ATTORNEY DOCKET NO: F6456- 16776

UML-129

ENHANCED IMMUNE MEMORY DEVELOPMENT BY APTAMER TARGETED MTOR INHIBITION OF T CELLS

CROSS-REFERENCE TO RELATED APPLICATIONS

[001] The present application claims priority of U.S. provisional patent application No. 61/541,588 filed September 30, 201 1 and is incorporated herein by reference in its entirety.

FIELD OF THE INVENTION

[002] Embodiments of the invention provide pharmacological compositions for promoting the generation of immune memory responses and enhancing protective immunity for the treatment of infectious diseases and cancer.

BACKGROUND

[003] The recent FDA approval of two immune modulatory drugs for cancer patients, Sipuleucel-T, a cellular vaccine based on enriched blood APC, and Ipilumimab, a CTLA-4 blocking antibody have provided the formal validation for using the immunological modality to treat cancer. Nonetheless, the therapeutic benefit of both drugs was modest, underscoring the need to develop more potent and/or complementary treatments. Recent studies in mice have highlighted the importance of immunological memory in mediating protective immunity in chronic infectious diseases, as well as in cancer. A strong correlation between T cell memory and protective immunity was also seen in macaques vaccinated against SIV, and in cancer patients treated with ex vivo expanded autologous T cells.

[004] Two main subsets of memory CD8 ⁺ T cells have been characterized.

CD62 ^l0W CCR7 ^l0W effector memory T cells (Tern) rapidly elaborate effector functions upon antigen reencounter, traffic to peripheral tissues, but have limited proliferative capacity.

CD62 ^hlgh CCR7 ^hlgh central memory T cells (Tcm) home to secondary lymphoid organs, slow to differentiate into effectors upon antigen reencounter, but exhibit a high proliferative capacity. Tern provide a rapid response to an acute pathogenic threat that needs to be neutralized quickly ATTORNEY DOCKET NO: F6456- 16776

UML-129 to prevent pathology, whereas Tcm are best suited to provide protection against pathogenic reencounters that are slow to induce pathology. Progressing tumors in humans, more so than fast-growing tumors in murine models, belong to the latter category.

SUMMARY

[005] Embodiments of the invention comprise the development of novel, broadly applicable, and clinically feasible, compositions and methods for enhancing the generation of immune cell memory responses which address the limitations of using pharmacological agents, limited specificity and "non-drugable" targets. The compositions have a wide applicability due to the induction of any desired antigen specific immune memory. For example, the new approach will enhance vaccine-induced regression of preexisting poorly immunogenic tumors in vivo, infectious disease organisms, autoimmunity, transplantation and the like.

[006] In other embodiments, the composition induces immune cell memory to host foreign antigens, for example, infectious disease organisms. These organisms include, virus, bacteria, protozoa, or parasites,

[007] In another preferred embodiment, the compositions modulate immune cell differentiation and/or immune memory cell induction to autologous, allogeneic, syngeneic, or xenogeneic antigens. These antigens include, for example, tumor antigens.

[008] In a preferred embodiment, a composition for modulating immune cell differentiation and/or immune memory comprising an targeting domain specific for an immune cell and a second domain targeting molecules associated with regulation or modulation of immune cell memory. In one embodiment, the composition comprises an aptamer- oligonucleotide construct or molecule wherein the molecule is targeted to cells and cellular molecules associated with regulation of an immune memory response and the oligonucleotide mediates interference of RNA molecules of the target cell(s).

[009] In another preferred embodiment, an oligonucleotide mediating the RNA interference comprises at least one of antisense RNA, short interfering RNA (siRNA); a micro, interfering RNA (miRNA); a small, temporal RNA (stRNA); or a short, hairpin RNA (shRNA). ATTORNEY DOCKET NO: F6456- 16776

UML-129

[010] In another preferred embodiment, the immune cells comprise T cells (T lymphocytes), B cells (B lymphocytes), antigen presenting cells, dendritic cells, monocytes, macrophages, myeloid suppressor cells, natural killer (NK) cells, CD4 ⁺ T cells, CD8 ⁺ cytotoxic T lymphocytes (CTLs), CTL lines, CTL clones, CTLs from tumor, inflammatory, or other infiltrates and subsets thereof. In some embodiments, the targeting or first domain is specific for T lymphocytes and subsets thereof. For example, the aptamer can target TCR, OX40, CD4, CD8, CD28, CD 134, CD 137, CD137L. Subsets of T lymphocytes are for example, T helper cells, CTLs, Treg.

[011] Other aspects are described infra.

BRIEF DESCRIPTION OF THE DRAWINGS

[012] Figures 1 A and IB show the results from aptamer targeted siRNA inhibition of mTOR in activated CD8 ⁺ T cells. Figure 1 A is a graph showing the knockdown of raptor RNA in cultured cells. OT-I T cells were activated in vitro with OVA peptide in the presence of IL- 12. 24 hours later cells were incubated with 75ng/ml rapamycin, or 1 nM of dimeric control aptamer, 4-1BB aptamer-raptor siRNA or 4-1BB aptamer-GFP siRNA conjugates. 48 hours later raptor, T-bet and Eomes RNA levels were measured by qRT-PCR. Figure IB are flow cytometer scans showing the inhibition of mTORCl activity in mice. CD45.2 C57BL/6 mice were adoptively transferred with 1.0 x 10 ⁶ congenic (CD45.1) OT-1 cells and 48 hours later vaccinated with OVA peptide in LPS. 24 hours later mice were injected i.p. with 1.5 μg rapamycin, or i.v. with 1 nmole of 4- IBB aptamer-raptor siRNA or 4- IBB aptamer-GFP siRNA conjugates. 48 hours later splenocytes were isolated and analyzed for phosphorylated S6 kinase (phospho-S6K) by flow cytometry.

[013] Figures 2A-2C show 4-lBB-raptor siRNA and rapamycin-mediated enhancement of memory differentiation. Mice were adoptively transferred with OT-I cells, vaccinated with OVA peptide/LPS and as indicated, treated with either rapamycin, 4-1BB-GFP siRNA, or 4- lBB-raptor siRNA. OT-I cells were enumerated in the splenocytic population by gating on CD45.1. Figure 2A are flow cytometer scans showing OT-1 cells with a central memory phenotype (CD62L ⁺ CD127 ) at day 10. Figure 2B: Mice were re-vaccinated with OVA peptide/LPS 30 days after the first vaccination, at which time the number of OT-I cells in the ATTORNEY DOCKET NO: F6456- 16776

UML-129 circulation was close to undetectable (< 0.05%), and three days later the CD45.1 ⁺ OT-I cells in the spleen were enumerated by flow cytometry. Figure 2C: At day 35 mice were infused with control and OVA peptide pulsed adherent CFSE ^low and CFSE ^hlgh splenocytes, respectively, and 18 hour later splenocytes were isolated and analyzed by flow cytometry for CFSE expression (Numbers represent CFSE ^hlgh as percent of CFSE ^low cells). In Figure 2C, the "No treatment" mice were not vaccinated with OVA.

[014] Figures 3 A and 3B show the enhanced accumulation of memory Pmel-1 CD8 ⁺ T cells in mice treated with rapamycin or 4-lBB-raptor siRNA. Figure 3 A shows flow cytometer scans of Pmel-1 CD8 T cells with memory phenotype 10 days post vaccination. CD90.2 C57BL/6 mice were spiked with congenic CD90.1 Pmel-1 CD8 ⁺ T cells. 48 hours later mice were vaccinated with gplOO peptide/LPS and treated with rapamycin or 4-lBB-raptor siRNA as described in the above Figures. 10 days later splenocytes were isolated and the CD90.1 gated CD62L ⁺ CD44 ⁺ Pmel-1 cells were analyzed by flow cytometry. Figure 3B: Recall response. Mice were re-vaccinated at day 35 with gplOO peptide/LPS and three days later the CD90.1+ Pmel-1 cells in the splenocytic population were enumerated by flow cytometry.

[015] Figure 4 shows the enhancement of memory in mice by targeted inhibition of raptor, Blimp- 1 and T-bet. Experimental conditions as described in Figure 2B except that mice were re -vaccinated at day 35. Blue, host CD8 ⁺ T cells, Red, Pmel-1.

[016] Figures 5A, 5B show that 4-lBB-raptor conjugate decreases mTORCl activity in activated OT-I cells in mice. CD45.2 C57BL/6 mice were transferred with congenic CD45.1 OT-I cells, activated in situ with OVA peptide, and treated with rapamycin or with either 4- IBB aptamer-GFP siRNA (4-1BB-GFP) or 4- IBB aptamer-raptor siRNA (4-lBB-raptor) conjugates as described in Methods. 48 hour after treatment splenocytes were stained for

(Figure 5 A) phosphorylated S6 protein (mTORCl activity) and CD45.1 (OT-I cells),

representative example of 4 mice, or (Figure 5B) CD8, CD45.1, and either phosphorylated S6 (p243) or phosphorylated Akt (p475) (mTORC2 activity).

[017] Figures 6A-6D show that 4-lBB-raptor conjugate promotes the persistence of OT-I cells in mice that are enriched for cells with a memory precursor phenotype. CD45.2 C57BL/6 mice were transferred with congenic CD45.1 OT-I cells, activated in situ with OVA ATTORNEY DOCKET NO: F6456- 16776

UML-129 peptide, and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugates. Cells were isolated from the blood or spleen and stained with PacBlue-CD8, PE-CD44, FITC- CD45.1 APC-CD62L antibodies (BioLegend, San Diego, CA) for 15 minutes at 4°C, washed and analyzed by flow cytometry. Figure 6A: CD8 CD45.1 ⁺ OT-I cells in the spleen at day 5. Figure 6B: Percent (CD44 ^high /CD62 ^high OT-I cells at day 5. Figure 6C: CD8 ⁺ CD45.1 ⁺ OT-I cells in the blood (5 mice per group). Figure 6D: CD8 ⁺ CD45.1 ⁺ OT-I cells in the spleen at day 28.

Differences between the 4-1BB-GFP and rapamycin groups was not significant (P=0.445).

[018] Figures 7A-7E show that 4-lBB-raptor generated memory OT-I cells exhibit proliferative and cytotoxic effector functions. CD45.2 C57BL/6 mice were adoptively transferred with CD45.1 OT-1 cells, activated with OVA peptide and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugates. Figure 7A: At day 30 mice were re- vaccinated with OVA peptide and 3 days later the number of CD45.1 OT-I in the spleen was determined. Figure 7B: At day 30 mice were injected i.v. with a 1 : 1 mixture of OVA or influenza NP peptide loaded splenocytes differentially labeled with CFSE, CFSE ^hlgh and

CFSE ^low , respectively. 17 hours later splenocytes were isolated and the lysis of OVA targets was determined, calculated as percent reduction of CFSE ^hlgh relative to CFSE ^low cells. Figure 7C: Compilation of data from the experiment in panel B and other experiments showing the percent lysis of OVA targets as a function of percent OT-I cells present in the spleen at day 30. Figure 7D: At day 30 splenocytes were isolated, 5 l0 ⁴ CD45.1 OT-I cells were mixed with an 1 : 1 mixture of 5 l0 ⁶ CFSE ^high OVA and CFSE ^low influenza NP peptide pulsed splenocytes, injected into na ^' ive mice, and lysis of OVA targets was determined as described in panel B. Figure 7E: 10 ⁴ OT-I cells from each mouse shown in Figure 7D were pooled and cotransferred to a na ^' ive mouse with CFSE ^hlgh OVA and CFSE ^low control peptide pulsed splenocytes. Lysis of OVA targets was determined as described in Figure 7B.

[019] Figures 8 A, 8B show that 4- IBB raptor generated memory Pmel-1 cells proliferate in response to antigenic challenge and control B16 melanoma tumor growth.

CD90.2 ⁺ C57BL/6 mice were transferred with congenic CD90.1 ⁺ Pmel-1 cells, activated with gplOO peptide 2 days later, and treated with rapamycin or with either 4-1BB-GFP or 4-1BB- raptor conjugates. Figure 8A: At day 30 mice were revaccinated with gplOO peptide and the proportion of CD8 CD90.1 ⁺ Pmel-1 cells in the spleen was determined by flow cytometry. ATTORNEY DOCKET NO: F6456- 16776

UML-129

Figure 8B: At day 30 mice were challenged subcutaneously with 10 ⁵ B16.F10 melanoma cells and survival (time to sacrifice when tumors reached 12 mm diameter) was determined.

[020] Figures 9A-9C show that 4-lBB-raptor conjugate treatment enhances vaccine- induced protective antitumor immunity. Figure 9A: C57BL/6 mice were vaccinated with GM- CSF-expressing irradiated B16/F 10 tumor cells (GVAX) and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugates. At day 50, mice were challenged with 10 ⁶ B16/F10 melanoma cells and survival was determined. Figures 9B, 9C: Mice were implanted with B16/F10 tumor cells, vaccinated with GVAX at days 5, 8 and 9, and/or treated with 4-1BB- GFP or 4-lBB-raptor conjugates at days 6, 9 and 10. Figure 9B: Survival. Figure 9C: Average tumor size.

[021] Figure 10 shows that dendritic cells from rapamycin-treated mice exhibit reduced allostimulatory activity. C57BL/6 mice were injected with PBS or GVAX and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugates. 24 hours after last treatment dendritic cell (DC)-enriched CD1 lc ⁺ cells were isolated from the spleen and 10 ⁴ cells were incubated with 4x 10 ⁵ Balb/c splenocytes. After 4 days ³ H-thymidine was added to the culture and 18 hours later ³ H-thymidine incorporation was measured.

[022] Figures 1 lA-1 ID show that 4-lBB-raptor conjugate downregulates raptor in cultured OT-I cells and promotes their persistence. Figures 11 A and 1 IB: Splenocytes from OT- I mice were activated with OVA peptides and incubated with scrambled aptamer-raptor siRNA conjugate (scram-Raptor), 4- IBB aptamer-GFP siRNA conjugate (4-1BB-GFP), or 4- IBB aptamer-raptor siRNA conjugate (4-lBB-Raptor) three times every 8 hours at a concentration of 0.8μΜ. 48 hours after the last treatment cells were harvested and RNA was quantified by qRT- PCR. Figures 11C and 1 ID: Splenocytes from OT-I mice were activated with OVA peptide and incubated with rapamycin (75 ng/ml) three times daily, or with 4-1BB-GFP and 4-lBB-raptor conjugates (0.8μΜ, three times every 8 hours). After last treatment 10 ⁶ cells were transferred to 5 ml of fresh media supplemented with IL-7 (2 ng/ml.) and cultured for 3-4 weeks. Every 3-5 days viable cells were counted and 10 ⁶ cells were passed to a fresh culture. Figure 11C: Viable cells. Figure 1 ID: At day 25 cells were counted and plated at 10 ⁴ cells/well in a 96 w plate in quintuplicates. Cells were stimulated with 0.01 nM of either OVA or influenza NP control ATTORNEY DOCKET NO: F6456- 16776

UML-129 peptide overnight. 1 μθ of ³ H-thymidine was added to each well 6 hrs prior harvesting and counting. P>0001 among all groups.

[023] Figures 12A, 12B show that 4-lBB-raptor conjugate increases the number of multifunctional OT-I cells in mice. CD45.2 C57BL/6 mice were transferred with congenic CD45.1 OT-I cells and 3 days later vaccinated with OVA peptide and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugate. After 30 days splenocytes were isolated, cultured for 6 hours in the presence of 0.1 nM OVA peptide, and stained with Pacific Blue anti- TNF, PE-Cy7 anti-IL-2, and PE anti-IFNy, antibodies. Cells co-expressing TNF, IL-2 and IFNy were enumerated by flow cytometry. Figure 12A: Total TNF, IL-2 and IFNy-expressing OT-I cells in the spleen. Figure 12B: Proportion of OT-I cells co-expressing TNF, IL-2 and IFNy.

