Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHOD OF SCREENING FOR COMPOUNDS THAT CAN BE USED FOR THE TREATMENT OF RESPIRATORY CONDITIONS
Document Type and Number:
WIPO Patent Application WO/2009/080910
Kind Code:
A2
Abstract:
The present invention relates to the use of a screening method for identifying candidate molecules that can be used for the treatment of respiratory conditions in a mammal, wherein said screening method comprises a step which comprises determining whether the functional activity of a TASK-2 polypeptide in the presence of a test molecule is decreased or eliminated compared with the functional activity of said TASK-2 polypeptide in the absence of said test molecule, the test molecule being considered to be a candidate molecule when it decreases or eliminates said functional activity.

Inventors:
UNIVERSITE PAUL CEZANNE MARSEI (FR)
BARHANIN JACQUES (FR)
GESTREAU CHRISTIAN (FR)
WARTH RICHARD (DE)
HEITZMANN DIRK (DE)
THOMAS JOERG (DE)
Application Number:
PCT/FR2008/001391
Publication Date:
July 02, 2009
Filing Date:
October 03, 2008
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
CENTRE NAT RECH SCIENT (FR)
UNIVERSITE PAUL CEZANNE MARSEI (FR)
BARHANIN JACQUES (FR)
GESTREAU CHRISTIAN (FR)
WARTH RICHARD (DE)
HEITZMANN DIRK (DE)
THOMAS JOERG (DE)
International Classes:
G01N33/68; C12Q1/02
Domestic Patent References:
WO2005054867A22005-06-16
Other References:
NIEMEYER M I ET AL: "Modulation of the two-pore domain acid-sensitive K+ channel TASK-2 (KCNK5) by changes in cell volume." THE JOURNAL OF BIOLOGICAL CHEMISTRY, vol. 276, no. 46, 16 novembre 2001 (2001-11-16), pages 43166-43174, XP009100818 ISSN: 0021-9258
GABRIEL ANJA ET AL: "Localization of the tandem pore domain K+ channel KCNK5 (TASK-2) in the rat central nervous system." BRAIN RESEARCH. MOLECULAR BRAIN RESEARCH, vol. 98, no. 1-2, 31 janvier 2002 (2002-01-31), pages 153-163, XP2329398 Netherlands (09-12-2001: on-line) ISSN: 0169-328X DOI: 10.1016/S0169-328X(01)00330-8
Attorney, Agent or Firm:
NOVAGRAAF TECHNOLOGIES (Levallois-Perret Cedex, FR)
Download PDF:
Claims:

REVENDICATIONS

1. Utilisation d'un procédé de criblage pour l'identification de molécules candidates pour Ie traitement de troubles respiratoires dus à un dysfonctionnement du système nerveux central chez un mammifère, ledit procédé de criblage comprenant une étape consistant à déterminer si l'activité fonctionnelle d'un polypeptide canal ionique TASK-2 en présence d'une molécule test est diminuée ou supprimée par rapport à l'activité fonctionnelle dudit canal ionique TASK-2 en l'absence de ladite molécule test, la molécule test étant considérée comme étant une molécule candidate lorsqu'elle diminue ou supprime ladite activité fonctionnelle.

2. Utilisation selon la revendication 1 , dans laquelle l'étape consistant à déterminer si l'activité fonctionnelle du polypeptide TASK-2 est diminuée ou supprimée comprend : i) une mise en contact d'une cellule exprimant un polypeptide TASK-2 présentant une activité fonctionnelle, avec ladite molécule test, et ii) une mesure de l'activité fonctionnelle du polypeptide TASK-2 et/ou de son expression en présence de ladite molécule test.

3. Utilisation selon la revendication 2, dans laquelle ladite cellule exprime le polypeptide TASK-2 de manière endogène.

4. Utilisation la revendication 3, dans laquelle ladite cellule exprime le polypeptide TASK-2 sous forme recombinante.

5. Utilisation selon l'une quelconque des revendications 1 à 4, dans laquelle ladite activité fonctionnelle est déterminée par une mesure choisie dans le groupe comprenant : une mesure du courant ionique traversant le polypeptide TASK-2, une mesure du changement du potentiel

membranaire de la cellule exprimant le polypeptide TASK-2, une mesure du changement de la concentration ionique intracellulaire de la cellule exprimant le polypeptide TASK-2.

6. Utilisation selon la revendication 5, dans laquelle ladite activité fonctionnelle est déterminée par mesure du courant ionique traversant le polypeptide TASK-2, et dans laquelle le courant ionique traversant le polypeptide TASK-2 est un efflux d'ions rubidium.

7. Utilisation selon l'une quelconque des revendications 1 à

6, pour l'identification de molécules utilisables pour le traitement de troubles respiratoires dus à un dysfonctionnement du système nerveux central choisis dans le groupe comprenant le syndrome des apnées du sommeil, les formes respiratoires du syndrome de mort subite du nourrisson, les modèles de respiration pathologique due à l'altitude.

Description:

PROCéDé DE CRIBLAGE DE COMPOSéS UTILISABLES POUR LE TRAITEMENT DE TROUBLES RESPIRATOIRES

Domaine technique de l'invention

[1] La présente invention se rapporte à l'utilisation d'un procédé de criblage de composés pour le traitement de troubles respiratoires chez un mammifère. Elle trouve notamment une application dans l'identification de nouvelles molécules candidates pour le traitement des troubles respiratoires.

[2] Dans la description ci-dessous, les références entre parenthèses (Réf) renvoient à la liste des références présentée après les exemples.

Art antérieur [3] L'adaptation centrale de la respiration aux besoins physiologiques est un phénomène chémosensible qui passe par des modifications de l'activité électrique de neurones spécialisés situés majoritairement dans le tronc cérébral. Ces neurones respiratoires ce répartissent en petits groupes formant des colonnes dans le tronc cérébral qui s'étendent de la partie ventrolatérale du bulbe rachidien caudal à la partie dorsolatérale de la protubérance annulaire (Richter DW, Spyer KM (2001) « Studying rhythmogenesis of breathing : comparison of in vivo and in vitro models ». Trends Neurosci, 24, 464-472 (Réf 1) et Feldman JL, DeI Negro (2006) « Looking for inspiration : new perspectives on respiratory rhythm ». Nat Rev Neurosci, 7, 232-242. (Ref 2)). Il n'est donc pas surprenant que des déficiences de canaux ioniques soient impliquées dans des physiopathologies respiratoires, par exemple liées à un séjour prolongé en altitude, ou à différentes maladies comme le syndrome de l'apnée du sommeil et le syndrome de la mort subite du nourrisson.

[4] Chez les mammifères, la respiration est régulée par trois paramètres chimiques du sang artériel :

i) l'augmentation en dioxyde de carbone, ou hypercapnie. ii) la diminution du pH sanguin, ou acidose. iii) la diminution de la concentration d'oxygène dans le sang, ou hypoxie.

[5] L'activité du réseau de neurones contrôlant la respiration est donc adaptée en fonction des différents paramètres précités (Feldman JL et al. (2003) « Breathing : rhythmicity, plasticity, chemosensivity »: Annu Rev Neurosci, 26, 239-266 (Réf 3)). [6] Les variations de ces paramètres sont mesurées grâce à des chémorécepteurs. Ces chémorécepteurs détectent les variations de pH et de pression partielle en CO 2 artériel au niveau périphérique grâce aux chémorécepteurs des corps carotidiens, et au niveau du tronc cérébral grâce aux chémorécepteurs centraux situés dans les noyaux du raphé et le noyau retrotrapézoïde (Severson et al. (2003) « Midbrainserotonergic neurons are central pH chemoreceptors ». Nat Neurosci, 6, 1139- 1140. (Réf 4)). Les signaux électriques des chémorécepteurs participent à l'adaptation de l'activité respiratoire aux besoins physiologiques de l'organisme.

