NAJIMUDIN MOHD NAZALAN MOHD (MY)
SAITO JENNIFER ANN (MY)
MISRA BISWAPRIYA BISWAVAS (MY)
ALAM MAQSUDUL (MY)
NAJIMUDIN MOHD NAZALAN MOHD (MY)
SAITO JENNIFER ANN (MY)
MISRA BISWAPRIYA BISWAVAS (MY)
| US20070067866A1 | 2007-03-22 | |||
| EP1046709B1 | 2006-01-18 | |||
| EP2143793A1 | 2010-01-13 |
DATABASE GENBANK 26 August 2003 (2003-08-26), XP003031002, accession no. Y349419
| CLAIMS 1 . An isolated polynucleotide encoding an enzyme for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of Hevea brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9 or any complementary sequence thereof. 2. An isolated polynucleotide according to claim 1 , wherein the plant of Hevea brasiliensis is clone RRDVI 600. 3. A recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID NO, 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide template; wherein the polynucleotide template is expressible in a host cell to produce an enz3'me which catalyzes biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis. 4. A transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 to produce an enzyme which catalyzes biosynthesis, conversion or utilization of prenyl- pyrophosphate for rubber biosynthesis. 5. A transgenic plant of Hevea brasiliensis with enhanced biosynthesis and accumulation of polyisoprenoids, comprising a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9. 6. A method for enhancing biosynthesis and accumulation of polyisoprenoids comprising the steps of cloning a gene construct having nucleotide sequence set forth in SEQ ED NO. 1 , SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5 and expressing the gene construct in a host cell. 7. An isolated polypeptide for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of Hevea brasiliensis, comprising amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10. 8. An isolated polypeptide according to claim 7, wherein the plant of Hevea brasiliensis is clone RREM 600. 9. A method for catalyzing biosynthesis, conversion or utilization of prenyl- pyrophosphate for enhancing the biosynthesis of natural rubber from its precursors, comprising the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 or SEQ ID NO. 12 into a plant cell in vitro. 10. A method for enhancing accumulation of prenyl-pyrophosphate in the plant of Hevea brasiliensis, comprising the step of down-regulating expression of a nucleic acid template containing at least one nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ID NO. 3, SEQ ID NO. 5, SEQ ED NO. 7 or SEQ ID NO. 9 in at least one cell. 11. A method according to claim 10, wherein the prenyl -pyrophosphate is isopentenyldiphosphate, dimethylallyldiphosphate, geranyl diphosphate, farnesyl diphosphate or geranylgeranyl diphosphate. 12. A method according to claim 10, wherein the down -regulating step is conducted by transforming the cell with a recombinant gene construct encoding open reading frame containing nucleotide sequence which is at least 70% identical to SEQ ID NO. 1 , SEQ ED NO. 2, SEQ ED NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5 and expressing the nucleotide sequence of the gene construct under expression control of a rubber polymerization-associated promoter. |
BRASILIENSIS
FIELD OF INVENTION
The present invention relates to the specific genes encoding for a series of enzymes involved in the biosynthesis, conversion and utilization of various precursors or initiator molecules for rubber biosynthesis in the plant of Hevea brasiliensis. More particularly, the present invention provides the polynucleotide sequences of the genes encoding for the series of enzymes involved in the biosynthesis, conversion and utilization of the prenyl-pyrophosphate as precursors for rubber biosynthesis; and a variety of specific genetic engineering and intervention approaches to regulate rubber biosynthesis in the plant, to enhance rubber production as well as to improve agro- genomic character of the plant.
BACKGROUND OF THE INVENTION
Rubber tree has been an important industrial crop for natural rubber production throughout the decades. It is reported that the world supply of natural rubber is barely keeping up with the estimated global demand for 12 million tons of natural rubber in 2020. In order to keep up with such increase of the global demand, further improvement of natural rubber production has become a necessary. One of the strategies taken by the industry to promote the natural rubber production is to rapidly expand the rubber plantations throughout the Montane main lands in South East Asia regions. Another strategy developed is a molecular biology approach, whereby the rubber biosynthesis process of the rubber tree is explored and improved.
Natural rubber is cytoplasm of laticifer cell. It is synthesized by at least 2,000 species of plants belonging to 300 genera. Among the rubber-producing plants, H. brasiliensis is deemed the only economically-viable source of natural rubber due to its good yield of rubber and the excellent physical properties of the rubber products. Latex is a biodegradable polymer yielding the natural rubber. It is widely used worldwide, because of its excellent properties in terms of high elasticity and mechanical strength including high resistance to impact and tear as well as low heat build-up during deformation. High yields of latex can be obtained from the H. brasiliensis clone RREVl 600, which is a clone evolved by the Rubber Research Institute of Malaysia from parent clones Tjir 1 and PB 86. This clone has an above average initial latex yield and a very high level of subsequent yield.
In general, rubber biosynthesis comprises 6 major processes, which include sucrose import and degradation, glycolysis, acetyl-CoA biosynthesis, prenyl diphosphate synthesis via mevalonate (MVA) pathway in cytosol, geranylgeranyl pyrophosphate (GGPP) synthesis in mitochondria, and rubber polymerization on rubber particle membrane. Besides, 2-C-methyl-D-erythritol-4-phosphate (MEP) pathway was also suggested to be important for rubber biosynthesis because it synthesizes prenyl diphosphate and GGPP which are used in rubber polymerization reaction. The biosynthetic pathways of MVA and MEP can give rise of the precursor units for natural rubber, which is isopentenyl diphosphate (ΓΡΡ) or its isomer dimethyl allyldiphosphate (DMAPP).
Natural rubber is a polymer of isoprenoids, which is also known as terpenoids, that are derived from ΓΡΡ units, condensed sequentially in cis-configuration by the group of enzymes, cis-prenyl transferases. An allylic diphosphate is also required as the priming co-substrate to initiate the subsequent extensive prenyl chain elongation towards the formation of the rubber polymer. These initiator molecules themselves are derived from isoprene units through the action of distinct prenyl transferases. These include dimethylallyldiphosphate (DMAPP; C5), geranyl diphosphate (GPP; CIO), farnesyl diphosphate (FPP, C I 5) and geranylgeranyl diphosphate (GGPP; C20).
The series of enzymes involved in the condensation of IPP and DMAPP to GPP, FPP and GGPP are collectively known as short-chain isoprenyl diphosphate synthases (IDSs) or linear prenyl-pyrophosphates (LPPs) synthases. They are trans- prenyltransferases (TPTs) which directly involve in the synthesis of rubber, based on the type of double bond formed during condensation. This series of enzymes are named isopentenyl diphosphate isomerase (ID I), geranyl pyrophosphate synthase (GPPS), farnesyl pyrophosphate synthase (FPPS), geranylgeranyl pyrophosphate synthase (GGPPS) and geranylgeranyl reductase (GGR).