[024] Figures 13 A, 13B show that 4-lBB-raptor conjugate promotes the persistence of Pmel-1 cells with a memory precursor phenotype in mice. CD90.2 ⁺ C57BL/6 mice were transferred with congenic CD90.1 ⁺ Pmel-1 cells, activated with gplOO peptide 2 days later, and treated with rapamycin or with either 4-1BB-GFP or 4-lBB-raptor conjugates. Figure 13 A: Proportion of Pmel-1 cells in the splenic CD8 ⁺ T cell population of mice 6 days after Pmel-1 transfer. Figure 13B: Proportion of CD8 ⁺ CD90.1 ⁺ Pmel-1 cells exhibiting a CD44 ^high CD62L ^high phenotype at day 6.

DETAILED DESCRIPTION

[025] The present invention is described with reference to the attached figures, wherein like reference numerals are used throughout the figures to designate similar or equivalent elements. The figures are not drawn to scale and they are provided merely to illustrate the instant invention. Several aspects of the invention are described below with reference to example applications for illustration. It should be understood that numerous specific details, relationships, and methods are set forth to provide a full understanding of the invention. One having ordinary skill in the relevant art, however, will readily recognize that the invention can be practiced without one or more of the specific details or with other methods. The present invention is not limited by the illustrated ordering of acts or events, as some acts may occur in different orders and/or concurrently with other acts or events. Furthermore, not all illustrated acts or events are required to implement a methodology in accordance with the present invention. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[026] All genes, gene names, and gene products disclosed herein are intended to correspond to homologs from any species for which the compositions and methods disclosed herein are applicable. Thus, the terms include, but are not limited to genes and gene products from humans and mice. It is understood that when a gene or gene product from a particular species is disclosed, this disclosure is intended to be exemplary only, and is not to be interpreted as a limitation unless the context in which it appears clearly indicates. Thus, for example, for the genes disclosed herein, e.g. T-bet (mouse) and T-box transcription factor (TBX21) (human), which in some embodiments relate to mammalian nucleic acid and amino acid sequences are intended to encompass homologous and/or orthologous genes and gene products from other animals including, but not limited to other mammals, fish, amphibians, reptiles, and birds. In preferred embodiments, the genes or nucleic acid sequences or products thereof, are human.

[027] Unless otherwise defined, all terms (including technical and scientific terms) used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. It will be further understood that terms, such as those defined in commonly used dictionaries, should be interpreted as having a meaning that is consistent with their meaning in the context of the relevant art and will not be interpreted in an idealized or overly formal sense unless expressly so defined herein.

Definitions

[028] The terminology used herein is for the purpose of describing particular embodiments only and is not intended to be limiting of the invention. As used herein, the singular forms "a", "an" and "the" are intended to include the plural forms as well, unless the context clearly indicates otherwise. Furthermore, to the extent that the terms "including", "includes", "having", "has", "with", or variants thereof are used in either the detailed description and/or the claims, such terms are intended to be inclusive in a manner similar to the term

"comprising."

[029] The term "about" or "approximately" means within an acceptable error range for the particular value as determined by one of ordinary skill in the art, which will depend in part on how the value is measured or determined, i.e., the limitations of the measurement system. For example, "about" can mean within 1 or more than 1 standard deviation, per the practice in the ATTORNEY DOCKET NO: F6456- 16776

UML-129 art. Alternatively, "about" can mean a range of up to 20%, preferably up to 10%, more preferably up to 5%, and more preferably still up to 1% of a given value. Alternatively, particularly with respect to biological systems or processes, the term can mean within an order of magnitude, preferably within 5 -fold, and more preferably within 2-fold, of a value. Where particular values are described in the application and claims, unless otherwise stated the term "about" meaning within an acceptable error range for the particular value should be assumed.

[030] As used herein, a "target cell" or "recipient cell" refers to an individual cell or cell which is desired to be, or has been, a recipient of exogenous nucleic acid molecules,

polynucleotides and/or proteins. The term is also intended to include progeny of a single cell.

[031] "Target molecule" includes any macromolecule, including protein, carbohydrate, enzyme, polysaccharide, glycoprotein, receptor, antigen, antibody, growth factor; or it may be any small organic molecule including a hormone, substrate, metabolite, cofactor, inhibitor, drug, dye, nutrient, pesticide, peptide; or it may be an inorganic molecule including a metal, metal ion, metal oxide, and metal complex; it may also be an entire organism including a bacterium, virus, and single-cell eukaryote such as a protozoon.

[032] By "aptamer" or "nucleic acid aptamer" as used herein is meant a nucleic acid molecule that binds specifically to a target molecule wherein the nucleic acid molecule has sequence that comprises a sequence recognized by the target molecule in its natural setting. Alternately, an aptamer can be a nucleic acid molecule that binds to a target molecule wherein the target molecule does not naturally bind to a nucleic acid. The target molecule can be any molecule of interest. Those in the art will recognize that other embodiments can be readily generated using techniques generally known in the art (see, e.g., Goldet al., Annu. Rev. Biochem. 64:763, 1995; Brody and Gold, J. Biotechnol. 74:5, 2000; Sun, Curr. Opin. Mol. Ther. 2:100, 2000; Kusser, J. Biotechnol. 74:21, 2000; Hermann and Patel, Science 257:820, 2000; and Jayasena, Clinical Chem. 45: 1628, 1999).

[033] As used herein, "an aptamer" is inclusive of one or more aptamers that may have the same specificity for a target molecule, or the aptamers are specific for different targets.

Thus, when using the term "aptamer" the term applies to one or a plurality of aptamers linked or conjugated together and can each be specific for different target molecules. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[034] As used herein, the terms "multi-domain constructs" or "multifunctional constructs" refers to the different variations of the targeting and immune modulating or therapeutic molecules that comprise a first domain which specifically targets or delivers the molecule to a desired cell or in vivo locale and a second domain which modulates expression or function of the immune cell memory or differentiation pathways or molecules associated with these pathways. For example, the multi-domain molecule can comprise at least one aptamer conjugated, linked, fused, etc., to an oligonucleotide such as a siRNA, which modulates the function of an immune memory inducing pathway and/or the function of a molecule associated with such pathways. Another example, would be pathways which induce immune cell differentiation. In some embodiments, the first domain is an aptamer and a second domain is an oligonucleotide.

[035] As used herein, the term "aptamer-oligonucleotide" refers to the compositions described herein wherein at least one aptamer is linked or conjugated to at least one antisense oligonucleotide. Combinations of more than one aptamer and oligonucleotides, with more than one specificity, are included.

[036] As used herein, the term "oligonucleotide specific for" refers to an

oligonucleotide having a sequence (i) capable of forming a stable complex with a portion of the targeted gene, or (ii) capable of forming a stable duplex with a portion of a mRNA transcript of the targeted gene.

[037] As used herein, the term "oligonucleotide," is meant to encompass all forms or desired RNA, RNA/DNA molecules which modulate gene expression and /or function, and includes without limitation: "siRNA," "shRNA" "antisense oligonucleotide" etc. The term also includes linear or circular oligomers of natural and/or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, substituted and alpha-anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioate, methylphosphonate, and the like. Oligonucleotides are capable of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to-monomer interactions, such as Watson-Crick type of base pairing, Hoogsteen or reverse Hoogsteen types of base pairing, or the like. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[038] The multifunctional construct may be "chimeric," that is, composed of different regions. In some embodiments of this invention "chimeric" compounds are aptamer- oligonucleotides, which contain two or more chemical regions, for example, DNA region(s), R A region(s), PNA region(s) etc. Each chemical region is made up of at least one monomer unit, i.e., a nucleotide in the case of an oligonucleotide compound. These oligonucleotides typically comprise at least one region wherein the oligonucleotide is modified in order to exhibit one or more desired properties. The desired properties of the oligonucleotide include, but are not limited, for example, to increased resistance to nuclease degradation, increased cellular uptake, and/or increased binding affinity for the target nucleic acid. Different regions of the

oligonucleotide may therefore have different properties. The chimeric oligonucleotides of the present invention can be formed as mixed structures of two or more oligonucleotides, modified oligonucleotides, oligonucleosides and/or oligonucleotide analogs as described above.

[039] The oligonucleotide can be composed of regions that can be linked in "register," that is, when the monomers are linked consecutively, as in native DNA, or linked via spacers. The spacers are intended to constitute a covalent "bridge" between the regions and have in preferred cases a length not exceeding about 100 carbon atoms. The spacers may carry different functionalities, for example, having positive or negative charge, carry special nucleic acid binding properties (intercalators, groove binders, toxins, fluorophors etc.), being lipophilic, inducing special secondary structures like, for example, alanine containing peptides that induce alpha-helices.

[040] "Analogs" in reference to nucleosides includes synthetic nucleosides having modified base moieties and/or modified sugar moieties, e.g., described generally by Scheit, Nucleotide Analogs, John Wiley, New York, 1980; Freier & Altmann, Nucl. Acid. Res., 1997, 25(22), 4429-4443, Toulme, J.J., Nature Biotechnology 19: 17-18 (2001); Manoharan M., Biochemica et Biophysica Acta 1489: 117-139(1999); Freier S.,M., Nucleic Acid Research, 25:4429-4443 (1997), Uhlman, E., Drug Discovery & Development, 3: 203-213 (2000),

Herdewin P., Antisense & Nucleic Acid Drug Dev., 10:297-310 (2000), ); 2 ^* -0, S ^' -C-linked

[3.2.0] bicycloarabinonucleosides (see e.g. N.K Christiensen.,et al, J. Am. Chem. Soc, 120: 5458-5463 (1998). Such analogs include synthetic nucleosides designed to enhance binding properties, e.g., duplex or triplex stability, specificity, or the like. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[041] As used herein, the term "gene" means the gene and all currently known variants thereof and any further variants which may be elucidated.

[042] As used herein, "variant" of polypeptides refers to an amino acid sequence that is altered by one or more amino acid residues. The variant may have "conservative" changes, wherein a substituted amino acid has similar structural or chemical properties (e.g. , replacement of leucine with isoleucine). More rarely, a variant may have "nonconservative" changes (e.g., replacement of glycine with tryptophan). Analogous minor variations may also include amino acid deletions or insertions, or both. Guidance in determining which amino acid residues may be substituted, inserted, or deleted without abolishing biological activity may be found using computer programs well known in the art, for example, LASERGENE software (DNASTAR).

[043] The term "variant," when used in the context of a polynucleotide sequence, may encompass a polynucleotide sequence related to a wild type gene. This definition may also include, for example, "allelic," "splice," "species," or "polymorphic" variants. A splice variant may have significant identity to a reference molecule, but will generally have a greater or lesser number of polynucleotides due to alternate splicing of exons during mRNA processing. The corresponding polypeptide may possess additional functional domains or an absence of domains. Species variants are polynucleotide sequences that vary from one species to another. Of particular utility in the invention are variants of wild type target gene products. Variants may result from at least one mutation in the nucleic acid sequence and may result in altered mRNAs or in polypeptides whose structure or function may or may not be altered. Any given natural or recombinant gene may have none, one, or many allelic forms. Common mutational changes that give rise to variants are generally ascribed to natural deletions, additions, or substitutions of nucleotides. Each of these types of changes may occur alone, or in combination with the others, one or more times in a given sequence.

[044] The resulting polypeptides generally will have significant amino acid identity relative to each other. A polymorphic variant is a variation in the polynucleotide sequence of a particular gene between individuals of a given species. Polymorphic variants also may encompass "single nucleotide polymorphisms" (SNPs,) or single base mutations in which the polynucleotide sequence varies by one base. The presence of SNPs may be indicative of, for ATTORNEY DOCKET NO: F6456- 16776

UML-129 example, a certain population with a propensity for a disease state, that is susceptibility versus resistance.

[045] As used herein, the term "mR A" means the presently known mR A

transcript(s) of a targeted gene, and any further transcripts which may be elucidated.

[046] By "desired RNA" molecule is meant any foreign RNA molecule which is useful from a therapeutic, diagnostic, or other viewpoint. Such molecules include antisense RNA molecules, decoy RNA molecules, enzymatic RNA, therapeutic editing RNA and agonist and antagonist RNA.

[047] By "antisense RNA" is meant a non-enzymatic RNA molecule that binds to another RNA (target RNA) by means of RNA-RNA interactions and alters the activity of the target RNA (Eguchiet al, 1991 Annu. Rev. Biochem. 60, 631-652).

[048] RNA interference "RNAi" is mediated by double stranded RNA (dsRNA) molecules that have sequence-specific homology to their "target" nucleic acid sequences (Caplen, N. J.,et al., Proc. Natl. Acad. Sci. USA 98:9742-9747 (2001)). In certain embodiments of the present invention, the mediators of RNA-dependent gene silencing are oligonucleotide nucleotide "small interfering" RNA duplexes (siRNAs). The siRNAs are derived from the processing of dsRNA by an RNase enzyme known as Dicer (Bernstein, E.,et al., Nature

409:363-366 (2001)). siRNA duplex products are recruited into a multi-protein siRNA complex termed RISC (RNA Induced Silencing Complex). Without wishing to be bound by any particular theory, a RISC is then believed to be guided to a target nucleic acid (suitably mRNA), where the siRNA duplex interacts in a sequence-specific way to mediate cleavage in a catalytic fashion (Bernstein, E.,et al., Nature 409:363-366 (2001); Boutla, A.,et al., Curr. Biol. 11 : 1776- 1780 (2001)). Small interfering RNAs that can be used in accordance with the present invention can be synthesized and used according to procedures that are well known in the art and that will be familiar to the ordinarily skilled artisan. Small interfering RNAs for use in the methods of the present invention suitably comprise between about 0 to about 50 nucleotides (nt). In examples of nonlimiting embodiments, oligonucleotides can comprise about 5 to about 40 nt, about 5 to about 30 nt, about 10 to about 30 nt, about 15 to about 25 nt, or about 20-25 nucleotides. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[049] By the term "modulate," it is meant that any of the mentioned activities, are, e.g., increased, enhanced, increased, agonized (acts as an agonist), promoted, decreased, reduced, suppressed blocked, or antagonized (acts as an agonist). Modulation can increase activity more than 1-fold, 2-fold, 3-fold, 5-fold, 10-fold, 100-fold, etc., over baseline values. Modulation can also decrease its activity below baseline values. Modulation can also normalize an activity to a baseline value.

[050] As used herein, a "pharmaceutically acceptable" component/carrier etc is one that is suitable for use with humans and/or animals without undue adverse side effects (such as toxicity, irritation, and allergic response) commensurate with a reasonable benefit/risk ratio.

[051] As used herein, the term "safe and effective amount" refers to the quantity of a component which is sufficient to yield a desired therapeutic response without undue adverse side effects (such as toxicity, irritation, or allergic response) commensurate with a reasonable benefit/risk ratio when used in the manner of this invention. By "therapeutically effective amount" is meant an amount of a compound of the present invention effective to yield the desired therapeutic response. For example, an amount effective to delay the growth of or to cause a cancer, either a sarcoma or lymphoma, or to shrink the cancer or prevent metastasis. The specific safe and effective amount or therapeutically effective amount will vary with such factors as the particular condition being treated, the physical condition of the patient, the type of mammal or animal being treated, the duration of the treatment, the nature of concurrent therapy (if any), and the specific formulations employed and the structure of the compounds or its derivatives.

