DISINFECTION

CROSS-REFERENCE TO RELATED APPLICATION

[001] This application claims priority to United States Provisional Patent Application No. 63/032,650, filed May 31, 2020, the entire contents of which is incorporated herein by reference in its entirety.

FIELD

[002] The present subject matter relates to pathogenic agents diagnostics. More particularly, the present subject matter relates to pathogenic agents sampling, identification, evaluation, preservation, monitoring, and disinfection.

BACKGROUND

[003] The current Coronoavirus Disease 2019 (COVID-19) pandemic increased global awareness of the need to find a way to quickly, easily, and most accurately detect the presence or absence of infectious agents in animals or humans who are travelling, or transported, respectively, from one place to another that can potentially host various types of pathogens.

[004] The current COVID-19 pandemic is caused by an RNA single strand virus that can be easily transmitted via humans and surfaces. Since it is a new strain of the Coronoavirus family (including SARS and MERS), it may take some time till all aspects of the virus are revealed. However, for safety reasons it is crucial to identify the infectious material and to disinfect surfaces - all as quickly as possible in order to inhibit the virus transmission. Moreover, in the future, as various drugs, vaccines, and combinations thereof, are being developed, an accurate estimation of their effect requires a simple, accurate, and quantitative test to determine the effect of these drugs in cell culture, animal models, and clinical trials. SUMMARY

[005] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this subject matter belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice or testing of the present subject matter, suitable methods and materials are described below. In case of conflict, the patent specification, including definitions, will control. In addition, the materials, methods, and examples are illustrative only and not intended to be limiting.

[006] According to one aspect of the present subject matter, there is provided a composition for sampling body fluids and secretions, preserving nucleic acids, and disinfecting surfaces, the composition comprising: guanidinium thyocianate, sulfite salt, and at least one detergent.

[007] According to one embodiment, the concentration of guanidinium thyocianate is substantially 4 M.

[008] According to another embodiment, the concentration of the sulfite salt is substantially 0.1% (w/v).

[009] According to yet another embodiment, the sulfite salt is selected from the group consisting of: calcium sulfite, sodium sulfite, and magnesium sulfite, and any combination thereof.

[010] According to still another embodiment, the detergent is selected from the group consisting of: sodium dodecyl (SDS), tween 80 and tween 20, and any combination thereof.

[Oil] According to a further embodiment, the composition further comprising glycogen, or linearized acrylamide.

[012] According to yet a further embodiment, the composition further comprising an RNA stabilizer.

[013] According to still a further embodiment, the RNA stabilizer comprises: sodium citrate, ethylenediaminetetraacetic acid (EDTA), and ammonium sulfate. [014] According to an additional embodiment, the concentration of sodium citrate is in the range of substantially 20-25 mM; the concentration of EDTA is in the range of substantially 8- 10 mM; and the concentration of ammonium sulfate is substantially 70% (w/v).

[015] According to yet an additional embodiment, the composition further comprising beta- mercaptoethanol.

[016] According to still an additional embodiment, the concentration of beta-mercaptoethanol is in the range of substantially 1-4% (v/v).

[017] According to another embodiment, the composition further comprising proteinase K.

[018] According to yet another embodiment, the concentration of proteinase K is substantially 1 mg/ml.

[019] According to another aspect of the present subject matter, there is provided a method for collecting a sample of a body fluid or secretion, the method comprising: mixing the composition described above with an equal volume of body fluid or secretion.

[020] According to one embodiment, the mixing of the composition with the body fluid or secretion is at ambient temperature.

BRIEF DESCRIPTION OF THE DRAWINGS

[021] Embodiments are herein described, by way of example only, with reference to the accompanying drawings. With specific reference now to the drawings in detail, it is stressed that the particulars shown are by way of example and for purposes of illustrative discussion of the preferred embodiments, and are presented in the cause of providing what is believed to be the most useful and readily understood description of the principles and conceptual aspects of the embodiments. In this regard, no attempt is made to show structural details in more detail than is necessary for a fundamental understanding, the description taken with the drawings making apparent to those skilled in the art how several forms may be embodied in practice.

[022] In the drawings: [023] Fig. 1 schematically illustrates, according to an exemplary embodiment, a flow chart of a method for collecting a sample of a body fluid or secretion, using the composition of the present subject matter.