[7] Parmi les pathologies liées à des défauts de la régulation de la respiration, le syndrome de l'apnée du sommeil est un véritable problème de santé publique. Ce syndrome est souvent associé à l'obésité. Par exemple, aux Etats-Unis, environ 3 millions d'hommes et 1 ,5 million de femmes souffrent du syndrome de l'apnée du sommeil. Ce syndrome pourrait avoir des conséquences négatives sur l'état de santé des personnes en souffrant, par exemple en empirant les maladies cardiovasculaires comme l'indique l'article de Namen et collaborateurs ((2002) « Increase Physician-reported sleep apnea : the National Ambulatory Médical Care Survey ». Chest 121(6) : 1741-1747 (Réf 5)).

[8] Les différentes formes d'apnée du sommeil ont en commun l'apparition durant le sommeil de pauses pathologiques dans la respiration (de plus de 10 secondes chez l'adulte, de plus de 8 secondes chez l'enfant), ce qui entraîne une hypoxie avec une alimentation en oxygène du cerveau et des tissus périphériques réduite. Les syndromes de l'apnée du sommeil ont une étiologie hétérogène et peuvent être classifiés selon les pathologies sous-jacentes probables. Par exemple, le sous-groupe des apnées obstructives du sommeil est caractérisé par une obstruction des voies respiratoires supérieures qui empêchent une ventilation correcte et efficace. Le sous-groupe des apnées centrales du sommeil est caractérisé par des défauts de la régulation de la respiration au niveau du tronc cérébral, la commande nerveuse des muscles respiratoires ne fonctionnant plus de façon transitoire. Le sous-groupe des apnées mixtes correspond à une apnée centrale suivie d'une apnée obstructive.

[9] De manière intéressante, l'une des formes centrales de l'apnée (« apnée centrale non hypercapnique ») est caractérisée par des périodes d'hyperventilation qui ont pour résultat une réduction de la concentration de dioxyde de carbone artériel appelée hypocapnie. La réduction du dioxyde de carbone, à son tour, entraîne un défaut de stimulation des centres respiratoires du tronc cérébral qui se traduit par des pauses plus longues dans la respiration, et par conséquent, provoque une réduction de la concentration de l'oxygène artériel.

[10] Apparemment, les patients souffrant de ces formes d'apnée du sommeil ont un retard dans la stimulation de la respiration induite par l'hypoxie.

[11] Plusieurs facteurs conduisant à la réduction de la stimulation de la respiration peuvent aggraver les syndromes de l'apnée du sommeil : par exemple les substances ayant un effet sur la respiration, comme l'alcool et les tranquillisants, ou un séjour à haute altitude.

[12] Actuellement, la thérapie des syndromes de l'apnée du sommeil comprend des procédures chirurgicales et des dispositifs pour établir une pression positive au niveau des voies respiratoires supérieures.

[13] Le traitement par ventilation assistée par pression positive continue par voie nasale (nCPAP) durant le sommeil est le procédé le plus efficace à ce jour pour améliorer les symptômes cliniques. Cependant, ce traitement nécessite que le patient soit connecté de manière permanente au système par l'intermédiaire d'un masque. Ainsi, le fait que la technique soit peu pratique limite son succès thérapeutique.

[14] à côté des interventions chirurgicales et du traitement nCPAP, quelques approches pharmacologiques ont été réalisées pour améliorer la respiration chez des patients souffrant d'apnée du sommeil, par exemple en utilisant de la progestérone, de la théophylline, de l'acétazolamide et de la protriptyline.

[15] Même si ces substances sont capables de stimuler la respiration au moins chez une partie des patients, aucune d'entre elles ne s'est avérée réellement efficace pour le traitement des syndromes de l'apnée du sommeil. En outre, certaines de ces substances présentent des effets secondaires importants. Ainsi, de nombreuses industries pharmaceutiques cherchent de nouvelles molécules qui permettraient de traiter le syndrome des apnées du sommeil.

[16] Des chercheurs se sont intéressés dans le passé au développement d'inhibiteurs de canaux potassiques TASK-1 qui semblent stimuler la respiration. Les canaux TASK-1 font partie d'une famille comprenant les canaux TASK 1 , TASK 2 et TASK 3. Ce sont des canaux K+ avec 4 domaines transmembranaires et deux domaines canal (canaux K2P) (Goldstein SA et al. (2005), « International Union Pharmacology. LV.

Nomemclature and molecular relationship of two-P potassium channels ». Pharmacol Rev, 57, 527-540. (Réf 6)). Ces canaux sont actifs sous Ia forme de monomères, d'hétérodimères et d'homodimères (Czirjak G, Enyedi P (2001), « Formation of functionnal heterodimers between the TASK-1 and TASK-3 two pore domain potassium channel subunits ». J Biol Chem, 277, 5426-5432. (Réf 7), voir Kang D et al. (2004), « Functionnal expression of TASK-1/TASK-3 heteromers in cérébral granule cells ». J.Physiol, 554, 64-77 (Réf 8) et Berg AP et al. (2004), « Motoneurons express heteromeric TWIK-related acid sensitive K+ (TASK) channels contanining TASK-1 (KNCK3) and TASK-3 (KNCK9) subunits ». J. Neurosci, 24, 6693-6702 (Réf 9)). Ces canaux produisent un courant K+ de inhibé par l'acidification externe et à la suite de l'activation de récepteurs couplés aux protéines G (Mathie A (2007) « Neuronal two pore domain potassium channels and their régulation by G protein coupled receptors ». J. Physiol, 578, 377-385 (Réf 10)). Ils sont activés par des anesthésiques volatiles (par exemple l'halothane, l'isoflurane) (voir Patel AJ, Honore E (2001) « Properties and modulation of mammalian 2P domain K+ channels ». Trends Neurosci, 24, 339-346 (Réf 11). [17] Les canaux TASK-1 sont abondants dans le cerveau, les glandes surrénales, les vaisseaux sanguins et le cœur. Sur la base des observations faites sur des souris « knock-out » pour TASK-1 , il a été noté que l'inactivation génétique de TASK-1 conduit à des troubles de la sécrétion d'aldostérone, à de l'hypertension artérielle et à des changements dans Pélectrocardiogramme. De plus, une hypertension pulmonaire peut également être observée. Pour ces différentes raisons, il est apparu que l'utilisation d'inhibiteurs de TASK-1 pour un traitement thérapeutique ne soit pas une solution acceptable. [18] II a été montré récemment que la chémosensibilité centrale en réponse à une hypercapnie persiste chez des souris doubles mutantes TASK1/TASK3 alors que la chémosensibilité des neurones du raphé est supprimée (Mulkey et al. (2007) « TASK channel détermine pHsensitivity in

select respiratory neurons but do not contribute to central respiratory chemosensitivity ». J Neurosci, 27, 14049-14058. (Réf 12)).

[19] Le terme « syndrome de mort subite du nourrisson » est utilisé pour les cas inexpliqués de mort des jeunes enfants et qui représente la principale cause de mortalité chez les enfants âgés d'un mois à un an.

Dans la plupart des cas, la cause de la mort n'est pas clairement identifiée, mais les troubles de la respiration semblent jouer un rôle important. Pour les enfants à risque, un système de surveillance respiratoire est disponible, mais il n'existe pas aujourd'hui de traitement pharmaceutique.

[20] A haute altitude, l'hypoxie conduit à une augmentation de la ventilation qui conduit elle-même à une réduction du dioxyde de carbone artériel (hypocapnie) et a pour conséquence une augmentation du pH artériel (alcalose respiratoire). L'alcalose respiratoire affecte la régulation de la respiration et conduit à des modes de respiration irrégulière, particulièrement pendant les phases de sommeil. Il a été montré que des substances capables d'inhiber l'alcalose respiratoire, par exemple l'acétazolamide, peuvent améliorer les modes respiratoires et les symptômes associés à la haute altitude par augmentation de l'élimination du bicarbonate par les reins, ce qui a pour conséquence la diminution du pH artériel. Toutefois, l'utilisation d'acétazolamide peut causer des effets secondaires, en perturbant par exemple l'homéostasie électrolytique.

