MEANS FOR THE TREATMENT OF PRE-ECLAMPSIA

FIELD OF THE INVENTION

The present invention is related to a lipid composition useful in the delivery of a pharmaceutically active agent to placenta of a female mammal, preferably a pregnant woman, and a double-stranded nucleic acid suitable to inhibit the expression of soluble VEGF receptor 1 (sFltl) and uses thereof.

BACKGROUND OF INVENTION

Vascular endothelial growth factor (VEGF)-VEGF receptor (VEGFR) system has been shown to play central roles not only in physiological angiogenesis, but also in

pathological angiogenesis in diseases such as cancer. Abnormal expression of an endogenous VEGF-inhibitor, sFlt-1, has been shown to be involved in a variety of diseases, such as preeclampsia and aged macular degeneration.

VEGFR family members are receptor tyrosine kinases (RTKs) which contain an extracellular ligand-binding region with seven immunoglobulin (Ig)-like domains, a transmembrane segment, and a tyrosine kinase (TK) domain within the cytoplasmic domain. This protein binds to VEGFR- A, VEGFR-B and placental growth factor and plays an important role in angiogenesis and vasculogenesis. Expression of this receptor is found in vascular endothelial cells, placental trophoblast cells and peripheral blood monocytes.

Multiple transcript variants encoding different iso forms have been found for the FLT1 gene. Isoforms include a full-length transmembrane receptor iso form and shortened, soluble iso forms. The soluble isoforms are associated with the onset of pre-eclampsia. sFlt-1 is abnormally overexpressed in the placenta of preeclampsia patients, resulting in the major symptoms of the disease due to abnormal trapping of VEGFs.

FLT1 genes involvement in human disease may include cancer cell survival, proliferation, migration, and invasion, and tumor angiogenesis and metastasis. It may contribute to cancer pathogenesis by promoting inflammatory responses and recruitment of tumor-infiltrating macrophages.

Abnormally high expression of soluble isoforms (isoform 2, iso form 3 or iso form 4) may be a cause of preeclampsia. Pre-eclampsia is the most common hypertensive disease of pregnancy. About 5-8% of pregnancies are affected and pre-eclampsia accounts for 18% of maternal death in the USA associated with adverse fetal outcome. Clinical parameters of pre-eclampsia are hypertension and proteinuria with an onset during week 20 of pregnancy. Mild and severe forms of preeclampsia can be distinguished. Mild form of pre-eclampsia is characterized by > 140 mmHg systolic or 90 mm diastolic blood pressure and 300 mg proteinuria over 24h; severe forms of pre-eclampsia are characterized by more severe blood pressure and/or additional end organ dysfunction, i.e. HELLP (which is an acronym for hemolysis, elevated liver enzymes, low platelets), cerebral and visual disturbances, pulmonary edema, and eclampsia which is characterized by symptoms of preeclampsia plus seizures.

Treatment options are observation or delivery.

In light thereof there is an ongoing need in the art for means suitable for delivering a pharmaceutically active agent to a pregnant woman, whereby said pharmaceutically active agent is to be delivered to the maternal organism only. In other words, the delivery vehicle used in the delivery of the pharmaceutically active agent is to discriminate between the maternal tissue and the fetal tissue and more specifically is to avoid passage of the pharmaceutically active agent from the maternal organism to which the pharmaceutically active agent is administered, to the fetal organism.

The present invention addresses these unmet needs through discovery of lipid compositions and its use.

SUMMARY OF THE INVENTION

The present invention relates to a lipid compositions for use in a method of treating a disease, for delivering a pharmaceutically active agent to placenta of a female mammal, for use in a method for diagnosing a disease and for delivering a diagnostic agent to placenta of a female mammal. The present invention also related to a short interfering RNA (siRNA) and a composition comprising such siRNA, wherein the siRNA is directed to an expressed RNA transcript of soluble VEGF receptor 1, sFltl (sometimes referred to as a "target nucleic acid" herein) and compositions thereof. These siRNA molecules can be used in the treatment of a variety of diseases and disorders where reduced expression of sFltl gene product is desirable, and in the treatment of pre-eclampsia in particular. The siRNAs can be isolated siRNAs, chemically synthesized, modified in any number of ways by substitution, deletion, insertion or alteration. Modifications may include chemical modification of the sugar moiety or the bases or the phosphodiester bonds.

BRIEF DESCRIPTION OF DRAWINGS

Further features, embodiments and advantages may be taken from the following figures:

Fig. 1 is a summary of siRNA molecules tested in vitro for inhibition of sFltl target gene expression; nucleotides with 2'-0-methyl are marked bold; nucleotides with 2'-F are underlined.

Fig. 2 is a bar diagram showing the efficacy of different Fltl and sFltl -specific siRNA molecules on human sFltsl mRNA degradation in human umbilical vein endothelial cells (HuVeCs); knock-down of human sFltl mRNA is normalized relative to untreated HuVeCs and luciferase-specific siRNA being used as negative controls.

Fig. 3 is a bar diagram showing siRNA distribution in maternal liver, placenta, maternal lung and embryo upon delivery of siRNA by mean of AtuPLEX in pregnant mice (E13.5) 1 hour post treatment.

Fig. 4 represents microphotographs of mouse placenta (El 3.5) taken 1 hour after treatment with a lipoplex composition comprising AtuPLEX and Cy3 labeled siRNA; Cy3 labeled siRNA is depicted in red is detectable in vessels of the labyrinth layer.

Fig. 5 represents microphotographs of mouse placenta (El 3.5) taken 1 hour after treatment with a lipoplex composition comprising AtuPLEX and Cy3 labeled siRNA; the left microphotograph shows localization of Cy3 labeled siRNA in maternal, but not fetal vessels of the labyrinth layer; the right microphotograph shows part of the placenta with part of the umbilichord, whereCy3 labeled siRNA staining is lacking.

Fig. 6 A - B is a summary outlining the experimental set-up for determining target gene inhibition in mice using different siRNA molecules targeting either sFltl or PKN3 and different delivery systems (AtuPLEX and DACC10).

Fig. 7 A - F is a compilation of various bar diagram showing sFltl and PKN3 target gene expression in lungs of pregnant mice treated with either AtuPLEX or DACC10 as delivery vehicle. PTEN expression is a house keeping gene. Its expression is not changes by AtuPLEX of DACC10 treatment.

Fig. 8 A - F is a compilation of various bar diagram showing sFltl and PKN3 target gene expression in placenta of pregnant mice treated with either AtuPLEX or DACC10 as delivery vehicle. PTEN expression is a house keeping gene. Its expression is not changes by AtuPLEX of DACC10 treatment.

Fig. 9 A- C shows that AtuPLEX delivers siRNA to maternal and placental tissue A: Female Sprague-Dawley rats were treated at day 18 of gestation with 1.4 mg/kg AtuPLEX ^slRNACy3 . 1 hour and 4 hours after treatment maternal tissues (liver, lung, Li- heparin blood, placenta and mesometrial triangle (B)) were collected and siRNA concentrations in these tissues were determined by quantitative capture probe ELISA assay (Fehring et al, 2014).

Fig. 10 A - D shows that AtuPLEX prepared with Cy3-labeled siRNA delivers siRNA to the spongio-trophoblast layer of the placenta. A: Female Sprague-Dawley rats were treated at day 18 of gestation with 1.4 mg/kg AtuPLEX ^siRNA_Cy3 . 1 hour after treatment placental tissues (B) were collected and processed for paraffin embedding and histology. CY3-labeled siRNA was detected by fluorescent microscopy in sections of the spongio-trophoblast layer of the placenta, lining the blood vessels (D, white arrows). Erythrocytes are visible as dots by autofluorescence/background staining in vehicle control group, treated with isotonic sucrose (C) and AtuPLEX treatment group (marked by white arrow head) (D).

Fig. 11 - AtuPLEX does not delivery siRNA to tissues of the fetus (fetal lung or fetal liver): Rats at dl8 of gestation were treated with 1.4 mg/kg AtuPLEX ^slRNA~CY3 or sucrose solution as vehicle control by i.v. bolus application. 1 hour and 4 hours after treatment tissues were collected and processed for paraffin embedding and histology. CY3-labeled siRNA was detected in sinusoids of maternal liver tissue, but not in foetal lung or foetal liver tissues (left and middle panel, respectively) by fluorescent microscopy.

Fig. 12: Rats transgenic for human renin and human angiotensinogen as model for gestational hypertension. Female rats transgenic for human angiotensinogen are mated with rats transgenic for human renin. During pregnancy, these rats develop high blood pressure, albuminuria and intrauterine growth reduction (IUGR). Ref: J. Am Soc. Nephrol. l l : 2056- 2061.

Fig. 13: AtuPLEX reduces sFLTl expression in lung tissue of the mother and in placental tissue. Female rats transgenic for human angiotensinogen were mated with male transgenic rats for human renin. They received five treatments of either sucrose solution as vehicle control or AtuPLEX ^{slRNAsFLT1"r8} siRNA, AtuPLEX ^ctrsiRNA1 or AtuPLEX ^ctrsiRNA2 at the time points indicated in (A). At day 21 of gestation, tissues were collected and sFLTl mRNA expression was assessed in total tissue lysates by qRT-PCR in lung (B) and plancenta (C). (*p<0.05, **p<0.01; one-way ANOVA with Tukey's post hoc; mean ± SEM).

Fig. 14 A -D shows that AtuPLEX ^{siRNAsFLTl r8} reduces blood pressure in rat model of preeclampsia. In this transgenic model for preeclampsia mean arterial blood pressure (MAP), diastolic blood pressure (DBP), systolic blood pressure increases beginning at day 13 of gestation. This elevation of blood pressure is reduced by repeated treatments with AtuPLEX (A,B) (see Figure.6A for treatment schedule). Heart rate is not affected by AtuPLEX ^{siRNAsFLT1" r8} compared to control groups treated with AtuPLEX ^{ctr slRNA2} or sucrose as vehicle control (D) (mean ± SEM).

Fig. 15 A - C - shows that no adverse effects by AtuPLEX concerning the wellbeing of the mother. The maternal body weight (A), motor activity (B) or proteinuria (C) are not affected by repeated treatments with AtuPLEX. Each dot depicts measurement of individual rats.

Fig. 16 A - B shows that the weight of the uteroplacental units, foetal weight or uteroplacental unit to fetus weight ratio is not adversely affected by repeated treatments with AtuPLEX ^{siRNAsFLTl r8} or AtuPLEX ^{ctr siRNA 2} · Depicted are individual values. B: There are fewer small embryos in the AtuPLEX ^slRNAsFLT_r8 treatment group. The lowest 10% percentiles of the foetal weights are 2.12 g for the vehicle group, but 2.4 g for the the AtuPLEX ^siRNAsFLT~r8 treatment group (*p<0.05; one-way ANOVA with Tukey's post hoc; ***p<0.001, Kruskal- Wallis test with Dunn's post hoc mean ± SEM).

Fig. 17 A - C shows that treatment with AtuPLEX does not enhance intrauterine growth reduction (IUGR). Foetal brain weights (A), foetal liver weights (B) and the ratio of foetal brain to fetal liver weights are depicted (C).

Fig. 18 A - C: Fetal brain weights (A), fetal liver weights (B) and the ratio of foetal brain to fetal liver weights are depicted (C). Treatment with AtuPLEX does not enhance intrauterine growth reduction.

BRIEF DESCRIPTION OF THE SEQUENCES

SEQ ID NOs: 1 to 22 are strands of different siRNAs targeting human sFltl .

SEQ ID NO: 25 is the mRNA sequence encoding human sFltl . This sequence has been taken from GenBank Accession number EU368830.1 which is incorporated herein by reference in its entirety. SEQ ID NOs: 23-24, 26-45 and 50-51 are strands of different siRNAs targeting

SEQ ID NOs: 46 and 47 are strands of an siRNA targeting CD31.

SEQ ID NOs: 48 and 49 are strands of an siRNA targeting luciferase.

SEQ ID NO. 52 - 59 are furhter strands of different siRNAs targeting human sFltl

SEQ ID NO. 60 - 65 are DNA primers in Example 7

Table 1 - showing modified nucleotides with 2'-0-methyl are marked bold; nucleotides with 2'-F are underlined.

