TISSUES IN CITRUS

GOVERNMENT SUPPORT

This invention was made with government support under 2018-70016-27392 awarded by The United States Department of Agriculture and 2017-68005-26807 grant awarded by the United States Department of Agriculture National Institute of Food and Agriculture. The government has certain rights in the invention.

BACKGROUND

Citrus tristeza virus (CTV) is one of the most economically important viruses of the Closteroviridae family that has destroyed entire citrus industries in several countries during the last century. It affects almost all citrus genotypes but causes different disease symptoms on citrus plants depending on the virus strain, the citrus variety and the scion- rootstock combination (Moreno et al. 2008). This virus is structured by a single-stranded RNA genome of 19.3 kb encapsidated by two coat proteins (25 and 27 kDa). CTV genome contains twelve open reading frames (ORFs) and a untranslated region (UTR) at each terminus (Albiach-Marti et al. 2000; Febres et al. 1996).

The CTV virions are very long and flexuous particles of 2μm length and are restricted to the phloem cells into the citrus plants. During the past decades, this virus was thoroughly studied because it could be used as a vector to express foreign proteins or RNA sequences into the citrus plants, especially theraμles against the Flunaglongbing (FILB), a disease that has devastated millions of trees worldwide (Hajeri et al. 2014).

Virus cell-to-cell movement through plasmodesmata (PD) is usually mediated by virus movement proteins (MPs). Some of the viral MPs like the 30 kDa MP of Tobacco mosaic virus (TMV) can modify the size exclusion limit of the PD by acting in association with other host factors (Heinietn et al. 1998, Wright et al. 2007). The TMV 30 kDa PM also can bind to viral RNA to create an unfolded nucleoprotein complex that moves cell- to-cell through the PD channels (Citovsky et al. 1990). The molecular mechanisms involved in CTV movement throughout the citrus plant is poorly understood. Some CTV proteins that are known to be involved in the virus particle assembling could be also involved in the virus spread (HSP70H, p61 , CP and CPm). At least two non-structural proteins; P6 (an integral type III transmembrane) and P33 (which contain a C-terminal transmembrane domain) that colocalizes in PD of citrus cell, are known to be involved in the virus ability to infect specific host and to spread throughout the citrus plant (Kang et al. 2015, Bak and Folimonova 2015, Tatineni et al. 2008).

In plants, RNA can also move cell-to-cell without the help of MPs. It is now widely accepted that some cellular mRNAs can move short distances from cell to cell through the plasmodesmata (PD) and then travel long distances through the phloem. Examples of plant mRNAs that follow this route include some of those involved in plant growth and flowering. The mechanisms to explain the movement of the mRNAs through the plant remain still unclear. At least it is known that the Flowering Locus T ( FLT) mRNA can moves short distances through the PD and over long distances through the phloem to accumulate and express on the shoot aμlcal meristem (SAM). A cis-element localized at the 5’-terminus of the FLT mRNA is responsible for its movement and also it was demonstrated that this cis-element can also move green fluorescent protein (GFP) and different viral RNAs in plant (Li et al. 2009).

The use of self-replicating RNAs as vectors based on virus replicons opened the door to a more efficient transient expression of recombinant proteins in plants. In combination with the biolistic method, that enables to directly delivery RNA into the plant cell, it made possible to express proteins without the introduction of any DNA fragment. Recently, a self-replicating vector based on the genetic elements of the potato virus X (PVX) was used to express the influenza vaccine candidate M2eFIBc in N. benthamiana, allowing to produce a yield of 30% of the total soluble proteins (Mardanova et al. 2017).

The expression levels of therapeutic sequences (proteins or RNAs) using CTV- based vectors were shown to be higher than those possible from plant promoters in transgenic plants. A big advantage of using a CTV-based vector is that the expression of the foreign sequences occurs only into the phloem tissue, where the FILB bacteria is also present and the psyllid insect (its vector) feeds (El-Mohtar and Dawson 2014). Another advantage of the CTV-based vectors is that they are available for the current generation of plants, especially if new peptides are discovered with the ability to heal/recover HLB infected plants. While inoculating CTV-based vectors into citrus plants is easier and faster than producing transgenic plants to express foreign proteins, but this virus is still very complex and difficult to insert foreign sequences on it. Furthermore, citrus plant infection with the CTV-based vectors still requires virion purification from N. benthamiana, which is a laborious task and relatively lengthy. BRIEF DESCRIPTION OF DRAWINGS

Figure 1. Schematic representation of the CTV genome showing proteins codified from the twelve ORFs and the engineered replicon in which nine CTV proteins (P33, P6, HSP70, P61 , CPm, CP, P18, P13, and P20) were taken out of the CTV genome and GFP was inserted in between p23 and the 3’ UTR. (PRO: papain-like protease, MET: methyl transferase, HEL: helicase, RdRp: RNA-dependent RNA polymerase).