[21] En résumé, peu de substances sont actuellement connues pour traiter ces troubles respiratoires, et celles qui sont connues sont soit insuffisamment efficaces, soit présentent des effets secondaires négatifs qui limitent leur utilisation pour des traitements dans la durée. En outre, les chercheurs ne disposent pas de suffisamment de moyens pour mettre en évidence de nouvelles substances candidates pour le traitement des troubles respiratoires.

[22] II existe donc un réel besoin de nouveaux moyens permettant d'identifier de nouvelles molécules candidates pour le traitement des troubles respiratoires.

Exposé de l'invention

[23] La présente invention répond précisément au besoin précité en fournissant un procédé de criblage pour l'identification de molécules candidates pour le traitement de troubles respiratoires chez un mammifère, ledit procédé de criblage comprenant une étape consistant à déterminer si l'activité fonctionnelle d'un polypeptide canal ionique TASK-2 (KCNK5) en présence d'une molécule test est diminuée ou supprimée par rapport à l'activité fonctionnelle dudit canal ionique TASK-2 en l'absence de ladite molécule test.

[24] S'il est déterminé que l'activité de TASK-2 est diminuée ou supprimée lors de la mise en œuvre du procédé de l'invention, alors la molécule test est considérée comme une molécule candidate pour le traitement de troubles respiratoires chez un mammifère.

[25] Les inventeurs de la présente invention sont en effet les premiers à avoir mis en évidence que les canaux TASK-2, également nommés KCNK5, sont présents dans certaines régions des centres respiratoires du tronc cérébral et jouent de manière surprenante un rôle dans la respiration. Des expériences in vitro sur une préparation de tronc cérébral provenant de souris nouveaux-nés, présentent une forte diminution de l'activité respiratoire lors d'une anoxie. Cette diminution n'est plus observée sur des préparations de tronc cérébral provenant de souris invalidées pour le canal TASK-2. L'inhibition ou l'absence de TASK-2 protège donc contre l'anoxie. Ces données indiquent que l'expression de ces canaux au niveau de certains neurones est directement ou indirectement associée à la chémoréception.

[26] Les inventeurs de la présente invention ont en outre démontré l'expression de ces canaux TASK-2 au niveau de certains neurones connus pour être directement ou indirectement associée à la chémoréception.

[27] Les inventeurs ont montré par ailleurs que les souris mutantes invalidées pour le canal TASK-2 inactifs (« knock-out » TASK-2) présentent un remarquable maintien de la respiration au cours d'une hypoxie, contrairement aux souris de type sauvage qui présentent une forte dépression respiratoire. Ces résultats démontrent que chez la souris en condition in vivo l'inactivation des canaux TASK-2 modifie profondément la réponse ventilatoire à l'hypoxie et résulte en une stimulation de la respiration.

[28] De manière intéressante, il a été mis en évidence à partir d'un système de culture cellulaire in vitro que l'expression de TASK-2 est réduite après plusieurs heures d'hypoxie due à la sensibilité à l'hypoxie du promoteur TASK-2 (Brazier et al. (2005) « Cloning of the human TASK-2 (KCNK5) promoter and its régulation by chronic hypoxia ». Biochem Biophys Res Commun 336 :1251-1258 (Réf 13)).

[29] Ainsi, l'adaptation à l'hypoxie (par exemple lors d'un séjour à haute altitude), peut inclure un mécanisme de défense du corps par réduction de l'expression des canaux TASK-2. Cependant, cette adaptation physiologique nécessite probablement plusieurs heures et ne fonctionne pas pour une réponse immédiate à une hypoxie à court terme.

[30] Dans ces cas d'hypoxie à court terme, l'inactivation pharmacologique de TASK-2 peut permettre d'anticiper les mécanismes de défense de régulation négative de l'expression de TASK-2.

[31] En outre, contrairement aux canaux TASK-1 et TASK-3, qui sont probablement eux aussi impliqués dans la régulation de la respiration du fait de leur expression dans de multiples groupes de neurones respiratoires chémosensibles (Sirois et al. (2000) « The TASK-1 two-pore domain K+ channel is a molecular substrate for neuronal effects of inhalation anesthesic ». J. Neurosci, 20, 6347-6354 (Réf 14)), l'expression de TASK-2 dans le système nerveux central est extrêmement faible et limitée à des groupes restreints de neurones des circuits de la respiration (Reyes R et al. (1998) « Cloning and expression of a novel pH-sensitive two pore domain K+ channel from human kidney ». J. Biol Chem, 273, 30863-30869 (Réf 15)). De plus, TASK-2 n'est pas ou très faiblement exprimé dans le cœur où TASK-1 est très fortement exprimé. Ainsi, l'expression très limitée de TASK-2 dans Ie système nerveux central et son absence virtuelle dans le cœur constitue un énorme avantage pour l'inhibition spécifique de TASK-2.

[32] La séquence peptidique de TASK-2, son organisation au niveau des membranes cellulaires et le gène codant sont décrits dans WO 00/27871 (PCTYI B99/01886 - appartenant au CNRS, déposée le 9 novembre 1999 et publiée le 18 mai 2000). Ce document décrit également la distribution cellulaire de TASK-2 chez l'humain et chez la souris, la distribution d'ARNm TASK-2 dans le rein adulte, la carte chromosomique de TASK-2, l'expression de TASK-2 dans des cellules COS transfectées et dans des ovocytes de xenope, la sensibilité des courants de TASK-2 au pH, ainsi que la régulation de TASK-2 en fonction du pH, ainsi que les propriétés biophysiques et pharmacologiques de TASK-2. Ces éléments sont utilisables dans la présente pour comprendre et mettre en œuvre la présente invention.

[33] On entend par « troubles respiratoires » des insuffisances respiratoires dues à un dysfonctionnement du système nerveux central, en

particulier toute insuffisance respiratoire liée à un défaut de fonctionnement des centres respiratoires cérébraux situés au niveau du tronc cérébral.

[34] Parmi les troubles respiratoires, on peut citer, sans s'y limiter : le syndrome des apnées du sommeil, les formes respiratoires du syndrome de mort subite du nourrisson, les modèles de respiration pathologique due à l'altitude, le syndrome d'Ondine ou syndrome d'hypoventilation alvéolaire congénitale, les troubles dus à une intoxication accidentelle ou volontaire par un médicament (par exemple par absorption de barbituriques ou de morphiniques), la dépression respiratoire liée à une anesthésie générale, l'insuffisance respiratoire aiguë et l'hypoxémie sévère.

[35] On entend par « molécule test » une molécule testée par le procédé de l'invention pour déterminer si elle diminue ou supprime l'activité du canal TASK-2 ou son expression.

[36] On entend par « molécule candidate » une molécule identifiée par la mise en œuvre de la présente invention comme diminuant ou supprimant l'activité du canal TASK-2 ou son expression.

[37] La présente invention permet d'identifier des molécules candidates pour le traitement de troubles respiratoires chez un mammifère, qu'il soit humain ou animal.

[38] Les molécules test pour la mise en œuvre de la présente invention peuvent être choisies par exemple de manière aléatoire dans des banques moléculaires ou, par exemple, parmi des molécules biologiquement acceptables et capables d'interagir avec un canal ionique.

[39] Comme molécules test susceptibles de diminuer ou supprimer l'activité de TASK-2, on peut citer par exemple la quinine, la quinidine, le

clofilium, la lidocaïne, Ia bupivacaïne, le doxapram ainsi que les anesthésiques volatils tels que l'halothane.

[40] Comme molécule candidate, on peut citer par exemple aussi un anticorps dirigé contre TASK-2. Cet anticorps peut être fabriqué par les techniques connues de l'homme du métier. Cet anticorps peut être par exemple un anticorps polyclonal, monoclonal, chimérique, un fragment Fab.