SEQ ID NO. 25: mRNA sequence encoding human sFltl auggucagcu acugggacac cgggguccug cugugcgcgc ugcucagcug ucugcuucuc acaggaucua guucagguuc aaaauuaaaa gauccugaac ugaguuuaaa aggcacccag cacaucaugc aagcaggcca gacacugcau cuccaaugca ggggggaagc agcccauaaa uggucuuugc cugaaauggu gaguaaggaa agcgaaaggc ugagcauaac uaaaucugcc uguggaagaa auggcaaaca auucugcagu acuuuaaccu ugaacacagc ucaagcaaac cacacuggcu ucuacagcug caaauaucua gcuguaccua cuucaaagaa gaaggaaaca gaaucugcaa ucuauauauu uauuagugau acagguagac cuuucguaga gauguacagu gaaauccccg aaauuauaca caugacugaa ggaagggagc ucgucauucc cugccggguu acgucaccua acaucacugu uacuuuaaaa aaguuuccac uugacacuuu gaucccugau ggaaaacgca uaaucuggga caguagaaag ggcuucauca uaucaaaugc aacguacaaa gaaauagggc uucugaccug ugaagcaaca gucaaugggc auuuguauaa gacaaacuau cucacacauc gacaaaccaa uacaaucaua gauguccaaa uaagcacacc acgcccaguc aaauuacuua gaggccauac ucuuguccuc aauuguacug cuaccacucc cuugaacacg agaguucaaa ugaccuggag uuacccugau gaaaaaaaua agagagcuuc cguaaggcga cgaauugacc aaagcaauuc ccaugccaac auauucuaca guguucuuac uauugacaaa

augcagaaca aagacaaagg acuuuauacu ugucguguaa ggaguggacc aucauucaaa

ucuguuaaca ccucagugca uauauaugau aaagcauuca ucacugugaa acaucgaaaa

cagcaggugc uugaaaccgu agcuggcaag cggucuuacc ggcucucuau gaaagugaag

gcauuucccu cgccggaagu uguaugguua aaagaugggu uaccugcgac ugagaaaucu

gcucgcuauu ugacucgugg cuacucguua auuaucaagg acguaacuga agaggaugca

gggaauuaua caaucuugcu gagcauaaaa cagucaaaug uguuuaaaaa ccucacugcc

acucuaauug ucaaugugaa accccagauu uacgaaaagg ccgugucauc guuuccagac

ccggcucucu acccacuggg cagcagacaa auccugacuu guaccgcaua ugguaucccu

caaccuacaa ucaagugguu cuggcacccc uguaaccaua aucauuccga agcaaggugu

gacuuuuguu ccaauaauga agaguccuuu auccuggaug cugacagcaa caugggaaac

agaauugaga gcaucacuca gcgcauggca auaauagaag gaaagaauaa gauggcuagc

accuugguug uggcugacuc uagaauuucu ggaaucuaca uuugcauagc uuccaauaaa

guugggacug ugggaagaaa cauaagcuuu uauaucacag augugccaaa uggguuucau

guuaacuugg aaaaaaugcc gacggaagga gaggaccuga aacugucuug cacaguuaac

aaguucuuau acagagacgu uacuuggauu uuacugcgga caguuaauaa cagaacaaug

cacuacagua uuagcaagca aaaaauggcc aucacuaagg agcacuccau cacucuuaau

cuuaccauca ugaauguuuc ccugcaagau ucaggcaccu augccugcag agccaggaau

guauacacag gggaagaaau ccuccagaag aaagaaauua caaucagaga ucaggaagca

ccauaccucc ugcgaaaccu cagugaucac acaguggcca ucagcaguuc caccacuuua

gacugucaug cuaauggugu ccccgagccu cagaucacuu gguuuaaaaa caaccacaaa

auacaacaag agccugaacu guauacauca acgucaccau cgucaucguc aucaucacca

uugucaucau caucaucauc gucaucauca ucaucaucau agcuaucauc auuaucauca

ucaucaucau caucaucaua gcuaccauuu auugaaaacu auuauguguc aacuucaaag

aacuuauccu uuaguuggag agccaagaca aucauaacaa uaacaaaugg ccgggcaugg

uggcucacgc cuguaauccc agcacuuugg gaggccaagg cagguggauc auuugagguc

aggaguccaa gaccagccug accaagaugg ugaaaugcug ucucuauuaa aaauacaaaa

uuagccaggc augguggcuc augccuguaa ugccagcuac ucgggaggcu gagacaggag

aaucacuuga acccaggagg cagagguugc agggagccga gaucguguac ugcacuccag

ccugggcaac aagagcgaaa cuccgucuca aaaaacaaau aaauaaauaa auaaauaaac

agacaaaauu cacuuuuuau ucuauuaaac uuaacauaca ugcuaaaaaa aaaaaaa

DETAILED DESCRIPTION

The problem underlying the present invention is solved by the subject matter of the independent claims. Preferred embodiments may be taken from the attached dependent claims.

The present inventors have surprisingly found that a lipid composition comprising a first lipid component and wherein the first lipid component is a compound according to formula (I),

wherein Ri and R ₂ are each and independently selected from the group comprising alkyl and alkenyl; n is any integer between 1 and 4;

R ₃ is an acyl selected from the group comprising lysyl, ornithyl, 2,4-diaminobutyryl, histidyl and an acyl moiety according to formula (II),

wherein m is any integer from 1 to 3, wherein the NH ₃ is optionally absent, and harmaceutically acceptable anion, in its various embodiments described herein, is effective in delivering a pharmaceutically active agent in a female mammal, preferably a pregnant female mammal and more preferably a pregnant woman, i.e. pregnant female human being, to the placenta but does not allow such pharmaceutically active agent to pass-over into the fetal organism. In other words, the pharmaceutically active agent delivered by said lipid composition is prevented from being delivered to the fetal organism in the pregnant female mammal. In an embodiment the pharmaceutically active agent is a nucleic acid, preferably an oligonucleotide such as an siRNA, which forms a lipoplex together with one or more of the lipid components of the lipid composition. The lipid composition as described herein is sometimes also referred to herein as "delivery vehicle" or delivery vehicle of the invention. Alternatively, the following one comprising the following lipid composition may be used as delivery vehicle in accordance with the invention:

70 mol% P-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl- amide tri-hydrochloride of the following formula:

29 mol% cholesterol; and

1 mol% mPEG-2000-Ceramide-C8 of the following formula:

The present invention relates in a further aspect to compositions comprising short interfering RNA (siRNA) directed to an expressed RNA transcript of sFltl (sometimes referred to as a "target nucleic acid" herein). Preferably such siRNA is used together with the delivery vehicle of the invention. The siRNA of the invention are nucleic acid molecules comprising a double stranded or duplex region as also disclosed in the claims. The present invention further relates to methods of using the siRNA compositions to reduce the expression level of sFltl . As used herein, the terms "silence" or "knock-down" when referring to gene expression means a reduction in gene expression. The present invention further relates to processes for making the siRNA.

In one aspect, the target nucleic acid is an RNA expressed from a mammalian sFltl gene. In one embodiment, the target nucleic acid is an RNA expressed from mouse sFltl . In another embodiment, the target nucleic acid is an RNA expressed from human sFltl . In another embodiment, the target nucleic acid is a human sFltl mRNA. In another embodiment, the target nucleic acid is a human sFltl hnRNA. In another embodiment, the target nucleic acid is an mRNA comprising the sequence of SEQ ID NO: 25. The siRNA of the present invention are suitable to inhibit the expression of sFltl . The siRNA according to the present invention is, thus, suitable to trigger the RNA interference response resulting in the reduction of the sFltl mRNA in a mammalian cell. The siRNA according to the present invention are further suitable to decrease the expression of sFltl protein by decreasing gene expression at the level of mRNA.

siRNA Design: An siRNA of the present invention comprises two strands of a nucleic acid, a first, antisense strand and a second, sense strand. The nucleic acid normally consists of ribonucleotides or modified ribonucleotides however; the nucleic acid may comprise deoxynucleotides (DNA) as described herein. The siRNA further comprises a double- stranded nucleic acid portion or duplex region formed by all or a portion of the antisense strand and all or a portion of the sense strand. The portion of the antisense strand forming the duplex region with the sense strand is the antisense strand duplex region or simply, the antisense duplex region, and the portion of the sense strand forming the duplex region with the antisense strand is the sense strand duplex region or simply, the sense duplex region. The duplex region is defined as beginning with the first base pair formed between the antisense strand and the sense strand and ending with the last base pair formed between the antisense strand and the sense strand, inclusive. The portion of the siRNA on either side of the duplex region is the flanking regions. The portion of the antisense strand on either side of the antisense duplex region is the antisense flanking regions. The portion of the antisense strand 5' to the antisense duplex region is the antisense 5' flanking region. The portion of the antisense strand 5' to the antisense duplex region is the antisense 3' flanking region. The portion of the sense strand on either side of the sense duplex region is the sense flanking regions. The portion of the sense strand 5 ' to the sense duplex region is the sense 5' flanking region. The portion of the sense strand 5' to the sense duplex region is the sense 3' flanking region.

Complementarity: In one aspect, the antisense duplex region and the sense duplex region may be fully complementary and are at least partially complementary to each other. Such complementarity is based on Watson-Crick base pairing (i.e., A:U and G:C base pairing). Depending on the length of a siRNA a perfect match in terms of base complementarity between the antisense and sense duplex regions is not necessarily required however, the antisense and sense strands must be able to hybridize under physiological conditions. In one embodiment, the complementarity between the antisense strand and sense strand is perfect (no nucleotide mismatches or additional/deleted nucleotides in either strand).

In one embodiment, the complementarity between the antisense duplex region and sense duplex region is perfect (no nucleotide mismatches or additional/deleted nucleotides in the duplex region of either strand).

In another embodiment, the complementarity between the antisense duplex region and the sense duplex region is not perfect. In one embodiment, the identity between the antisense duplex region and the complementary sequence of the sense duplex region is selected from the group consisting of at least 75%, 80%>, 85%, 90% and 95%>; wherein a siRNA comprising the antisense duplex region and the sense duplex region is suitable for reducing expression of sFltl In another embodiment, the siRNA, wherein the identity between the antisense duplex region and complementary sequence of the sense duplex region is selected from the group consisting of at least 75%, 80%>, 85%, 90% and 95%, is able to reduce expression of sFltl by at least 25%, 50% or 75% of a comparative siRNA having a duplex region with perfect identity between the antisense duplex region and the sense duplex region. As used herein the term "comparative siRNA" is a siRNA that is identical to the siRNA to which it is being compared, except for the specified difference, and which is tested under identical conditions.

RNAi using siRNA involves the formation of a duplex region between all or a portion of the antisense strand and a portion of the target nucleic acid. The portion of the target nucleic acid that forms a duplex region with the antisense strand, defined as beginning with the first base pair formed between the antisense strand and the target sequence and ending with the last base pair formed between the antisense strand and the target sequence, inclusive, is the target nucleic acid sequence or simply, target sequence. The duplex region formed between the antisense strand and the sense strand may, but need not be the same as the duplex region formed between the antisense strand and the target sequence. That is, the sense strand may have a sequence different from the target sequence however; the antisense strand must be able to form a duplex structure with both the sense strand and the target sequence.

In one embodiment, the complementarity between the antisense strand and the target sequence is perfect (no nucleotide mismatches or additional/deleted nucleotides in either nucleic acid).

In one embodiment, the complementarity between the antisense duplex region (the portion of the antisense strand forming a duplex region with the sense strand) and the target sequence is perfect (no nucleotide mismatches or additional/deleted nucleotides in either nucleic acid).

In another embodiment, the complementarity between the antisense duplex region and the target sequence is not perfect. In one embodiment, the identity between the antisense duplex region and the complementary sequence of the target sequence is selected from the group consisting of at least 75%, 80%, 85%, 90% or 95%, wherein a siRNA comprising the antisense duplex region is suitable for reducing expression of sFltl . In another embodiment, the siRNA, wherein the identity between the antisense duplex region and complementary sequence of the target sequence is selected from the group consisting of at least 75%, 80%, 85%, 90% and 95%, is able to reduce expression of sFltl by at least 25%, 50% or 75% of a comparative siRNA with perfect identity to the antisense strand and target sequence.

In another embodiment, the siRNA of the invention comprises a duplex region wherein the antisense duplex region has a number of nucleotides selected from the group consisting of 1, 2, 3, 4 and 5 that are not base-paired to a nucleotide in the sense duplex region, and wherein said siRNA is suitable for reducing expression of sFltl . Lack of base- pairing is due to either lack of complementarity between bases (i.e., no Watson-Crick base pairing) or because there is no corresponding nucleotide on either the antisense duplex region or the sense duplex region such that a bulge is created. In one embodiment, a siRNA comprising an antisense duplex region having a number of nucleotides selected from the group consisting of 1, 2, 3, 4 and 5 that are not base-paired to the sense duplex region, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA wherein all nucleotides of said antisense duplex region are base paired with all nucleotides of said sense duplex region.

In another embodiment, the antisense strand has a number of nucleotides selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 that do not base-pair to the sense strand, and wherein a siRNA comprising said antisense strand is suitable for reducing expression of sFltl . Lack of complementarity is due to either lack of complementarity between bases or because there is no corresponding nucleotide on either the antisense strand or the sense strand. The lack of a corresponding nucleotide results in either a single-stranded overhang or a bulge (if in the duplex region), in either the antisense strand or the sense strand. In one embodiment, a siRNA comprising an antisense strand having a number of nucleotides selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 that do not base pair to the sense strand, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA wherein all nucleotides of said antisense strand are complementary to all nucleotides of the sense strand. In one embodiment, a siRNA comprising an antisense strand having a number of nucleotides selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 that are mismatched to the target sequence, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA wherein all nucleotides of said antisense strand are complementary to all nucleotides of said sense strand. In another embodiment, all of the mismatched nucleotides are outside the duplex region.

In another embodiment, the antisense duplex region has a number of nucleotides selected from 1, 2, 3, 4 or 5 that do not base-pair to the sense duplex region, and wherein a siRNA comprising said antisense duplex region is suitable for reducing expression of sFltl . Lack of complementarity is due to either lack of complementarity between bases or because there is no corresponding nucleotide on either the antisense duplex region or the sense duplex region such that a bulge in created in either the antisense duplex region or the sense duplex region. In one embodiment, a siRNA comprising an antisense duplex region having a number of nucleotides selected from the group consisting of 1, 2, 3, 4 and 5 that do not base pair to the sense duplex region, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA wherein all nucleotides of said antisense duplex region are complementary to all of the nucleotides of said sense duplex region.