Figures 2A - 2C. Inoculation of the CTV replicon into the eμlcotyl explants of “Pineapple” sweet orange. A: Eμlcotyl explants bundled and positioned together into silicon ring for particle bombardment. B: GFP fluorescence 8 days after CTV replicon inoculation (I: inoculated, C: - control). C: PCR amplification of GFP using as a template a cDNA synthesized using a specific primer to target the negative strand of the CTV replicon. RNA was extracted 5-8 days after bombardment (P: plasmid pCTVΔCIa 333R, C-: non- inoculated).

Figure 3. Time-curse analysis for GFP transient expression from the capped mRNA (mGFP) and the CTV-replicon from 2 to 6 days after bombardment into in vitro cultured Carrizo eμlcotyl explants (A) and Citrus macrophylla eμldermal cells (B).

Figure 4A - 4B. GFP expression in different tissues of the citrus stem 5 days (FIG. 4A) and 8 days (FIG. 4B) after the CTV replicon inoculation. Free GFP expression is detected in nuclei. CTV replicon is spreading extensively in different cell types. (GT: ground tissue, Xy: Xylem, Ph: Phloem) Figure 5A-5B. GFP expression in a Citrus macrophylla eμldermal cells (FIG. 5A) and “Pineapple” sweet orange eμlcotyl derived callus (FIG. 5B). Extensive cell to cell movement is taking place in the eμlcotyl callus (but not in eμldermal cells).

Figure 6A, 6B, 6C, 6D, 6E 6F. CTV-based replicon infiltration into the developed callus tissue, 20 days after bombardment into Citrus macrophylla stem sections. FIG. 6A-C: single cell (white arrow) expressing GFP at the surface of the callus. FIG. 6D-F: Multiple cells showing active replication of the replicon in the tissue inside the callus. A and D: GFP detection channel (500-530 nm). B and E: Whitfield. C and F: channels overlay DETAILED DESCRIPTION

It has been discovered that an engineered RNA replicon of CTV showed certain movement inside citrus eμlcotyl explants (sweet orange) and callus tissue after inoculation by particle bombardment. The replication and movement of this RNA seems not to be restricted to the phloem cells as expected. This RNA replicon construction was engineered to express the CTV replication complex (Methyltransferase + Helicase + RNA Dependent RNA Polymerase) together with CTV P23 and the green fluorescence protein (GFP) at its 3’ end (Figure 1). When bombarded into the ends of the citrus eμlcotyl explants, GFP expression was detected throughout the whole explant and in different kind of cells 5-8 days after bombardment, suggesting that this RNA replicon is still capable to move cell-to-cell without the presence of the structural proteins of the CTV virions.

This very surprising result can enable production and use of much simpler and more efficient CTV vectors to carry theraμles into citrus plants. The small size of the viral replicon makes it much more efficient for cloning, and for delivery into the citrus plant. Moreover, working with a minimum replicon completely avoids the danger of the recombinant virus being transmitted to another plant. This replicon cannot form particles, and therefore probably will not be able to be transmitted by insects. In addition, in the absence of the p33 protein, this virus will can avoid the cross-protection.

According to one embodiment, provided is CTV-based RNA replicon that can be efficiently used to express foreign protein in citrus. The CTV-based RNA replicon comprises a CTV viral sequence wherein sequences encoding nine CTV proteins (P33, P6, HSP70, P61 , CPm, CP, P18, P13, and P20) have been removed. In a specific embodiment, the arrangement of the CTV replicon comprises, from 5’ to 3’ end, a 5’UTR, first papain-like protease sequence, a second papain-like protease sequence, a methyl transferase sequence, a helicase sequence, a RNA-dependent RNA polymerase sequence, a p23 sequence and a 3’ UTR.