[052] As used herein, a "pharmaceutical salt" include, but are not limited to, mineral or organic acid salts of basic residues such as amines; alkali or organic salts of acidic residues such as carboxylic acids. Preferably the salts are made using an organic or inorganic acid. These preferred acid salts are chlorides, bromides, sulfates, nitrates, phosphates, sulfonates, formates, tartrates, maleates, malates, citrates, benzoates, salicylates, ascorbates, and the like. The most preferred salt is the hydrochloride salt.

[053] "Diagnostic" or "diagnosed" means identifying the presence or nature of a pathologic condition. Diagnostic methods differ in their sensitivity and specificity. The ATTORNEY DOCKET NO: F6456- 16776

UML-129

"sensitivity" of a diagnostic assay is the percentage of diseased individuals who test positive (percent of "true positives"). Diseased individuals not detected by the assay are "false negatives." Subjects who are not diseased and who test negative in the assay, are termed "true negatives." The "specificity" of a diagnostic assay is 1 minus the false positive rate, where the "false positive" rate is defined as the proportion of those without the disease who test positive. While a particular diagnostic method may not provide a definitive diagnosis of a condition, it suffices if the method provides a positive indication that aids in diagnosis.

[054] The terms "patient" or "individual" are used interchangeably herein, and refers to a mammalian subject to be treated, with human patients being preferred. In some cases, the methods of the invention find use in experimental animals, in veterinary application, and in the development of animal models for disease, including, but not limited to, rodents including mice, rats, and hamsters; and primates.

[055] "Treatment" is an intervention performed with the intention of preventing the development or altering the pathology or symptoms of a disorder. Accordingly, "treatment" refers to both therapeutic treatment and prophylactic or preventative measures. "Treatment" may also be specified as palliative care. Those in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. In tumor (e.g. , cancer) treatment, a therapeutic agent may directly decrease the pathology of tumor cells, or render the tumor cells more susceptible to treatment by other therapeutic agents, e.g., radiation and/or chemotherapy. Accordingly, "treating" or "treatment" of a state, disorder or condition includes: (1) preventing or delaying the appearance of clinical symptoms of the state, disorder or condition developing in a human or other mammal that may be afflicted with or predisposed to the state, disorder or condition but does not yet experience or display clinical or subclinical symptoms of the state, disorder or condition; (2) inhibiting the state, disorder or condition, i.e., arresting, reducing or delaying the development of the disease or a relapse thereof (in case of maintenance treatment) or at least one clinical or subclinical symptom thereof; or (3) relieving the disease, i.e., causing regression of the state, disorder or condition or at least one of its clinical or subclinical symptoms. The benefit to an individual to be treated is either statistically significant or at least perceptible to the patient or to the physician. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[056] In accordance with the present invention, there may be employed conventional molecular biology, microbiology, recombinant DNA, immunology, cell biology and other related techniques within the skill of the art. See, e.g., Sambrooket al, (2001) Molecular Cloning: A Laboratory Manual. 3 ^rd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Sambrooket al, (1989) Molecular Cloning: A Laboratory Manual. 2 ^nd ed. Cold Spring Harbor Laboratory Press: Cold Spring Harbor, New York; Ausubelet al, eds. (2005) Current Protocols in Molecular Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Bonifacinoet al, eds. (2005) Current Protocols in Cell Biology. John Wiley and Sons, Inc.: Hoboken, NJ; Coliganet al, eds. (2005) Current Protocols in Immunology, John Wiley and Sons, Inc. : Hoboken, NJ; Coicoet al, eds. (2005) Current Protocols in Microbiology, John Wiley and Sons, Inc.: Hoboken, NJ; Coliganet al, eds. (2005) Current Protocols in Protein Science, John Wiley and Sons, Inc. : Hoboken, NJ; Ennaet al, eds. (2005) Current Protocols in Pharmacology John Wiley and Sons, Inc.: Hoboken, NJ; Hameset al, eds. (1999) Protein Expression: A Practical Approach. Oxford University Press: Oxford; Freshney (2000) Culture of Animal Cells: A Manual of Basic

Technique. 4 ^th ed. Wiley-Liss; among others. The Current Protocols listed above are updated several times every year.

Compositions

[057] Cancer, not unlike chronic infection, is a slowly progressing disease characterized by an increasing state of localized, and eventually systemic, immune dysfunction. Without wishing to be bound by theory, long-lasting memory T cells, generated shortly after vaccination, are better equipped to provide protective immunity against progressing tumors. Embodiments of the invention are directed, inter alia, to treatments that promote the generation of strong memory immune cell responses to any desired antigen be it foreign, auto antigens, pathogenic organism antigens and the like.

[058] Regulation of effector/memory differentiation by intrinsic pathways. When a T cell is activated, following encounter of antigen presented by dendritic cells (DC), it will experience either of two fates. The majority of activated T cells will differentiate into short-lived effectors whereas a smaller proportion, between 2-10%, will differentiate into long-lived memory cells capable of responding to repeated antigenic encounters over an extended period of ATTORNEY DOCKET NO: F6456- 16776

UML-129 time. From a therapeutic standpoint the challenge, heretofore, was how to redirect or skew the differentiation of vaccine-induced activated T cells along the memory pathway. Multiple extrinsic pathways were shown to contribute to the differentiation of antigen activated CD8 T cells into effector and memory CD8 ⁺ T cells. These pathways include costimulation, such as 4- 1BB, OX40, CD27, cytokines, IL-2, IL-12, IL-15, IL-21, IFNa, duration and dose of antigen, overall inflammation, and CD4 T help.

[059] The molecular mechanism underpinning effector/memory differentiation of CD8 ⁺ T cells includes several intrinsic, cell autonomous, pathways and downstream intracellular mediators that regulate effector/memory differentiation. Whereas products such as mTOR, T- bet, Blimp- 1 and GSK3 promote effector differentiation, products such as Bcl-6, Eomes, β- catenin, and TRAF6/AMPK promote memory differentiation.

[060] In general embodiments, the multifunctional constructs comprise domains that can promote the generation of memory responses and enhance protective immunity. These constructs form the basis for developing a new class of drugs to promote the generation of effective memory responses for the treatment of infectious diseases and cancer.

[061] In other embodiments, the multifunctional constructs comprise domains that inhibit the expression or function of mediators that promote effector differentiation. This not only reduces the generation of effectors but also leads to the accumulation of memory cells. Genetic means were used to show that reduced expression of T-bet or Blimp- 1 in CD8 ⁺ T cells promotes their differentiation into memory T cells. T-bet and Blimp- 1 are key transcription factor and transcription repressor, respectively, in cells of lymphoid origin, albeit not limited to CD8 ⁺ T cells.

[062] Pharmacological agents had previously been used to attempt to promote memory differentiation. Inhibition of mTOR activity in mice acutely infected with LCMV using rapamycin promotes the differentiation of the LCMV-specific CD8 ⁺ T cells into CD127 ⁺ CD62L Bcl-2 and KLRG , memory precursors (known as memory precursor effector cells or MPEC), and their subsequent differentiation into long-lived highly proliferative memory cells. Rapamycin-enhanced memory response was studied using rapamycin treatment of mice ATTORNEY DOCKET NO: F6456- 16776

UML-129 receiving day 8 activated LCMV-specific CD8 ⁺ T cells exhibited enhanced protection from a challenge with a recombinant vaccinia virus expressing an LCMV antigen. Rapamycin-mediated enhanced generation of a memory response was also seen during vaccination with HBV antigen incorporated in virus-like particles (VLPs), as well as in macaques vaccinated with a modified vaccinia virus Ankara (MVA). Given the pleiotropic effects of rapamycin and mTOR activity in many cell types (see below), the cell-intrinsic effects of mTOR inhibition on memory

developments were shown by siRNA knockdown of mTOR, raptor, a component of the mTORCl complex, as well as S6K and eIF-4, two of the downstream mediators of mTORCl action. It has been shown that IL-12, the effector cytokine generated during a productive immune response induces mTOR activity in the activated CD8 ⁺ T cells via both PI3K and STAT4 pathways, which in turn induces T-bet expression and downregulates Eomes expression, two hallmarks of effector differentiation. Conversely, rapamycin treatment of the antigen stimulated OT-1 cells downregulated T-bet and upregulated Eomes expression, leading to the enhanced generation of memory cells. The functional importance of the rapamycin-induced memory OT-1 cells was demonstrated by their increased ability, upon adoptive transfer, to protect mice from a challenge from the OVA-expressing E.G7-OVA tumors.

[063] TRAF6 was shown to promote the development of CD8 ⁺ memory T cells by activating AMPK-dependent fatty acid metabolism (Pearce, E.L.,et al., 2009, Nature 460: 103- 107). Administration of the AMPK-activating anti-diabetic drug metformin in conjunction with priming against OVA, enhanced memory development that was capable of inhibiting the growth of a subsequent challenge with E.G7-OVA tumor cells. In a second study, Gattinoniet al.

(Gattinoni, L.,et al., 2010, Clinical Cancer Research, 16:4695-4701) have shown that activating the wnt/ -catenin pathway in murine CD8 ⁺ T cells leads to the generation of population of antigen-activated CD8 ⁺ T cells that exhibit properties of self-renewing memory stem cells (MSC) that have been previously described in human PBMC. This was achieved by incubating transgenic tumor-specific CD8 ⁺ T cells with TWS119, an inhibitor of GSK3P that negatively regulates wnt/ -catenin function. In adoptive transfer experiments on a per cell basis the MSC exhibited a superior proliferative capacity and control of tumor growth than Tcm, Tern or effector T cells, the hierarchy being MSC>Tcm>Tem>Teff ATTORNEY DOCKET NO: F6456- 16776

UML-129

[064] Although the use of drugs to identify mediators in T cell differentiation versus memory have some merit, the drugs may have systemic effects when they are administered to patients, the doses would likely be higher, the target is not localized nor specific and there would be potential health risks associated with the administration of such drugs.

[065] Further limitations in the use of pharmacological agents are as follows: (1) The development of pharmacological agents to modulate the function of intracellular targets that are not accessible to antibodies ("undrugable targets") is highly challenging, and their current availability, especially for clinical use, is limited. There are no pharmacological agents to inhibit Blimp- 1 or T-bet and therefore, before the invention herein, one could not assess their potential value in modulating immunity. For example, inhibition of Blimp- 1 could prevent the exhaustion of vaccine-induced T cells in the tumor environment or even reverse the state of exhaustion in resident T cells. T-bet inhibition may be preferable to mTOR inhibition because mTOR activity may be required to provide the metabolic needs for the expansion of the newly formed MPEC. (2). A more serious concern stems from the often pleiotropic effects of systemically administered pharmacological agents, reflecting the fact that their targets regulate also other pathways and/or function in other cell types. Rapamycin inhibition of mTOR is a case in point. Rapamycin is a highly effective immune suppressive drug used in the setting of allogeneic transplantation and the dose used to promote memory in the murine studies approximated the dose used in immune suppression, except that duration of treatment was reduced. In CD4 ⁺ T cells mTOR regulates their differentiation. Inhibiting mTOR not only prevented the differentiation of antigen activated CD4 ⁺ T cells into Thl, Th2 and Thl7 subsets, but also induced their differentiation into foxp3- expressing Treg. mTOR inhibition was also shown to inhibit T cell trafficking by preventing the downregulation of CD26L and CCR7. Rapamycin inhibition of mTOR in DC inhibited the maturation monocyte derived DC, and prevented IFNa secretion by pDC. Inhibition of GSK3 with TSW119 or other pharmacological drugs can also have significant undesired effects. The wnt/ -catenin pathway has oncogenic potential in humans, posing significant hurdles in approving such drugs for clinical use, despite apparent differential between the dosing required for memory development and tumor formation. In CD4 ⁺ T cells GSK3 inhibition-activated β- catenin is required for Th2 differentiation and promotes the survival of Treg, which will be undesirable in the setting of cancer immunotherapy. In LPS treated DC, GSK3 promotes TLR- ATTORNEY DOCKET NO: F6456- 16776

UML-129 driven IL-12 secretion (independent of the wnt/ -catenin pathway), and therefore inhibition of GSK3 could impair global antigen presentation and induction of immunity. Thus it is important to provide specific delivery and targeting of these molecules to avoid any pleiotropic effects.

[066] Advantages of cell-targeted inhibition. Without wishing to be bound by theory, it was hypothesized that targeted inhibition of mediators of differentiation, for example mTOR, in CD8 ⁺ T cells do not exhibit undesirable effects (from the standpoint of inducing protective immunity) seen with pharmacological inhibitors like rapamycin.

[067] Compositions: The multifunctional constructs of the invention can be used for modulating immune cell memory and/or immune cell differentiation in vitro or in vivo.

[068] In a preferred embodiment, a composition for inducing specific immune cell memory responses in vitro or in vivo, comprises a multifunctional construct having a first domain which specifically homes the construct to a target molecule and a second domain specific for a molecule which modulates an immune cell memory development and response.

[069] In a preferred embodiment, the first domain specifically targets the

multifunctional construct in vitro or in vivo. The specificity of the composition results in localized targeting allowing for the efficient delivery and lower effective amounts of the composition, without the risk of any undesirable systemic effects.

[070] In one preferred embodiment, the first domain which specifically targets the composition comprises: an aptamer, peptides, nucleic acids, glycopeptides, carbohydrates, a synthetic molecules, antibody binding fragments or combinations thereof. In one preferred embodiment, the targeting molecule is an aptamer.

[071] In another embodiment, the second domain is specific for one or more molecules associated with immune cell effector differentiation and/or specific antigenic memory.

Preferably, the composition inhibits or decreases immune cell effector differentiation and increases specific antigenic memory cells or pools thereof. This can be accomplished in multiple ways, such as for example, targeting molecules associated with the development of immune cell ATTORNEY DOCKET NO: F6456- 16776

UML-129 effector differentiation and inhibiting the development of these cells. In one embodiment, the composition is specific for targeting molecules associated with the development of immune memory cells. Preferably, the composition increases the number of antigen specific memory immune cells as compared to a base line control.

[072] In preferred embodiments, the second domain comprises oligonucleotides specific for molecules modulating immune cell differentiation and/or immune cell memory induction. As used herein, the term "oligonucleotide," is meant to encompass all forms or desired R A, R A/DNA molecules, and includes without limitation: "siR A," "shRNA" "antisense oligonucleotide" , interference RNA etc. The term also includes linear or circular oligomers of natural and/or modified monomers or linkages, including deoxyribonucleosides, ribonucleosides, substituted and alpha-anomeric forms thereof, peptide nucleic acids (PNA), locked nucleic acids (LNA), phosphorothioate, methylphosphonate, and the like. Oligonucleotides are capable of specifically binding to a target polynucleotide by way of a regular pattern of monomer-to- monomer interactions, such as Watson-Crick type of base pairing, Hoogsteen or reverse

Hoogsteen types of base pairing, or the like.

[073] In another preferred embodiment, the polynucleotide encoding the multifunctional construct comprises one or more nucleotide substitutions. Preferably, the nucleotide

substitutions comprise at least one or combinations thereof, of adenine, guanine, thymine, cytosine, uracil, purine, xanthine, diaminopurine, 8-oxo-N ⁶ -methyladenine, 7-deazaxanthine, 7- deazaguanine, N ⁴ ,N ⁴ -ethanocytosin, N ⁶ ,N ⁶ -ethano-2,6-diaminopurine, 5-methylcytosine, 5-(C ³ - C ⁶ )-alkynylcytosine, 5-fluorouracil, 5-bromouracil, pseudoisocytosine, 2-hydroxy-5-methyl-4- triazolopyridin, isocytosine, isoguanin, inosine, non-naturally occurring nucleobases, locked nucleic acids (LNA), peptide nucleic acids (PNA), variants, mutants and analogs thereof.