In another embodiment, the antisense strand has a number of nucleotides selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 that do not base-pair to the target sequence, and wherein a siRNA comprising said antisense strand is suitable for reducing expression of sFltl . Lack of complementarity is due to either lack of complementarity between bases or because there is no corresponding nucleotide on either the antisense strand or the target sequence. The lack of a corresponding nucleotide results in a bulge in either the antisense strand or the target sequence. In one embodiment, a siRNA comprising an antisense strand having a number of nucleotides selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10 do not base pair to the target sequence, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA wherein all nucleotides of said antisense strand are complementary to all nucleotides of said target sequence. In one embodiment, a siRNA comprising an antisense strand having a number of nucleotides selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10 that are mismatched to the target sequence, is able to reduce expression of sFltl by at least 25%, 50% or 75% of a comparative siRNA wherein all nucleotides of said antisense strand are complementary to all nucleotides of said target sequence. In another embodiment, the complementarity between an antisense duplex region and both a sense duplex region and a target sequence of an siRNA is such that the antisense duplex region and the sense duplex region or the target sequence hybridize to one another under physiological conditions (37°C in a physiological buffer) and the siRNA is suitable for reducing expression of sFltl . In one embodiment, the siRNA comprising an antisense duplex region that hybridizes to a sense duplex region and a target sequence under physiological conditions, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA with perfect complementarity between the antisense strand and target sequence.

In another aspect, the complementarity between an antisense duplex region and a sense duplex region of a siRNA is such that the antisense duplex region and sense duplex region hybridize under the following conditions: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 70°C, and is suitable for reducing expression of sFltl . In one embodiment, the siRNA comprising an antisense duplex region and a sense duplex region that hybridize to one another under the conditions 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 70°C, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA with perfect complementarity between the antisense duplex region and sense duplex region.

In another embodiment, the complementarity between an antisense strand of a siRNA and a target sequence is such that the antisense strand and target sequence hybridize under the following conditions: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 70°C and wherein the siRNA is suitable for reducing expression of sFltl . In one embodiment, the siRNA comprising an antisense strand that hybridizes to the target sequence under the following conditions: 400 mM NaCl, 40 mM PIPES pH 6.4, 1 mM EDTA, 70°C, is able to reduce expression of sFltl by at least 25%, 50%, 75% of a comparative siRNA with perfect complementarity between the antisense strand and the target sequence.

Length: RNA interference is observed using long nucleic acid molecules comprising several dozen or hundreds of base pairs, although shorter RNAi molecules are generally preferred.

In one embodiment, the length of the siRNA duplex region is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 base pairs. In one embodiment, the length of the siRNA duplex region is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 consecutive base pairs. In another embodiment, the length of the siRNA duplex region is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 base pairs. In another embodiment, the length of the siRNA duplex region is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 consecutive base pairs.

In one embodiment, the length of the antisense strand is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides. In one embodiment, the length of the antisense stand is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides.

In one embodiment, the length of the sense strand is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides. In one embodiment, the length of the sense stand is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides.

In one embodiment, the length of the antisense strand and the length of the sense strand are independently selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides. In one embodiment, the length of the antisense strand and the length of the sense stand are independently selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides. In one embodiment, the antisense strand and the sense strand are equal in length. In another embodiment, the antisense strand and the sense stand are equal in length, wherein the length is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides.

In one embodiment, the length of the antisense strand is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5. In one embodiment, the length of the antisense strand is selected from the group consisting of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5.

In one embodiment, the length of the sense strand is selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to

25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides, wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6..

In one embodiment, the length of the sense strand is selected from the group consisting of about 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides, wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6.

In one embodiment, the length of the antisense strand and the length of the sense strand are independently selected from the group consisting of about 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6.

In one embodiment, the length of the antisense strand and the length of the sense stand are independently selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25,

26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13 or 15, preferably SEQ ID NOs: 1, 3, 5, or 7, and wherein the sense strand comprises the nucleotide sequence SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14 or 16, preferably SEQ ID NOs: 2, 4, 6, or 8.

In one embodiment, the antisense strand and the sense strand are equal in length, wherein the antisense strand comprises the nucleotide sequence SEQ ID NOs: 1 , 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6. In another embodiment, the antisense strand and the sense stand are equal in length, wherein the length is selected from the group consisting of 16 to 35, 16 to 30, 17 to 35, 17 to 30, 17 to 25, 17 to 24, 18 to 29, 18 to 25, 18 to 24, 18 to 23, 19 to 25, 19 to 24, 19 to 23, 20 to 25, 20 to 24, 21 to 25 and 21 to 24 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1, 3, 5, 7, 9, 11, 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6.

In another embodiment, the antisense strand and the sense stand are equal in length, wherein the length is selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34 and 35 nucleotides, wherein the antisense strand comprises the nucleotide sequence of SEQ ID NOs: 1 , 3, 5, 7, 9, 11 , 13, 15, 17, 19, 21 or 23, preferably SEQ ID NOs: 1, 3, or 5, and wherein the sense strand comprises the nucleotide sequence of SEQ ID NOs: 2, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22 or 24, preferably SEQ ID NOs: 2, 4 or 6.

Certain embodiments provide for antisense and sense strand combinations (identified by SEQ ID NO:): 1 and 2; 3 and 4; and 5 and 6.

Ends (overhangs and blunt ends): The siRNA of the present invention may comprise an overhang or be blunt ended. An "overhang" as used herein has its normal and customary meaning in the art, i.e., a single stranded portion of a nucleic acid that extends beyond the terminal nucleotide of a complementary strand in a double strand nucleic acid. The term "blunt end" includes double stranded nucleic acid whereby both strands terminate at the same position, regardless of whether the terminal nucleotide(s) are base paired. In one embodiment, the terminal nucleotide of an antisense strand and a sense strand at a blunt end are base paired. In another embodiment, the terminal nucleotide of a antisense strand and a sense strand at a blunt end are not paired. In another embodiment, the terminal two nucleotides of an antisense strand and a sense strand at a blunt end are base paired. In another embodiment, the terminal two nucleotides of an antisense strand and a sense strand at a blunt end are not paired.

In one embodiment, the siRNA has an overhang at one end and a blunt end at the other. In another embodiment, the siRNA has an overhang at both ends. In another embodiment, the siRNA is blunt ended at both ends. In one embodiment, the siRNA is blunt ended at one end. In another embodiment, the siRNA is blunt ended at the end with the 5 '- end of the antisense strand and the 3 '-end of the sense strand. In another embodiment, the siRNA is blunt ended at the end with the 3 '-end of the antisense strand and the 5 '-end of the sense strand. In another embodiment, the siRNA is blunt ended at both ends.

In another embodiment, the siRNA comprises an overhang at a 3'- or 5 '-end. In one embodiment, the siRNA has a 3 '-overhang on the antisense strand. In another embodiment, the siRNA has a 3 '-overhang on the sense strand. In another embodiment, the siRNA has a 5'- overhang on the antisense strand. In another embodiment, the siRNA has a 5 '-overhang on the sense strand. In another embodiment, the siRNA has an overhang at both the 5 '-end and 3'- end of the antisense stand. In another embodiment, the siRNA has an overhang at both the 5'- end and 3 '-end of the sense stand. In another embodiment, the siRNA has a 5' overhang on the antisense stand and a 3 ' overhang on the sense strand. In another embodiment, the siRNA has a 3' overhang on the antisense stand and a 5' overhang on the sense strand. In another embodiment, the siRNA has a 3' overhang on the antisense stand and a 3' overhang on the sense strand. In another embodiment, the siRNA has a 5' overhang on the antisense stand and a 5 ' overhang on the sense strand.

In one embodiment, the overhang at the 3 '-end of the antisense strand has a length selected from the group consisting of 1, 2, 3, 4 and 5 nucleotides. In one embodiment, the overhang at the 3 '-end of the sense strand has a length selected from the group consisting of 1, 2, 3, 4 and 5 nucleotides. In one embodiment, the overhang at the 5 '-end of the antisense strand has a length selected from the group consisting of 1, 2, 3, 4 and 5 nucleotides. In one embodiment, the overhang at the 5 '-end of the sense strand has a length selected from the group consisting of 1, 2, 3, 4 and 5 nucleotides.

Modification: Another aspect relates to modifications of the siRNA. The siRNA according to the invention are a ribonucleic acid or a modified ribonucleic acid. Chemical modifications of the siRNA of the present invention provides a powerful tool in overcoming potential limitations including, but not limited to, in vitro and in vivo stability and bioavailability inherent to native RNA molecules. Chemically-modified siRNA can also minimize the possibility of activating interferon activity in humans. Chemical modification can further enhance the functional delivery of a siRNA to a target cell. The modified siRNA of the present invention may comprise one or more chemically modified ribonucleotides of either or both of the antisense strand or the sense strand. A ribonucleotide may comprise a chemical modification of the base, sugar or phosphate moieties.

Modifications to base moiety: A secondary aspect relates to modifications to a base moiety. One or more nucleotides of a siRNA of the present invention may comprise a modified base or a nucleotide analogue. A "modified base" means a nucleotide base other than an adenine, guanine, cytosine or uracil at the Γ position.

In one aspect, the siRNA comprises at least one nucleotide comprising a modified base. In one embodiment, the modified base in on the antisense strand. In another embodiment, the modified base in on the sense strand. In another embodiment, the modified base is in the duplex region. In another embodiment, the modified base is outside the duplex region, i.e., in a single stranded region. In another embodiment, the modified base is on the antisense strand and is outside the duplex region. In another embodiment, the modified base is on the sense strand and is outside the duplex region. In another embodiment, the 3 '-terminal nucleotide of the antisense strand is a nucleotide with a modified base. In another embodiment, the 3 '-terminal nucleotide of the sense strand is nucleotide with a modified base. In another embodiment, the 5 '-terminal nucleotide of the antisense strand is nucleotide with a modified base. In another embodiment, the 5 '-terminal nucleotide of the sense strand is nucleotide with a modified base.

In one embodiment, a siRNA has 1 modified base. In another embodiment, a siRNA has about 2-4 modified bases. In another embodiment, a siRNA has about 4-6 modified bases. In another embodiment, a siRNA has about 6-8 modified bases. In another embodiment, a siRNA has about 8-10 modified bases. In another embodiment, a siRNA has about 10-12 modified bases. In another embodiment, a siRNA has about 12-14 modified bases. In another embodiment, a siRNA has about 14-16 modified bases. In another embodiment, a siRNA has about 16-18 modified bases. In another embodiment, a siRNA has about 18-20 modified bases. In another embodiment, a siRNA has about 20-22 modified bases. In another embodiment, a siRNA has about 22-24 modified bases. In another embodiment, a siRNA has about 24-26 modified bases. In another embodiment, a siRNA has about 26-28 modified bases. In each case the siRNA comprising said modified bases retains at least 50% of its activity as compared to the same siRNA but without said modified bases.

In one embodiment, the modified base is a purine. In another embodiment, the modified base is a pyrimidine. In another embodiment, at least half of the purines are modified. In another embodiment, at least half of the pyrimidines are modified. In another embodiment, all of the purines are modified. In another embodiment, all of the pyrimidines are modified.

In another embodiment, the siRNA comprises a nucleotide comprising a modified base, wherein the base is selected from the group consisting of 2-aminoadenosine, 2,6- diaminopurine,inosine, pyridin-4-one, pyridin-2-one, phenyl, pseudouracil, 2, 4, 6-trimethoxy benzene, 3-methyl uracil, dihydrouridine, naphthyl, aminophenyl, 5-alkylcytidine (e.g., 5- methylcytidine), 5-alkyluridine (e.g., ribothymidine), 5-halouridine (e.g., 5-bromouridine), 6- azapyrimidine, 6-alkylpyrimidine (e.g. 6-methyluridine), propyne, quesosine, 2-thiouridine, 4- thiouridine, wybutosine, wybutoxosine, 4-acetylcytidine, 5-(carboxyhydroxymethyl)uridine, 5 '-carboxymethylaminomethyl-2-thiouridine, 5 -carboxymethylaminomethyluridine, beta-D- galactosylqueosine, 1-methyladenosine, 1-methylinosine, 2,2-dimethylguanosine, 3- methylcytidine, 2-methyladenosine, 2-methylguanosine, N6-methyladenosine, 7- methylguanosine, 5-methoxyaminomethyl-2-thiouridine, 5-methylaminomethyluridine, 5- methylcarbonylmethyluridine, 5-methyloxyuridine, 5-methyl-2-thiouridine, 2-methylthio-N6- isopentenyladenosine, beta-D-mannosylqueosine, uridine-5-oxyacetic acid and 2-thiocytidine.

In another aspect, a siRNA of the present invention comprises an abasic nucleotide. The term "abasic" as used herein, refers to moieties lacking a base or having other chemical groups in place of a base at the Γ position, for example a 3',3'-linked or 5',5'-linked deoxyabasic ribose derivative. As used herein, a nucleotide with a modified base does not include abasic nucleotides. In one aspect, the siRNA comprises at least one abasic nucleotide. In one embodiment, the abasic nucleotide is on the antisense strand. In another embodiment, the abasic nucleotide is on the sense strand. In another embodiment, the abasic nucleotide is in the duplex region. In another embodiment, the abasic nucleotide is outside the duplex region. In another embodiment, the abasic nucleotide is on the antisense strand and is outside the duplex region. In another embodiment, the abasic nucleotide is on the sense strand and is outside the duplex region. In another embodiment, the 3 '-terminal nucleotide of the antisense strand is an abasic nucleotide. In another embodiment, the 3 '-terminal nucleotide of the sense strand is an abasic nucleotide. In another embodiment, the 5 '-terminal nucleotide of the antisense strand is an abasic nucleotide. In another embodiment, the 5 '-terminal nucleotide of the sense strand is an abasic nucleotide. In another embodiment, a siRNA has a number of abasic nucleotides selected from the group consisting of 1, 2, 3, 4, 5 and 6.