[41] On entend par « activité fonctionnelle » la capacité du canal potassique à conduire et contrôler les mouvements ioniques à travers la membrane cellulaire.

[42] Selon l'invention, l'étape de détermination de l'activité fonctionnelle de TASK-2 peut être réalisée suivant une des méthodes connues de l'homme du métier pour déterminer l'activité d'un canal ionique. Il peut s'agir à titre d'exemple d'une méthode telle que celle décrite pour le canal KCNK2 dans le document WO 05/054866 (PCT/EP/2004/012823 - Bayer Healthcare

AG, déposée le 12 novembre 2004 et publiée le 16 juin 2005), d'une méthode telle que celle décrite pour les canaux TASK-2, TWIK-1 , TREK-1 et TASK-1 dans le document WO 00/27871 précité, ou encore d'une méthode telle que celle décrite pour le canal TREK-2 décrite dans WO

02/00715 (PCT/IB01/01436 - CNRS, déposée le 27 juin 2001 et publiée le

3 janvier 2002).

[43] Selon l'invention, l'étape consistant à déterminer si l'activité fonctionnelle du polypeptide TASK-2 est diminuée ou supprimée peut comprendre :

i) une mise en contact d'une cellule exprimant un polypeptide

TASK-2 présentant une activité fonctionnelle, avec ladite molécule test, et

ii) une mesure de l'activité fonctionnelle du polypeptide TASK-2 et/ou de son expression en présence de ladite molécule test.

[44] Des exemples de mise en œuvre de cette étape sont notamment décrits dans les trois documents précités.

[45] Selon l'invention, la cellule exprimant le polypeptide TASK-2 peut l'exprimer de manière endogène ou sous forme recombinante. Des procédés permettant de faire exprimer ce polypeptide par des cellules pour la mise en œuvre de la présente invention sont décrits par exemple dans WO 00/27871 (cellules COS ou ovocytes de xenope) et dans les autres documents précités.

[46] De manière générale, selon l'invention, l'activité fonctionnelle peut être mesurée par un ou plusieurs paramètre(s) choisi(s) dans le groupe comprenant : le courant ionique traversant le polypeptide TASK-2, le changement du potentiel membranaire de la cellule exprimant le polypeptide TASK-2, le changement de la concentration ionique intracellulaire de la cellule exprimant le polypeptide TASK-2. Des exemples de mesure d'activité fonctionnelle d'un canal utilisables dans la présente invention sont donnés par exemple dans chacun des trois documents précités.

[47] Selon l'invention, l'activité fonctionnelle peut être déterminée par exemple par mesure du courant ionique traversant le polypeptide TASK-2, le courant ionique traversant le polypeptide TASK-2 pouvant être par exemple un efflux d'ions rubidium. De préférence, la mesure du courant ionique traversant le polypeptide TASK-2 est réalisée par la mesure de l'efflux d'ions rubidium, cette mesure pouvant être réalisée par exemple par spectroscopie d'absorption atomique, par exemple comme indiqué dans

GiII et collaborateurs (2007) (GiII S et al. (2007« A cell-based rb(+)-flux

assay of the kv1.3 potassium channel ». Assay Drug Dev Technol 5, 373- 80 (Réf 16)).

[48] Selon l'invention, une molécule test qui diminue l'activité de TASK-2 de préférence d'au moins 10%, de préférence d'au moins 50%, et encore plus préférentiellement 75, 90 ou 100% est identifiée comme une molécule candidate pour diminuer l'activité de TASK-2.

[49] L'invention permet notamment l'identification de molécules candidates pour le traitement de troubles . respiratoires choisis dans le groupe comprenant Ie syndrome des apnées du sommeil, les formes respiratoires du syndrome de mort subite du nourrisson, les modèles de respiration pathologique due à l'altitude.

[50] Une étape ultérieure à l'identification d'une molécule candidate peut être une étape d'étude de l'effet de ladite molécule sur les troubles respiratoires, par exemple après administration de la molécule candidate à un modèle animal présentant des troubles de la respiration ou mis dans des conditions entraînant des troubles respiratoires.

[51] Un autre aspect de l'invention concerne donc l'utilisation d'une molécule modulant l'activité fonctionnelle du polypeptide TASK-2 et/ou inhibant son expression, pour la préparation d'une composition pour le traitement de troubles respiratoires.

[52] Suivant une variante de la présente invention, il est également possible de cribler des molécules pour rechercher celles qui ont la capacité d'augmenter, de diminuer ou de supprimer l'expression génique de TASK- 2. Il s'agit par exemple de déterminer, pour chaque molécule testée, le niveau d'ARNm codant TASK-2 ou de TASK-2 généré. Cette détermination peut être réalisée par toute méthode connue de l'homme du métier. Il peut s'agir d'une méthode qualitative ou quantitative. Des méthodes de

détermination utilisables dans la présente invention peuvent être trouvées par exemples dans les documents WO 05/054866, WO 00/27871 et WO 02/00715. La présence d'un ARNm codant TASK-2 ou de TASK-2 peut être déterminée par exemple par l'une des méthodes immunochimiques connues de l'homme du métier, par exemple par immuno-dosage, une technique Western blot ou par immunohistochimie.

[53] Le criblage de la présente invention peut être réalisé dans un système sans cellule ou avec cellule. N'importe quelle cellule exprimant TASK-2 peut être utilisée. Le polypeptide TASK-2 peut être exprimé naturellement dans la cellule ou peut y être introduit par une technique de recombinaison génétique connue de l'homme du métier. Des exemples de protocoles de recombinaison génétique utilisables pour la mise en œuvre de la présente invention sont décrits dans les trois documents précités.

[54] Ainsi, selon cette variante, une molécule candidate peut être par exemple une séquence complémentaire de la séquence polynucléotidique codant TASK-2 (ou KCNK5) qui est susceptible de bloquer la transcription de canal.

[55] Les vecteurs d'expression dérivés des rétrovirus, adénovirus, du virus de la vaccine ou de l'herpès ou d'autres virus bactériens peuvent être utilisés pour délivrer des séquences nucléotidiques complémentaires aux organes cibles, tissus ou populations cellulaires. Des procédés connus de l'homme du métier peuvent être utilisés pour la construction de vecteurs qui expriment la séquence d'acide nucléique complémentaire aux polynucléotides des gènes codant TASK-2 (Scott JK, Smith GP (1990) « Searching for peptide ligands with an epitope library ». Science, 249 :386-390 (Réf 17)). Des méthodes connues de l'homme du métier peuvent être utilisées pour construire des vecteurs d'expression contenant des séquences codant TASK-2 ainsi que les éléments contrôlant la transcription et la traduction. Ces méthodes incluent les techniques d'ADN

recombinant in vitro, les techniques synthétiques et la recombinaison génétique in vivo. Les trois documents précités décrivent des méthodes utilisables pour la construction de vecteurs pour la mise en œuvre de la présente invention.

[56] D'autres avantages apparaîtront encore à la lecture des exemples qui suivent donnés à titre illustratif en référence aux figures annexées.

Brève description des figures [57] La figure 1 est une photographie de canaux TASK-2 présents à la surface ventrale du bulbe rachidien rostral.

[58] La figure 2 est un histogramme représentant les résultats expérimentaux de l'exemple 2 ci-dessous de mise en évidence in vitro de l'intervention des canaux TASK-2 dans les mécanismes de chémosensibilité centrale. Sur cette figure, l'axe des ordonnées représente la fréquence de l'activité rythmique respiratoire (exprimée en nombre de cycles par minute), et l'axe des abscisses, les différents tests mis en œuvre dans cet exemple. Les barres blanches correspondent aux résultats obtenus sur les souris sauvages et les barres noires sur les souris TASK-2 mutantes.