[074] In a preferred embodiment, the second domain modulates function or activity of molecules associated with immune cell effector differentiation and immune memory cell expansion or induction comprises mTOR, mTOR complex, mTORC 1 , mTORC complex, raptor, Blimp- 1, T-box transcription factor (TBX21; T-bet), Glycogen synthase kinase 3 (GSK3), B-cell CLL/lymphoma (Bcl-6), eomesodermin (Eomes), testosterone conversion factor (TCF-1), wnt, β-catenin, tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), AMP-activated ATTORNEY DOCKET NO: F6456- 16776

UML-129 protein kinase (AMPK), TRAF6/AMPK, 4-lBB, OX40, CD27, cytokines, IL-2, IL-12, IL-15,IL- 21, interferons (IFN), CD4, intracellular mediators of CD8 ⁺ T cell differentiation, or

combinations thereof. In this aspect, the second domain inhibits immune cell effector

differentiation. The molecules associated with the pathways involved in modulating the immune memory cells can be both direct or indirect in their interactions with the development of these cells.

[075] In another embodiment, the first domain is specifically targeted to T cells and is specific for activated CD8 ⁺ T cell markers comprising: CD137 (4-lBB), IFN-γ, TNF-a,

CD 1 la/CD 18 (LFA-1), CD2, CD49d/CD29 (VLA-4), CD8 or combinations thereof. In one aspect, the first domain is specific for CD137 (4-lBB).

[076] In another preferred embodiment, the multifunctional constructs are specific for one or more immune cell molecules comprising: 4-lBB (CD137), B7-1/2, 4-1BBL, OX40L, CD40, LIGHT, OX40, CD2, CD3, CD4, CD8a, CDl la, CDl lb, CDl lc, CD19, CD20, CD25 (IL-2Ra), CD26, CD27, CD28, CD40, CD44, CD54, CD56, CD62L (L-Selectin), CD69 (VEA), CD70, CD80 (B7.1), CD83, CD86 (B7.2), CD95 (Fas), CD134 (OX-40), CD137, CD137L, (Herpes Virus Entry Mediator (HVEM), TNFRSF14, ATAR, LIGHTR, TR2), CD150 (SLAM), CD 152 (CTLA-4), CD 154, (CD40L), CD 178 (FasL), CD209 (DC-SIGN), CD 270, CD277, AITR, AITRL, B7-H3, B7-H4, BTLA, HLA-ABC, HLA-DR, ICOS, ICOSL (B7RP-1), NKG2D, PD-1 (CD279), PD-L1 (B7-H1), PD-L2 (B7-DC), TCR-a, TCR-β, TCR-γ, TCR-δ, ZAP-70, lymphotoxin receptor (LTP), NK1.1, HLA-ABC, HLA-DR, T Cell receptor αβ (TCRaP), T Cell receptor γδ (TCRy5), T cell receptor ζ (TCRC), TGFpRII, TNF receptor, Cdl lc, CD 1-339, B7, Foxp3, mannose receptor, or DEC205, variants, mutants, species variants, ligands, alleles and fragments thereof.

[077] In another preferred embodiment, immune cells comprise T cells (T

lymphocytes), B cells (B lymphocytes), antigen presenting cells, dendritic cells, monocytes, macrophages, myeloid suppressor cells, natural killer (NK) cells, NK T cells, suppressor cells, CD4 ⁺ T cells, T regulatory cells (Tregs), cytotoxic T lymphocytes (CTLs), CTL lines, CTL clones, CTLs from tumor, inflammatory, or other infiltrates and subsets thereof. Anyone or more of these cells can be targeted. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[078] The multifunctional constructs are applicable to a wide range of diseases or disorders. Since the multifunctional constructs modulate immune cell memory, immune cell differentiation, these constructs can be tailor made to target the pathways associated with the induction or inhibition of these pathways. For example, in some aspects, the immune memory cell induction is important, in others immune cell differentiation is important and in others a balance is needed. These constructs can be used in the prevention or treatment of infectious disease organisms, parasites, viruses, bacteria, and the like. In other aspects immune suppression may be desired, for example, inflammation, autoimmunity, transplantation and the like. In others a strong memory induction is need as in the case, for example, tumors, infections and the like.

[079] One aspect of the invention comprises a pharmaceutical composition in combination with other treatments for which the constructs are used. For example, in

inflammatory, infectious organisms, autoimmune diseases, cancer, and other related disorders, the appropriate therapeutic care can be conducted in parallel or concomitantly. Examples:

chemotherapy, radiation therapy, antibiotics, anti-inflammatory agent, an immunostimulator, an antiviral agent, or the like. Furthermore, the compositions of the invention may be administered in combination with a cytotoxic, cytostatic, or chemotherapeutic agent such as an alkylating agent, anti-metabolite, mitotic inhibitor or cytotoxic antibiotic, as described above. In general, the currently available dosage forms of the known therapeutic agents for use in such

combinations will be suitable.

[080] In another preferred embodiment, the multifunctional constructs are administered to patients in need of a transplant. These constructs can be administered both prior to and during the transplantation, to modulate the immune responses. It may be necessary to modulate effector and/or memory cell in such cases. Without wishing to be bound by theory, in allotransplanted patients effector and memory responses promote GVHD and GVT respectively, indicating that redirection of alloactivated T cells toward the memory pathway could increase the GVT/GVHD ratio It is thought that donor T cells transplanted with or developing from a tissue or cell transplant react with cells of the human leukocyte antigen (HLA)-matched but genetically non- identical host, providing a beneficial graft-versus-tumor (GVT) response but also resulting in possibly life-threatening graft- versus-host disease (GVHD). The compsoitions of the invention provide the balance to promote the beneficial GVT and inhibit the GVHD effects, as these ATTORNEY DOCKET NO: F6456- 16776

UML-129 compositions provide targeted therapy to reduce the intensity and duration of post-grafting immunosuppression while augmenting GVT activity.

[081] Inhibition of mTORC 1 with CD 137 (4- 1 BB)-raptor siRNA can be compared for example with the effects of rapamycin, such as, for example, on the impairment of dendritic cell (DC) maturation; IFNa secretion of pDC; enhancement of Treg differentiation and foxp3 expression; inhibition of CD4 ⁺ T cell polarization into Thl, Th2 and Thl 7 subsets. In other aspects, for example, inhibition of GSK3P versus TSW119, the effects of the compositions are measured with respect to Th2 polarization; Treg survival; differentiation of tolerogenic IL-10 secreting DC and the like. In another aspect, inhibition of T-bet or Blimp-1 by the compositions, for example, aptamer-siRNA, to measure the specificity of aptamer-targeted siRNA delivery to CD8 ⁺ T cells T-bet dependent CD4 Thl polarization and Blimp-1 mediated B cell differentiation into immunoglobulin-secreting plasma cells are measured. Thus, depending on the composition and the target, various pertinent parameters are measured or assayed to determine the

effectiveness of the compositions.

[082] In embodiments, the compositions are utilized in the induction of antigen specific T memory cells in patients in need thereof. In a preferred embodiment, a method of inducing antigen specific T memory cells in vivo, comprises administering to a patient in need thereof, a construct having multifunctional domains wherein a first domain specifically delivers the construct to a specific in vivo tissue or cell target and, a second domain that specifically targets molecules associated with effector T cell differentiation or T memory cells, wherein the second domain modulates expression or activity of the molecules associated with effector T cell differentiation or T memory cells. Preferably, the first domain specifically targets the

multifunctional construct in vitro or in vivo and comprises: an aptamer, peptides, nucleic acids, glycopeptides, carbohydrates, a synthetic molecules, antibody binding fragments or

combinations thereof. The construct also comprises a second domain is specific for one or more molecules associated with immune cell effector differentiation and/or specific antigenic memory. The second domain of the construct, preferably modulates expression, function or activity of molecules associated with immune cell effector memory comprising Bcl-6, Eomes, TCF-1, wnt, β-catenin, TRAF6/AMPK or combinations thereof. Modulating the expression, function or activity of such molecules, modulates the number of immune memory cells. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[083] In another preferred embodiment, the multifunctional construct is administered to in vitro activated T cells used in adoptive immune therapy. In such cases, the immune cells are cultured ex vivo with the multifunctional constructs prior to administering to a patient.

[084] Various combinations of domains can be used to synthesize constructs which induce memory cell formation in vivo. For example, the second domain of the multifunctional construct upregulates or activates a wnt/ β-catenin pathway or molecules associated with the wnt/ β-catenin pathway. Upregulation of the wnt/ β-catenin pathway by the multifunctional construct increases the immune memory cell pool or numbers of memory T cells specific for an antigen. In some embodiments, a specific antigen may also be administered which provides a larger antigen specific memory cell number, or activity.

[085] In addition, methods of inducing immune memory in vivo utilize a construct wherein the second domain modulates expression, function or activity of molecules associated with immune cell effector differentiation comprising: mTOR, mTORCl, mTORC complex, T- bet, Blimp-1, GSK3P, CD137 (4-1BB), OX40, CD27, cytokines, IL-2, IL-12, IL-15,IL-21, interferons (IFN), CD4, T-box transcription factor (TBX21), Glycogen synthase kinase 3 (GSK3), B-cell CLL/lymphoma (Bcl-6), eomesodermin (Eomes), testosterone conversion factor (TCF-1), wnt, β-catenin, tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), AMP-activated protein kinase (AMPK), TRAF6/AMPK, intracellular mediators of CD8 ⁺ T cell differentiation, or combinations thereof. This type of construct would inhibit immune cell effector differentiation and can be administered with other constructs wherein the targets are molecules associated with T cell memory induction.

[086] In preferred embodiments, the agent which modulates molecules associated with the development of memory T cells are specifically targeted to the appropriate cells in vivo, for example, immune cells as discussed above. In preferred embodiments, a multifunctional construct enhances the generation of antitumor CD 8 memory responses which thereby addresses the two main limitations of using pharmacological agents, limited specificity and "non-drugable" targets. Preferably, the compositions enhance vaccine-induced regression of preexisting poorly immunogenic tumors in patients. The constructs, depending on the target cell and target molecule will be applicable to generation of any type of antigen specific memory cell. Thus, for ATTORNEY DOCKET NO: F6456- 16776

UML-129 example, patients who respond poorly to vaccines, e.g. Hepatitis B vaccinated non-responders or infectious organisms can be treated. Other examples can be the long term maintenance of immune memory so that booster vaccines are not required or boosters can be administered over longer periods of time if required.

[087] In another preferred embodiment, a composition comprises a targeting first domain and a gene silencing second domain to modulate induction of memory T cells. In a preferred embodiment, the gene silencing agent is an siRNA/shRNA, antisense RNA. However, the silencing agent which is specific for the pathways associated with T cell memory can be any type of molecule such as, for example, peptides, proteins, oligonucleotides, organic compounds, inorganic compounds and the like.

[088] In one embodiment, a composition for potentiating (vaccine -induced) T cell- mediated immunological memory in patients with cancer, in particular breast cancer, comprises oligonucleotides in the form of short chemically synthesized siRNAs to downregulate intracellular mediators of CD8 ⁺ effector T cell differentiation, mTORCl complex, T-bet, Blimp- 1 and GSK3p. Unlike antibodies or pharmacological agents, siRNA inhibition is broadly applicable to virtually any target, including "non drugable" intracellular targets such as Blimp- 1 or T-bet. The composition comprising therapeutic siRNAs target activated CD8 ⁺ T cells by conjugation of the siRNAs to oligonucleotide-based aptamer ligands that bind to 4- IBB. 4- IBB is a costimulatory receptor that is transiently upregulated on antigen stimulated CD8 ⁺ T cells. Specific targeting of siRNAs to CD8 ⁺ T cells reduces any undesirable effects that would result from the downregulation of the siRNA targets in other cell types.

[089] In one embodiment, aptamer-targeted oligonucleotide inhibition of intracellular mediators in vaccine-activated CD8 ⁺ T cells enhance the differentiation of these cells into long- lasting memory T cells and engender protective antitumor immunity for breast cancer. The advantages of the aptamer targeted siRNA are that they are more effective than pharmacological agents due to their specific targeting.

[090] In one embodiment, a method of treating breast cancer comprises administering constructs comprising aptamer-oligonucleotide compounds which target "non-drugable" ATTORNEY DOCKET NO: F6456- 16776

UML-129 mediators. Examples include, raptor (mTORCl complex), T-bet, Blimp-1 and GSK3p. The aptamer is specific for T cell specific molecules, such as , for example 4- IBB.

[091] Other Target Molecules and Domains: In another preferred embodiment, a targeting first domain can comprise any nucleic acid or peptide identified by phage display libraries, high throughput screening assays or any other means at the disposal of a user both current and discovered in the future. In other preferred embodiments, the cell targeting first domain may also be conjugated to transporter proteins to increase the transportation of the second domain specific for molecules associated with, for example, T cell memory induction. In another preferred embodiment, the agents embodied herein optionally comprise cell-penetrating domains allowing for the enhanced intra-cellular delivery.

[092] In another preferred embodiment, the multi-functional construct comprises at least two target specific domains and at least one domain which modulates expression and function of one or more molecules associated with T cell memory and/or T cell differentiation. Examples of such molecules comprise: comprising: mTOR, mTORCl, mTORC complex, T-bet, Blimp-1, GSK3P, CD137 (4-1BB), OX40, CD27, cytokines, IL-2, IL-12, IL-15,IL-21, interferons (IFN), CD4, T-box transcription factor (TBX21), Glycogen synthase kinase 3 (GSK3), B-cell

CLL/lymphoma (Bcl-6), eomesodermin (Eomes), testosterone conversion factor (TCF-1), wnt, β-catenin, tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), AMP-activated protein kinase (AMPK), TRAF6/AMPK, intracellular mediators of CD8 ⁺ T cell differentiation, or any combination thereof.

[093] In another preferred embodiment, the target specific domains comprise specificities for similar target molecules, different target molecules, or combinations thereof.

[094] Targeting Domain: In preferred embodiments, the targeting domain is an aptamer. Oligonucleotide (ODN) aptamers are high affinity single stranded nucleic acid ligands which can be isolated trough a combinatorial chemistry process known as SELEX. Aptamers exhibit specificity and avidity comparable to or exceeding that of antibodies and can be generated against most targets. Unlike antibodies, aptamers can be synthesized in a chemical process (using modified nucleotides which confer nuclease resistance and plasma stability), and hence offer significant advantages in terms of reduced production cost and simpler regulatory approval ATTORNEY DOCKET NO: F6456- 16776

UML-129 process. The short oligonucleotide based aptamers of the invention are not expected to exhibit significant immunogenicity in vivo.

Pharmaceutical Compositions

[095] The invention also includes pharmaceutical compositions containing the multifunctional constructs. In some embodiments, the compositions are suitable for internal use and include an effective amount of a pharmacologically active conjugate of the invention, alone or in combination, with one or more pharmaceutically acceptable carriers.

[096] The patient having a pathology, e.g. the patient treated by the methods of this invention can be a mammal, or more particularly, a human. In practice, the agents, are administered in amounts which will be sufficient to exert their desired biological activity.

