CROSS-REFERENCE TO PRIOR APPLICATION This application claims priority pursuant to 35 U.S.C. §119(e) to U.S. Provisional Application No. 62/928,256, filed October 30, 2019, the disclosure of which is incorporated herein by reference in its entirety.

INCORPORATION BY REFERENCE OF SEQUENCE LISTING PROVIDED AS A TEXT FILE A Sequence Listing is provided herewith as a text file, “UCSF-598W0 Seq List_ST25.txt,” created on October 27, 2020 and having a size of 79 KB. The contents of the text file are incorporated by reference herein in their entirety.

STATEMENT OF GOVERNMENT SUPPORT This invention was made with government support under grant numbers P30 AR070155 and P60 AR053308 awarded by The National Institutes of Health, and grant number U01 DP005120 awarded by The Centers for Disease Control and Prevention. The government has certain rights in the invention.

INTRODUCTION

Systemic lupus erythematosus (SLE) is an autoimmune disease that disproportionately affects women ¹ and is characterized by a broad range of manifestations across multiple organs ² . Molecular analyses have implicated the production of autoantibodies, dysregulation of antigen presentation and lymphocyte signaling ³⁴ , activation of the interferon signaling pathway ³⁴ , and failure of apoptotic clearance as hallmarks of the disease ⁵⁶ . Many genes that participate in these immunological processes are proximal to the -100 genetic variants thus far associated with SLE ⁷ . However, while these results implicate multiple immune pathways ³⁸ , mapping the cell types and states underlying the pathogenesis of SLE remains incomplete and annotating the molecular function of disease-associated variants remains challenging.

Historically, separate approaches have been used to characterize changes in cell composition and state in SLE. Flow cytometry analyses that estimates composition based on known cell surface markers have reported frequency changes of circulating immune populations ^{9 10} . Bulk gene expression analyses with or without sorting for specific peripheral immune subsets have found elevated levels of interferon signaling with pleiotropic effects across immune cell types ³ _’ ^{4 11} . However, flow cytometry relies on the initial set of markers

(and thus biased by prior knowledge) and bulk expression averages across diverse cells between and within types. Moreover, neither can simultaneously measure the frequencies and activation states of cell types or capture heterogeneity within sorted populations. Additionally, it is challenging to apply both methods at scale across the large cohorts necessary to detect subtle shifts in cell composition and gene expression caused by disease or disease-associated variants.

Massively parallel single-cell RNA-sequencing (scRNA-seq) holds potential as a comprehensive approach to simultaneously estimate the composition and characterize the state of circulating immune cells. When integrated with dense genotyping data, there is a further opportunity to ascribe molecular functionality to disease-associated variants across cellular contexts. However, profiling large population cohorts using scRNA-seq has been limited by sample throughput and susceptibility to technical and biological variability.

SUMMARY

Provided are methods of treating Systemic Lupus Erythematosus (SLE) in subjects in need thereof. In certain embodiments, the subjects in need thereof are identified as having cytotoxic CD8+ T lymphocytes comprising a particular expression profile, and the methods comprise administering an effective amount of an agent that targets the cytotoxic CD8+ T lymphocytes. According to some embodiments, the subjects in need thereof are identified as having activated monocytes comprising a particular expression profile, and the methods comprise administering an effective amount of an agent that targets the activated monocytes. In certain embodiments, the subjects in need thereof are identified as having macrophages comprising a particular expression profile, and the methods comprise administering an effective amount of an agent that targets the macrophages. Also provided are methods that find use, e.g., in identifying the subjects in need of treatment of SLE.

BRIEF DESCRIPTION OF THE FIGURES

FIG. 1 : Overview and compositional changes in SLE. Panel A Multiplexing approach (Mux-seq) applied to 119 cases and 50 healthy controls. Panel B UMAP projection and assignment of cells to 11 major cell types. Panel C Cell density plots of cases and controls split by ethnicity and sequencing batch. Panel D UMAP projection for each sample in a pool after demultiplexing using demuxlet. Panel E Correlation of single cell (x-axis) and CBC estimates (y-axis) of monocyte (orange) and lymphocyte (purple) abundances. Panel F Cell type percentage differences between cases and controls. Repeated controls are connected by a line. Panel G Monocyte and lymphocyte abundances across populations in the UCSF EHR database. Panel H Causal effect size correlation between Lymphocyte Count and SLE disease status reported in the UKBK. FIG. 2: Expression differences and variance decomposition in SLE. Panel A Volcano plot of effect size (x-axis) and loglO(p-value) (y-axis) for differentially expressed genes in PBMCs (black) or specific cell types (dark gray). Previously identified 30 published ISG genes are circled. Panel B PBMC and cell-type-specific expression heatmaps and module assignments of 198 differentially expressed genes between cases and controls. Panel C Correlation between pseudobulk PBMC ISG score (x-axis) and myeloid percentage (y-axis). Panel D Distribution of the contribution of cell composition to pseudobulk PBMC expression variability colored by genes differentially expressed across (blue) or specific to cell types (green). Panel E Contribution of cell-type percentage (left) or cell-type-specific expression (right) to pseudobulk PBMC expression variability for each DE gene. Panel F Correlation of IL6 expression in PBMCs with the percentage (top) and IL6 expression (bottom) of each cell type. Panel G Cross-validated Ft ² of elastic-net predictions for case/control status and clinical outcomes relevant to SLE.

FIG. 3: Myeloid changes in SLE. Panel A UMAP projection and assignment of myeloid cells to 10 clusters. Panel B Violin plot of marker genes differentiating annotated monocytes clusters. Panel C Cell density plots for cases and controls split by ethnicity and sequencing batch. Panel D Cluster percentage differences between cases and controls. Lines connect control samples replicated across pools. Panel E Cluster percentages (y- axis) by pseudobulk PBMC ISG score (x-axis). Panel F UMAP projections of single cells colored by the average expression of modules of DE genes. Panel G Distribution of cells along DPT ordering based on the expression of modules of DE genes or lineage markers.