[59] La figure 3 est un histogramme représentant les résultats expérimentaux de l'exemple 3 ci-dessous de mise en évidence in vivo de l'intervention des canaux TASK-2 dans les mécanismes de la respiration. Sur cette figure, l'axe des ordonnées représente le débit ventilatoire par minute (« minute volume » ou MV) exprimé en ml/min/g de poids corporel, et l'axe des abscisses, les différents tests mis en œuvre dans cet exemple.

[60] La figure 4 représente un enregistrement en « patch-clamp » du courant TASK-2 (intensité I en picoampères (pA)) sur des cellules HEK transfectées avec de I 1 ADN codant pour le canal TASK-2 humain.

[61] La figure 5 décrit la localisation des canaux TASK-2 présents dans le tronc cérébral d'une souris adulte. A: cerveau entier, surface ventrale du tronc cérébral autour du noyau moteur facial (VII) et agrandissement montrant le noyau rétrotrapézoïde et le groupe respiratoire parafacial (RTN/pfRG). De B à E : localisation des cellules exprimant TASK-2 sur des sections coronales. B: mésencéphale, raphé dorsal (DR). C: pont rostral, noyau latéral de l'olive supérieure (LSO). D: pont caudal, surface ventrale (RTN/pfRG) et noyau réticulaire parvocellulaire (PCRtA). E: bulbe rachidien rostral, extrémité caudal du VII. F; schéma récapitulatif montrant la distribution des cellules exprimant TASK-2 sur une coupe sagittale du tronc cérébral. Autres abréviations: 3N, noyau oculomoteur; 4V, 4 eme ventricule; 7N, noyau facial; 1ON, noyau dorsal moteur vagal; 12N, noyau hypoglosse; Amb, noyau ambigu; AP, area postrema; CIC, noyau caudal du colliculus inférieur; ILL, noyau intermédiaire du lemnisque latéral; IO, olive inférieure; me5, tractus trigéminal mésencéphalique; Soi, noyau du tractus solitaire.

[62] La figure 6 illustre l'adaptation respiratoire mesurée par la technique de pléthysmographie en réponse à l'hypercapnie et à l'hypoxie de courte durée chez la souris éveillée. Cette adaptation est similaire chez les souris sauvages ou les souris invalidées pour TASK-2. Sur cette figure, l'axe des ordonnées représente le débit ventilatoire par minute (« minute volume » ou MV) exprimé en ml/min/g de poids corporel, la fréquence respiratoire (RF) et le volume courant (VT), l'axe des abscisses, les différents tests mis en œuvre dans cet exemple en fonction du temps.

[63] Les figures 7 A et B illustrent l'adaptation respiratoire mesurée par la technique de pléthysmographie en réponse à l'hypoxie de longue durée. La forte dépression respiratoire qui est observée chez les souris sauvages est totalement absente chez les souris invalidées pour TASK-2. En A, les axes des ordonnées représentent le volume courant (VT), la fréquence

respiratoire (RF) et le débit ventilatoire par minute (MV, exprimé en ml/min/g) ; l'axe des abscisses représente les différents tests mis en œuvre dans cet exemple en fonction du temps. En B, les mêmes paramètres sont représentés sur une échelle de temps plus longue ; TE, temps d'expiration. En C, sont représentés des exemples de traces originales pour des animaux individuels à différents temps (1 , 2, 3 et 4 comme indiqué en B, dernière trace du bas). Immédiatement après le changement en atmosphère hypoxique, les souris sauvages et les souris mutantes présentent une augmentation de la respiration (point 2). Cette réponse est suivie par une dépression (point 3) observable uniquement chez les souris sauvages. Après 12 heures d'hypoxie (point 4) toutes les souris présentent une ventilation similaire.

[64] La figure 8 est un histogramme représentant l'expression des ARN messagers de TASK-1 , TASK-2 et de l'érythropoïétine (EPO) dans le rein et dans le tronc cérébral chez des souris maintenues pendant 12 heures dans un environnement hypoxique. Il s'agit de résultats de PCR quantitative (8 souris par groupe).

[65] La figure 9 A illustre l'expression de TASK-2 dans la zone située autour du noyau moteur facial (noyau rétrotrapézoïde et groupe respiratoire parafacial) sur un cerveau entier de souris âgée de 1 jour. Cette zone est préservée dans la technique d'enregistrement en bloc. B : représentation schématique de la préparation en bloc où les structures du bulbe rachidien et de la partie la plus caudale du pont sont préservées. Une électrode placée sur la racine cervicale C4 permet d'enregistrer l'activité du nerf phrénique représentant l'activité respiratoire. C: exemple de trace d'enregistrement (C4) et d'intégration (JC4) des bouffées inspiratoires à partir desquelles l'amplitude, la surface et la durée des phases inspiratoires (Tl) et expiratoires (TE) sont mesurées. D: exemples d'activité respiratoire (JC4) en conditions normoxiques (contrôle) et anoxiques obtenus sur des préparations en bloc de souris sauvages

(task2+/+) ou mutantes (task2-/-). E: Histogramme des fréquences respiratoires (RF) en conditions contrôle, anoxie, acidose respiratoire ou métabolique et alcalose pour des souris sauvages (WT), hétérozygotes (task2+/-) ou homozygotes (task2-/-).

EXEMPLES

Exemple 1 : Mise en évidence de l'expression de TASK-2 dans les cellules neuronales du tronc cérébral

[66] Les expériences de cet exemple démontrent la présence de canaux TASK-2 dans une structure nerveuse majeure appartenant aux centres respiratoires du tronc cérébral. Ces expériences ont été réalisées à partir de souris mutantes hétérozygotes adultes (TASK-2 +/" ). Le gène TASK-2 qui est invalidé est remplacé par une séquence codante pour une enzyme, la beta-galactosidase. Grâce à cette enzyme, les cellules qui expriment normalement les canaux TASK-2 peuvent être facilement identifiée par la technique histochimique classique de révélation utilisant I 1 X-GaI comme substrat qui devient bleu lorsqu'il est hydrolyse.

[67] Après un protocole de fixation au para-formaldéhyde, le tissu nerveux est prélevé puis la technique de révélation X-GAL est pratiquée sur des coupes transversales de tronc cérébral de 30μm d'épaisseur, obtenues à l'aide d'un cryostat. à l'issue de cette réaction, les cellules exprimant les canaux TASK-2 sont colorées en bleu (flèche sur la figure 1).

[68] Les résultats obtenus montrent la présence de cellules exprimant

TASK-2 dans des zones discrètes du tronc cérébral. à titre d'exemple, la figure 1 illustre les canaux TASK-2 présents à la surface ventrale du bulbe rachidien rostral. Il s'agit d'une coupe transversale illustrant la présence de

marquage X-gal dans des neurones de la surface ventrale du bulbe rachidien rostral (noyau rétrotrapézoïdal, RTN).

[69] Comme le montrent de très nombreuses études, cette zone joue un rôle fondamental dans la chémosensibilité centrale, c'est-à-dire dans les processus d'adaptation de la ventilation en réponse à une variation chimique du milieu intérieur (sang, liquide cérébrospinal ou LCR). Grâce à la localisation unique de ces canaux dans des zones dès impliquées dans le contrôle de la respiration, il est donc envisageable de moduler spécifiquement la respiration par un procédé agissant sur TASK-2.

Exemple 2: Mise en évidence in vitro de l'intervention des canaux TASK-2 dans les mécanismes centraux d'adaptation de la respiration

[70] Dans cet exemple, les inventeurs ont utilisé des souris « type sauvage » (canaux TASK-2 actifs) et des souris TASK-2 mutantes n'exprimant pas de canaux TASK-2 actifs (« TASK-2 ";" »). Ces souris ont été produites initialement par le laboratoire de W. SKARNES à San Francisco dans le domaine public. Elles ont été rétrocroisées dans le fond génétique C57BI/6J puis élevées et produites au sein même des laboratoires des inventeurs.

