitor that inhibits acetylcholinesterase from breaking down acetylcholine into choline and acetate, thereby increasing both the level and duration of action of the neurotransmitter acetylcholine in the central nervous system, autonomic ganglia and neuromuscular junctions, which are rich in acetylcholine receptors. Acetylcholinesterase inhibitors are one of two types of cholinesterase inhibitors; the other being butyryl-cholinesterase inhibitors. [0340] In some aspects, the tissue targeted by a targeting moiety is a skeletal muscle. In some aspects, the targeting moiety targeting skeletal muscle is capable being transported by Large-neutral Amino Acid Transporter 1 (LAT1). [0341] It is expressed in numerous cell types including T-cells, cancer cells and brain endothelial cells. LAT1 is consistently expressed at high levels in brain microvessel endothelial cells. Being a solute carrier located primarily in the BBB, targeting the micelles of the present disclosure to LAT1 allows delivery through the BBB. In some aspects, the targeting moiety targeting a micelle of the present disclosure to the LAT1 transporter is an amino acid, e.g., a branched-chain or aromatic amino acid. In some aspects, the amino acid is valine, leucine, and/or isoleucine. In some aspects, the amino acid is tryptophan and/or tyrosine. In some aspects, the amino acid is tryptophan. In some aspects, the amino acid is tyrosine. [0342] In some aspects, the targeting moiety is a LAT1 ligand selected from tryptophan, tyrosine, phenylalanine, tryptophan, methionine, thyroxine, melphalan, L-DOPA, gabapentin, 3,5-I-diiodotyrosine, 3-iodo-I-tyrosine, fenclonine, acivicin, leucine, BCH, methionine, histidine, valine, or any combination thereof. [0343] See Singh & Ecker (2018) “Insights into the Structure, Function, and Ligand Discovery of the Large Neutral Amino Acid Transporter 1, LAT1,” Int. J. Mol. Sci.19:1278; Geier et al. (2013) “Structure-based ligand discovery for the Large-neutral Amino Acid Transporter 1, LAT-1,” Proc. Natl. Acad. Sci. USA 110:5480-85; and Chien et al. (2018) “Reevaluating the Substrate Specificity of the L-type Amino Acid Transporter (LAT1),” J. Med. Chem.61:7358-73, which are herein incorporated by reference in their entireties. VI. Pharmaceutical compositions [0344] In some aspects, the present disclosure also provides pharmaceutical compositions comprising an miRNA inhibitor (e.g., miR-485-3p inhibitor) that are suitable for administration to a subject. The pharmaceutical compositions generally comprise an miRNA inhibitor described herein and a pharmaceutically-acceptable excipient or carrier in a form suitable for administration to a subject. Pharmaceutically acceptable excipients or carriers are determined in part by the particular composition being administered, as well as by the particular method used to administer the composition. [0345] Accordingly, there is a wide variety of suitable formulations of pharmaceutical compositions comprising an miRNA inhibitor (e.g., miR-485-3p inhibitor) of the present disclosure. (See, e.g., Remington's Pharmaceutical Sciences, Mack Publishing Co., Easton, Pa. 18th ed. (1990)). The pharmaceutical compositions are generally formulated sterile and in full compliance with all Good Manufacturing Practice (GMP) regulations of the U.S. Food and Drug Administration. [0346] The following examples are offered by way of illustration and not by way of limitation. Examples Example 1: Materials and Methods [0347] The Examples described below use one or more of the following materials and methods. Synthesis of Cy5.5-Labeled miRNA Mimic [0348] All oligonucleotides were automatically synthesized by oligo synthesizer (AKTA oligopilot10, GE Healthcare). Briefly, ribo U-300 (66.89 mg, 20 µmol) as a primer support was filled into the column and the sequence information was entered into the AKTA software. The water contents, UV, and pressure were monitored until 22-mer of oligomer was synthesized. After the reaction, the column was separated from oligo synthesizer and washed with acetonitrile. The CpG was dried in vacuum and separated from the oligonucleotide as follows. For the separation of CpG from the oligonucleotide, dried CpG was mixed with 6 mL of methylamine (40%) and ethanol mixture (3:1, v/v) solution, and stirred for 4 hours at 25°C. The mixture was filtered using syringe filter (0.45 µm) and subsequently dried in vacuo. The dried power was dissolved into the NMP, and triethylamine and triethylamine tri-hydro fluoride were sequentially added into the solution. The mixture solution was maintained with stirring for 2 hrs at 65°C. After cooling down the mixture to room temperature, 25 mL of isopropyl alcohol and 1.5 mL of sodium acetate were