FIG. 4: Lymphoid changes in SLE. Panel A UMAP projection and assignment of lymphocytes to 19 clusters. Panel B Violin plot of marker genes differentiated annotated lymphocyte clusters. Panel C Cell density plots for cases and controls split by ethnicity and sequencing batch. Panel D Cluster percentage differences between cases and controls. Lines connect control samples replicated across pools. Panel E Cluster percentages (y- axis) by pseudobulk PBMC ISG score (x-axis). Panel F Gini coefficients for T4 and T8 cells in cases and controls. Panel G UMAP projection with clonally expanded cells highlighted and Gini coefficients of specific T cell clusters.

FIG. 5: Mapping cell-type-specific and interferon-specific genetic effects. Panel A Number of overlapping c/ ^' s-e QTLS (lower triangle) and average genetic correlation (upper triangle) between pairs of cell types. Panel B Enrichment of cell-type-specific c/ ^' s-e QTLs in cell-type-specific ATAC-seq peaks. Panel C Enrichment of c/ ^' s-e QTLs detected in each cell type for SLE-associated loci. Panel D Cell-type-specific eQTLs associated with the expression of HSPA6 (T8-specific) and ICAM3 (ncM-specific). Panel E Quantile-quantile plot of c/s-IFN-eQTLs (orange) subsetted for previously published c/s-IFN-eQTLs (green). Panel F IFN-specific genetic effects on APOBEC3B gene expression in each cell type.

Figure 6: Analysis of SLE flare cases. Panel A Mux-Ab-seq applied over 16 flare cases, 8 treated cases, 5 managed cases and 10 healthy controls. Panel B UMAP projection and annotation of each PBMC as one of 11 cell types. Panel C Cell density plot of cases and controls. Panel D Correlation of cluster-specific gene expression profiles between the cross-sectional and flare cohorts. Panel E Correlation of log2 fold-change of cluster percentages between flare cases and healthy controls (x-axis) and cross-sectional cases and healthy controls (y-axis). Panel F Assignment of each PBMC to 26 clusters and changes in key clusters between flare and cross-sectioanl cases. Panel G UMAP estimated from protein features colored by cell type. T8 _e ff,c toi population estimated from mRNA are colored in bold. Panel H PBMCs colored by normalized CD4 (left) and CD8 (right) antibody abundance. T8 _e m, _C ytoi is circled. Panel I Differences in the percentages of T8em,cytoi and T4 _em ,cytoi between flare cases, treated cases, managed cases and controls.

DETAILED DESCRIPTION

Before the methods of the present disclosure are described in greater detail, it is to be understood that the methods are not limited to particular embodiments described, as such may, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting, since the scope of the methods will be limited only by the appended claims.

Where a range of values is provided, it is understood that each intervening value, to the tenth of the unit of the lower limit unless the context clearly dictates otherwise, between the upper and lower limit of that range and any other stated or intervening value in that stated range, is encompassed within the methods. The upper and lower limits of these smaller ranges may independently be included in the smaller ranges and are also encompassed within the methods, subject to any specifically excluded limit in the stated range. Where the stated range includes one or both of the limits, ranges excluding either or both of those included limits are also included in the methods.

Certain ranges are presented herein with numerical values being preceded by the term “about.” The term “about” is used herein to provide literal support for the exact number that it precedes, as well as a number that is near to or approximately the number that the term precedes. In determining whether a number is near to or approximately a specifically recited number, the near or approximating unrecited number may be a number which, in the context in which it is presented, provides the substantial equivalent of the specifically recited number. Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which the methods belong. Although any methods similar or equivalent to those described herein can also be used in the practice or testing of the methods, representative illustrative methods are now described.

All publications and patents cited in this specification are herein incorporated by reference as if each individual publication or patent were specifically and individually indicated to be incorporated by reference and are incorporated herein by reference to disclose and describe the materials and/or methods in connection with which the publications are cited. The citation of any publication is for its disclosure prior to the filing date and should not be construed as an admission that the present methods are not entitled to antedate such publication, as the date of publication provided may be different from the actual publication date which may need to be independently confirmed.

It is noted that, as used herein and in the appended claims, the singular forms “a”, “an”, and “the” include plural referents unless the context clearly dictates otherwise. It is further noted that the claims may be drafted to exclude any optional element. As such, this statement is intended to serve as antecedent basis for use of such exclusive terminology as “solely,” “only” and the like in connection with the recitation of claim elements, or use of a “negative” limitation.

It is appreciated that certain features of the methods, which are, for clarity, described in the context of separate embodiments, may also be provided in combination in a single embodiment. Conversely, various features of the methods, which are, for brevity, described in the context of a single embodiment, may also be provided separately or in any suitable sub-combination. All combinations of the embodiments are specifically embraced by the present disclosure and are disclosed herein just as if each and every combination was individually and explicitly disclosed, to the extent that such combinations embrace operable processes and/or compositions. In addition, all sub-combinations listed in the embodiments describing such variables are also specifically embraced by the present methods and are disclosed herein just as if each and every such sub-combination was individually and explicitly disclosed herein.

As will be apparent to those of skill in the art upon reading this disclosure, each of the individual embodiments described and illustrated herein has discrete components and features which may be readily separated from or combined with the features of any of the other several embodiments without departing from the scope or spirit of the present methods. Any recited method can be carried out in the order of events recited or in any other order that is logically possible. Recently a sample multiplexing approach (Mux-seq) was described that leverages single nucleotide polymorphisms (SNPs) to enable systematic and cost-effective profiling of 10 ⁴ cells from 10-100 genetically distinct samples in one microfluidic reaction ¹² . Mux-seq was used to profile ~1 million peripheral blood mononuclear cells (PBMCs) isolated from 58 healthy controls and 136 SLE patients of Asian and European ancestry, including patients experiencing active disease flares. This rich dataset was analyzed to define changes in cellular composition, cell-type-specific gene expression, and immune repertoire in cases. To place the findings in the context of the known molecular signatures of SLE, the contribution of cellular composition and cell-type-specific expression to inter-individual expression variability was estimated and calculated over aggregated PBMCs, hereinafter pseudobulk. The contribution of genetics to interindividual variability was further explored by mapping common genetic variants associated with gene expression (eQTLs) across 8 immune cell types, identifying eQTLs whose effects are modified by cell-type identity and interferon activation. Finally, published genome-wide association studies (GWAS) summary statistics were leveraged to annotate cell types that may mediate genetic associations in SLE and other autoimmune diseases. This application demonstrates the power of multiplexed single-cell RNA-seq as a compelling tool for quantitative high-dimensional phenotyping of immunological disease.

