The present invention relates to a method for determining the presence of chronic rhinosinusitis with nasal polyps (CRSwNP) in a patient. The present invention also relates to a method for determining whether or not a patient has chronic rhinosinusitis with nasal polyps (CRSwNP).

The present invention also relates to a method for performing a follow-up in a patient that has previously been diagnosed with CRSwNP. Chronic rhinosinusitis with nasal polyps (CRSwNP) represents a subtype of chronic rhinosinusitis with an estimated prevalence between 2-5% of the overall population. The annual direct cost for chronic rhinosinusitis, including CRSwNP, is estimated to be approximately $10 billion. Despite recent advances in the understanding of the mechanisms underlying polypoid inflammation, the etiopathology of the disease remains unclear. Consequently, optimal diagnostic and treatment algorithms remain elusive, as no appropriate biomarker or biosignature of CRSwNP has yet been identified or developed.

A biosignature represents a collection of biomarkers that are specific and sensitive to a particular physiological or pathological condition. While numerous studies have demonstrated altered protein expression in nasal polyps in comparison to healthy control mucosa, such analysis has typically required extensive and invasive surgical tissue sampling. Other attempts have focused on the analysis of nasal mucus, since this may be easily and non-invasively harvested and may therefore be easily subjected to further investigation. However, mucus is a complex and heterologous fluid resulting in a typically low signal-to- noise ratio (S/N) and high inter-patient variability with respect to the occurrence of individual biomarkers or combinations thereof. Accordingly, there remains a need in the art to provide for an easy and reliable method for diagnosis, follow-up and prognosis of chronic rhinosinusitis with nasal polyps (CRSwNP). There is also a need in the art to provide for a method of diagnosis for CRSwNP that is non-invasive and reliable.

The present invention addresses these and similar needs. In a first aspect, the present invention relates to a method for determining whether or not a patient has chronic rhinosinusitis with nasal polyps (CRSwNP), said method comprising the steps: a) Isolating exosomes from a nasal mucus sample of a patient suspected of having CRSwNP, b) measuring, in said exosomes, expression of pappalysin-i (PAPPA),

c) comparing said expression of step b) with expression of pappalysin-i (PAPPA) in exosomes of a healthy person not affected by CRSwNP.

In one embodiment, the method further comprises the steps: d) Determining whether or not said patient has CRSwNP based on the results of step c), wherein said patient is determined to be a patient having CRSwNP, if the expression of pappalysin-i is higher in said exosomes of said patient in comparison to said exosomes from said healthy person.

In one embodiment, said nasal mucus sample of said patient suspected of having CRSwNP is a sample obtained from the nasal cavity adjacent to the middle turbinate of said patient

In one embodiment, said exosomes of said healthy person have been isolated from a nasal mucus sample of said healthy person, wherein the nasal mucus sample of said healthy person has been obtained from the nasal cavity adjacent to the middle turbinate of said healthy person.

In another embodiment of the method for determining whether or not a patient has CRSwNP, said step b) is performed by measuring expression of pappalysin-i in whole nasal mucus, instead of measuring such expression in exosomes. In such embodiments step a) is: obtaining a whole mucus sample of a patient suspected of having CRSwNP; and step c) is: comparing said expression of step b) with expression of pappalysin-i in a whole nasal mucus sample of a healthy person not affected by CRSwNP.

The advantage of performing the method for determining, in nasal whole mucus is that measurements of expression in whole mucus is that measurements of expression in while mucus, instead of in exosomes, is faster and cheaper. The advantage of performing the method using exosomes isolated from a nasal mucus sample, is that such measurements in exosomes are more accurate. It should be noted that, in embodiments of the present invention, the measurement of said expression of pappalysin-i (PAPPA) in exosomes of a healthy person not affected by CRSwNP, need not be performed every time that a patient is subjected to the method according to the present invention, and does not form part of the method. Rather in such embodiments, measurement of expression of pappalysin-i (PAPPA) in exosomes of a healthy person not affected by CRSwNP may also be or have been performed separately to determine a reference value of a healthy person (“healthy reference value”) or a range of representative reference values of a healthy person or of several healthy persons (“range of healthy reference values”) with which the expression of PAPPA measured in said exosomes of said patient suspected of having CRSwNP, is then compared. Such a“healthy reference value” or“range of healthy reference values” is herein also sometimes referred to as“healthy reference value”.

Hence in these embodiments, step c) is:

c) comparing said expression of step b) with a reference value of a healthy person not affected by CRSwNP.

In one embodiment, said step b) is: b) measuring, in said exosomes, expression of pappalysin-i (PAPPA) only.

In one embodiment, step b) is: b) Measuring, in said exosomes, expression of pappalysin-i and the expression of one or more, preferably at least three or at least four, of the following proteins: cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase-3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP-dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), Periostin, SerpinEi, Serpin F2 and thrombospondin-i (THBSi).

In one embodiment, step b) is: b) Measuring, in said exosomes, expression of pappalysin-i and the expression of exactly three or exactly four of the following proteins: cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase-3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP-dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), Periostin, SerpinEi, Serpin F2 and thrombospondin-i (THBSi).

In embodiments, where, in step b), in addition to the expression of pappalysin-i (PAPPA), also the expression of one or more, preferably at least three or at least four, of the following proteins: cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase-3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP-dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), Periostin, SerpinEi, Serpin F2 and thrombospondin-i (THBSi), is measured, then step c) is: c) comparing said expression of step b) with expression of the same proteins in exosomes of a healthy person not affected by CRSwNP.

In one embodiment, where in step b) expression of pappalysin-i (PAPPA) and expression of at least four, or exactly four, of the aforementioned other proteins is measured, said at least four proteins or said exactly four other proteins are cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), periostin and platelet glycoprotein VI (GP6). In such an embodiment, step b) is: b) Measuring, in said exosomes, expression of pappalysin-i and the expression of at least the following four or exactly the following four proteins: cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), periostin and platelet glycoprotein VI (GP6).

In embodiments, where in step b) expression of pappalysin-i (PAPPA) and expression of one or more other proteins is measured, then step c) is: c) comparing said expression of step b) with expression of the same proteins in exosomes of a healthy person not affected by CRSwNP, and step d) then is: d) Determining whether or not said patient has CRSwNP based on the results of step c), wherein said patient is determined to be a patient having CRSwNP, if the expression of pappalysin-i and, optionally of said one or more other proteins, is higher in said exosomes of said patient in comparison to said exosomes from said healthy person.

In one embodiment, said measuring in step b) is done by any of the following: Aptamer-based measurement, such as is commercially available in the form of SOMAscan® analysis, Western Blot, and ELISA.