[024] Figs. 2A-B schematically illustrates, according to an exemplary embodiment, a sample of body fluid or secretion, before and after, respectively, mixing with a composition of the present subject matter.

[025] Fig. 3 schematically illustrates, according to an exemplary embodiment, a flow chart of a method for isolating nucleic acids from a mixture of a body fluid or secretion with the composition of the present subject matter.

[026] Fig. 4 schematically illustrates, according to an exemplary embodiment, test tubes with silica spin columns inside the test tubes, after centrifugation.

[027] Fig. 5 schematically illustrates, according to an exemplary embodiment, cycles in a q- RT-PCR assay for quantitatively detecting a presence of nucleic acids of a COVID-19 in a nucleic acids preparation.

[028] Fig. 6 schematically illustrates, according to an exemplary embodiment, results of a q- RT-PCR assay for quantitatively detecting a presence of nucleic acids of a COVID-19 in a sample.

[029] Fig. 7 illustrates results of a q-RT-PCR assay for the detection of a Mycoplasma RNA sequence spiked in saliva.

[030] Fig. 8 illustrates a table showing results of a test comparing isolation of nucleic acids from saliva with the compound of the present subject matter, with a Seegene validated Kit using a swab, followed by a q-RT-PCR assay for detecting COVID-19.

[031] Fig. 9 illustrates a table showing differences between collection of body fluid and secretion samples, and detection of pathogenic agents in the samples, compared between the procedures of the present subject matter and prior art procedures. DESCRIPTION OF THE PREFERRED EMBODIMENTS

[032] Before explaining at least one embodiment in detail, it is to be understood that the subject matter is not limited in its application to the details of construction and the arrangement of the components set forth in the following description or illustrated in the drawings. The subject matter is capable of other embodiments or of being practiced or carried out in various ways. Also, it is to be understood that the phraseology and terminology employed herein is for the purpose of description and should not be regarded as limiting. In discussion of the various figures described herein below, like numbers refer to like parts. The drawings are generally not to scale.

[033] For clarity, non-essential elements were omitted from some of the drawings.

[034] The present subject matter provides a composition for preserving nucleic acids in samples collected from body fluids and secretions, while neutralizing pathogenic agents present in the collected samples, and serving as a disinfecting agent for the disinfection of surfaces, medical equipment, and the like. In addition, the composition of the present subject matter is also suitable for preserving nucleic acids in samples collected from water sources, for example drinking water, sewage water, rivers, lakes, ponds, water reservoirs, pools and the like.

[035] The present subject matter relates to diagnostics of pathogenic agents, and for sampling of fluids for the diagnostics of pathogenic agents. In other words, the present subject matter relates to identification, evaluation, preservation, monitoring, and disinfection of pathogenic agents. Any pathogenic agent is under the scope of the present subject matter, for example viruses, bacteria, bacteriophages, yeast, parasites, and the like. More particularly, some pathogenic agents that the present subject matter relates to, are COVID-19, SARS, MERS, and derivatives thereof.

[036] In addition, the composition of the present subject matter is configured to preserve nucleic acids, for example at ambient temperature.

[037] In addition, the composition and methods of the present subject matter, allow precise determination of the load of pathogenic agents, for example viral load, to determine efficiency of treatment with drugs, efficiency of disinfection, and infectivity of water sources, for example swage water.

[038] Furthermore, the composition and method of the present subject matter allows isolation of all types of nucleic acids present in the collected sample, namely not only nucleic acids of pathogenic agents, if they are present in the collected sample, but also nucleic acids of other organisms that can be present in the collected sample, for example, genomic DNA and RNA of the individual from which the sample, like body fluid or secretion, was collected. In addition, the composition and method of the present subject matter allow isolation of DNA as well as RNA. In other words, the composition and method of the present subject matter allows isolation of substantially the entire content of nucleic acids present in the collected sample. Therefore, diagnostic analysis that is performed on the nucleic acids that are isolated from the collected sample is not limited to the detection of the presence of pathogenic agent nucleic acids in the collected sample, but rather encompasses any type of diagnostic analysis, for example genotyping. Moreover, this allows understanding the route of infectivity of a pathogenic agent, or predict the rate of infectivity, or the efficiency of a treatment.

