Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHOD OF TREATING LEUKAEMIA
Document Type and Number:
WIPO Patent Application WO/2021/237270
Kind Code:
A1
Abstract:
The present disclosure relates to a method for treating a haematological malignancy or pre-malignant condition in a subject. In one particular application, the method involves administering to a subject with Acute Myeloid Leukaemia (AML) and preferably an AML overexpressing miR-10a (eg NPMc+ AML), an effective amount of a first agent comprising an MDM2/MDMX inhibitor (eg Nutlin-3a), a second agent comprising an inhibitor of MiR-10a expression and/or activity (eg an antisense oligonucleotide targeted to MiR-10a), and optionally, a chemotherapeutic agent such as a "standard of care" (SOC) chemotherapeutic agent for AML (eg cytarabine).

Inventors:
MOLLOY TIMOTHY (AU)
MA DAVID DANG FUNG MA (AU)
Application Number:
PCT/AU2021/000038
Publication Date:
December 02, 2021
Filing Date:
May 26, 2021
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
ST VINCENTS HOSPITAL SYDNEY LTD (AU)
International Classes:
A61P35/02; A61K31/496; A61K31/7088
Foreign References:
US20090192114A12009-07-30
Other References:
VU THI T.; STOELZEL FRIEDRICH; EHNINGER GERHARD; MOLLOY TIM; MA DAVID: "Inhibition of microRNA 10a, an Autophagy Modulator, Increases Chemosensitivity to Ara-C in Acute Myeloid Leukemia", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 130, 8 December 2017 (2017-12-08), US , pages 3795, XP086632941, ISSN: 0006-4971, DOI: 10.1182/blood.V130.Suppl_1.3795.3795
VU T.T ET AL.: "Inhibiting M1R-10A overcomes cytarabine-resistance in Acute Myeloid Leukemia", HAEMATAOLOGICA, 2017, 102(S2), ABSTRACT E880 BACKGROUND, AIMS, METHODS, RESULTS AND SUMMARY/CONCLUSIONS
ADAM BRYANT;CATALINA A PALMA;VIVEK JAYASWAL;YEE WA YANG;MARK LUTHERBORROW;DAVID DF MA: "miR-10a is aberrantly overexpressed in Nucleophosmin1 mutated acute myeloid leukaemia and its suppression induces cell death", MOLECULAR CANCER, BIOMED CENTRAL, LONDON, GB, vol. 11, no. 1, 20 February 2012 (2012-02-20), GB , pages 8, XP021118573, ISSN: 1476-4598, DOI: 10.1186/1476-4598-11-8
MOLLOY TIMOTHY J, VU THI T, STÖLZEL FRIEDRICH, EHNINGER GERHARD, MA DAVID: "Mir-10a Regulates Autophagy and Cell Cycle in Normal Karyotype Acute Myeloid Leukaemia", BLOOD, AMERICAN SOCIETY OF HEMATOLOGY, US, vol. 128, no. 22, 2 December 2016 (2016-12-02), US , pages 2862 - 2862, XP055880019, ISSN: 0006-4971, DOI: 10.1182/blood.V128.22.2862.2862
DMITRIY OVCHARENKO; FRIEDRICH STLZEL; DAVID POITZ; FERNANDO FIERRO; MARKUS SCHAICH; ANDREAS NEUBAUER; KEVIN KELNAR; TIMOTHY DAVISO: "miR-10a overexpression is associated with NPM1 mutations and MDM4 downregulation in intermediate-risk acute myeloid leukemia", EXPERIMENTAL HEMATALOGY, ELSEVIER INC., US, vol. 39, no. 10, 1 July 2011 (2011-07-01), US , pages 1030 - 1042.e7, XP028292583, ISSN: 0301-472X, DOI: 10.1016/j.exphem.2011.07.008
KOJIMA K ET AL.: "MDM2 antagonists induce p53-dependent apoptosis in AML: implications for leukemia therapy", BLOOD, vol. 106, no. 9, 2005, pages 3150 - 3159, XP055165820, DOI: 10.1182/blood-2005-02-0553
COLOMBO EMANUELA, MARTINELLI PAOLA, ZAMPONI RAFFAELLA, SHING DANIELLE C., BONETTI PAOLA, LUZI LUCILLA, VOLORIO SARA, BERNARD LORIS: "Delocalization and Destabilization of the Arf Tumor Suppressor by the Leukemia-Associated NPM Mutant", CANCER RESEARCH, AMERICAN ASSOCIATION FOR CANCER RESEARCH, US, vol. 66, no. 6, 15 March 2006 (2006-03-15), US , pages 3044 - 3050, XP055880024, ISSN: 0008-5472, DOI: 10.1158/0008-5472.CAN-05-2378
HAUPT SUE, MEJÍA-HERNÁNDEZ JAVIER OCTAVIO, VIJAYAKUMARAN RESHMA, KEAM SIMON P, HAUPT YGAL: "The long and the short of it: the MDM4 tail so far", JOURNAL OF MOLECULAR CELL BIOLOGY, vol. 11, no. 3, 1 March 2019 (2019-03-01), pages 231 - 244, XP055880026, DOI: 10.1093/jmcb/mjz007
FALINI B ET AL.: "Acute myeloid leukemia carrying cytoplasmic/mutated nucleophosmin (NPMc+ AML): biologic and clinical features", BLOOD, vol. 109, 2007, XP002680455, DOI: 10.1182/BLOOD-2006-07-012252
TRINO STEFANIA, LAMORTE DANIELA, CAIVANO ANTONELLA, LAURENZANA ILARIA, TAGLIAFERRI DANIELA, FALCO GEPPINO, DEL VECCHIO LUIGI, MUST: "MicroRNAs as New Biomarkers for Diagnosis and Prognosis, and as Potential Therapeutic Targets in Acute Myeloid Leukemia", INTERNATIONAL JOURNAL OF MOLECULAR SCIENCES, vol. 19, no. 2, pages 460, XP055880030, DOI: 10.3390/ijms19020460
ANDREW BURGESS, KEE MING CHIA, SUE HAUPT, DAVID THOMAS, YGAL HAUPT, ELGENE LIM: "Clinical Overview of MDM2/X-Targeted Therapies", FRONTIERS IN ONCOLOGY, vol. 6, XP055736163, DOI: 10.3389/fonc.2016.00007
VU THI THANH; STöLZEL FRIEDRICH; WANG KRISTY W.; RöLLIG CHRISTOPH; TURSKY MELINDA L.; MOLLOY TIMOTHY J.; MA DAVID D.: "miR-10a as a therapeutic target and predictive biomarker for MDM2 inhibition in acute myeloid leukemia", LEUKEMIA, NATURE PUBLISHING GROUP UK, LONDON, vol. 35, no. 7, 1 December 2020 (2020-12-01), London, pages 1933 - 1948, XP037500535, ISSN: 0887-6924, DOI: 10.1038/s41375-020-01095-z
Attorney, Agent or Firm:
MADDERNS PATENT & TRADE MARK ATTORNEYS (AU)
Download PDF:
Claims:
CLAIMS

1. A method of treating a haematological malignancy or pre-malignant condition in a subject, said method comprising administering to said subject an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent.

2. The method of claim 1 , wherein the haematological malignancy is acute myeloid leukaemia

(AML).

3. The method of claim 2, wherein the AML is of subtype.

4. The method of any one of claims 1 to 3, wherein the subject is characterised by a high level of expression of miR-10a.

5. The method of any one of claims 1 to 3, wherein the subj ect is characterised by high or overexpression of MDM4/ Mdm4.

6. The method of any one of claims 1 to 5, wherein the first agent comprises an inhibitor of MDM2 and/or MDMX selected from the group consisting of cis-imidazoline compounds, spiro- oxindole compounds, imidazothiazole, dihydroisoquinolinone, piperidine compounds and piperidinone.

7. The method of claim 6, wherein the first agent comprises a nutlin compound or a derivative or analogue thereof.

8. The method of claim 7, wherein the first agent comprises Nutlin-3a

9. The method of any one of claims 1 to 8, wherein the second agent comprises a nucleic acid molecule which encodes interfering RNA (iRNA) targeted to miR-10a or constitutes an inhibitory RNA molecule itself targeting miR-10a, or which provides a cis acting gene regulatory element to repress expression of miR-10a

10. The method of claim 9, wherein the second agent comprises an anti-microRNA-lOa agent comprising a single-stranded antisense oligonucleotide specifically targeted to microRNA-10a

11. The method of any one of claims 1 to 10, wherein the method comprises administering a chemotherapeutic agent selected from agents belonging to the classes of alkylating agents, anti- metabolites, anti-microtubule agents, topoisomeraae inhibitors, and cytotoxic antibiotics.

12 The method ofclaim 1, wherein the chemotherapeutic agent is cytarabine, or cytarabine and daunorubidn.

13. A pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-IOa expression and/or activity; and

(iii) optionally, a chemotherapeutic agent

14. A pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX; and

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity.

15. The pharmaceutical composition of claim 13, wherein the composition comprises a chemotherapeutic agent selected from agents belonging to the classes of alkylating agents, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic antibiotics.

16. The pharmaceutical composition of claim 15, wherein the chemotherapeutic agent is cytarabine, or cytarabine and daunorubicia

17. The pharmaceutical composition of any one of claims 13 to 15, wherein the first agent comprises an inhibitor of MDM2 and/or MDMX selected from the group consisting of cis-imidazolinc compounds, spiro-axindole compounds, imidazothiazole, dihrydroisoquinolinone , piperidine compounds and piperidmone.

18. The pharmaceutical composition of claim 17, wherein the first agent comprises a nutlin compound or a derivative or analogue thereof

19. The pharmaceutical composition of claim 18, wherein the first agent comprises Nutlin-3a.

20. The pharmaceutical composition of any one of claims 13 to 19, wherein the second agent comprises a nucleic acid molecule which encodes interfering RNA (iRNA) targeted to miR-IOa or constitutes an inhibitory RNA molecule itself targeting miR-IOa, or which provides a cis acting gene regulatory element to repress expression of miR-IOa.

21. The pharmaceutical composition of claim 20, wherein the second agent comprises an anti- microRNA-10a agent comprising a single-stranded antisense oligonucleotide specifically targeted to microRNA-1.0a

22. A kit comprising first, second and third containers, wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity, and the third container contains a chemotherapeutic agent; optionally packaged with instructions for the use of the kit in the method of claim 1.

23. A kit comprising first and second containers, wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, and the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity; optionally packaged with instructions for the use of the kit in the method of claim 1.