In one embodiment, said method is performed in-vitro.

In one embodiment, said step a) is performed using ultracentrifugation or a commercially available kit, such as“Total Exosome Isolation Kit”, available from ThermoFisher, cat. No. 4484450, or miRCURY Exosome Kit available from Qiagen.

It should be noted that, in one embodiment, the method in accordance with the present invention also is a method to determine whether a patient is a CRSwNP patient with a rapid recurrence or with a non-rapid recurrence of the disease. The term“rapid recurrence of CRSwNP” as used herein is meant to refer to a recurrence of CRSwNP symptoms within a period of 24 months after a point in time when the respective patient had been symptom-free (e.g. because (s)he had been treated, undergone surgery, etc). The term“rapid recurrence of CRSwNP” is sometimes used herein synonymously with the term“recalcitrant disease of CRSwNP”.

The term“non-rapid recurrence of CRSwNP”, as used herein, is meant to refer to a recurrence of CRSwNP symptoms after a period of 24 months or more after a point in time when the respective patient had been symptom-free. The term“non-rapid recurrence of CRSwNP” is sometimes used herein synonymously with the term “stable disease of CRSwNP”.

In a further aspect, the present invention relates to a kit for determining whether or not a patient has chronic rhinosinusitis with nasal polyps (CRSwNP), preferably for performing the method according to the present invention, as defined herein, said kit comprising:

Means to measure expression in exosomes of a patient suspected of having CRSwNP, of pappalysin-i (PAPPA), and, optionally, means to additionally measure expression of one or more, preferably at least three or at least four, more preferably exactly three or exactly four, proteins, other than pappalysin-i (PAPPA), selected from cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase 3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP-dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), thrombospondin-i (THBSi),periostin, serpinEi, and serpinF2,

means to compare said expression of said pappalysin-i (PAPPA), and, optionally, of said one or more, preferably at least three or at least four, more preferably exactly three or exactly four, other proteins, with expression of the same protein(s) in exosomes of a healthy person not affected by CRSwNP.

In one embodiment, the kit according to the present invention further comprises:

Means to obtain a nasal mucus sample of a patient suspected of having CRSwNP, and optionally,

Means to isolate exosomes from said nasal mucus sample of said patient suspected of having CRSwNP.

In one embodiment, the kit according to the present invention further comprises a leaflet or other printed medium or storage medium containing information about said expression of the same proteins in exosomes of a healthy person not affected by CRSwNP.

In one embodiment, the kit according to the present invention further comprises a package or container comprising the kit according to the present invention, said container allowing or facilitating handling, manipulation and/or transport of said kit, said kit being contained within said container.

In a further aspect, the present invention also relates to a method for monitoring and/or determining, in a patient having chronic rhinosinusitis with nasal polyps (CRSwNP), a response to treatment with an anti-CRSwNP drug, said drug being administered to said patient repeatedly over a defined period of time to alleviate or treat said CRSwNP, wherein said method comprises the steps:

a) obtaining a nasal mucus sample of said patient having CRSwNP, before said defined period of time over which said drug is administered, and at least one nasal mucus sample after said defined period of time, and, optionally, also at least one nasal mucus sample during said defined period of time over which said drug is administered;

b) measuring in each of said obtained nasal mucus samples, preferably in nasal whole mucus or in exosomes isolated from each of said obtained nasal mucus samples, the level of pappalysin-i (PAPPA); and

c) comparing the measured levels of pappalysin-i of each of said obtained nasal mucus samples;

d) monitoring and/or determining whether said patient shows a response to said anti- CRSwNP drug, based on the comparison made in step c), wherein said patient is determined to show a response to said drug, if the level of pappalysin-i measured in the nasal mucus sample obtained before said defined period of time is higher than the level of pappalysin-i measured in the at least one nasal mucus sample obtained during and/or in the at least one nasal mucus sample obtained after said defined period of time. In one embodiment, said anti-CRSwNP drug is a corticosteroid, preferably selected from hydrocortisones, acetonides, betamethasones, esters of any of the foregoing, more preferably selected from prednisolone, amcinonide, budesonide, beclomethasone, betamethasone, and mometasone.

In a further aspect, the present invention also relates to a kit for determining whether or not a patient has chronic rhinosinusitis with nasal polyps (CRSwNP), preferably to a kit for performing the method for determining whether or not a patient has chronic rhinosinusitis with nasal polyps (CRSwNP), in accordance with the present invention, or it relates to a kit for monitoring and/or determining a response to treatment with an anti-CRSwNP drug in a patient having CRSwNP, preferably to a kit for performing the method for monitoring and/ or determining, in a patient having chronic rhinosinusitis with nasal polyps (CRSwNP), a response to treatment with an anti-CRSwNP drug, in accordance with the present invention, said kit comprising:

Means to measure expression in a (first) nasal mucus sample, preferably in nasal whole mucus or in exosomes isolated from said (first) nasal mucus sample, of a patient having or suspected of having CRSwNP, of pappalysin-i (PAPPA), and, optionally, means to additionally measure expression of one or more, preferably at least three or at least four, more preferably exactly three or exactly four, proteins, other than pappalysin-i (PAPPA), selected from cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase 3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation- regulated kinase 3 (DYRK3), cGMP-dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), thrombospondin-i (THBSi),periostin, serpinEi, and serpinF2,

means to compare said expression of said pappalysin-i (PAPPA), and, optionally, of said one or more, preferably at least three or at least four, more preferably exactly three or exactly four, other proteins, with expression of the same protein(s) in another nasal mucus sample, preferably in nasal whole mucus or in exosomes isolated from said another nasal mucus sample, of a healthy person not affected by CRSwNP; or means to compare said expression of said pappalysin-i (PAPPA), and, optionally, of said one or more, preferably at least three or at least four, more preferably exactly three or exactly four, other proteins, with expression of the same protein(s) in another nasal mucus sample, preferably in nasal whole mucus or in exosomes isolated from said another nasal mucus sample, of the same patient having CRSwNP, wherein said another nasal mucus sample has been obtained at a different point in time than said first nasal mucus sample. In one embodiment, the kit further comprises:

Means to obtain a nasal mucus sample of a patient having or suspected of having CRSwNP, or of a healthy person not affected by CRSwNP, and optionally,

Means to isolate exosomes from said nasal mucus sample of said patient having or suspected of having CRSwNP, or of said healthy person not affected by CRSwNP.

In one embodiment, the kit further comprises a leaflet or other printed medium or storage medium containing information about said expression of the same proteins in exosomes of a healthy person not affected by CRSwNP.

In a further aspect, the present invention also relates to a package or container comprising the kit according to the present invention, said container allowing or facilitating handling, manipulation and/ or transport of said kit, said kit being contained within said container.