[039] The composition of the present subject matter allows rapid and safe identification of individuals - humans or animals, infected with certain pathogenic agents, particularly COVID- 19. The composition of the present subject matter further allows disinfection of surfaces that can be infected with body fluids and secretions that can contain pathogenic agents, for example COVID-19. The composition of the present subject matter can further be used to disinfect surgical tools, and plasticware, for example pipes and connectors of ventilation devices. In addition, the disinfection with the composition of the present subject matter occurs at ambient temperature. Therefore, the composition of the present subject matter can be used for disinfecting tools and devices that cannot be treated by heating, for example devices and parts of equipment that are made of heat-sensitive materials like plastic, rubber, and the like. Moreover, the composition of the present subject matter can be used instead of the "gold standard" disinfecting agent - 70% ethanol, having its own drawbacks, for example, fixation of nucleic acids, including pathogenic agent nucleic acids, on treated surfaces.

[040] The present subject matter further allows self-collection of body fluids and secretions for analysis for the presence of pathogenic agents in the body fluids and secretions. Self collection of body fluids and secretions is advantageous over the currently practiced sampling of body fluids for the detection of various pathogenic agents, for example COVID-19, that is performed by a healthcare practitioner. Thus, the present subject matter reduces exposure of healthcare practitioners to potential pathogens, like COVID-19.

[041] The current practice of diagnostics of pathogenic agents, like COVID-19, is based on collection of nasal or pharyngeal swabs, and detection of the pathogenic agents' nucleic acids in the nasal or pharyngeal fluid samples. However, in the case of COVID-19 for example, it was found that testing for the presence of this pathogenic agent in nasal or pharyngeal fluid samples leads sometimes in false negative results. In some cases an individual can be infected with the pathogenic agent, but the amount of this pathogenic agent that is collected with the nasal or pharyngeal swabs is below the detection limit of the diagnostic method used for its detection. However, at least in the case of COVID-19, it was found that it travels from the mouth into the digestive system and secreted with the stool during the course of the disease. Thus, infected individuals that are otherwise diagnosed negative for the pathogenic agent can be diagnosed as positive by using the composition of the present subject matter, because this composition is suitable for sampling of any type of tissue, body fluid, and secretion, and is not limited to nasal or pharyngeal fluids sampling. In addition, the composition of the present subject matter allows sampling of water sources, and their analysis for the presence of pathogenic agents in the water. Furthermore, the composition of the present subject matter allows sampling of nucleic acids, namely DNA and RNA, from surfaces and samples, for forensic analysis.

[042] Currently, as mentioned above, nasal or pharyngeal swabs are used for the collection of samples for the detection of pathogenic agents, for example COVID-19. After collection of the nasal or pharyngeal fluids, the swabs are maintained in a sampling medium, for example RPMI 1640. This sampling medium does not inactivate the pathogenic agent, and requires refrigeration till the time of sample analysis, in order to prevent degradation of the pathogen's nucleic acids, particularly when the pathogen's genome is an RNA molecule, like in the case of COVID-19. The composition of the present subject matter is advantageous over the current sampling media in that it preserves nucleic acids, including RNA, for a few days, at ambient temperature. Thus, the composition of the present subject matter allows more accurate results of detection analysis, because nucleic acids of pathogenic agents remain intact and do not degrade during the time that passes from sampling to detection analysis. In additions, sample storage with the composition of the present subject matter is cheaper and does not require specific logistics, since no sample refrigeration is needed. [043] As mentioned above, the pathogenic agent, for example COVID-19, is not inactivated in the sampling medium after collection of nasal and pharyngeal fluids by swabs. Therefore, upon arrival at a healthcare institution, for example a hospital or a diagnostic laboratory, the samples should be treated in a Biosafety Level 3 (BSL 3) facility. In addition, a common practice is to inactivate the pathogenic agent in the sample by heating, for example at 70°C for 20 minutes. Such treatment is not optimal for RNA genome viruses, like COVID-19, because RNA is heat sensitive, and therefore can be degraded before the performance of a diagnostic analysis based on detection of pathogenic agent nucleic acids. The composition of the present subject matter overcomes these drawbacks. The composition neutralizes the pathogenic agent at ambient temperature. Therefore, samples containing the composition of the present subject matter do not have to be treated in high level biosafety facilities, like BSL 3, but rather in facilities having s lower biosafety level, for example BSL 2. This makes this assay more accessible to urban places, and significantly decreases the barriers to implement the assay in other places, as well as significantly reduces the cost since a BSL3 facility is more expensive and needs specially trained personnel and equipment, compared to facilities having lower biosafety levels. In addition, the composition of the present subject matter makes heat inactivation of the samples unnecessary, and therefore preserves the nucleic acids of the pathogenic agents, particularly RNA, intact - a feature that increases the reliability of diagnostic tests performed on samples containing the composition of the present subject matter.