DEFINITIONS

As used herein, “treating” or “treatment” of a disease in a subject refers to (1 ) preventing the symptoms or disease from occurring in a subject that is predisposed or does not yet display symptoms of the disease; (2) inhibiting the disease or arresting its development; or (3) ameliorating or causing regression of the disease or the symptoms of the disease. As understood in the art, “treatment” is an approach for obtaining beneficial or desired results, including clinical results. For the purposes of the present technology, beneficial or desired results can include one or more, but are not limited to, alleviation or amelioration of one or more symptoms, diminishment of extent of a condition (including a disease), stabilized (i.e., not worsening) state of a condition (including disease), delay or slowing of condition (including disease), progression, reduction in the number of disease episodes and/or symptoms, reduction in lesional size, decrease of auto-immune response, which may, but does not have to, result in the regression or ablation of the disease lesion, amelioration or palliation of the condition (including disease), increase in the length of disease-free presentation following treatment, and/or decreased mortality at a given point of time following treatment, whether detectable or undetectable. Treatments containing the disclosed compositions and methods can be used as a sole therapy or in combination with other appropriate therapies. According to some embodiments, treatment excludes prophylaxis. An "effective amount" or “efficacious amount” is an amount sufficient to achieve the intended purpose, non-limiting examples of such include: modulation of the immune response, suppression of an inflammatory response and modulation of T cell activity or T cell populations. According to some embodiments, the effective amount is one that functions to achieve a stated therapeutic purpose, e.g., a therapeutically effective amount. As described herein in detail, the effective amount, or dosage, depends on the purpose and the composition, and can be determined according to the present disclosure.

As used herein, the term “administer” and “administering” are used to mean introducing the therapeutic agent into a subject. The therapeutic administration of this substance serves to attenuate any symptom or prevent additional symptoms from arising. When administration is for the purposes of preventing or reducing the likelihood of developing an autoimmune disease or disorder, the substance is provided in advance of any visible or detectable symptom. Routes of administration include, but are not limited to, oral (such as a tablet, capsule or suspension), parenteral, topical, transdermal, intranasal, subcutaneous, intravenous, intraarterial, intramuscular, intraosseous, intraperitoneal, epidural, and intrathecal.

As used herein, the term “autologous,” in reference to cells, tissue, and/or grafts refers to cells, tissue, and/or grafts that are isolated from and then and administered back into the same subject, patient, recipient, and/or host. “Allogeneic” refers to non-autologous cells, tissue, and/or grafts.

The term “diagnosis” is used herein to refer to the identification of a molecular or pathological state, disease or condition, such as the identification of an autoimmune disorder. The term “prognosis” is used herein to refer to the prediction of the likelihood of autoimmune disorder-attributable disease symptoms, including, for example, recurrence, flaring, and drug resistance, of an autoimmune disease. The term “prediction” is used herein to refer to the likelihood that a patient will respond either favorably or unfavorably to a drug or set of drugs. According to some embodiments, the prediction relates to the extent of those responses. According to some embodiments, the prediction relates to whether and/or the probability that a patient will survive or improve following treatment, for example treatment with a particular therapeutic agent, and for a certain period of time without disease recurrence. The predictive methods of the invention can be used clinically to make treatment decisions by choosing the most appropriate treatment modalities for any particular patient. The predictive methods of the present invention are valuable tools in predicting if a patient is likely to respond favorably to a treatment regimen, such as a given therapeutic regimen, including for example, administration of a given therapeutic agent or combination, surgical intervention, steroid treatment, etc., or whether long-term survival of the patient, following a therapeutic regimen is likely. The term “long-term” survival is used herein to refer to survival for at least 1 year, 5 years, 8 years, or 10 years following therapeutic treatment. The term “subject,” “host,” “individual,” and “patient” are used interchangeably herein to refer to animals, typically mammalian animals. Any suitable mammal can be treated by a method, cell or composition described herein. Non-limiting examples of mammals include humans, non-human primates (e.g., apes, gibbons, chimpanzees, orangutans, monkeys, macaques, and the like), domestic animals (e.g., dogs and cats), farm animals (e.g., horses, cows, goats, sheep, pigs) and experimental animals (e.g., mouse, rat, rabbit, guinea pig). In some embodiments a mammal is a human. A mammal can be any age or at any stage of development (e.g., an adult, teen, child, infant, or a mammal in utero). A mammal can be male or female. A mammal can be a pregnant female. In some embodiments, a subject is a human.

