FIELD OF INVENTION

[001] The present invention relates to a method for generation of genetically modified microorganism through homologous recombination. Furthermore, it relates to production of zeaxanthin from the genetically modified microorganism.

BACKGROUND OF INVENTION

[002] Carotenoids are a group of structurally and functionally diverse isoprenoid pigments, naturally produced by plants and microorganisms (Ravanello et ah, 2003). Animals have to obtain them through dietary intake, thereby constituting an essential nutritional supplement. Owing to their applications in food, pharmaceutical and healthcare industries, the global carotenoid market has been projected to grow from USD 1.2 billion in 2010 to USD 1.4 billion in 2018 with a compound annual growth rate of 2.3% (BCC Report, 2011; Berman et al., 2014).

[003] Amongst xanthophylls, lutein and zeaxanthin are known to have efficient anti-oxidant and free radical scavenging capabilities over carotenes (Li et ah, 2014). They protect the cell against photo -oxidative damage, chiefly by quenching undesirable chlorophyll triplets, thus preventing the formation of highly reactive singlet oxygen species.

[004] Zeaxanthin, C ₄ o yellow coloured xanthophyll with 11 conjugated double bonds, has higher ability to quench singlet oxygen than lutein (10 conjugated double bonds). All-trans zeaxanthin (3, 3'-dihydroxy-P-carotene) is a thermodynamically active form of zeaxanthin and is predominantly involved with cellular photo- protection by quenching and/or scavenging excessive light (Li et ah, 2014). Due to its strong anti-oxidant capacity, it is effective even in lower dosage and thus has become an integral part of ocular health products (Vachali et ah, 2012). In addition to this, zeaxanthin also finds application in prevention of cardiovascular diseases and in some types of cancers (Kim et al, 2017). In 2012, the European Food Safety Authority (EFSA) suggested a daily intake of zeaxanthin (0.75 mg/ kg body weight) to reduce likelihood of incidences of carcinogenesis. Although zeaxanthin market is still young, it has been estimated to reach almost USD 15-20 million by 2018 (BCC Reports, 2011).

[005] Current commercial products based on zeaxanthin for human consumption contain only 5-15% natural zeaxanthin; extracted from Tagetes erecta flowers, Capsicum, etc. (Berman et al., 2014). Although zeaxanthin is commercially obtained from plants, their production and marketing have major obstacle of seasonal and geographical variations. Chemically synthesized zeaxanthin, on the other hand contains hazardous by-products and generate harmful wastes (Carlos et al., 2014). Most of the reported zeaxanthin sources including green-leafy vegetables have 15- 20% lutein and only 2-3% zeaxanthin (Lin et al., 2015). Moreover, due to their similar molecular structures, separation of lutein and zeaxanthin becomes challenging and subsequently leads to multiple downstream unit operations for purifying zeaxanthin, ultimately lowering its yield and affecting the cost economy. Therefore, microbial production systems for zeaxanthin synthesis have been considered to be efficient over the current sources (Li et al., 2014). SUMMARY OF THE INVENTION

[006] In an aspect of the present disclosure, there is provided a method of producing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: 1 ; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria. [007] In an aspect of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO:l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[008] In an aspect of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[009] In an aspect of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[0010] These and other features, aspects, and advantages of the present subject matter will be better understood with reference to the following description and appended claims. This summary is provided to introduce a selection of concepts in a simplified form. This summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.

BRIEF DESCRIPTION OF ACCOMPANYING DRAWINGS [0011] The following drawings form a part of the present specification and are included to further illustrate aspects of the present disclosure. The disclosure may be better understood by reference to the drawings in combination with the detailed description of the specific embodiments presented herein.

[0012] Figure 1 represents a schematic representation of the overall experimental work conducted at every step (KEGG, Kyoto Encyclopedia of Genes and Genomes; IC, incubator; EL, environmental laboratory), in accordance with an embodiment of the present disclosure.

[0013] Figure 2 represents algal characterization for xanthophyll biosynthesis: A) Carotenoid backbone synthesis pathway adapted from KEGG pathway (map00906) shows that PCC 7942, PCC 6803 and PCC 7002 do not possess genes for biosynthesis of lutein. Secondly, PCC 7942 lack genes for directing the flux of β-carotene and lutein towards any other carotenoid. B) Representative HPLC chromatograms from eukaryotic microalgae and cyanobacteria for lutein and zeaxanthin. Eukaryotic microalgae displays 2 partially overlapping peaks corresponding to zeaxanthin and lutein, however cyanobacteria show single peak corresponding to zeaxanthin. C) HPLC peaks of zeaxanthin and lutein in pigment extracts from algae were confirmed by spiking the standard zeaxanthin with standard lutein, where the lutein was seen to get partially resolved at higher RT than zeaxanthin, in accordance with an embodiment of the present disclosure.

[0014] Figure 3 represents a method for selection of the host species. A) Relative rate of zeaxanthin synthesis from well characterized model cyanobacterial species showed that PCC 7942 displays higher relative rate over PCC 6803 and PCC 7002. Thus, PCC 7942 was selected as a host organism for further cloning. (*p<0.05) B) Neighbour joining distance tree constructed for obtaining the most diverged CrtR sequences for that from PCC 7942 using multiple sequence alignment of polynucleotide sequences from different Synechococcus strains. Higher divergence was obtained for the CrtR sequence from PCC 7002. Thus, PCC 7002 was selected as a source organism for CrtR. C) Polypeptide sequence alignment dot-matrix plot for β-carotene oxygenase proteins from PCC 7942 and PCC 7002, in accordance with an embodiment of the present disclosure.

[0015] Figure 4 represents colony PCR of PCC 7942 Tr. (A). Two genetic constructs were synthesized possessing only CrtR (pR48) and an operon construct having CrtR and GalP genes (pRG48) under the control of Ptrc promoter, in PCC 7942 compatible vector, pAM2991. (B) Colony PCR of PCC 7942 transformants and agarose gel electrophoresis using 5'NSI_F and 3' NSI_R (neutral site primers for PCC 7942 genome) exhibited the bands corresponding to 1.2 kbps (lane 1) for the clones possessing pR48 plasmid; Synechococcus 79R48, and 2.8 kbps for pRG48 possessing mutants (lane 3), Synechococcus 79RG48. Amplicon obtained from recombinant plasmid pRG48 (positive control, lane 2) showed same band size as lane 3 and no visible bands were observed with WT PCC 7942 colony and template free PCR mixture as negative control (lanes 4 and 5, respectively), in accordance with an embodiment of the present disclosure.

[0016] Figure 5 represents coomassie stained SDS-PAGE profiles of proteins from A) E. coli cells transformed with pR48 (Lane 1) and pAM2991 (Lane 2) plasmids, and B) induced Tr Synechococcus 79R48 (Lane 1) and WT (Lane 2) PCC 7942 whole cell extracts. The CrtR protein in the induced samples in lane 1 of both the gels is visible as pronounced 34 kDa band, in accordance with an embodiment of the present disclosure.

[0017] Figure 6 represents relative flux analysis. Relative flux of β-carotene towards zeaxanthin (coz) and fraction of uncoverted β-carotene (COB,B) were analysed for both Tr and WT PCC 7942, in IC and EL. Results displayed that Tr IC and EL under autotrophy and mixotrophy had higher flux as compared to that of WT. As a consequence, COB,B values are higher for WT than Tr, in accordance with an embodiment of the present disclosure.

[0018] Figure 7 represents carotenoid and growth profiles of Synechococcus 79RG48 Tr and WT PCC 7942. Synechococcus 79RG48 transformants grown in EL were analysed for their biomass (DCW, g/L), glucose uptake (g/L) and pigment profiles. A) HPLC analysis of methanol extracts of Tr and WT with Abs ₇₃ o 1.0 density cell suspensions showed increased AUC for zeaxanthin (Z) and corresponding decrease in β-carotene (B) peaks. B) Growth and glucose uptake profiles shows that Tr grown mixotrophically (MIXO) in BG-11 + 1% glucose has improved biomass production over WT and autotrophically grown Tr (AUTO), with concurrent reduction in the amount of residual glucose in the medium. WT and autotrophically grown Tr show almost same biomass production, in accordance with an embodiment of the present disclosure.

[0019] Figure 8 represents comparative carotenoid yields. Zeaxanthin and β- carotene yields (mg/ g DCW) from WT and Tr PCC 7942 cells were compared. Results indicated that the zeaxanthin content was comparatively higher amongst Tr while WT displayed lower zeaxanthin yield as compared to β-carotene. Due to improved flux towards zeaxanthin, Synechococcus 79RG48 Tr exhibited increased zeaxanthin yield of 9 and 8 mg/ g DCW under autotrophy and mixotrophy in EL, which was almost double than that with WT, in accordance with an embodiment of the present disclosure.

[0020] Figure 9 represents positive ion ESI mass spectroscopic analysis, ESI (+)- MS was performed to verify the peak corresponding to that of the standard of all-trans zeaxanthin. The product ion spectra displayed similar fragmentation pattern of protonated (M+H) ⁺ zeaxanthin fragment corresponding to 551.4 and (MH-H ₂ 0) ⁺ fragment of 569.4 as that of the standard, in accordance with an embodiment of the present disclosure.

[0021] Figure 10 represents quantum carotenoid yield and quantum biomass yield for different recombinant cyanobacteria under different conditions, in accordance with an embodiment of the present disclosure.