Modifications to sugar moiety: Another secondary aspect relates to modifications to a sugar moiety. One or more nucleotides of an siRNA of the present invention may comprise a modified ribose moiety.

Modifications at the 2'-position wherein the 2'-OH is substituted include the non- limiting examples selected from the group consisting of alkyl, substituted alkyl, alkaryl-, aralkyl-, -F, -CI, -Br, -CN, -CF3, -OCF3, -OCN, -O-alkyl, -S-alkyl, HS-alkyl-O, -O-alkenyl, -S-alkenyl, -N-alkenyl, -SO-alkyl, -alkyl-OSH, -alkyl-OH, -O-alkyl-OH, -O-alkyl-SH, -S- alkyl-OH, -S-alkyl-SH, -alkyl-S-alkyl, -alkyl-O-alkyl, -ON02, -N02, -N3, -NH2, alkylamino, dialkylamino-, aminoalkyl-, aminoalkoxy, aminoacid, aminoacyl-, -ONH2, -O-aminoalkyl, - O-aminoacid, -O-aminoacyl, heterocycloalkyl-, heterocycloalkaryl-, aminoalkylamino-, polyalklylamino-, substituted silyl-, methoxyethyl- (MOE), alkenyl and alkynyl. "Locked" nucleic acids (LNA) in which the 2' hydroxyl is connected, e.g., by a methylene bridge, to the 4' carbon of the same ribose sugar is further included as a 2' modification of the present invention. Preferred substitutents are 2'-0-methoxyethyl, 2'-0-CH3, 2'-0-allyl, 2'-C-allyl, and 2'-fluoro.

In one embodiment, the siRNA comprises 1-5 2'-modified nucleotides. In another embodiment, the siRNA comprises 5-10 2'-modified nucleotides. In another embodiment, the siRNA comprises 15-20 2'-modified nucleotides. In another embodiment, the siRNA comprises 20-25 2'-modified nucleotides. In another embodiment, the siRNA comprises 25- 30 2 '-modified nucleotides.

In one embodiment, the antisense strand comprises 1-2 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 2-4 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 4-6 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 6-8 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 8-10 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 10-12 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 12-14 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 14-16 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 16-18 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 18-20 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 22-24 2'-modified nucleotides. In one embodiment, the antisense strand comprises about 24-26 2'-modified nucleotides.

In one embodiment, the sense strand comprises 1-2 2'-modified nucleotides. In one embodiment, the sense strand comprises about 2-4 2'-modified nucleotides. In one embodiment, the sense strand comprises about 4-6 2'-modified nucleotides. In one embodiment, the sense strand comprises about 6-8 2'-modified nucleotides. In one embodiment, the sense strand comprises about 8-10 2'-modified nucleotides. In one embodiment, the sense strand comprises about 10-12 2'-modified nucleotides. In one embodiment, the sense strand comprises about 12-14 2'-modified nucleotides. In one embodiment, the sense strand comprises about 14-16 2'-modified nucleotides. In one embodiment, the sense strand comprises about 16-18 2'-modified nucleotides. In one embodiment, the sense strand comprises about 18-20 2'-modified nucleotides. In one embodiment, the sense strand comprises about 22-24 2'-modified nucleotides. In one embodiment, the sense strand comprises about 24-26 2'-modified nucleotides.

In one embodiment, the siR A comprises 1-5 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA comprises 5-10 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA comprises 15-20 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA comprises 20-25 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA comprises 25-30 2'-0-CH3 modified nucleotides.

In one embodiment, the antisense strand comprises 1-2 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 2-4 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 4-6 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 6-8 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 8-10 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 10-12 2'-0- CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 12-14 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 14- 16 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 16-18 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 18-20 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 22-24 2'-0-CH3 modified nucleotides. In one embodiment, the antisense strand comprises about 24-26 2'-0-CH3 modified nucleotides.

In one embodiment, the sense strand comprises 1-2 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 2-4 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 4-6 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 6-8 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 8-10 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 10-12 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 12-14 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 14-16 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 16-18 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 18-20 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 22-24 2'-0-CH3 modified nucleotides. In one embodiment, the sense strand comprises about 24-26 2'-0-CH3 modified nucleotides.

In one embodiment, the siR A duplex region comprises 1-5 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA duplex region comprises 5-10 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA duplex region comprises 15-20 2'- 0-CH3 modified nucleotides. In another embodiment, the siRNA duplex region comprises 20-25 2'-0-CH3 modified nucleotides. In another embodiment, the siRNA duplex region comprises 25-30 2'-0-CH3 modified nucleotides.

In one embodiment, the antisense duplex region comprises 1-2 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 2-4 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 4-6 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 6-8 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 8-10 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 10-12 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 12-14 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 14-16 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 16-18 2'-0- CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 18-20 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 22-24 2'-0-CH3 modified nucleotides. In one embodiment, the antisense duplex region comprises about 24-26 2'-0-CH3 modified nucleotides.

In one embodiment, the sense duplex region comprises 1-2 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 2-4 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 4-6 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 6-8 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 8-10 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 10-12 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 12-14 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 14-16 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 16-18 2'-0- CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 18-20 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 22-24 2'-0-CH3 modified nucleotides. In another embodiment, the sense duplex region comprises about 24-26 2'-0-CH3 modified nucleotides.

In one embodiment, the siRNA comprises an antisense strand 19 nucleotides in length and a sense strand 19 nucleotides in length, wherein said antisense strand comprises 2'-0- CH3 modifications at nucleotides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 2, 4, 6, 8, 10, 12 ,14, 16 and 18, wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 20 nucleotides in length and a sense strand 20 nucleotides in length, wherein said antisense strand comprises 2'- 0-CH3 modifications at nucleotides 1, 3, 5, 7, 9, 11, 13, 15, 17 and 19, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 2, 4, 6, 8, 10, 12 ,14, 16, 18 and 20 wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 21 nucleotides in length and a sense strand 21 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 1, 3, 5, 7, 9, 11, 13, 15, 17, 19 and 21, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 2, 4, 6, 8,

10, 12 ,14, 16, 18 and 20, wherein said antisense strand is numbered from 5'-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 22 nucleotides in length and a sense strand 22 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 1 , 3, 5, 7, 9, 1 1, 13, 15, 17, 19 and 21 , and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 2, 4, 6, 8, 10, 12 ,14, 16, 18, 20 and 22, wherein said antisense strand is numbered from 5'-3 ' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 23 nucleotides in length and a sense strand 23 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 1, 3, 5, 7, 9,

11, 13, 15, 17, 19, 21 and 23, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 2, 4, 6, 8, 10, 12 ,14, 16, 18, 20 and 22 wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'.

In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 3, 5, 7, 9, 11, 13, 15 and 17, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 4, 6, 8, 10, 12 ,14 and 16, wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5' . In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0- CH3 modifications at nucleotides 5, 7, 9, 11, 13 and 15, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 6, 8, 10, 12 and 14, wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 7, 9, 11, 13 and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 8, 10 and 12, wherein said antisense strand is numbered from 5'- 3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 7, 9 and 11, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 8, 10 and 12, wherein said antisense strand is numbered from 5'-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0-CH3 modifications at nucleotides 7 and 9, and wherein said sense strand comprises 2'-0-CH3 modifications at nucleotides 8 and 10, wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'. In another embodiment, the siRNA comprises an antisense strand 18-23 nucleotides in length and a sense strand 18-23 nucleotides in length, wherein said antisense strand comprises 2'-0- CH3 modifications at nucleotides 9 and 11, and wherein said sense strand comprises 2'-0- CH3 modifications at nucleotides 8 and 10, wherein said antisense strand is numbered from 5 '-3' and said sense strand is numbered from 3 '-5'.

In another embodiment, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,

12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 2'-deoxy nucleotides.

In another embodiment, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 2 '-deoxy nucleotides.

In another embodiment, the antisense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11,

12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 2'-fluoro nucleotides.

In another embodiment, the sense strand comprises 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12,

13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24 or 25 2'-fluoro nucleotides. In another embodiment, the pyrimidine nucleotides in the antisense strand are 2'-0- methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the antisense strand are 2'-0- methyl purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense strand are 2'- deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense strand are 2'-deoxy purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense strand are 2'- fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense strand are 2'-fluoro purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense strand are 2'-0-methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the sense strand are 2'-0-methyl purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense strand are 2'-deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense strand are 2'-deoxy purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense strand are 2'-fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense strand are 2'-fluoro purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense duplex region are 2'-0-methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the antisense duplex region are 2'- O-methyl purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense duplex region are 2'-deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense duplex region are 2'- deoxy purine nucleotides. In another embodiment, the pyrimidine nucleotides in the antisense duplex region are 2'-fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense duplex region are 2'- fluoro purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense duplex region are 2'- O-methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the sense duplex region are 2'-0- methyl purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense duplex region are 2'- deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense duplex region are 2'-deoxy purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense duplex region are 2'- fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense duplex region are 2'-fluoro purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense duplex flanking regions are 2'-0-methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the antisense duplex flanking regions are 2'-0-methyl purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense duplex flanking regions are 2 '-deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense duplex flanking regions are 2'-deoxy purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the antisense duplex flanking regions are 2'-fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the antisense duplex flanking regions are 2'-fluoro purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense duplex flanking regions are 2'-0-methyl pyrimidine nucleotides.

In another embodiment, of the purine nucleotides in the sense duplex flanking regions are 2'-0-methyl purine nucleotides. In another embodiment, the pyrimidine nucleotides in the sense duplex flanking regions are 2 '-deoxy pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense duplex flanking regions are 2 '-deoxy purine nucleotides.

In another embodiment, the pyrimidine nucleotides in the sense duplex flanking regions are 2'-fluoro pyrimidine nucleotides.

In another embodiment, the purine nucleotides in the sense duplex flanking regions are 2'-fluoro purine nucleotides.

Pattern: In one aspect, the antisense duplex region comprises a plurality of groups of modified nucleotides, referred to herein as "modified groups", wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a second group of nucleotides, referred to herein as "flanking groups", wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the antisense duplex region is identical, i.e., each modified group consists of an equal number of identically modified nucleotides. In another embodiment, each flanking group has an equal number of nucleotide. In another embodiment, each flanking group is identical. In another embodiment, the nucleotides of said modified groups in the antisense duplex region comprise a modified base. In another embodiment, the nucleotides of said modified groups comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups comprise a modified 2' position.

In another aspect, the sense duplex region comprises a plurality of groups of modified groups, wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a flanking group, wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the sense duplex region is identical. In another embodiment, each flanking group has an equal number of nucleotides. In another embodiment, each flanking group is identical. In another embodiment, the nucleotides of said modified groups in the sense duplex region comprise a modified base. In another embodiment, the nucleotides of said modified groups comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups comprise a modified 2' position.

In another aspect, the antisense duplex region and the sense duplex region each comprise a plurality of modified groups, wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a flanking group, wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the antisense duplex region and the sense duplex region are identical. In another embodiment, each flanking group in the antisense duplex region and the sense duplex region each have an equal number of nucleotides. In another embodiment, each flanking group in the antisense duplex region and in the sense duplex region are identical. In another embodiment, the nucleotides of said modified groups in the antisense duplex region and the sense duplex region each comprise the same modified groups and the same flanking groups. In another embodiment, the nucleotides of said modified groups in the antisense duplex region and the sense duplex region each comprise a modified base. In another embodiment, the nucleotides of said modified groups in the antisense duplex region and the sense duplex region each comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups in the antisense duplex region and the sense duplex region each comprise a modified 2' position.

In one aspect, the antisense strand comprises a plurality of groups of modified nucleotides, referred to herein as "modified groups", wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a second group of nucleotides, referred to herein as "flanking groups", wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the antisense strand is identical, i.e., each modified group consists of an equal number of identically modified nucleotides. In another embodiment, each flanking group has an equal number of nucleotide. In another embodiment, each flanking group is identical. In another embodiment, the nucleotides of said modified groups in the antisense strand comprise a modified base. In another embodiment, the nucleotides of said modified groups comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups comprise a modified 2' position. In another aspect, the sense strand comprises a plurality of groups of modified groups, wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a flanking group, wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the sense strand is identical. In another embodiment, each flanking group has an equal number of nucleotides. In another embodiment, each flanking group is identical. In another embodiment, the nucleotides of said modified groups in the sense strand comprise a modified base. In another embodiment, the nucleotides of said modified groups comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups comprise a modified 2' position.

In another aspect, the antisense strand and the sense strand each comprise a plurality of modified groups, wherein each modified group consists of one or more identically modified nucleotides, wherein each modified group is flanked on one or both sides by a flanking group, wherein each said flanking group consists of one or more nucleotides that are either unmodified or modified in a manner different from the nucleotides of said modified group. In one embodiment, each modified group in the antisense strand and the sense strand are identical. In another embodiment, each flanking group in the antisense strand and the sense strand each have an equal number of nucleotides. In another embodiment, each flanking group in the antisense strand and in the sense strand are identical. In another embodiment, the nucleotides of said modified groups in the antisense strand and the sense strand each comprise the same modified groups and the same flanking groups. In another embodiment, the nucleotides of said modified groups in the antisense strand and the sense strand each comprise a modified base. In another embodiment, the nucleotides of said modified groups in the antisense strand and the sense strand each comprise a modified phosphate backbone. In another embodiment, the nucleotides of said modified groups in the antisense strand and the sense strand each comprise a modified 2' position.