According to another embodiment, the CTV RNA replicon described in the preceding paragraph comprises a heterologous nucleic acid sequence inserted between the p23 sequence and the 3’ UTR. The heterologous sequence may include but are not limited to sequences that encode polypeptides that increase agronomic traits, help ameliorate or prevent citrus infection, or encode expression silencing molecules such as RNAi (e.g. siRNA, shRNA and the like). Examples of heterologous sequences are taught in U.S. Patent No. 10,017,747 and PCT Pub. WO/2019/122394A2, which are incorporated by reference. According to another embodiment, provided is method of infecting a tree with a heterologous nucleic acid sequence that involves transfecting at least one cell of said tree with a CTV-based RNA replicon as described herein. In a further embodiment, the transfected cell is regenerated into a plant. Tyμlcally, the plant cell is obtained from callus tissue. In another embodiment, provided is a plant having at least one cell transfected with a CTV-based RNA replicon described herein. In a more specific embodiment, the plant cell is a citrus cell and the plant is a citrus plant.

Definitions

The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting. As used herein, the singular forms "a," "an," and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including," "includes," "having," "has," "with," or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term "comprising."

Practice of the methods, as well as preparation and use of the compositions disclosed herein employ, unless otherwise indicated, conventional techniques in molecular biology, biochemistry, chromatin structure and analysis, computational chemistry, cell culture, recombinant DNA and related fields as are within the skill of the art. These techniques are fully explained in the literature. See, e.g., Sambrook et al. MOLECULAR CLONING: A LABORATORY MANUAL, 2d ed„ Cold Spring Harbor Laboratory Press, 1989; 3d ed., 2001 ; Ausubel et al., CURRENT PROTOCOLS IN MOLECULAR BIOLOGY, John Wiley & Sons, New York, 1987 and periodic updates; the series METHODS IN ENZYMOLOGY, Academic Press, San Diego; Wolfe, CHROMATIN STRUCTURE AND FUNCTION, Third edition, Academic Press, San Diego, 1998; METHODS IN ENZYMOLOGY, Vol. 304, “Chromatin” (P. M. Wassarman and A. P. Wolffe, eds.), Academic Press, San Diego, 1999; and METHODS IN MOLECULAR BIOLOGY, Vol. 119, “Chromatin Protocols” (P. B. Becker, ed.) Humana Press, Totowa, 1999.

The term “citrus” refers to any known citrus variety. Citrus varieties contemplated by this disclosure include, but are not limited to, cultivated citrus types such as sweet orange, bitter orange, blood orange, grapefruit, pomelo, citron, Clementine, naval orange, lemon, lime, mandarin, tangerine, tangelo, or the like.

The terms “nucleic acid,” “polynucleotide,” and “oligonucleotide” are used interchangeably and refer to a deoxyribonucleotide or ribonucleotide polymer, in linear or circular conformation, and in either single- or double-stranded form. For the purposes of the present disclosure, these terms are not to be construed as limiting with respect to the length of a polymer. The terms can encompass known analogues of natural nucleotides, as well as nucleotides that are modified in the base, sugar and/or phosphate moieties (e.g., phosphorothioate backbones). In general, an analogue of a particular nucleotide has the same base-pairing specificity; i.e., an analogue of A will base-pair with T.

The terms “polypeptide,” “peptide” and “protein” are used interchangeably to refer to a polymer of amino acid residues. The term also applies to amino acid polymers in which one or more amino acids are chemical analogues or modified derivatives of a corresponding naturally-occurring amino acids.

The term “sequence” refers to a nucleotide sequence of any length, which can be DNA or RNA; can be linear, circular or branched and can be either single-stranded or double stranded. The term sequence may includes sequences encoding CRISPR gene editing constructs. For example, the sequence may include a construct encoding a gRNA-Cas9 construct.