[044] Thus, sampling of body fluids and secretions and diagnostics of pathogenic agents based on the composition of the present subject matter is safer, cheaper and gives rise to more accurate results, compared to currently available sampling media. Another advantage of the composition of the present subject matter is its additional use as a disinfecting agent.

[045] The present subject matter provides a composition for sampling body fluids and secretions, preserving nucleic acids, and disinfecting surfaces. According to one embodiment, the composition comprises: guanidinium thyocianate, sulfite salt, and at least one detergent.

[046] According to one embodiment, the concentration of guanidinium thyocianate is substantially 4 M.

[047] According to one embodiment, the concentration of the sulfite salt is substantially 0.1% (w/v). [048] According to one embodiment, the sulfite salt is sodium sulfite. According to another embodiment, the sulfite salt is calcium sulfite. According to yet another embodiment, the sulfite salt is magnesium sulfite. According to still another embodiment, the sulfite salt is any combination of at least two of sodium sulfate, calcium sulfite, and magnesium sulfate.

[049] According to one embodiment, the detergent is sodium dodecyl sulfate (SDS). According to another embodiment, the concentration of SDS is substantially 0.02% (w/v).

[050] According to one embodiment, the detergent is tween 80. According to another embodiment, the concentration of tween 80 is substantially 0.02 (w/v).

[051] According to one embodiment, the detergent is tween 20. According to another embodiment, the concentration of tween 20 is substantially 0.4% (w/v).

[052] According to one embodiment, the composition comprises any combination of at least two of SDS, tween 80 and tween 20.

[053] According to one embodiment, the composition further comprises glycogen, or linearized acrylamide. The addition of glycogen, or linearized acrylamide, to the composition increases the yield for RNA in a nucleic acid preparation derived from a body fluid or secretion sample comprising the composition. According to one embodiment, the concentration of the glycogen is in the range of substantially 0.05-1 mg/ml; or the concentration of the linearize acrylamide is in the range of substantially 15-20 mg/ml.

[054] According to one embodiment, the composition further comprises an RNA stabilizer. According to one embodiment, the RNA stabilizer comprises sodium citrate, ethylenediaminetetraacetic acid (EDTA), and ammonium sulfate. According to another embodiment, the concentration of the sodium citrate is in the range of substantially 20-25 mM. According to yet another embodiment, the concentration of the EDTA is in the range of substantially 8-10 mM. According to still another embodiment, the concentration of the ammonium sulfate is in the range of substantially 70% (w/v).

[055] According to one embodiment, the composition further comprises beta- mercaptoethanol. According to another embodiment, the concentration of beta- mercaptoethanol is in the range of substantially 1-4% (v/v). According to yet another embodiment, the concentration of beta-mercaptoethanol is substantially 1.16% (v/v). According to still another embodiment, the concentration of beta-mercaptoethanol is substantially 3.3% (v/v). According to a further embodiment, beta-mercaptoethanol is added to the composition just before isolation of nucleic acids.

[056] According to one embodiment, the composition further comprises proteinase K. According to another embodiment, the concentration of proteinase K is substantially 1 mg/ml. According to a further embodiment, proteinase K is added to the composition just before isolation of nucleic acids.

[057] According to one embodiment, the pH value of the composition is in the range of substantially 5-8. According to another embodiment, the pH of the composition is lower than 7, namely acidic. According to yet another embodiment, the pH value of the composition is substantially 5.2.