In another aspect, the modified groups and the flanking groups form a regular pattern on the antisense stand. In another aspect, the modified groups and the flanking groups form a regular pattern on the sense strand. In one embodiment, the modified groups and the flanking groups form a regular pattern on the both the antisense strand and the sense strand. In another embodiment, the modified groups and the flanking groups form a regular pattern on the antisense duplex region. In another aspect, the modified groups and the flanking groups form a regular pattern on the sense duplex region. In one embodiment, the modified groups and the flanking groups form a regular pattern on the both the antisense duplex region and the sense duplex region.

In another aspect, the pattern is a spatial or positional pattern. A spatial or positional pattern means that (a) nucleotide(s) are modified depending on their position within the nucleotide sequence of a double-stranded portion. Accordingly, it does not matter whether the nucleotide to be modified is a pyrimidine or a purine. Rather the position of a modified nucleotide is dependent upon: (a) its numbered position on a strand of nucleic acid, wherein the nucleotides are numbered from the 5 '-end to the 3 '-end with the 5 '-end nucleotide of the strand being position one (both the antisense strand and sense strand are numbered from their respective 5 '-end nucleotide), or (b) the position of the modified group relative to a flanking group. Thus, according to this embodiment, the modification pattern will always be the same, regardless of the sequence which is to be modified.

In another embodiment, the number of modified groups on the antisense strand is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In another embodiment, the number of modified groups on the sense strand is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In another embodiment, the number of flanking groups on the antisense strand of nucleic acid is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In another embodiment, the number of flanking groups on the sense strand of nucleic acid is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In one embodiment, the number of modified groups and the number of flanking groups on either or both the antisense strand and the sense strand are the same.

In another embodiment, the number of modified groups on the antisense duplex region is selected 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 or 14. In another embodiment, the number of modified groups on the sense duplex region is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 or 14. In another embodiment, the number of flanking groups on the antisense duplex region of nucleic acid is 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In another embodiment, the number of flanking groups on the sense duplex region of nucleic acid is selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9, 10, 11 , 12, 13 or 14. In one embodiment, the number of modified groups and the number of flanking groups on either or both the antisense duplex region and the sense duplex region are the same.

In one embodiment, the number of modified groups and the number of flanking groups on a strand or on a duplex region are the same. In another embodiment, the number of modified groups and the number of flanking groups on a strand or on a duplex region are the same, wherein the number is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14.

In another embodiment, the number of nucleotides in a modified group is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14. In another embodiment, the number of nucleotides in a flanking group is selected from 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14.

In one embodiment, each modified group on both the antisense strand and the sense strand is identical. In one embodiment, each modified group on both the antisense duplex region and the sense duplex region is identical. In another embodiment, each modified group and each flanking group on both the antisense strand and the sense strand are identical. In one embodiment, each modified group and each flanking group on both the antisense duplex region and the sense duplex region are identical.

In one embodiment, each modified group, each modified group position, each flanking group and each flanking group position on both the antisense strand and the sense strand are identical. In one embodiment, each modified group, each modified group position, each flanking group and each flanking group position on both the antisense duplex region and the sense duplex region are identical. In another embodiment, the modified groups on the antisense strand are complementary with the modified groups on the sense strand (the modified groups on the antisense strand and the sense strand are perfectly aligned across from one another). In another embodiment, there are no mismatches in the modified groups such that each modified group on the antisense strand is base paired with each modified group on the sense strand. In another embodiment, each modified group on the sense strand is shifted by 1, 2, 3, 4 or 5 nucleotides relative to the modified groups on the antisense strand. For example, if each modified group on the sense strand is shifted by one nucleotide and a modified group started at position one on the antisense strand, a modified group on the sense strand would begin at position two. In another embodiment, the modified groups of the antisense strand do not overlap the modified groups of the sense strand, i.e., no nucleotide of a modified group on the antisense strand is base paired with a nucleotide of a modified group on the sense strand.

In one embodiment, deoxyribonucleotides at an end of a strand of nucleic acid are not considered when determining a position of a modified group, i.e., the positional numbering begins with the first ribonucleotide or modified ribonucleotide. In another embodiment, abasic nucleotides at an end of a strand of nucleic acid are not considered when determining a position of a modified group. In one aspect, a modified group comprises a 5 '-end nucleotide of either or both of the antisense strand and the sense strand. In another embodiment, a flanking group comprises the 5 '-end nucleotide of either or both of the antisense strand and the sense strand. In another embodiment, the 5 '-end nucleotide of either or both of the antisense strand and the sense strand is unmodified. In another embodiment, a modified group comprises the 5 '-most nucleotide of either or both of the antisense duplex region and sense duplex region. In another embodiment, a flanking group comprises the 5 '-most nucleotide of either or both of the antisense duplex region or the sense duplex region. In another embodiment, the 5 '-most nucleotide of either or both of the antisense duplex region or the sense duplex region is unmodified. In another embodiment, the nucleotide at position 10 of the antisense strand is unmodified. In another embodiment, the nucleotide at position 10 of the sense strand is modified. In another embodiment, a modified group comprises the nucleotide at position 10 of the sense strand.

In one embodiment, the modification at the 2' position is selected from the group comprising amino, fluoro, methoxy, alkoxy and Ci-C3-alkyl. In another embodiment, the modification is 2'-0-methyl.

In another aspect, each modified group consists of one nucleotide and each flanking group consists of one nucleotide. In one embodiment, each modified group on the antisense strand is aligned with a flanking group on the sense strand.

In another aspect, each modified group consists of one 2'-0-methyl modified nucleotide and each flanking group consists of one nucleotide. In one embodiment, each flanking group consists of one unmodified nucleotide. In one embodiment, each flanking group consists of one 2'-0-methyl modified nucleotide. In another embodiment, each modified group on both the antisense strand and the sense strand consists of one 2'-0-methyl modified nucleotide and each flanking group on both the antisense strand and the sense strand consists of one nucleotide, wherein no modified group on one strand is either aligned or both aligned and base paired with another modified group on the other strand and no flanking group on one strand is either aligned or both aligned and base paired with a flanking group on the other strand. In another embodiment, excluding any optional overhangs, each modified group on each strand is either aligned or both aligned and based paired with a flanking group on the other strand. In one embodiment, the flanking group is unmodified. In another embodiment, the nucleotide of position one on the antisense strand is 2'-0-methyl modified. In another embodiment, the 5 '-most nucleotide of the antisense duplex region is 2'-0-methyl modified.

Positional modification schemes are described in international patent application WO 2004/015107, incorporated by reference in its entirety.

Modifications to phosphate backbone: Another secondary aspect relates to modifications to a phosphate backbone. All or a portion of the nucleotides of the siRNA of the invention may be linked through phosphodiester bonds, as found in unmodified nucleic acid. A siRNA of the present invention however, may comprise a modified phosphodiester linkage. The phosphodiester linkages of either the antisense stand or the sense strand may be modified to independently include at least one heteroatom selected from the group consisting of nitrogen and sulfur. In one embodiment, a phosphoester group connecting a ribonucleotide to an adjacent ribonucleotide is replaced by a modified group. In one embodiment, the modified group replacing the phosphoester group is selected from the group consisting of phosphothioate, methylphosphonate or phosphoramidate group.

In one embodiment, all of the nucleotides of the antisense strand are linked through phosphodiester bonds. In another embodiment, all of the nucleotides of the antisense duplex region are linked through phosphodiester bonds. In another embodiment, all of the nucleotides of the sense strand are linked through phosphodiester bonds. In another embodiment, all of the nucleotides of the sense duplex region are linked through phosphodiester bonds. In another embodiment, the antisense strand comprises a number of modified phosphoester groups selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In another embodiment, the antisense duplex region comprises a number of modified phosphoester groups selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In another embodiment, the sense strand comprises a number of modified phosphoester groups selected from 1, 2, 3, 4, 5, 6, 7, 8, 9 or 10. In another embodiment, the sense duplex region comprises a number of modified phosphoester groups selected from 1 , 2, 3, 4, 5, 6, 7, 8, 9 or 10.

5 ' and 3 ' end modifications: Another secondary aspect relates to 5' and 3 ' modifications. The siRNA of the present invention may include nucleic acid molecules comprising one or more modified nucleotides, abasic nucleotides, acyclic or deoxyribonucleotide at the terminal 5 '- or 3 '-end on either or both of the sense or antisense strands. In one embodiment, the 5'- and 3 '-end nucleotides of both the sense and antisense strands are unmodified. In another embodiment, the 5 '-end nucleotide of the antisense strand is modified. In another embodiment, the 5 '-end nucleotide of the sense strand is modified. In another embodiment, the 3 '-end nucleotide of the antisense strand is modified. In another embodiment, the 3 '-end nucleotide of the sense strand is modified. In another embodiment, the 5 '-end nucleotide of the antisense strand and the 5 '-end nucleotide of the sense strand are modified. In another embodiment, the 3 '-end nucleotide of the antisense strand and the 3 '-end nucleotide of the sense strand are modified. In another embodiment, the 5 '-end nucleotide of the antisense strand and the 3 '-end nucleotide of the sense strand are modified. In another embodiment, the 3 '-end nucleotide of the antisense strand and the 5 '-end nucleotide of the sense strand are modified. In another embodiment, the 3 '-end nucleotide of the antisense strand and both the 5 '- and 3 '-end nucleotides of the sense strand are modified. In another embodiment, both the 5 '- and 3 '-end nucleotides of the antisense strand are modified. In another embodiment, both the 5 '- and 3 '-end nucleotides of the sense strand are modified.

In another embodiment, the 5 '-end nucleotide of the antisense strand is phosphorylated. In another embodiment, the 5 '-end nucleotide of the sense strand is phosphorylated. In another embodiment, the 5 '-end nucleotides of both the antisense strand and the sense strand are phosphorylated. In another embodiment, the 5 '-end nucleotide of the antisense strand is phosphorylated and the 5 '-end nucleotide of the sense strand has a free hydroxyl group (5 ' -OH). In another embodiment, the 5 '-end nucleotide of the antisense strand is phosphorylated and the 5 '-end nucleotide of the sense strand is modified.

Modifications to the 5 '- and 3 '-end nucleotides are not limited to the 5 ' and 3 ' positions on these terminal nucleotides. Examples of modifications to end nucleotides include, but are not limited to, biotin, inverted (deoxy) abasics, amino, fluoro, chloro, bromo, CN, CF, methoxy, imidazole, caboxylate, thioate, Ci to C ₁₀ lower alkyl, substituted lower alkyl, alkaryl or aralkyl, OCF ₃ , OCN, 0-, S-, or N-alkyl; 0-, S-, or N-alkenyl; SOCH ₃ ; S0 ₂ CH ₃ ; ON0 ₂ ; N0 ₂ , N ₃ ; heterozycloalkyl; heterozycloalkaryl; amino alky lamino; polyalkylamino or substituted silyl, as, among others, described, e.g., in PCT patent application WO 99/54459, European patents EP 0 586 520 Bl or EP 0 618 925 B l , incorporated by reference in their entireties.. As used herein, "alkyl" means Ci-Ci ₂ -alkyl and "lower alkyl" means Ci-C ₆ -alkyl, including Ci-, C ₂ -, C ₃ -, C ₄ -, C ₅ - and C ₆ -alkyl.

In another aspect, the 5 '-end of the antisense strand, the 5 '- end of the sense strand, the 3 '-end of the antisense strand or the 3 '-end of the sense strand is covalently connected to a prodrug moiety. In one embodiment, the moiety is cleaved in an endosome. In another the moiety is cleaved in the cytoplasm. Various possible non-limiting embodiments of the siRNA of the present invention having different kinds of end modification(s) are presented in the following Table.

Various embodiments of the interfering ribonucleic acid according to the

present invention

Antisense strand Sense strand

1.) 5 '-end free OH free OH

3 '-end free OH free OH

2.) 5 -end free OH free OH

3 -end end modification end modification

3.) 5 -end free OH free OH

3 -end free OH end modification

4.) 5 -end free OH free OH

3 -end end modification free OH

5.) 5 -end free OH end modification

3 -end free OH free OH

6.) 5 -end free OH end modification

3 -end end modification free OH

7.) 5 -end free OH end modification

3 -end free OH end modification

8.) 5 -end free OH end modification

3 -end end modification end modification

In another embodiment, the terminal 3' nucleotide or two terminal 3 '-nucleotides on either or both of the antisense strand or sense strand is a 2'-deoxynucleotide. In another embodiment, the 2'-deoxynucleotide is a 2'-deoxy-pyrimidine. In another embodiment, the 2'- deoxynucleotide is a 2' deoxy-thymidine.

shRNA and linked siRNA: Another aspect relates to shR A and linked siR A. It is within the present invention that the double-stranded structure is formed by two separate strands, i.e. the antisense strand and the sense strand. However, it is also with in the present invention that the antisense strand and the sense strand are covalently linked to each other. Such linkage may occur between any of the nucleotides forming the antisense strand and sense strand, respectively. Such linkage can be formed by covalent or non-covalent linkages. Covalent linkage may be formed by linking both strands one or several times and at one or several positions, respectively, by a compound preferably selected from the group comprising methylene blue and bifunctional groups. Such bifunctional groups are preferably selected from the group comprising bis(2-chloroethyl)amine, N-acetly-N'-(p- glyoxylbenzoyl)cystamine, 4-thiouracile and psoralene.

In one aspect, the antisense strand and the sense strand are linked by a loop structure. In another embodiment, of the loop structure is comprised of a non-nucleic acid polymer. In another embodiment, the non-nucleic acid polymer is polyethylene glycol. In another embodiment, the 5 ^' -end of the antisense strand is linked to the 3 ^' -terminus of the sense strand. In another embodiment, the 3 ^' -end of the antisense strand is linked to the 5 ^' -end of the sense strand.