SEQUENCES

[0022] SEQ ID NO: 1 depicts crtRl gene of Synechococcus elongatus PCC7942. atgtcagaggctcaaacgcccctgacagtaccgaagaagtttcttggtgctccaggaggc ttcaaccccaccgtcgcact cttcttggcaggttatacctgcgcggcgctctcagttttggggtactggtgctggagttg gccccactggctatctttccttct gagtgtcacagccttacatttggtaggcaccgtcattcacgatgcctctcataatgtggc tcacgccagtcgcattctgaatg cgattttgggacatggcagtgcactattgctgggctttacttttccggtgtttacgcggg ttcacctgcaacatcacgcccac gtcaacgatcccaagaacgatcccgaccacatcgtttccacctttgggccgctgtggttg atcgcaccgcgcttcttctatc acgagatctatttcttccagcgccgcctttggaagaaatttgaattactcgaatggttcc tcagtcgcgctgtggtcatcggc atctttgcctgcggcgtcaagtttggcttcctgggcttcctgatgaactactggctggct ccagccttggtcgttggcattgc cctaggactcttcttcgactatttaccccaccgccccttccaagagcgcaaccgctggcg caatgcacgggtctatcccgg tcaggtgatgaacatcctgatcatgggtcagaactatcacctgatccatcacctctggcc atcgatcccctggtatctctacc gaccggcctaccacgctaccaagccgttgttggacctacgccagtcgccgcaaacgctcg ggattctctccagcaaaaa agatttctggaactttatctacgacgttttcatcggcatccgcattcaccaatcgcacga ggctgagccgcagagctccgtc gttcctgaaacgaagtcgagtgaatcagccgttctcgcaaaagctccgatgtctgccaca gaagactctcgtgagccagc cttgacgaagtag

[0023] SEQ ID NO: 2 depicts crtR2 gene of Synechococcus elongatus PCC7002. atgacggcggcggcagcgtcatcattggtaatgtcaagggagtatttgcgtccccctggt gggatgaaccctaatgtgtg gatggtcatcatcgcagtaggattgatcgccacctccgtgggaggctattggttttgggg ttggtatgactggatttgcttcc tagaaaacgttttagcgctgcaccttgcgggaacggtgatccacgatgcgtcccaccgtg ccgcccatagcaaccgtgc ggtcaataccatcttgggccatgccagtgccctaatgctgggatttgctttcccggtttt tacccgggtccatctccagcacc acgcccatgtcaatgatcctgaaaatgatccggatcatttcgtttcgactggcggccccc tctggatgattgcagcccgtttt ttctaccacgaaatctttttctttaagcgtcgtctgtggaaaaattacgaattactggag tggttccttagccgtgcttttttagg agtcattgtctacctaggcatccagtatggcttcattggctacatcatgaacttttggtt tgttccggccctggtggttggtattg ccctgggtttgttctttgattatttaccccatcgtccctttgaagaacgcgatcgctgga aaaatgccagggtttacccaagc aagctcctcaatcttttgatccttgggcaaaattaccacctagtccatcacctgtggccc tcaattccttggtataagtatcaac ccgcctattactacatcaagcccctgttagatcaaaaaggttctccccaatcattagggc tgctccagggaaaagattttctc agtttcctctacgatatttttgtgggcattcgcctgcaccacaaacccaaatcctaa

[0024] SEQ ID NO: 3 depicts galP gene.

atgcctgacgctaaaaaacaggggcggtcaaacaaggcaatgacgtttttcgtctgc ttccttgccgctctggcgggatta ctctttggcctggatatcggtgtaattgctggcgcactgccgtttattgcagatgaattc

cagattacttcgcacacgcaagaatgggtcgtaagctccatgatgttcggtgcggca gtcggtgcggtgggcagcggct ggctctcctttaaactcgggcgcaaaaagagcctgatgatcggcgcaattttgtttgttg ccggttcgctgttctctgcggct gcgccaaacgttgaagtactgattctttcccgcgttctactggggctggcggtgggtgtg gcctcttataccgcaccgctgt acctctctgaaattgcgccggaaaaaattcgtggcagtatgatctcgatgtatcagttga tgatcactatcgggatcc tcggtgcttatctttctgataccgccttcagctacaccggtgcatggcgctggatgctgg gtgtgattatcatcccggcaattt tgctgctgattggtgtcttcttcctgccagacagcccacgttggtttgccgccaaacgcc gttttgttgatgccgaacgcgtg ctgctacgcctgcgtgacaccagcgcggaagcgaaacgcgaactggatgaaatccgtgaa agtttgcaggttaaacag agtggctgggcgctgtttaaagagaacagcaacttccgccgcgcggtgttccttggcgta ctgttgcaggtaatgcagca attcaccgggatgaacgtcatcatgtattacgcgccgaaaatcttcgaactggcgggtta taccaacactaccgagcaaat gtgggggaccgtgattgtcggcctgaccaacgtacttgccacctttatcgcaatcggcct tgttgaccgctggggacgtaa accaacgctaacgctgggcttcctggtgatggctgctggcatgggcgtactcggtacaat gatgcatatcggtattcactct ccgtcggcgcagtatttcgccatcgccatgctgctgatgtttattgtcggttttgccatg agtgccggtccgctgatttgggta ctgtgctccgaaattcagccgctgaaaggccgcgattttggcatcacctgctccactgcc accaactggattgccaacatg atcgttggcgcaacgttcctgaccatgctcaacacgctgggtaacgccaacaccttctgg gtgtatgcggctctgaacgta ctgtttatcctgctgacattgtggctggtaccggaaaccaaacacgtttcgctggaacat attgaacgtaatctgatgaaag gtcgtaaactgcgcgaaataggcgctcacgattaa

[0025] SEQ ID NO: 4 depicts crtRl gene of Synechococcus elongatus PCC 6301. atgtcagaggctcaaacgcccctgacagtaccgaagaagtttcttggtgctccaggaggc ttcaaccccaccgtcgcact cttcttggcaggttatacctgcgcggcgctctcagttttggggtactggtgctggagttg gccccactggctatctttccttct gagtgtcacagccttacatttggtaggcaccgtcattcacgatgcctctcataatgtggc tcacgccagtcgcattctgaatg cgattttgggacatggcagtgcactattgctgggctttacttttccggtgtttacgcggg ttcacctgcaacatcacgcccac gtcaacgatcccaagaacgatcccgaccacatcgtttccacctttgggccgctgtggttg atcgcaccgcgcttcttctatc acgagatctatttcttccagcgccgcctttggaagaaatttgaattactcgaatggttcc tcagtcgcgctgtggtcatcggc atctttgcctgcggcgtcaagtttggcttcctgggcttcctgatgaactactggctggct ccagccttggtcgttggcattgc cctaggactcttcttcgactatttaccccaccgccccttccaagagcgcaaccgctggcg caatgcacgggtctatcccgg tcaggtgatgaacatcctgatcatgggtcagaactatcacctgatccatcacctctggcc atcgatcccctggtatctctacc gaccggcctaccacgctaccaagccgttgttggacctacgccagtcgccgcaaacgctcg ggattctctccagcaaaaa agatttctggaactttatctacgacgttttcatcggcatccgcattcaccaatcgcacga ggctgagccgcagagctccgtc gttcctgaaacgaagtcgagtgaatcagccgttctcgcaaaagctccgatgtctgccaca gaagactctcgtgagccagc cttgacgaagtag

[0026] SEQ ID NO: 5 depicts crtRl gene of Synechococcus elongatus UTEX 2973. atgtcagaggctcaaacgcccctgacagtaccgaagaagtttcttggtgctccaggaggc ttcaaccccaccgtcgcact cttcttggcaggttatacctgcgcggcgctctcagttttggggtactggtgctggagttg gccccactggctatctttccttct gagtgtcacagccttacatttggtaggcaccgtcattcacgatgcctctcataatgtggc tcacgccagtcgcattctgaatg cgattttgggacatggcagtgcactattgctgggctttacttttccggtgtttacgcggg ttcacctgcaacatcacgcccac gtcaacgatcccaagaacgatcccgaccacatcgtttccacctttgggccgctgtggttg atcgcaccgcgcttcttctatc acgagatctatttcttccagcgccgcctttggaagaaatttgaattactcgaatggttcc tcagtcgcgctgtggtcatcggc atctttgcctgcggcgtcaagtttggcttcctgggcttcctgatgaactactggctggct ccagccttggtcgttggcattgc cctaggactcttcttcgactatttaccccaccgccccttccaagagcgcaaccgctggcg caatgcacgggtctatcccgg tcaggtgatgaacatcctgatcatgggtcagaactatcacctgatccatcacctctggcc atcgatcccctggtatctctacc gaccggcctaccacgctaccaagccgttgttggacctacgccagtcgccgcaaacgctcg ggattctctccagcaaaaa agatttctggaactttatctacgacgttttcatcggcatccgcattcaccaatcgcacga ggctgagccgcagagctccgtc gttcctgaaacgaagtcgagtgaatcagccgttctcgcaaaagctccgatgtctgccaca gaagactctcgtgagccagc cttgacgaagtag

[0027] SEQ ID NO: 6 depicts neutral site I (NS 1- GenBank accession no. U30252.3) sequence in Synechococcus elongatus PCC 7942 (U30252.3:29425-30669 Synechococcus sp. PCC 7942 cosmids 7H1 and 2E8, complete sequence), atgtttgaaacgatttttgcgctgctgattgttctaggcgctggcgccggggctggcagc ttagtcctgcgcaatctctacta catctgccaacccagtgaaattttgatctttgctggcagtagtcgccgcagtagtgatgg ccgccgagttggctatcgcttg gtcaagggcggcagcagcctgcgggtacctctgctggaaaaagcgctccgcatggatctg accaacatgatcattgagt tgcgcgtttccaatgccttctccaagggcggcattcccctgactgttgaaggcgttgcca atatcaagattgctggggaag aaccgaccatccacaacgcgatcgagcggctgcttggcaaaaaccgtaaggaaatcgagc aaattgccaaggagacc ctcgaaggcaacttgcgtggtgttttagccagcctcacgccggagcagatcaacgaggac aaaattgcctttgccaaaag tctgctggaagaggcggaggatgaccttgagcagctgggtctagtcctcgatacgctgca agtccagaacatttccgatg aggtcggttatctctcggctagtggacgcaagcagcgggctgatctgcagcgagatgccc gaattgctgaagccgatgc ccaggctgcctctgcgatccaaacggccgaaaatgacaagatcacggccctgcgtcggat cgatcgcgatgtagcgat cgcccaagccgaggccgagcgccggattcaggatgcgttgacgcggcgcgaagcggtggt ggccgaagctgaagc ggacattgctaccgaagtcgctcgtagccaagcagaactccctgtgcagcaggagcggat caaacaggtgcagcagca acttcaagccgatgtgatcgccccagctgaggcagcttgtaaacgggcgatcgcggaagc gcggggggccgccgccc gtatcgtcgaagatggaaaagctcaagcggaagggacccaacggctggcggaggcttggc agaccgctggtgctaat gcccgcgacatcttcctgctccagaagctcgagtccctgctcgtcacgctttcaggcacc gtgccagatatcgacgtgga gtcgatcactgtgattggcgaaggggaaggcagcgctacccaaatcgctagcttgctgga gaagctgaaacaaaccac gggcattgatctggcgaaatccctaccgggtcaatccgactcgcccgctgcgaagtccta a