As used herein, the term “T cell,” refers to a type of lymphocyte that matures in the thymus. T cells play an important role in cell-mediated immunity and are distinguished from other lymphocytes, such as B cells, by the presence of a T cell receptor on the cell surface. T- cells may either be isolated or obtained from a commercially available source. “T cell” includes all types of immune cells expressing CD3 including T-helper cells (CD4+ cells), cytotoxic T cells (CD8+ cells), natural killer T cells, T-regulatory cells (Treg) and gamma- delta T cells. A “cytotoxic cell” includes CD8+ T cells, natural-killer (NK) cells, and neutrophils, which cells are capable of mediating cytotoxicity responses. Non-limiting examples of commercially available T cell lines include lines BCL2 (AAA) Jurkat (ATCC® CRL-2902™), BCL2 (S70A) Jurkat (ATCC® CRL-2900™), BCL2 (S87A) Jurkat (ATCC® CRL-2901 ™), BCL2 Jurkat (ATCC® CRL-2899™), Neo Jurkat (ATCC® CRL-2898™), TALL-104 cytotoxic human T cell line (ATCC # CRL-11386). Further examples include but are not limited to mature T cell lines, e.g., such as Deglis, EBT-8, HPB-MLp-W, HUT 78, HUT 102, Karpas 384, Ki 225, My-La, Se-Ax, SKW-3, SMZ-I and T34; and immature T- cell lines, e.g, ALL-SIL, Bel3, CCRF-CEM, CML-T1 , DND-41 , DU.528, EU-9, HD-Mar, HPB-ALL, H-SB2, HT-I, JK-T1 , Jurkat, Karpas 45, KE-37, KOPT-K1 , K-TI, L-KAW, Loucy, MAT, MOLT-I, MOLT 3, MOLT-4, MOLT 13, MOLT-16, MT-I, MT-ALL, PI 2/Ichikawa, Peer, PER0117, PER-255, PF-382, PFI-285, RPMI-8402, ST-4, SUP-T1 to T14, TALL-I, TALL-101 , TALL-103/2, TALL-104, TALL-105, TALL-106, TALL-107, TALL-197, TK-6, CCL-119); and cutaneous T cell lymphoma lines, e.g., HuT78 (ATCC CRM-TIB-161), MJ[GI I] (ATCC CRL-8294), HuTI02 (ATCC TIB-162). Null leukemia cell lines, including but not limited to REH, NALL-I, KM-3, L92-221 , are a another commercially available source of immune cells, as are cell lines derived from other leukemias and lymphomas, such as K562 erythroleukemia, THP-I monocytic leukemia, U937 lymphoma, HEL erythroleukemia, HL60 leukemia, HMC-I leukemia, KG-I leukemia, U266 myeloma. Non-limiting exemplary sources for such commercially available cell lines include the American Type Culture Collection, or ATCC, (http://www.atcc.org/) and the German Collection of Microorganisms and Cell Cultures (https://www.dsmz.de/). As used herein, the term “regulatory T cells” (or Tregs) refers to a subgroup of T cells that maintain immunological unresponsiveness to self-antigens and suppress excessive immune responses deleterious to the host. Sakaguchi et al. Cell. 133(5):775-872008.

As used herein, the term “monocytes” refers to mononuclear phagocytes in their various forms have been shown to participate in many critical phases of the mammalian immune response. Monocytes and macrophages are known to be essential for the initiation of immune responses by virtue of their ability to process antigen (Rosenthal, New Engl. J. Med. 303, 1153. 1980), and for their ability to secrete soluble factors such as interleukin 1 (IL-1), colony stimulating factor (CSF), interferon (IFN) and prostaglandin E (PGE) which allow them to function as immunoregulators for a number of immune responses (Epstein, Biology of Lymphokines; Academic Press, NY, pp. 123-152. 1979; Stevenson, The Reticuloendothelial System. A Comprehensive Treatise, Vol. VI: Plenum Press, NY, pp. 79-91. 19882). In addition, monocytes are known to play critical role as final effector cells in humoral immunity by virtue of the fact that these cells secrete complement components (Nathan, et al, New England J. Med. 303, 623. 1980) and are capable of mediating cytotoxic functions. The term "activated monocytes" as used herein refers to monocytes have been exposed to or treated with such agents or factors which would stimulate, modify or enhance the immunoregulatory, biological or physiochemical property, native characteristics or functions of the monocytes. Such agents or factors include suitable antigens, adjuvants, biological response modifiers (BRMs) and the like.

As used herein, the term “macrophages” refers to relatively long-lived phagocytic cells of mammalian tissue that are derived from blood monocytes. Macrophages play an important role in the phagocytosis (digestion) of foreign substances such as bacteria, viruses, protozoa, tumor cells, cell debris, and the release of chemicals that stimulate other cells of the immune system, such as cytokines and growth factors.

As used herein, the term “expression” or “express” refers to the process by which polynucleotides are transcribed into mRNA and/or the process by which the transcribed mRNA is subsequently translated into peptides, polypeptides, or proteins. If the polynucleotide is derived from genomic DNA, expression may include splicing of the mRNA in a eukaryotic cell. The expression level of a gene may be determined by measuring the amount of mRNA or protein in a cell or tissue sample. According to some embodiments, the expression level of a gene from one sample may be directly compared to the expression level of that gene from a control or reference sample. In some embodiments, the expression level of a gene from one sample may be directly compared to the expression level of that gene from the same sample following administration of a compound.

As used herein, the term “gene expression profile” refers to measuring the expression level of multiple genes to establish an expression profile for a particular sample. Expression levels/amounts can be determined based on any suitable criterion known in the art, including but not limited to mRNA, cDNA, proteins, protein fragments and/or gene copy. Expression levels/amounts can be determined qualitatively and/or quantitatively.

As used herein, the term “T cell receptor” or “TCR” refers to a cell surface molecule found on T cells that functions to recognize and bind antigens presented by antigen presenting molecules. Generally, a TCR is a heterodimer of an alpha chain (TRA) and a beta chain (TRB). Some TCRs are comprised of alternative gamma (TRG) and delta (TRD) chains. T cells expressing this version of a TCR are known as gd T cells. TCRs are part of the immunoglobulin superfamily. Accordingly, like an antibody, the TCR comprises three hypervariable CDR regions per chain. There is also an additional area of hypervariability on the beta-chain (HV4). The TCR heterodimer is generally present in an octomeric complex that further comprises three dimeric signaling modules CD3Y/S, CD36/S, and CD247 z/z or z/h. Non-limiting examples of TCRs include single- VaVp TCRs (scTv), full-length TCRs produced through use of a T cell display system, and TCRs wherein the CDR regions have been engineered to recognize a specific antigen, peptide, fragment, and/or MHC molecule. Methods of developing and engineering modified TCRs are known in the art. For example, see Stone, J.D. et al. Methods in Enzymology 503: 189-222 (2012), PCT Application WO2014018863 Al.