A “homologous, non-identical sequence” refers to a first sequence which shares a degree of sequence identity with a second sequence, but whose sequence is not identical to that of the second sequence. For example, a polynucleotide comprising the wild-type sequence of a mutant gene is homologous and non-identical to the sequence of the mutant gene. In certain embodiments, the degree of homology between the two sequences is sufficient to allow homologous recombination there between, utilizing normal cellular mechanisms. Two homologous non-identical sequences can be any length and their degree of non-homology can be as small as a single nucleotide (e.g., for correction of a genomic point mutation by targeted homologous recombination) or as large as 10 or more kilobases (e.g., for insertion of a gene at a predetermined ectoμlc site in a chromosome). Two polynucleotides comprising the homologous non-identical sequences need not be the same length. For example, an exogenous polynucleotide (i.e., donor polynucleotide) of between 20 and 10,000 nucleotides or nucleotide pairs can be used. -Techniques for determining nucleic acid and amino acid sequence identity are known in the art. Tyμlcally, such techniques include determining the nucleotide sequence of the mRNA for a gene and/or determining the amino acid sequence encoded thereby, and comparing these sequences to a second nucleotide or amino acid sequence. Genomic sequences can also be determined and compared in this fashion. In general, identity refers to an exact nucleotide-to-nucleotide or amino acid-to-amino acid correspondence of two polynucleotides or polypeptide sequences, respectively. -Two or more sequences (polynucleotide or amino acid) can be compared by determining their percent identity. The percent identity of two sequences, whether nucleic acid or amino acid sequences, is the number of exact matches between two aligned sequences divided by the length of the shorter sequences and multiplied by 100. An approximate alignment for nucleic acid sequences is provided by the local homology algorithm of Smith and Waterman, Advances in Applied Mathematics 2:482-489 (1981). This algorithm can be applied to amino acid sequences by using the scoring matrix developed by Dayhoff, Atlas of Protein Sequences and Structure, M. O. Dayhoff ed., 5 suppl. 3:353-358, National Biomedical Research Foundation, Washington, D.C., USA, and normalized by Gribskov, Nucl. Acids Res. 14(6):6745-6763 (1986). An exemplary implementation of this algorithm to determine percent identity of a sequence is provided by the Genetics Computer Group (Madison, Wis.) in the “BestFit” utility application. The default parameters for this method are described in the Wisconsin Sequence Analysis Package Program Manual, Version 8 (1995) (available from Genetics Computer Group, Madison, Wis.). A preferred method of establishing percent identity in the context of the present disclosure is to use the MPSRCFI package of programs copyrighted by the University of Edinburgh, developed by John F. Collins and Shane S. Sturrok, and distributed by IntelliGenetics, Inc. (Mountain View, Calif.). From this suite of packages the Smith-Waterman algorithm can be employed where default parameters are used for the scoring table (for example, gap open penalty of 12, gap extension penalty of one, and a gap of six). From the data generated the “Match” value reflects sequence identity. Other suitable programs for calculating the percent identity or similarity between sequences are generally known in the art, for example, another alignment program is BLAST, used with default parameters. For example, BLASTN and BLASTP can be used using the following default parameters: genetic code=standard; filter=none; strand=both; cutoff=60; expect=10; Matrix=BLOSUM62; Descriptions=50 sequences; sort by=HIGH SCORE; Databases=non-redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS translations+Swiss protein+Spupdate+PIR. Details of these programs can be found at the following internet address: http://www.ncbi.nlm.gov/cgi-bin/BLAST. With respect to sequences described herein, the range of desired degrees of sequence identity is approximately 80% to 100% and any integer value therebetween. Tyμlcally the percent identities between sequences are at least 70-75%, preferably 80-82%, more preferably 85-90%, even more preferably 92%, still more preferably 95%, and most preferably 98% sequence identity.

-Alternatively, the degree of sequence similarity between polynucleotides can be determined by hybridization of polynucleotides under conditions that allow formation of stable duplexes between homologous regions, followed by digestion with single- stranded-specific nuclease(s), and size determination of the digested fragments. Two nucleic acid, or two polypeptide sequences are substantially homologous to each other when the sequences exhibit at least about 70%-75%, preferably 80%-82%, more preferably 85%-90%, even more preferably 92%, still more preferably 95%, and most preferably 98% sequence identity over a defined length of the molecules, as determined using the methods above. As used herein, substantially homologous also refers to sequences showing complete identity to a specified DNA or polypeptide sequence. DNA sequences that are substantially homologous can be identified in a Southern hybridization experiment under, for example, stringent conditions, as defined for that particular system. Defining appropriate hybridization conditions is within the skill of the art. See, e.g., Sambrook et al., supra; Nucleic Acid Hybridization: A Practical Approach, editors B. D. Hames and S. J. Higgins, (1985) Oxford; Washington, D.C.; IRL Press).