[0028] SEQ ID NO: 7 depicts neutral site II (NS2- GenBank accession no. U44761) sequence in Synechococcus elongatus PCC7942. gatccgcccttgctttgggcgattgattccgatccggttttggccggtacgaagctcatt gctgaagcttgggacgcagc cggcttatatcaggttggtacctttattggcgatcgctttgggacttggaacggtccctt ccgggacgatattcggcgttttt ggcgtggagatcagggctgtacttacgccctcagtcaacgcctgctgggtagccccgatg tctacagcacagaccaat ggtatgccggacgcaccattaacttcatcacctgccatgacggctttacgctgcgagatc tagtcagctatagccagaa gcacaactttgccaatggagagaacaatcgggacgggaccaatgacaactacagctggaa ctacggcattgaaggc gagaccgatgaccccacgattctgagcttacgggaacggcagcagcgcaatttgctcgcc acgttattcctcgcccag ggcacaccgatgctgacgatgggcgatgaggtcaaacgcagtcagcagggtaacaataac gcctactgccaagaca atgagatcagctggtttgattggtcgctgtgcgatcgccatgccgatttcttggtgttca gtcgccgcctgattgaactttcc cagtcgctggtgatgttccaacagaacgaactgctgcagaacgaaccccatccgcgtcgt ccctatgccatctggcatg gcgtcaaactcaaacaacccgattgggcgctgtggtcccacagtctggccgtcagtctct gccatcctcgccagcagg aatggctttacctagcctttaatgcttactgggaagacctgcgcttccagttgccgaggc ctcctcgcggccgcgtttggt atcgcttgctcgatacttcactgccgaatcttgaagcttgtcatctgccggatgaggcaa aaccctgcctacggcgcgat tacatcgtcccagcgcgatcgctcttactgttgatggctcgtgcttaaaaacaatgcaaa cttcaccgtttcagctggtgat tttcgactgtgatggtgtgcttgttgatagcggaacgcatcactaatcgcgtctttgcag acatgctcaatgaactgggtct gttggtgactttggatgacatgtttgagcagtttgtgggtcattccatggctgactgtct caaactaattgagcgacggtta ggcaatcctccaccccctgactttgttcagcactatcaacgccgtacccgtatcgcgtta gaaacgcatctacaagccgt tcctggggttgaagaggctttggatgctcttgaattgccctactgtgttgcgtccagtgg tgatcatcaaaagatgcgaac cacactgagcctgacgaagctctggccacgatttgagggacgaatcttcagcgtgactga agtacctcgcggcaagc catttcccgatgtctttttgttggccgccgatcgcttcggggttaatcctacggcctgcg ctgtgatcgaagacaccccctt gggagtagcggcaggcgtggcggcaggaatgcaagtgtttggctacgcgggttccatgcc cgcttggcgtctgcaag aagccggtgcccatctcatttttgacgatatgcgactgctgcccagtctgctccaatcgt cgccaaaagataactccaca gcattgcccaatccctaacccctgctcgcgccgcaactacacactaaaccgttcctgcgc gatcgctcttactgttgatg gctcgtgcttaaaaacaatgcaaccctaaccgtttcagctggtgattttcggacgatttg gcttacagggataactgagag tcaacagcctctgtccgtcattgcacacccatccatgcactggggacttgactcatgctg aatcacatttcccttgtccatt gggcgagaggggaggggaatcttctggactcttcactaagcggcgatcgcaggttcttct acccaagcagtggcgatc gcttgattgcagtcttcaatgctggcctctgcagccatcgccgccaccaaagcatcgtag gcgggacgttgttgctcca gtaaagtcttcgcccgtaacaatccccagcgactgcgtaaatccgcttcggcaggattgc gatcgagttgccgccaca gttgtttccactgggcgcgatcgtcagctcccccttccacgttgccgtagaccagttgct ctgccgctgcaccggccatc aacacctgacaccactgttccagcgatcgctgactgagttgcccctgtgcggcttcggct tctagcgcagctgcttgga actgcacacccccgcgaccaggttgtccttggcgcagcgcttcccacgctgagagggtgt agcccgtcacgggtaac cccagcgcggttgctaccaagtagtgacccgcttcgtgatgcaaaatccgctgacgatat tcgggcgatcgctgctgaa tgccatcgagcagtaacgtggcaccccgcccctgccaagtcaccgcatccagactgaaca gcaccaagaggctaaa acccaatcccgccggtagcagcggagaactacccagcattggtcccaccaaagctaatgc cgtcgtggtaaaaatcg cgatcgccgtcagactcaagcccagttcgctcatgcttcctcatctaggtcacagtcttc ggcgatcgcatcgatctgatg ctgcagcaagcgttttccataccggcgatcgcgccgtcgccctttcgctgccgtggcccg cttacgagctcgtttatcga ccacgatcgcatccaaatccgcgatcgcttcccagtccggcaattcagtctggggcgtcc gtttcattaatcctgatcag gcacgaaattgctgtgcgtagtatcgcgcatagcggccagcctctgccaacagcgcatcg tgattgcctgcctcaaca atctggccgcgctccatcaccaagatgcggctggcattacgaaccgtagccagacggtga gcaatgataaagaccgt ccgtccctgcatcacccgttctagggcctcttgcaccaaggtttcggactcggaatcaag cgccgaagtcgcctcatcc agaattaaaatgcgtggatc

[0029] SEQ ID NO: 8 depicts CrtRE_F primer sequence.

AGTTGAATTCATGACGGCGGCGG

[0030] SEQ ID NO: 9 depicts CrtRBMX_R primer sequence.

ATCGGATCCCAATTGCTCGAGTTAGGATTTGGGTTTG

[0031] SEQ ID NO: 10 depicts GalPM_F primer sequence.

CTAACAATTGATGCCTGACGCTAAAAAACAGGGGCG

[0032] SEQ ID NO: 11 depicts GalPBg_R primer sequence.

GGATAGATCTTTAATCGTGAGCGCCTATTTCG

[0033] SEQ ID NO: 12 depicts SP48_F primer sequence.

GTCTTTCGACTGAGCCTTTCG

[0034] SEQ ID NO: 13 depicts SP48_R primer sequence.

CAGGCAGCCATCGGAAGC DETAILED DESCRIPTION OF THE INVENTION

[0035] Those skilled in the art will be aware that the present disclosure is subject to variations and modifications other than those specifically described. It is to be understood that the present disclosure includes all such variations and modifications. The disclosure also includes all such steps, features, compositions, and compounds referred to or indicated in this specification, individually or collectively, and any and all combinations of any or more of such steps or features.

Definitions

[0036] For convenience, before further description of the present disclosure, certain terms employed in the specification, and examples are delineated here. These definitions should be read in the light of the remainder of the disclosure and understood as by a person of skill in the art. The terms used herein have the meanings recognized and known to those of skill in the art, however, for convenience and completeness, particular terms and their meanings are set forth below.

[0037] The articles "a", "an" and "the" are used to refer to one or to more than one (i.e., to at least one) of the grammatical object of the article.

[0038] The terms "comprise" and "comprising" are used in the inclusive, open sense, meaning that additional elements may be included. It is not intended to be construed as "consists of only".

[0039] Throughout this specification, unless the context requires otherwise the word "comprise", and variations such as "comprises" and "comprising", will be understood to imply the inclusion of a stated element or step or group of element or steps but not the exclusion of any other element or step or group of element or steps.

[0040] The term "including" is used to mean "including but not limited to". "Including" and "including but not limited to" are used interchangeably.

[0041] For the purposes of the present document, natural diurnal light refers to light having maximum intensity of 1000 + 200 μιηο1/ιη ² /8. The EL (environmental laboratory) conditions refers to, the cells grown under natural diurnal light (maximum 1000 + 200 μιηο1/ιη ² /8) in controlled temperature conditions (28 + 2 °C). The wild type strain refers to the naturally occurring strain PCC7982. According to the strains referred to, the wild type strain refers to naturally occurring strain in which no modification has been attempted.

[0042] Trc promoter is a hybrid of lac and trp promoter. It is a strong inducible promoter. Cpc is a strong light inducible promoter.

[0043] Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this disclosure belongs. Although any methods and materials similar or equivalent to those described herein can be used in the practice or testing of the disclosure, the preferred methods, and materials are now described. All publications mentioned herein are incorporated herein by reference.