DDI is the flavoenzyme that catalyzes the interconversion (isomerization) between IPP and DMAPP, both of which are essential precursors for isoprenoid or terpenoid biosynthesis. The DDI genes have been shown to be present and expressed in various plants, such as tobacco (Nicotiana tabacum L.), tomato (Solarium lycopersicum), Gossypium barbadense, sweet potato (Ipomea batatas) and Camptotheca acuminate. The recombinant DDI from sweet potato was also shown to be involved in the reconstruction of carotenoid pathway.
The enzyme GPPS, catalyzes the synthesis of CIO-GPP, which is the common precursor of C lO-monoterpenes that involved in producing floral or fruit scents, emitting signals that ward off pathogens, and acting as mediators of interplant communication. With the exception of mint GPPS, protein sequences have not been obtained from plant-purified GPPS. Attempts to identify GPPS in a given plant species have relied primarily on mining DNA databases, expressing candidate genes in a bacterial system, and testing the resulting proteins in vitro. On the other hand, FPPS, a polyprenyltransferase, plays central role in plant isoprenoid biosynthetic pathways, by catalyzing the synthesis of C15-FPP by the sequential Γ-4 condensation of dimethylallyl diphosphate C5-DMAPP with two molecules of C5-DPP. FPPS is the vital allylic pyrophosphate initiator for successive condensations of IPP leading to production of cis-polyisoprene or natural rubber. It has been found in the synthesis of various metabolites and its genes are isolated from various organisms such as humans, fruit flies and plants.
Another enzyme, GGPPS, catalyzes the biosynthesis of 20-carbon GGDP, which is a result of condensation of DMAPP and FPP, finally leading to biosynthesis of important pharmaceuticals known till date, such as ginkgolides, forskolins, taxols and others. The GGPPS has been found and characterized in Taxus media, Taxus canadensis. Ginkgo biloba, hazel, Coleus forskohlii, Scoparia dulcis and Croton sublyratus, and H. brasiliensis . Whilst, GGR from plants and cyanobacteria catalyzes the saturation of the geranylgeranyl group to produce chlorophyll, tocopherol and phyloquinone. Plethora of prenyl lipids including chlorophylls and tocopherols are synthesized in the plastids of plant cells; while p-prenylation of these compounds with the C20-intermediate GGPP and the reduction of GGPP to phytyl diphosphate are catalyzed by GGPP reductase, which is also known as GGR or Chi P. This enzyme has been investigated in detail in a few plant species such as tobacco, Arabidopsis, soybean, ice plant, Sulfolobus acidocaldarius, the thermophilic heterotrophic archaea Thermoplasma acidophilum and the cyanobacterium Synechocystis.
It is shown in the prior art that the genes encoding the series of enzymes which catalyzes the synthesis of the prenyl -pyrophosphates have been found or cloned from a number of organisms, including plants, and these genes encode polypeptides (enzymes) with certain conserved regions of homology. However, none of the existing technologies discloses the polynucleotide sequences or polypeptides encoded thereof for these series of prenyl-pyrophosphates biosynthetic genes or enzymes which are specifically found in or derived from the plant of H. brasiliensis, and their utilization for rubber biosynthesis. There is also no successful technique provided in the prior art to elucidate these related enzymes and apply them in the genetic intervention of rubber biosynthesis. Apart from that, the prior art also has not provided or suggested any method for constructing a pathway for the biosynthesis, conversion and utilization of prenyl-pyrophosphate in H. brasiliensis, nor method for regulating the biosynthesis, conversion and utilization of prenyl-pyrophosphate in this plant for rubber biosynthesis.
In view of the fact that the series of enzymes involved in the biosynthesis, conversion and utilization of prenyl-pyrophosphate could play an important role in the biosynthetic pathway of rubber, it is desirable for the industry to provide a genetic approach relating the biosynthesis of rubber in plant by exploring and utilizing the molecular biology and genetic information of this series of enzymes. Besides, a species-specific approach is also preferable in order to yield a cost-effective result as the rubber biosynthetic pathway and genetic makeup of each species of plant are potentially varied among one another.
SUMMARY OF INVENTION
The primary object of the present invention is to provide the polynucleotide sequences encoding for a series of enzymes, including IDI, GPPS, FPPS, GGPPS and GGR, which are involved in the biosynthesis and conversion of prenyl-pyrophosphates, as well as their utilization for biosynthesis of rubber in the plant of H. brasiliensis.
Another object of the present invention is to provide the molecular biology and genetic information of the genes and enzymes set forth in the primary object to be exploited for the regulation of the biosynthesis, conversion and utilization of prenyl- pyrophosphate for the production of natural rubber in H. brasiliensis.
Still another object of the present invention is to provide the isolated polypeptides encoded by the polynucleotide sequences provided, which is the series of enzymes involved in the biosynthesis, conversion and utilization of prenyl-pyrophosphate, such as IPP, GPP, FPP and GGPP, for rubber polymerization.
Yet another object of the present invention is to manipulate or regulate the biosynthesis of cis-polyisoprene (natural rubber) in H. brasiliensis, in vitro or in vivo, by genetically intervening the pathway of biosynthesis and conversion of prenyl- pyrophosphates as well as their utilization for rubber biosynthesis.
Further object of the present invention is to produce a transgenic plant of H. brasiliensis with increased polyisoprenoid (rubber) production, by manipulation of cellular levels of the series of enzymes involved in the biosynthetic, conversion and utilization pathway of prenyl-pyrophosphates. Another further object of the present invention is to provide a method for enhancing accumulation of polyisoprenoids in plant cell in vitro by genetic intervention, such as down regulation or overexpression technique.
Still another further object of the present invention is to provide a potential commercially feasible way to increase the yield of rubber in order to keep up with the increasing global demand on rubber-based products. At least one of the preceding objects is met, in whole or in part, by the present invention, in which one of the embodiments of the present invention describes an isolated polynucleotide encoding an enzyme for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of H. brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7, SEQ ID NO. 9 or any complementary sequence thereof. Preferably, the plant of H. brasiliensis is clone RRBVI 600.
Another embodiment of the present invention is a recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide template; wherein the polynucleotide template is expressible in a host cell to produce an enzyme which catalyzes biosynthesis, conversion or utilization of prenyl- pyrophosphate for rubber biosynthesis. Accordingly, a chimeric gene, in combination of two or more gene constructs having nucleotide sequence as set forth in the preceding description can be provided.
Still another embodiment of the present invention is a transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ED NO. 9 to produce an enzyme which catalyzes biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis.
According to yet another embodiment of the present invention, a transgenic plant of H. brasiliensis with enhanced biosynthesis and accumulation of polyisoprenoids is provided, wherein the transgenic plant comprises a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ED NO. 1, SEQ ED NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9.
Another embodiment of the present invention discloses a method for enhancing biosynthesis and accumulation of polyisoprenoids comprising the steps of cloning a gene construct having nucleotide sequence set forth in SEQ ED NO. 1, SEQ ED NO. 2, SEQ ID NO. 3, SEQ ED NO. 4 or SEQ ID NO. 5 and expressing the gene construct in a host cell. Further embodiment of the present invention is an isolated polypeptide for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of H. brasiliensis, comprising amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8 or SEQ ID NO. 10. Preferably, the plant of H. brasiliensis is clone RRIM 600.