As used herein, the term“nasal whole mucus” or“nasal whole mucus sample” or“whole mucus sample” refer to a nasal mucus sample that has not been further processed and that is used in the embodiments of the method according to the present invention, as it is or as it has been obtained. As an example, such“nasal whole mucus sample” may be used in a method for determining whether or not a patient has CRSwNP, in accordance with the present invention, or it may be used in a method for monitoring and/or determining, in a CRSwNP patient, a response to treatment with an anti-CRSwNP drug, in accordance with the present invention, as also outlined herein. The advantage of using whole mucus is that it is cheaper and faster, because additional processing steps are not performed.

In one embodiment of the method according to the present invention, said method is non- invasive. In one embodiment, the patient is determined to be a patient not having CRSwNP, if the expression of said protein pappalysin-i and, optionally the expression of said one or more other proteins, is not higher, preferably substantially the same, in said sample of exosomes of said patient, in comparison to said exosomes from said healthy person. In embodiments according to the present invention, such measured expression levels from a sample of a patient suspected of suffering from CRSwNP, are subsequently compared with expression levels of the same protein(s) in a sample of a healthy person. A“healthy person”, as used herein, is meant to refer to a person that is not suffering from or affected by CRSwNP. The respective expression levels of the corresponding protein(s) of a healthy person may be determined as part of the method according to the present invention, or they may be or have been determined separately. In this latter case, such separate determination does not form part of embodiments according to the present invention. In one embodiment, such expression levels of the same protein(s) in a healthy person have been determined entirely separately and do not form part of the present invention. In accordance with embodiments of the present invention, the measurement of expression of said at least three or at least four or more proteins is performed using exosomes from said patient. Such exosomes of said patient have preferably been produced from a sample of nasal mucus of said patient. In a preferred embodiment, the nasal mucus sample of said patient is a sample obtained from the middle meatus of said patient. The corresponding expression levels in a healthy sample are also based on samples obtained from the same site.

The present inventors have surprisingly found that using exosomes from nasal mucus of a patient provides a reproducible and unique biosignature for the diagnosis of chronic rhinosinusitis with nasal polyps (CRSwNP). The reliability of such methodology is particularly high, if the nasal mucus has been obtained from the nasal cavity adjacent to the middle turbinate of the patient.

Typically, in embodiments according to the present invention, a patient is determined to be a patient having CRSwNP, if the expression of pappalysin-i (PAPPA) alone or the expression of pappalysin-i (PAPPA) together with the expression of at least one protein of said one or more previously mentioned proteins, preferably at least three or at least four, of the previously mentioned proteins is higher in said exosomes of said patient in comparison to expression of the same protein(s) in exosomes from a healthy person. The term“is higher” as used herein in the context of the comparison between different expression levels, is meant to refer to a scenario wherein the expression of at least pappalysin-i and, optionally, of at least one other protein protein of the aforementioned proteins of a patient is higher than the expression of the same protein(s) in a healthy sample.

Measuring the expression of a protein in a sample can be done by various ways and methodologies known to a person skilled in the art such as Western blots, ELISAs, commercially available kits, (optionally involving centrifugation for isolation of exosomes), but also more refined proteomic approaches, such as the SOMAscan®-methodology (commercially available from SomaLogic; USA).

According to a further aspect, the present invention also relates to a method for monitoring and/or determining, in a patient having chronic rhinosinusitis with nasal polyps (CRSwNP), a response to treatment with an anti-CRSwNP drug, said drug being administered repeatedly over a defined period of time to alleviate or treat said CRSwNP, wherein said method comprises the steps: a) obtaining a nasal mucus sample of said patient having CRSwNP, before said defined period of time over which said drug is administered, and at least one nasal mucus sample after said defined period of time, and, optionally, also at least one nasal mucus sample during said defined period of time over which said drug is administered;

b) measuring in each of said obtained nasal mucus samples, preferably in nasal whole mucus or in exosomes isolated from each of said obtained nasal mucus samples, the level of pappalysin-i (PAPPA); and

c) comparing the measured levels of pappalysin-i of each of said obtained nasal mucus samples;

d) monitoring and/or determining whether said patient shows a response to said anti- CRSwNP drug, based on the comparison made in step c), wherein said patient is determined to show a response to said drug, if the level of pappalysin-i measured in the nasal mucus sample obtained before said defined period of time is higher than the level of pappalysin-i measured in the at least one nasal mucus sample obtained during and/or in the at least one nasal mucus sample obtained after said defined period of time.

According to this aspect, using embodiments of the present invention, it is possible to use pappalysin-i as biomarker to determine whether a patient who has CRSwNP, shows a response to treatment with an anti-CRSwNP drug. Likewise, it is also possible according to this aspect to monitor, during treatment, a response to such treatment with an anti-CRSwNP drug in a patient having CRSwNP.

The term “anti-CRSwNP drug”, as used herein, is meant to refer to a drug that is administered with the aim to alleviate one or more symptoms of chronic rhinosinusitis with nasal polyps, such as nasal congestion, anterior or posterior rhinorrhea, hyposmia, facial pressure or pain, rhinitis, asthma and inflammation of the upper respiratory airways.

In one embodiment, an anti-CRSwNP drug is a corticosteroid, and is preferably selected from hydrocortisone, acetonides, betamethasones, esters of any of the foregoing, and is more preferably selected from prednisolone, amcinonide, budesonide, beclomethasone, betamethasone, and mometasone. Typically, such anti-CRSwNP drugs are administered repeatedly over a defined period of time to alleviate or treat CRSwNP. For example, for such treatment, steroid may be administered on a daily basis over a defined period of time, such as a period of 10-20 days, e. g. 11 days, 12 days, 13 days, 14 days, 15 days, 16 days, 17 days, 18 days, 19 days, 20 days. During such defined period of time, the daily doses of anti-CRSwNP drug may be continually reduced or may be constant. A typical example of such a treatment is a repeated treatment over a period of 16 days, starting with an initial daily dose of 40 mg and decreasing the dose by 10 mg every four days. In embodiments of such a method for monitoring and/or determining a response to treatment with an anti-CRSwNP drug, nasal mucus samples are obtained before initiation of said treatment with such anti-CRSwNP drug. Likewise, at least one nasal mucus sample is obtained after treatment, i. e. after said defined period of time over which said anti-CRSwNP drug is administered. In embodiments, wherein only nasal mucus samples are obtained before and after said defined period of time, the method is mainly used for determining an overall response to treatment with said anti-CRSwNP drug. If, however, additionally, a response should be monitored for and during said defined period of time, it is preferred that at least one nasal mucus sample is also obtained during said defined period of time. Thereafter, in embodiments, in each of said obtained mucus samples, the level of pappalysin- l is measured. It is preferred, that such measurements occurs with respect to or in exosomes that have been isolated from each of said obtained nasal mucus samples.