The term “chimeric antigen receptor” (CAR), as used herein, refers to a fused protein comprising an extracellular domain capable of binding to an antigen, a transmembrane domain derived from a polypeptide different from a polypeptide from which the extracellular domain is derived, and at least one intracellular domain. The “chimeric antigen receptor (CAR)” is sometimes called a “chimeric receptor” or a “chimeric immune receptor (CIR).” The “extracellular domain capable of binding to an antigen” means any oligopeptide or polypeptide that can bind to a certain antigen. The “intracellular domain” or “intracellular signaling domain” means any oligopeptide or polypeptide known to function as a domain that transmits a signal to cause activation or inhibition of a biological process in a cell. In certain embodiments, the intracellular domain may comprise one or more costimulatory signaling domains in addition to the primary signaling domain. The “transmembrane domain” means any oligopeptide or polypeptide known to span the cell membrane and that can function to link the extracellular and signaling domains. A chimeric antigen receptor may optionally comprise a “hinge domain” which serves as a linker between the extracellular and transmembrane domains.

As used herein, a “first generation CAR” refers to a CAR comprising an extracellular domain capable of binding to an antigen, a transmembrane domain derived from a polypeptide different from a polypeptide from which the extracellular domain is derived, and at least one intracellular domain. A “second generation CAR” refers to a first generation CAR further comprising one costimulatory domain (e.g. 4-1 BB or CD28). A “third generation CAR” refers to a first generation CAR further comprising two costimulatory domains (e.g. CD27, CD28, ICOS, 4-1 BB, or 0X40). A “fourth generation CAR” (also known as a “TRUCK”) refers to a CAR T cell further engineered to secrete an additional factor (e.g. proinflammatory cytokine IL-12). A review of these CAR technologies and cell therapy is found in Maus, M. et al. Clin. Cancer Res. 22(3): 1875-84 (2016).

Non-limiting exemplary polynucleotide sequences that encode for components of each domain are disclosed herein, e.g.:

Hinge domain: IgGI heavy chain hinge polynucleotide sequence: CTCGAGCCCAAATCTTGTGACAAAACTCACACATGCCCACCGTGCCCG (SEQ ID NO:289).

Transmembrane domain: CD28 transmembrane region polynucleotide sequence: TTTTGGGTGCTGGTGGTGGTTGGTGGAGTCCTGGCTTGCTATAGCTTGCTAGTAA CAGTGGCCTTTATTATTTTCTGGGTG (SEQ ID NO:290). The fragment sequences associated with the GenBank Accession NOs: XM_0067I2862.2 and XM_009444056.1 provide additional, non-limiting, example sequences of the CD28 transmembrane domain.

Transmembrane domain: CD8 alpha transmembrane domain. The fragment sequences associated with the amino acid positions 183 to 203 of the human T cell surface glycoprotein CD8 alpha chain (GenBank Accession No: NP_00I759.3), or the amino acid positions 197 to 217 of the mouse T cell surface glycoprotein CD8 alpha chain (GenBank Accession No: NP_00I074579. 1), and the amino acid positions 190 to 210 of the rat T cell surface glycoprotein CD8 alpha chain(GenBank Accession No: NP_113726.1 ) provide example sequences of the CD8 a transmembrane domain.

Intracellular domain: 4-1 BB co-stimulatory signaling region polynucleotide sequence: AAACGGGGCAG AAAGAAACTCCTGT AT AT ATT CAAACAACCATTT AT G AG ACCAGT ACAA ACT ACT C AAG AGG AAG AT GGCTGTAGCT GCCG ATTTCC AG AAG AAG AA GAAGGAGGATGTGAACTG (SEQ ID NO:291). Non-limiting example sequences of the 4-1 BB costimulatory signaling region are provided in U.S. App. No. 13/826,258.

Intracellular domain: CD28 co-stimulatory signaling region polynucleotide sequence: AGG AGTAAG AGG AGCAGGCT CCTGCACAGTG ACT ACAT GAACAT G ACT CCCCGCCGCC CCGGGCCCACCCGCAAGCATTACCAGCCCTATGCCCCACCACGCGACTTCG CAGCCTATCGCTCC (SEQ ID NO:292). Further exemplary sequences CD28 costimulatory signaling domain are provided in U.S. Patent No. 5,686,281 ; Geiger, T.L. et al. (2001 ) Blood 98: 2364-2371 ; Hombach, A. et al. (2001 ) J Immunol 167: 6123-6131 ; Maher, J. et al. (2002) Nat Biotechnol 20: 70-75; Haynes, N.M. et al. (2002) J Immunol. 169: 5780-5786 (2002); Haynes, N.M. et al. (2002) Blood 100: 3155-3163.

Intracellular domain: CD3 zeta signaling region polynucleotide sequence: AGAGTGAAGTTCAGCAGGAGCGCAGACGCCCCCGCGTACCAGCAGGGCCAGAACCAGC TCTATAACGAGCTCAATCTAGGACGAAGAGAGGAGTACGATGTTTTGGACAAGAGACGT GGCCGGGACCCTGAGATGGGGGGAAAGCCGAGAAGGAAGAACCCTCAGGAAGGCCTG TACAATGAACTGCAGAAAGATAAGATGGCGGAGGCCTACAGTGAGATTGGGATGAAAGG CGAGCGCCGGAGGGGCAAGGGGCACGATGGCCTTTACCAGGGTCTCAGTACAGCCACC AAGGACACCTACGACGCCCTTCACATGCAGGCCCTGCCCCCTCGCTAA (SEQ ID NO:293). Non-limiting example sequences of the CD3 zeta signaling domain amino acid sequence are provided in U.S. Application No. 13/826,258.

Intracellular domain: ICOS costimulatory signaling region. Non-limiting example sequences of the ICOS costimulatory signaling region are provided in U.S. Patent Application Publication No. 2015/0017141.

Intracellular domain: 0X40 costimulatory signaling region. Non-limiting example sequences of the 0X40 costimulatory signaling region are disclosed in U.S. Patent Application Publication No. 2012/20148552.

Hinge domain: Exemplary CD8 alpha hinge domains for human, mouse, and other species are provided in Pinto, R.D. et al. (2006) Vet. Immunol. Immunopathol. 110:169-177.