[71] Les expériences de cet exemple démontrent des changements dans l'activité respiratoire lors d'une anoxie. Ces expériences ont été réalisées sur la préparation de tronc cérébral isolé in vitro à partir de souriceaux âgés de 1 à 3 jours préparation "en bloc").

[72] Le tronc cérébral de souris sauvages ou mutantes (TASK-2 ) est rapidement disséqué dans la glace, isolé des tissus adjacents, puis placé dans du LCR artificiel (LCRa) équilibré dans du carbogène (95% O 2 , 5%

CO 2 ). La racine ventrale du segment spinal C4 est à .l'origine du nerf phrénique qui innerve le diaphragme. Cette racine nerveuse est aspirée à l'intérieur d'une électrode de verre afin de recueillir l'activité respiratoire rythmique générée spontanément par la préparation. L'activité électrique de la racine C4 est filtrée, amplifiée, visualisée et stockée sur ordinateur pour analyser a posteriori les paramètres respiratoires (fréquence, amplitude, durée). Les tests ont consisté à modifier la quantité de gaz dissous dans le LCRa ou sa composition chimique et à comparer les activités respiratoires.

[73] La figure 2 est un histogramme représentant les résultats expérimentaux de cet exemple (préparation « en bloc » : fréquence respiratoire et activité électrique de la racine C4 du nerf phrénique enregistrée chez les souris sauvages et task2-/-). Contrôle : LCR artificiel équilibré en 95% O 2 , 5% CO 2 . Anoxie : 95% N 2 , 5% CO 2 . L'axe des ordonnées représente la fréquence de l'activité rythmique respiratoire (exprimée en nombre de cycles par minute), et l'axe des abscisses, les différents tests mis en œuvre dans cet exemple. Les barres blanches correspondent aux résultats obtenus sur les souris sauvages et les barres noires sur les souris TASK-2 mutantes.

[74] Les résultats obtenus montrent qu'en condition contrôle (95% O 2 , 5% CO 2 ), la fréquence respiratoire ne diffère pas entre les animaux sauvages et TASK-2 mutants. En anoxie (LCRa équilibré dans un gaz dépourvu d'oxygène : 95% N 2 , 5% CO 2 ), la fréquence respiratoire des animaux sauvages chute d'environ 40%. Cette réponse classique, appelée dépression respiratoire hypoxique, n'est plus observée chez les souriceaux mutants TASK-2 (comparaison statistique, ** * : p<0.001).

[75] Ces expériences démontrent que l'activité respiratoire in vitro des souriceaux soumis à une anoxie est significativement plus fréquente après

invalidation du gène codant pour les canaux TASK-2. Ainsi, dans des conditions de dépression respiratoire, il est envisageable de restaurer l'activité respiratoire centrale par un procédé agissant sur TASK-2.

Exemple 3 : Mise en évidence in vivo de l'intervention des canaux TASK-2 dans les mécanismes de la respiration

[76] Dans cet exemple, les inventeurs ont également utilisé des souris « type sauvage » et des souris TASK-2 mutantes. [77] La respiration des souris a été mesurée avec un appareil pléthysmographique (EMKA technologies, France).

[78] La figure 3 est un histogramme représentant les résultats expérimentaux de cet exemple illustrant les réponses ventilatoires des souris sauvages et TASK-2-/- lors d'une exposition prolongée à l'hypoxie (8% O2). Sur cette figure, l'axe des ordonnées représente le débit ventilatoire par minute (« minute volume » ou MV, exprimé en ml/min/g), et l'axe des abscisses, les différents tests mis en œuvre dans cet exemple. Les barres blanches correspondent aux résultats obtenus sur les souris sauvages et les barres noires sur les souris TASK-2 mutantes.

[79] Différentes conditions d'exposition à l'oxygène ont été testées. Le débit ventilatoire par minute (ml/min/g) a été mesuré pendant le contrôle (con) (21 % de d'oxygène) et lors d'une hypoxie à 8% d'oxygène correspondant à une altitude de 6500m au-dessus du niveau de la mer. L'hypoxie a été testée pendant 1 à 6 heures.

[80] L'hypoxie a entraîné une augmentation transitoire de la respiration chez tous les animaux (hyperventilation consécutive à la stimulation des chémorécepteurs périphériques) (non illustrée). Secondairement, l'exposition prolongée à l'hypoxie a entraîné une réduction des mouvements respiratoires ou dépression qui s'observe uniquement chez les souris de type sauvage. La réduction de dioxyde de carbone artériel

consécutive à l'hyperventilation initiale a été un facteur important chez les souris de type sauvage (en blanc sur l'histogramme de la figure 1) pour réduire leur respiration.

[81] Les animaux invalidés pour le canal TASK2 présentent au contraire une ventilation soutenue. pendant toute la durée de l'hypoxie.

[82] II apparaît clairement que suite à l'inactivation des canaux TASK-2, l'hypoxie est un stimulus puissant pour la respiration, y compris dans des conditions d'hypocapnie (alcalose respiratoire). Il est probable que l'alcalose respiratoire ne soit plus capable d'activer les canaux TASK-2 du système nerveux central.

[83] Les résultats de ces expériences démontrent clairement qu'une souris « TASK-2 knock-out » présente une respiration augmentée pendant l'hypoxie en comparaison à une souris de type sauvage. [84] Ainsi, l'inhibition de TASK-2 apparaît comme un moyen de traitement des troubles de la respiration.

[85] En conclusion, il apparaît que l'inactivation des canaux potassiques TASK-2 comme moyen pour stimuler la respiration dans des conditions hypoxiques est une nouvelle stratégie qui se distingue des approches thérapeutiques utilisées dans l'art antérieur.

Exemple 4 : Localisation de l'expression de TASK-2 dans le tronc cérébral

[86] Les souris et les conditions utilisées dans cette expérience étaient identiques à celles de l'exemple 1.

[87] Le vecteur utilisé pour la génération de souris TASK-2 ";" contient un gène codant pour la béta-galactosidase tel que décrit dans Mitchell KJ et al. (2001) « Functional analysis of secreted and transmembrane proteins critical to mouse development ». Nat Genêt, 28, 241-249 (Réf 18). L'expression des cellules TASK-2 a été visualisée en utilisant un

promoteur de TASK-2 dirigeant l'activité dans les souris TASK-2 "/+ . De manière surprenante, un marquage spécifique avec Ie X-gal est restreint a peu de régions du tronc cérébral. Aucune cellule exprimant TASK-2 n'a été trouvée dans d'autres régions du cerveau.

[88] Le marquage présent au niveau du bulbe rachidien est limité à la partie ventrolatérale de la surface ventrale.

[89] Les cellules exprimant TASK-2 forment une colonne bilatérale s'étendant sur 1 ,5 mm, à partir de 500-700 μm en avant de l'obex jusqu'au pôle rostral du noyau moteur facial (VII). Ces cellules forment des amas localisés dans la zone marginale à la surface du tronc cérébral et dans le parenchyme tissulaire entre 100 à 300 μm de profondeur (voir Figure 5).

Cette région correspond à la région péri-faciale regroupant le noyau rétrotrapézoïde et le groupe respiratoire parafacial (RTN/pfRG).

[90] Dans la protubérance annulaire (ou pont), les cellules exprimant TASK-2 sont observées dans la partie latérale de l'olive supérieure (Figure 5 C), le noyau réticulaire parvocellulaire (Figure 5 D), et les noyaux du raphé dorsal et du lemnisque latéral intermédiaire. Un marquage partiel est détecté dans le colliculus caudal inférieur.

[91] Aucun marquage n'a été détecté dans la moelle épinière cervicale correspondant au noyau moteur phrénique.

[92] Comme démontré dans l'exemple 1 et dans cette expérience, les canaux TASK-2 sont présents à la surface ventrale du bulbe rachidien rostral, plus particulièrement dans la région correspondant au noyau rétrotrapézoïde (RTN) et le groupe respiratoire parafacial (pfRG).