Thereafter, levels of pappalysin-i each of said obtained nasal mucus samples are compared, and it is monitored and/or determined, whether said patient shows a response to said anti- CRSwNP drug, based on the comparison that is made in the previous step. The patient is then determined to show a response to said drug, if the level of pappalysin-i measured in the nasal mucus sample obtained before treatment is higher than the level(s) of pappalysin-i measured in the nasal mucus sample(s) obtained after treatment and/or obtained during said treatment.

In embodiments of a method for monitoring and/or determining a response to treatment with an anti-CRSwNP drug, in addition to pappalysin-i, also other proteins may be measured and their levels be determined. Such other proteins include but are not limited to cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase 3 (CASP3), cystatin-SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP- dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), Periostin, SerpinEi, Serpin F2 and thrombospondin-i (THBSi).

In a further aspect, the present invention also relates to a kit for monitoring and/or determining a response to treatment with an anti-CRSwNP drug in a patient having CRSwNP, wherein said kit comprises:

Means to measure expression in a first nasal mucus sample, preferably in exosomes isolated from said first nasal mucus sample, of a patient having CRSwNP, of pappalysin-i

(PAPPA), and optionally, means to additionally measure expression of one or more, preferably at least three or at least four, more preferably exactly three or exactly four, proteins, other than pappalysin-i (PAPPA), selected from cystatin-SN (CSTi), peroxiredoxin-5 (PRDX5), platelet glycoprotein VI (GP6), caspase 3 (CASP3), cystatin- SA (CST2), discoidin domain-containing receptor 2 (DDR2), dickkopf-like protein 1 (DKKLi), dual specificity tyrosine-phosphorylation-regulated kinase 3 (DYRK3), cGMP- dependent 3’, 5’-cyclic phosphodiesterase (PDE2A), protein S100-A7 (S100A7), thrombospondin-i (THBSi),periostin, serpinEi, and serpinF2,

means to compare said expression of said pappalysin-i (PAPPA), and, optionally, of said one or more, preferably at least three or at least four, more preferably exactly three or exactly four, other proteins, with expression of the same protein(s) in another nasal mucus sample, preferably in exosomes isolated from said another nasal mucus sample, of a healthy person not affected by CRSwNP; or means to compare said expression of said pappalysin-i (PAPPA), and, optionally, of said one or more, preferably at least three or at least four, more preferably exactly three or exactly four, other proteins, with expression of the same protein(s) in another nasal mucus sample, preferably in exosomes isolated from said another nasal mucus sample, of the same patient having CRSwNP, wherein said another nasal mucus sample has been obtained at a different point in time than said first nasal mucus sample.

In one embodiment, the means to compare said expression of said pappalysin-i allow to compare the expression levels of the same protein(s) in other nasal mucus samples, preferably in exosomes isolated from said nasal mucus samples, of the same patient, wherein said other nasal mucus samples have been obtained at different points in time.

The present invention represents a unique achievement in that it has revealed a unique biomarker in the form of pappalysin-i (PAPPA) and a useful biosignature (pappalysin-i in combination with other proteins), associated with CRSwNP which outperforms previous methodologies based on whole mucus sampling or surgical procedures. It provides a method of non-invasive disease diagnosis.

Furthermore, the present invention is further described by the enclosed figures wherein:

Figure 1— Figure 3: Show qPCR-results of PAPPA mRNA-levels and of STC-i-mRNA and STC-2-mRNA-levels.

Figure 4: Shows western blot results using a polyclonal antibody against PAPP-A comparing nasal polyp tissue, inferior turbinate tissue of polyp patients, inferior turbinate tissue of control patients and placenta. Beta Actin was used as a reference protein. It can be seen that PAPP-A is significantly expressed in tissue of polyp patients.

Figure 5: Shows results of PAPP-A ELISAs of n=66 patients measured at 10 different time points over a time period of 2 years. It can be seen that PAPP-A is able to mirror the course of the disease and is able to distinguish between the recalcitrant disease group and the stable disease group. Drawn through line= recalcitrant disease (or rapid recurrent disease), dashed line= stable disease group (or non-rapid recurrent disease group); x-axis time in months, y- axis PAPP-A concentration

Figure 6: Shows expression of PAPPA in tissue lysates of CRSwNP-patients compared to controls.

Figure 7: Shows immunohistochemistry results in nasal polyps and control (inferior turbinate) tissue, staining against PAPP-A, negative control; the arrow points on eosinophils inside the polyp.

Figure 8: Box-and-Whisker Plot of the activity of PAPP-A (pg CT-IGFBP-4) per ing PAPP- A. The figure shows the increased PAPP-A activity in nasal polyps compared to controls (inferior mucosa). Solid line box= CRSwNP, dotted line box= control.

Figure 9: Variance curves demonstrating significantly greater inter-patient variability among protein expression in the mucus fraction than the exosome fraction.

Figure 10: Levels of pappalysin-i (in pg/ml) in nasal mucus samples over sample period of a single day in a patient.

Moreover, the present invention is further described by the following examples which are given to illustrate, not to limit the present invention.

Examples

Fxamnle 1

Tissue and mucus sampling was approved by the Massachusetts Eye and Ear Infirmary Institutional Review Board and the Institutional Review Board of the University of Erlangen- Nuremberg. All samples were taken from patients undergoing sinonasal surgery and had not been exposed to antibiotics or any topical/systemic steroids for at least 4 weeks. Inclusion criteria included patients diagnosed with CRSwNP by the International Consensus Statement on Allergy and Rhinology (ICAR:RS) (Orlandi RR, Kingdom TT, Hwang PH, et al. International Consensus Statement on Allergy and Rhinology: Rhinosinusitis. Int Forum Allergy Rhinol. 20i6;6 Suppl i:S22-S209) criteria and healthy patients (i.e. Controls) undergoing surgery for non-inflammatory disease (n=20 per group). Exclusion criteria included ciliary dysfunction, autoimmune disease, cystic fibrosis, or immunodeficiency. Among controls, additional exclusion criteria included the presence of allergy or asthma.

Tissue, Mucus, and Exosome Collection Technique

Mucus samples were taken prior to antibiotic or steroid administration by applying a compressed polyvinyl alcohol sponge (PVA, Medtronic, Minneapolis, MN) to either the posterior nasal cavity (POST) adjacent to the middle turbinate or anterior (ANT) internal valve taking care not to abrade the mucosa or contaminate the sponge with blood. Adjacent nasal polyp (in CRSwNP) and nasal mucosa (in controls) tissue samples were then harvested using a blakesly forceps while minimizing crush injury to the tissue.