[0044] As discussed in the background section, viable methods for producing lutein- free zeaxanthin is highly sought after. For the same purpose, production of zeaxanthin from different systems is an option. In light of the same, expression of zeaxanthin has been attempted in non-carotenogenic bacteria as well as in photosynthetic microbial systems like microalgae (Jin et ah, 2002). Microalgae are cheap and effective bio-resource that can be used to produce carotenoids (Jian-Hao Lin et ah, 2014). Nevertheless, such photosynthetic systems have been extensively explored at commercial scale for sustainable production of carotenoids, like β- carotene from Dunalliella salina, astaxanthin from Haematococcus pluvialis. (Sun et ah, 2016; Lin et ah, 2015). Although eukaryotic microalgae and cyanobacteria are photosynthetic organisms, they possess different modalities for photosynthesis and photo-protection. Like higher plants, eukaryotic microalgae {Chlorella saccharophila, Chlorella vulgaris, Dunalliella salina, etc.) have pathways for synthesis of both; lutein and zeaxanthin; whereas cyanobacteria do not exhibit lutein biosynthesis pathway (KEGG Pathways, map00906). Thus, it is noteworthy to explore cyanobacteria as potential photosynthetic candidate for exploring production of lutein-free zeaxanthin. In addition to that cyanobacteria do not employ carotenoids as accessory light harvesting pigment (Graham et ah, 2008; Sulcenik et ah, 2009). In addition to that, unlike eukaryotic microalgae, zeaxanthin accumulation is less likely to affect photosynthesis dynamics of the cyanobacteria! system. [0045] Thus, cyanobacteria namely Synechococcus elongatus PCC 7942, Synechococcus elongatus PCC 7002, Synechocystis sp. PCC 6803 (hereafter referred as PCC 7942, PCC 7002, PCC 6803, respectively) were studied for their relative rate of synthesis of zeaxanthin. It was observed that PCC 7942 displays highest rate of zeaxanthin synthesis from β-carotene than PCC 7002 and PCC 6803. It was also noticed that PCC 7942 synthesizes predominantly zeaxanthin as compared to other carotenoids under natural diurnal light conditions (Sarnaik et ah, 2017).

[0046] Therefore, the present disclosure attempts to improve zeaxanthin production from cyanobacteria PCC 7942 and genetically modifying the cells by overexpressing β-carotene oxygenase gene (CrtR) from PCC 7002. Increase in zeaxanthin productivity as well as cell mass lead to an increase in total zeaxanthin titer (Bhosale et al., 2004). Therefore, to improve zeaxanthin titre (mg/L), simultaneous introduction of hexose-H ⁺ symporter gene (GalP) was also attempted.

[0047] The present disclosure is not to be limited in scope by the specific embodiments described herein, which are intended for the purposes of exemplification only. Functionally-equivalent products, compositions, and methods are clearly within the scope of the disclosure, as described herein.

[0048] Carotenoids are isoprenoid biomolecules and integral part of photosynthesis where they serve as accessory pigments, photoprotecting compounds as well as antioxidants to prevent oxidative damage to the cell. There are two classes of naturally occurring carotenoids viz. carotenes and xanthophylls. Zeaxanthin, a type of xanthophyll, is one of the vital photoprotective and anti-oxidant pigment. All- trans zeaxanthin is the most abundant and an active form of zeaxanthin in nature, which is important in protection against light-mediated photo-toxicity and hence predominantly used in age-related macular degeneration in humans. Thus, it holds significant market value and market share, especially in ocular health products.

[0049] Commercially, zeaxanthin is produced by chemical synthesis as well as extracted from plant sources. Since synthetic zeaxanthin production involves number of complex chemical conversions and due to public-bias against synthetic chemical additives, microbial biosynthesis is considered to be more efficient and cost-effective (Bhosale). As algae are aquatic counterparts of terrestrial plants, use of algal systems for commercial production of value-added compounds like zeaxanthin would be a viable alternative to plants. Thus, analytical characterization of pigments was performed from different algal cell extracts for production of zeaxanthin.

[0050] Various microalgal species have been characterized for zeaxanthin production through growth as well as genetic engineering. Eukaryotic microalga Dunaliela salina had been genetically mutated by Jin et al. by blocking antheraxanthin synthesis, thereby accumulating zeaxanthin in the cell obtaining maximum yield of 5.9 mg/g DCW (EonSeon). Similarly, Chlorella species have also been explored and modelled for zeaxanthin synthesis by Singh et al. where the maximum yield of zeaxanthin obtained was 11.64 mg/ g DCW (Singh). However, eukaryotic microalgae synthesize lutein as well as zeaxanthin and owing to their similar molecular structure, it is challenging to obtain lutein-free zeaxanthin. Moreover, zeaxanthin is an integral part of xanthophyll cycle and this phenomenon is majorly photo-driven, there exists active modulation in the yield of zeaxanthin. Overall carotenoid synthesis is a dynamic process that is difficult to control, where pigments like lutein constitutes larger portion. Therefore, separation and purification of lutein-free zeaxanthin from eukaryotic microalgae still remains uneconomical.

[0051] To address the above-mentioned problems, the present disclosure selected algal species for analyzing their zeaxanthin profiles under natural light conditions and for choosing an appropriate host for genetic modification to improve zeaxanthin production. Model eukaryotic microalgae namely, Chlorella saccharophila, Chlorella vulgaris and Dunaliella salina were selected for the study. KEGG pathways for carotenoid backbone synthesis (map00906) of these species revealed that eukaryotic algae synthesize lutein as well as zeaxanthin (Figure 1). This phenomenon was clearly evident from HPLC chromatograms where zeaxanthin peak (RT 24.4 min) overlaps with adjoining peak of lutein (RT 24.7 min) which are difficult to separate (Figure 2C). Although zeaxanthin has higher photo-protecting and antioxidant capacity as compared to lutein, due to similar structures and higher lutein content in eukaryotic cells, their purification becomes challenging. This demands more number of downstream processing steps for isolating lutein-free zeaxanthin, thereby reducing its yield and increasing the final cost. [0052] Cyanobacteria, on the other hand, can synthesize lutein-free zeaxanthin as they lack lutein biosynthesis pathway genes. Therefore, cyanobacterial strains namely PCC 7942, PCC 6803 and PCC 7002 were chosen for the study. HPLC chromato grams also supported that cyanobacteria produce single continuous peak of zeaxanthin (RT 24.4 min) and hence could be promising hosts for pure zeaxanthin production (Figure 2B). Therefore, these cyanobacterial strains were further characterized for their rate of zeaxanthin synthesis.

[0053] PCC 6803 strain has been already explored by Lagarde et al. (Lagarde. D et al., App. and Env. Microbiol. 2000;66(l):64-72) for increased zeaxanthin synthesis through genetic engineering. They applied multiple strategies, wherein they inactivated genes which divert the flux of β-carotene towards other carotenoids or they improved flux towards zeaxanthin synthesis. However, amongst all the approaches, flux improvement towards zeaxanthin strategy worked efficiently giving zeaxanthin yield of 0.98 μg/ml/Abs730. Nevertheless, there are no reports on natural light zeaxanthin synthesis of cyanobacteria.

[0054] In an embodiment of the present disclosure, there is provided a method of producing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: 1 ; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

Introduction of the construct into the cyanobacteria as described in step (c) can be done by various methods such as homologous recombination, conjugation, transformation. The method would depend on the cyanobacteria chosen for the preparation of the recombinant strain.

[0055] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO:l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[0056] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the cyanobacteria is Synechococcus elongatus.

[0057] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the cyanobacteria of step a) is selected from a group consisting of: (i) Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1; (ii) Synechococcus elongatus PCC 6301 comprising a crtRl gene as set forth in SEQ ID NO: 4, and (iii) Synechococcus elongatus UTEX 2973 comprising a crtRl gene as set forth in SEQ ID NO: 5.

[0058] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the cyanobacteria of step a) is Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1.

[0059] In an embodiment of the present disclosure, there is provided a method of producing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a trc promoter to drive the expression of the crtR2 gene, wherein the trc promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is prepared using pAM 2991 vector.

[0060] In an embodiment of the present disclosure, there is provided a method of producing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a cpc promoter to drive the expression of the crtR2 gene, wherein the cpc promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is prepared using pAM 2991 vector.

[0061] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a trc promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the trc promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is prepared using pAM 2991 vector.

[0062] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining Synechococcus elongatus PCC7942 comprising a crtRl gene as set forth in SEQ ID NO: 1; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a cpc promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the cpc promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is prepared using pAM 2991 vector.

[0063] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein introducing the recombinant construct into the cyanobacteria is through homologous recombination.

[0064] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the promoter is an inducible promoter.

[0065] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the inducible promoter is selected from a group consisting of Trc promoter, cpc promoter, lac promoter, psb promoter, and rbc promoter.

[0066] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the promoter is Trc promoter.

[0067] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin as disclosed herein, wherein the promoter is cpc promoter.

[0068] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is obtained using a vector selected from a group consisting of pAM2991, pAM1619, and pAM2314. In another embodiment of the present disclosure, the recombinant construct is obtained using the vector pAM2991.

[0069] In an embodiment of the present disclosure, there is provided a method of preparing a recombinant cyanobacteria for enhanced production of zeaxanthin, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: 1 ; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the recombinant construct is obtained using a vector selected from a group consisting of pAM2991, pAM1619, and pAM2314. In another embodiment of the present disclosure, the recombinant construct is obtained using the vector pAM2991.

[0070] In an embodiment of the present disclosure, there is provided a recombinant cyanobacteria obtained by using a method, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria. [0071] In an embodiment of the present disclosure, there is provided a recombinant cyanobacteria obtained using a method, said method comprising: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain a recombinant cyanobacteria, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[0072] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[0073] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria.

[0074] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein the method further comprises a purification step to obtain a purified zeaxanthin.

[0075] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein growing the recombinant cyanobacteria is done under natural diurnal light, at a temperature in a range of 20-40 °C, at a pH in a range of 6-8, for a time period in a range of 48-240 hours with a stirring in a range of 100-140rpm. In another embodiment of the present disclosure, growing the recombinant cyanobacteria is done under natural diurnal light, at a temperature in a range of 25-35 °C, at a pH in a range of 6.5-7.5, for a time period in a range of 96-198 hours with a stirring in a range of 110-130rpm.

[0076] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein the nutrient medium comprises at least one carbon source, and at least one nitrogen source.