Further embodiments of each exemplary domain component include other proteins that have analogous biological function that share at least 70%, or at least 80% amino acid sequence identity, preferably 90% sequence identity, more preferably at least 95% sequence identity with the proteins encoded by the above disclosed nucleic acid sequences.

According to some embodiments, the recombinant T cell or CAR of this disclosure further comprises a suicide gene. As used herein, the term “suicide gene” is a gene capable of inducing cell apoptosis; non-limiting examples include HSV-TK (Herpes simplex virus thymidine kinase), cytosine deaminase, nitroreductase, carboxylesterase, cytochrome P450 or PNP (Purine nucleoside phosphorylase), truncated EGFR, or inducible caspase (“iCasp”). Suicide genes may function along a variety of pathways, and, in some cases, may be inducible by an inducing agent such as a small molecule.

As used herein, the term “antibody” (“Ab”) collectively refers to immunoglobulins (or “lg”) or immunoglobulin-like molecules including but not limited to antibodies of the following isotypes: IgM, IgA, IgD, IgE, IgG, and combinations thereof. Immunoglobulin like molecules include but are not limited to similar molecules produced during an immune response in a vertebrate, for example, in mammals such as humans, rats, goats, rabbits and mice, as well as non- mammalian species, such as shark immunoglobulins (see Feige, M. et al. Proc. Nat. Ac. Sci. 41 (22): 8155-60 (2014)). Unless specifically noted otherwise, the term “antibody” includes intact immunoglobulins and “antibody fragments” or “antigen binding fragments” that specifically bind to a molecule of interest (or a group of highly similar molecules of interest) to the substantial exclusion of binding to other molecules (for example, antibodies and antibody fragments that have a binding constant for the molecule of interest that is at least 10 ³ M ¹ greater, at least 10 ⁴ M ¹ greater or at least 10 ⁵ M ¹ greater than a binding constant for other molecules in a biological sample). The term “antibody” also includes genetically engineered forms such as chimeric antibodies (for example, humanized murine antibodies), heteroconjugate antibodies (such as, bispecific antibodies). See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, III.); Kuby, I, Immunology, 3 ^rd Ed., W.H. Freeman & Co., New York, 1997. The general structure of an antibody is comprised of heavy (H) chains and light (L) chains connected by disulfide bonds. The structure can also comprise glycans attached at conserved amino acid residues. Each heavy and light chain contains a constant region and a variable region (also known as "domains"). There are two types of light chain, lambda (I) and kappa (K). There are five primary types of heavy chains which determine the isotype (or class) of an antibody molecule: gamma (g), delta (d), alpha (a), mu (m) and epsilon (e). The constant regions of the heavy chain also contribute to the effector function of the antibody molecule. Antibodies comprising the foregoing heavy chains result in the following isotypes: IgM, IgD, lgG3, IgGI, IgAI, lgG2, lgG4, IgE, and lgA2, respectively. An IgY isotype, related to mammalian IgG, is found in reptiles and birds. An IgW isotype, related to mammalian IgD, is found in cartilaginous fish. Class switching is the process by which the constant region of an immunoglobulin heavy chain is replaced with a different immunoglobulin heavy chain through recombination of the heavy chain locus of a B-cell to produce an antibody of a different isotype. Antibodies may exist as monomers (e.g. IgG), dimers (e.g. IgA), tetramers (e.g. fish IgM), pentamers (e.g. mammalian IgM), and/or in complexes with other molecules. In some embodiments, antibodies can be bound to the surface of a cell or secreted by a cell.

The variable regions of the immunoglobulin heavy and the light chains specifically bind the antigen. The "framework" region is a portion of the Fab that acts as a scaffold for three hypervariable regions called "complementarity-determining regions" (CDRs). A set of CDRs is known as a paratope. The framework regions of different light or heavy chains are relatively conserved within a species. The combined framework region of an antibody (comprising regions from both light and heavy chains), largely adopts a b-sheet conformation and the CDRs form loops which connect, and in some cases form part of, the b-sheet structure. Thus, framework regions act to position the CDRs in correct orientation by inter chain, non-covalent interactions. The framework region and CDRs for numerous antibodies have been defined and are available in a database maintained online (Rabat el al, Sequences of Proteins of Immunological Interest, U.S. Department of Health and Human Services. The CDRs of the variable regions of heavy and light chains (VH and VL) are responsible for binding to an epitope of an antigen. A limited number of amino acid positions within the CDRs are directly involved in antigen binding. These positions within the CDRs are called specificity determining residues (SDRs). The CDRs of a heavy or light chain are numbered sequentially starting from the N-terminal end (i.e. CDR1 , CDR2, and CDR3). For example, a VL CDR3 is the middle CDR located in the variable domain of the light chain of an antibody. A VH CDR1 is the first CDR in the variable domain of a heavy chain of an antibody. An antibody that binds a specific antigen will have specific VH and VL region sequences, and thus specific CDR sequences. Antibodies with different specificities (i.e. different combining sites for different antigens) have different CDRs.

The term “humanized” when used in reference to an antibody, means that the amino acid sequence of the antibody has non-human amino acid residues (e.g., mouse, rat, goat, rabbit, etc.) of one or more complementarity determining regions (CDRs) that specifically bind to the desired antigen in an acceptor human immunoglobulin molecule, and one or more human amino acid residues in the Fv framework region (FR), which are amino acid residues that flank the CDRs. Such antibodies typically have reduced immunogenicity and therefore a longer half- life in humans as compared to the non-human parent antibody from which one or more CDRs were obtained or are based upon. Furthermore, humanized antibodies may comprise residues that are not found in the recipient antibody or in the donor antibody. These modifications are made to further refine antibody performance. In general, the humanized antibody will comprise substantially all of at least one, and typically two, variable domains, in which all or substantially all of the hypervariable loops correspond to those of a non-human immunoglobulin and all or substantially all of the FRs are those of a human immunoglobulin sequence. The humanized antibody optionally will also comprise at least a portion of an immunoglobulin constant region (Fc), typically that of a human immunoglobulin. For further details, see Jones et al., A/aftvre 321 :522-525 (1986); Riechmann et al., Nature 332:323-329 (1988); and

Presta, Curr. Op. Struct. Biol. 2:593-596 (1992). See also the following review articles and references cited therein: Vaswani and Hamilton, Ann. Allergy, Asthma & Immunol. 1 :105-115 (1998); Harris, Biochem. Soc. Transactions 23:1035-1038 (1995); Hurle and Gross, Curr. Op. Biotech. 5:428-433 (1994).