sequentially added into the solution and stored at - 20°C for 12 hours for precipitation. The precipitate was separated by centrifuge (13,000 rpm, 30 min) and dried in vacuo. Synthesized oligonucleotide was purified using Fast Protein Liquid Chromatography (FPLC) (AKTA Pure, GE Healthcare) attached with Hiscreen Capto Q column (GE Healthcare). As a mobile phase 10 mM of PB and 1M of NaCl was used and the UV peaks of oligonucleotides were detected at 260 nm wavelength. After purifying the oligonucleotides, remaining salt was removed by desalting column (HiTrap Desalting, GE Healthcare). The solution was lyophilized, and white powder was obtained. The purity of final product was analyzed by HPLC and molecular weight was measured by MALDI-TOF (Bruker). Synthesis of BBQ-650 (Cy5.5 Quencher) Labeled Anti-miRNA Oligonucleotide [0349] BBQ-650 labeled anti-miRNA oligonucleotide ("BBQ-ASO") was synthesized using the same procedure as that used to produce the Cy5.5-labeled miRNA mimic described above, except relating to the incorporation of the labeling site of the dye or quencher into the oligonucleotide. For BBQ-650 ASO synthesis, BBQ-650 labeled CpG was used from the starting point instead of using dye labeled amidite because of the difference of the labeling site (5ʹ to 3ʹ). In brief, BBQ-650 labeled CpG was filled into the column and the anti-sense sequence of cy5.5 label oligonucleotide was entered into the AKTA software. The separation of CPG, deprotection and purification steps were conducted with the same procedure of Cy5.5 labeled sense oligonucleotide. Example 2: Analysis of the Quenching Effects of Anti-miRNA Oligonucleotides [0350] To being assessing the capability of the diagnostic systems described herein, the quenching effect of anti-miRNA oligonucleotides conjugated to BBQ-650 ("BBQ-ASO") was assessed. Briefly, various concentrations (0-14 µM) of the BBQ-ASO was mixed with a fixed concentration (10 µM) of the Cy5.5-labeled miRNA mimic. Then, an annealing buffer was added to the mixture to promote the BBQ-ASO and miRNA mimics to form duplexes (see FIG. 2A). The "annealing buffer" is a buffer required to form a duplex of anti-miRNA oligonucleotide and specific miRNA, anti-miRNA oligonucleotide-specific miRNA duplex miRNA and miRNA mimic, respectively. The anneal buffer comprised the following: Tris- HCl (pH 8.0) 100 mM; MgCl2100 mM; NaCl 500 mM; and DTT (Dithiothreitol) 15.4 mg/mL. Then, the fluorescence intensity of Cy5.5 (i.e., conjugated to the miRNA mimic) was measured with a microplate-reader (excitation signal = 650 nm; emission signal = 690 nm). [0351] As shown in FIG. 2B, with increasing concentration of the BBQ-ASO (i.e., quencher), there was reduced Cy5.5 fluorescence observed. For instance, at anti-miRNA oligonucleotide to miRNA mimic ratios of 0:10, 2:10, and 4:10 (i.e., low quencher concentration; upper left quadrant of FIG. 2B), high fluorescence intensity was observed. However, when the concentration of the BBQ-ASO was the same or exceeded that of the miRNA mimic (i.e., 10:10, 12:10, and 14:10; bottom right quadrant of FIG. 2B), there was minimal fluorescence observed. [0352] The above results confirm the quenching effect of BBQ-ASO when in close proximity to the Cy5.5-labeled miRNA mimic. Example 3: Analysis of the Ability to Detect miRNA [0353] To assess whether the anti-miRNA oligonucleotides and miRNA mimics described herein are capable of detecting miRNA in a biological sample, the BBQ-ASO and miRNA mimic described in Example 2 were used to detect the presence of a sense oligonucleotide using methods described herein. Similar to when targeting a specific miRNA of interest, the sense oligonucleotide was designed to have the same sequence as the miRNA mimic. Accordingly, the BBQ-ASO was capable of specifically binding to the sense oligonucleotide when present. Varying concentrations (0-10 µM) of the sense oligonucleotide were first mixed with a fixed high (20 µM) or low (10 µM) concentration of the BBQ-ASO, and then duplex formation (i.e., first duplex reaction) was allowed to occur in the presence of the annealing buffer. Then, the corresponding fixed concentration of the Cy5.5-labeled miRNA mimic was added with additional annealing buffer to allow any unbound BBQ-ASO to form a duplex with the Cy5.5- labeled miRNA mimic (i.e., second duplex reaction). Finally, the fluorescence intensity of Cy5.5 (i.e., conjugated to the miRNA mimic) was measured with a microplate-reader (excitation signal = 650 nm; emission signal = 690 nm). [0354] As shown in FIGs. 3B and 3D, at low concentration of the sense oligonucleotide, the Cy5.5 fluorescence intensity was low, suggesting that majority of the Cy5.5-labeled miRNA mimic were in an unbound form (i.e., there was significant excess of the Cy5.5-labeled miRNA mimic compared to the sense oligonucleotide) when the BBQ-ASO was added for the second duplex reaction. Accordingly, majority of the Cy5.5-labeled miRNA mimic formed a duplex with the BBQ-ASO, resulting in low fluorescence intensity. In contrast, at high concentration of the sense oligonucleotide, high fluorescence intensity was observed, suggesting that majority of the Cy5.5-labeled miRNA mimic were already bound to the sense oligonucleotide when the BBQ-ASO was added. Since BBQ-ASO only binds to unbound Cy5.5-labeled miRNA mimic, the attached BBQ quencher had minimal inhibitory effect on the Cy5.5 fluorescence. [0355] The above results confirm that by measuring the fluorescence intensity, the anti- miRNA oligonucleotides and miRNA mimics described herein (conjugated to a quencher or a probe) can be useful in accurately and quickly measuring the amount of miRNA present in a biological sample. Example 4: Measuring miRNA Levels in Human Biological Samples [0356] To further demonstrate the capability of the diagnostic methods and compositions described herein, anti-miRNA oligonucleotides and miRNA mimics described herein (e.g., conjugated to a quencher or probe) will be used to measure a miRNA of interest (e.g., miR- 485-3p) in a human biological sample (e.g., saliva). As described herein, in some aspects, the anti-miRNA oligonucleotides will be conjugated to a quencher (e.g., BBQ-650) and designed to be complementary (partially or fully) to the target miRNA, such that the anti-miRNA oligonucleotides can specifically bind to the target miRNA when present. Additionally, in some aspects, the miRNA mimic will be conjugated to a probe (e.g., Cy5.5) and designed to share high sequence identity with the target miRNA, such that the miRNA mimic can specifically bind to any unbound anti-miRNA oligonucleotides. [0357] The above oligonucleotides (i.e., anti-miRNA oligonucleotide and miRNA mimic) will be added to a biological sample obtained from a human subject as described herein (see, e.g., Example 3). In some aspects, the biological sample will be obtained from a subject suffering from or suspected of suffering from a disease or disorder, wherein the disease or disorder is associated with abnormal level of the target miRNA. In some aspects, the biological sample will be obtained from a healthy subject (i.e., not suffering from the disease or disorder). After duplex formation, the detectable signal exhibited by the probe (e.g., fluorescence) will be measured as described herein. *** [0358] It is to be appreciated that the Detailed Description section, and not the Summary and Abstract sections, is intended to be used to interpret the claims. The Summary and Abstract sections can set forth one or more but not all exemplary aspects of the present disclosure as contemplated by the inventor(s), and thus, are not intended to limit the present disclosure and the appended claims in any way. [0359] The present disclosure has been described above with the aid of functional building blocks illustrating the implementation of specified functions and relationships thereof. The boundaries of these functional building blocks have been arbitrarily defined herein for the convenience of the description. Alternate boundaries can be defined so long as the specified functions and relationships thereof are appropriately performed. [0360] The foregoing description of the specific aspects will so fully reveal the general nature of the disclosure that others can, by applying knowledge within the skill of the art, readily modify and/or adapt for various applications such specific aspects, without undue experimentation, without departing from the general concept of the present disclosure. Therefore, such adaptations and modifications are intended to be within the meaning and range of equivalents of the disclosed aspects, based on the teaching and guidance presented herein. It is to be understood that the phraseology or terminology herein is for the purpose of description and not of limitation, such that the terminology or phraseology of the present specification is to be interpreted by the skilled artisan in light of the teachings and guidance. [0361] The breadth and scope of the present disclosure should not be limited by any of the above-described exemplary aspects, but should be defined only in accordance with the following claims and their equivalents. [0362] The contents of all cited references (including literature references, patents, patent applications, and websites) that can be cited throughout this application are hereby expressly incorporated by reference in their entirety for any purpose, as are the references cited therein.