In accordance with another embodiment of the present invention, a method for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for enhancing the biosynthesis of natural rubber from its precursors is provided, wherein the method comprises the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ED NO. 2, SEQ ID NO. 4, SEQ ED NO. 6, SEQ ED NO. 8, SEQ ED NO. 10 or SEQ ED NO. 12 into a plant cell in vitro.
Another further embodiment of the present invention is a method for enhancing accumulation of prenyl-pyrophosphate in the plant of H. brasiliensis, comprising the step of down-regulating expression of a nucleic acid template containing at least one nucleotide sequence set forth in SEQ ED NO. 1, SEQ ED NO. 3, SEQ ID NO. 5, SEQ ED NO. 7 or SEQ ED NO. 9 in at least one cell. Preferably, the prenyl-pyrophosphate is isopentenyldiphosphate, dimethylallyldiphosphate, geranyl diphosphate, farnesyl diphosphate or geranylgeranyl diphosphate.
More preferably, the down-regulating step of the preceding embodiment is conducted by transforming the cell with a recombinant gene construct encoding open reading frame containing nucleotide sequence which is at least 70% identical to SEQ ED NO. I, SEQ ED NO. 2, SEQ ED NO. 3, SEQ ID NO. 4 or SEQ ED NO. 5 and expressing the nucleotide sequence of the gene construct under expression control of a rubber polymerization-associated promoter.
The present invention is useful for a variety of agricultural and commercial purposes including, but not limited to, controlling, modulating, or regulating gene expression (e.g. of a commercially useful compound), increasing crop yields, improving crop and ornamental quality, and reducing agricultural production costs. As set forth in the embodiments of the present invention, the methods described herein provide simple means for silencing or activating genes involved in the synthesis of any or a number of isoprenoid compounds, for example, metabolites such as sterols, carotenoids, growth regulators, and the polyprenol substituents of poly-isoprene (rubber), dolichols, quinones, and proteins, monoterpenes, diterpenes and sesquiterpenes. In other words, by regulating the biosynthesis, conversion and utilization of prenyl- pyrophosphate in the plant, the biosynthetic pathway of natural rubber as well as other metabolites can also be manipulated. Thus, the methods described herein have an agricultural-genomics value for the preparation of transgenic plants or organisms towards significant commercial-scale improvement in H. brasiliensis rubber production.
One skilled in the art will readily appreciate that the present invention is well adapted to carry out the objects and obtain the ends and advantages mentioned, as well as those inherent therein. The embodiments described herein are not intended as limitations on the scope of the invention. BRIEF DESCRIPTION OF THE DRAWINGS
For the purpose of facilitating an understanding of the invention, there is illustrated in the accompanying drawing the preferred embodiments from an inspection of which when considered in connection with the following description, the invention, its construction and operation and many of its advantages would be readily understood and appreciated.
Figure 1 is the nucleotide sequence SEQ ID NO. 1 of the polynucleotide
encoding the enzyme EDI of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention.
Figure 2 is the amino acid sequence SEQ ID NO. 2 of the polypeptide encoded by the SEQ ED NO. 1 of Figure 1. is the nucleotide sequence SEQ ED NO. 3 of the polynucleotide encoding the enzyme GPPS of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention.
Figure 4 is the amino acid sequence SEQ ID NO. 4 of the polypeptide encoded by the SEQ ID NO. 3 of Figure 3.
Figure 5 is the nucleotide sequence SEQ ED NO. 5 of the polynucleotide
encoding the enzyme FPPS of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention.
Figure 6 is the amino acid sequence SEQ ED NO. 6 of the polypeptide encoded by the SEQ ED NO. 5 of Figure 5. Figure 7 is the nucleotide sequence SEQ ED NO. 7 of the polynucleotide
encoding the enzyme GGPPS of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention. is the amino acid sequence SEQ ID NO. 8 of the polypeptide encoded by the SEQ ID NO. 7 of Figure 7. is the nucleotide sequence SEQ ID NO. 9 of the polynucleotide encoding the enzyme GGR of the plant H. brasiliensis as described in one of the preferred embodiments of the present invention. is the amino acid sequence SEQ ID. NO. 10 of the polypeptide encoded by the SEQ ED NO. 9 of Figure 9. is the electrophoresed agarose gel image showing the polymerase chain reaction (PCR) amplification result of EDI from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of IDI (705 bp). shows the restriction pattern of HbEDI, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring IDI cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring IDI cDNA (-700 bp insert). is the electrophoresed agarose gel image showing the PCR
amplification result of HbGPPS from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of HbGPPS (921 bp). shows the restriction pattern of HbGPPS, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring HbGPPS cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring HbGPPS cDNA (-900 bp insert). While presence of internal Bglll site, the gene and protein are also shown to be further digested internally to generate -550 bp + -350 bp products. is the electrophoresed agarose gel image showing the PCR amplification result of FPPS from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of FPPS (1029 bp). shows the restriction pattern of FPPS, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring FPPS cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring FPPS cDNA (digested internally to generate -550 bp + -350 bp + - 100 bp products). is the electrophoresed agarose gel image showing the PCR
amplification result of GGPPS from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of GGPPS (921 kbp). shows the restriction pattern of HbGGPPS, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring GGPPS cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring GGPPS cDNA showing a product at -900 bp, digested into multiple products. is the electrophoresed agarose gel image showing the PCR
amplification result of GGR from cDNA, in which lane 1 is 1 kbp DNA ladder marker and lane 2 is amplicon of GGR (1416 bp). shows the restriction pattern of HbGGR, in which lane 1 is 1 kbp DNA ladder marker, lane 2 is undigested pJET 1.2 cloning vector harbouring GGR cDNA and lane 3 is Bglll-digested 1.2 cloning vector harbouring GGR cDNA (- 1.4 kbp insert). shows the respective roles of isoprenoid biosynthesis enzymes involved in the significant processes, including EDI, GPPS, FPPS, GGPPS and GGR from H. brasiliensis . Figure 22 is an operative biosynthetic pathway, conversions and utilization of prenyl-pyrophosphates in the mitochondria of H. brasiliensis laticifer, constructed using the program of Pathway Studio, showing the precursors and enzymes for rubber polymerization, which include IDI, GPPS, FPPS, GGPPS and GGR.
DETAILED DESCRIPTION OF THE INVENTION The present invention relates to the specific genes encoding for a series of enzymes involved in the biosynthesis, conversion and utilization of various precursors or initiator molecules for rubber biosynthesis in the plant of H. brasiliensis. More particularly, the present invention provides the polynucleotide sequences of the genes encoding for the series of enzymes involved in the biosynthesis, conversion and utilization of the prenyl-pyrophosphate as precursors for rubber biosynthesis; and a variety of specific genetic engineering and intervention approaches to regulate rubber biosynthesis in the plant, to enhance rubber production as well as to improve agro- genomic character of the plant.