[93] Les résultats obtenus montrent la présence de cellules exprimant TASK-2 dans des zones discrètes du tronc cérébral.

[94] Grâce à Ia localisation unique de ces canaux dans des zones clés impliquées dans le contrôle de Ia respiration, il est donc envisageable de moduler spécifiquement la respiration par un procédé agissant sur TASK- 2.

Exemple 5 : Effet de l'hypoxie et de l'hypercapnie sur la respiration des souris en condition in vivo

[95] Les souris utilisées dans cette expérience sont identiques à celle de l'exemple 2 précédent.

[96] Pour cette expérience, 10 souris TASK-2 +/+ et 7 souris TASK-2 ~ ' ~ ont été utilisés.

[97] Les chémorécepteurs centraux et périphériques contribuent à l'adaptation de la respiration en détectant les variations de pH et des gaz du sang (Vizek M et al. (1987) « Biphasic ventilatory response of adult cats to sustained hypoxia has central origin ». J Appl Physiol, 63, 1658-

1664.(Réf 19)). Les cellules chémoréceptrices périphériques situées dans les corps carotidiens contrôlent plus particulièrement l'augmentation rapide de la ventilation en réponse à l'hypoxie. [98] L'adaptation respiratoire en réponse à une hypoxie ou une hypercapnie de courte durée a été étudiée chez les souris sauvages et mutantes (TASK-2 ";" ).

[99] La respiration des souris a été mesurée avec un appareil pléthysmographique (EMKA technologies, France).

[100] Dans les conditions normales (21 % d'oxygène), les paramètres respiratoires étaient identiques chez des souris TASK-2 'A et les souris sauvages.

[101] Les deux types de souris montrent une augmentation similaire de la respiration en réponse à un environnement comprenant 5% de CO2

(hypercapnie) (Figure 6A). Une diminution de la concentration d'oxygène

de 21 % à 9% a également induit une augmentation de la respiration identique chez les deux types de souris (Figure 6B). [102] L'hypoxie était transitoire et l'augmentation maximale de la respiration est apparue après quelques minutes.

[103] Cette expérience montre une adaptation respiratoire normale en réponse à une hypoxie de courte durée, laquelle est liée à la sensibilité à l'oxygène des cellules chémosensibles périphériques situées dans les corps carotidiens. La réponse à l'hypercapnie est également inchangée chez les souris mutantes.

Exemple 6 : Effet de l'hypoxie prolongée sur la transcription de TASK-2

[104] La réponse à une hypoxie prolongée a également été étudiée. Cette réponse a été mesurée à 8% en oxygène sur une période de plusieurs heures.

[105] Les souris utilisées dans cette expérience sont identiques à celles de l'exemple précédent. [106] Pour cette expérience, 8 souris TASK-2 +/+ et 7 souris TASK-2 '7" ont été utilisées.

[107] Au cours d'une hypoxie de 2 heures, une diminution de la respiration a été observée chez les souris contrôles (Figure 7A). Une dépression hypoxique du débit ventilatoire (minute volume ou MV, exprimé en ml/min/g) a été causée en particulier par une diminution de la fréquence respiratoire (RF). Cette dépression respiratoire induite en réponse à une hypoxie chronique était absente chez les souris TASK-2 ' ' " .

[108] Cet exemple montre que la réponse initiale à l'hypoxie est normale chez les souris TASK-2 "7" . Cette réponse correspond à la stimulation des chémorécepteurs périphériques (Takakura AC et al. (2006) « Peripheral chemoreceptor inputs to retrotrapezoid nucleus (RTN) CO2-sensitive

neurons in rats ». J. Appl Physiol, 63, 1658-1664 (Réf 20). Au contraire, la dépression respiratoire centrale induite par l'hypoxie chronique est totalement absente chez les souris TASK-2 ~ ' ~ .

[109] Cette expérience indique donc clairement que le canal TASK-2 est un élément critique pour la sensibilité médullaire à l'hypoxie.

[11O] TeI que démontré dans cette expérience et dans l'exemple 2 précédent, l'inactivation des canaux potassiques TASK-2 est donc un moyen pour inhiber la dépression respiratoire et stimuler la respiration dans des conditions hypoxiques. Cette inactivation est donc une nouvelle stratégie qui se distingue des approches thérapeutiques utilisées dans l'art antérieur.

[111] L'adaptation respiratoire à une hypoxie chronique telle que décrite dans Powell et collaborateurs (Powell FL et al. (1998) « Time domain of the hypoxie ventilatory response ». Respir Physiol, 112, 123-134. (1998) (Réf 21)) a été étudiée dans les conditions suivantes : 10% de d'oxygène correspondant à une altitude de 5300m pendant 20 heures. [112] Durant les trois à quatre premières heures d'hypoxie, les souris contrôles ont montré une forte dépression du débit respiratoire avec une prolongation du temps d'expiration et une réduction de la fréquence respiratoire. Cette phase a été suivie par une phase d'adaptation caractérisée par une diminution du temps d'expiration qui est revenu à des valeurs normales après 10 à 12 heures (Figure 8 B et C). [113] Durant tout le temps de l'hypoxie, les paramètres respiratoires sont restés inchangés pour les souris TASK-2 ';" . Ces souris présentent donc un phénotype respiratoire similaire à celui des souris contrôles après adaptation.

[114] Par ailleurs, une mesure de l'expression de TASK-2 a été effectuée. [115] Les souris ont été soumises dans un environnement avec 10% d'oxygène pendant 24 heures, la mesure de l'expression des ARN messagers de TASK-2 (ainsi que TASK-1 et l'érythropoïétine en contrôles) a ensuite été effectuée.

[116] Les ARN ont été isolés à partir du rein et du tronc cérébral des souris en utilisant le Kit mini RNeasy (Qiagen). Pour la transcription inverse, une reverse transcriptase (Promega) a été utilisée selon le protocole fourni par le fabricant. Une réaction de polymérisation en chaîne en temps réel a été effectuée avec le système LightCycler (Roche) en utilisant le kit PCR SYBR Green (Qiagen). La transcription des gènes TASK-2, TASK-1 et de l'érythropoïétine a été mesurée et norrrialisée par rapport à l'expression de la béta-actine.

[117] Les amorces utilisées et les conditions de réalisation de la réaction de polymérisation en chaîne en temps réel étaient les suivantes. Amorces pour la béta-actine : Amorce sens, 5' CCACCGATCCACACAGAGTACTT 3' (SEQ ID N°1); Amorce antisens, 5' GACAGGATGCAGAAGGAGATTACTG 3 (SEQ ID N°2) '. Amorces pour l'érythropoïétine : Amorce sens, 5' AGAATGGAGGTGGAAGAACAG 3' (SEQ ID N°3); Amorce antisens, 5' TGTCTATATGAAGCTGAAGGGT 3'(SEQ ID N°4). Amorces pour TASK-2 : Amorce sens, 5' GCTTTGGGGACTTTGTGG 3' (SEQ ID N°5); Amorce antisens, 5' AAAGAGGGACAGCCAAGC 3'(SEQ ID N°6).

[118] La température d'hybridation des amorces étaient de 55 0 C.

[119] Les résultats ont montré que la quantité d'ARNm codant pour TASK- 2 reste inchangée dans le rein et dans le tronc cérébral durant l'hypoxie. (Figure 8 A et B).

[120] La transcription du gène TASK-2 reste donc inchangée lors d'une hypoxie prolongée. Ainsi, le canal potassique TASK-2 est donc une nouvelle cible pour inhiber la dépression respiratoire et stimuler la respiration dans des conditions hypoxiques. Tel que démontré précédemment, l'inactivation de TASK-2 est donc une nouvelle stratégie qui se distingue des approches thérapeutiques utilisées dans l'art antérieur.

Exemple 7 : Mise en évidence in vitro de l'intervention des canaux TASK-2 dans les mécanismes d'adaptation centrale de la respiration

[121] Cette expérience a été réalisée dans des conditions et sur des souriceaux identiques à ceux de l'exemple 2.