In another aspect, the loop consists of a nucleic acid. As used herein, locked nucleic acid (LNA) (Elayadi and Corey (2001) Curr Opin Investig Drugs. 2(4):558-61) and peptide nucleic acid (PNA) (reviewed in Faseb J. (2000) 14: 1041-1060) are regarded as nucleic acids and may also be used as loop forming polymers. In one embodiment, the nucleic acid is ribonucleic acid. In one embodiment, the 5 '-terminus of the antisense strand is linked to the 3 '-terminus of the sense strand. In another embodiment, the 3 '-end of the antisense strand is linked to the 5 '-terminus of the sense strand. The loop consists of a minimum length of four nucleotides or nucleotide analogues. In one embodiment, the loop consists of a length of nucleotides or nucleotide analogues selected from 4, 5, 6, 7, 8, 9, 10, 1 1, 12, 13, 14 or 15. In one embodiment, the length of the loop is sufficient for linking the two strands covalently in a manner that a back folding can occur through a loop structure or similar structure. The ribonucleic acid constructs may be incorporated into suitable vector systems. Preferably the vector comprises a promoter for the expression of RNAi. Preferably the respective promoter is pol III and more preferably the promoters are the U6, HI, 7SK promoter as described in Good et al. (1997) Gene Ther, 4, 45-54.

In another aspect, the nucleic acid according to the present invention comprises a phosphorothioate internucleotide linkage. In one embodiment, a phosphorothioate internucleotide linkage is within 5 nucleotides from the 3 '-end or the 5 '-end of either or both of the antisense strand and the sense strand. The antisense strand can comprise about one to about five phosphorothioate internucleotide linkages.

Combinations of embodiments:

In one embodiment, an overhang at the 3 '-end of the sense strand is selected from consisting of 1, 2, 3, 4 and 5 nucleotides in length. In one embodiment, an overhang at the 5'- end of the antisense strand is selected from consisting of 1, 2, 3, 4 and 5 nucleotides in length. In one embodiment, an overhang at the 5 '-end of the sense strand is selected from consisting of 1, 2, 3, 4 and 5 nucleotides in length.

In one embodiment, the siRNA molecule is blunt-ended on both ends and has a length selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 consecutive nucleotides.

In one embodiment, the siRNA molecule is blunt-ended on one end and the double stranded portion of the siRNA molecule has a length selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 consecutive nucleotides.

In one embodiment, the siRNA molecule has overhangs on both ends and the double stranded portion of the siRNA molecule has a length selected from the group consisting of 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28 or 29 consecutive nucleotides.

In one embodiment, the siRNA molecule comprises an overhang, said overhang comprising at least one deoxyribonucleotide. In one embodiment, the siRNA molecule comprises an overhang, said overhang comprising two deoxyribonucleotides.

In one embodiment, the siRNA molecule has overhangs on the 3 '-end of the antisense strand and at the 3 '-end of the sense strand, said overhangs comprising at least one deoxyribonucleotide. In one embodiment, the siRNA molecule has overhangs on the 3 '-end of the antisense strand and at the 3 '-end of the sense strand, said overhangs consisting two deoxyribonucleotides.

To the extent it is referred herein to the position of a nucleotide within a nucleotide sequence as "even numbered" or "odd numbered", such numbering starts from the 5' end of such nucleotide sequence. The nucleotide(s) forming the overhang may be (a) desoxyribonucleotide(s), (a) ribonucleotide(s) or a combination thereof. In one embodiment, the antisense strand and/or the sense strand comprise a TT dinucleotide at the 3 ' end.

Processes of making: The nucleic acid of the present invention can be produced using routine methods in the art including chemically synthesis or expressing the nucleic acid either in vitro (e.g., run off transcription) or in vivo. In one embodiment, the siRNA is produced using solid phase chemical synthesis. In another embodiment, the nucleic acid is produced using an expression vector. In one embodiment, the expression vector produced the nucleic acid of the invention in the target cell. Accordingly, such vector can be used for the manufacture of a medicament. Methods for the synthesis of the nucleic acid molecule described herein are known to the ones skilled in the art. Such methods are, among others, described in Caruthers et al, 1992, Methods in Enzymology 211, 3-19, Thompson et al, International PCT Publication No. WO 99/54459, Wincott et al, 1995, Nucleic Acids Res. 23, 2677-2684, Wincott et al, 1997, Methods Mol. Bio., 74, 59, Brennan et al, 1998, Biotechnol Bioeng., 61, 33-45, and Brennan, U.S. Pat. No. 6,001,311 (each incorporated herein by reference in their entireties).

Protein kinase 3 (PKN3) specific siRNAs

The delivery vehicle may, in a further embodiment, encompass and thus deliver an siRNA which is targeting PKN3. Such PKN3-specific siRNAs are, for example, described in international patent application WO 2008/009477. Preferred embodiments are the following siRNAs, whereby the modification is only optional and any of the modifications described herein may be equally applied to and thus be realized by such PKN3-specific siRNAs. As used herein, the nucleotide indicated with a capital letter is a nucleotide which is 2'-0-methyl modified.

PKN3 (2) cUuGaGgAcUuCcUgGaCa (SEQ ID NO: 23)

UgUcCaGgAaGuCcUcAaG (SEQ ID NO: 24)

PKN3 (3) uUgAgGaCuUcCuGgAcAa (SEQ ID NO: 26)

UuGuCcAgGaAgUcCuCaA (SEQ ID NO: 27)

PKN3 (4) aGgAcUuCcUgGaCaAuGc (SEQ ID NO: 28)

GcAuUgUcCaGgAaGuCcU (SEQ ID NO: 29)

PKN3 (5) cCuGgAcAaUgCcUgUcAc (SEQ ID NO: 30)

GuGaCaGgCaUuGuCcAgG (SEQ ID NO: 31) PK 3 (6): gGgAcAcUuUgGgAaGgUc (SEQ ID NO: 32)

GaCcUuCcCaAaGuGuCcC (SEQ ID NO: 33)

PKN3 (8): cUcCaGcCaUgCcUgCuUu (SEQ ID NO: 34)

AaAgCaGgCaUgGcUgGaG (SEQ ID NO: 35)

PKN3-23-vl : UuGuCcAgGaAgUcCuCaAgUcU (SEQ ID NO: 36)

aGaCuUgAgGaCuUcCuGgAcAa (SEQ ID NO: 37)

PKN3-23-v2: GgCaUuGuCcAgGaAgUcCuCaA (SEQ ID NO: 38)

uUgAgGaCuUcCuGgAcAaUgCc (SEQ ID NO: 39)

PKN3-23-v3: AuUgUcCaGgAaGuCcUcAaGuC (SEQ ID NO: 40)

gAcUuGaGgAcUuCcUgGaCaAu (SEQ ID NO: 41)

PKN3-23-v4: CaUuGuCcAgGaAgUcCuCaAgU (SEQ ID NO: 42)

aCuUgAgGaCuUcCuGgAcAaUg (SEQ ID NO: 43)

PKN3-23-v5: GcAuUgUcCaGgAaGuCcUcAaG (SEQ ID NO: 44)

cUuGaGgAcUuCcUgGaCaAuGc (SEQ ID NO: 45).

Delivery/formulations : siRNA can be delivered to cells, both in vitro and in vivo, by a variety of methods known to those of skill in the art, including direct contact with cells ("naked" siRNA) or by in combination with one or more agents that facilitate targeting or delivery into cells. Such agents and methods include lipoplexes, liposomes, iontophoresis, hydrogels, cyclodextrins, nanocapsules, micro- and nanospheres and proteinaceous vectors (e.g., Bioconjugate Chem. (1999) 10: 1068-1074 and WO 00/53722). The nucleic acid/vehicle combination may be locally delivered in vivo by direct injection or by use of an infusion pump. The siRNA of the invention can be delivered in vivo by various means including intravenous subcutaneous, intramuscular or intradermal injection or inhalation. The molecules of the instant invention can be used as pharmaceutical agents. Preferably, pharmaceutical agents prevent, modulate the occurrence, or treat (alleviate a symptom to some extent, preferably all of the symptoms) of a disease state in a subject.

There is also provided the use of a composition comprising surface-modified liposomes containing poly (ethylene glycol) lipids (PEG-modified, or long-circulating liposomes or stealth liposomes). These formulations offer a method for increasing stability of a liposome or lipoplex solutions by preventing their aggregation and fusion. The formulations also have the added benefit in vivo of resisting opsonization and elimination by the mononuclear phagocytic system (MPS or RES), thereby enabling longer blood circulation times and enhanced tissue exposure for the encapsulated drug. Such liposomes have been shown to accumulate selectively in tumors, presumably by extravasation and capture in the neovascularized target tissues (Lasic et al, Science 1995, 267, 1275-1276; Oku et al, 1995, Biochim. Biophys. Acta, 1238, 86-90). The long-circulating liposomes enhance the pharmacokinetics and pharmacodynamics of DNA and RNA, particularly compared to conventional cationic liposomes which are known to accumulate in tissues of the MPS (Liu et al, J. Biol. Chem. 1995, 42,24864-24780; Choi et al, International PCT Publication No. WO 96/10391; Ansell et al, International PCT Publication No. WO 96/10390; Holland et al, International PCT Publication No. WO 96/10392). Long-circulating liposomes also protect the siRNA from nuclease degradation.

The siRNA of the present invention may be formulated as pharmaceutical compositions. The pharmaceutical compositions may be used as medicaments or as diagnostic agents, alone or in combination with other agents. For example, one or more siRNAs of the invention can be combined with a delivery vehicle (e.g., liposomes) and excipients, such as carriers, diluents. Other agents such as preservatives and stabilizers can also be added. Methods for the delivery of nucleic acid molecules are known in the art and described, e.g., in Akhtar et al, 1992, Trends Cell Bio., 2, 139; Delivery Strategies for Antisense Oligonucleotide Therapeutics, ed. Akhtar, 1995, Maurer et al, 1999, Mol. Memb. Biol, 16, 129-140; Hofiand and Huang, 1999, Handb. Exp. Pharmacol, 137, 165-192; and Lee et al, 2000, ACS Symp. Sen, 752, 184-192, U.S. Pat. No. 6,395,713 and PCT WO 94/02595 (each of which are incorporated herein by reference in their entireties). The siRNA of the present invention can also be administered in combination with other therapeutic compounds, either administrated separately or simultaneously, e.g., as a combined unit dose. In one embodiment, the invention includes a pharmaceutical composition comprising one or more siRNA according to the present invention in a physio logically/pharmaceutically acceptable excipient, such as a stabilizer, preservative, diluent, buffer, and the like.

Dosage levels for the medicament and pharmaceutical compositions of the invention can be determined by those skilled in the art by routine experimentation. In one embodiment, a unit dose contains between about 0.01 mg/kg and about 100 mg/kg body weight of siRNA. In one embodiment, the dose of siRNA is about 10 mg/kg and about 25 mg/kg body weight. In one embodiment, the dose of siRNA is about 1 mg/kg and about 10 mg/kg body weight. In one embodiment, the dose of siRNA is about 0.05 mg/kg and about 5 mg/kg body weight. In another embodiment, the dose of siRNA is about 0.1 mg/kg and about 5 mg/kg body weight. In another embodiment, the dose of siRNA is about 0.1 mg/kg and about 1 mg/kg body weight. In another embodiment, the dose of siRNA is about 0.1 mg/kg and about 0.5 mg/kg body weight. In another embodiment, the dose of siRNA is about 0.5 mg/kg and about 1 mg/kg body weight.

In one aspect, the pharmaceutical composition is a sterile injectable aqueous suspension or solution. In one aspect, the pharmaceutical composition is in lyophilized form. In one embodiment, the pharmaceutical composition comprises lyophilized lipoplexes, wherein the lipoplexes comprises a siRNA of the present invention. In another embodiment, the pharmaceutical composition comprises an aqueous suspension of lipoplexes, wherein the lipoplexes comprises a siRNA of the present invention.

The pharmaceutical compositions and medicaments of the present invention may be administered to a subject (mammal) in the disclosed methods of treatment. In one embodiment, the mammal is selected from the group consisting humans, dogs, cats, horses, cattle, pig, goat, sheep, mouse, rat, hamster and guinea pig. In one embodiment, the mammal is a human. In another embodiment, the mammal is a non-human mammal.

In one embodiment, the present invention is related to lipoplexes comprising a siRNA according to the present invention. Such lipoplexes consist of siRNA and liposomes. Such lipoplexes may be used to deliver the siRNA of the invention to a target cell either in vitro or in vivo.

In one aspect, the lipoplex has a zeta-potential of about 40 to 55 mV, preferably about 45 to 50 mV. The size of the lipoplex according to the present invention is about 80 to 200 nm, about 100 to 140 nm or about 110 nm to 130 nm, as determined by dynamic light scattering (QELS) such as, e. g., by using an N5 submicron particle size analyzer from Beckman Coulter according to the manufacturer's recommendation.

In one embodiment, the liposome as forming part of the lipoplex is a positively charged liposome consisting of:

a) about 50 mol% -arginyl-2,3-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride, preferably P-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl- amide tri-hydrochloride, b) about 48 to 49 mol% l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE), and

c) about 1 to 2 mol% l,2-distearoyl-sn-glycero-3-phosphoethanolamine-polyethylen- glycole, preferably N-(Carbonyl-methoxypolyethyleneglyco 1-2000)- 1 ,2-distearoyl-sn- glycero-3-phosphoethanolamine sodium salt.

The lipoplex and lipid composition forming the liposomes is preferably in a carrier however, the lipoplex can also be present in a lyophilised form. The lipid composition contained in a carrier usually forms a dispersion. More preferably, the carrier is an aqueous medium or aqueous solution as also further characterised herein. The lipid composition typically forms a liposome in the carrier, whereby such liposome preferably also contains the carrier inside.