The term "gene", as used herein, is defined as the genomic sequence of the plant H. brasiliensis, particularly polynucleotide sequence encoding polypeptide of the series of enzymes involved in the biosynthesis, conversion and utilization of the prenyl- pyrophosphate as precursors for rubber biosynthesis.
The term "polynucleotide", as used herein, is a nucleic acid chain containing a sequence greater than 100 nucleotides in length.
The term "polypeptide", as used herein, is a single linear chain of amino acids bonded together by peptide bonds, and having a sequence greater than 100 amino acids in length.
The term "isolated polynucleotide", as used herein, refers to polymer of RNA or DNA acquired from biological sample or produced chemically via any known method in the art. The polymer can be single- or double-stranded.
The term "primer", as used herein, is an oligonucleotide capable of binding to a target nucleic acid sequence and priming the nucleic acid synthesis. An amplification oligonucleotide as defined herein will preferably be 10 to 50, most preferably 15 to 25 nucleotides in length. While the amplification oligonucleotides of the present invention may be chemically synthesized and such oligonucleotides are not naturally- occurring nucleic acids.
The abbreviation used throughout the specification to refer to nucleic acids comprising nucleotide sequences are the conventional one-letter abbreviations. Thus, when included in a nucleic acid, the naturally occurring encoding nucleotides are abbreviated as follows: adenine (A), guanine (G), cytosine (C), thymine (T) and uracil (U). Also, unless otherwise specified, the nucleic acid sequences presented herein in the 5'→3'direction.
As used . herein, the term "complementary" and derivatives thereof are used in reference to pairing of nucleic acids by the well-known rules that A pairs with T or U and C pairs with G. Complement can be "partial" or "complete". ' In partial complement, only some of the nucleic acid bases are matched according to the base pairing rules; while in complete or total complement, all the bases are matched according to the paring rule. The degree of complement between the nucleic acid strands may have significant effects on the efficiency and strength of hybridization between nucleic acid strands as well known in the art. This may be of particular in detection method that depends upon binding between nucleic acids.
The term 'host cell" or "transformed cell" used herein refers to cell received a foreign gene material or a recombinant gene construct and capable of producing a products according to the genetic information presented in the foreign gene material.
The term "operably-linked", as used herein, refers to association of nucleic acid sequence on a single nucleic acid fragment so that the function of one is affected by the other. For example, a promoter can be operably-linked with a coding sequence when it affects the expression of that coding sequence, i.e. that the coding sequence is under the transcriptional control of the promoter.
The term "in vivo", as used herein, refers to a biological reaction or experimentation conducted in a whole, living organism within a natural setting.
As opposed to "in vivo", the term "in vitro", as used herein, refers to a biological reaction occurs in an artificial environment outside a living organism, which is usually conducted in a laboratory using components of an organism that have been isolated from their usual biological context in order to permit a more detailed or more convenient analysis to be performed.
Hereinafter, the invention shall be described according to the preferred embodiments of the present invention and by referring to the accompanying description and drawings. However, it is to be understood that limiting the description to the preferred embodiments of the invention and to the drawings is merely to facilitate discussion of the present invention and it is envisioned that those skilled in the art may devise various modifications without departing from the scope of the appended claim.
The present invention discloses an isolated polynucleotide encoding an enzyme for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of H. brasiliensis, comprising nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ED NO. 7, SEQ ID NO. 9 or any complementary sequence thereof. The isolated polynucleotides having nucleotide sequences as set forth herein are the gene cluster encoding for the enzymes of DDI, GPPS, FPPS, GGPPS and GGR from H. brasiliensis, which having specific and significant roles in the biosynthetic pathway of natural rubber, in the plant.
There are five most important proteins, DDI, GPPS, FPPS, GGPPS and GGR performing enzymatic steps involved in production . and regulation of isoprenoids in the plant cell are identified, which can be consequently utilized as precursors in rubber biosynthesis and in biosynthesis of pigments, antioxidants and defence molecules in the H. brasiliensis tree. Illustrated in Figure 1 is SEQ ID NO. 1, showing the nucleotide sequence of the isolated polynucleotide encoding for IDI, which catalyzes the isomerization between the IPP and DMAPP. Illustrated in Figure 3 is SEQ ID NO. 3, showing the nucleotide sequence of the isolated polynucleotide encoding for GPPS, which catalyzes the synthesis of GPP. The synthesis of FPP from GPP is catalyzed by FPPS, whose nucleotide sequence are as set forth in SEQ ID NO. 5, as shown in Figure 5. Figure 7 shows the nucleotide sequence SEQ ID NO. 7 of the isolated polynucleotide encoding for GGPPS, which catalyzes the biosynthesis of 20- carbon GGDP, as a condensation result of DMAPP and FPP. The SEQ ID NO. 9 as shown in Figure 9 is the nucleotide sequence of the isolated polynucleotide encoding for GGR. It catalyzes the conversion of GGPP to produce chlorophyll, tocopherol and phyloquinone. The roles of these isoprenoid biosynthesis, conversion and utilization enzymes are further shown in Figure 21.
Before the genetic intervention procedure can be conducted, the gene cluster encoding the series of enzymes set forth in the preceding description can be identified and characterized, by using the existing molecular biology information of the related enzymes which were isolated from other species of plants or microorganisms. According to one of the preferred embodiments, the present invention applies the TBLASTN program, against assembled DNA sequences of rubber genome to manually identify all relevant proteins as well as by automatic annotation by orthologs identified with best reciprocal hit method from BLASTP. The available molecular biological database such as GenBank and Uniprot are preferably used, and the transcriptome data for the present invention is preferably obtained from the clone H. brasiliensis RRIM 600. This rubber tree clone is preferably used for the production of natural rubber as it gives higher yield, more adaptable to the environment and known to be less susceptible to climatic variations.
In accordance with the preferred embodiment of the present invention, the transcriptome and the gene models data obtained or predicted from the genome sequences of H. brasiliensis, or other related species of plants or microorganisms, can be used for designing primers for PCR amplification of the target genes encoding the series of enzymes as set forth in the preceding description. Amplification primers are preferably designed targeting the conserved region of each gene. The primers are preferably gene-specific. Example 1 shows an exemplary method for primer designing, and the exemplary oligonucleotide sequences of the primers designed are tabulated in Table 1.
A pathway re-construction process can be conducted to showcase the biosynthesis, conversion and utilization of prenyl-pyrophosphate in rubber using the molecular biology information obtained from the present invention. Figure 22 shows an operative biosynthetic pathway, conversions and utilization of prenyl-pyrophosphates in the mitochondria of H. brasiliensis laticifer, which can be constructed using the program of Pathway Studio. An example of this pathway re-construction process is further detailed in Example 2.
According to the preferred embodiment of the present invention, total RNA can be isolated from the leaves of the plant of H. brasiliensis, and the process of amplification, cloning and sequencing of DDI, GPPS, FPPS, GGPPS and GGR can be conducted using a method as detailed in Example 3. Accordingly, RT-PCR is preferably carried out using the cDNA derived from the total RNA of the leaves of H. brasiliensis, and the amplification products of each target gene encoding the series of enzymes are shown by the electrophoresed gels in Figures 11 , 13, 15, 17 and 19. The purified products can be ligated in a commercially available cloning vector, and then be transformed into a host cell, such as the commercially available chemically competent E. coli cell.