[058] Referring now to Fig. 1, schematically illustrating, according to an exemplary embodiment, a flow chart of a method for collecting a sample of a body fluid or secretion, using the composition of the present subject matter. The method illustrated in Fig. 1 is only exemplary and should not be considered as limiting the scope of the present subject matter. Please note that occasionally, for example in the drawings, the composition is occasionally termed "MKV buffer".

[059] According to embodiment, the method for collecting a sample of a body fluid or secretion comprises: adding to the composition an equal volume of body fluid or secretion. For example, to 1 ml composition - 1 ml body fluid or secretion is added. Fig. 1 illustrates an example of adding 500 microliter saliva to 500 microliter composition. According to an additional embodiment, the body fluid or secretion can be saliva, or urine, or stool, or sperm. As mentioned above, the sampling of the body fluids or secretions can be performed by the patient himself. In some embodiment, sampling should be performed early in the morning, before for example washing the mouth, when saliva sampling is performed. According to another embodiment, the method further comprises mixing the body fluid or secretion with the composition, for example by inverting several times, or agitating, a test tube containing the body fluid or secretion and the composition. In other words, the method comprises mixing the composition according to the aforementioned embodiments with an equal volume of body fluid or secretion. According to yet another embodiment, the composition according to the aforementioned embodiments is mixed with the equal volume of body fluid or secretion at ambient temperature. According to still another embodiment, the mixture of the body fluid or secretion with the composition is delivered to a healthcare institution for diagnostic analysis. According to a further embodiment, the composition is kept at ambient temperature. According to yet a further embodiment, the body fluid or secretion is mixed with the composition at ambient temperature. According to still a further embodiment, the mixture of the body fluid or secretion with the composition is delivered to the healthcare institution at ambient temperature.

[060] Referring now to Figs. 2A-B, schematically illustrating, according to an exemplary embodiment, a sample of body fluid or secretion, before and after, respectively, mixing with a composition of the present subject matter. As can be seen in Fig. 2A a sample of saliva was collected. The sample is a viscous and opaque suspension of cells, lipids and proteins. Fig. 2B illustrates the sample after mixing with an equal volume of the composition. The sample is now more fluidic and clear and homogeneous, indicating that the lipids and proteins have been digested due to the presence of the composition.

[061] Referring now to Fig. 3, schematically illustrating, according to an exemplary embodiment, a flow chart of a method for isolating nucleic acids from a mixture of a body fluid or secretion with the composition of the present subject matter. After the mixture of the body fluid or secretion with the composition is arrived at the healthcare facility, and optionally after a certain time of storage, for example at ambient temperature, the method for isolating nucleic acids from the mixture starts by adding to the mixture an equal volume of 100% ethanol. If, for example, the volume of the mixture is 1 ml, 1 ml of 100% ethanol is added to the mixture. The next stage is mixing the mixture with the ethanol. The next stages are applying the mixture with ethanol to a silica spin column.

[062] According to one embodiment, the silica spin column is made of a 0.2 ml, or a 0.5 ml test tube, when a hole is made at the bottom of the test tube, for example with a 0.8 mm syringe needle. Then, a silica resin is loaded into the test tube. According to one embodiment, the silica resin is glass wool. According to another embodiment, the amount of glass wool inserted into the test tube is in the range of substantially 5.9-8.5 mg. For the next steps of isolating the nucleic acids, the spin column is placed into a 2 ml test tube, serving as a collection tube.

[063] Referring now to Fig. 4, schematically illustrating, according to an exemplary embodiment, test tubes with silica spin columns inside the test tubes, after centrifugation. The mixture of the body fluid or secretion, with the composition and 100% ethanol, prepared as described above, is applied into the spin column, placed in the 2 ml tube, and centrifuged. According to one embodiment, before applying the mixture of the body fluid or secretion, with the composition and 100% ethanol into the spin column, the silica resin in the spin column is alternatively washed with an acid prior to the loading of the sample. The liquid accumulated in the test tube is the mixture with the ethanol that passed through the silica spin column. At this stage, nucleic acids from the body fluid or secretion, namely DNA and RNA, are adhered to the silica resin. It was found that RNA adheres more efficiently to the silica resin than DNA, when the pH value of the composition is substantially 8. On the other hand, for an efficient adherence of DNA to the silica resin, the pH value of the composition is in the range of substantially 5-8.