The lipid composition contained in the carrier and the carrier, respectively, preferably has an osmolality of about 50 to 600 mosmole/kg, preferably about 250 - 350 mosmole/kg, and more preferably about 280 to 320 mosmole/kg.

The liposomes preferably are formed by the first lipid component and optionally also by the second lipid component, preferably in combination with the first lipid component, preferably exhibit a particle size of about 20 to 200 nm, preferably about 30 to 100 nm, and more preferably about 40 to 80 nm. It is noted that the size of the particles follows a certain statistical distribution.

A further optional feature of the lipid composition in accordance with the present invention is that the pH of the carrier is preferably from about 4.0 to 6.0. However, also other pH ranges such as from 4.5 to 8.0, preferably from about 5.5 to 7.5 and more preferably about 6.0 to 7.0 are within the present invention.

For realizing these particular features various measures may be taken. For adjusting the osmolality, for example, a sugar or a combination of sugars is particularly useful. Insofar, the lipid composition of the present invention may comprise one or several of the following sugars: sucrose, trehalose, glucose, galactose, mannose, maltose, lactulose, inulin and raffmose, whereby sucrose, trehalose, inulin and raffinose are particularly preferred. In a particularly preferred embodiment, the osmolality mostly adjusted by the addition of sugar is about 300 mosmole/kg which corresponds to a sucrose solution of 270 mM or a glucose solution of 280 mM. Preferably the carrier is isotonic to the body fluid into which such lipid composition is to be administered. As used herein the term that the osmolality is mostly adjusted by the addition of sugar means that at least about 80 %, preferably at least about 90 % of the osmolality is provided by said sugar or a combination of said sugars.

If the pH of the lipid composition of the present invention is adjusted, this is done by using buffer substances which, as such, are basically known to the one skilled in the art. Preferably, basic substances are used which are suitable to compensate for the basic characteristics of the cationic lipids and more specifically of the ammonium group of the cationic head group. When adding basic substances such as basic amino acids and weak bases, respectively, the above osmolality is to be taken into consideration. The particle size of such lipid composition and the liposomes formed by such lipid composition is preferably determined by dynamic light scattering such as by using an N5 submicron particle size analyzer from Beckman Coulter according to the manufacturer's recommendation.

If the lipid composition contains one or several nucleic acid(s), such lipid composition usually forms a lipoplex (liposome-nucleic acid complex). The more preferred concentration of the overall lipid content in the lipoplex in preferably isotonic 270 mM sucrose or 280 mM glucose is from about 0.01 to 100 mg/ml, preferably 0.01 to 40 mg/ml and more preferably 0.01 to 25 mg/ml. It is to be acknowledged that this concentration can be increased so as to prepare a reasonable stock, typically by a factor of 2 to 3. It is also within the present invention that based on this, a dilution is prepared, whereby such dilution is typically made such that the osmolality is within the range specified above. More preferably, the dilution is prepared in a carrier which is identical or in terms of function and more specifically osmolality similar to the carrier used in connection with the lipid composition or in which the lipid composition is contained. In the embodiment, of the lipid composition of the present invention whereby the lipid composition also comprises a nucleic acid, preferably a functional nucleic acid such as, but not limited to, a siRNA, the concentration of the functional nucleic acid, preferably of siRNA in the lipid composition is about 0.2 to 0.4 mg/ml, preferably 0.28 mg/ml, and the total lipid concentration is about 1.5 to 2.7 mg/ml, preferably 2.17 mg/ml. It is to be acknowledged that this mass ratio between the nucleic acid fraction and the lipid fraction is particularly preferred, also with regard to the charge ratio thus realized. In connection with any further concentration or dilution of the lipid composition of the present invention, it is preferred that the mass ratio and the charge ratio, respectively, realized in this particular embodiment, is preferably maintained despite such concentration or dilution.

Such concentration as used in, for example, a pharmaceutical composition, can be either obtained by dispersing the lipid in a suitable amount of medium, preferably a physiologically acceptable buffer or any carrier described herein, or can be concentrated by appropriate means. Such appropriate means are, for example, ultra filtration methods including cross-flow ultra- filtration. The filter membrane may exhibit a pore width of 1,000 to 300,000 Da molecular weight cut-off (MWCO) or 5 nm to 1 μιη. Preferred is a pore width of about 10,000 to 100,000 Da MWCO. It will also be acknowledged by the one skilled in the art that the lipid composition more specifically the lipoplexes in accordance with the present invention may be present in a lyophilized form. Such lyophilized form is typically suitable to increase the shelve life of a lipoplex. The sugar added, among others, to provide for the appropriate osmolality, is used in connection therewith as a cryo -protectant. In connection therewith it is to be acknowledged that the aforementioned characteristics of osmolality, pH as well as lipoplex concentration refers to the dissolved, suspended or dispersed form of the lipid composition in a carrier, whereby such carrier is in principle any carrier described herein and typically an aqueous carrier such as water or a physiologically acceptable buffer, preferably an isotonic buffer or isotonic solution.

Another delivery system is for example described in European patent application EP 13 005 672.4 the disclosure of which is incorporated herein by reference. The delivery system described therein is a composition comprising a lipid composition, wherein the lipid composition consists of

a cationic lipid of formula (I)

wherein n is any one of 1, 2, 3, and 4, wherein m is any one of 1 , 2 and 3,

Y ^" is an anion, wherein each of Rl and R2 is individually and independently selected from the group consisting of linear C12-C18 alkyl and linear C12-C18 alkenyl; a sterol compound, wherein the sterol compound is selected from the group consisting of cholesterol and stigmasterol; and a PEGylated lipid, wherein the PEGylated lipid comprises a PEG moiety and wherein the PEGylated lipid is selected from the group consisting of a PEGylated phosphoethanolamine of formula (II)

wherein each of R3 and R4 is individually and independently linear C13-C17 alkyl, and

p is any integer from 15 to 130; a PEGylated ceramide of formula (III)

(III) wherein R5 is linear C7-C15 alkyl, and q is any integer from 15 to 130; and a PEGylated diacylglycerol of formula (IV)

(IV) wherein each of R6 and R7 is individually and independently linear CI 1-C17 alkyl, and r is any integer from 15 to 130.

A preferred embodiment of the delivery vehicle is one comprising the following lipid composition:

70 mol% P-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl- amide tri-hydrochloride of the following formula:

29 mol% cholesterol; and

1 mol% mPEG-2000-Ceramide-C8 of the following formula:

Another preferred embodiment of the delivery vehicle is one comprising the following lipid composition: 70 mole % of -arginyl-2,3-diamino propionic acid-N-palmityl-N-oleyl-amide trihydrochloride

29 mole % of cholesterol, and

1 mole % of l,2-distearoyl-5/7-glycero-3-phosphoethanolamine-N-[methoxy( polyethylene glycol)-2000] (ammonium salt)

Diseases: One aspect of the present invention provides a means for the treatment of pre-eclampsia or aged macular degeneration. Preferably such means is the delivery vehicle as disclosed herein and more preferably the lipid composition defined herein as AtuPLEX. The treatment of pre-eclampsia is, without wishing to be bound by any theory based on the observation that any payload of said delivery vehicle is contained within the maternal body of a pregnant female mammal and is not passed-on to the embryo of the pregnant female mammal. A preferred payload is a nucleic acid such as an siRNA and an siRNA directed to sFltl and/or PK 3 as described herein. Accordingly such means is also a nucleic acid such as to siRNA directed to sFltl and/or PKN3. In a still further embodiment such means is a lipoplex comprising a delivery vehicle as disclosed herein and an siRNA as disclosed herein, wherein preferably such siRNA is a sFltl -specific siRNA or a PKN3 -specific siRNA as described herein. The siRNA molecules can be used in combination with other therapeutic agents to enhance the therapeutic effects of a given treatment modality. In another aspect, the present invention provides reagents and methods useful for treating diseases and conditions characterized by undesirable or aberrant levels of sFltl activity in a cell.

The means described herein and delivery vehicle as disclosed herein in particular is also suitable for the diagnosis of a disease related to the malfunctions of sFlt-1 gene such as aged macular degeneration and preferably pre-eclampsia. It will be understood by a person skilled in the art that if the payload of the delivery vehicle is effective as a diagnostic agent, it will be possible to diagnose, more specifically by means of radioimmuno techniques, fluorescence techniques and/or imaging techniques diseases and disorders of the maternal body, or by way of exclusion, of the fetal body. Typically, the payload of the delivery vehicle will encompass a detectable marker such as, for example, a radio label or a fluorescence label. The payload of the delivery vehicle for the purpose of diagnosis can be, for example, a small molecule, a peptide, a polypeptide, a protein, an oligonucleotide, a polynucleotide or a nucleic acid.

Example 1: Materials and Methods

If not specifically indicated differently in the further examples, the following materials and methods were used in the practicing of said examples.

Cell Lines

Human endothelial cells were cultivated according to standard protocol.

Lipid compositions

AtuPLEX is a lipid composition containing

a) 50 mol% P-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl- amide tri-hydrochloride);

b) 49 mol% l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE); and c) 1 mol% N-(Carbonyl-methoxypo lyethylenegly co 1-2000)- 1,2-distearoyl- sn- glycero-3-phosphoethanolamine sodium salt. , whereby the charge ratio [lipids/phosphate oligo] is 8.4

DACC10 is a lipid composition containing

70 mol% P-(L-arginyl)-2,3-L-diaminopropionic acid-N-palmityl-N-oleyl- amide tri-hydrochloride of the following formula:

29 mol% cholesterol; and

1 mol% mPEG-2000-Ceramide-C8 of the following formula:

whereby the charge ratio [lipids/phosphate oligo] is 8.4.

Preparation and characterization of siRNA-lipoplexes

Cationic liposomes comprising the novel cationic lipid AtuFECTOl which is -Z-arginyl-2,3- Z-diaminopropionic acid-N-palmityl-N-oleyl-amide trihydrochloride, Atugen AG (Berlin), the neutral/helper lipid phospholipid l,2-diphytanoyl-sn-glycero-3-phosphoethanolamine (DPhyPE) (Avanti Polar Lipids Inc., Alabaster, AL) and the PEGylated lipid N-(Carbonyl- methoxypolyethylenegly co 1-2000)- 1 ,2-distearoyl-sn-glycero-3-phospho-ethanolamine sodium salt (DSPE-PEG) (Lipoid GmbH, Ludwigshafen, Germany) in a molar ratio of 50/49/1 were prepared by lipid film re-hydration in 300mM sterile R ase-free sucrose solution to a total lipid concentration of 4.34 mg/ml 300mM sucrose, pH=4.5-6.0. Subsequently the multilamellar dispersion was further processed by high pressure homogenization (22 cycles at 750 bar and 5 cycles at 1000 bar) using an EmulsiFlex C3 device (Avestin, Inc., Ottawa, Canada). To generate siRNA-lipoplexes (AtuPLEX) the obtained liposomal dispersion was mixed with an equal volume of a 0.5625 mg/ml solution of siRNA in 300 mM sucrose, resulting in a calculated charge ratio of nucleic acid backbone phosphates to cationic lipid nitrogen atoms of approximately 1 to 4. The size of the liposome and the lipoplex-dispersion was determined by Quasi Elastic Light Scattering (N5 Submicron Particle Size Analyzer, Beckman Coulter, Inc., Miami, FL) and the zeta potential was measured using a Zetasizer Nano-ZS (Malvern Instruments, Worcestershire, UK).

Labelling of siRNA

CY3 labeled siR A with the sequence shown below was obtained from Biospring, Frankfurt.,

CD31-23-mr-4A-Cy3 AuCuUgCuGaAaUuCuGaUaCuG-CY3 (SEQ ID NO: 46)

CD31-23-mr-4B cAgUaUcAgAaUuUcAgCaAgAu- (SEQ ID NO: 47)

Staining of tissues and microscopy

Tissues were paraffin embedded, sectioned and counter-stained with nuclear stain Sytox green (Molecualr Probes, 100 nM) using standard protocols. Stained tissues were directly examined by epifluorescence with a Zeiss LSM510 Meta confocal microscope.

Transfection of cultured cells and quantification of mRNA levels

Cells were seeded in 6 well plates and transfected with siRNA lipolexes consisting of AtuPLEX or DACCIO as lipid composition and thus delivery vehicle, as described previously (Santel, A et al. (2006). Gene Ther 13: 1222-1234)). Briefly, about 12 hours after cell seeding different amounts of lipoplex formulations diluted in 10% serum-containing medium were added to the cells to achieve transfection concentrations in a final concentration of 20 nM siRNA. 24 days after transfection cells were lysed and total RNA was isolated for qRT-PCR to determine target gene expression.

Statistical analysis

Data are expressed as means ± s.e.m. Statistical significance of differences was determined by the Mann- Whitney U test. P values < 0.05 were considered statistically significant.

Animal studies siRNA distribution in pregnant mice

Pregnant mice stage 13.5 were treated with single dose of a lipoplex consisting of AtuPLEX and PKN3-specific siRNA (2.8 mg siRNA/kg body weight )). siRNA content in liver, placenta, lung and embryo was determined by quantitative capture probe ELISA one hour after treatment (Aleku et al. 2008).

Example 2: sFltl specific siRNA molecules

The siRNA molecules which are directed to the mRNA encoding sFLTl and the siRNA molecules directed to Luciferase which were used in connection with the experiments and examples described herein, were synthesized by BioSpring (Frankfurt a. M., Germany) and are indicated in Fig. 1 in terms of the sequences of both the first strand (being the antisense strand) and the second strand (being the sense strand) forming the double-stranded nucleic acid molecules of the present invention.