Exosome Purification Technique from Whole Mucus

The exosome purification procedure was adapted from the ultracentrifugation (UCF) procedure described by Thery et al. (Thery C, Amigorena S, Raposo G, et al. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol. 2006;Chapter 3:Unit 3.22) and previously reported by the present inventors (Nocera AL, Miyake MM, Seifert P, et al. Exosomes mediate interepithelial transfer of functional P-glycoprotein in chronic rhinosinusitis with nasal polyps. Laryngoscope. 2017). Mucus samples were extracted from the PVA sponges by centrifugation (i500g at 4°C for 30 minutes). The mucus was then diluted in 150 pL of lx phosphate buffered saline (PBS, Life Technologies, Carlsbad, CA) with Protease Inhibitor Cocktail (1:100, Sigma, St.Louis, MO). Cellular debris was pelleted by centrifugation at 45 min at 12,000 x g at 4 ⁰ C. The supernatant was then suspended in 4-5mL of PBS in polypropylene tubes (Thinwall, 5.0 mL, 13 x 51 mm, Beckman Coulter, Indianapolis, IN) and ultracentrifuged for 2 hours at 110,000 x g, at 4 ⁰ C. The supernatant was collected and the pellet was resuspended in 4.5 mL lx PBS. The suspension was filtered through a 0.22-mih filter (Fisher Scientific, Pittsburgh, PA) and collected in a fresh ultracentrifuge tube. The filtered suspension was then centrifuged for 70 min at 110,000 x g at 4°C. The supernatant was collected and the pellet was resuspended in 175 mΐ PBS M-per with protease inhibitor for further proteomic analysis.

Proteomic Array

SOMAscan analysis (SomaLogic; Boulder, CO) on nasal tissue, mucus and isolated exosomes was performed at the BIDMC Genomics, Proteomics, Bioinformatics and Systems Biology Center. Samples were run using the SOMAscan Assay Cells & Tissue Kit, 1.3k (SomaLogic #900-00009) following the recommended protocol from the manufacturer. For nasal tissue extracts and mucus, 2.4 ug of protein from each sample was run. With exosomes isolated from nasal mucus, 1.7 ug per sample of protein was used in the SOMAscan assay. Three provided kit controls and one no-protein buffer control were run in parallel with the samples per plate. Median normalization and calibration of the SOMAscan data was performed according to the standard quality control (QC) protocols at SomaLogic

Validation of Proteomic Results by Western Blot

Western blots were performed at the University of Erlangen-Nuremberg in an independent group of CRSwNP and control (n=6 per group) tissue and mucus derived exosomal samples in order to validate the proteomic results. Tissue samples were prepared as previously described (Valadi H, Ekstrom K, Bossios A, Sjostrand M, Lee JJ LJ. Exosome-mediated transfer of mRNAs and microRNAs is a novel mechanism of genetic exchange between cells. Nat Cell Biol. 2007;9(6):654-6; Thery C, Amigorena S, Raposo G, et al. Isolation and characterization of exosomes from cell culture supernatants and biological fluids. Curr Protoc Cell Biol. 2006;Chapter 3:Unit 3.22). Briefly, homogenization (T25 Basic, IKA Labortechnik, Staufen, Germany) of 30-40 mg of each tissue sample was accomplished in 1.0 mL lysis buffer [T-PER™ Mammalian Protein Extraction Reagent (Thermo Scientific, Bonn, Germany) and protease inhibitor cocktail Completei (Roche, Mannheim, Germany)]. They were then incubated at 4°C for 2 hours and centrifuged at i6ooog for 1 hour. The total protein concentration of the supernatant was determined with bicinchoninic acid assays (Thermo Fisher Scientific, Bonn, Germany). 50ug of lysed tissue protein were used for each patient.

Exosomes were isolated as described above, and 2ug of lysed exosomal protein was used for each patient. After denaturation at 90°C with SDS loading buffer including mercaptoethanol for 5 minutes, lysates were applied on 8-15% SDS-Page and transferred to nitrocellulose membranes (Protran-BA-83, Schleicher & Schuell). GAPDH (monoclonal rabbit antibody against GAPDH, clone D16H11, New England Biolabs GmbH Frankfurt, Germany) staining served as control. The primary detection antibodies were antibodies against PAPPA, SerpinEi, SerpinF2, Periostin, peroxiredoxin-5, platelet glycoprotein VI and cystatin-SN, e.g. mouse Anti-CSTi, clone 213139 (R&D Systems, Abingdon, UK) for Cystatin-SN (CST 1) and Peroxiredoxin-5 (mouse Anti-PRDXs, clone B-7, Santa Cruz Biotechnology, Heidelberg, Germany); respectively followed by the secondary antibody (Peroxidase-labeled anti mouse/rabbit IgG, F(ab’)2 antibody (KPL, Gaithersburg, USA). The blot was incubated with SuperSignal West Dura Extended Duration Substrate (Thermo Fisher Scientific, Bonn, Germany) and the signals were imaged using ChemStudio PLUS (Analytik Jena, Jena, Germany). Quantification of band intensity was performed using VisionWorks 8.2 (Analytik Jena, Jena, Germany). qPCR

qPCR shows that PAPP-A RNA levels are also significantly upregulated in CRSwNP compared to controls (n=30 per group). We isolated total RNA from tissue of healthy patients and patients with CRSwNP using using illustra RNAspin (GE-Healthcare) according to manufacturer’s instructions, including genomic DNA digestion. We used l pg of total RNA, determined by photometric analysis, for reverse transcription (biotechrabbit, Berlin, Germany), obtaining 20 pL of final volume.

For all real-time PCR reactions, solutions provided by a Blue S' Green qPCR Kit (Biozym, Oldendorf, Germany) and StepOnePlus real-time PCR devices (Thermo Fisher Scientific, Darmstadt, Germany) were used. Each amplification step consisted of denaturation, annealing, and elongation at optimized temperatures and primer concentrations. All samples were analyzed as triplets; their arithmetic mean was compared with 7 triplets of standardized PAPP-A cDNA amplified within the same run (sense: GATGCCATCAACAACCGAGC, antisense: AGGTCTTTCCGGCTGTGTTC). We used water as a negative control. For determination of concentrations, StepOnePlus software (StepOne Software V2.3) was used. For normalization, we used a GeNorm software algorithm, which selected tubulin, alpha la (TUBAiA) and glyceraldehyde-3-phosphate dehydrogenase ( GAPDH) as most suitable of 3 housekeeping genes [GAPDH, TUBAiA, and beta-2-microglobulin (B2M)].