[097] The pharmaceutical compositions of the invention may contain, for example, more than one specificity. In some examples, a pharmaceutical composition of the invention, containing one or more compounds of the invention, is administered in combination with another useful composition such as an anti-inflammatory agent, an immunostimulator, a

chemotherapeutic agent, an antiviral agent, or the like. Furthermore, the compositions of the invention may be administered in combination with a cytotoxic, cytostatic, or chemotherapeutic agent such as an alkylating agent, anti-metabolite, mitotic inhibitor or cytotoxic antibiotic. In general, the currently available dosage forms of the known therapeutic agents for use in such combinations will be suitable.

[098] Combination therapy (or "co-therapy") includes the administration of the composition and at least a second agent as part of a specific treatment regimen intended to provide the beneficial effect from the co-action of these therapeutic agents. The beneficial effect of the combination includes, but is not limited to, pharmacokinetic or pharmacodynamic co- action resulting from the combination of therapeutic agents. Administration of these therapeutic agents in combination typically is carried out over a defined time period (usually minutes, hours, days or weeks depending upon the combination selected).

[099] Combination therapy may, but generally is not, intended to encompass the administration of two or more of these therapeutic agents as part of separate monotherapy ATTORNEY DOCKET NO: F6456- 16776

UML-129 regimens that incidentally and arbitrarily result in the combinations of the present invention. Combination therapy is intended to embrace administration of these therapeutic constructs in a sequential manner, that is, wherein each therapeutic agent is administered at a different time, as well as administration of these therapeutic agents, or at least two of the therapeutic agents, in a substantially simultaneous manner. Substantially simultaneous administration can be

accomplished, for example, by administering to the subject a single capsule having a fixed ratio of each therapeutic agent or in multiple, single capsules for each of the therapeutic agents.

[0100] Sequential or substantially simultaneous administration of each therapeutic agent can be effected by any appropriate route including, but not limited to, topical routes, oral routes, intravenous routes, intramuscular routes, and direct absorption through mucous membrane tissues. The therapeutic agents can be administered by the same route or by different routes. For example, a first therapeutic agent of the combination selected may be administered by injection while the other therapeutic agents of the combination may be administered topically.

[0101] Alternatively, for example, all therapeutic agents may be administered topically or all therapeutic agents may be administered by injection. The sequence in which the therapeutic agents are administered is not narrowly critical unless noted otherwise. Combination therapy also can embrace the administration of the therapeutic agents as described above in further combination with other biologically active ingredients. Where the combination therapy further comprises a non-drug treatment, the non-drug treatment may be conducted at any suitable time so long as a beneficial effect from the co-action of the combination of the therapeutic agents and non-drug treatment is achieved. For example, in appropriate cases, the beneficial effect is still achieved when the non-drug treatment is temporally removed from the administration of the therapeutic agents, perhaps by days or even weeks.

[0102] Therapeutic or pharmacological compositions of the present invention will generally comprise an effective amount of the active component(s) of the therapy, dissolved or dispersed in a pharmaceutically acceptable medium. Pharmaceutically acceptable media or carriers include any and all solvents, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delaying agents and the like. The use of such media and agents ATTORNEY DOCKET NO: F6456- 16776

UML-129 for pharmaceutical active substances is well known in the art. Supplementary active ingredients can also be incorporated into the therapeutic compositions of the present invention.

[0103] For any agent used in the methods of the invention, the therapeutically effective amount or dose can be estimated initially from activity assays in cell cultures and/or animals. For example, a dose can be formulated in animal models to achieve a circulating concentration range that includes the IC ₅₀ as determined by activity assays (e.g., the concentration of the test compound, which achieves a half-maximal inhibition of the proliferation activity). Such information can be used to more accurately determine useful doses in humans.

[0104] Toxicity and therapeutic efficacy of the peptides described herein can be determined by standard pharmaceutical procedures in experimental animals, e.g., by determining the IC ₅₀ and the LD ₅₀ (lethal dose causing death in 50% of the tested animals) for a subject compound. The data obtained from these activity assays and animal studies can be used in formulating a range of dosage for use in human.

[0105] The dosage may vary depending upon the dosage form employed and the route of administration utilized. The exact formulation, route of administration and dosage can be chosen by the individual physician in view of the patient's condition. (See e.g., Fingl,et al., 1975, in "The Pharmacological Basis of Therapeutics", Ch. 1 p. l). Dosage amount and interval may be adjusted individually to provide plasma levels of the active moiety which are sufficient to maintain therapeutic effects, termed the minimal effective concentration (MEC). The MEC will vary for each preparation, but can be estimated from in vitro and/or in vivo data, e.g., the concentration necessary to achieve 50-90% inhibition of a proliferation of certain cells may be ascertained using the assays described herein. Dosages necessary to achieve the MEC will depend on individual characteristics and route of administration. HPLC assays or bioassays can be used to determine plasma concentrations. Dosage intervals can also be determined using the MEC value. Preparations should be administered using a regimen, which maintains plasma levels above the MEC for 10-90% of the time, preferable between 30-90% and most preferably 50-90%). Depending on the severity and responsiveness of the condition to be treated, dosing can also be a single administration of a slow release composition described hereinabove, with course of treatment lasting from several days to several weeks or until cure is effected or diminution of ATTORNEY DOCKET NO: F6456- 16776

UML-129 the disease state is achieved. The amount of a composition to be administered will, of course, be dependent on the subject being treated, the severity of the affliction, the manner of

administration, the judgment of the prescribing physician, etc.

[0106] The preparation of pharmaceutical or pharmacological compositions will be known to those of skill in the art in light of the present disclosure. Typically, such compositions may be prepared as injectables, either as liquid solutions or suspensions; solid forms suitable for solution in, or suspension in, liquid prior to injection; as tablets or other solids for oral administration; as time release capsules; or in any other form currently used, including eye drops, creams, lotions, salves, inhalants and the like. The use of sterile formulations, such as saline- based washes, by surgeons, physicians or health care workers to treat a particular area in the operating field may also be particularly useful. Compositions may also be delivered via microdevice, microparticle or other known methods.

[0107] Upon formulation, therapeutics will be administered in a manner compatible with the dosage formulation, and in such amount as is pharmacologically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described above, but drug release capsules and the like can also be employed.

[0108] In this context, the quantity of active ingredient and volume of composition to be administered depends on the host animal to be treated. Precise amounts of active compound required for administration depend on the judgment of the practitioner and are peculiar to each individual.

[0109] The pharmaceutical compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. In addition, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulating, or coating methods, and typically contain about 0.1% to 75%, preferably about 1% to 50%), of the active ingredient.

[0110] Liquid, particularly injectable compositions can, for example, be prepared by dissolving, dispersing, etc. The active compound is dissolved in or mixed with a ATTORNEY DOCKET NO: F6456- 16776

UML-129 pharmaceutically pure solvent such as, for example, water, saline, aqueous dextrose, glycerol, ethanol, and the like, to thereby form the injectable solution or suspension. Additionally, solid forms suitable for dissolving in liquid prior to injection can be formulated.

[0111] The compositions of the present invention can be administered in intravenous (both bolus and infusion), intraperitoneal, subcutaneous or intramuscular form, all using forms well known to those of ordinary skill in the pharmaceutical arts. Injectables can be prepared in conventional forms, either as liquid solutions or suspensions.

[0112] Parenteral injectable administration is generally used for subcutaneous, intramuscular or intravenous injections and infusions. Additionally, one approach for parenteral administration employs the implantation of a slow-release or sustained-released systems, which assures that a constant level of dosage is maintained, according to U.S. Pat. No. 3,710,795, incorporated herein by reference.

[0113] Furthermore, preferred compositions for the present invention can be

administered in intranasal form via topical use of suitable intranasal vehicles, inhalants, or via transdermal routes, using those forms of transdermal skin patches well known to those of ordinary skill in that art. To be administered in the form of a transdermal delivery system, the dosage administration will, of course, be continuous rather than intermittent throughout the dosage regimen. Other preferred topical preparations include creams, suppositories, ointments, lotions, aerosol sprays and gels, wherein the concentration of active ingredient would typically range from 0.01% to 15%, w/w or w/v.

[0114] The active compound defined above, may be also formulated as suppositories, using for example, polyalkylene glycols, for example, propylene glycol, as the carrier. In some embodiments, suppositories are advantageously prepared from fatty emulsions or suspensions.

[0115] The compounds of the present invention can also be administered in the form of liposome delivery systems, such as small unilamellar vesicles, large unilamellar vesicles and multilamellar vesicles. Liposomes can be formed from a variety of phospholipids, containing cholesterol, stearylamine or phosphatidylcholines. In some embodiments, a film of lipid components is hydrated with an aqueous solution of drug to a form lipid layer encapsulating the ATTORNEY DOCKET NO: F6456- 16776

UML-129 drug, as described in U.S. Pat. No. 5,262,564. For example, the molecules described herein can be provided as a complex with a lipophilic compound or non-immunogenic, high molecular weight compound constructed using methods known in the art. An example of nucleic-acid associated complexes is provided in U.S. Pat. No. 6,011,020.

[0116] The compounds of the present invention may also be coupled with soluble polymers as targetable drug carriers. Such polymers can include polyvinylpyrrolidone, pyran copolymer, polyhydroxypropyl-methacrylamide -phenol, polyhydroxyethylaspanamidephenol, or polyethyleneoxidepolylysme substituted with palmitoyl residues. Furthermore, the compounds of the present invention may be coupled to a class of biodegradable polymers useful in achieving controlled release of a drug, for example, polylactic acid, polyepsilon caprolactone, polyhydroxy butyric acid, polyorthoesters, polyacetals, polydihydropyrans, polycyanoacrylates and cross- linked or amphipathic block copolymers of hydrogels.

[0117] If desired, the pharmaceutical composition to be administered may also contain minor amounts of non-toxic auxiliary substances such as wetting or emulsifying agents, pH buffering agents, and other substances such as for example, sodium acetate, and triethanolamine oleate. The dosage regimen utilizing the molecules is selected in accordance with a variety of factors including type, species, age, weight, sex and medical condition of the patient; the severity of the condition to be treated; the route of administration; the renal and hepatic function of the patient; and the particular molecule or salt thereof employed. An ordinarily skilled physician or veterinarian can readily determine and prescribe the effective amount of the drug required to prevent, counter or arrest the progress of the condition. Compounds of the present invention may be administered in a single daily dose, or the total daily dosage may be administered in divided doses of two, three or four times daily.

Kits

[0118] Embodiments of the invention provide for kits. In some embodiments a kit comprises a multifunctional construct having a first domain which specifically targets the construct to a target molecule and a second domain specific for a molecule which modulates an immune cell memory development and response. In other embodiments, the kit comprises a construct with one domain for targeting a target molecule and/or a domain specific for a ATTORNEY DOCKET NO: F6456- 16776

UML-129 molecule which modulates an immune cell memory development and response. In some embodiments linker molecules are included.

[0119] In embodiments, the first domain comprises: an aptamer, peptides, nucleic acids, glycopeptides, carbohydrates, a synthetic molecules, antibody or combinations thereof.

[0120] In embodiments, the first domain is specific for one or more immune cell markers comprising: CD137 (4- IBB), B7-1/2, 4-lBBL, OX40L, CD40, LIGHT, OX40, CD2, CD3, CD4, CD8a, CDl la, CDl lb, CDl lc, CD19, CD20, CD25 (IL-2Ra), CD26, CD27, CD28, CD40, CD44, CD54, CD56, CD62L (L-Selectin), CD69 (VEA), CD70, CD80 (B7.1), CD83, CD86 (B7.2), CD95 (Fas), CD 134 (OX-40), CD 137, CD137L, Herpes Virus Entry Mediator (HVEM), TNFRSF14, ATAR, LIGHTR, TR2, CD150 (SLAM), CD152 (CTLA-4), CD154, (CD40L), CD 178 (FasL), CD209 (DC-SIGN), CD 270, CD277, AITR, AITRL, B7-H3, B7-H4, BTLA, HLA-ABC, HLA-DR, ICOS, ICOSL (B7RP-1), NKG2D, PD-1 (CD279), PD-L1 (B7-H1), PD- L2 (B7-DC), TCR-a, TCR-β, TCR-γ, TCR-δ, ZAP-70, lymphotoxin receptor (LTP), NK1.1, HLA-ABC, HLA-DR, T Cell receptor αβ (TCRc^, T Cell receptor γδ (TCRy5), T cell receptor ζ (TCRQ, TGFβRII, TNF receptor, Cdl lc, CDl-339, B7, Foxp3, mannose receptor, or DEC205, variants, mutants, species variants, ligands, alleles or fragments thereof.

[0121] In other embodiments, the second domain is specific for one or more molecules associated with immune cell effector differentiation and/or specific antigenic memory.

[0122] In embodiments, the second domain is an oligonucleotide comprising: a short interfering RNA (siRNA); a micro RNA (miRNA); a small temporal RNA (stRNA); a short hairpin RNA (shRNA) or combinations thereof.

[0123] In embodiments, the second domain modulates expression and/or function of one or more molecules comprising: mTOR, mTOR complexes, raptor, Blimp- 1, T-box transcription factor (TBX21 (T-bet)), Glycogen synthase kinase 3 (GSK3), B-cell CLL/lymphoma (Bcl-6), eomesodermin (Eomes), testosterone conversion factor (TCF-1), wnt, β-catenin, tumor necrosis factor (TNF) receptor-associated factor 6 (TRAF6), AMP-activated protein kinase (AMPK), TRAF6/AMPK or combinations thereof. ATTORNEY DOCKET NO: F6456- 16776

UML-129

[0124] In addition, the kits can include various diluents and buffers, labeled conjugates or other agents, such as enzyme substrates, cofactors and chromogens. Other components of a kit can easily be determined by one of skill in the art. Such components may include disposable gloves, decontamination instructions, applicator sticks or containers, a sample preparatory cup, etc. In one embodiment, a kit comprises buffers or other reagents appropriate for constituting a reaction medium allowing the formation of an aptamer-oligonucleotide conjugation or linkage.

[0125] The invention has been described in detail with reference to preferred embodiments thereof. However, it will be appreciated that those skilled in the art, upon consideration of this disclosure, may make modifications and improvements within the spirit and scope of the invention. Embodiments of the invention may be practiced without the theoretical aspects presented. Moreover, the theoretical aspects are presented with the understanding that Applicants do not seek to be bound by the theory presented.

EXAMPLES

[0126] Example 1: Enhancing CD8 ⁺ T cell memory in vivo using 4-lBB aptamer-raptor siRNA conjugates to downregulate mTORCl function in activated CD8 ⁺ T cells.

[0127] Inhibition of mTOR activity in activated CD8 ⁺ T cells with rapamycin promotes their differentiation into memory cells. To test whether aptamer-targeted siRNA downregulation of mTOR activity in activated CD8 ⁺ T cells can promote memory differentiation an siRNA to raptor was isolated, and was then conjugated to a dimeric form of 4- IBB aptamer which binds to 4- IBB, upregulates transiently on TCR stimulated CD8 ⁺ T cells, and costimulates CD8 ⁺ T cells. Figures 1A, IB show that 4- IBB aptamer-raptor siRNA conjugate (4-lBB-raptor) downregulates raptor RNA and mTORCl activity in CD8 ⁺ T cells, both in vitro and in vivo, respectively. As shown in Figure 1A, incubation of the 4-lBB-raptor siRNA with activated OVA-specific OT-I CD8 ⁺ T cells in vitro led to -50% reduction of raptor RNA levels (>75% with two daily incubations). Consistent with inhibition of mTOR activity, in the 4-lBB-raptor treated group more so than in the rapamycin treated group, inhibition of raptor led to the downregulation of T- bet and upregulation of Eomes. Figure IB shows that systemically administered 4-lBB-raptor to OVA immunized OT-I spiked mice led to the downregulation of mTORC 1 activity in about 60% (64% to 21%) of the circulating antigen-activated CD8 ⁺ OT-1 cells. The CD8 ⁺ T cell targeted ATTORNEY DOCKET NO: F6456- 16776

UML-129 nature of mTORCl inhibition by 4-lBB-raptor conjugate, in contrast to that of rapamycin, is shown by the fact that in a subset of host cells rapamycin treatment inhibited mTOR activity in virtually all cells (932 to 51) whereas 4-lBB-raptor siRNA conjugate did not or barely so (932 to 744).