-Selective hybridization of two nucleic acid fragments can be determined as follows. The degree of sequence identity between two nucleic acid molecules affects the efficiency and strength of hybridization events between such molecules. A partially identical nucleic acid sequence will at least partially inhibit the hybridization of a completely identical sequence to a target molecule. Inhibition of hybridization of the completely identical sequence can be assessed using hybridization assays that are well known in the art (e.g., Southern (DNA) blot, Northern (RNA) blot, solution hybridization, or the like, see Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.). Such assays can be conducted using varying degrees of selectivity, for example, using conditions varying from low to high stringency. If conditions of low stringency are employed, the absence of non-specific binding can be assessed using a secondary probe that lacks even a partial degree of sequence identity (for example, a probe having less than about 30% sequence identity with the target molecule), such that, in the absence of non-specific binding events, the secondary probe will not hybridize to the target. -When utilizing a hybridization-based detection system, a nucleic acid probe is chosen that is complementary to a reference nucleic acid sequence, and then by selection of appropriate conditions the probe and the reference sequence selectively hybridize, or bind, to each other to form a duplex molecule. A nucleic acid molecule that is capable of hybridizing selectively to a reference sequence under moderately stringent hybridization conditions tyμlcally hybridizes under conditions that allow detection of a target nucleic acid sequence of at least about 10-14 nucleotides in length having at least approximately 70% sequence identity with the sequence of the selected nucleic acid probe. Stringent hybridization conditions tyμlcally allow detection of target nucleic acid sequences of at least about 10-14 nucleotides in length having a sequence identity of greater than about 90-95% with the sequence of the selected nucleic acid probe. Hybridization conditions useful for probe/reference sequence hybridization, where the probe and reference sequence have a specific degree of sequence identity, can be determined as is known in the art (see, for example, Nucleic Acid Hybridization: A Practical Approach, editors B. D. Hames and S. J. Higgins, (1985) Oxford; Washington, D.C.; IRL Press).

-Conditions for hybridization are well-known to those of skill in the art. Hybridization stringency refers to the degree to which hybridization conditions disfavor the formation of hybrids containing mismatched nucleotides, with higher stringency correlated with a lower tolerance for mismatched hybrids. Factors that affect the stringency of hybridization are well-known to those of skill in the art and include, but are not limited to, temperature, pH, ionic strength, and concentration of organic solvents such as, for example, formamide and dimethylsulfoxide. As is known to those of skill in the art, hybridization stringency is increased by higher temperatures, lower ionic strength and lower solvent concentrations.

-With respect to stringency conditions for hybridization, it is well known in the art that numerous equivalent conditions can be employed to establish a particular stringency by varying, for example, the following factors: the length and nature of the sequences, base composition of the various sequences, concentrations of salts and other hybridization solution components, the presence or absence of blocking agents in the hybridization solutions (e.g., dextran sulfate, and polyethylene glycol), hybridization reaction temperature and time parameters, as well as, varying wash conditions. The selection of a particular set of hybridization conditions is selected following standard methods in the art (see, for example, Sambrook, et al., Molecular Cloning: A Laboratory Manual, Second Edition, (1989) Cold Spring Harbor, N.Y.).

As noted above, the CTV-based RNA replicon may engineered to include heterologous sequences encoding a gRNA-Cas9 construct.

Target gene sequences for genome editing and genetic modification can be selected using methods known in the art, and as described elsewhere in this application. In a specific embodiment, target sequences are identified that include or are proximal to protospacer adjacent motif (PAM). Once identified, the specific sequence can be targeted by synthesizing a pair of target-specific DNA oligonucleotides with appropriate cloning linkers, and phosphorylating, annealing, and ligating the oligonucleotides into a digested plasmid vector, as described herein. The plasmid vector comprising the target-specific oligonucleotides can then be used for transformation of a plant. In specific embodiments, the target gene sequences comprise a disease susceptibility gene. In other embodiments, a CTV replicon can be introduced by convention techniques including transfection, particle bombardment, microinjection, electroporation, nucleofection and lipofection. Transfected plant cells which are produced by any of the above transfectiontechniques can be cultured to regenerate a whole plant which possesses the transformed genotype and thus the desired phenotype. Such regeneration techniques rely on manipulation of certain phytohormones in a tissue culture growth medium, tyμlcally relying on a biocide and/or herbicide marker which has been introduced together with the desired nucleotide sequences. Regeneration can also be obtained from plant callus, explants, organs, pollens, embryos or parts thereof. Such regeneration techniques are described generally in Klee et al (1987) Ann. Rev. of Plant Phys. 38:467- 486.

Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which embodiments belong. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

The teachings of any patents, patent applications, technical or scientific articles or other references are incorporated herein in their entirety to the extent not inconsistent with the teachings herein.

EXAMPLES

EXAMPLE 1 : TRANSFECTION OF CITRUS CELLS WITH CTV REPLICON The inoculation of the CTV replicon into sweet orange eμlcotyl explants using the Helios® system was highly efficient. Up to 15 explants (out of 20) per shoot, showed GFP expression when visualized under the confocal microscope. In previous experiments, we bombarded GFP capped mRNA into sweet orange eμldermal and phloem associated cells for transient expression. GFP-expressing cells were observed as soon as 16 hrs after bombardment, but at 6 days the fluorescence was undetectable. In contrast, we were capable to detect GFP expression in citrus eμlcotyl cells for at least 8 days when using the CTV-based RNA replicon. PCR amplification of the virus negative RNA strand after specific virus cDNA retro-transcription, confirmed that the CTV-replicon was actively replicating for at least 8 days after inoculation (dμl) (figure 2).

For a control assay of the time course analysis for GFP expression driven by the CTV-based replicon, a capped and polyadenylated mRNA, which mimics a fully processed mature GFP mRNA (mGFP) (Trilink Biotechnologies, cat#: L-7601), was bombarded into the terminal ends of 20 Carrizo eμlcotyl explants along with the replicon. The confocal visualization of the number of cells expressing GFP revealed that transient expression from mGFP decreases dramatically and was undetectable 6 days after bombardment. In contrast, the transient expression of GFP driven by the CTV-based replicon stabilized after 4 days post-bombardment and continued at 6 days (figure 3A). GFP transient expression from the CTV-replicon was also confirmed to be stable 6 days after bombardment into Citrus macrophylla eμldermal cells (figure 3B).

Viral vectors are widely used in plants for transient gene expression. Gene expression from viral vectors is usually more efficient and allows to recover a larger amount of protein than genes driven by plant promoters in transgenic plants. A high- efficiency RNA vector constructed on base of the TMV replicon expressed up to 100 times the level of the routinely used enhanced agro-infiltration method in N. benthamiana (Lindbo 2007).

The replication and the gene expression of the replicon was greatly affected by the quality of the IVT reaction and bullet preparation. Before IVT, the cDNA clone must be analyzed by restriction enzyme digestion in order to corroborate the true-to-type clone. CTV cDNA vectors are considered toxic when replicating in E. coii, leading to many recombinant and defective clones.

The molecular mechanisms that explain how CTV moves short distances through the companion cells and then spread systemically through the plant it is extremely complex and remains still unclear. Even in susceptible citrus species, CTV has limited cell-to-cell movement that produces small clusters compounded by 3 -12 infected cells (Dawson et al. 2013).The most surprising finding in the work disclosed herein was the certain kind of cell-to-cell movement of the CTV-replicon into the eμlcotyl explants. Confocal microscopy observation of the cross-sections showed that this replicon can move cell-to-cell and through different kind of tissues (Figure 4). Because this CTV- replicon is lacking capsid proteins and other proteins well known to be involved in the infection, we didn’t expect any cell-to-cell movement.

The CTV-replicon did not spread in leaf eμldermal cells. However, when inoculated into eμlcotyl derived calli it spread cell-to-cell easily (Figure 5a). The replicon was also spread into the callus tissue developed several weeks after bombardment into the stem sections of Citrus macrophylla and cultured in vitro (Figure 6). It is well known that there are differences in plasmodesmata size exclusion limit in between the different kind of cells, and that could be the reason of why this CTV-replicon can move cell-to-cell through the eμlcotyl callus tissues and not through the eμldermal cells. Furthermore, calli are compounded by larger cells actively dividing, that could help the spread of the CTV- replicon from the infected cells to the new cells after division.

The results in Example 1 indicate that CTV-based RNA replicon can be successfully produce and can be efficiently used as a DNA-free strategy for transient expression of foreign protein in citrus, and specifically in eμlcotyl derived callus cells when inoculated by particle bombardment. The robust and prolongated transient expression driven from this replicon in citrus cells make it very promising for expressing nucleases and CrisprRNAs as a DNA-free strategy for gene editing in citrus. Recently, an in planta gene editing approach was developed wherein an RNA virus was used as a vector to express the sgRNAs in Nicotiana benthamiana (Ellison et al 2020). The fact that this CTV- based replicon can replicate and move cell to cell in citrus calluses could lead to higher efficient regeneration of gene edited citrus plants.