Luciferase-specific siRNA was formed by the following two strands:

Luc-23-2A (capital nucleotides

modified at the 2' position with UcGaAgUaUuCcGcGuAcGuGaU

an O-methyl group) NO: 48)

Luc-23-2B (capital nucleotides

modified at the 2' position with aUcAcGuAcGcGgAaUaCuUcGa

an O-methyl group) NO : 49)

The following PKN3 siRNA molecule was used in combination with AtuPLEX or DACCIO fin in in vivo studies:

5 ' UuGuCcAgGaAgUcCuCaAgUcU 3 ' (SEQ

PKN3-h-3A23 ID NO: 50)

5 ' aGaCuUgAgGaCuUcCuGgAcAa3 ' (SEQ

PKN3-h-3B23 ID NO: 51)

"A" stands for the antisense strand which is also referred to herein as the first strand; "B" stands for the sense strand which is also referred to herein as the second strand. Please note that any sequence indicated in the instant application is presented in 5'-> 3' direction, if not explicitly indicated to the contrary. In certain embodiments, the antisense strands (as set forth in the Tables above) can be modified at the 2' position (e.g., with a 2'-0-methyl group) on one or more odd numbered nucleotide (or on each odd numbered nucleotide) and one or more even numbered nucleotides remain unmodified (e.g., a OH group is present at the 2' position on each of the unmodified nucleotides, for example each of the unmodified nucleotides is unmodified). Sense strands can be modified on one or more even numbered nucleotide (or on each even numbered nucleotide) at the 2' position (e.g., with a 2'-0-methyl group) and one or more odd numbered nucleotides can remain unmodified (e.g., a OH group is present at the 2' position on each of the unmodified nucleotides, for example each of the odd numbered nucleotides is unmodified).

Alternative embodiments provide for antisense strands (as set forth above) that are modified at the 2' position (e.g., with a 2'-0-methyl group) on one or more even numbered nucleotide (or on each even numbered nucleotide) and sense strands are modified on one or more odd numbered nucleotide (or on each odd numbered nucleotide) at the 2' position (e.g., with a 2'-0-methyl group). One or more unmodified nucleotide is present in both the sense and antisense strands in these alternative embodiments (e.g., the unmodified nucleotides have a OH group at the 2' position in each of these alternative embodiments). In certain embodiments, each odd numbered nucleotide is unmodified in the antisense strand and each even numbered nucleotide is unmodified in the sense strand for the alternative embodiments discussed in this paragraph.

The siRNA molecules of Fig. 1 were tested in vitro for inhibition of sFltl target expression in cell cultures using degradation of human sFltl mRNA as read-out. The results are indicated in Fig. 2 where the level of human sFltl mRNA is normalized relative to the level of human sFltl mRNA in untreated cells. As may be taken from Fig. 2 siRNA sFltl hm4 consisting of sFLTl-hm-4A and sFLTl-hm-4B was particularly effective, whereby siRNAs sFltl hm3 consisting of sFLTl-hm-3A and sFLTl-hm3B and sFltl hml consisting of sFLTl- hm-3A and sFLTl-hm-3B also exhibited some efficiency.

Example 4: Animal studies - siRNA distribution in pregnant mice

The purpose of these animal studies was to determine siRNA distribution in pregnant mice (El 3.5) receiving a single dose of a lipoplex consisting of AtuPLEX and PKN3-specific siRNA. The result is shown for two mice in Fig. 3. As may be taken from Fig. 3 siRNA is found in maternal tissues like lungs and liver, but not in the embryo. Significant amounts of siRNAs were detected in all placentas of mice treated with AtuPLEX.

A similar study using pregnant mice (stage El 3.5) was performed using Cy3 labeled siRNA which were lipoplexed with AtuPLEX. The results are shown in Fig. 4 and Fig. 5.

As may be taken from Fig. 4 siRNA Cy3 staining is detectable in the labyrinth layer of the placenta. The labyrinth layer is the region where maternal and fetal blood vessels are in closest proximity and gas and nutrient exchange takes place. Furthermore, it may be taken from Fig. 5 that in the placenta only maternal blood vessels are stained with Cy3 labeled siRNA, whereas fetal blood vessels are not stained; also umbilichord is also free of Cy3 labeled siRNA.

Example 5: Animal studies - knock-down of sFltl by lipoplexes consisting of sFLTl- targeting siRNA and either AtuPLEX or DACC10

The rational underlying these animal studies was the observation that sFltl is up- regulated during pregnancy and even more in pre-eclampsia. Furthermore it was found that in patients treated with an siRNA targeting PKN3 plasma levels of sFltl were found to be down- regulated. In connection with these observations it is to be acknowledged that placenta is the major source for sFltl during pregnancy; in mice Fltl is produced by trophoblast cells of the spongio-trophoblast layer. In these studies formulations comprising either DACC10 or AtuPLEX as delivery vehicle were used for the delivery of sFltl -targeting siRNA in pregnant mice aiming for reducing sFltl in serum and selected tissues. The time course of the treatment and treatment groups are illustrated in Fig. 6.

Expression of sFltl and PKN3 in lungs of pregnant mice (stage 13,5) treated with siRNA targeting either sFltl ("sFLTl-hm4") or PKN3 ("PKN3") together with either AtuPLEX or DACC10 as delivery vehicle (forming a lipoplex with the respective siRNA), is shown in Fig. 7. As may be taken from said Fig. 7, PKN3 and sFLT-1 target gene inhibition can be measured in lungs of pregnant mice. DACC10 is more potent in reducing target gene expression in lungs than AtuPLEX.

Expression of sFltl and PKN3 in placentas of pregnant mice (stage 13,5) treated with siRNA targeting either sFltl ("sFLTl-hm4") or PKN3 ("PKN3") together with either AtuPLEX or DACC10 as delivery vehicle (forming a lipoplex with the respective siRNA), is shown in Fig. 8, whereby four placentas per mother were analysed). As may be taken from said Fig. 8 sFltl expression in placentas is reduced in those groups where AtuPLEX was used as the delivery vehicle.

Example 6 - Animal studies: - Biodistribution studies in pregnant rats

Biodistribution studies were carried out in pregnant Sprague Dawley rats. At day 18 of gestation rats were anesthetized with isofluran and treated with a single dose of 1.4 mg/kg AtuPLEX ^{slRNA Cy3} (0.28 mg/ml) by intravenous injection into the jugular vein. One hour and 4 hours after treatment, rats were sacrificed by decapitation, maternal and fetal organs were dissected and weight. A part of the tissues were snap frozen for quantitative capture probe ELISA assay and the remaining part fixed according to Beckstead. (J Histochem Cytochem. 1995; 43: 345.) and embedded in paraffin. The distribution of Cy3-labeled siRNA in tissues was visualized by fluorescent microscopy of 3 μΜ tissue sections using Axio Imager M2 microscope with AxionCAM HRc from Zeiss, Germany. Quantitative assessment of siRNA concentration in selected tissues was performed by siRNA sequence specific quantitative capture probe ELISA assay (Fehring et al. 2014).

Preeclampsia was induced in rats by mating female rats transgenic for human angiotensinogen with male rats transgenic for human renin (Bohlender et al, 2000). Pregnant rats develop hypertension on day 13 of gestation (the day of plug is assigned dl of gestation), albuminuria and intrauterine growth restriction. For continuous measurements of blood pressure, heart rate and ambulatory activity radiotelemetric systems (Data Sciences International, La Jo 11a) were implanted into the infra-renal aorta and harbored in the abdominal cavity. Rats were anaesthetized for telemetry implantation, tail cuff measurements, treatments with AtuPLEX and termination using isoflurane. Transgenic pregnant rats received treatments with either isotonic sucrose (270 mM) as vehicle control or with AtuPLEX (1.4 mg/kg) on day 7, 10, 13, 16, and day 19 of gestation. From day 17 to day 18 of gestation animals were kept in metabolic cages for urine collection. Transgenic animals from this study were sacrificed on day 21 of gestation. Maternal and fetal organs of interest were collected; weight and selected tissues were snap frozen. Urinary rat albumin from day 17/18 was measured using an ELISA kit from CellTrend, Germany. All animal studies and study protocols were approved by local authorities (Landesamt f. Gesundheit und Soziales, Berlin). Example 7 - mRNA isolation and real time PCR

Dissected organs and tissues were snap frozen and homogenized by ceramic balls. Total R A was isolated using commercial Kits (Qiazol lysis reagent and Quiagen R easy mini kit) and protocols provided by the manufacturers. The following primers were used for reverse transcriptase, PCR amplification and detection: sFLTl : GGGAAGAGATCCTTCGGAAGA (forward) (SEQ ID NO. 60), GAGATCCGAGAGAAAATAGCCTTTT (reverse) (SEQ ID. NO. 61), AGAAGTTCTCGTTAGAGGTGAGCACTGCAGC (probe) (SEQ ID NO. 62). 18S: AC ATC C AAGG A AGGC AGC AG (forward) (SEQ ID NO. 63),

TTTTCGTCACTACCTCCCCG (reverse) (SEQ ID N0.64),

CGCGCAAATTACCCACTCCCGAC (probe) (SEQ ID N0.65).

It has been shown that ystemic administration of AtuPLEX in pregnant rats delivers siRNA to sthe mother, placental tissues, but not fetal tissues (see Figure 9,10,11 for biodistribution study with siRNA-Cy3 labeled AtuPLEX.

Within the placenta, siRNA delivered by AtuPLEX is detected in the spongio-trophoblast layer (Fig.10). This is the part of the placenta were sFLT-1 expression is induced during pregnancy and particularly in preeclampsia. (sFltl is a bio marker and also a mediator of preeclampsia).

It has aslo been shown for the first time by the present inventors that treatment with

AtuPLEX/sFLtl siRNA formulation of the presetn invention reduces sFlt-1 expression in pregnant rats (Fig. 13).

Surprisingly, treatment of preeclampsis rats with AtuPLEX/sFLtl siRNA formulation reduces blood pressure (which is life treatening for mother and child in severe case of preeclampsia) see Fig. 14, but at the same time the well being of the mother or of the foetus are not adversely affected by AtuPLEX (Fig. 14D, 15, 16 and Fig. 17, 18 respectively .)

The features of the present invention disclosed in the specification, the claims, the sequence listing and/or the drawings may both separately and in any combination thereof be material for realizing the invention in various forms thereof and any modifications is within the scope of the person skilled in the art. REFERENCES

Aird, W.C. 2003. The role of the endothelium in severe sepsis and multiple organ dysfunction syndrome. Blood. 101 :3765-77.

Aleku, M. 2008- Atu027, a liposomal small interfering RNA formulation targeting protein kinase N4, inhibits cancer progression. Cancer Res 2008; 68 (23): 9788-98.

Daly, C, E. Pasnikowski, E. Burova, V. Wong, T.H. Aldrich, J. Griffiths, E. Ioffe, T.J. Daly,

J.P. Fandl, N. Papadopoulos, D.M. McDonald, G. Thurston, G.D. Yancopoulos, and Maniatis, N.A., and S.E. Orfanos. 2008. The endothelium in acute lung injury/acute

respiratory distress syndrome. Curr Opin Crit Care. 14:22-30.

Matute-Bello, G., C.W. Frevert, O. Kajikawa, S.J. Skerrett, R.B. Goodman, D.R. Park, and

T.R. Martin. 2001. Septic shock and acute lung injury in rabbits with peritonitis: failure of the neutrophil response to localized infection. Am J Respir Crit Care Med.

163:234-43.

Opitz, B., A. Puschel, B. Schmeck, A.C. Hocke, S. Rosseau, S. Hammerschmidt, R.R.

Schumann, N. Suttorp, and S. Hippenstiel. 2004. Nucleotide-binding oligomerization domain proteins are innate immune receptors for internalized Streptococcus pneumoniae. J Biol Chem. 279:36426-32.

Paton, J.C., J.K. Morona, S. Harrer, D. Hansman, and R. Morona. 1993. Immunization of mice with Salmonella typhimurium C5 aroA expressing a genetically toxoided derivative of the pneumococcal toxin pneumolysin. Microb Pathog. 14:95-102.

Santel, A., M. Aleku, O. Keil, J. Endruschat, V. Esche, B. Durieux, K. Loffler, M. Fechtner, T. Rohl, G. Fisch, S. Dames, W. Arnold, K. Giese, A. Klippel, and J. Kaufmann. 2006a. RNA interference in the mouse vascular endothelium by systemic

administration of siRNA-lipoplexes for cancer therapy. Gene Ther. 13 : 1360-70.

Santel, A., M. Aleku, O. Keil, J. Endruschat, V. Esche, G. Fisch, S. Dames, K. Loffler, M.

Fechtner, W. Arnold, K. Giese, A. Klippel, and J. Kaufmann. 2006b. A novel siRNA- lipoplex technology for RNA interference in the mouse vascular endothelium. Gene Ther. 13 : 1222-34.

Schmeck, B., J. Zahlten, K. Moog, V. van Laak, S. Huber, A.C. Hocke, B. Opitz, E.

Hoffmann, M. Kracht, J. Zerrahn, S. Hammerschmidt, S. Rosseau, N. Suttorp, and S.

Hippenstiel. 2004. Streptococcus pneumoniae-induced p38 MAPK-dependent phosphorylation of RelA at the interleukin-8 promotor. J Biol Chem. 279:53241-7. Ware, L.B. 2006. Pathophysiology of acute lung injury and the acute respiratory distress syndrome. Semin Respir Crit Care Med. 27:337-49.