As used herein, the terms “type I interferon” and “human type I interferon” are defined as all species of native human and synthetic interferon which fall within the human and synthetic interferon-a, interferon-w and interferon-b classes and which bind to a common cellular receptor. Natural human interferon-a comprises 23 or more closely related proteins encoded by distinct genes with a high degree of structural homology (Weissmann and Weber, Prog. Nucl. Acid. Res. Mol. Biol., 33: 251 (1986); J. Interferon Res., 13: 443-444 (1993)). The human IFN- a locus comprises two subfamilies. The first subfamily consists of at least 14 functional, nonallelic genes, including genes encoding IFN-aA (IFN-a2), IFN-aB (IFN-a8), IFN-aC (IFN-a10), IFN-aD (IFN-a1), IFN-aE (IFN-a22), IFN-aF (IFN-a21), IFN-aG (IFN-a5), IFN-a16, IFN-a17, IFN-a4, IFN-a6, IFN-a7, and IFN-aH (IFN-a14), and pseudogenes having at least 80% homology. The second subfamily, an or w, contains at least 5 pseudogenes and 1 functional gene (denoted herein as “IFN-an1” or “IFN-w”) which exhibits 70% homology with the IFN-a genes (Weissmann and Weber (1986)). The human IFN-b is generally thought to be encoded by a single copy gene.

As used herein, the term “interferon alpha receptor 1” or “IFNAR1” is defined as the 557 amino acid receptor protein cloned by Uze et al., Cell, 60: 225-234 (1990), including an extracellular domain of 409 residues, a transmembrane domain of 21 residues, and an intracellular domain of 100 residues.

As used herein, the term “interferon alpha receptor 2” or “IFNAR2” is defined as the 515 amino acid receptor protein cloned by Domanski et al., J. Biol. Chem., 37: 21606-21611 (1995), including an extracellular domain of 217 residues, a transmembrane domain of 21 residues, and an intracellular domain of 250 residues.

The term “interferon inhibitor” as used herein refers to a molecule having the ability to inhibit a biological function of wild type or mutated Type 1 interferon. Accordingly, the term “inhibitor” is defined in the context of the biological role of Type 1 interferon. According to some embodiments, an interferon inhibitor referred to herein specifically inhibits cell signaling via the Type 1 interferon/interferon receptor pathway. For example, an interferon inhibitor may interact with (e.g. bind to) interferon alpha receptor, or with a Type 1 interferon which normally binds to interferon receptor. According to some embodiments, an interferon inhibitor binds to the extracellular domain of interferon alpha receptor. According to some embodiments, an interferon inhibitor binds to the intracellular domain of interferon alpha receptor. According to some embodiments, an interferon inhibitor binds to Type 1 interferon. According to some embodiments, the Type 1 interferon is an interferon alpha subtype. According to some embodiments, the Type 1 interferon is not interferon beta. According to some embodiments, the Type 1 interferon is not interferon omega. According to some embodiments, interferon biological activity inhibited by an interferon inhibitor is associated with an immune disorder, such as an autoimmune disorder. An interferon inhibitor can be in any form, so long as it is capable of inhibiting interferon/receptor activity; inhibitors include antibodies (e.g., monoclonal antibodies as defined hereinbelow), small organic/inorganic molecules, antisense oligonucleotides, aptamers, inhibitory peptides/polypeptides, inhibitory RNAs (e.g., small interfering RNAs), combinations thereof, etc.

A “composition” typically intends a combination of the active agent, e.g., a recombinant T cell, an antibody, or a small molecule, and a naturally- occurring or non-naturally-occurring carrier, inert (for example, a detectable agent or label) or active, such as an adjuvant, diluent, binder, stabilizer, buffers, salts, lipophilic solvents, preservative, adjuvant or the like and include pharmaceutically acceptable carriers. Carriers also include pharmaceutical excipients and additives proteins, peptides, amino acids, lipids, and carbohydrates (e.g., sugars, including monosaccharides, di-, tri-, tetra-oligosaccharides, and oligosaccharides; derivatized sugars such as alditols, aldonic acids, esterified sugars and the like; and polysaccharides or sugar polymers), which can be present singly or in combination, comprising alone or in combination 1-99.99% by weight or volume. Exemplary protein excipients include serum albumin such as human serum albumin (HSA), recombinant human albumin (rHA), gelatin, casein, and the like. Representative amino acid/antibody components, which can also function in a buffering capacity, include alanine, arginine, glycine, arginine, betaine, histidine, glutamic acid, aspartic acid, cysteine, lysine, leucine, isoleucine, valine, methionine, phenylalanine, aspartame, and the like. Carbohydrate excipients are also intended within the scope of this technology, examples of which include but are not limited to monosaccharides such as fructose, maltose, galactose, glucose, D- mannose, sorbose, and the like; disaccharides, such as lactose, sucrose, trehalose, cellobiose, and the like; polysaccharides, such as raffmose, melezitose, maltodextrins, dextrans, starches, and the like; and alditols, such as mannitol, xylitol, maltitol, lactitol, xylitol sorbitol (glucitol) and myoinositol.

The compositions used in accordance with the disclosure, including cells, treatments, therapies, agents, drugs and pharmaceutical formulations can be packaged in dosage unit form for ease of administration and uniformity of dosage. The term "unit dose" or "dosage" refers to physically discrete units suitable for use in a subject, each unit containing a predetermined quantity of the composition calculated to produce the desired responses in association with its administration, i.e., the appropriate route and regimen. The quantity to be administered, both according to number of treatments and unit dose, depends on the result and/or protection desired. Precise amounts of the composition also depend on the judgment of the practitioner and are peculiar to each individual. Factors affecting dose include physical and clinical state of the subject, route of administration, intended goal of treatment (alleviation of symptoms versus cure), and potency, stability, and toxicity of the particular composition. Upon formulation, solutions will be administered in a manner compatible with the dosage formulation and in such amount as is therapeutically or prophylactically effective. The formulations are easily administered in a variety of dosage forms, such as the type of injectable solutions described herein.