Immunohistochemistry

The procedure was adapted from previous work of our group ²⁵ _’ ²⁶ . IHC on paraffin embedded sections was carried out with ImmPRESS™-AP Anti-Rabbit IgG (alkaline phosphatase) Polymer Detection Kit (Vector Laboratories, Inc., Burlingame, USA). To make the epitopes available for antibody binding the sections underwent deparaffinization and heat mediated antigen retrieval, using Vector Antigen Unmasking Solution pH 6 (Vector Laboratories, Inc., Burlingame, USA) at 95°C for 20 minutes. The reduction of background staining was achieved by covering the sections for 10 minutes with BLOXALL™ Endogenous Peroxidase and Alkaline Phosphatase Blocking Solution (Vector Laboratories, Inc., Burlingame, USA), followed by protein block with 2% horse serum. The antibody anti- rabbit PAPP-A (abeam, Cambridge, United Kingdom) was incubated over night at 4°C. A nonspecific antibody (Cell Signaling Technology, Inc., Danvers, USA) served as negative control. Afterwards the ImmPRESS™-AP Reagent was applied. Antigens were stained with Chromogen VECTOR- Red Alkaline Phosphatase-Substrat (Vector Laboratories, Inc., Burlingame, USA). Counterstaining was performed with Harris' hematoxylin solution (ORSAtec GmbH, Bobingen, Germany). The sections were covered with Roti Histokit II (Carl Roth GmbH, Karlsruhe, Germany).

ELISA

The present inventors determined tissue and mucus exosomal PAPP-A concentrations by using a highly specific ELISA (Human Pappalysin-i DuoSet No. DY2487-05, R&D SYSTEMS (Bio-Techne GmbH, Wiesbaden, Germany) with a sample volume of either 40 mΐ (2 pg) exosome protein or 5 mΐ tissue lysate (35 pg). Nasal mucus standards were not diluted for the measurements. All samples were analyzed after the manufacturer' s protocol and were analyzed as duplicates.

Functional PAPP-A Assay

The present inventors performed the functional assay for n=30 patients per group. The main substrate of PAPP-A is insulin-like growth factor binding proteins (IGFBP)-4 leading to CT- IGFBP-4 (C-terminal end) and NT-IGFBP-4 (N-terminal end). We let PAPP-A and IGFBP-4 react and measured the change in the concentration of the C-terminal end of IGFBP-4 using an ELISA (method see above). The higher the concentration of CT-IGFBP-4, the higher the activity of PAPP-A. We determined the activity of PAPP-A (pg CT-IGFBP-4) per ing PAPP-A as well as the protein concentration of PAPP-A in ng/i pg total protein. Finally, we determined the CT-IGFBP-4 in pg per 1 pg total protein PAPP-A.

Explant model

Immediately after harvest, polyps from CRSwNP patients were sectioned into 5-mm3 explants (n = 10 per experimental group), taking care to ensure that each contained an intact epithelial layer. Regions of hemorrhage or epithelial avulsion were excluded. Explants were placed in 12-well plates containing 1 mL of serum-free bronchial epithelial growth medium (BEGM; Lonza, Basel, Switzerland) and incubated at 37°C, 5% CO2 for 30 minutes. The specific biosignature pattern in the exosomes was measured via ELISA as described above. The media was then removed and replaced with PAPPA inhibitory or intensifying substances (including STC-i, STC-2, batimastat, mecasermin, dolotuzumab, simvastatin, atorvastatin, aldosterone, metformin, heparin) media for 10 minutes. Secretion in the presence of the exosomal biosignature over each 10-minute period of the 40-minute washout period for each polyp was measured via ELISA. The data was then normalized to secretion over the first 10 minutes in media alone and expressed as a percentage in order to make direct comparisons between polyp samples. Statistical Analysis

Protein expression profiling was done using SomaLogic’s SOMAscan™ platform (Gold L, Ayers D, Bertino J, et al. Aptamer-based multiplexed proteomic technology for biomarker discovery. PLoS One. 20i0;5(i2):ei5004) for 1,317 proteins including 12 controls. Protein abundance was measured in normal (controls, labeled C) and polyp (labeled P) samples. Data was obtained in two sets: Seti involved 10 C and 10 P matched tissue, whole mucus (all POST), and exosome samples. Set2 involved 10 C and 10 P exosome samples with 4 C and 5 P samples collected from anterior nasal cavity (ANT) and the rest collected from the posterior nasal cavity (POST). One C and one P sample from Seti were included in Set2 to assess reproducibility. Raw data (abundance signal values) were normalized using the rank invariant set method (Li C, Hung Wong W. Model -based analysis of oligonucleotides arrays: model validation, design issues and standard error application. Genome Biol. 200i;2(8):RESEARCH0032). Briefly, proteins that do not exhibit large differences in their signal rank between two samples were labeled as the rank invariant set and a lowess smoothing line was fitted through their expression values to define the normalization equation.

Differential protein expression was calculated using Student’s t-test and clustering of samples and/or proteins was done using the Unweighted Pair Group Method with Arithmetic-mean (UPGMA) method with Pearson’s correlation as the distance measure (Sneath P, Sokal R. Numerical Taxonomy: The Principles and Practice of Numerical Classification. WH Free Company, San Fr. 1973:573). The expression data matrix was row-normalized prior to the application of average linkage clustering. Discriminatory power of the protein expression was also established using principal components analysis (PCA) (Pearson K. LIII. On lines and planes of closest fit to systems of points in space. Philos Mag Ser 6. i90i;2(n):559-572). Classification was done using Support Vector Machines (SVM) (Hsu C-W, Lin C-J. A comparison of methods for multiclass support vector machines. IEEE Trans neural networks. 2002;i3(2):4i5-425) on the PCA results. During the SVM application, different kernels (e.g. Linear, Gaussian, Polynomial) were tested and the kernel with the best prediction accuracy was reported. K-fold cross validation and area under the curve (AUC) of the receiver operating characteristics (ROC) were applied to assess the predictive performance of protein expression.