MATERIALS AND METHODS MATERIALS AND METHODS

In vitro transcription of the RNA replicon: Approximately 3 μg of DNA plasmid pCTVΔCIa 333R, containing a cDNA of the replication elements from the CTV genome and GFP inserted in between P23 and the 3’ UTR, was linearized with Notl prior to in vitro transcription. 2 μg of linearized plasmid was used as template in a 60 μl reaction volume to synthesize the 5’-capped transcripts using AmpliCap™ SP6 High Yield Message Maker Kit from CELLSCRIPT with an incubation period of 4 h at 37°C. DNA template was removed by addition of 3 μl of DNasel and incubation at 37°C for 15 min. RNA was preciμltated after DNasel treatment by addition of 60 μl of nuclease-free water and 140 μl of ammonium acetate 5M and incubation at 15 min in ice. After 20 min centrifugation at 15000rμm 4°C, RNA pellet was washed with 70% ethanol and resuspended in 60 μl nuclease-free water. Transcription quality was determined by electrophoresis in agarose gel and concentration was measured using a nanodrop. RNA was stored at -80°C until being used to prepare microcarriers.

Preparation of RNA-coated gold microcarriers: 20 μg of RNA was preciμltated on 10 mg of gold particles (1 μm) by addition of 1 /10 volume of 3M NaAc (pH 7.4) and 3 volumes of an unopened 200 proof ethanol. The suspension was mixed by tapμlng the tube and placing it at -20 °C for 1 hour. After a 5 sec centrifugation at 10000 rμm the supernatant was discarded, and the gold pellet was washed three times with 1 ml of ethanol (200 proof). The RNA-coated gold particles were then resuspended by a quick vortex and sonication in 3 ml of a freshly made ethanol solution containing 0.03 mg/ml PVP. Cartridges were prepared as described by Acanda et al 2019.

Plant material and particle bombardment: Seeds of “Pineapple” sweet orange were peeled to remove the external seed coat and disinfected in 25 % commercial bleach solution for 10 min. After 3 washes with sterile deionized water the seeds were planted on MS medium (Murashige and Skoog 1962) supplemented with 1.5% sucrose and kept in a darkness at 28 °C during 4 weeks. Prior to bombardment, eμlcotyl segments (1 cm length) were cultured on a high osmotic medium (MS medium supplemented with 0.4M sorbitol) for 4 h. Approximately 20 explants were then bundled together into an autoclaved 1.5 cm diameter silicon ring (Figure 2A) and positioned in the center of an sterile petri dish to bombard their terminal ends using a BIO-RAD Helios® Gene Gun at 350 psi Helium pressure. After bombardment, the explants were placed back to MS medium supplemented with 3% sucrose and incubated 5-8 days in the dark at room temperature.

Replicon replication and cell-to-cell movement: Total RNA was extracted from 100 mg tissue (collected from the terminal section of the eμlcotyl explants) 5-8 days after bombardment using Trizol. The cDNA was synthesized with the specific positive primer C-342 located near the 3’ terminus of p23 using the High Capacity cDNA Reverse Transcription Kit (Applied Biosystems). A fragment of 413 bp was PCR amplified using the primer pair (GFPF: G ATG CT AC AT ACG G AAAG CTT AC and GFPR: CAATGTTGTGGCGAATTTTGAAG) to confirm RNA replication. GFP expression was visualized on a Leica TCS SP8 confocal microscope.

References

Albiach-Marti, Maria R., Munir Mawassi, Siddarame Gowda, Tatineni Satyanarayana, Mark E Hilf, Savita Shanker, Ernesto C Almira, et al. 2000. “Sequences of Citrus

Tristeza Virus Separated in Time and Space Are Essentially Identical †.” Journal of Virology 74 (15): 6856-65.

Bak, Aurelie, and Svetlana Y. Folimonova. 2015. “The Conundrum of a Unique Protein Encoded by Citrus Tristeza Virus That Is Dispensable for Infection of Most Hosts yet Shows Characteristics of a Viral Movement Protein.” Virology 485: 86-95. https://doi.Org/10.1016/j.virol.2015.07.005.