24. A method of predicting effectiveness of MDM2 and/or MDMX inhibition in treating an individual with a malignant condition or pre-malignant condition, comprising quantifying miR-10a expression and/or modulation of downstream genes/factors in a suitable body sample.

25. The method of claim 24, wherein the malignant condition is acute myeloid leukaemia (AML) and the method comprises quantifying miR-10a expression and/or downregulation of any or all of , and/or upregulation of in a suitable body sample.

26. The method of claim 24 or 25, wherein the body sample is a blood or bone marrow sample.

27. A method of treating a haematological malignancy or pre-malignant condition in a subject, said method comprising: quantifying miR-10a expression and/or modulation of downstream genes/factors in a suitable body sample to determine whether the subject is suitable for treatment with an inhibitor of MDM2 and/or MDMX; and treating the subject by administering an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent.

28. The method of claim 27, wherein the haematological malignancy is acute myeloid leukaemia

(AML).

29. The method of claim 28, wherein the AML is of NPM°+ AML subtype.

30. The method of any one of claims 27 to 29, wherein the first agent comprises an inhibitor of MDM2 and/or MDMX selected from the group consisting of cis-imidazoline compounds, spiro- oxindole compounds, imidazothiazole, dihydroisoquinolinone, piperidine compounds and piperidinone.

31. The method of claim 30, wherein the first agent comprises a nutlin compound or a derivative or analogue thereof.

32. The method of claim 31 , wherein the first agent comprises Nutlin-3a.

33. The method of any one of claims 27 to 32, wherein the second agent comprises a nucleic acid molecule which encodes interfering RNA (iRNA) targeted to miR-10a or constitutes an inhibitory RNA molecule itself targeting miR-10a, or which provides a cis acting gene regulatory element to repress expression of miR-10a.

34. The method of claim 33, wherein the second agent comprises an anti-microRNA-lOa agent comprising a single-stranded antisense oligonucleotide specifically targeted to microRNA-1.0a

35. The method of any one of claims 27 to 34, wherein the method comprises administering a chemotherapeutic agent selected from agents belonging to the classes of alkylating agents, antimetabolites, anti-microtubule agents, topoisomerase inhibitors, and cytotoxic antibiotics.

36. The method of claim 35, wherein the chemotherapeutic agent is cytarabine, or cytarabine and daunorubicin.

37. The method of any one of claims 27 to 36, wherein the subject is determined as suitable for treatment with an inhibitor of MDM2 and/or MDMX by quantifying miR-10a expression at a level corresponding to a high level of expression of miR-10a.

38. The method of any one of claims 27 to 37, wherein the subject is determined as suitable for treatment with an inhibitor of MDM2 and/or MDMX by quantifying expression at a level corresponding to a high level or overexpression of M

Description:
METHOD OF TREATING LEUKAEMIA

TECHNICAL FIELD

[0001] The present disclosure relates to a method for treating a haematological malignancy or pre- malignant condition in a subject. In one particular application, the method involves administering to a subject with Acute Myeloid Leukaemia (AML), an effective amount of a first agent comprising an MDM2/MDMX inhibitor, a second agent comprising an inhibitor of miR-10a expression and/or activity, and optionally, a chemotherapeutic agent such as a "standard of care" (SOC) chemotherapeutic agent for AML (eg cytarabine).

PRIORITY DOCUMENT

[0002] The present application claims priority from Australian Provisional Patent Application No 2020901704 titled "Method of treating leukaemia" filed on 26 May 2020, the content of which is hereby incorporated by reference in its entirety.

BACKGROUND

[0003] Acute myeloid leukaemia (AML), otherwise known as acute myelogenous leukaemia and acute granulocytic leukaemia amongst others, is a rare disease that affects the blood and bone marrow. Each year in Australia, around 1000 new cases of AML are diagnosed, most commonly in adult men and generally first appearing at about the age of 60-65 (https://www.cancercouncil.com.au/acute-myeloid- leukaemia). For patients under 60 years of age, the disease is typically curable in 35% of cases, but in patients over the age of 60 years, the disease is only curable in about 10% of cases [2], And for those older patients who are unable to tolerate intensive chemotherapy (eg using the standard of care chemotherapeutic agent, cytarabine), the typical survival period is only 5-10 months [2],

[0004] p53 is a critical tumour suppressor protein that has a central role in modulating diverse cellular processes including proliferation, cell cycle, DNA repair, senescence, apoptosis and autophagy [1], Approximately half of all human cancers bear inactivating mutations of p53, and p53-deficent mice develop a range of tumours with high penetrance [2], While common in solid cancers, TP53 mutations are less frequent in haematological malignancies such as AML, in which they are present in only around 5% of patients [3], In the majority of AML cases however, it is thought that p53 is repressed by other means, including the overexpression of its two primary negative regulators, murine double minute 2 homolog (MDM2) and murine double minute 4 homolog (MDM4; otherwise known as MDMX) [4] [5], or via mutation of the nucleophosmin 1 (NPM1) [6] which occurs in around 30% of AML patients [7], As a nucleocytoplasmic shuttle protein, mutation in NPM1 results in the improper relocalisation of the crucial MDM2 inhibitor p!4ARF from the nucleoli to the cytoplasm, effectively disabling it and thereby repressing both the p53 and the tightly-linked retinoblastoma (Rb) tumour suppressor networks [8] [9],

[0005] Pharmacological inhibitors of MDM2 and MDM4 have recently been developed in an effort to reactivate the p53/Rb tumour suppressor network in p53-wildtype cancers [10]. While most clinical trials in AML to date have been Phase I/ll studies focussed on safety and tolerability, some preliminary response data has been reported [10], Overall efficacy has been promising but variable, with the second generation MDM2 inhibitor idasanutlin (RG7388) + cytarabine in relapsed/refractory AML for example, achieving response rates of around 60% [11], Toxicity is a significant issue however, with most patients experiencing adverse gastrointestinal and infection-related events, as well as frequent high grade neutropenia and thrombocytopenia [11] [12], Interestingly, complete remission (CR) has been observed in diverse patients, including those in varied risk groups as well as relapsed/refractory patients. These findings, while showing promise, highlight the need to identify compounds that can synergise with MDM2 inhibition to enable lower effective doses to be used, and the development of new biomarkers to identify patients most likely to benefit, as well as those that will not respond so they can be excluded and spared toxic side-effects.

[0006] It has previously been shown that the microRNA miR-10a is strongly overexpressed in AML compared to healthy bone marrow (up to 80-fold), and also displays subgroup-specific expression [13], miR-10a is involved in the p53/Rb tumour suppressor/stress response pathway regulation via its repression of a number of the p53/Rb networks' key genes, including MDM4, Rb regulator RB-Inducible Coiled-Coil 1 (RBCC1), and p21 regulator Transcription Factor AP2-Gamma (TFAP2C) [13] [14]. These findings have suggested that miR-10a may represent an oncomiR which contributes to the repression of the p53/Rb pathway by repressing key downstream pathway members. As such, miR-10a may have a role in the response to MDM2 inhibitors in AML and could represent both a valuable therapeutic target for modulating drug responses via de-repression of its key p53/Rb-related targets, and a biomarker of response.

[0007] There is an ongoing need to identify and develop new therapeutic and diagnostic methods for treating leukaemia such as AML. Increased understanding of the underlying aberrations in molecular pathways and cellular functions at play in AML may lead to the identification of new and more effective strategies for treating the disease at a more subtype-focussed level. As described hereinafter, the present Applicant has now identified a novel approach to the treatment of at least a subgroup of AML, which offers significant potential to provide a more effective treatment of the disease, especially in older patients of 60 years of age or more that account for over 50% of all AML cases. SUMMARY

[0008] In a first aspect, this disclosure relates to a method of treating a haematological malignancy or pre-malignant condition in a subject, said method comprising administering to said subject an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and (ii) optionally, a chemotherapeutic agent.

[0009] The method is preferably applied to the treatment of AML, more preferably, to the treatment of AML overexpressing miR-10a.

[0010] The first agent comprising an inhibitor of MDM2 and/or MDMX is preferably selected from cis- imidazoline compounds such as Nutlin-1, Nutlin-2 and Nutlin-3 (ie (±)-4-[4,5-Bis(4-chlorophenyl)-2-(2- isopropoxy-4-methoxy-phenyl)-4,5-dihydro-imidazole-l-carbony l]-piperazin-2-one) [62] [63], and especially the (-)-Nutlin 3 enantiomer known as Nutlin-3a, or a derivative or analogue thereof.

[0011] The second agent comprising an inhibitor of miR-10a is preferably selected from anti- microRNA-lOa agents comprising a single-stranded antisense oligonucleotide designed to specifically target mature miRNA 10a.

[0012] The chemotherapeutic agent may be selected from those chemotherapeutic agents that may be regarded as "standard" in the art or comprise what is considered a "standard of care" chemotherapeutic agent (eg cytarabine, or cytarabine in combination with daunorubicin).

[0013] In a second aspect, the disclosure relates to a pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent.

[0014] In a third aspect, the disclosure relates to a pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX; and

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity. [0015] In a fourth aspect, the present disclosure relates to a kit comprising first, second and third containers (eg vials), wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity, and the third container contains a chemotherapeutic agent; optionally packaged with instructions for the use of the kit in the method of the first aspect

[0016] In a fifth aspect, the present disclosure relates to a kit comprising first and second containers (eg vials), wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, and the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity; optionally packaged with instructions for the use of the kit in the method of the first aspect.

[0017] In a sixth aspect, the present disclosure relates to a method of predicting effectiveness of MDM2 and/or MDMX inhibition in treating an individual with a malignant condition (preferably a haematological malignancy such as AML) or pre-malignant condition, comprising quantifying miR-10a expression and/or modulation of downstream genes/factors (eg in a suitable body sample (eg a blood or bone marrow sample).