Predictive protein set development was performed using a combination of robustness in differential expression and fold change (FC: ratio of the average expression between P and C samples) analysis. Seti was regarded as the training set and the identified potential predictive proteins were separately applied on the following four sets as the test set: Sett, Set2, Set2 POST samples only, and Set2 ANT samples only. In order to identify potential predictive protein sets, samples in Sett were split 10,000 times by 4-fold (i.e. i/4 ^th of the samples in each group were left out in each split) and for each split a set of significantly differentially expressed proteins (p<o.oi) were calculated. Proteins were assigned a“frequency” value based on the number of times they were included in the significantly differentially expressed list out of the 10,000 splits. 12 proteins based on their robustness in differential expression (top 10 highest frequency) and high FC (top 2, not included in the top 10 most frequent) were picked as the refined predictive set. 4-fold cross validation using each combination of the 12 proteins (i.e. 2 ¹² -1 = 4,095 protein sets) were applied on each of the four test sets. For each test set, 1,000 4-fold splits were tried for each of the 4,095 predictive protein set combinations. If the number of possible 4-fold splits for a test data was less than 1,000, all possible 4-fold splits were used. Average, median, 95% lower and upper confidence bounds, and 25 ^th and 75 ^th percentile of accuracy, sensitivity and specificity were calculated. ROC curves and corresponding AUC values were obtained for predictive protein sets with good performance.

Bioinformatic Analysis

To assess for potential molecular pathways underlying the exosome-specific protein signatures and to more precisely understand the complex interactions between the differentially expressed proteins, the inventors performed functional category, canonical pathway, and interactive network analyses of the proteins using the Ingenuity Pathway Analysis software tool (IPA, Qiagen, http://www.ingenuitv.com). MetaCore™ (Thomson Reuters, version 6.31, New York, NewYork) and Genemania (http://genemania.org/).

Examnle 2

General information

PAPP-A is secreted as a dimer of 400 kDa but circulates in pregnancy as a disulfide-bound 500-kDa 2:2 complex with the preform of eosinophil major basic protein (pro-MBP). Pro- MBP has been recently shown to function as a proteinase inhibitor of PAPP-A.

It has been shown that PAPP-A is a secreted protease whose main substrate is insulin-like growth factor binding proteins (IGFBP)-4 and -5. By cleaving IGFBP-4 and -5, PAPP-A thus functions within tissues as a growth-promoting enzyme, releasing bioactive IGF-i in close proximity to the IGF receptor.

Studies could show the influence of IGF-i of the regulation of physiological and pathological proliferative processes. IGF-i is furthermore described to play a role in the development of cancer as it does increase cell proliferation and seems to decrease the apoptosis rate. PAPP-A increases IGF-i indirectly by the cleavage of its binding partner, therefore accounting for its proliferative effect.

Proteolytic inhibition of PAPP-A may involve the protein stanniocalcin-i (STC-i) and stanniolcalcin-2 (STC-2), recently found to potently inhibit PAPP-A activity by forming a covalent complex with PAPP-A. qPCR of Pappalvsin and its known inhibitors

qPCR shows that PAPPA mRNA levels are also significantly upregulated in CRSwNP compared to controls (n=30 per group). Similar results can be seen for inhibitors of PAPPA like STC-i and STC-2 (see figures l - 3).

Western Blot

The present inventors compared inferior turbinate tissue of nasal polyps and inferior turbinate tissue of healthy controls as it is suggested that the inferior turbinate itself might be protective against polypoid changes. The different embryologic origin of the inferior turbinate compared to the rest of the bones of the sinonasal cavity might contribute to this and should be examined further. Placenta tissue, a highly proliferative tissue in which PAPP- A has been described before, is was also run as an internal control.

Western Blot using a polyclonal antibody against PAPP-A comparing nasal polyp tissue, inferior turbinate tissue of polyp patients, inferior turbinate tissue of control patients and placenta. Beta Actin was used as a reference protein (figure 4).

ELISA

In mucus, PAPPA could mirror the progression of the disease as well as subjective parameters (SNOT-22, SF-36 and RSDI). The course of the disease may be followed or even predicted using PAPPA. PAPPA is able to distinguish between early and late recurrences which is important to know for patient counseling and therapeutical adjustments (n=66 patients). It seems that PAPPA changes occur even before the patient experiences symptoms or decline in general health. If that is the case symptoms or a drop in general perceptions may be prevented before they occur.

CRSwNP patients were followed up after sinus surgery (time points o) over a course of 24 months (10 time points total) and PAPPA was measured at each time point. The dashed line curve represents the group of patients that had early progression of nasal polyps (n=5). The drawn through line curve shows the CRSwNP patients that had recurrence of the disease later/ after the 2-year time period (n=6i)(figure 5). Additionally, PAPPA was significantly overexpressed in tissue lysates of CRSwNP patients compared to controls (inferior turbinate of control and CRSwNP patients) (n=9 per group Xfigure 6).

Immunohistochemistrv

Additionally, the present inventors performed immunohistochemical (IHC) staining for PAPP-A in nasal polyps and control tissue (inferior turbinates) to identify the location of PAPP-A in polyp and control tissue. The immunohistochemistry of the control tissue, PAPP- A was found in the epithelial cells, fibroblast and endothelium of the vessels. The epithelium as well as the eosinophils were prominently stained with PAPP-A in the polyp tissue(figure 7)·

Functional Assay

Measurement of the cleavage product IGFBP-4 to assess the function of PAPPA. At this point, data show more than triple the activity of PAPPA in polyps than in control tissue (n=30 per group). The difference of the activity between groups is significant (figure 8).

Explant model

Due to the results of the proteomic and transcriptomic analysis, PAPP-A as well as other proteins of the biosignature (including CST-2, Periostin, SerpinEi, SerpinF2) seem to be overexpressed in CRSwNP. For PAPP-A, also the activity of the protease is shown to be highly increased. Using the ex vivo explant model, the physiological and pathological processes can be simulated. This includes testing the effect of various medications on polyp regrowth and changes in the biosignature.

Exosomes may be reproducibly isolated, contain a unique proteomic signature, and are more homogenous than whole mucus

Among the Sett data, eleven established core exosomal markers (Mathivanan S, Ji H, Simpson R. Exosomes: extracellular organelles important in intercellular communication. J Proteomics. 2qΐq;73(iq):ΐ9q7-ΐ92q) among both the CRSwNP and control patients were significantly enriched in the exosome isolate relative to the matched mucus samples demonstrating successful purification of the exosome fraction. The overall exosomal proteome between CRSwNP and control groups correlated more strongly to one another (r =0.84, p<o.ooi) than with either the mucus or tissue proteome (r=o.72, p<o.ooi, p=o.66, p<o.ooi) suggesting that that the exosome isolation yielded discreet and reproducible protein expression data between patients. This was subsequently confirmed by 2 dimensional PCA. Furthermore, the inter-patient variance among the sampled proteins was significantly lower in the exosomes than matched whole mucus samples (5.88x1o ⁸ vs 2.4x1o ⁹ , p< 0.05)(figure 9).