Citovsky, Vitaly, David Knorr, Gadi Shuster, and Patricia Zambryski. 1990. “The P30 Movement Protein of Tobacco Mosaic Virus Is a Single-Strand Nucleic Acid Binding Protein.” Cell 60: 637-47. papers2://publication/uuid/A6B7303F-7963-41 F9-BDFD- 9B30DCB8B824.

Dawson, W. O., S. M. Garnsey, S. Tatineni, S. Y. Folimonova, S. J. Harper, and S. Gowda. 2013. “Citrus Tristeza Virus-Host Interactions.” Frontiers in Microbiology 4 (MAY): 1-10. https://doi.org/10.3389/fmicb.2013.00088. El-Mohtar, Choaa, and William O. Dawson. 2014. “Exploring the Limits of Vector Construction Based on Citrus Tristeza Virus.” Virology 448: 274-83. https://doi.Org/10.1016/j. virol.2013.10.017.

Febres, V J, L Ashoulin, M Mawassi, A Frank, M Bar-Joseph, K L Manjunath, R F Lee, and C L Niblett. 1996. “The P27 Protein Is Present at One End of Citrus Tristeza Virus Particles.” Molecular Plant Pathology.

Hajeri, Subhas, Nabil Killiny, Choaa El-Mohtar, William O. Dawson, and Siddarame Gowda. 2014. “Citrus Tristeza Virus-Based RNAi in Citrus Plants Induces Gene Silencing in Diaphorina Citri, a Phloem-Sap Sucking Insect Vector of Citrus Greening Disease (Huanglongbing).” Journal of Biotechnology 176 (1 ): 42-49. https://doi.Org/10.1016/j.jbiotec.2014.02.010.

Heinietn, Manfred, Malcolm R. Wood, Teresa Thiel, and Roger N. Beachy. 1998. “Targeting and Modification of Prokaryotic Cell-Cell Junctions by Tobacco Mosaic Virus Cell-to-Cell Movement Protein.” Plant Journal 14 (3): 345-51. https://doi.Org/10.1046/j.1365-313X.1998.00118.x.

Kang, Sung Hwan, Aurelie Bak, Ok Kyung Kim, and Svetlana Y. Folimonova. 2015. “Membrane Association of a Nonconserved Viral Protein Confers Virus Ability to Extend Its Host Range.” Virology 482: 208-17. https://doi.Org/10.1016/j. virol.2015.03.047.

Li, C., K. Zhang, X. Zeng, S. Jackson, Y. Zhou, and Y. Hong. 2009. “A Cis Element within Flowering Locus T MRNA Determines Its Mobility and Facilitates Trafficking of Heterologous Viral RNA.” Journal of Virology 83 (8): 3540-48. https://doi.Org/10.1128/jvi.02346-08.

Lindbo, John A. 2007. “TRBO: A High-Efficiency Tobacco Mosaic Virus RNA-Based Overexpression Vector.” Plant Physiology 145 (4): 1232-40. https://doi.Org/10.1104/pp.107.106377.

Mardanova, Eugenia S., Elena A. Blokhina, Liudmila M. Tsybalova, Hadrien Peyret, George P. Lomonossoff, and Nikolai V. Ravin. 2017. “Efficient Transient Expression of Recombinant Proteins in Plants by the Novel PEff Vector Based on the Genome of Potato Virus X.” Frontiers in Plant Science 8 (February): 1-8. https://doi.Org/10.3389/fpls.2017.00247.

Moreno, Pedro, Silvia Ambros, Maria R. Albiach-Marti, Jose Guerri, and Leandro Pena. 2008. “Citrus Tristeza Virus: A Pathogen That Changed the Course of the Citrus Industry.” Molecular Plant Pathology 9 (2): 251-68. https://doi.org/10-1111/j.1364- 3703.2007.00455.x.

Murashige, Toshio, and Folke Skoog. 1962. “A Revised Medium for Raμld Growth and Bio Assays with Tobacco Tissue Cultures.” Physiologia Plantarum 15 (3): 473-97. https://doi.Org/10.1111/j.1399-3054.1962.tb08052.x.

Tatineni, Satyanarayana, Cecile J. Robertson, Stephen M. Garnsey, Moshe Bar-Joseph, Siddarame Gowda, and William O. Dawson. 2008. “Three Genes of Citrus Tristeza Virus Are Dispensable for Infection and Movement throughout Some Varieties of Citrus Trees.” Virology 376 (2): 297-307. https://doi.Org/10.1016/j.virol.2007.12.038.