BRIEF DESCRIPTION OF FIGURES

[0018] Figure 1 provides the results of an experiment designed to assess whether miR-10a expression is correlated to cancer cell line drug sensitivity, specifically for the MDM2 inhibitor, Nutlin-3a The endogenous expression of miR-10a in 60 cancer cell lines was correlated to sensitivity to 265 drugs (A) and Nutlin-3a was found to be the 4th strongest correlation (B); (C) Cell lines with endogenous expression below the median level had a mean IC50 of 34.1 μΜ, versus 95.7μΜ for those above;

[0019] Figure 2 provides the results of an experiment designed to assess whether expression of miR-10a downstream target genes TFAP2C, CDKNIA, TPS 3 and MDM4 are correlated to sensitivity to the MDM2 inhibitor, milademetan (DS-3032b) in 38 pre-treatment AML primary patient samples treated ex vivo. The IC50 dose was calculated for each sample, enabling them to be split into "resistant" (samples with the top 33% of IC50 values) and "sensitive" (bottom 33%) subgroups. Resistant samples had a 21.9- fold higher mean IC50 than sensitive samples (p < 0.001): (A) Samples sensitive to DS-3032b expressed significantly higher levels of TFAP2C, TP53 and MDM4 mRNA, and significantly lower levels of CDKNIA; (B) These patients also participated in a Phase I/II clinical trial of DS-3032b and response data was available for the cohort. "Responders" (ie those that experienced either complete remission (CR), complete remission with incomplete platelet recovery (CRp) or haematological improvement (HI)) displayed analogous expression patterns of miR-10a targets compared to non-responders; (C-E) TFAP2C, RB1CC1 and CDKN1A were also significantly prognostic in a second independent cohort (Munich'; n = 242) treated with intensive cytarabine-based double-induction and consolidation chemotherapy; (F-H) miR-10a itself was also strongly predictive of outcome in patients treated with cytarabine-based chemotherapy + HSCT. In a subset of patients (n = 35) derived from the SAL AML2003 trial ('Dresden'), low miR-10a was strongly predictive of both improved relapse-free (F) and overall (G) survival. Similar results were observed in an additional independent cohort ('Sydney'; n = 21), in which low miR-10a was also associated with improved overall survival in patients treated with cytarabine-based induction chemotherapy +/- HSCT (H);

[0020] Figure 3 provides the results of experiments designed to assess whether miR-10a mediates sensitivity to Nutlin-3a and cytarabine in AML. (A-B): miR-10a inhibition in the miR-10a-high AML cell lines OC1-AML3 and IMS-M2 resulted in significant sensitisation to Nutlin-3a (A) and cytarabine (B). (C-D): Conversely, overexpression of miR-10a in miR-10a-low AML cell lines MV4-11 and HL60 led to significant resistance. (E-F): The exogenous expression of Rblccl (OE) or knockdown (KD) of p21 alone was sufficient to recapitulate these effects in OCI-AML3 and 1MS-M2 cells, confirming that these miR- 10a targets are mediators of Nutlin-3a and cytarabine sensitivity. (G-H): OCI-AML3 cells transduced with a miR-10a or scrambled control inhibitor (G) and MV4-11 cells transduced with a miR-10a or scrambled control mimic (H) were treated with a combination of Nutlin-3a and cytarabine at various doses and cell viability determined by MTS assay to quantify fractional inhibition of proliferation (Effect (Fa)). The Combination Index (Cl) was calculated to determine antagonistic (Cl > 1), additive (Cl ~ 1), or synergistic (Cl < 1) effects between the two compounds. Nutlin-3a and cytarabine were strongly additive in OCI-AML3 cells but less so in MV4-11 cells. Additivity significantly increased (p = 3.57 x 10-4) and turned synergistic when miR-10a was simultaneously inhibited, and significantly decreased (p = 1.29 x 10-5) and turned antagonistic when miR-10a was overexpressed. (* = p < 0.05, ** = p < 0.01; *** = p< 0.001 by Student’s T-test with error bars representing SD (3-6 replicates per experiment)); and

[0021] Figure 4 provides results of an experiment designed to assess the effectiveness of a combination of Nutlin-3a, cytarabine and miR-10a inhibition on the survival time of animals of an aggressive AML model, namely mice provided with orthotopic xenografts established via tail vein injection of 5* 10 6 OCI- AML3 cells. The figure shows that inhibition of miR-10a markedly improved the survival of mice bearing OCI-AML3 xenografts compared to the control inhibitor group when treated with both Nutlin-3a (A; mean survival 22.9 days vs 34.6 days; p < 0.001) and cytarabine (B; (mean survival 27.4 days for miR-10a inhibitor vs 33.2 days for control inhibitor; p = 0.02), as visualised in Kaplan-Meier survival plots. (C): A combination of cytarabine, Nutlin-3a, and miR-10a inhibition further increased survival (mean 37.1 days) compared to vehicle-only (22.3 days) and cytarabine + control inhibitor "standard-of- care" (SOC) controls (27.4 days). (D-E): This corresponds with significantly reduced hCD45+ leukaemic cell infiltrate in the spleen following 7 days of treatment. Images were collected using a Leica Aperio LV1 Real-time Digital Pathology System (20 χ scan). (* = p < 0.05, ** = p < 0.01; *** = p < 0.001 by

Student’s T-test with error bars representing SD (six 400-600-cell fields quantified per bar)).

DETAILED DESCRIPTION

[0022] A study was conducted to determine whether a novel approach to AML treatment may be based upon (i) inhibiting repression of the p53/Rb pathway (eg through the use of an MDM2/MDMX inhibitor), and (ii) inhibiting miR-10a expression and/or activity, which appears to potentiate repression of the p53/Rb pathway, through the use of an miR-10a inhibitor. In addition, the study aimed to determine whether a prediction of the response to such a treatment of AML could be made by measuring miR-10a expression and/or downstream genes/factors (eg TF ΑΡ20ΊΈ AP2C, TP53Ip53, RB1/ Rb, RBCCll RBCCl and in blood or bone marrow samples. Results described hereinafter (see Example 1) indicate that, for example, a combination of an MDM2/MDMX inhibitor and an inhibitor of miR-10a, optionally with "standard of care" (SOC) treatment with the chemotherapeutic agent cytarabine (cytosine arabinoside or Ara-C), offers significant potential to provide a more effective treatment of AML and, particularly, those overexpressing miR-10a (ie a "miR-10a-high AML", including for example, ), especially in older subjects of 60 years of age or more.

[0023] In a first aspect, this disclosure relates to a method of treating a haematological malignancy, preferably AML, or pre-malignant condition in a subject, said method comprising administering to said subject an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent.

[0024] The method may be applied to the treatment of any haematological malignancy, such as a leukaemia, lymphoma, multiple myeloma and myelodysplastic syndromes (MDS), as well as pre- malignant conditions such as clonal haematopoiesis (CH). However, preferably, the method of the first aspect is applied to the treatment of AML. More preferably, the method is applied to the treatment of an AML overexpressing miR-10a (eg NPM C+ AML). An AML overexpressing miR-10a (ie a miR-1 Oa-high AML) may be readily identified by those skilled in the art. For example, using any suitable assay for miR-10a as will be apparent to those skilled in the art, an AML subject characterised by miR-10a overexpression will show a level of miR-10a in a suitable body sample (eg a blood or bone marrow sample) that is higher than the typical or median level of miR-10a found in a comparable sample taken from a normal patient (eg a healthy patient with no apparent disease). Suitable assays for the determination of the level of expression of miR-10a include quantitative PCR-based assays known to those skilled in the art (eg Quantitative reverse transcriptase polymerase chain reaction (QRT-PCR), Real-time quantitative PCR (RT-PCT) and fluorescence in situ hybridisation (FISH); examples of specific QRT-PCT and RT-PCR assays for the determination ofmiR-10aare described in Zhi Y etal., 2015 [31] and Zhang T-j et al., 2018 [33]; the entire contents of which are both incorporated herein by reference).

[0025] Thus, in some embodiments, where the method is being applied to the treatment of a subject with AML, the subject may be characterised by miR-10a overexpression (ie such that the level of miR-10a present in a blood or bone marrow sample is above the typical or median level found in normal blood or bone marrow samples), and/or by modulation of downstream genes/factors (eg downregulation of any or all of and/or upregulation of For example, in some particular embodiments, the method may be applied to the treatment of a subject characterised by high or overexpression of overexpression (ie such that the level of Mdm4 and/or mRNA present in a blood or bone marrow sample is above the typical or median level found in normal blood or bone marrow samples), especially when under genotoxic stress (ie conditions causing or likely to cause genotoxic (DNA) damage that may introduce mutations that may potentially generate other cancers; such conditions are well known to those skilled in the art and include, for example, treatment with chemotherapeutic drugs like AraC, etoposide, daunorubicin and doxorubicin [17]), and, including, for example, a subject that is also characterised by miR-10 overexpression.

[0026] In other embodiments, where the method is being applied to the treatment of a subject with AML (especially, an AML subject overexpressing miR-10a), the subject may further be characterised by the absence of the following biomarkers; loss of function mutations in the TP 53 and RB1 genes. As such, in some preferred embodiments, the subject may be selected on the basis of at least one of, but preferably all, of the following biomarkers: a high level of expression of miR-10a, absence of a loss of function mutation(s) in TP53, and the absence of a loss of function mutation(s) in RB1, as determined from one or more suitable sample(s). Loss of function mutations in TP53 and RB1 may be readily determined by DNA sequencing.

[0027] The method may be applied to the treatment of a subject with AML (especially, AML overexpressing miR-10a), at any or all of the induction (ie remission induction), consolidation and maintenance (ie post consolidation) phases of AML treatment [51],

[0028] The first agent comprising an inhibitor of MDM2 and/or MDMX may be selected from, for example, any of the MDM2/MDMX inhibitors known to those skilled in the art. As used herein, the terms "MDM2 inhibitor" and "MDMX inhibitor" refer to agents which inhibit interaction between MDM2 and MDMX respectively, and p53. Where the term "MDM2/MDMX inhibitor" is used, it is to be understood that this encompasses agents that inhibit MDM2 selectively (ie agents that have little or no inhibitory action on MDMX; or in other words, have little or no opacity to inhibit the interaction between MDMX and p53), agents that inhibit MDMX selectively (ie agents that have little or no inhibitory action on MDM2; that is, have little or no capacity to inhibit the interaction between MDM2 and p53) as well as agents which inhibit both MDM2 and MDMX (so-called "dual inhibitors").