[0128] Figures 2A-2C show that treatment of mice with 4-lBB-raptor conjugate promotes the differentiation of activated OT-I cells into memory cells evidencing superiority to that of using rapamycin. As shown in Figure 2A, treatment with either rapamycin or 4-1BB- raptor siRNA, but not with 4-1BB-GFP siRNA, led to a 4 to 5-fold increase in the proportion of OT-1 cells exhibiting a central memory phenotype co-expressing CD62L and CD 127 measured 10 days after activation. The functionality of the memory response, namely their ability to respond to a second exposure to antigen at a later time point was assessed by two criteria, proliferation and cytotoxicity. Figure 2B shows that re-vaccination of mice with OVA peptide 30 days later led to a significantly pronounced expansion of the OT-I T cells in mice treated (during initial vaccination) with either 4-lBB-raptor conjugate or with rapamycin. However, when the cytotoxic potential of the memory response was measured using an in vivo cytotoxicity assay, as shown in Figure 3C, the 4-lBB-raptor conjugate treated mice exhibited enhanced cytotoxicity, commensurate with the increased pool of proliferating memory cells as shown in panel Figure 3B, rapamycin treatment inhibited the cytotoxic activity of the memory cells despite the fact that they were able to respond and proliferate. This experiment, shows that whereas both rapamycin and 4-lBB-raptor siRNA lead to the generation of an enhanced memory response in terms of phenotype and proliferative capacity, treatment with rapamycin compromised their cytotoxic capacity. This observation supports the underlying premise and central hypothesis of the approach, namely that (aptamer-siRNA) targeted inhibition of mTOR and other mediators of differentiation in the activated CD8 T cells will obviate undesirable effects resulting from the non targeted administration of pharmacological inhibitors such as rapamycin.

[0129] To determine whether inhibition of mTOR activity in CD8 ⁺ T cells specific to an endogenous weak tumor antigen is also capable of promoting their differentiation into memory cells, the experiments described in Figures 1A, IB and Figures 2 A, 2B and 2C were conducted except that instead of using the transgenic Pmel-1 CD8 ⁺ T cells which recognize an epitope in gplOO, an endogenous tumor antigen in B16 melanoma tumor cells was used. In stark contrast to ATTORNEY DOCKET NO: F6456- 16776

UML-129

OT-I spiked mice, the total number of Pmel-1 cells present 10 days post vaccination and treatment with rapamycin or 4-lBB-raptor siRNA conjugate was 10-30 fold lower. Nonetheless, as shown in Figures 3A and 3B, both by phenotypic and functional criteria, systemic treatment with 4-lBB-raptor siRNA enhanced memory formation which was at least as effective as treatment with rapamycin.

[0130] The dimeric 4-1BB aptamer used to target raptor siRNA to CD8 ⁺ T cells exhibits costimulatory function, and costimulation was shown to promote memory differentiation.

However, any significant contribution of 4- IBB costimulation to enhanced memory formation can be excluded because unconjugated 4- IBB aptamer and 4- IBB aptamer-GFP siRNA conjugate do not enhance memory formation by any criteria tested. This further underscores the value of manipulating the cell-intrinsic mediators of effector/memory differentiation to promote the formation of a potent memory response.

[0131] To assess whether targeted inhibition of Blimp-1 or T-bet in CD8 ⁺ T cells promote memory differentiation, a 4- IBB aptamer-Blimp-1 and T-bet siRNA conjugates were developed and were characterized in vitro for knockdown of the corresponding targets in OT-1 cells as shown in Figure 1A for raptor . Both 4-lBB-Blimp-l and 4-lBB-T-bet enhanced the differentiation of CD62I/CD44+ memory OT-I with memory phenotype as determined 5 days post vaccination, and enhanced a recall response as shown in Figure 4. This experiment confirms the role of Blimp-1 and T-bet in effector/memory differentiation, provides additional evidence for the potential usefulness of the aptamer-targeted siRNA inhibition to enhance memory development, and underscores the versatility of siRNA technology to inhibit

"undrugable" targets.

[0132] Example 2: Development and in vitro characterization of optimal configurations of 4- IBB aptamer - siRNA conjugates corresponding to raptor (mTORCl complex), T-bet, Blimp-1 and ϋΞΚ3β.

[0133] Design of aptamer-siRNA conjugates. Potent siRNA candidates for raptor, Blimp-1, T-bet and GSK3P, are screened using the RNAxs algorithm (Tafer, H.,et al., 2008. Nat Biotechnol 26:578-583). 6 to 8 21 nt long siRNAs are designed for each target and tested in a quick screening assay using the dual luciferase psiCHECK™ assay system (Promega corp.). ATTORNEY DOCKET NO: F6456- 16776

UML-129

Several algorithms for conjugating the siRNA to the 3' end of the dimeric 4- IBB aptamer as described (Dassie, J.F.,et al., 2009. Nat Biotechnol 27:839-849) are tested. The best so far has been the use of a collinear transcript of aptamer and sense siRNA strand to which the antisense strand is hybridized.

[0134] Binding to 4- IBB and targeted knockdown in activated CD8 T cells. Fluorophore tagged aptamer-siRNA conjugate (Alexa 488 conjugated to 5' end of the antisense strand) and confocal microscopy are used to demonstrate 4- IBB dependent binding of aptamer-to 4-1BB- expressing activated CD8 T cells, but not to quiescent CD8 T cells or CD4 T cells. siRNA target knockdown is determined primarily by qRT-PCR as shown in Figure 1 A and at the protein or functional level (see for example Figure IB). Non-targeted products that are under control of the siRNA-targeted product is also measured. For example raptor/mTORCl inhibition mediated downregulation of T-bet and upregulation of Eomes (Figure 1A) or GSK3P inhibition mediated upregulation of Eomes. A mutant non-binding 4- IBB aptamer-siRNA conjugate is used to provide another level of evidence for the 4- IBB targeted mechanism of the observed inhibition.

[0135] Functional assessment. The survival and proliferative potential of peptide activated OT-I T cells treated with aptamer-siRNA or pharmacological agents in the presence of IL-12 is assessed.

[0136] Example 3: Developing optimal conditions for the induction of memory CD8+ T cells responses in mice against the foreign chicken OVA and the endogenous gplOO tumor antigen.

[0137] Best-in class aptamer-siRNA conjugates identified are tested, singly and in combination, for the generation of CD8 ⁺ memory responses using the OT-I and Pmel-1 models.

[0138] Pharmacological and biochemical analysis. The extent and time course of aptamer targeted siRNA accumulation in the adoptively transferred OT-1 or Pmel-1 cells is monitored using ³² P-labeled conjugate. Target gene knockdown and mechanistic evidence for siRNA-mediated action in vivo is obtained by qRT-PCR (as shown in Figure 1 A) and RACE PCR, respectively, in the re-isolated cells. Specificity of targeting to (the adoptively transferred) activated OT-I and Pmel-1 cells is demonstrated by analyzing host tissue, including host CD8 ⁺ T ATTORNEY DOCKET NO: F6456- 16776

UML-129 cell, T-bet expressing activated CD4 ⁺ T cells, and Blimp- 1 expressing activated B cells (as illustrated for example in Figure IB). The lack of specificity of pharmacological agents is evaluated for rapamycin using the S6K phosphorylation assay (Figure IB), and for TSW119 measuring the accumulation of the inactive (phosphorylated) form of GSK3P in the adoptively transferred CD8 T cells and host tissues. Aptamer-siRNA conjugates exhibiting off target effects, determined by measuring serum levels for IFNa, TNF or IL-6, are discarded.

[0139] Measuring the generation of long lasting functional memory. Two aspects of memory differentiation was measured as shown in Figures 2A, 2B and 2C, what proportion of activated T cells differentiate into cells with memory characteristics, and the ability to respond to a second encounter with antigen at a later time point (recall response). Cells for analysis were isolated from the spleen (enriched for Tern) and from draining lymph nodes (enriched for Tcm). To evaluate the potential of the aptamer-siRNA conjugates to enhance (vaccine -induced) protective immunity in stringent tumor models, the dose, frequency and timing of aptamer- siRNA administration following antigenic stimulation were optimized. These experiments determine which (combinations of) aptamer-siRNA conjugates generate a more potent memory response and how they compare to pharmacological agents. Of note, the targeted inhibition studies of GSK3P in CD8 ⁺ T cells will help resolve the role of the wnt pathway and/or GSK3P in memory formation.

[0140] Differentiation of activated CD8 ⁺ T cells into memory precursors (MPEC). The characteristics of memory cells that are generated shortly after activation are phenotype and co- expression of multiple cytokines. Memory cells are CD44 ⁺ CD127 ⁺ . Central memory cells are also CD62L ⁺ . The generation of memory stem cells (MSC) that accumulate when GSK3P is inhibited and the wnt/p-catenin pathway is activated are measured. MSC are CD44 ^l0W CD62L but can be distinguished from naive cells by the expression of SCA-1, Bcl-2 and CD122.

Multiparameter flow cytometry is also used to enumerate activated OT-1 or Pmel-1 cells co- expressing multiple cytokines, IFNy, IL-2 and TNF, a characteristic of activated CD8 T cells slated to differentiated into memory cells.

[0141] Generation of a functional memory pool. The functionality of a long-lasting memory response is determined by measuring the recall response, the ability to respond to a ATTORNEY DOCKET NO: F6456- 16776

UML-129 subsequent exposure to antigen 30 and 60 days after priming & treatment. Three parameters of functionality are assessed. Two parameters were proliferation and cytotoxicity, as described in Figures 2B and 2C, respectively. The third parameter is the inhibition of tumor growth when challenged with OVA-expressing EG.7-OVA or B16 melanoma cells which express gplOO.

[0142] Synergy of co-targeting mediators of CD8 T cell differentiation. Mediators of memory differentiation could exert synergistic or complementary effects. For example, the wnt/p-catenin pathway also promotes mTORCl activity antagonizing its effect on memory differentiation. Thus inhibiting both GSK3P and mTOR would be advantageous. Likewise, inhibiting Blimp- 1 to counter exhaustion could enhance the effects of targeting other mediators. The versatility of the aptamer targeted siRNA technology, illustrated in the data shown in Figure 4, provides a novel and unique tool that is used to assess the potential benefits of co-inhibiting multiple mediators of T cell differentiation.

[0143] Example 4: Induction of protective immunity in the TUBO and 4T1 models for breast cancer.

[0144] The issue evaluated in these experiments is whether and to what extent potentiating the antitumor CD8 ⁺ T cell memory response using the best-in-class (combinations of) aptamer-siRNA conjugates enhance the antitumor impact of a weak vaccination protocol. These experiments test the hypothesis that given their specificity, the antitumor activity of aptamer-siRNAs are superior to that of pharmacological agents. The therapeutic value of manipulating memory with pharmacological agents was demonstrated using experimental systems whereby antigen-specific transgenic OT-I or Pmel-1 T cells were adoptively transferred to mice challenged with tumor, and/or using the immunogenic OVA-expressing E.G7-OVA tumor model. The antitumor activity of aptamer-siRNA conjugates using more stringent and clinically relevant tumor models, whereby the aptamer-siRNA conjugates are administered to tumor bearing mice in order to enhance vaccine-induced immunity directed against endogenous tumor antigens expressed in two poorly immunogenic tumors of breast origin.

[0145] Tumor models. The 4T1 breast tumor cell line, a thioguanine -resistant variant of a spontaneously arising tumor derived from a breast carcinoma, is a poorly immunogenic highly metastatic tumor cell line of Balb/c origin (H-2 ^d ) origin. The TUBO (H-2 ^d ) tumor cell line was ATTORNEY DOCKET NO: F6456- 16776

UML-129 established from a tumor originating in the transgenic Balb/NeuT mouse. Balb/NeuT mice, which carry an activated rat Her2 oncogene, represent an excellent model for breast cancer, and is used in future studies.

[0146] Experimental design. Guided by the demonstration that adoptively transferred transgenic Pmel-1 derived MSC and Tcm generated by incubation with TSWl 19 exhibit superior capability to inhibit the growth of established B16 melanoma tumors, use of a therapeutic lung metastasis model, whereby TUBO or 4T1 cells are administered via the tail vein, vaccination and treatment with aptamer-siRNA or pharmacological agent starts between days 3 and 7 depending on the model and treatment, and lung metastasis is measured 28-33 days later when mice in the control group show early signs of morbidity, or by following the survival of the treated mice. Vaccinations are calibrated to provide a limited measure of tumor protection and treatment with aptamer-siRNA are optimized in terms of dose, frequency and timing. Vaccination in the TUBO model consists of irradiated TUBO cells which has a small anti-metastatic effect in this model. In the 4T1 model mice is vaccinated with GM-CSF expressing irradiated 4T1 cells or bone marrow derived DC pulsed with tumor lysate. The duration of the antitumor immune response are determined in a prophylactic protocol whereby mice are vaccinated and treated with aptamer- siRNA or pharmacological agent and challenged with tumor one to several month later.

[0147] Immunological analysis. Mice are monitored for the induction and persistence of tumor- specific CD8 ⁺ T cell responses by a) Measuring IFNy secretion from in vitro cultured CD8 ⁺ T cell-enriched splenocytes incubated with tumor or control lysate loaded DC and b) In vivo cytotoxicity using differentially CFSE-labeled tumor and control targets. The role of CD8 ⁺ , as well as helper CD4 ⁺ T cell responses in protective immunity are determined by antibody depletion experiments.

[0148] Example 5: Aptamer-targeted siRNA inhibition of mTORCl in CD8 ⁺ cytotoxic T lymphocytes enhances immunological memory and antitumor immunity.

[0149] Described in this study is a versatile, broadly applicable, and clinically feasible approach to promote the generation of memory T cell responses that addresses the main limitations of pharmacological agents. siRNAs were used to downregulate intracellular mediators of CD8 ⁺ T cell effector differentiation. RNAi is broadly applicable to virtually any ATTORNEY DOCKET NO: F6456- 16776

UML-129 target, including "non drugable" intracellular targets such as Blimp- 1 or T-bet. To reduce the undesirable effects that could result from the downregulation of the siRNA targets in other cell types, the systemically administered siRNA was targeted to CD8 ⁺ T cells using oligonucleotide aptamers. Aptamers are high affinity single-stranded nucleic acid ligands that can be isolated using a combinatorial chemistry process known as SELEX (Ellington, A.D. & Szostak, J.W. Nature 346, 818-822 (1990); Tuerk, C. & Gold, L. Science 249, 505-510 (1990)). Aptamers exhibit specificity and avidity comparable to or exceeding that of antibodies and can be generated against most targets. In this study it was shown that aptamer-targeted siRNA inhibition of mTOR function in CD8+ T cells potentiates vaccine-induced memory and antitumor immunity that is quantitatively comparable but qualitatively superior to rapamycin treatment.