[064] It should be noted that this embodiment allows detection of not only one pathogenic agent in one test, as currently practiced, but rather allows potential detection of a plurality of pathogenic agents in one test, because the present subject matter allows isolation of substantially the entire nucleic acids content of the sample. This allows the performance of a plurality of tests in parallel on the same data. This can provide some crucial information, such as genotyping, transcriptomic analysis, and amplification of specific regions for sequencing, thus allowing the identification of novel mutations.

[065] Returning now to Fig. 3. After centrifuging the mixture with ethanol, the next stages are, discarding the liquid from the test tube; centrifuging again the test tube, with the spin column inside the test tube, for 1 minute at 10,000-11,000 g, in order to get rid of excess fluids, and dry, the spin column; alternatively washing with 50% ethanol in the composition of the present subject matter by centrifugation for 1 minute at 10,000-11,000 g; transferring the silica spin column to a fresh test tube; applying a small volume, for example 18-20 microliter, of double distilled water (DDW), preferably brought to pH 7, and preferably preheated, for example to 52°C, over the spin column; incubating for a short period of time, for example 2 minutes, at ambient temperature, and centrifuging for 2 minute at 12,000 g. At this final stage, the nucleic acids are eluted from the silica spin column with the DDW to the test tube, giving rise to a nucleic acids preparation derived from the body fluid or secretion sample. Another option for performing this method without centrifugation, is by using a vacuum system according to instructions of the manufacturer. An alternative way to perform this method is by using plates instead of tubes, for example 96-well plates, with a hole at a bottom of each well, and a micro-column extending from the hole, containing silica resin. A method using such plates can also be performed by centrifugation, or with a vacuum setting.

[066] It should be noted that the entire process of nucleic acids isolation from the body fluid or secretion mixed with the composition of the present subject matter takes substantially 10 minutes - a very short time period, which is an advantage over prior art practice.

[067] Following are some exemplary experiments aimed at detecting the presence of nucleic acids of a pathogenic agent in a nucleic acids preparation, prepared as described above, with the composition of the present subject matter. The results of these experiments indicate the high quality of nucleic acid preparations obtained with the composition of the present subject matter, particularly in highly sensitive detection methods, like quantitative real time polymerase chain reaction (qPCR).

[068] The nucleic acids preparation prepared according to the aforementioned embodiments can serve as a template in a qPCR assay, when the pathogenic agent has a DNA genome; or in a quantitative reverse transcriptase polymerase chain reaction (q-RT-PCR) assay, when the pathogenic agent has an RNA genome.

[069] During the qPCR and q-RT-PCR assays, coding regions, or non-coding regions, can be amplified and assayed.

[070] During the qPCR and q-RT-PCR assays of the present subject matter, a single region was amplified, with a single forward primer, and a single reverse primer. Alternatively, a plurality of regions are amplified, by multiplexing, namely with multiple sets of forward and reverse primers that are specific to multiple regions - all in a single assay.

[071] All types of nucleotides can be used in the assay, including ALN-nucleotides and phosphorothioate-nucleotides, which are resistant to nucleases that might be present in the collected samples.

[072] It is possible to detect new mutations, for example in the nucleic acid sequences of pathogenic agents, with an appropriate set of primers and probes. This can be achieved by looking for the most identical homologues and identify conserved regions in evolution, and design several probe sets that could work within one tube and provide a signal from different regions within the genome of the pathogenic agent within one tube. All sets should give identical Ct call if indeed this is a real and specific signal. This method can also identify new mutants. If several families would like to be tested, degenerative probes can be used to detect the entire family at the same time.