[0029] Suitable examples of MDM2/MDMX inhibitors include czs-imidazoline compounds, spiro- oxindole compounds, imidazothiazole, dihydroisoquinolinone, piperidine compounds and piperidinone [32], However, in some preferred embodiments, the first agent is a nutlin compound (ie a cz.v-imidazoline compounds) such as Nutlin- 1, Nutlin-2 andNutlin-3 (ie (±>4-[4,5-Bis(4-chlorophenyl>2-(2-isopropoxy- 4-methoxy-phenyl)-4,5-dihydro-imidazole-l-carbonyl]-piperazi n-2-one) [62] [63], and especially the (-)- Nutlin 3 enantiomer known as Nutlin-3a, or a derivative or analogue thereof (eg ((4S,5R)-2-(4-(tert- butyl)-2-ethoxyphenyl)-4,5-bis(4-chlorophenyl)-4,5-dimethyl- 4,5-dihydro-lH-imidazol-l-ylX4-(3- (methylsulfonyl)propyl)piperazin-l-yl)methanone (RG7112) and 4-[[(2R,3S,4R,5S)-3-(3-chloro-2- fluorophenyl)-4-(4-chloro-2-fluorophenyl)-4-cyano-5-(2,2-dim ethylpropyl)pym)lidine-2- carbonyl]amino]-3-methoxybenzoic acid (idasanutlin, RG7388/RO5503781). Such compounds are particularly described in, for example, United States Patent No 7,705,007; the entire disclosure of which is incorporated herein by reference. Other examples of suitable MDM2/MDMX inhibitors include 3-(4- amino- 1-oxo 1 ,3-dihydro-2//-isoindol-2-y 1) piperidine-2, 6-dione (lenalidomide), (2'S,3R,4'S,5'R)-6- chloro-4'-(3-chloro-2-fluorophenyl)-2'-(2,2-dimethylpropyl)- l,2-dihydro-N-(/ra/w-4-hydroxycyclohexyl)- 2-oxo-spiro[3H-indole-3,3'-pyrrolidine]-5'-carboxamide (SAR405838), niraparib (MK4828), milademetan (DS-3032b), (S)-l-(4-chlorophenyl)-7-isopropoxy-6-methoxy-2-(4-(methyl(( (lr,4S)-4-(4- methyl-3-oxopiperazin-l-yl)cyclohexyl)methyl)amino)phenyl)-l ,2-dihydroisoquinolin-3(4H)-one (CGM097), 2-((3R,5R,6S)-5-(3-chlorophenyl)-6-(4-chlorophenyl)-l-((S)-l -(isopropylsulfonyl)-3- methylbutan-2-yl)-3-methyl-2-oxopiperidin-3-yl)acetic acid (AMG232) and (6S)-5-(5-chloro-l,2- dihydro-l-methyl-2-oxo-3-pyridinyl)-6-(4-chlorophenyl>2-( 2,4-dimethoxy-5-pyrimidinyl)-5, 6-dihydro- l-(l-methylethyl>Pyrrolo[3,4-d]imidazol-4(lH)-one (siremadlin; HDM201). In some embodiments, the first agent may comprise two or more inhibitors of MDM2 and/or MDMX. Also, in some embodiments, the first agent may be a dual inhibitor such as the stapled a-helical peptides, ATSP-7041[38] and ALRN- 6924 [39]).

[0030] The second agent comprising an inhibitor of miR-10a may be selected from, for example, any of the miR-10a inhibitors known to those skilled in the art. For example, suitable inhibitors of miR-10a may take the form of a nucleic acid molecule (eg a polynucleotide or oligonucleotide molecule) which encodes interfering RNA (iRNA) targeted to miR-10a or constitutes an inhibitory RNA molecule itself (ie targeting miR-10a), or which provides a cis acting gene regulatory element to repress expression of miR-10a. However, preferably, miR-10a inhibitors for use in the method of the first aspect are selected from anti-microRNA- 1 Oa agents comprising a single-stranded antisense oligonucleotide designed to specifically target mature miRNA 10a which are readily available (eg from Genepharma, Shanghai, China). General approaches to the design and synthesis of inhibitors to miRNAs are provided in International Patent Specification No WO 2005/079397, the entire content of which is incorporated herein by reference. Other suitable examples of miR-10a inhibitors may include various small organic molecules as may be identified by, for example, screening of suitable compound libraries. In addition, suitable miR- 10a inhibitors may include proteins which interact and inhibit miR-10a, as well as oligonucleotide- or peptide-aptamers which specifically bind to and inhibit miR-10a In some embodiments, the second agent may comprise two or more inhibitors of mi R- 10a.

[0031] The chemotherapeutic agent may be selected from, for example, any of the chemotherapeutic agents known to those skilled in the art, but preferably, from those chemotherapeutic agents that may be regarded as "standard" in the art or comprise what is considered a "standard of care" (SOC) chemotherapeutic agent. Suitable standard chemotherapeutic agents may include agents belonging to the classes of alkylating agents (eg cisplatin and derivatives, nitrogen mustard compounds such as chlorambucil and busulfan, nitrosoureas including N-nitroso-N-methylurea (MNU) and carmustine (BCNU), and tetrazine compounds such as dacarbazine and temozolomide), anti-metabolites (eg antifolate compounds such as methotrexate (MTX)), fluoropyrimidines (eg 5-fluorouracil (5FU)), deoxynucleoside analogues (eg cytarabine and gemcitabine), and thiopurines (eg 6-thioguanine (6-TG) and mercaptopurine), anti-microtubule agents (eg Vinca alkaloids and taxanes), and topoisomerase inhibitors (eg the topoisomerase I inhibitors, irinotecan and topotecan, and agents which target topoisomerase Π such as etoposide, teniposide, and merbarone), and cytotoxic antibiotics including bleomycins and anthracycline drugs (eg doxorubicin (adriamycin), daunorubicin (daunomycin), dactinomycin, epirubicin, idarubicin and mitoxantrone), epigenetic drugs (azaciditine, decitabine) and immunotherapy (antibodies and cell therapy). In some embodiments, the chemotherapeutic agent may comprise a combination of two or more chemotherapeutic agents.

[0032] In some preferred embodiments, the chemotherapeutic agent is selected from cytarabine, anthracycline drugs, and combinations of such agents. In some particular examples of such embodiments, the chemotherapeutic agent is cytarabine (ie alone) or cytarabine and daunorubicin, which represent examples of standard of care treatments of AML. For instances where the subject to be treated is over 60 years of age, and especially where the subject to be treated is over 65 years of age, the inclusion of an anthracycline drug such as daunorubicin may be preferably avoided as such drugs can show cardiotoxicity.

[0033] The first agent, second agent and chemotherapeutic agent may, for example, be administered to the subject concurrently (eg in combination) or all separately (ie consecutively) and in any order, or, for example, the first and second agents may be administered concurrently with the chemotherapeutic agent administered before or after, or the chemotherapeutic agent may be administered in combination with either of the first and second agents with the other agent (ie the "remaining" first or second agent as the case may be) administered before or after. However, in some preferred embodiments, the first, second and chemotherapeutic agents are administered concurrently (ie in combination). As used herein, it is to be understood that when administered consecutively, the respective agents may be administered one after another with practically no time interval (ie one is administered effectively immediately after the other) or, otherwise, after an interval of 1 to 5 minutes or more (eg 10 minutes, 30 minutes, 60 minutes, 4 hours or 12 hours between each of the agents). Where one or more of the agents are administered consecutively, they may each be formulated for administration in a pharmaceutical composition form including a pharmacologically acceptable carrier and/or excipient, which may be the same or different. Similarly, where two or more of the agents are administered in combination, then they may be formulated for administration in a single pharmaceutical composition form (including a pharmacologically acceptable carrier and/or excipient) or as two pharmaceutical compositions (eg with a first pharmaceutical composition comprising the first and second agents, and a second pharmaceutical composition comprising the chemotherapeutic composition).

[0034] Where the second agent comprises a nucleic acid molecule (eg a single-stranded antisense oligonucleotide molecule designed to specifically target miR-10a), it may be preferred to formulate the agent so as to improve the efficacy of delivery or transfer to the subject's cells. For example, nucleic acid molecules may be complexed with cationic lipids to form cationic particles known as lipid nanoparticles (LNP), which may optionally be coated with, for example, an electrostatically adsorbed, poly(glutamic acid>based peptide coating to reduce toxicity and/or polyethylene glycol (PEG) to "shield" or neutralise the positive charges of the cationic particles (which can promote electronic association with negatively charged serum proteins, along with subsequent opsonisation and clearance of the particles). Other approaches to the formulation of nucleic acid molecules for therapeutic delivery are reviewed in Tatiparti K el al., Nanomaterials 7:77 (2017).

[0035] Pharmaceutical compositions suitable for use in administering the agents in accordance with the method of the first aspect may optionally comprise other substances such as absorption enhancers including surfactants (eg sodium lauryl sulphate, laureth-9, sodium dodecyl sulphate, sodium taurodihydrofusidate and poly oxyethylene ethers) and chelating agents (eg EDTA, citric acid and salicylates). The pharmaceutical composition^) may be suitable for, for example, oral, buccal, sublingual, nasal, subcutaneous, intramuscular and intravenous administration. In some embodiments, the pharmaceutical composition^) are particularly suitable for iv infusion. In other embodiments, the pharmaceutical composition(s) are particularly formulated for oral administration, and may therefore be provided in dosage forms such as compressed tablets, pills, capsules, caplets, gellules, and drops. [0036] Typically, the pharmaceutical composition^) will be administered to the subject in an amount which is effective for treating the disease (eg AML) and which, in the context of treating AML for example, may therefore result in one or more of the following: reduced leukaemic cell numbers, slowed spread of the disease, and amelioration of one or more AML disease symptom, increased survival, improved quality of life and cure rate for de novo secondary AML, treatment refractory and relapsed AML. A composition comprising the first agent may be administered to provide, for example, an amount of tiie MDM2/MDMX inhibitor that is between about 0.1 and about 100 mg/kg body weight per day, or between about 5 and about 50 mg/kg body weight per day. A composition comprising the second agent may be administered to provide, for example, an amount of the agent comprising an inhibitor of miR-10a that is between about 0.1 and about 100 mg/kg body weight per day, between about 5 and about 15 mg/kg body weight per day of the agent. A composition comprising the chemotherapeutic agent will be administered to provide an amount of the chemotherapeutic agent that is in line with the typical (ie routine) amounts used for the particular chemotherapeutic agent in the clinic. However, it is anticipated that by virtue of the enhanced effect of treating a disease in accordance with the method, amounts of the chemotherapeutic agents may be used that that are lower than the amounts routinely used. In other words, it is anticipated that the method of the first aspect provides an opportunity to use lower doses of the chemotherapeutic agent. Thus, where for example, the chemotherapeutic agent is cytarabine for treating AML, the method may enable the use of a relatively low dose of cytarabine (eg 20-50 mg per day compared to the standard dose of 100 to 200 mg per square meter per day) which may offer advantages such as reduced side-effects (eg ataxia, anaemia, GI disturbances, fever and dermatitis).

[0037] However, notwithstanding the above, it will be understood by those skilled in the art that the administered amount of the first and second agents and the chemotherapeutic agent, and the frequency of administration of any or all of these agents for any particular subject, may vary and depend upon a variety of factors including the activity of the agents, the metabolic stability and length of action of the agents, the age, body weight, sex, mode and time of administration, and the rate of excretion of the agents.