[0150] Materials and Methods

[0151] Animals: 5-6 week old female C57BL/6 (H-2 ^b ) , Balb/c (H-2 ^d ) mice, and transgenic OT-1 (H-2 ^b ) and Pmel-l(H-2 ^d ) mice, were purchased from The Jackson Laboratory (Bar Harbor, ME) and used within 1-3 weeks.

[0152] Cells: Splenocytes were isolated from CD45.1 OT-I mice and RBC were lysed with ACK solution (Gibco, Life Technologies, Grand Island, NY). Mononuclear cells were washed and incubated overnight with 1 nM of the chicken ovalbumin (OVA) MHC class I SIINFEKL (SEQ ID NO: 2) peptide (Anaspec Inc., Fremont, CA) at a density of 10 ⁶ cell/ml in complete RPMI-1640 media supplemented with 10% FBS, essential and non-essential amino acids, Na Pyruvate (Gibco, Life Technologies, Grand Island, NY) and 2 ng/ml murine IL-12 (R&D Systems, Inc., Minneapolis, MN). After overnight incubation cells were washed extensively to remove excess peptide and used the in subsequent analysis.

[0153] Quantitative PCR (qPCR). Cells were plated in triplicates into 96-well plates (10 ⁵ cells/well), and incubated with 0.8 μΜ aptamer-siRNA conjugates three times every 8 hours. 36 hrs after the last treatment cells were lysed with RLT buffer and RNA was isolated with RNeasy kit (Qiagen, Inc., Valencia, CA). RNA was quantified using an Agilent 2100 Bioanalyzer (Agilent Technologies, Inc., Santa Clara, CA). cDNA synthesis was performed using the High Capacity cDNA Reverse Transcription kit (Applied Biosystems, Carlsbad, CA). cDNA ATTORNEY DOCKET NO: F6456- 16776

UML-129 equivalents of 25 ng of mRNA were used per reaction in a Taqman qPCR assay using Step One qPCR machine (Applied Biosystems, Carlsbad, CA) with primer sets corresponding to the gene of interest or housekeeping products.

[0154] Persistence. Cells were plated into 6-well plates (10 ⁶ cells/5 ml) and incubated with 0.8 μΜ aptamer-siRNA conjugates three times every 8 hours or with rapamycin at 0.5 μg/5 ml. 72 hrs after plating cells were washed and cells were replated (10 ⁶ cells/5 ml) and incubated in complete RPMI-1640 media with addition of 5 ng/mL recombinant IL-7 (R&D Systems, Inc., Minneapolis, MN). Every 3-5 days cells were collected, and 10 ⁶ cells plated per well.

[0155] Proliferation. At day 25 the cells were harvested, washed, and plated into 96-well plates, 10 replicates per condition. 5 wells per each condition were treated with 0.01 nM

SIINFEKL (SEQ ID NO: 2) peptide overnight and 5 other wells were treated with control SDYEGRLl (SEQ ID NO: 3) influenza NP peptide 18 hours later 1 μθ H ³ -thymidine was added to each well. 6 hours later cells were harvested and tritium incorporation was measured using a Wallac micro-beta scintillation counter (Perkin Elmer, Waltham, MA).

[0156] Design and characterization of aptamer-siRNA conjugates. A bivalent murine 4- lBB-binding aptamer50 was transcribed in vitro using the DURASCRIBE T7 transcription kit (Illumina, San Diego, CA). The DNA template (SEQ ID NO: 1) encoded a T7 promoter (lower case), two aptamers (BOLD) separated by a single-stranded linker {italicized) fused with the passenger strand of an siRNA (underlined) against Raptor mRNA. mRaptor mRNA targeting siRNA was characterized as described (Berezhnoy, A.et al., Thermal stability of siRNA modulates aptamer-conjugated siRNA inhibition. Molecular Therapy: Nucleic Acids In press(2012)). Briefly, candidate sequences were predicted using HTC dispatcher (City of Hope - Biomedical Informatics, Duarte, CA), siRNA scales (Department of Human Genetics at the University of Utah, Salt Lake City, UT) and siDESIGN (Dharmacon, Thermo Fisher Scientific; Lafayette, CO) software. Overlapping predictions featuring low Tm were selected and screened for specific activity as 4- IBB aptamer conjugates using SICHECK® assay. The aptamer- passenger strand fusion transcript was purified by polyacrylamide gel electrophoresis and annealed to a chemically synthesized guide stand. SICHECK® assay was used to confirm that ATTORNEY DOCKET NO: F6456- 16776

UML-129 target knockdown by the aptamer-siRNA conjugate was comparable to that of free duplex siRNA.

[0157] gggggaattctaatacgactcactataGGGCGGGAGAGAGGAAGAGGGATGGGCG ACCGAACGTGCCCTTCAAAGCCGTTCACTAACCAGTGGCATAACCCAGAGGTC G AT AGT AC TGG ATC C C GC C C 7XC GC GGC C G AG AG AGG AAG AGGG ATGGGC G A CCGAACGTGCCCTTCAAAGCCGTTCACTAACCAGTGGCATAACCCAGAGGTCG ATAGTACTGGATCGGCCGCrCCCCTCGGGATCTCTTCCAAAA (SEP ID NO: 1).

[0158] Adoptive transfer of OT-I cells into mice and treatment with rapamycin or aptamer-siRNA conjugates. Splenocytes from CD45.1 OT-I mice were isolated and enriched for CD8 ⁺ T cells using Ly-2 microbeads (Miltenyi Biotec, Cambridge, MA) to purity over 90% confirmed by flow cytometry. 0.5 ^χ 10 ⁶ CD8 ⁺ cells were transferred to CD45.2 C57B1/6 mice by tail vein injection. 48 hours after transfer animals were injected i.v. with 10 μg SIINFEKL (SEQ ID NO: 2) peptide, the chicken ovalbumin (OVA) dominant class I epitope, and with 10 μg of E. coli LPS (Sigma-Aldrich Corp. St. Louis, MO) in 100 μΐ PBS. Starting 6 hours after peptide administration animals received i.v. injection of 0.25 nmoles of aptamer-siRNA conjugate in 100 μΐ PBS twice daily, or 1.5 μg rapamycin administered i.p. in 200 μΐ PBS immediately after peptide administration, also twice daily.

[0159] To measure mTORCl activity, 36 hours following the second aptamer-siRNA conjugate or rapamycin injection splenocytes were isolated, fixed in 4% PFA for 10 minutes in RT, and red blood cells were lysed with a 0.1% Triton X-100/PBS solution (37°C for 20 minutes), an equal volume of ice-cold wash buffer was added, and the suspension was centrifuged (300g, 6 minutes, 4°C). Cells were dehydrated with 80%> methanol (prechilled to -20°C) and incubated on ice for 10 minutes. Then, cells were washed with ice-cold PBS, blocked with ice-cold washing buffer (4°C for 30 minutes), and incubated with CD45.1-PacBlue (BioLegend, San Diego, CA) and p-S6-Alexa488 monoclonal antibodies (mAbs) (Cell Signaling Technology, Inc. Danvers, MA). To measure mTORCl and mTORC2 activity in the same preparation, splenocytes were incubated with anti-CD8 and anti-CD45.1 mAbs for 15 minites at +4°C, washed, and then fixed and permeabilized using Fix/Perm kit (BD Biosciences, San Diego, CA) according to manufacturer's instructions. After permeabilization cells were stained ATTORNEY DOCKET NO: F6456- 16776

UML-129 with anti-phospho S235/236-S6/Alexa488 together with anti-phospho S473-AKT/Alexa647 mAbs (Cell Signaling Technology, Inc. Danvers, MA) and analyzed by flow cytometry.

[0160] OT-I in vivo cytotoxicity assays: Splenocytes from C57BL/6 mice were incubated with 100 nM of either the OVA SIINFEKL (SEQ ID NO: 2) peptide or with SDYEGRLI (SEQ ID NO: 3) influenza NP peptide MHC class I-restricted (control) peptide in serum- free RPMI- 1640 media for 1 hour at 37°C, washed and incubated with either 5 μΜ or 0.5 μΜ CFSE solution in PBS and 2% FBS at RT for 30 minutes. After extensive washing 5x 10 ⁶ peptide loaded CFSE labeled cells were injected i.v. into OT-I harboring mice treated with aptamer-siRNA conjugates or with rapamycin. 17 hour after transfer splenocytes were isolated and specific lysis was measured as the ratio of remaining SIINFEKL (SEQ ID NO: 2) loaded (CFSE ^high )/control peptide loaded (CFSE ^low ) targets. The proportion of OT-I cells in the splenocytes was determined by co-staining for CD8 and CD45.1. Alternatively, at day 30 splenocytes were isolated from OT-I transferred mice treated with rapamycin or with aptamer-siRNA conjugates and the proportion of OT-I cells was determined in each mouse by CD8 and CD45.1 co-staining. 5x l0 ⁶ CFSE-labeled OVA and control peptide loaded splenocytes were mixed with splenocytes containing 5 ^X 10 ⁴ OT-I cells and injected i.v. into C57B1/6 mice. 17 hour after transfer splenocytes were isolated and specific lysis of the OVA peptide loaded splenocytes was measured.

[0161] Mixed lymphocyte reaction. Female C57B1/6 mice (H-2 ^b ) were injected subcutaneously with 10 ⁶ irradiated (6000 Rad) GM-CSF-secreting B16 cells (GVAX). 24 hours later, GVAX-immunized or untreated mice were injected twice daily with aptamer-siRNA conjugate or with rapamycin and 24 hour after the second injection CD1 lc ⁺ DC were purified from the spleen using CD1 lc MicroBeads (Miltenyi Biotec, Cambridge, MA) and irradiated 2000 Rad prior MLR. In parallel, splenocytes were isolated from female Balb/c mice (H-2 ^d ) mice and 4>< 10 ⁵ cells mixed with 10 ⁴ CD1 lc enriched CD57BL/6-derived splenocytes, and plated into round-bottom 96-well plates in quintuplicates in complete RPMI-1640 media. 4 days after plating 1 \x,Ci ³ H-thymidine was added to each well and tritium incorporation was measured 6 hours later using Wallac micro-beta scintillation counter (Perkin Elmer, Waltham, MA). ATTORNEY DOCKET NO: F6456- 16776

UML-129

[0162] Adoptive transfer of Pmel-1 cells. 10 ⁶ splenocytes from Pmel-I transgenic Thyl .1 C57BL/6 mice were transferred to congenic CD90.2 (Tyl .2+) C57BL/6 mice by i.v. injection. 48 hours later 100 μg of KVPR QDWL (SEQ ID NO: 4) human gplOO peptide (Anaspec Inc., Fremont, CA) and 10 μg of E. coli LPS were injected intravenously and mice were treated with rapamycin or with aptamer-siRNA conjugates as described above. Proliferation and phenotypic analysis was performed as described for OT-I cells except that cells were co-stained for CD90.1 (Thy 1.1) instead of CD45.1. To determine the antitumor effector functions of the Pmel-1 cells, 30 days after peptide administration mice were challenged with 10 ⁵ B16/F10 melanoma tumor cells injected subcutaneously and tumor growth was monitored daily. Mice were sacrificed when tumor diameter reached 12 mm.

[0163] Tumor immunotherapy studies. C57B1/6 mice were immunized with 10 ⁶ irradiated (6000 Rad) GM-CSF-secreting B16/F10 melanoma cells (GVAX) and 24 hours later mice were treated with 0.25 nmoles of aptamer-siRNA conjugates administered i.v. or with 1.5 μg of rapamycin administered i.p., three times daily. At day 50 mice were challenged subcutaneously with 10 ⁶ B16/F10 tumor cells and tumor growth was monitored daily. Mice were sacrificed when tumor diameter reached 12 mm. Alternatively, mice were injected subcutaneously with 10 ⁵ B16/F10 cells and 5 days later immunized with GVAX. 24 hous later mice were treated with 0.25 nmoles of aptamer-siRNA conjugates administered i.v. or with 1.5 μg of rapamycin administered i.p., repeated on day 9 and 12.

[0164] Statistical analysis. Non-paired two-tailed student t-test was used to determine statistical power for percentages and absolute numbers. Differences with p<0.05 were considered significant.

[0165] Results

[0166] Aptamer-targeted siRNA knockdown of raptor RNA and inhibition of mTORCl activity. To test whether CD8 ⁺ T cell memory can be enhanced by targeted inhibition of mTOR, a raptor specific siRNA was conjugated to a component of the mTORCl complex (Powell, D.,et al. Annu Rev Immunol 30, 39-68 (2012)), to a dimeric aptamer that binds to 4-1BB and costimulates antigen-activated CD8 ⁺ T cells (McNamara, J.O.,et al. J Clin Invest 118, 376-386 (2008)). 4-1BB is a major costimulatory molecule that is transiently expressed on CD8 ⁺ T cells ATTORNEY DOCKET NO: F6456- 16776

UML-129 following TCR stimulation (Croft, M. Nat Rev Immunol 9, 271-285 (2009); Kwon, B.,et al. Trends Immunol 23, 378-380 (2002); Wang, C.,et al. Immunol Rev 229, 192-215 (2009)). Incubation of activated OT-1 cells, transgenic CD8 ⁺ T cells that recognize a determinant of the chicken OVA product, with 4- IBB aptamer-raptor siRNA (4-lBB-raptor) conjugates downregulated raptor RNA in an-aptamer dependent manner (Figure 11 A). It was hypothesized that the observed reduction in raptor RNA levels which led to the inhibition of mTOR activity was provided by the observations that raptor RNA downregulation was accompanied by downregulation of T-bet RNA and upregulation of Eomes RNA (Takemoto, N.,et al. J Immunol 177, 7515-7519 (2006)) (Figure 11B), and that the 4-lBB-raptor conjugate treated OT-1 cells exhibited enhanced survival and proliferative capacity comparable to that of rapamycin treated cells (Araki, K.,et al. mTOR regulates memory CD8 T-cell differentiation. Nature 460, 108-112 (2009); Rao, R.R.,et al. Immunity 32, 67-78 (2010)) (Figures 11C and 1 ID).

[0167] To test whether systemic administration of 4-lBB-raptor conjugates is capable of inhibiting mTOR activity in activated CD8 ⁺ T cells in vivo, OT-I cells were transferred to mice, vaccinated with OVA peptide, and treated with aptamer-siRNA conjugates or with rapamycin. Two days later mTOR activity was determined in the host cells and donor OT-I cells by measuring the phosphorylation of one of its downstream products, S6. As shown in Figure 5A, treatment of the OT-I bearing mice with rapamycin or with 4-lBB-raptor, but not 4-1BB-GFP, conjugate downregualted mTOR activity in 93% and 59% of the OT-1 cells, respectively. The cell and target specificity of raptor siRNA inhibition is shown by the fact that rapamycin, but not the 4-lBB-raptor conjugate, inhibited mTOR activity also in a proportion of host cells (Figure 5A), and that the 4-lBB-raptor conjugate inhibited the activity of mTORCl but not mTORC2, whereas rapamycin inhibited both mTOR complexes (Figure 5B). The small decrease of phospho-S6-expressing host (CD45.1 ) cells seen in the 4-lBB-raptor conjugate-treated mice may correspond to a small fraction of non-CD8 ⁺ T cells that also express 4-lBB (Vinay, O.S.et al. Cellular & Molecular Immunology 8, 281-284 (2011); Palazon, A.,et al.. Cancer Res 71, 801- 811 (2011)). In addition, unlike rapamycin, the 4-lBB-raptor conjugate did not inhibit mTOR activity in host CD3 CD8 T cells.