[073] During the experiments, the presence of nucleic acids of COVID-19 in a nucleic acids preparation, prepared as described above, with the composition of the present subject matter, was determined. Since COVID-19 has an RNA genome, a q-RT-PCR assay was conducted. Primers specific to a sequence derived from COVID-19 were used in the q-RT-PCR assay. The sequence derived from COVID-19 can be found in GenBank Accession No. MT461669.1. The primer sequences are:

MVK11F

5 '-A AT CT GT GT GGCT GT C ACTCG-3 '

MVK11R

5'-CACGGACGAAACCGTAAGCA-3

A PCR product using primers MVK1 IF and MVK11R, when the template is COVID-19 genome, is 90 bp long, having the following sequence:

A AT CT GT GT GGCT GT C ACTCGGCT GC ATGCTT AGT GC ACT C ACGC AGT AT A ATT A AT A ACT A ATT ACT GTCGTT G AC AGG AC ACG AGT A ACTCGT CT AT CTTCT GC AGGC TGCTTACGGTTTCGTCCGTG

Another set of primers is:

MVK20F

5 A A AGGTTT AT ACCTT CCC AG-3 '

MVK20R

5'-GCCGATCATCAGCACATCTA-3'

[074] Referring now to Fig. 5, schematically illustrating, according to an exemplary embodiment, cycles in a q-RT-PCR assay for quantitatively detecting a presence of nucleic acids of a COVID-19 in a nucleic acids preparation. The assay starts with reverse transcription at 45°C for 8 minutes, followed by a denaturation step at 95°C for 5 minutes, followed by 40 cycles of DNA amplification, each cycle comprises a denaturation step at 95°C for 12 seconds, and an annealing and elongation step at 60°C for 30 seconds. The entire q-RT-PCR assay takes substantially 30 minutes to be completed.

[075] Referring now to Fig. 6, schematically illustrating, according to an exemplary embodiment, results of a q-RT-PCR assay for quantitatively detecting a presence of nucleic acids of a COVID-19 in a sample. A q-RT-PCR assay for quantitatively detecting a presence of nucleic acids of a COVID-19 in a sample was conducted, using a synthetic COVID-19 DNA sequence fragment as a template, according to embodiments described above. The results show that the q-RT-PCR assay can detect a single copy of the COVID-19 DNA sequence fragment, indicating the high sensitivity of the q-RT-PCR assay.

[076] Referring now to Fig. 7, illustrating results of a q-RT-PCR assay for the detection of a Mycoplasma RNA sequence spiked in saliva. A synthetic RNA spanning a specific Mycoplasma genome was utilized to determine the ability to use a q-RT-PCR assay, with a TaqMan probe and a SYBER green probe to detect the Mycoplasma RNA sequence within uninfected saliva which went through the nucleic acid isolation process of the present subject matter. Line E indicates that 3.2 copies were detected. If SYBER is used, then DNAse is added to the samples to get rid of genomic DNA that can influence the SYBER green signal. The q- RT-PCR assay sensitivity could be increased with the combination of fluorescent probes for multiplexing. A combination of two primer sets within one sample to increase the copy number could also be used.

[077] Referring now to Fig. 8, illustrating a table showing results of a test comparing isolation of nucleic acids from saliva with the compound of the present subject matter, with a Seegene validated Kit using a swab, followed by a q-RT-PCR assay for detecting COVID-19. In print on the left is the Ct of the suggested modified RNA/DNA isolation using the Seegen one step- Rt-PCR kit. On the right, in handwriting, is the Ct call of the Seegen validated isolation and Seegen one step-Rt-PCR validated kit. The results show that the assay that was performed with the composition of the present subject matter, according to embodiments of the present subject matter, did detect the COVID-19 infected samples with relatively low enough Ct values. Two of the saliva samples are negative, and all the rest of the saliva samples are positive. These results well correlate with the expected results.

[078] Referring now to Fig. 9, illustrating a table showing differences between collection of body fluid and secretion samples, and detection of pathogenic agents in the samples, compared between the procedures of the present subject matter and prior art procedures. In all aspects that were compared, the present subject matter is superior over the prior art procedures - variety of biological samples, time duration, cost, and primers used in q-RT-PCR assays.

[079] To summarize, sampling of body fluids and secretions and diagnostics of pathogenic agents based on the composition of the present subject matter is safer, cheaper and gives rise to more accurate results, compared to currently available sampling media. Another advantage of the composition of the present subject matter is its additional use as a disinfecting agent.

[080] It is appreciated that certain features of the subject matter, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the subject matter, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub combination.

[081] Although the subject matter has been described in conjunction with specific embodiments thereof, it is evident that many alternatives, modifications and variations will be apparent to those skilled in the art. Accordingly, it is intended to embrace all such alternatives, modifications and variations that fall within the spirit and broad scope of the appended claims.