[0038] The pharmaceutical composition(s) may be intended for single daily administration, multiple daily administration, or controlled or sustained release, as needed to achieve the most effective results.

[0039] Preferably, the first agent and second agent are formulated in combination for administration in a single pharmaceutical composition. This enables the consulting physician to readily treat the subject in accordance with the method of the first aspect by using the composition in combination with his/her preferred chemotherapeutic treatment (which may, of course, vary depending upon the characteristics of the subject (eg age) and the stage of the AML disease etc). The combination composition may further comprise, for example, a pharmacologically acceptable carrier and/or excipient, optionally together with others substances such as absorption enhancers (including surfactants and chelating agents) and protease inhibitors (such as aprotinin (trypsin/chymotrypsin inhibitor), amastatin, bestatin, boroleucine, and puromycin (aminopeptidase inhibitors)) for improving bioavailability.

[0040] Typically, the subject will be a human. However, the method of the first aspect may also be applicable to non-human subjects such as, for example, livestock (eg cattle, sheep and horses), exotic animals (eg tigers, lions, elephants and the like) and companion animals (such as dogs and cats).

[0041] The method of the first aspect may further comprise a haematopoietic stem cell transplant (HSC Tx), especially for stronger and/or younger subjects (eg subjects younger than 60 years of age). Techniques for performing such a transplant, often with unrelated HLA matched HSCs, are well known to those skilled in the art [34],

[0042] The first aspect of the present disclosure also relates to the use of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent, for treating AML (preferably an AML overexpressing miR-10a) in a subject.

[0043] In a second aspect, the disclosure relates to a pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent.

[0044] In a third aspect, the disclosure relates to a pharmaceutical composition comprising:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX; and

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity.

[0045] The pharmaceutical compositions of the second and third aspects may be suitable for, for example, oral, buccal, sublingual, nasal, subcutaneous, intramuscular and intravenous administration. The composition may further comprise, for example, a pharmacologically acceptable carrier and/or excipient, optionally together with others substances such as absorption enhancers and protease inhibitors for improving bioavailability, especially oral bioavailability. The composition may be intended for single daily administration, multiple daily administration, or controlled or sustained release, as needed to achieve the most effective results. [0046] In a fourth aspect, the present disclosure relates to a kit comprising first, second and third containers (eg vials), wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity, and the third container contains a chemotherapeutic agent; optionally packaged with instructions for the use of the kit in the method of the first aspect

[0047] Similarly, in a fifth aspect, the present disclosure relates to a kit comprising first and second containers (eg vials), wherein the first container contains a first agent comprising an inhibitor of MDM2 and/or MDMX, and the second container contains a second agent comprising an inhibitor of miR-10a expression and/or activity; optionally packaged with instructions for the use of the kit in the method of the first aspect.

[0048] The first agent second agent and chemotherapeutic agent provided in the containers of the kits may be as described above in relation to the method of the first aspect. The kits may further comprise materials and agents for assaying for the determination of any or all of the biomarkers: miR-10a overexpression, high or overexpression (especially when under genotoxic stress), absence of a loss of function mutation(s) in TP53, and the absence of a loss of functionmutations) in RB1, as described above.

[0049] In a sixth aspect, the present disclosure relates to a method of predicting effectiveness of MDM2 and/or MDMX inhibition in treating an individual with a malignant condition (preferably a haematological malignancy such as AML) or pre-malignant condition, comprising quantifying miR-10a expression and/or modulation of downstream genes/factors (eg downregulation of any or all of , and/or upregulation of in a suitable body sample (eg a blood or bone marrow sample).

[0050] In a further aspect, the present disclosure relates to a method of treating a haematological malignancy or pre-malignant condition (preferably AML) in a subject, said method comprising: quantifying miR-10a expression and/or modulation of downstream genes/factors (eg downregulation of any or all of and/or upregulation of in a suitable body sample (eg a blood or bone marrow sample) to determine whether the subject is suitable for treatment with an inhibitor of MDM2 and/or MDMX; and treating the subject by administering an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent. In some embodiments of this method, the subject is determined as being suitable for treatment with an inhibitor of MDM2 and/or MDMX by quantifying miR-10a expression at a level corresponding to a high level of expression of miR-10a, and/or by quantifying MDM4I Mdm4 expression at a level corresponding to a high level or overexpression of MDM4/Mdm4.

[0051] In a still further aspect, the present disclosure relates to the use of an effective amount of:

(i) a first agent comprising an inhibitor of MDM2 and/or MDMX;

(ii) a second agent comprising an inhibitor of miR-10a expression and/or activity; and

(iii) optionally, a chemotherapeutic agent; for treating a haematological malignancy, preferably AML, or pre-malignant condition in a subject.

[0052] The disclosure is hereinafter expanded by way of the following non-limiting example(s) and accompanying figures.

EXAMPLES

Example 1 Targeting NPMl-mutant AML via reactivation of the p53/Rb tumour suppressor network

[0053] It was hypothesised that miR-10a may represent an oncomiR which contributes to the repression of the p53/Rb pathway by repressing key downstream pathway members including (but not limited to) TFAP2C, CDKN1 A, RB1CC1, T53 and MDM4. As such, the measurement of miR-10a expression in the context of AML may be used to predict how effective MDM2 inhibition may be in patients. Secondly, it was hypothesised that this therapeutic strategy could be enhanced by the simultaneous inhibition of miR- 10a to trigger the de-repression of p53/Rb-related targets. A study was therefore conducted to determine whether (a) quantifying miR-10a in patient blood and/or bone marrow (BM) samples could predict the effectiveness of future MDM2 inhibitor therapy, and (b) dual targeting in such a manner so as to restore p53/Rb tumour suppression leading to selective apoptosis of miR-10a overexpressing AML cells, may represent a potential therapeutic strategy for AML.

Materials and Methods

[0054] Clinical specimens

Primary AML specimens were collected at diagnosis. miRNA was extracted from tissue samples using the mirVana miRNA Isolation Kit (Ambion Inc., Foster City, CA, United States of America) as per the manufacturer's instructions. [0055] Cell lines and transfections

Cell lines were obtained from the American Type Culture Collection (ATCC) and cultured according to their recommendations (www.atcc.org). miR-10a and negative control mi Script mimics and inhibitors (Qiagen NV, Hilden, Germany) were lentivirally-transfected into cultured cells. The sequence of the miR- 10a inhibitor was: UACCCUGUAGAUCCGAAUUUGUG: SEQ ID NO: 1). A p.L287*fs mutation was introduced into the GFP-NPM WT plasmid using the QuikChange II Site-Directed Mutagenesis Kit (Agilent Technologies Inc., Santa Clara, CA, United States of America) and suitable oligonucleotides. CDKNla "Silencer Select" siRNA was obtained from ThermoFisher Scientific (assay s416; Waltham, MA, United States of America).

[0056] Drug sensitivity assays

Mean values of surviving fractions following drug treatment were used to construct growth inhibition curves and for drug combinations to generate a set of Combination Index (Cl) values as calculated by Calcusyn (Biosoft) software, as previously described [14], Cl values of <1, 1, >1 indicated synergism, additive effect, and antagonism, respectively. Mean Cl values reported were the average of at least three independent experiments.

[0057] In vitro assays

The CellTitre 96 Aqueous One Solution Cell Proliferation Assay (MTS) Assay (Promega Corporation, Madison, WI, United States of America) and Click-iT EdU Alexa Fluor 488 Flow Cytometry Cell Cycle Assay (ThermoFisher Scientific) were performed as per the manufacturer's instructions.

[0058] cDNA synthesis and quantitative real-time PCR

For miRNA/miRNA quantification, cDNA was prepared using the Superscript III First-Strand Synthesis SuperMix for qRT-PCR (mRNA; Life Technologies, Carlsbad, CA, United States of America) or the TaqMan MicroRNA Reverse Transcription Kit (miRNA; Applied Biosystems, Foster City, CA, United States of America) and measured using the SYBR Select Mastermix (mRNA; Applied Biosystems) or TaqMan Universal PCR Master Mix (miRNA; hsa-miR-10a assay ID 1093, mu6B assay ID 387; Applied Biosystems). mRNA QPCR primer sequences are shown in Table 1 below. Table 1

Oligonucleotide sequences: Primers used for QPCR (RB1CC1, TFAP2C, and β-Actm) and sile-direcled mutagenesis (NPM1-SDM).

[0059] Antibodies

Annexin V, LC3, p53, Rb, and β-Actin antibodies were obtained from Sigma-Aldrich (St Louis, MO, United States of America).

[0060] Animal studies

To establish NPMl^ AML orthotopic xenografts, 5 χ 106 OCI-AML3 cells were injected into the tail veins of 8- 12-week-old female mice. 12 days after cell delivery, mice were treated with cytarabine (50 mg/kg ip), Nutlin-3a (100 mg/kg oral gavage), a combination of both compounds at the dosages above, or a vehicle control 4 days/week for up to 3 weeks. Ethical endpoint was >20% weight loss or hind limb disability.

[0061] Statistical analysis

Statistical analyses were performed using Prism 9 (Graphpad) and PASW Statistics 18 (SPSS). All results were confirmed in at least three independent experiments. Quantitative data are presented as mean ± SD unless otherwise denoted. Students T tests were used for the comparison of means of quantitative data between groups. Two-way ANOVA was used to compare dose response curves. Univariate Cox regression analyses and Kaplan-Meier plots were used for survival analyses in which the endpoint was overall survival, p values < 0.05 were considered statistically significant and all tests were two-sided. Results

[0062] miR-1 Qa regulates several members of the p 53/Rb network miR-10a directly regulates the p53 regulator MDM4 [15], and also binds to the 3'UTR of two other key p53/Rb network genes: the p21 negative regulator TFAP2C and the Rb positive regulator RBI CC1 [12]. Since these effects may modulate response to MDM2 inhibition, an experiment was conducted to determine whether manipulating the intracellular availability of miR-10a would lead to the modulation of the expression of these genes and therefore, the activity of the p53/Rb network.