Example 4 shows an exemplary method of plasmid isolation from the transformed cell and the restriction digestion procedure for the confirmation of clones. The restriction digestion patterns of the digested and undigested recombinant plasmids comprising the genes encoding the enzymes , of DDI, GPPS, FPPS, GGPPS and GGR are further illustrated in Figures 12, 14, 16, 18 and 20. Another embodiment of the present invention is an isolated polypeptide for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis in the plant of H. brasiliensis, comprising amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ED NO. 8 or SEQ ID NO: 10. As set forth in the preceding description, the plant of H. brasiliensis is clone RREVI 600. SEQ ID NO. 2 is the polypeptide sequence of IDI; SEQ ID NO. 4 shows the polypeptide sequence of GPPS; SEQ ID NO. 6 shows the polypeptide sequence of FPPS; SEQ ID NO. 8 shows the. polypeptide sequence of GGPPS; and SEQ ID NO. 10 is the polypeptide sequence of GGR. A comparison between the sequences of the series of enzymes obtained from the present invention and those derived from other species, obtained from the existing data, can be conducted at the nucleic acid as well as the amino acid levels. An example of the comparison of sequences is further detailed in Example 5.
Another embodiment of the present invention is a recombinant gene construct comprising a polynucleotide template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9, and a promoter region operably-linked to enhance expression of the polynucleotide template; wherein the polynucleotide template is expressible in a host cell to produce an enzyme which catalyzes biosynthesis, conversion or utilization of prenyl- pyrophosphate for rubber biosynthesis. Accordingly, a chimeric gene, in combination of two or more gene constructs having nucleotide sequence as set forth in the preceding description can be provided. The chimeric gene can be applied for the process of transformation at a later stage to obtain a transformed cell with desired genetic properties.
Still another embodiment of the present invention is a transformant comprising a recombinant gene construct capable of overexpressing a polynucleotide . template having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 to produce an enzyme which catalyzes biosynthesis, conversion or utilization of prenyl-pyrophosphate for rubber biosynthesis. Preferably, the transformation of H. brasiliensis can be mediated by a microorganism by co-cultivation method.
According to yet another embodiment of the present invention, a transgenic plant of H. brasiliensis with enhanced biosynthesis and accumulation of polyisoprenoids is provided, wherein the transgenic plant comprises a recombinant gene construct having an expressible nucleotide sequence set forth in SEQ ID NO. 1 , SEQ ED NO. 3, SEQ ID NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9. Another embodiment of the present invention discloses a method for enhancing biosynthesis and accumulation of polyisoprenoids comprising the steps of cloning a gene construct having nucleotide sequence set forth in SEQ ID NO. 1, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5 and expressing the gene construct in a host cell. Example 7 and 9 show the overexpression processes for the target gene or chimeric gene encoding the selected enzymes towards the - development of a transgenic plant of H. brasiliensis in vitro cell line leading to enhanced accumulation of poly-isoprenoids or natural rubber. According to the preferred embodiment of the present invention, the processes involved include construction of a gene cassette containing one or more target genes, such as FPPS, and GPPS with GGPPS. Southern hybridization or PCR amplification using a specific probe and primers are conducted to confirm the insertion of copies of the transgene. Northern blot of RNA can then be conducted and RNA are then analysed. Overexpression of the recombinant protein can then be performed and the purified protein raised can be analysed by Western blot. The quality and quantity of the transformed H. brasiliensis seedlings can be determined by biochemical characterization.
In accordance with another embodiment of the present invention, a method for catalyzing biosynthesis, conversion or utilization of prenyl-pyrophosphate for enhancing the biosynthesis of natural rubber from its precursors is also provided, wherein the method comprises the step of introducing an isolated polypeptide having amino acid sequence set forth in SEQ ID NO. 2, SEQ ID NO. 4, SEQ ID NO. 6, SEQ ID NO. 8, SEQ ID NO. 10 or SEQ ID NO. 12 into a plant cell in vitro. Another further embodiment of the present invention is a method for enhancing accumulation of prenyl -pyrophosphate in the plant of H. brasiliensis, comprising the step of down-regulating expression of a nucleic acid template containing at least one nucleotide sequence set forth in SEQ ED NO. 1 , SEQ ED NO. 3, SEQ ED NO. 5, SEQ ID NO. 7 or SEQ ID NO. 9 in at least one cell. Preferably, the prenyl-pyrophosphate is IPP, DMAPP, GPP, FPP or GGPP
According to the preferred embodiment of the present invention, accumulation of these prenyl -pyrophosphates can be applied for regulating the biosynthesis process of any of the involving metabolites. The method of down-regulation of the target gene can be applied towards development of a transgenic H. brasiliensis in vitro cell line with enhanced accumulation of EPP and a reduced conversion into DMAP or a transgenic H. brasiliensis in vitro cell line which is rich in tocopherols (antioxidants) and pigments (chlorophyll, carotenoids). Such down-regulating processes are further detailed in Example 6 and 8.
In accordance with another preferred embodiment of the present invention, an antisense inhibitory system can be applied for regulating the biosynthesis, conversion and utilization processes of any of the prenyl-pyrophosphates, IPP, DMAPP, GPP, FPP or GGPP, depending on the desired purpose to be achieved. Accordingly, the down- regulating step of the preceding embodiment is conducted by transforming the cell with a recombinant gene construct encoding open reading frame containing nucleotide sequence which is at least 70% identical to SEQ ID NO. l, SEQ ED NO. 2, SEQ ED NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5 and expressing the nucleotide sequence of the gene construct under expression control of a rubber polymerization-associated promoter.
The open reading frame containing nucleotide sequence which is at least 70% identical to SEQ ED NO.l, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ED NO. 4 or SEQ ID NO. 5 allows generation of an antisense mRNA which hybridizes to the complementary mRNA having nucleotide sequence set forth in SEQ ED NO. l, SEQ ID NO. 2, SEQ ID NO. 3, SEQ ID NO. 4 or SEQ ID NO. 5, and thus preventing the transcription process of any of the . series of prenyl-pyrophosphate biosynthesis, conversion or utilization-associated enzymes, including EDI, GPPS, FPPS, GGPPS and GGR. It is preferably for the expression of the antisense mRNA in the present invention to be initiated by the rubber polymerization-associated promoter located at upper stream of the open reading frame. This rubber polymerization-associated promoter can serve as a regulatory mechanism to control expression of the antisense RNA so that only the specific cell types could be signaled to produce rubber. Tissue- specific promoters is also preferably used to drive the expression of the recombinant gene construct in the plant, so that the desired events can be limited to only the rubber producing tissues or cells, thus preventing the disruption of other physiological pathways in the transgenic plant. The transformed genes could then be stably inherited over generations in the genetically modified plant of H. brasiliensis . The present disclosure includes as contained in the appended claims, as well as that of the foregoing description. Although this invention has been described in its preferred form with a degree of particularity, it is understood that the present disclosure of the preferred form has been made only by way of example and that numerous changes in the details of construction and the combination and arrangements of parts may be resorted to without departing from the scope of the invention.