[0077] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein the nutrient medium is BG-11 medium comprising 0.75 g/L NaN0 ₃ , 0.04 g/L K ₂ HP0 ₄ , 0.075 g/L MgS0 ₄ .7H ₂ 0, 0.036 g/L CaCl ₂ .2H ₂ 0, 0.006 g/L citric acid, 0.006 g/L ferric ammonium citrate, 0.001 g/L disodium EDTA, 0.02 g/L Na ₂ C0 ₃ , 1 ml/L trace metal mix A5 (2.86 g/L H ₃ B0 , 1.81 g/L MnCl ₂ .4H ₂ 0, 0.222 g/L ZnS0 ₄ .7H ₂ 0, 0.39 g/L NaMo0 ₄ .2H ₂ 0, 0.079 g/L CuS0 ₄ .5H ₂ 0, 49.4 mg/L Co(N0 ₃ )2.6H ₂ 0) in distilled water. [0078] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein isolating zeaxanthin is done by a process selected from a group consisting of methanol extraction, centrifugation, sonication, and combinations thereof.

[0079] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria as described herein, wherein zeaxanthin obtained by the method is essentially lutein-free.

[0080] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the method leads to zeaxanthin yield in a range of 4.5-8.5 mg/g of dry cell weight (DCW). In another embodiment of the present disclosure, the method leads to zeaxanthin yield in a range of 5.5-8.5 mg/g of dry cell weight (DCW). In yet another embodiment of the present disclosure, the method leads to zeaxanthin yield in a range of 6.5-8.5 mg/g of dry cell weight (DCW).

[0081] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, and a promoter to drive the expression of the crtR2 gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the method leads to zeaxanthin titre in a range of 5.5-6 mg/L. In another embodiment of the present disclosure, the method leads to zeaxanthin titre in a range of 5.8-6 mg/L.

[0082] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the method leads to zeaxanthin yield in a range of 7.5-10.5 mg/g of dry cell weight (DCW). In another embodiment of the present disclosure, the method leads to zeaxanthin yield in a range of 8.5-10.5 mg/g of dry cell weight (DCW).

[0083] In an embodiment of the present disclosure, there is provided a method for production of zeaxanthin using a recombinant cyanobacteria, said method comprising: (i) obtaining the recombinant cyanobacteria from the method comprising the steps of: (a) obtaining a cyanobacteria comprising a crtRl gene having a similarity of at least 98% with a sequence as set forth in SEQ ID NO: l; (b) obtaining a recombinant construct comprising a crtR2 gene as set forth in SEQ ID NO:2, a GalP gene as set forth in SEQ ID NO: 3, and a promoter to drive the expression of the crtR2 gene and the GalP gene, wherein the promoter is heterologous to the cyanobacteria of step (a); and (c) introducing the recombinant construct of step (b) into the cyanobacteria of step (a) to obtain the recombinant cyanobacteria; (ii) growing the recombinant cyanobacteria in a nutrient medium under suitable conditions to obtain a culture; and (iii) isolating zeaxanthin from the culture, wherein the recombinant cyanobacteria shows enhanced production of zeaxanthin as compared to wild type cyanobacteria, and wherein the method leads to zeaxanthin titre in a range of 7-14mg/L. In another embodiment of the present disclosure, the method leads to zeaxanthin titre in a range of 9-14mg/L.

[0084] Although the subject matter has been described in considerable detail with reference to certain examples and implementations thereof, other implementations are possible.

EXAMPLES

[0085] The disclosure will now be illustrated with working examples, which is intended to illustrate the working of disclosure and not intended to take restrictively to imply any limitations on the scope of the present disclosure. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs. Although methods and materials similar or equivalent to those described herein can be used in the practice of the disclosed methods and compositions, the exemplary methods, devices and materials are described herein. It is to be understood that this disclosure is not limited to particular methods, and experimental conditions described, as such methods and conditions may apply.

[0086] PCC 7942 is a cyanobacteria that inherently exhibits efficient rate of 0.16 + 0.006 mg g ^"1 DCW d ^"1 of zeaxanthin synthesis under natural light conditions. The organism was modified using CrtR gene (crtR 2 - SEQ ID NO: 2) from related cyanobacterial strain PCC 7002 for increasing the flux towards zeaxanthin production from β-carotene. The strain was analysed for functionality of the β- carotene oxygenase protein produced by the cloned CrtR gene, that displayed improved flux towards zeaxanthin production over WT.

Example 1

Microorganisms and culture conditions [0087] Six different microalgae were selected on the basis of their use as model algal systems for genetic modifications, as host systems for pigment production and availability of their annotated genome and proteome databases. Initially comparative pigment profiles were analysed using eukaryotic microalgae; Chlorella saccharophila, Chlorella vulgaris, Dunalliella salina, and cyanobacteria; PCC 7942, PCC 6803, PCC 7002 (Kim et al, 2017; Singh et al, 2015; Graham et al, 2008; Lagarde et al., 2000; Masamoto et al., 1996) in environmental laboratory (EL), a state-of-the-art glass house facility at DBT-ICT Centre for Energy Biosciences, Mumbai, India. In EL, the cells were grown under natural diurnal light (maximum 1000 + 200 μιηο1/ιη ² /8) in controlled temperature conditions (28 + 2 °C). All cultures were grown on shakers at the speed of 120 rpm, in 250 ml Erlenmeyer flasks in BG- 11 medium (0.75 g/L NaNOs, 0.04 g/L K ₂ HP0 ₄ , 0.075 g/L MgS0 ₄ .7H ₂ 0, 0.036 g/L CaCl ₂ .2H ₂ 0, 0.006 g/L citric acid, 0.006 g/L ferric ammonium citrate, 0.001 g/L disodium EDTA, 0.02 g/L Na ₂ C0 ₃ , 1 ml/L trace metal mix A5 (2.86 g/L H B0 ₃ , 1.81 g/L MnCl ₂ .4H ₂ 0, 0.222 g/L ZnS0 ₄ .7H ₂ 0, 0.39 g/L NaMo0 ₄ .2H ₂ 0, 0.079 g/L CuS0 ₄ .5H ₂ 0, 49.4 mg/L Co(N0 )2.6H ₂ 0) in distilled water).

[0088] Construction and amplification of recombinant plasmids was performed in E. coli ToplOF (ThermoFisher Scientific, India). Cells were grown at 37 °C in Luria Bertani (LB) broth (HiMedia, India) supplemented with 100 μg/ml spectinomycin (HiMedia, India). Further, the stains PCC 7942, PCC7002, PCC 6301, UTEX 2973 are widely available in public domain such as Pasteur type Culture Collection, Paris, France (PCC), American type Culture Collection, USA (ATCC) and University of TEXas, Texas, USA (UTEX).

Example 2

Screening and selection of the cloning host Carotenoid extraction and HPLC analysis

(a) Carotenoid extraction

[0089] Three eukaryotic microalgae; Chlorella saccharophila, Chlorella vulgaris, Dunalliella salina and three cyanobacteria; PCC 7942, PCC 7002, PCC 6803 were the algal candidates analysed for their pigment profiles using HPLC. Pigments from these cells were extracted using absolute methanol. Algal cell suspensions were centrifuged at 10,000 rpm for 10 min and the obtained pellet was resuspended in 1ml absolute methanol. It was sonicated for 30 min and the cell extract was centrifuged at 10,000 rpm for 1 min to remove cell debris. (b) HPLC analysis

[0090] Filtered pigment extracts were used for HPLC analysis of carotenoids using Agilent C ₁₈ RP column. Mobile phase A was methanol: acetonitrile: water (21: 16.5:62.5) with lOmM ammonium acetate and B was Methanol: Acetonitrile: Ethyl acetate (50:20:30). The solvent B gradient program (time [min], %B, flow rate [ml min ^"1 ]) employed was as follows: 0, 20, 0.750; 10, 70, 1.0; 40, 100, 1.0 and 60, 100, 1.0; taking absorbance at 480 nm. Peaks were compared with the standard zeaxanthin {Sigma-Aldrich) and β-carotene {Sigma-Aldrich) prepared in absolute methanol. Pigments from eukaryotic microalgae and cyanobacteria methanol extracts were analysed through qualitative comparison of HPLC chromatograms.

[0091] As lutein and zeaxanthin exhibit overlapping peaks in HPLC chromatograms, due to their similar molecular structures. Therefore, spiking studies were performed to decipher their relative peak positions by comparative analysis of HPLC chromatograms of ImM zeaxanthin standard and zeaxanthin spiked with ImM lutein. Result:

[0092] Eukaryotic microalgae {Chlorella saccharophila, Chlorella vulgaris, Dunaliella salina) and cyanobacteria (PCC 6803, PCC 7942, PCC 7002) were selected to analyse their carotenoid profiles. Eukaryotic microalgae displayed overlapping peaks at RT 24-25 min, while cyanobacteria displayed single peak at RT 24.4 min corresponding to all-trans zeaxanthin in HPLC chromatograms (Figure 2B).

[0093] As denoted by KEGG pathway (map00906) for carotenoid backbone synthesis (also explained in preceding paragraphs), the selected eukaryotic microalgae produce lutein as well as zeaxanthin. Thus, to determine relative peak positions of lutein and zeaxanthin spiking experiments were performed using ImM lutein and zeaxanthin standards. The chromatograms indicated that the later larger peak (at RT 24.7 min) in eukaryotic microalgae extract was corresponding to lutein while the smaller peak was zeaxanthin (at RT 24.4 min) (Figure 2C).

[0094] Further, KEGG pathway for carotenoid backbone synthesis (syn00906: PCC 6803, syf00906 PCC 7942, syp00906 PCC 7002) showed that the selected cyanobacterial species do not possess the pathway genes for lutein biosynthesis (Figure 2A). Thus, their HPLC chromatogram displayed single continuous peak corresponding to zeaxanthin (Figure 2B). Therefore, further studies were limited to cyanobacteria to determine the rate of zeaxanthin synthesis.