The exosomal proteome is perturbed in CRSwNP and reflects the underlying tissue proteome

Among the Seti data, seventy-five proteins were significantly up regulated in the exosomal proteome in CRSwNP (17, p<o.oi; 58, p<0.05) relative to control. Similarly, forty-eight proteins were significantly down regulated (10, p<o.oi; 38, p<0.05) among the polyp patients relative to control. As a result of the improved S/N evident in the exosomal proteome relative to whole mucus, 80 of these proteins overlapped with the CRSwNP tissue proteome versus only 4 in matched whole mucus. One hundred and two of these perturbed exosomal proteins have not been previously described within the CRSwNP literature.

Exosomal Protein Biosignatures Accurately Predict CRSwNP

Following invariant set normalization, the rerun samples showed high correlation between Sets 1 and 2 (0.9918 for the control and 0.9891 for the polyp sample) implying successful normalization and reproducibility. The inventors’ results showed successful separation of the polyps rendering a proteomic profile associative with the phenotype. As described in Example 1, the inventors identified 12 proteins with the highest FC and most robust differential expression as the refined predictive protein set.

Prediction performance gradually degraded as the test data set followed the order Seti - Set2 POST Only - Set2 ALL - Set2 ANT Only. Therefore, the site of the sample (e.g. posterior versus anterior) influenced the proteomic profile, which determined the prediction performance. This is also evident from data (not shown), which depict the PCA of Set2 exosomal samples only in an unsupervised fashion using all of the 1,305 proteins. This global proteomic profile clustering indicates that the site of the sample is a major factor in the overall protein expression. Indeed, a direct comparison between these groups reveal 74, 27, and 153 significantly differentially expressed proteins (p<o.oi) between POST and ANT samples in control, polyp, and all samples in Set2, respectively. The inventors also identified proteins significantly differentially expressed (p<o.oi) between polyp and control samples across POST (28 proteins) and ANT samples (5 proteins) separately in Set2. The 5 proteins associated with the polyp phenotype when only ANT samples were considered were not among the 28 proteins significantly differentially expressed between POST polyp and POST control samples. These results imply that the difference in protein abundance due to nasal polyps is more profound in the POST samples and exhibit a site-dependent behavior. Despite recent consensus statements on the diagnosis of CRSwNP ⁵ , current symptom, endoscopy, and imaging based criteria offer essentially no information on the pathobiology underlying the disease. The inability to glean a priori information about patient endotype has led to variable outcomes in recent clinical trials (Miyake MM, Nocera A, Levesque P, et al. Double-blind placebo-controlled randomized clinical trial of verapamil for chronic rhinosinusitis with nasal polyps. J Allergy Clin Immunol. 20175140(1); Van Zele T, Gevaert P, Holtappels G, Beule A, Wormald PJ, Mayr S, et al. Oral steroids and doxycycline: two different approaches to treat nasal polyps. The Journal of allergy and clinical immunology. 20io;i25(5):io69-76.e4; Varvyanskaya A, Lopatin A. Efficacy of long-term low-dose macrolide therapy in preventing early recurrence of nasal polyps after endoscopic sinus surgery. Int Forum Allergy Rhinol 2014 Jul; 4(7)533-41 doi I0i002/alr2i3i8 Epub 2014 Mar 21; Gevaert P, Van Bruaene N, Cattaert T, et al. Mepolizumab, a humanized anti-IL-5 mAh, as a treatment option for severe nasal polyposis. J Allergy Clin Immunol. 20ii;i28(5):989-995). Patients with similar clinical phenotypes are grouped together despite the possibility of significant underlying immunologic differences with attendant variable clinical responses. Consequently, there is an urgent need to develop a non-invasive, quantitative, biosignature of CRS endotypes.

Characteristics of an optimal substrate for biosignature sampling are being non-invasive, quantitative, multiplexed, and providing a high S/N ratio. While protein and cytokine expression have been studied in whole mucus (Al Badaai Y, DiFalco M, Tewfik M, et al. Quantitative proteomics of nasal mucus in chronic sinusitis with nasal polyposis. J Otolaryngol Head Neck Surg. 2009;38(3):38I-389; Biswas K, Chang A, Hoggard M, et al. Toll-like receptor activation by sino-nasal mucus in chronic rhinosinusitis. Rhinol. 2017;55(I):59-69), this substrate represents a complex fluid replete with cellular debris and degraded protein fragments. The significant protein variability arising from this heterologous mixture led the inventors to search for a novel biosignature substrate which could provide an enhanced S/N ratio while maintaining the potential for serial and non-invasive sampling.

Pappalysin as indicator of response to treatment

The present inventors could show in an experiment that PAPP-A is, among all 1300 proteins measured, the protein that diminishes most after a corticosteroid taper (starting dose 40 mg).

The experiment was designed as follows: N= 12 patients with chronic rhinosinusitis with nasal polyps (CRSwNP) were included in this study. Patients were only included when they had not received any oral corticosteroids or antibiotics in the last 30 days. To obtain mucus samples, a compressed polyvinyl alcohol sponge (Medtronic, Minneapolis, MN) was placed in the posterior nasal cavity adjacent to the middle turbinate and let in place for 5 minutes, and care was taken to not contaminate sampling sponges with blood. All patients had mucus samples collected before and after a standardized oral prednisone course, consisting of a 16 day taper of oral prednisone daily starting at 4omg and decreasing by lomg every 4 days. 1300 proteins were analyzed in a multiplexed approach and levels were measured in exosomes and compared pre/post corticosteroids. PAPP-A was the protein that showed the highest negative change of all 1300 proteins- the PAPP-A concentration diminished by 41%. This is a very important finding as corticosteroids are the gold standard for treatment of CRSwNP. PAPP-A is a very important biomarker to monitor the response to corticosteroids.

Circadian rhythm of PAPP-A

In order to validate PAPP-A as a biomarker, the present inventors collected mucus every 3 hours for 24 hours. They analyzed how the levels of PAPP-A changed over time. This is very important to know as a biomarker should be stable during the time period sampled. The levels of PAPP-A were stable between 6am and 12pm which means that PAPP-A is stable during the sample period between 9am and 5pm. This is another proof that PAPP-A is a valid biomarker.

Without wishing to be bound by any theory, the present inventors believe that exosomes are a highly regulated and relatively homogenous sub-fraction of most bodily fluids. Because the exosomal proteome may reflect the host cell and may be protected from degradation by nucleases and proteases, the present inventors’ results demonstrate that inter-patient proteomic variability is reduced in exosomes relative to whole mucus. Consequently, the proteomic perturbations indicative of CRSwNP within the tissue are highly reflected in the exosomal population leading to a 20-fold increase in the number of overlapping differentially regulated proteins within exosomes as compared to whole mucus.