[0168] Inhibition of raptor in CD8 ⁺ T cells promotes the development of enhanced memory responses. It was next determined whether the 4-lBB-raptor conjugate-mediated mTOR ATTORNEY DOCKET NO: F6456- 16776

UML-129 inhibition leads to the generation of enhanced memory CD8 ⁺ T cell responses in mice. As shown in Figure 6A, six days after vaccination with OVA peptide the number of OT-I cells increased in mice treated with 4-lBB-raptor conjugates though the difference did not reach statistical significance (compared to 4-lBB-GFP). In mice treated twice with rapamycin OT-I numbers decreased slightly, while 8 or more injections were detrimental, unlike what was seen in the acute LCMV infection model (Araki, K.,et al. mTOR regulates memory CD8 T-cell differentiation. Nature 460, 108-112 (2009)). The differences in the rapamycin effects in the LCMV and OT-I models may reflect the differences in the conditions prevailing during priming of the CD8 T cell responses. In LCMV infected mice the CD8 T cells are primed over an extended period of 4-7 days under strong inflammatory conditions, whereas in the OVA+LPS vaccinated OT-I bearing mice the duration and intensity of inflammatory conditions are reduced. Figure 6B shows that at day 5 a higher proportion of OT-1 cells in mice treated with rapamycin or 4-lBB-raptor, but not 4-lBB-GFP, conjugate exhibited CD62 ^high CD44 ^high phenotype indicative of enhanced proliferative capacity and potential to develop into memory cells. At latter time points increased numbers of OT-I cells accumulated in the blood of both rapamycin and 4-1BB raptor treated mice (Figure 6C), and at day 28 in the spleen (Figure 6D). Thus, both rapamycin and 4-lBB-raptor treatment enhanced the persistence and proportion of OT-I cells that are enriched for cells with a memory precursor phenotype.

[0169] The functional status of the persisting OT-I cells was determined by measuring their proliferative capacity and cytotoxic effector functions following antigenic re-exposure. Figure 7A shows that in the rapamycin and 4-lBB-raptor, but not 4-lBB-GFP, conjugate -treated mice that were re-vaccinated with OVA peptide 35 days following priming, the OT-I cells accumulated to higher numbers in the spleen, and contained a higher proportion of multifunctional cells that co-expressed IFNy, TNF, and IL-2 upon restimulation in vitro with OVA peptide (Figure 12A). To assess the cytotoxic effector functions of the OT-I cells an in vivo cytotoxicity assay was used whereby 30 days post vaccination the OT-I bearing mice were infused with OVA-presenting and control splenocytes that were differentially labeled with CFSE, and the proportion of CFSE ^high OVA-targets/CFSE ^low control targets was determined 17 hours later. As shown in Figure 7B, the OVA-presenting CFSE ^hlgh cells were killed more efficiently in mice treated with the 4-lBB-raptor conjugate compared to untreated mice or mice ATTORNEY DOCKET NO: F6456- 16776

UML-129 treated with the 4-1BB-GFP conjugate, conceivably reflecting the presence of increased numbers of OT-I cells in the spleen (Figures 7 A and 7C). Surprisingly, despite comparable numbers of OT-I cells present in mice treated with 4-lBB-raptor conjugate or with rapamycin, killing of the OVA targets in the rapamycin-treated mice was significantly diminished (Fig3b & c), providing evidence that the rapamycin-induced memory OT-I cells are compromised in their cytotoxic effector functions. To test this possibility, OT-I cells were isolated 30 days post vaccination with OVA peptide, mixed with CFSE ^hlgh OVA-presenting splenocyte and CFSE ^low control splenocytes, equal numbers were injected into recipient mice and the specific lysis of the OVA targets was determined 17 hours later. As shown in Figures 7D and 7E e, on a per cell basis OT- I cells derived from rapamycin treated mice were less effective than OT-I cells derived from any of the other groups in killing their targets, showing that the rapamycin generated memory OT-I cells exhibited reduced cytotoxic effector functions. No differences were seen in the expression of cytotoxic effector molecules, perforin, granzyme B or CD 107a, in the OT-1 cells derived from the rapamycin-treated and any of the other groups. Overall, these observations provide evidence that while both rapamycin and 4- IBB conjugate treatment during priming can promote the development of memory OT-I cells capable of proliferating in response to antigenic stimulation, rapamycin treatment prevented the full acquisition of cytotoxic effector functions by the memory OT-I cells during a subsequent antigenic exposure.

[0170] The OT-I CD8 ⁺ T cells which recognize a foreign epitope derived from OVA are a poor model for endogenous tumor antigens, most of which correspond to nonmutated products that elicit low affinity T cells. It was next sought to determine if the 4-lBB-raptor conjugate is also capable of expanding memory responses directed to low affinity epitopes encoded in nonmutated endogenous tumor antigens. To this end transgenic Pmel-1 CD8 ⁺ T cells were used which recognize a determinant in the murine nonmutated gplOO tumor antigen expressed in B16 melanoma tumor cells. Pmel-1 cells binds the cognate epitope with much lower affinity than OT-I cells. As was seen in the OT-I model, 6 days post vaccination with the gplOO peptide, more Pmel-1 cells were present in the spleens of the rapamycin and 4-lBB-raptor treated mice compared to untreated or 4-1BB-GFP treated mice (Figure 13 A), which were enriched for cells with CD62 ^high CD44 ^high phenotype (Figure 13B). Similarly, when mice were re -vaccinated 30 days later, the Pmel-1 cells accumulated to higher numbers in mice treated with either 4-1BB- ATTORNEY DOCKET NO: F6456- 16776

UML-129 raptor conjugate or rapamycin compared to that of untreated mice or mice treated with 4-1BB- GFP conjugate (Figure 8 A). Nonetheless, reflecting their lower avidity, Pmel-1 cells proliferated less effectively than OT-1 cells.

[0171] To assess the antitumor effector functions of the memory Pmel-1 cells, 30 days post vaccination mice were challenged subcutaneously with B16/F10 tumor cells and tumor growth was monitored. As shown in in Figure 8B, tumor growth was significantly inhibited in mice treated with 4-lBB-raptor conjugate but not with rapamycin or with 4-1BB-GFP conjugate, despite the fact that rapamycin treatment also enhanced the generation of Pmel-1 cells as shown in Figures 13 A, 13B and Figure 8 A. This observation, consistent with the findings in the OT-I model (Figures 7A-7E), provides evidence that the rapamycin generated memory Pmel-1 CD8 ⁺ T cells are impaired in their antitumor cytotoxic effector functions.

[0172] Aptamer targeted inhibition of raptor potentiates vaccine-induced antitumor immunity. Transgenic CD8 ⁺ T cells like OT-I and Pmel-1 cells provide a useful tool to monitor the immunological parameters of memory development and function, and have been all but exclusively used to show that pharmacological inhibition of intracelllular mediators can enhance immunological memory and protective immunity (Araki, K.,et al. Nature 460, 108-112 (2009); Gattinoni, .,et al. Nat Med 15, 808-813 (2009); Pearce, E. .,et al. Nature 460, 103-107 (2009); Li, Q.,et al. J Immunol 188, 3080-3087 (2012); Rao, R.R.,et al. Immunity 32, 67-78 (2010)). To assess the therapeutic potential of 4-lBB-raptor conjugates it was tested whether 4-lBB-raptor conjugates can enhance vaccine -induced memory responses corresponding to T cells recognizing endogenous tumor antigens that develop from the resident, mostly naive, T cell repertoire of the mouse. First, a prophylactic experimental design was used whereby mice were first vaccinated with GM-CSF-expressing irradiated B16 melanoma cells (GVAX; (Dranoff, G.,et al. Proc Natl Acad Sci U S A 90, 3539-3543 (1993)) and then challenged subcutaneously with B16 tumor. While a number of tumor antigens expressed in B16 tumor cells have been characterized, the antigens that dominate the antitumor response induced by GVAX are not known. It is conceivable that the dominant antigens in the GVAX vaccine correspond to tumor-specific mutated products or to oncofetal antigens, and not to products like Trp-2 or gplOO expressed in normal melanocytes. Be as it may, as shown in Figure 9A, treatment with 4-lBB-raptor, but not with 4-1BB-GFP nor with rapamycin, enhanced GVAX-induced antitumor immunity, ATTORNEY DOCKET NO: F6456- 16776

UML-129 underscoring the failure of rapamcyin to promote memory responses exhibiting antitumor effector functions (Figures 7B-7E and 8B). To further test the therapeutic potential of enhancing vaccine-induced memory responses, a therapeutic model was used whereby mice were first implanted with tumor and 5 days later subjected to vaccination with GVAX and treatment with 4-lBB-raptor or 4-1BB-GFP conjugates. As shown in Figure 9B, 4-lBB-raptor, but not 4-1BB- GFP, conjugates enhanced GVAX-induced antitumor immunity.

[0173] Given the nontargeted nature of rapamycin administration and the ubiquitous expression of mTOR, it is possible that inhibition of mTOR in cells other than CD8 ⁺ T cells was responsible for imprinting the effector defects in the developing memory CD8+ T cells (Figs. 3b- e, 4b and 5 a). Since rapamycin was shown to compromise the immune stimulatory activity of DC (Hackstein, H.,et al. Blood 101, 4457-4463 (2003); Taner, T.,et al. Am J Transplant 5, 228- 236 (2005); Turnquist, H.R.,et al. J Immunol 178, 7018-7031 (2007)), resident DC were analyzed in mice treated with rapamycin or aptamer-siRNA conjugates in the presence or absence of vaccination with GVAX. As shown in Figure 10 the alloMLR activity of splenic DC isolated from the rapamycin treated mice was reduced compared to that of untreated mice especially in the setting of GVAX vaccination. In contrast, treatment with 4-lBB-raptor conjugate with or without GVAX vaccination had no adverse effect on DC function.

[0174] Discussion

[0175] In this study it was shown that aptamer-targeted siRNA inhibition of raptor in circulating CD8 ⁺ T cells leads to the generation of a potent CD8 ⁺ T cell memory response and enhances vaccine-induced protective immunity in the B16 melanoma tumor model. Here the therapeutic potential for promoting immunological memory was shown, using a non-transgenic experimental model whereby mice are implanted with B16.F10 melanoma tumors, a notoriously aggressive and poorly immunogenic tumor cell line, and vaccinated with GM-CSF-expressing irradiated syngeneic tumor cells (GVAX) presenting endogenous tumor antigens to prime cognate T cells present in the repertoire of C57BL/6 mice. It was shown herein, that in both prophylactic (Figure 9A) and therapeutic (Figure 9B) settings enhancement of GVAX-induced memory responses with 4-lBB-raptor conjugates inhibits tumor growth. These findings ATTORNEY DOCKET NO: F6456- 16776

UML-129 underscore the importance of memory responses in protective immunity and show that the approach used in this study would be therapeutically useful.

[0176] R Ai that was targeted to antigen-activated CD8 ⁺ T cells by conjugation of the raptor siRNA to a 4- IBB binding aptamer ligand. Cell targeting of siRNAs offers important advantages compared to nontargeted administration of pharmacological agents. Reflecting the broad distribution of their targets, pharmacological agents often exhibit pleiotropic effects that can have undesirable consequences. Case in point, rapamycin inhibition of mTOR can promotes the development of immune suppressive regulatory Treg, tolerogenic DC, and reduces tissue trafficking of activated T cells (Araki, K.,et al. Immunol Rev 235, 234-243 (2010); Powell, J.D.,et al. Annu Rev Immunol 30, 39-68 (2012); Thomson,et al. Nat Rev Immunol 9, 324-337 (2009)).

[0177] As shown in Figures 5A, 5B, systemic administration of rapamycin inhibited mTOR activity in both the transferred OT-I and host cells (Figure 5A), and in the targeted OT-I cells both mTORCl and mTORC2 activity were affected (Figure 5B). Importantly, it was shown here that the rapamycin-generated memory CD8 ⁺ T cells exhibited reduced cytotoxic effector functions (Figures 7B-7E) that may be responsible for their inability to control a tumor challenge (Figures 8B and 9A). It was also shown that dendritic cells isolated from the rapamycin-treated mice exhibited reduced MLR activity (Figure 10), raising the possibility that defective antigen presentation by the rapamycin-exposed resident DC is the root cause of the cytotoxicity defect of the memory CD8 ⁺ T cells. In contrast, aptamer-targeted inhibition of raptor in activated CD8 ⁺ T cells spared host cells (Figure 5 A) and inhibited mTORCl, but not mTORC2, in the aptamer- targeted CD8 ⁺ T cells (Figure 5B). Importantly, the memory cells exhibited normal cytotoxic effector functions (Figures 7B-7E), controlled tumor growth (Figures 8B and 9A), and the MLR activity of the resident DC was not adversely affected (Figure 10).

[0178] A second advantage of cell targeting is that it reduces the effective dose of siRNA needed to elicit the desired biological effect, thereby lessening the risk of nonspecific immune activation and enhancing the cost-effectiveness of the treatment. Underscoring the efficiency of aptamer-targeted siRNA delivery, two consecutive injections of 400 pmoles of the 4-BB-raptor conjugate led to the downregulation of mTORCl activity in over 60% of the circulating antigen- ATTORNEY DOCKET NO: F6456- 16776

UML-129 activated CD8 ⁺ T cells (Figures 5A, 5B) resulting in enhanced memory development that was not less effective than that of using rapamycin (Figures 6A-6D through to Figures 8A and 8B), while three injections engendered protective antitumor immunity in both prophylactic and therapeutic settings (Figures 9A-9C). This compares favorably with nontargeted polymer- formulated siRNA delivery that required 10-50 fold higher doses of siRNA to inhibit tumor growth (Judge, AD.,et al. J Clin Invest 119, 661-673 (2009); Ren, Y.,et al. Sci Transl Med 4, 147ral l2 (2012)).

[0179] In this study the raptor siRNA was targeted to activated CD8 ⁺ T cells using an agonistic dimeric 4-1BB binding aptamer (McNamara, J.O.,et al. Multivalent 4-1BB binding aptamers costimulate CD8 T cells and inhibit tumor growth in mice. J Clin Invest 118, 376-386 (2008)). Thus, the 4-1BB aptamer used in this study might have served a dual role, both to target the siRNA to 4- IBB expressing CD8 ⁺ T cells as well as promote their survival and potential to differentiate into memory cells. Nonetheless, the agonistic 4- IBB aptamer did not exert a measurable contribution to memory differentiation since the 4- IBB aptamer-GFP siRNA conjugate used in every experiment did not affect any parameter of memory tested. While 4- 1BB expression is highly restricted, it is also upregulated on activated conventional CD4 ⁺ T cells, foxp3 ⁺ Treg, activated NK cells, CD40 stimulated mature DC, and on proliferating endothelial cells. Targeting receptors expressed more exclusively on activated CD8+ T cells are being developed as these will further enhance the specificity and the therapeutic potential of this approach.

[0180] All documents mentioned herein are incorporated herein by reference. All publications and patent documents cited in this application are incorporated by reference for all purposes to the same extent as if each individual publication or patent document were so individually denoted. By their citation of various references in this document, Applicants do not admit any particular reference is "prior art" to their invention.

[0181] The Abstract of the Disclosure is provided to allow the reader to quickly ascertain the nature of the technical disclosure. It is submitted with the understanding that it will not be used to interpret or limit the scope or meaning of the following claims.