Example 3

Selection of the host for zeaxanthin over-production

[0095] Three cyanobacterial species (screened from the Example 2); PCC 6803, PCC 7002, PCC 7942 were analysed for their potential to synthesize zeaxanthin in terms of relative rate of synthesis of zeaxanthin (μζ) from β-carotene. Results indicated that PCC 7942 possessed significantly higher μ∑οΐ 0.16 + 0.006 mg g ^"1 DCW d ¹ as compared to PCC 6803 and PCC 7002 (Figure 3A). Thus, PCC 7942 was selected as a cloning host to improve production of zeaxanthin. Example 4

Selection of the donor strain for amplifying CrtR gene

(a) In-silico analysis

(i) Identification of genes by multiple sequence alignment (MSA) [0096] Synechococcus strains with well-established genome and proteome databases {Synechococcus elongatus PCC 7942, Synechococcus sp. PCC 6301, Synechococcus elongatus PCC 7002, Synechococcus elongatus UTEX 2973) were analysed in silico for most diverged CrtR gene sequences from that of PCC 7942, to facilitate precise homologous recombination only at the neutral site in PCC 7942 genome (Sequences similar as SEQ ID NO: 6 and SEQ ID NO: 7). The strains used in the present disclosure are publicly available. The public databases they refer to are University of Texas (UTEX) in case of UTEX 2973, Pasteur Type Culture Collection (PCC) in case of PCC 7942, PCC 6301, and PC 7002. Nucleotide sequences were aligned using multiple sequence alignment and neighbour joining distance tree was generated through Clustal Omega (ClustalO) tool at EBI-EMBL (http://www.ebi.ac.uk/Tools/msa/clustalo/). The most diverged nucleotide sequence amongst all was selected for its polypeptide sequence analysis.

Result:

[0097] CrtR gene sequence from PCC 7942 was compared with various Synechococcus strains using multiple sequence alignment through ClustalO. Neighbour joining distance tree then obtained, showed highest polynucleotide divergence with PCC 7002 (Figure 3B).

(ii) Polypeptide analysis

[0098] Polypeptide sequences of β-carotene hydroxylase from PCC 7942 and β- carotene oxygenase from PCC 7002 (both are transcribed and translated products CrtR genes from corresponding strains catalysing the biochemical conversion of β- carotene to zeaxanthin) were aligned using Align tool (pair-wise alignment) of BLAST. Percentage Identity (PID) was calculated using Doolittle method (Raghava).

[0099] PID = Identical positions / (Aligned positions + Internal gap positions) ... (1)

Result:

[00100] Pair-wise global alignment (Needleman-Wunsch algorithm) of polypeptide sequences of CrtR from PCC 7942 and PCC 7002 using Align tool displayed the two sequences are 65% identical with 98% query coverage and e-value of 4e-149. Functional domains of proteins generated from CrtR (fatty acid desaturase domain, FA_desaturase) were obtained from UniProtKB and their sequence alignment displayed 74% sequence identity with 97% query coverage and e-value of 3e-120. Thus, CrtR gene from PCC 7002 was amplified for cloning in PCC 7942 (Figure 3B and 3C).

Example 5

Preparation of recombinant cyanobacteria

[00101] The cyanobacterium PCC 7942, selected for genetic modifications after detailed screening, was grown in BG-11 medium and BG-11 medium supplemented with 30 μg/ml of spectinomycin in case of transformants, using atmospheric C0 ₂ (Sarnaik et al., 2017). For mixotrophy, cultures were grown in BG-11 medium supplemented with 10 g/L glucose. PCC 7942 wild type (WT) and transformants (Tr) were grown under two different conditions; in incubator (IC) with continuous illumination using artificial cool white light of an intensity of 55 + 0.5 μιηο1/ιη ² /8 at 28 + 1 °C, and in environmental laboratory (EL). The paragraphs below provide detailed protocol for the preparation of transformants.

Cyanobacterial plasmid construction and transformation

[00102] Two plasmids were constructed for transforming PCC 7942, namely pR48 and pRG48 using pAM2991 vector. pR48 was constructed by cloning CrtR gene (ACA98919.1) amplified from PCC 7002 (β-carotene oxygenase, SYNPCC7002_A0915) genomic DNA between EcoRI and BamHI sites of pAM2991 vector (Primers; CrtRE_F and CrtRBMX_R). Mfel site was introduced in the construct using CrtR gene reverse primer (CrtRBMX_R) for introduction of another gene into the recombinant vector pR48. pRG48 was constructed by cloning GalP gene (NC_000913.3) amplified from E. coli MG1655 genomic DNA between Mfel and BamHI sites in pR48 vector (Primers; GalPM_F and GalPBg_R).

[00103] PCC 7942 transformants (Synechococcus 79R48 and Synechococcus 79RG48) were developed based on homologous recombination strategy using plasmids (pR48 and pRG48, respectively) through natural transformation. The transformation protocol was followed as demonstrated by Clerico et al. Typically, PCC 7942 cells were grown in liquid culture to Abs ₇₃ o 0.7. Cells were centrifuged and the pellet was suspended in 10ml of lOmM NaCl followed by centrifugation.

[00104] The pellet obtained was then suspended in 300μ1 of BG-11 medium and ^g of recombinant plasmid was mixed with it. This cell suspension was incubated overnight in dark at 28 °C. Following incubation, the entire mixture was spread on BG-11 + 30 μg/ml spectinomycin plate and incubated under continuous light of 55 + 0.5 μιηο1/ιη ² /8 at 28 + 1°C for 8-10 days. Colonies obtained on plates were passaged at least four times to get stable transformants. (Sarnaik, Clerico) Gene integration in cyanobacterial genome was confirmed by colony PCR (as explained in below paragraphs) using neutral site primers SP48_F and SP48_R.

[00105] Therefore, to summarize, two separate vector constructs were made for integration of CrtR gene into PCC 7942 genome. First construct was synthesized by amplifying CrtR gene from PCC 7002 followed by cloning into vector pAM2991 under the control of P _trc promoter to generate recombinant plasmid pR48 (Figure 4A). PCC 7942 is an obligate autotroph, thus hexose-H ⁺ symporter gene GalP, was simultaneously introduced into the plasmid to exhibit mixotrophy. Hence, another operon construct, pRG48, was made containing two genes cloned in pAM2991; CrtR from PCC 7002 followed by GalP from E. coli MG1655 (Figure 4A). The plasmids were successfully transformed first into E. coli ToplOF to increase their copy number. Following cyanobacterial transformation, PCC 7942 transformants with pR48 (Synechococcus 79R48) and pRG48 (Synechococcus 79RG48) were successfully obtained after four passages under selective antibiotic pressure. Table 1: List of primers used

5'-

GalPM_F (SEQ ID NO:

CTAACAATTGATGCCTGACGCTAAAAAACAGGGG

10)

CG -3'

GalPBg_R (SEQ ID NO: 5'- GGATAGATCTTTAATCGTGAGCGCCTATTTCG - 11) 3'

SP48_F (SEQ ID NO: 12) 5'- GTCTTTCGACTGAGCCTTTCG - 3'

SP48_R (SEQ ID NO: 13) 5' - CAGGCAGCCATCGGAAGC - 3'

Colony PCR of the cyanobacterial transformants for confirmation of gene integration

[00106] Clones generated through homologous recombination were confirmed for the gene integration using colony PCR. Agarose gel electrophoresis of the colony PCR samples showed bands corresponding to 1.2 kbps (lane 1, Synechococcus 79R48) and 2.8 kbps (lane 3, Synechococcus 79RG48) (Figure 4B).

Mass spectroscopy analysis for all-trans zeaxanthin

[00107] Stock solution of ImM was prepared by dissolving zeaxanthin powder in methanol. Methanol extracts of the cell and standard were filtered through 0.2 μιη filters to avoid artefact interference. Standard or extract was introduced into MS through direct infusion at a solvent (Phase A: ACN + 0.1% formic acid Phase B: H ₂ 0 with 0.1% formic acid at 1 : 1 ratio) flow rate of 0.2 mL/min for a run time of 2min.

[00108] LC-MS analyses were performed with the HPLC system described above to confirm the peak of all-trans zeaxanthin by comparing product ion spectra of standard and PCC 7942 pigment extract. Positive ion ESI mass spectra was obtained using Accurate-Mass Q-TOF LC/MS 6520 {Agilent Technologies) mass spectrometer. Data acquisition and processing were performed using Agilent MassHunter software. Mass spectra of the column eluate was recorded in the range of m/z 50-1000 at an acquisition rate of 1 spectra/s with acquisition time 1000 ms/ spectrum. Nitrogen was used as both, drying gas at a flow rate of 10 L/min and as the nebulizing gas at a pressure of 35 psig. The nebulizer temperature was set at 300 °C and the potential of +3500 V was used on the capillary. Capillary was set at 0.039 μΑ, chamber was set at 2.67 μΑ. For TOF analyser, fragmentor was set at 135 V and skimmer was set at 65 V.

Example 6

Studies in recombinant cyanobacteria (a) Acclimatization and induction

[00109] Culture acclimatization to natural light and induction with ImM IPTG was performed in BG-11 medium in case of WT and BG-11 supplemented with spectinomycin in case of (transformants) Tr. However, comparative analysis of Tr with WT did not involve any addition of antibiotic in the medium, to maintain uniform culture conditions.

(b) Growth measurement

[00110] Algal cell growth was monitored by measuring optical density and dry cell weight (DCW). Culture absorbance was measured at 730 nm (Abs ₇₃ o) (Shota). DCW was determined by dewatering and desalting the culture, followed by harvesting it by centrifugation at 10,000 rpm for 10 min. Cells were then dried at 60-65 °C for 18 hrs.