[0063] Under physiological conditions, p53 is rapidly turned over and present at low levels [16] and correspondingly, the p53 network genes were also found to be expressed at low basal levels ( data not shown). As a result, neither the inhibition of miR-10a in the miR-10a-high OCI-AML3 cell line nor its overexpression in the miR-1 Oa-low MV4-11 cell line resulted in significant changes to target expression. In cells in which p53 was stabilised however, either by direct upregulation by Nutlin-3a or stress induction by serum starvation, modulation of miR-10a had significant effects, with inhibition resulting in significant upregulation of both TFAP2C and RBCC1 targets, and overexpression resulting in significant downregulation {data not shown). Further demonstrating the requirement of p53 in miR-10a target modulation, p53-/- KYO-1 cells transduced with a miR-10a mimic and similarly treated, displayed no significant effects on target gene expression. As a consequence of miR-10a-mediated modulation of TFAP2C, its transcriptional target p21 was significantly downregulated (4-fold, p < 0.05 for both). Thus, there appears to exist significant crosstalk and positive feedback between the Rb and p53 pathways, with p53 binding to RBCCl to upregulate Rb [18], and Rb binding to MDM2 to stabilise and stimulate the apoptotic function of p53 [19], In accordance with this, it was also found that modulation of these p53/Rb network genes by miR-10a inhibition significantly increased accumulation of p53 itself (data not shown). A similar trend was found in primary patient specimens, in which a strong negative correlation was observed between endogenous miR-10a levels and p53 levels. Together these results confirm that miR- 10a modulates several key members of the p53/Rb stress response network when it is activated by p53.

[0064] Sensitivity to MDM2 inhibitor Nutlin-3a is regulated bv downstream miR-10a gene targets Activation of the p53 network in response to cell damage can promote cytoprotective cell cycle arrest and autophagy or cytotoxic apoptosis depending on the cellular context, with the former responses representing a major determinant of resistance to a wide variety of therapeutic compounds in cancer [20], miR-10a downstream targets p53 (TP53), Rb (RB1) and p21 (CDKN1A) have central roles in this response network. These proteins interact in a highly coordinated manner, including both binding and coregulating one another [18], Hypothesising that these downstream p53-related miR-10a targets may be correlated to therapeutic sensitivity to Nutlin-3a, an analysis was conducted of data from the Genomics of Drug Sensitivity in Cancer (GDSC) database [21], which correlates sensitivity of 265 compounds to genomic features (mutation/loss/gain) across >1000 human cancer cell lines. This revealed that loss of function mutations in TP53 was the strongest predictor of Nutlin-3a resistance of all genomic features present in the database (p = 1.49 χ 10-40). RB1 loss of function was the 4th strongest predictor of Nutlin- 3a resistance (p = 8.12 * 10-7). On the other hand, cell lines with CDKN1A loss of function mutations were vanishingly rare in this dataset (with a mutation rate of 0.01%), thereby precluding a correlation to Nutlin-3a sensitivity. However, amplification of the CDKN1A gene was significantly associated with resistance (p < 0.05 for all). Interestingly, TP53 and RB1 loss of function was also significantly correlated to sensitivity to the AML standard of care (SOC) chemotherapeutic agent, cytarabine.

[0065] In accordance with these findings, endogenous expression of miR- 10a itself in the NCI-60 Human Tumour Cell Line panel [22] was strongly correlated to sensitivity to Nutlin-3a (4th highest correlation of 265 drugs screened in GDSC, with a mean IC50 of 34.1 μΜ for those cell lines that expressed miR-10a below the median level, versus 95.7μΜ for those above (p = 0.008; Figure 1 A-C). Overall, this data indicates that miR-10a and several of its target genes are key mediators of sensitivity to the MDM2 inhibitor Nutlin-3a and the chemotherapeutic agent, cytarabine.

[0066] miR-lQa and/or its downstream targets are biiomarkers of MDM2 inhibitor and cvtarabine responsiveness in AML patient samples

Next it was determined whether the above observations in tumour cell lines could be generalised to primary AML patient samples, potentially identifying miR-10a and/or its downstream gene targets as clinically valuable predictive biomarkers. Drug sensitivity data previously generated [25] from 38 primary pre-treatment AML patient samples (labelled here as the Houston' cohort; clinical and molecular features as previously described [25]) treated ex vivo with the MDM2 inhibitor DS-3032b was therefore correlated to miR-10a target expression. Consistent with the GDSC data, primary samples that were sensitive to MDM2 inhibition (defined as exhibiting an IC50 dose in the lower third of the cohort) expressed significantly higher levels of TFAP2C, TP53 and MDM4 mRNA (1.2-1.9-fold; p < 0.05 for all), and significantly lower levels of CDKN1A (2.1-fold; p < 0.05) compared to non-responsive samples (upper third; Figure 2A). Importantly, similar correlations between the expression of these genes and the clinical response of the same patients to DS-3032b during a clinical trial [25] were also observed (Figure

2B).

[0067] An additional independent cohort ('Munich') of 242 cytogenetically-nonnal AML patients (most of which were derived from German AMLCG 1999 trial [26]; clinical and molecular features as previously described [27]) treated with intensive double-induction and consolidation chemotherapy demonstrated that these targets were also prognostic in patients treated with a cytarabine-based treatment (Figure 2C-E). Patients expressing high levels of TFAP2C or RB1CC1, or low levels of CDKN1A had significantly improved outcome following chemotherapy compared to other patients (hazard ratios (HR) = 0.6, 0.6, and 1.6, respectively (all p < 0.05).

[0068] The predictive value of miR-10a itself in patients treated with cytarabine-based chemotherapy was determined in two further independent, retrospective AML patient cohorts. miR-10a was measured in diagnostic samples immediately prior to treatment and correlated to outcome. The first cohort ('Dresden') comprised a subset of patients ( n = 35) derived from the Study Alliance Leukemia (SAL) AML2003 trial [28, 29], which investigated optimal timing of allogeneic hematopoietic stem cell transplantation (HSCT). Low miR-10a was strongly predictive of improved relapse- free and overall survival in those patients treated with intensive cytarabine-based induction chemotherapy followed by allogeneic stem cell transplantation in remission (hazard ratio (HR) = 10.2 (p = 0.003) and 3.8 ( p = 0.007), respectively;

Figure 2F and 1G). Similar results were shown in a second independent cohort ('Sydney'; n = 23) consecutively collected from AML patients at diagnosis, with low miR-10a also associated with improved overall survival in patients treated with cytarabine-based induction chemotherapy +/- HSCT (HR = 3.1 (p = 0.037); Figure 2H). Together this data supports the hypothesis that miR-10a and/or its downstream targets may provide valuable biomarkers for both MDM2 inhibitor and cytarabine-based therapies.

[0069] miR-10a mediates response to Nutlin-3a and cvtarabine in AML

To confirm the role of miR-10a in response to Nutlin-3a and cytarabine, miR-10a-high AML cell lines OCI-AML3 and IMS-M2 were transduced with a miR-10a inhibitor (Qiagen NV), which resulted in a significant sensitisation to both compounds (Figure 3A and 3B). Conversely, resistance to both compounds could be induced by overexpressing miR-10a in miR-10a-low AML cell lines MV4-11 and HL60 (Figure 3C and3D). The ectopic expression of RBCC1 or knockdown of CDKN1 A alone was sufficient to recapitulate these effects in the absence of miR-10a repression, further confirming the role of these miR-10a target genes themselves in sensitivity to these compounds (Figure 3E-F). Nutlin-3a and cytarabine combined proved to be strongly additive in miR-10a-high cells (Figure 3G). This was made strongly synergistic when combined with miR-10a inhibition, and antagonistic when combined with miR- 10a overexpression, respectively. In particular, the observed level of synergy between Nutlin-3a, cytarabine and miR-10a inhibition corresponded to a potential mean dose reduction of 4.4-fold for Nutlin- 3a and 2.6-fold for cytarabine. Conversely, in miR-10a-low MV4-11 cells, the combination was only weakly additive (Cl = 0.95), which was antagonistic when miR-10a was overexpressed (Cl = 1.30; Figure 3H). These data indicate a significant benefit in combining Nutlin-3a, cytarabine, and miR-10a inhibition in miR-10a-overexpressing AML cells, potentially allowing increased efficacy and/or decreased dosage and therefore toxicity while maintaining equivalent anti-leukaemic activity. [0070] Mutant NPM1 redistributes P53 and together with miR-lOa regulates the switch between p53- mediated autophayv and apoptosis

Activation of the p53/Rb-mediated stress response is potentiated by increased expression of miR-10a target RBCC1 via its direct binding to and stabilisation of p53, and subsequent upregulation of Rb, pl6, and p21 [18], Excessive accumulation of Rb and p53 in the cytoplasm represses pro-survival autophagy and instead promotes intrinsic apoptosis via their direct interaction with Bcl-2 family proteins [23], Consistent with miR-10a's ability to regulate key genes in this network, significantly fewer miR-10a- inhibited OCI-AML3 cells had detectable autophagic vacuoles as determined by monodansylcadaverine (MDC [24]) fluorescence following treatment with Nutlin-3a or cytarabine. Concordantly, these cells also expressed significantly lower levels of the autophagy marker LC3-II compared to controls.

[0071] Cytotoxic stress leading to the activation of cytoprotective autophagy is universally associated with cell cycle arrest mediated by downstream miR-10a target p21 [25], Extended arrest gives the cells sufficient time to repair DNA and recycle organelles before recommencing proliferation, and an inability to do so results in the accumulation of DNA damage and mitotic catastrophe leading to apoptosis [26] [27], OCI-AML3 cells transduced with a scrambled control inhibitor and treated with Nutlin-3a or cytarabine arrested in G0/G1 -phase and S-phase, respectively, as has been previously observed [28] [29]. Conversely, cells transduced with a miR-10a inhibitor were unable to arrest as normal in response to either compound, with significantly more cells escaping arrest and progressing through each checkpoint. The inhibition of autophagy and cell cycle arrest coincided with a significant activation of apoptosis in miR-10a-inhibited, RB 1 CC 1 -overexpressing, or p21 -knockdown cells treated with Nutlin-3a, and to a more modest extent with cytarabine. Together these observations are consistent with miR-10a inhibition potentiating activation of p53/Rb stress response pathway following treatment via RB1CC1 and p21, and which favours the activation of apoptosis over autophagy.

[0072] A combination of Nutlin-3a. cvtarabine and miR-10a inhibition is an effective therapeutic strategy for miR-10a-high AML in vivo

An AML xenograft model was used to investigate whether a cytarabine and Nutlin-3a combination was an effective therapy for miR-10a-high AML in vivo, and to determine whether simultaneously inhibiting miR-10a further increased efficacy. Accordingly, miR-10a-high AML orthotopic xenografts were established via tail vein injection of 5><10 6 cells transduced with a miR-10a or scrambled control inhibitor, resulting in rapid engraftment of aggressive acute leukaemia with a mean survival of just 22 days.