EXAMPLE
Examples are provided below to illustrate different aspects and embodiments of the present invention. These examples are not intended in any way to limit the disclosed invention, which is limited only by the claims.
Example 1 Designing and synthesis of primers
The primers used in the present invention were either designed from the manually curated "transcriptome" and the "gene models" predicted from the genomic sequences of H. brasiliensis RREVI 600, by choosing the sequences manually with complete ORFs or using databases where similar genes have been successfully isolated from other plants. Comparative and bioinformatic analyses of the nucleotide sequences obtained from transcriptome were carried out online using BLAST search, such as BLASTP, RPS-BLAST, BLASTX and PSI-BLAST, to identify homologues of the related genes and for the proper identification of gene. Besides, nucleotide sequence alignments .were performed using Clustai W version 1.82 whenever multiple sequences were found from the "gene pool". The alignment was edited. Gene-specific primers (both forward and reverse) were selected manually or through Primer 3 plus Web tool through consensus from highly conserved sequences and the primers were custom-synthesized. All oligonucleotides used in the present invention were synthesized and high performance liquid chromatography (HPLC)-purified by the supplier and procured commercially. Stock solutions of 100 pmol were prepared in autoclaved ddH 2 0 and stored at -20°C, in aliquots for use. Table 1 depicts the primers used in the present invention and the rationale for their synthesis.
Table 1
No Gene Primers T m Amplicon
Name Sizes (bp)
1 IDI 5'- ATGGGTGATGCTCCTGATACT -3' 55.5 705
5'· - TCAGGTTAACTTGTGAATCGTTTT-3' 53.1
2 GPPS 5'- ATGTCCGTTTCAGGCAATTC-3' 58.3 921
5'- • TCAATTCAACTCTAAAACACTGAAA-3' 52.5
3 FPPS 5'- - ATGGCGGATCTGAAGTCAAC-3 ' • 55 1029
5'- TTCTTTTTATTTCTGTCTCTTGTA AATTT-3 ' 50.9
4 GGPPS 5'- ATGTCCGTTTCAGGCAATTC-3' 53.5 921
5'- TCAATTCAACTCTAAAACACTGAAA-3 ' 51.3
5 GGR 5'- - ATGACTTCCTCCATCGCCTT-3 ' 56.1 . 1416
5'- - TCATACGCTAAGCTTGTTCATCTC-3' 54.8 '
Example 2 Pathway re-construction showcasing biosynthesis, conversion and utilization of prenyl-pyrophosphates in rubber
Automatic metabolic pathway reconstruction was done by identifying orthologs for predicted rubber proteins in Arabidopsis genome and sequence orthologs. Enzymatic reactions encoded within rubber genome involved in biosynthesis, conversion and utilization of prenyl-pyrophosphates (isoprenoid intermediate pools) were constructed out of 566 enzymatic reactions available in Resnet-Plant 3.0 database for Pathway Studio and from metabolic pathway databases (MPW).
Example 3 Amplification, cloning and sequencing of EDI, GPPS, FPPS, GGPPS & GGR from H. brasiliensis RRIM 600
Total RNA was isolated from young leaves of matured fully grown H. brasiliensis RR 600 using QIAGEN-RNeasy Mini Kit following the manufacturer's instructions. The quality as well as quantity was checked by Agarose gel electrophoresis and Thermo Scientific Nano Drop 2000™ (Thermo Scientific- Agilent's). cDNA first strand .was synthesized using Superscript© VELO™ cDNA Synthesis Kit (Invitrogen) according to the manufacturer's instructions. The genes were amplified from the cDNA by PCR using primers and conditions as designated in Table 1. The PCR reaction mixture (50 μΐ-) contained Ιμί, of cDNA, 20 pmoles of each primer, 5 of lOX Pfu Buffer, 5 μΐ, of 2.5 mM dNTP mix and 2.5 units of Pfu Turbo® DNA polymerase (Stratagene). PCR was carried out in Veriti™ Thermal Cycler (Applied Biosystems) using the following conditions: Initial denaturation for 5 min at 94°C followed by 35 cycles of denaturation at 94°C for 30 sec, annealing at 50°C for 30 sec and extension at 72°C for 1 min/ kbp, with a final extension at 72°C for 7 min. The PCR product was analysed by 1 % agarose gel, and the electrophoresed gels with amplicons of each gene of IDI, GPPS, FPPS, GGPPS and GGR, were respectively shown in Figure 11, 13, 15, 17 and 19. Subsequently, the amplicons were respectively eluted from the gels using GENE CLEAN® TURBO gel band elution kit (MP Biomedicals) according to the manufacturer's instructions. The purified PCR products were ligated into pJET 1.2 Blunt Vector (#K1232, Fermentas) and was transformed into One Shot® Machl™-T1R Chemically Competent Escherichia coli cells (Invitrogen). Plasmids were isolated from putative colonies using QIAprep Spin® Miniprep Kit (Qiagen) according to the manufacturer's instructions.
Example 4 Plasmid isolation and restriction digestion for confirmation of clones
Recombinant colonies were cultured and small-scale preparation (mini-preps) of plasmid DNA was performed by the Spin Miniprep kit (Qiagen) as per the protocol supplied by the manufacturer. To select positive recombinant colonies, after ligation and transformation, individual colonies were picked up with a sterile tip into 10 of sterile water and heated at 95°C for 20 min for lysis of cells and subsequent amplification of insert DNA by PCR. Presence of insert within the plasmid was reconfirmed with insert flanking restriction enzymes. The presence of the insert was checked by digesting the vector, pJET 1.2 (Fermentas) harbouring inserts with Bgl II (Fermentas) and positive plasmids were subjected to sequencing, in triplicates. The digested and undigested recombinant plasmids were separated on a 0.8-1.5 % agarose gel to identify the correct inserts. Figures 12, 14, 16, 18 and 20 respectively show the restriction digestion patterns as well as inserts of DDI, GPPS, FPPS, GGPPS and GGR. Subsequently, clones were sequenced using vector specific standard M13/pUC universal primers or pJET 1.2 Forward Sequencing Primer [23-mer, 5'- CGACTCACTATAGGGAGAGCGGC-3'] and pJET 1.2 Reverse Sequencing Primer [24-mer, 5 ' - AAGAACATCG ATTTTCC ATGGC AG-3 ' ] , supplied by the manufacturers (Fermentas) for sequencing. Automated dye terminator cycle sequencing was done using the ABI BigDye™ (fluorescence-labelled dideoxynucleotide termination method) Terminator Cycle Sequencing Ready reaction kit (Applied Biosystems, USA) in an ABI 3730x1 DNA sequencer (Applied Biosystems, USA) following manufacturer's instructions. Sequences were visualized ' and analysed using Chromas LiteTM version 2.01 software or BioEdit Tool (Version 7.0.8) which is available in the website. Glycerol stocks [i.e., 0.5 ml of sterilized { 65 % glycerol (v/v), 0.1 M MgS04, 25 mM Tris- HC1, pH 8 } and 0.75 ml of culture volume; pipette-mixed] of positive clone harbouring cells from mid log phase were stored in aliquots in sterile cryo vials and Eppendorf micro centrifuge tubes in -80°C for future use.