(c) Carotenoid analysis of PCC 7942 Tr

(i) Synechococcus 79R48 study

[00111] Synechococcus 79R48 strain, constructed using recombinant plasmid pR48, was verified for precise functioning of the cloned gene by studying its pigment profile in comparison with WT PCC 7942 cells under autotrophy condition. The experiment was performed in IC and EL in biological triplicates. HPLC analysis of carotenoids was performed and relative efficiency of cloned protein to convert β- carotene to zeaxanthin was calculated on the basis of relative flux of β-carotene towards zeaxanthin synthesis (coz) and corresponding fraction of unconverted β- carotene (COB,B). The parameters were calculated as follows; WB= mz + rtiB ... (2)

<OB,B = MB/ WB ... (3)

( z,B = mz/ We ... (4)

Cyanobacterial species were further compared on the basis of their relative rate of zeaxanthin synthesis (μζ, mg Zea g ^'1 DCW d ^'1 ) using following equation;

(ii) Synechococcus 79RG48 study [00112] Synechococcus 79RG48 strain, constructed using recombinant plasmid pRG48, was verified for precise functioning of the cloned genes by studying its pigment profile in comparison with WT PCC 7942 cells with autotrophy as well as mixotrophy condition for transformants using 10 g/L glucose supplemented BG-11 medium. The experiment was performed under natural light conditions in EL in biological triplicates. Growth assay and HPLC analysis of carotenoids was performed to obtain carotenoid yields and titers. Relative flux towards zeaxanthin synthesis (coz) and fraction of unconverted β-carotene (COB,B) were calculated as in case of Synechococcus 79R48 transformants.

(iii) Glucose consumption [00113] Functionality of cloned hexose-H ⁺ symporter gene GalP in Synechococcus 79RG48 Tr. was assessed on the basis of cellular glucose uptake profile. Amount of residual glucose (g/L) was measured to trace the glucose uptake using enzyme assay, lml cell suspension was centrifuged at 10,000 rpm for 10 min and the supernatant was tested for residual glucose using GOD-POD (Accurex) kit; a substrate specific and sensitive enzymatic technique.

Result:

[00114] PCC 7942 positive transformants were investigated for their relative flux towards zeaxanthin synthesis under controlled light (55 + 0.5 μιηο1/ιη ² /8) and temperature (28 + 1 C) conditions in IC and under natural light (maximum 1000 + 200 μmol/m ² /s) condition in EL. Relative flux analysis of Synechococcus 79R48 indicated that these transformants displayed 50% improved co _z in IC while 20% increased co _z in EL as compared to WT PCC 7942. Decrease in relative synthesis of zeaxanthin in EL could be attributed to the light conditions, as natively zeaxanthin production is photo-driven. However, this increase was significant with respect to WT and it exhibited appropriate functioning of the cloned gene.

[00115] Another set of PCC 7942 transformants, Synechococcus 79RG48, possessing CrtR gene for improved zeaxanthin production and GalP gene for uptaking extracellular glucose, were grown in EL under autotrophy as well as mixotrophy. Gene functionalities were assessed on the basis of coz values and daily glucose uptake by the cells, coz for these strains was 37% higher than that of WT. Nonetheless, natural light productivity of transformants under mixotrophy was 40% more than that in autotrophy of the Tr and WT, with concurrent 40% decrease in amount of residual glucose in the medium.

[00116] Positive transformants of Synechococcus 79RG48 were grown in EL and analysed for improvement in product titres. The cyanobacterial transformants exhibited 1.8- 2 times increase in zeaxanthin yield over WT with autotrophy as well as mixotrophy. Under mixotrophy the titre was enhanced almost 3 times over WT to 12.6 + 0.44 mg/L.

Table 2 summarizes the zeaxanthin production as reported in previous studies.

Table 2:

Organism Zeaxanthin yield Zeaxanthin titer Reference

(mg L)

E. coli BETA-1 11.95 mg/ g DCW 43.46 Li et al.

Synechocystis PCC 6803 0.98 μg/ml/OD73o Lagarde et al.

Synechococcus 79R48 4.31 mg/ g DCW 0.57 This study (Autotrophy, IC) 0.59 μg/ml/OD73o

Synechococcus 79RG48 9.02 mg/ g DCW 8.24 This study (Autotrophy, EC)

Synechococcus 79RG48 8.24 mg/ g DCW 12.6 This study (Mixotrophy, EC)

(d) SDS-PAGE study

[00117] 2 ml of E. coli cells (transformants with pR48 and pAM2991 plasmids) (Abs6oo of 1.0) were centrifuged at 10,000 rpm for 1 min and resuspended in 50 μΐ of 0. IM sodium phosphate buffer (7.74 ml 0. IM Na ₂ HP0 ₄ + 2.26 ml NaH ₂ P0 ₄ , pH 7.4). Similarly, 10ml of PCC 7942 cells (WT and Synechococcus 79R48) (Abs ₇ 30 of 0.5) were centrifuged at 10,000 rpm for 10 min and resuspended in 100 μΐ of 0.1M sodium phosphate buffer. Cell suspension was sonicated for lh with intermittent vortexing, followed by centrifugation at 10,000 rpm for lmin to remove debris. Supernatant was analysed for protein concentration using Bradford's assay (Bio- Rad). 5μg protein from E. coli extracts and 20μg of protein from PCC 7942 extract were loaded in 12% SDS-PAGE. Coomassie staining was performed to probe the over-expressed β-carotene oxygenase band corresponding to 34kDa. E. coli and PCC 7942 transformants cloned with CrtR gene displayed a prominent band corresponding to -34 kDa indicating overexpressed oxygenase protein (Lane 1 of Figure 5A and 5B). This substantiated proper functioning of the construct.

(e) Carotenoid analysis of PCC 7942 transformants (i) Assessing gene functionality in PCC 7942 Tr

[00118] Relative flux towards zeaxanthin production (co _z ) and fraction of unconverted β-carotene (COB,B) were calculated for both the transformants Synechococcus 79R48 and 79RG48 to ensure effective functioning of the cloned gene (protocol used was as described earlier).

[00119] Pigment profiles of PCC 7942 transformants were verified using the HPLC technique. Their qualitative analysis was accomplished by comparing their chromatograms and quantitative measurements were performed by using equations 2 to 5 (as described earlier under "carotenoid analysis").

[00120] Synechococcus 79R48 transformants were investigated for zeaxanthin production in incubator (IC) as well as in EL. There was 50% increase in co _z and concurrent 44% decrease in COB,B of Tr as compared to WT when grown in IC. It is noteworthy that when exposed to higher light intensities with diurnal variation in EL, Synechococcus 79R48 showed 73% increase in co _z as compared to that in IC. In case of EL, co _z was improved 20% with 30% reduction in COB,B as compared to WT. This established precise functionality of oxygenase protein in Synechococcus 79R48 irrespective of growth regimes. The study under different growth regime also revealed that relative flux towards zeaxanthin was higher flux under natural light in EL as compared to IC.

[00121] While assessing flux modulation under autotrophic and mixotrophic conditions using Synechococcus 79RG48, it was observed that the flux towards zeaxanthin did not change significantly. However, the PCC 7942 Tr exhibited 37% increase in co _z with concurrent 44% decrease in COB.B was observed when compared with WT PCC 7942, in EL. Therefore, flux of β -carotene towards zeaxanthin (ω∑) and fraction of unconverted (COB.B) . COZ of Tr was relatively higher than WT, while COB,B was lower for Tr than WT. Thus, the flux analysis ensured proper functioning of the cloned protein in heterologous system, under natural light conditions (Figure 6 and Figure 8).

(ii) Analysing growth and zeaxanthin production from Tr [00122] PCC 7942 WT and Tr; Synechococcus 79R48 and Synechococcus 79RG48 were grown in EL (max. 1000 + 100 μηιο1/ηι ² /8). Biomass productivities of WT and autotrophically grown Tr were observed to be 0.12-0.13 g/L.d. Synechococcus 79RG48 when grown under mixotrophy using 10 g/L glucose that showed significantly improved biomass productivity of 0.22 + 0.01 g/L.d (Table 3). This improvement was supported by glucose uptake studies wherein concomitant 40% consumption of glucose was observed under mixotrophy indicating precise functioning of cloned GalP protein (Figure 7C).

[00123] HPLC analysis of pigments showed that highest zeaxanthin yield of 9.02 + 1.10 mg/g DCW of Synechococcus 79RG48 in EL. Synechococcus 79R48 displayed zeaxanthin yield of 6.34 + 1.86 mg/ g DCW while WT showed 4.08 + 0.12 mg/g DCW. This improvement was very evident in HPLC chromatograms of Synechococcus 79RG48 and WT (Figure 7A). Although mixotrophically grown Tr showed zeaxanthin yield of 8.09 + 0.19 mg/g DCW, the overall zeaxanthin titer was 12.6 + 0.44 mg/ L which was 3 times higher than that in WT.

[00124] Relative flux towards zeaxanthin production (co _z ) and fraction of unconverted β-carotene (COB,B) were calculated for both the transformants Synechococcus 79R48 and 79RG48 to ensure effective functioning of the cloned gene.

[00125] PCC 7942 positive transformants were investigated for their relative flux towards zeaxanthin synthesis under controlled light (55 + 0.5 μιηο1/ιη ² /8) and temperature (28 + 1 °C) conditions in IC and under natural light (maximum 1000 + 200 μιηο1/ιη ² /8) condition in EL. Relative flux analysis of Synechococcus 79R48 indicated that these transformants displayed 50% improved co _z in IC while 20% increased co _z in EL as compared to WT PCC 7942 (Figure 6). Decrease in relative synthesis of zeaxanthin in EL could be attributed to the light conditions, as natively zeaxanthin production is photo-driven. However, this increase was significant with respect to WT and it exhibited appropriate functioning of the cloned gene.