[0073] 12 days after cell delivery (ie to allow for engraftment of the cells and an aggressive acute leukaemia to develop), mice were treated with cytarabine, Nutiin-3a, a combination of the compounds, or a vehicle control 4 days/week for up to 3 weeks. Inhibition of miR-10a markedly improved the survival of animals treated with Nutlin-3a compared to the control inhibitor group (mean survival 22.9 days vs 34.6 days; p < 0.001; Figure 4A). A similar effect was observed in animals treated with cytarabine (mean survival 27.4 days for miR-10a inhibitor vs 33.2 days for control inhibitor; p = 0.02; Figure 4B). Simultaneous treatment with Nutlin-3a, cytarabine, and the miR-10a inhibitor resuhed in the longest overall survival (37.1 days), extending survival by 35% in this aggressive in vivo model compared to the "standard of care" cytarabine + control inhibitor group (p = 0.001; Figure 4C). Improved survival was consistent with significantly lower human CD45 positive (hCD45+) leukaemic cell infiltrate in the spleen of miR-10a inhibited vs control animals collected after 7 days of treatment (Figure 4D-E). Together this data indicates that Nutlin-3a + cytarabine is an effective combination in treating AML, and that simultaneous inhibition of miR-10a further synergises with these compounds to significantly extend survival.

Discussion

[0074] Combination treatment modalities, particularly those that target multiple nodes of the same network, have the potential for increased efficacy, decreased toxicity, and reduced likelihood of drug resistance.

[0075] The work described herein shows that miR-10a and several of its direct and downstream targets are correlated with sensitivity to both MDM2 inhibition and cytarabine in primary patient-derived AML cells treated ex vivo, as well as to clinical response in patients. Early efforts to identify biomarkers of MDM2 inhibitor response focussed on MDM2 and p53 themselves [40] [41], however it has become clear that alone these are not strongly predictive, with one recent study demonstrating that TP53 mutation status had a positive predictive value (PPV) in primary AML cells of just 62% [25]. Since then, three more recent studies have sought to identify multigene biomarker signatures using gene expression profiling of cancer cell lines and primary AML samples [25] [42] [43], This work resulted in gene signatures ranging from 4 to 1532 genes, and PPVs up to 82% when internally validated on patient- derived tumour PDX models and ex vi vo-treated cells (nb. miR-10a downstream targets CDKNla,

MDM4 and TP53 were consistently among the top genes that made up the predictive signatures). Independent validation is required to confirm the power of these panels to ensure model overfitting has not occurred however - an attempt to validate the 4-gene signature in a subsequent study for example [43] demonstrated a PPV no better than using TP53 mutation status itself [25], Implementing gene expression- based signatures clinically also requires specialist expertise and equipment and is more expensive than measuring the expression of a single gene. Importantly, miR-10a may also be attractive as a biomarker of cytarabine-based therapy with which MDM2 inhibition has shown synergy [44], and can be effectively targeted therapeutically using miRNA inhibitors to sensitise to the combination therapy that has been demonstrated here. [0076] MDM2 inhibitors such as Nutlin-3a triggers the massive intracellular accumulation of p53 resulting in the activation of one (or sometimes both) of the tumour suppressors’ contrasting canonical signalling networks - either cytoprotective, promoting cell cycle arrest, autophagy and DNA repair, or cytotoxic, promoting cell death via the activation of apoptosis [37] [45], Cell fate depends heavily on the status of key nodes within these signalling networks [46], of which four - p21, Rbl, MDM4 and p53 itself - are shown here to be both downstream targets of miR-10a as well as the most important determinants of cellular sensitivity to both Nutlin-3a and cytarabine. miR-10a regulates cell cycle inhibitor p21 by directly binding to and downregulating its repressor TFAP2C [13], with miR-10a inhibition ameliorating the ability of p53 to upregulate p21 in response to genotoxic stress, coinciding with an inability to initiate cell cycle arrest and the subsequent activation of apoptosis. These observations are consistent with p21’s function as a key determinant of the switch between p53’s cytoprotective and cytotoxic roles. Repression of p21 also directly upregulates p53 itself in response to DNA damaging chemotherapeutics, thereby promoting apoptosis by increasing the intracellular Bax/Bcl2 ratio [45], For these reasons, p21 antisense therapy has proven to be a viable adjuvant to DNA damaging therapeutics via its promotion of apoptosis in preclinical in vivo models [47], and helps explain the synergy between Nutlin-3a and miR-10a inhibition observed here. To sum up, the upregulation of TFAP2C by miR-10a inhibition similarly synergises with Nutlin-3a to tip the cellular balance away from autophagy and towards apoptosis.

[0077] miR-10a also directly targets RB1CC1 [13], which plays an essential role in the induction of autophagy in mammalian cells [48], Autophagy is an evolutionarily-conserved mechanism activated in response to cell stress that acts as a buffer against damaging stimuli, in which damaged cytosolic components and organelles are degraded and recycled through the lysosomal machinery [49], The activation of autophagy therefore normally results in resistance to weak-to-moderate cytotoxic stressors, including sublethal concentrations of chemotherapeutic agents [50], As with other stress response pathways, autophagy is universally associated with cell cycle arrest, requiring the induction of p21- mediated cellular senescence for successful execution [34], Here it has been shown that loss of p21 coincided with the inhibition of autophagy activation, as has been observed previously [51], RB1CC1 is also central to p53-mediated damage sensing and like p53 plays a dual role in the response to cell stress. When cell repair pathways are overwhelmed by cytotoxic or genotoxic injury, RB1CC1 switches from its canonical role as an inducer of cytoprotective autophagy to one of classical tumour suppressor and apoptosis inducer. This fundamental switch, evolutionarily conserved from nematodes to mammals, is primarily determined by the abundance of p53 in the cytoplasm. Accumulation of the cytoplasmic pool of p53 functions as a measure of genotoxic damage in this case, and its depletion is required before autophagy can be initiated [52] [53], Loss of p21 can also further shift the equilibrium of p53 from the nucleus to the cytoplasm, in an effect which can be reversed by the reintroduction of p21 back into p21-Z- cells [54], p53 tonically represses the apical step of autophagy initiation in the cytoplasm by binding to RB1CC1, which strongly induces the expression of pl6, p21 and Rb proteins [55] [20] [56], This occurs simultaneously with preprogramed cell death stimulated via the direct interaction of p53 with Bcl2 family apoptotic proteins in the cytoplasm, triggering mitochondrial membrane permeabilisation and the intrinsic pathway of apoptosis [30] [57], In this way, the upregulation of RB1CC1 by miR-10a inhibition similarly synergises with Nutlin-3a to tip the cellular balance away from autophagy and towards apoptosis.

[0078] Similarly, miR-10a target MDM4, shown here to be upregulated in primary AML cells sensitive to the MDM2 inhibitor DS-3032b as well as in samples from responders in a clinical trial, exhibits pleotropic effects depending on cellular context. MDM4's canonical role in non-stressed cells is to cooperate with the central p53 inhibitor MDM2 to enhance its E3 ubiquitin ligase activity which marks p53 for degradation. In response to DNA damage however, it can stabilise the secondary structure of the TP53 mRNA via interaction with its C-terminal RING domain, which conversely promotes the induction of p53 synthesis. In addition, in this context it can compete with MDM2 for p53 binding which stimulates p53 stabilisation and relocalisation to the cytoplasm [17] where p53 can further contribute to apoptotic activation. For these reasons, AML cells that express high endogenous MDM4 levels under genotoxic stress can be highly sensitive to MDM2 inhibition [17], MDM2 similarly promotes ubiquitin-dependent degradation of the Rb protein [35] in a process which is inhibited by competitive binding by MDM4, resulting in the activation of the Rb network when MDM4 is upregulated [36], Like p53, this interaction is likely to be dependent on cellular context, and promoted in response to genotoxic stress. The data indicates that these mechanisms are central to the efficacy of the miR-10a inhibitor / MDM2/MDMX inhibitor / cytarabine combination and result in a cellular bias away from autophagy and towards apoptosis in in vitro and in vivo models.

[0079] These mechanisms likely explain the synergy observed between Nutiin-3a, cytarabine, and miR- 10a inhibition in the in vivo model in which it significantly improved survival. In AML specifically, MDM2 inhibition has shown useful activity as both a single agent and with cytarabine, though thus far in undefined clinical subgroups [58], The data here indicates that a biomarker-driven approach using miR- 10a may allow optimal targeting of the most responsive patients. While the use of miRNA inhibitors as therapeutic molecules is still in its infancy, there have been a number of successful non-human primate in vivo studies and early clinical trials that have shown promise, combining efficacy with an acceptable toxicity profile [59-61], Further investigations into the use of the combination therapy of the present disclosure, either to increase efficacy or decrease the dose of either (or both) compounds while maintaining equivalent efficacy, are therefore warranted, and may represent an efficacious treatment strategy for a significant subgroup of AML patients. [0080] Throughout the specification and the claims that follow, unless the context requires otherwise, the words "comprise" and "include" and variations such as "comprising" and "including" will be understood to imply the inclusion of a stated integer or group of integers, but not the exclusion of any other integer or group of integers.

[0081] The reference to any prior art in this specification is not, and should not be taken as, an acknowledgement of any form of suggestion that such prior art forms part of the common general knowledge.

[0082] It will be appreciated by those skilled in the art that the subject matter described herein is not restricted in its use to the particular application described. Neither is the subject matter restricted in its preferred embodiment with regard to the particular elements and/or features described or depicted herein, but is capable of numerous rearrangements, modifications and substitutions without departing from the scope as set forth and defined by the following claims.

REFERENCES

1. Kastenhuber, E.R. and S.W. Lowe, Puttingp53 in Context. Cell, 2017. 170(6): p. 1062-1078.

2. Donehower, L.A., et al., Mice deficient for p53 are developmental normal but susceptible to spontaneous tumours. Nature, 1992. 356(6366): p. 215-21.

3. Cancer Genome Atlas Research, N., et al., Genomic and epigenomic landscapes of adult de novo acute myeloid leukemia. NEngl J Med, 2013. 368(22): p. 2059-74.

4. Toledo, F., etal.,v4 mouse p53 mutant lacking the proline-rich domain rescues Mdm4 deficiency and provides insight into the Mdm2-Mdm4-p53 regulatory network. Cancer Cell, 2006. 9(4): p. 273-85.

5. Seipel, K., et al., Inactivation of the p53-KLF4-CEBPA Axis in Acute Myeloid Leukemia. Clin Cancer Res, 2016. 22(3): p. 746-56.

6. Colombo, E., et al. , Delocalization and destabilization of the Arf tumor suppressor by the leukemia-associated NPM mutant. Cancer Res, 2006. 66(6): p. 3044-50.

7. Falini, B., et al., Cytoplasmic nucleophosmin in acute myelogenous leukemia with a normal karyotype. N Engl J Med, 2005. 352(3): p. 254-66.