Example 5 Comparison with other plant sequences
The HbDDI has a theoretical mol. wt. of 26.821 kDa and pi of 5.13 with a myristylation modification site. SMART analysis reveals the presence of a Pfam domain, i.e., 'NUDIX' [52-197 aa, E value- 4.2e-21 ], with . pBLAST matches with PDB: 21CK: A [1-233 aa, E value-0] and SCOP: d lgOsa [199-377 aa, E-value- 2e- 25]. The comparison result shows sequence identities with EDI from H. brasiliensis (AB294697, 99%; AB294696, 92%; AF111843, 92%; AFl 1 1842, 92%), Ricinus communis (XM_002514802, 89%), Camptotheca acuminata (AF031080, 83%), Eucomia ulmoides (AB041629, 82%), Jatwpha curcas (GQ386928, 89%), Sapium sebiferum (AB049931, 92%), Lactuca sativa (AF188063, 79%) and others at the nucleotide levels. The conserved domain database (CDD) classifies the protein as a Nudix_Hydrolase superfamily protein, with characteristic IDI-multi domains, presence of metal binding sites, active sites and nudix motifs. At protein levels, HblDI shows identities to IDI from H. brasiliensis (BAF98287, 99%; BAF98286, 90%, AF1 1 1842, 90%), R. communis (EEF47402, 97%), Corylus avellena (ABW06959, 90%), Gossypium barbadense (ABI94388, 88%), Populus trichocarpa (ACD70403, 92%), Pueraria Montana (AAQ84167, 90%), Nicotiana tabac m (BAB40974, 89%), Clarkia brewe (AAB67743, 88%) and others.
Whilst, the HbGPPS has a theoretical mol. wt. of 33.586 kDa and pi of 6.37 with glycosylation and myristylation modification sites. SMART analysis reveals the presence of a Pfam domain, i.e., 'polyprenyl_synth' [67-305 aa, E value- 6.5e-06], with pBLAST matches with PDB: 2J 10: A [46-262 aa, E value-0] and SCOP: dluby [47-254 aa, E-value- 2e-16]. The CDD classifies the protein as an Isoprenoid_Biosyn_C l superfamily protein. The comparison result shows sequence identities with GPPS from H. brasiliensis (AB294711, 99%), R. communis (XM_002532524, 77%) and others at the nucleotide levels. At protein levels, HbGPPS shows identities to GPPS from H. brasiliensis (BAF98300, 99%), R. communis (EEF29831, 62%), Antirrhinum majus (AAS82859, 52%), Humulus lupulus (ACQ90681, 50%), Mentha piperita (AAF08792, 48%), Glycine max (ABY90133, 49%), C. breweri (AAS82870, 48 %) and others.
On the other hand, the HbFPPS has a theoretical mol. wt. of 40.415 kDa and pi of 5.81 with glycosylation and myristylation modification sites, as the characteristic polyprenoid synthase motifs, DDXXD, inclusive of the FARM and the SARM motifs. SMART analysis reveals the presence of a Pfam domain, i.e., 'polyprenyl_synth', with pBLAST matches with best matches from SAM PNT [17-107 aa, 1.68e+03], TSPN [93-238 aa, 1.37e+3], RBD [113- 188 aa, 2.08e+3] and others. The CDD classifies the protein as a Isoprenoid_Biosyn_Cl superfamily protein and a Trans_rPPS_HT, with characteristic, substrate binding pocket for GPP, a Mg 2+ binding site, a chain length determination region, the responsible catalytic residues and the two aspartate rich regions (FARM and SARM). The comparison result shows sequence identities with FPPS from H. brasiliensis (AY349419, AY135188, Z49786, AB294712, 99%), R. communis (XM_002534292, 91 %), Euphorbia pekinensis (FJ755465, 87%), Glycyrrhiza uralensis (GQ214505, 84%), Lupinus albus (LAU15777, 83%), Malus domestica (AY083165, 83%), Medicago sativa (GU361537, 82%), G. max (AK245850, 81 %) at the nucleotide levels. At protein levels, HbFPPS shows identities to FPPS from H. brasiliensis (AAM98379, BAF98301 , ABR09548, 99%), E. pekinensis (ACN63187, 89%), G. uralensis (ADE18770, 89%), Lupinus albus (AAA86687, 88%), Medicago sativa (ADC32809, 87%), Salvia miltiorrhiza (ABV08819, 85%), Gossypium arboretum (CAA72793, &5%), Aquilaria microcarpa (ADH95 185, 86%) and others. As for the HbGGPPS, it has a theoretical mol. wt. of 33.705 kDa and pi of 5. U with myristylation modification sites, as the characteristic polyprenoid synthase motif, i.e., DDXXD. SMART analysis reveals the presence of a Pfam domain, i.e., 'polyprenyLsynth' [41-296 aa, 1.2e-37], with pBLAST matches with best matches from PDB: 2J1P [5-298aa, 0] and the SCOPI: dluby [24-279 aa, 4e-41] etc. The comparison result shows sequence identities with GGPPS from H. brasiliensis (AB294714, 99%) and R. communis (XM_002529756, 86%) at the nucleotide levels. The CDD classifies the protein as a Isoprenoid_Biosyn_Cl superfamily protein and a Trans_EPPS_HT, with characteristic, substrate binding pocket for FPP, a Mg 2+ binding site, a chain length determination region, the responsible catalytic residues and the two aspartate rich regions (FARM and SARM). At protein levels, HbGGPPS shows identities to GGPPS from H. brasiliensis (BAF98303, 99%), R. communis (EEF32584, 85%), Solanum pennellii (ADZ24721 , . 77%), Arabidopsis thaliana (AAG41488, 66%), Zea mays (ABQ85649, 56%), Oryza sativa (BAG94618, 55%), Taxus media (AAS49033, 47%), Picea abies (ACZ57571, 46%), Abies grandis (AAL17614, 45%), Picea sitchensis (ACA21461, 45%) and others.