[00126] It is noteworthy that when exposed to higher light intensities with diurnal variation in EL, Synechococcus 79R48 showed 73% increase in co _z as compared to that in IC. In case of EL, co _z was improved 20% with 30% reduction in COB,B as compared to WT (Figure 6A). This established precise functionality of oxygenase protein in Synechococcus 79R48 irrespective of growth regimes. The study under different growth regime also revealed that relative flux towards zeaxanthin was higher flux under natural light in EL as compared to IC.

[00127] Improved zeaxanthin yield and increased biomass production could ultimately enhance zeaxanthin titer of the system. Therefore, the present disclosure included another plasmid containing both; CrtR and hexose transporter gene GalP from E. coli MG1655 under the control of P _trc promoter, pRG48. This plasmid was transformed in PCC 7942 obtaining Synechococcus 79RG48. Positive transformants were grown in EL and analysed for improvement in product titres. The cyanobacterial transformants exhibited 1.8- 2 times increase in zeaxanthin yield over WT with autotrophy as well as mixotrophy. Under mixotrophy the titre was enhanced almost 3 times over WT to 12.6 + 0.44 mg/L.

[00128] While assessing flux modulation under autotrophic and mixotrophic conditions using Synechococcus 79RG48, it was observed that the flux towards zeaxanthin did not change significantly. However, the PCC 7942 Tr exhibited 37% increase in co _z with concurrent 44% decrease in COB.B was observed when compared with WT PCC 7942, in EL (Figure 6B).

[00129] Another set of PCC 7942 transformants, Synechococcus 79RG48, possessing CrtR gene for improved zeaxanthin production and GalP gene for uptaking extracellular glucose, were grown in EL under autotrophy as well as mixotrophy. Gene functionalities were assessed on the basis of coz values and daily glucose uptake by the cells, coz for these strains was 37% higher than that of WT. Nonetheless, natural light productivity of transformants under mixotrophy was 40% more than that in autotrophy of the Tr and WT, with concurrent 40% decrease in amount of residual glucose in the medium.

[00130] Finally, analytical confirmation of cyanobacterial zeaxanthin was done using mass spectroscopy. Similar product ion spectra were obtained for standard all- trans zeaxanthin (Sigma-Aldrich) and Synechococcus 79RG48 pigment eluate at RT 24.4 min. This confirmed that zeaxanthin obtained from transformants is all-trans zeaxanthin, the desired active form. [00131] Thus, Synechococcus 79RG48 could be considered as a sustainable cell factory that can be scaled up under natural light conditions for lutein-free zeaxanthin production.

Analysing growth and zeaxanthin production from Transformant

[00132] PCC 7942 WT and Tr; Synechococcus 79R48 and Synechococcus 79RG48 were grown in EL (max. 1000 + 100 μιηο1/ιη ² /8). Biomass productivities of WT and autotrophically grown Tr were observed to be 0.12-0.13 g/L.d. Synechococcus 79RG48 when grown under mixotrophy using 10 g/L glucose that showed significantly improved biomass productivity of 0.22 + 0.01 g/L.d (Table 3) This improvement was supported by glucose uptake studies wherein concomitant 40% consumption of glucose was observed under mixotrophy indicating precise functioning of cloned GalP protein (Figure 7B).

[00133] HPLC analysis of pigments showed that highest zeaxanthin yield of 9.02 + 1.10 mg/g DCW of Synechococcus 79RG48 in EL. Synechococcus 79R48 displayed zeaxanthin yield of 6.34 + 1.86 mg/ g DCW while WT showed 4.08 + 0.12 mg/g DCW. This improvement was very evident in HPLC chromatograms of Synechococcus 79RG48 and WT. (Figure 7A) Although mixotrophically grown Tr showed zeaxanthin yield of 8.09 + 0.19 mg/g DCW, the overall zeaxanthin titer was 12.6 + 0.44 mg/ L which was 3 times higher than that in WT (Table 3).

[00134] Table 3: Analysis for biomass, yield, and titer of transformants and WT strains

[00135] Figure 8 shows that the strain 79RG48 produces higher yield of zeaxanthin as compared to the other carotenoid under autotrophy as well as under mixotrophy conditions. While in case of WT, the yield of other carotenoid is higher as compared to zeaxanthin. Thus, the present transformant displays a better yield of zeaxanthin.

[00136] Figure 10 shows enhanced carotenoid yield and enhanced biomass yield in favour of zeaxanthin production in relation to light in case of 79RG48 as compared to the WT. It can be appreciated that the zeaxanthin yield is highly improved in case of EL (environmental laboratory) conditions as compared to IC (incubator conditions). In case of EL conditions, it can be observed that the strain 79RG48 leads to highest yield of zeaxanthin under mixotrophy conditions. Further, it can also be observed that zeaxanthin yield is more than 3 times in case of 79RG48 strain under mixotrophy condition as compared to wild type under autotrophy.

[00137] Table 4 as depicted below illustrates the quantum of light utilized in case of biomass production, zeaxanthin production, and beta carotene production in different transformants as compared to the wild type. It can be observed that in case of WT (EL conditions), the quantum of light utilized is more for production of beta carotene than zeaxanthin in case of autotrophic conditions. Further, it can be seen that in case of R48, the quantum of light utilized is slightly more for zeaxanthin production than beta carotene production. On the other hand, for the strain RG48, the quantum of light utilized for production of zeaxanthin is almost twice than that utilized for production of beta carotene. Therefore, the present result is in agreement with the result obtained in case of relative flux values in different transformants.

Table 4: Effective quantum of light utilized for biomass and carotenoid 5 synthesis

Table 5: Yields and titres of WT and Tr under controlled incubator conditions

[00138] Table 5 depicts that Synechococcus 79R48 cultures grown in light and

temperature controlled conditions in incubator exhibited significant difference in yields of zeaxanthin produced by the wild type and Tr. WT displayed zeaxanthin yield of 1.72 mg/g DCW whereas Tr displayed it to be 4.31 mg/g DCW which was almost 2.5 times enhancement. The results indicated effective functionality of the transformants. However, to further improvise titers, it was necessary to leverage biomass productivities. Thus, the cultures were further grown in EL.

Analytical characterization of zeaxanthin

[00139] ESI (+)-MS characterization of standard zeaxanthin and PCC 7942 methanol extract HPLC fraction corresponding to RT 24.4 min was performed. Figure 9 shows ESI(+) - MS product ion spectra exhibiting two fragments corresponding to 569.4 (M+H) ⁺ and 551.4 (MH-fhO) ^"1" in standard as well as Synechococcus 79RG48 cell extract confirming presence of all-trans zeaxanthin as desired. Advantages of the present disclosure

[00140] The present disclosure discloses the construction of the transformant 79RG48 which shows enhanced yield and titer of zeaxanthin under natural diurnal light conditions. The process of production of zeaxanthin is highly economical as compared to the previous methods. Also, the titre and yield is significantly higher in the transformant of the present disclosure.

[00141] Significant advantages of the present disclosure as compared to the prior art {Lagarde. D et al., App. and Env. Microbiol. 2000;66(l):64-72- The prior art had shown the production of zeaxanthin from a recombinant strain constructed from PCC 6803, and the studies are confined to continuous light intensity of 50 umol/m2/s. Whereas, the present disclosure discloses a method of production of zeaxanthin from a recombinant strain PCC 7942, and the production of zeaxanthin is performed under natural diurnal light conditions with maximum light intensity of 1200 umol/m2/s. The cloning locus in case of prior art is psbA2 gene of PCC 6803, which is a gene for the photosynthetic protein, whereas the present disclosure exploits neutral site II (NS2) of PCC 7942 genome. The prior art uses the crtR gene of the same strain (PCC 6803) to obtain transformant in the same strain, whereas the present disclosure uses the crtR gene of a different strain (PCC 7002) for creating a transformant in PCC 7942 strain. The former method as used in the prior art may lead to undesirable results but the latter method of using a gene from a related strain provides superior results. Possible shortcomings of the prior art is that cloning at psbA2 location might be advantageous in terms of utilization of endogenous promoters for gene expression, however psbA2 is essential under high light conditions and thus the transformant may not perform efficiently under natural diurnal light conditions during scale up. The present disclosure offers significant advantages in terms of performing homologous recombination at NS2, the cell growth is normally regulated as per the light conditions around. This shall also not affect any of the cell's regular activities and facilitates economical scale-up reaction.

References:

1. Ravanello MP, Ke AD, Alvarez J, Huang B, Shewmaker CK, 2003. Coordinate expression of multiple bacterial carotenoid genes in canola leading to altered carotenoid production. Metabolic engineering. 5(4):255-263. doi: 10.1016/j.ymben.2003.08.001.

Berman J, Zorrilla-lopez U, Farre G, Zhu C, Sandmann G, Twyman RM, Capell T, Christou P, 2014. Nutritionally important carotenoids as consumer products. Phytochem Rev. doi: 10.1007/sl l l01-014-9373-l.

Li X, Gui L, Tian Q, Jie H, 2014. Metabolic engineering of Escherichia coli to produce zeaxanthin. J Ind Microbiol Biotechnol. doi: 10.1007/sl0295-014-1565- 6.

Vachali P, Bhosale P, Bernstein PS, 2012. Microbial Carotenoids from Fungi: Methods and Protocols, Methods in Molecular Biology, Chapter 2. 898: 41-59. doi: 10.1007/978-l-61779-918-l.

Kim M, Ahn J, Jeon H, Jin E, 2017. Development of a Dunaliella tertiolecta Strain with Increased Zeaxanthin Content Using Random Mutagenesis. Mar Drugs. 15: 189. doi:10.3390/mdl5060189.

Mata-gomez LC, Montanez JC, Mendez-zavala A, Aguilar CN, 2014.

Biotechnological production of carotenoids by yeasts : an overview. Microbial

Cell Factories. 13: 12. doi: 10.1186/1475-2859-13-12.

Lin J, Lee D, Chang J, 2015. Lutein production from biomass : Marigold flowers versus microalgae. Bioresour Technol.;lS4 :421-428. doi: 10.1016/j .biortech.2014.09.099.