8. Bolli, N., et al., A dose-dependent tug of war involving the NPM1 leukaemic mutant, nucleophosmin, and ARF. Leukemia, 2009. 23(3): p. 501-9.

9. Zhang, Y., Y. Xiong, and W.G. Yarbrough, ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways. Cell, 1998. 92(6): p. 725-34.

10. Burgess, A., et al., Clinical Overview ofMDMl'X-Targeted Therapies. Front Oncol, 2016. 6: p.

7.

11. Yee, K. , et al., Phase I/lb Study of RG7388, a Potent MDM2 Antagonist, in Acute Myelogenous Leukemia (AML) Patients (Pts). Blood, 2014. 124(21): p. 116.

12. Ray-Coquard, I., et al., Effect of the MDM2 antagonist RG7112 on the P53 pathway in patients with MDM2-amplified, well-differentiated or dedifferentiated liposarcoma: an exploratory proof- of-mechanism study. Lancet Oncol, 2012. 13(11): p. 1133-40.

13. Bryant, A., et al., miR-lOa is aberrantly overexpressed in Nucleophosminl mutated acute myeloid leukaemia and its suppression induces cell death. Mol Cancer, 2012. 11: p. 8.

14. Ovcharenko, D., et al., miR-lOa overexpression is associated with NPM1 mutations and MDM4 downregulation in intermediate-risk acute myeloid leukemia. Exp Hematol, 2011. 39(10): p. 1030-1042 e7.

15. Foucquier, J. and M. Guedj, Analysis of drug combinations: current methodological landscape. Pharmacol Res Perspect, 2015. 3(3): p. e00149. 16. Garzon, R, et al., Distinctive microRNA signature of acute myeloid leukemia bearing cytoplasmic mutated nucleophosmin. Proc Natl Acad Sci U S A, 2008. 105(10): p. 3945-50.

17. Tan, B.X. etai, High Mdm4 levels suppress p53 activity and enhance its half-life in acute myeloid leukaemi. Oncotarget, 20145(4): p. 933-43.

18. McShane, L.M., et al., REporling recommendations for tumour MARKer prognostic studies (REMARK). Br J Cancer, 2005. 93(4): p. 387-91.

19. Mirzayans, R, et al., Ionizing radiation-induced responses in human cells with differing TP53 status. IntJMol Sci, 2013. 14(11): p. 22409-35.

20. Chano, T., et al., RB1CC1 activates RB1 pathway and inhibits proliferation and cologenic survival in human cancer. PLoS One, 2010. 5(6): p. el 1404.

21. Hsieh, J.K., et al., RB regulates the stability and the apoptotic function of p53 via MDM2. Mol Cell, 1999. 3(2): p. 181-93.

22. Yang, W., et al., Genomics of Drug Sensitivity in Cancer (GDSC): a resource for therapeutic biomarker discovery in cancer cells. Nucleic Acids Res, 2013. 41(Database issue): p. D955-61.

23. Sokilde, R, et al., Global microRNA analysis of the NCI-60 cancer cell panel. Mol Cancer Ther, 2011. 10(3): p. 375-84.

24. Weinstein, J.N. and Y. Pommier, Transcriptomic analysis of the NCI-60 cancer cell lines. C R Biol, 2003. 326(10-11): p. 909-20.

25. Ishizawa, J., et al. , Predictive Gene Signatures Determine Tumor Sensitivity to MDM2 Inhibition. Cancer Res, 2018. 78(10): p. 2721-2731.

26. Buchner, T., et al., Double induction containing either two courses or one course of high-dose cytarabine plus mitoxantrone and postremission therapy by either autologous stem-cell transplantation or by prolonged maintenance for acute myeloid leukemia. J Clin Oncol, 2006. 24(16): p. 2480-9.

27. Metzeler, K.H., et al., An 86-probe-set gene-expression signature predicts survival in cytogenetically normal acute myeloid leukemia. Blood, 2008. 112(10): p. 4193-201.

28. Rollig, C., et al., Allogeneic stem-cell transplantation in patients with NPMl-mutated acute myeloid leukemia: results from a prospective donor versus no-donor analysis of patients after upfront HLA typing within the SAL- AML 2003 trial. J Clin Oncol, 2015. 33(5): p. 403-10.

29. Schetelig, J., et al., Hematopoietic ceU transplantation in patients with intermediate and high-risk AML: results from the randomized Study Alliance Leukemia (SAL) AML 2003 trial Leukemia, 2015. 29(5): p. 1060-8.

30. Chipuk, J.E., et al., Direct activation of Bax by p53 mediates mitochondrial membrane permeabilization and apoptosis. Science, 2004. 303(5660): p. 1010-4.

31. Zhi Y et al.. Serum level ofmiR-10-5p as a prognostic biomarker for acute myeloid leukemia. Int J Hematol, 2015. 102:p. 296-303. 32. Hilgendorf, K.I., et al., The retinoblastoma protein induces apoptosis directly at the mitochondria. Genes Dev, 2013. 27(9): p. 1003-15.

33. Zhang T-j et al., Bone marrow mill-lOa overexpression is associated with genetic events but not affects clinical outcome in acute myeloid leukemia. Pathol Res Pract, 2018. 214:p. 169-73.

34. Goehe, R.W., et al., The autophagy-senescence connection in chemotherapy: must tumor cells (self) eat before they sleep? J Pharmacol Exp Ther, 2012. 343(3): p. 763-78.

35. Uchida C el al.. Enhanced Mdm2 activity inhibits pRB function via ubiquilin ^dependent degradation. EMBO J. 2005. 24(l):p. 160-9.

36. Uchida C et al., Effects of MdmX on Mdm2-mediated downregulation of pRB. FEES Lett. 2006. 580(7):p. 1753-8.

37. Waldman, T., et al., Uncoupling ofS phase and mitosis induced by anticancer agents in cells lacking p21. Nature, 1996. 381(6584): p. 713-6.

38. Chang YS el al., The potential of targeting P 53 andHSP90 overcoming acquired MAPKi- resistant melanoma Proc Natl Acad Sci U S A. 2013. 110(36):E3445-54.

39. Meric-Bemstam F et al., J Clin Oncol. 2017. 35(15 suppl):2505.

40. Reis, B., et al., Acute myeloid leukemia patients' clinical response to idasanuilin (RG7388) is associated with pre-treatment MDM2 protein expression in leukemic blasts. Haematologica, 2016. 101(5): p. el 85-8.

41. Kojima, K., et al., MDM2 antagonists induce p53-dependent apoptosis in AML: implications for leukemia therapy. Blood, 2005. 106(9): p. 3150-9.

42. Jeay, S., et al.,v4 distinct p53 target gene set predicts for response to the selective p53-HDM2 inhibitor NVP-CGM097. Elife, 2015. 4.

43. Zhong, H., et al., MDM2 antagonist clinical response association with a gene expression signature in acute myeloid leukaemia. Br J Haematol, 2015. 171(3): p. 432-5.

44. Yee, K., et al., Phase lb Study Of The MDM2 Antagonist RG7112 In Combination With 2 Doses Schedules Of Cytarabine. Blood, 2013. 122(21): p. 498.

45. Javelaud, D. and F. Besancon, Inactivation of p21WAFl sensitizes cells to apoptosis via an increase of both pl4ARl·’ and p53 levels and an alteration of the Bax/‘Bcl-2 ratio. J Biol Chem, 2002. 277(40): p. 37949-54.

46. Sionov, R.V. and Y. Haupt, The cellular response to p53: the decision between life and death. Oncogene, 1999. 18(45): p. 6145-57.

47. Tian, H., E.K. Wittmack, and T.J. Jorgensen, p21WAFl/CIPl antisense therapy radiosensittes human colon cancer by converting growth arrest to apoptosis. Cancer Res, 2000. 60(3): p. 679-

84.

48. Kara, T., et al., FIP200, a ULK-interacling protein, is required for aulophagosome formation in mammalian cells. J Cell Biol, 2008. 181(3): p. 497-510. 49. Eisenberg-Lemer, A., et al., Life and death partners: apoptosis, autophagy and the cross-talk between them. Cell Death Differ, 2009. 16(7): p. 966-75.

50. Kumar, A., U.K. Singh, and A. Chaudhary, Targeting autophagy to overcome drug resistance in cancer therapy. Future Med Chem, 2015. 7(12): p. 1535-42.

51. Mohapatra, P., et al., Quinacrine-medialed autophagy and apoptosis in colon cancer cells is through a p53- and p21 -dependent mechanism. Oncol Res, 2012. 20(2-3): p. 81-91.

52. Tasdemir, E., et al., A dual role ofp53 in the control of autophagy. Autophagy, 2008. 4(6): p. 810-4.

53. Tavemarakis, N., et al., The effects of p53 on whole organism longevity are mediated by autophagy. Autophagy, 2008. 4(7): p. 870-3.

54. Pang, L.Y., et al., p21(WAFl ) is component of a positive feedback loop that maintains the p53 transcriptional program. Cell Cycle, 2011. 10(6): p. 932-50.

55. Morselli, E., et al .,p53 inhibits autophagy by interacting with the human ortholog of yeast Algl7, RB1CC1/FIP200. Cell Cycle, 2011. 10(16): p. 2763-9.

56. Chano, T, et al., Identification of RB1CC1, a novel human gene that can induce RB1 in various human cells. Oncogene, 2002. 21(8): p. 1295-8.

57. Boya, P., et al., Inhibition of macroautophagy triggers apoptosis. Mol Cell Biol, 2005. 25(3): p. 1025-40.

58. Andreeff, M., et al., Results of the Phase I Trial qfRG7112, a Small-Molecule MDM2 Antagonist in Leukemia. Clin Cancer Res, 2016. 22(4): p. 868-76.

59. Christopher, A.F., et al., MicroRNA therapeutics: Discovering novel targets and developing specific therapy. Perspect Clin Res, 2016. 7(2): p. 68-74.

60. Lanford, R.E., et al., Therapeutic silencing of microRNA-122 in primates with chronic hepatitis C virus infection. Science, 2010. 327(5962): p. 198-201.

61. Rayner, K. J., et al., Inhibition of miR-33a?b in non-human primates raises plasma HDL and lowers VLDL triglycerides. Nature, 2011. 478(7369): p. 404-7.

62. Shangary S andx S Wang. Annu Rev Pharmacol Toxicol 49:223-241 (2008).

63. Vassilev LT et aL, In Vivo Activation of the p53 Pathway by Small-Molecule Antagonists of MDM2. Science. 2004. 303(5659):p. 844-48.