[122] Cette expérience démontre des changements dans l'activité respiratoire lors d'une anoxie, d'une acidose et d'un alcalose. [123] Une préparation en bloc de troncs cérébraux de souris néonatale qui comprennent les chémorécepteurs centraux a été effectuée (Figure 9 A-C). [124] La préparation en bloc a été effectuée sur des nouveau-nés de 1 à 3 jours. Chaque souriceau a été anesthésié avec de l'halothane. Le tronc cérébral et la moelle épinière cervicale ont été isolés et transférés dans une chambre d'enregistrement, la partie ventrale vers Ie haut, et perfusés avec un fluide cérébrospinal artificiel à un débit de 4 ml. min "1 .

[125] Une mesure de la fréquence respiratoire, de la durée des bouffées respiratoires, de l'amplitude et de l'aire de surface des bouffées a été effectuée.

[126] Pour cette expérience, 10 souris TASK-2 +/+ , 8 souris TASK-2 +/" et 7 souris TASK-2 " ' " ont été utilisées.

[127] La fréquence respiratoire de base était identique chez tous les individus dans les conditions normales. Chez les souris contrôles, une acidose métabolique ou respiratoire a induit une augmentation de la fréquence respiratoire (environ + 40%), tandis qu'une alcalose et une anoxie ont provoqué une diminution significative de la fréquence respiratoire (environ - 40%).

[128] Les souris TASK-2 -/- ont montré des diminutions de la fréquence respiratoire similaires au changement de pH. Cependant, cette réponse à l'anoxie a été complètement supprimée dans les souris TASK-2 -/- (Figure 9 D et E).

[129] Cette expérience montre qu'il existe chez les souris TASK-2 -/- une réponse à l'hypoxie qui se traduit par une augmentation de la durée des inspirations sans modification de la fréquence respiratoire. [130] Ainsi, le canal potassique TASK-2 est donc une nouvelle cible pour inhiber la dépression respiratoire et stimuler la respiration dans des conditions hypoxiques. 2

Exemple 8 : Mise en œuvre d'un criblage selon la présente invention

[131] La distribution de TASK-2 chez un être humain adulte, sa cartographie chromosomique, ses propriétés biophysique et pharmacologiques, sa régulation par le pH externe ont été étudiées d'après le document WO 00/27871.

[132] Le criblage suivant a été mis en œuvre . Des cellules HEK (Human Embryonnic Kidney cells) ont été transfectées avec un plamide contenant le DNA complémentaire du gène du canal TASK-2 humain (plRES-CD8- hTASK2) par la méthode à la lipofectamine. Après 24 heures de culture, les courants TASK-2 sont enregistrés par la méthode du voltage-clamp (patch-clamp en configuration cellules entière). Les courants sont activés par des sauts de voltage depuis un potentiel de repos à -95V jusqu'à des valeurs variables comprises entre -80 et +45mV.

[133] Les courants sont enregistrés en configuration cellule entière au moyen d'un amplificateur EPC-10 (HEKA). La pipette de « patch » contient une solution 95 K-gluconate, 30 mM KCI, 4,8 mM Na 2 HPO 4 , 1 ,2 mM

NaH 2 PO 4 , 5 mM glucose, 2,38 mM MgCI 2 , 0,726 mM CaCI 2 ,1 mM EGTA,

3 mM ATP, pH 7,2. La solution externe est une solution RINGER : 145 mM

NaCI, 0,4 mM KH 2 PO 4 , 1 ,6 mM K 2 HPO 4 , 5 mM glucose, 1 mM MgCI 2 , 1 ,3 mM CaCI 2 , 5 mM HEPES, pH 7,4.

[134] Différentes drogues peuvent être appliquées à différentes concentrations par perfusion du bain externe et leurs effets sont évalués par la modification des courants par rapport aux conditions contrôles.

[135] Dans l'exemple de la Figure 4, on voit que l'application de Doxapram à 0,9 mM dans le bain a provoqué une diminution de 25% du courant évoqué par les sauts de potentiel.

Listes des références

(Réf 1) Richter DW, Spyer KM (2001) « Studying rhythmogenesis of breathing : comparison of in vivo and in vitro models ». Trends

Neurosci, 24, 464-472.

(Réf 2) Feldman JL, DeI Negro (2006) « Looking for inspiration : new perspectives on respiratory rhythm ». Nat Rev Neurosci, 7, 232- 242. (Réf 3) Feldman JL et al. (2003) « Breathing : rhythmicity, plasticity, chemosensivity ». Annu Rev Neurosci, 26, 239-266.

(Réf 4) Severson et al. (2003) « Midbrainserotonergic neurons are central pH chemoreceptors ». Nat Neurosci, 6, 1139-1140.

(Réf 5) Namen AM et al. (2002) « Increase Physician-reported sleep apnea : the National Ambulatory Médical Care Survey ». Chest

121(6) : 1741-1747.

(Réf 6) Goldstein SA et al. (2005), « International Union Pharmacology. LV. Nomemclature and molecular relationship of two-P potassium channels ». Pharmacol Rev, 57, 527-540. (Réf 7) Czirjak G, Enyedi P (2001), « Formation of functionnal heterodimers between the TASK-1 and TASK-3 two pore domain potassium channel subunits ». J Biol Chem, 277 ', 5426- 5432.

(Réf 8) Kang D et al. (2004), « Functionnal expression of TASK- 1/TASK-3 heteromers in cérébral granule cells ». J.Physiol, 554,

64-77.

(Réf 9) Berg AP et al. (2004), « Motoneurons express heteromeric TWIK-related acid sensitive K+ (TASK) channels contanining TASK-1 (KNCK3) and TASK-3 (KNCK9) subunits ». J. Neurosci, 24, 6693-6702.

(Réf 10) Mathie A (2007) « Neuronal two pore domain potassium channels and their régulation by G protein coupled receptors ». J. Physiol, 578, 377-385.

(Réf 11) Patel AJ, Honore E (2001) « Properties and modulation of mammalian 2P domain K+ channels ». Trends Neurosci, 24,

339-346.

(Réf 12) Mulkey et al. (2007) « TASK channel détermine pHsensitivity in sélect rèspiratory neurons but do not contribute to central respiratory chemosensitivity ». J Neurosci, 27, 14049-14058. (Réf 13) " Brazier et al. (2005) « Cloning of the human TASK-2 (KCNK5) promoter and its régulation by chronic hypoxia ». Biochem Biophys Res Commun 336 :1251-1258.

(Réf 14) Sirois et al. (2000) « The TASK-1 two-pore domain K+ channel is a molecular substrate for neuronal effects of inhalation anesthesic ». J. Neurosci, 20, 6347-6354.

(Réf 15) Reyes R et al. (1998) « Cloning and expression of a novel pH-sensitive two pore domain K+ channel from human kidney ». J. Biol Chem, 273, 30863-30869.

(Réf 16) GiII S et al. (2007) « A cell-based rb(+)-flux assay of the kv1.3 potassium channel ». Assay Drug Dev Technol 5, 373-80.

(Réf 17) Scott JK, Smith GP (1990) « Searching for peptide ligands with an epitope library ». Science, 249 :386-390.

(Réf 18) Mitchell KJ et al. (2001) « Functional analysis of secreted and transmembrane proteins critical to mouse development ». Nat Genêt, 28, 241-249.

(Réf 19) Vizek M et al. (1987) « Biphasic ventilatory response of adult cats to sustained hypoxia has central origin ». J Appl Physiol, 63, 1658-1664.

(Réf 20) Takakura AC et al. (2006) « Peripheral chemoreceptor inputs to retrotrapezoid nucleus (RTN) CO2-sensitive neurons in rats ». J. AppI Physiol, 63, 1658-1664.

(Réf 21) Powell FL et al. (1998) « Time domain of the hypoxic ventilatory response ». Respir Physiol, 112, 123-134.