The last enzyme, HbGGR has a theoretical mol. wt. of 51.895 kDa and pi of 9.04 with myristylation and amidation modification sites. SMART analysis reveals the presence of a Pfam domain, i.e., 'FAD_binding_3' [55-378 aa, 1.5e-04], with pBLAST matches with best matches from the SCOP: dlfoha5 [56-433 aa, 2e-42] etc. The comparison result shows sequence identities with GGR from H. brasiliensis (AB 376090, 99%), R. communis (XM_002514703, 84%), P. trichocarpa (EF147670, 82%), Prunus persica (AY230212, 81%), Brassica rapa (DQ886527, 79%), Silene latifolia (AJ697654, 78%), Matoniella squamata (FJ175676, 80%) at the nucleotide levels. The CDD classifies the protein as a Pyr_redox superfamily protein. At protein levels, HbGGR shows identities to GGR from H. brasiliensis (ΒΑΗ10639, 99%), R. communis (EEF47855, 90%), G. max (AAD28640, 84%), N. tabacum (CAA07683, 84%), Lotus japonicas (AAY52460, 83%), Medicago truncatula (AAX63898, 83%), B. rapa (ABI63587, 83%), Sesamwn indicum (ADK35887, 83%), A. thaliana (CAA74372, 82%) and others. Example 6 Down regulation of HbGGR towards development of a transgenic H. brasiliensis in vitro cell line rich in tocopherols (antioxidants) and pigments (chlorophyll, carotenoids) by anti-sense approach
Initially, the construction of a GGR antisense gene, followed by the transformation of H. brasiliensis were carried out. The full-length cDNA sequence was cut out of the vector with appropriate restriction enzymes and ligated into the multiple cloning site (MCS) of the plant binary vector BinAR, which was a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis embryogenic calli was mediated by Agrobacterium tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using a GGR-specific probe and oligonucleotide primers. Total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [ 32 P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging plates (Fuji Film, Tokyo) and analysed. Equal loading of samples was controlled by rehybridizing the RNA filter with a cDNA probe for 18S rRNA. Two oligonucleotide primers were designed to amplify the coding sequences of GGR and the resultant PCR fragment was cloned into the MCS of the expression vector pQE 60 (Qiagen). Overexpression of recombinant GGR protein was performed in E. coli XL- 1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from H. brasiliensis tissues were quantified and 10 μg protein aliquots were analysed by western blot with the anti-GGR antiserum using an immunoblotting kit (ECL, Amersham). Biochemical characterization of transformed H. brasiliensis seedlings. Levels of carotenoids, xanthophylls, chlorophylls, tocopherols were characterized by spectrophotometry, TLC, HPLC and LC -MS/MS approaches.
Example 7 Overexpression of HbFPPS towards development of a transgenic H. brasiliensis in vitro cell line leading to enhanced accumulation of poly- isoprenoids or rubber
The full-length FPPS cDNA sequence was cut out of the vector with appropriate restriction enzymes and li gated into the MCS of the plant binary vector BinAR, which was a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis embryogenic calli was mediated by A. tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using a FPPS -specific probe and oligonucleotide primers. Total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 ng of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [ 32 P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging : plates (Fuji Film, Tokyo) and analysed. Equal loading of samples was controlled by rehybridizing the RNA filter with a cDNA probe for 18S rRNA. Two oligonucleotide primers were designed to amplify the coding sequences of FPPS and the resultant PCR fragment was. cloned into the MCS of the expression vector pQE 60 (Qiagen). Overexpression of recombinant FPPS protein was performed in Escherichia coli XL-1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from H. brasiliensis tissues were quantified and 10 x.g protein aliquots were analysed by western blot with the anti-GGR antiserum using an immunoblotting kit (ECL, Amersham). Increment in FPP levels within the cell was measured by TLC or HPLC analysis. Levels of accumulated rubber, towards quantification of quality (rubber particle size) and quantities (in mg/ DW g cell basis) were determined by HPLC/C 13-NMR analysis.
Example 8 Anti-sense mediated silencing of HblDI towards development of a transgenic H. brasiliensis in vitro cell line leading to enhanced accumulation of IPP (isopentenyl pyrophosphate) and a reduced conversion into DMAPP
The full-length IDI cDNA sequence was cut out of the vector with appropriate restriction enzymes and ligated into the MCS of the plant binary vector BinAR, which was a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis embryogenic call! was mediated by Λ. tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance of regenerated explants and by genomic Southern hybridization or PCR amplification using an IDI-specific probe and oligonucleotide primers. Total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [ 2 P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging plates (Fuji Film, Tokyo) and analysed. Equal loading of samples was controlled by rehybridizing the RNA filter with a cDNA probe for 18S rRNA. Two oligonucleotide primers were designed to amplify the coding sequences of EDI and the resultant PCR fragment was cloned into the A and B sites of the expression vector pQE 60 (Qiagen). Overexpression of recombinant EDI protein was performed in E. coli XL- 1 Blue strain. The protein was purified by metal chelate affinity chromatography and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from H. brasiliensis tissues were quantified and 10^g protein aliquots were analysed by Western blot with the .anti-EDI antiserum using an immunoblotting kit (ECL, Amersham). Increment in EPP levels and the concomitant decreasing or affected levels of DMAPP within the cell was measured by TLC or HPLC analysis. Levels of accumulated rubber, towards quantification of quality (rubber particle size) and quantities (in mg/ DW g cell basis) were determined by HPLC/C -NMR analysis.
Example 9 Overexpression of HbGPPS and HbGGPPS towards development of a transgenic H. brasiliensis in vitro cell line leading to enhanced accumulation of polyisoprenoids or rubber
The full-length GPPS and GGPPS cDNA sequences were cut out of the vector MultiSite Gateway®. Pro 2.0 Kit for 2-fragment recombination [Invitrogen, Catalogue No. 12537-102] with appropriate restriction enzymes and ligated into the MCS of the plant binary vector BinAR, which was a pBIB derivative containing the cauliflower mosaic virus 35S promoter. The transformation of H. brasiliensis embryogenic calli was mediated by A. tumefaciens by co-cultivation method. The insertion of copies of the transgene was confirmed by kanamycin resistance ofregenerated explants and by genomic Southern hybridization or PCR amplification using a GPPS- and GGPPS -specific probe and oligonucleotide primers. Total RNA was isolated using RNeasy Plant RNA Minikit following the manufacturer's instructions (Qiagen). Aliquots of 10 μg of RNA were blotted onto nylon membranes (Hybond N, Amersham) and hybridized with [ 2 P] dCTP using the nick-translation method. Hybridized filters were exposed to phosphor-imaging plates (Fuji Film, Tokyo) and analysed. Equal loading of samples was controlled by rehybridizing the RNA filter with a cDNA probe for 18S rRNA. Two oligonucleotide primers were designed to amplify the coding sequences of GPPS and GGPPS and the resultant PCR fragments were cloned into the A and B sites of the expression vector pQE 60 (Qiagen), independently. Overexpression of recombinant GPPS, and GGPPS proteins were performed in E. coli XL-1 Blue and BL-21 strain. The protein was purified by metal chelate affinity chromatography, and used for immunization of rabbits. Antiserum was collected after triple injection of the antigen. The soluble protein fractions from H. brasiliensis tissues were quantified and 10 μg protein aliquots were analysed by western blot with the anti-EDI antiserum using an immunoblotting kit (ECL, Amersham). Biochemical characterization of transformed H. brasiliensis RREvl 600 cell lines. Increment in GPP and GGPP levels within the cell was measured by TLC or HPLC analysis. Levels of accumulated rubber, towards quantification of quality (rubber particle size) and quantities (in mg/ DW g cell basis) were determined by HPLC/Cu-NMR analysis.
Next Patent: METHOD FOR PRODUCING FIBREBOARDS UTILIZING PALM BIOMASS