As used herein, the terms “flare state” or “flare” refer to onset of disease activity in a subject diagnosed with an immune disorder, such as SLE. In clinical intervention trials of SLE, flares are classified as mild, moderate or severe based on criteria published in Lupus [1999] 8(8) :685-91 as the SELENA-SLEDAI Flare Index (SFI) and in a revised form (SFI-R) in Arthritis & Rheumatology [2011] 63(12): 3918-30. Flares can be identified by an acute measurable increase in disease activity in one or more organ systems involving new or worse clinical signs and symptoms and/or laboratory measurements. It must be considered clinically significant by the assessor and usually there would be at least consideration of a change or an increase in treatment. (See Ruperto et al., International consensus for a definition of disease flare in lupus. Lupus (2011) 20: 453-462.)

The term "heterologous" refers to two components that are defined by structures derived from different sources. Exemplary “heterologous” nucleic acids include expression constructs in which a nucleic acid comprising a coding sequence is operably linked to a regulatory element (e.g., a promoter) that is from a genetic origin different from that of the coding sequence (e.g., to provide for expression in a host cell of interest, which may be of different genetic origin relative to the promoter, the coding sequence or both). For example, a T7 promoter operably linked to a polynucleotide encoding an TCR chain is said to be a heterologous nucleic acid. “Heterologous” in the context of recombinant cells can refer to the presence of a nucleic acid (or gene product, such as a polypeptide) that is of a different genetic origin than the host cell in which it is present. When "heterologous" is used in the context of a chimeric polypeptide, the chimeric polypeptide includes operably linked amino acid sequences that can be derived from different polypeptides. Similarly, "heterologous", in the context of a polynucleotide encoding a chimeric polypeptide, includes an operably linked nucleic acid sequence that can be derived from different genes. METHODS

Therapeutic Methods

SLE Treatment for subject identified as having cytotoxic CD8+ T lymphocytes comprising disclosed TCRs and/or expression profiles

Aspects of the present disclosure include methods of treating Systemic Lupus Erythematosus (SLE) in a subject in need thereof comprising administering to the subject a recombinant cell, such as, an immune cell that reduces an autoimmune response in the subject. The autoimmune response may include presence of one or more CD8+ T lymphocytes expressing TCRs comprising an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence having 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to the a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence set forth in any one of SEQ ID NOs:1-96, where each sequence includes the a chain CDR3 amino acid sequence followed by a period followed by the b chain CDR3 amino acid sequence. These sequences are depicted in Table 1 below.

Table 1- T Cell Receptor CDR3 a and b chain amino acid seauences

Thus, recitation of a T cell receptor comprising an a chain and a b chain CDR3 amino acid sequence at least 80% identical to one or more of SEQ ID NOs:1-96 means that the a chain CDR3 amino acid sequence of the TCR is at least 80% identical to the a chain CDR3 amino acid sequence set forth in SEQ ID NO:1 and the b chain CDR3 amino acid sequence of the TCR is at least 80% identical to the chain CDR3 amino acid sequence set forth in SEQ ID NO:1 , and so on.

The immune cell administered to the subject may be a regulatory T cell expressing a TCR comprising a b chain CDR3 amino acid sequence having 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to the b chain CDR3 amino acid sequence set forth in any one of SEQ ID NOs:97-192. These sequences are provided in Table 2 below:

Table 2 - TCRB CDR3 amino acid sequences The TCR expressed by the immune cell (e.g., regulatory T cell) administered to the subject may further comprise an a chain CDR3 amino acid sequence having 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to the a chain CDR3 amino acid sequence set forth in any one of SEQ ID NOs:193-288. These sequences are provided in Table 3 below:

Table 3 - TCRA CDR3 amino acid sequences

The b chain of the TCR expressed by the immune cell may comprise the amino acid sequence of SEQ ID NO: 97 and the a chain of the TCR expressed by the immune cell may comprise the amino acid sequence of SEQ ID NO:193. In another embodiment, the b chain of the TCR expressed by the immune cell may comprise the amino acid sequence of SEQ ID NO: 98 and the a chain of the TCR expressed by the immune cell may comprise the amino acid sequence of SEQ ID NO:194. In another embodiment, the b chain of the TCR expressed by the immune cell may comprise the amino acid sequence of one of SEQ ID NOs: 99-192 and the a chain of the TCR expressed by the immune cell may comprise the amino acid sequence of one SEQ ID NO:195-288, respectively. Thus, the TCR expressed by the immune cell (e.g., a regulatory T cell) may comprise an a chain CDR3 and a b chain CDR3 comprising the amino acid sequence of one of SEQ ID Nos:1-96, where the a chain CDR3 amino acid sequence is listed followed by a period followed by the b chain CDR3 amino acid sequence (see Table 1). In certain embodiments, the subject may be a subject identified as having one or more cytotoxic CD8+ T lymphocytes comprising a TCR comprising an a chain CDR3 and a b chain CDR3 comprising the amino acid sequence of one of SEQ ID Nos:1-96, where the a chain CDR3 amino acid sequence is listed followed by a period followed by the b chain CDR3 amino acid sequence (see Table 1). The subject may be administered one or more immune cells expressing a TCR comprising a b chain CDR3 having at least 70% (e.g. at least 80%, at least 85%, at least 90%, at least 95%, or 1~% identity) to the b chain CDR3 expressed by the cytotoxic CD8+ T lymphocytes. In certain cases, the subject may be administered two or more, three or more, 10 or more, 30 or more, 90 or more immune cells, each immune cell expressing a different TCR.

Aspects of the present disclosure include methods of treating Systemic Lupus Erythematosus (SLE) in a subject in need thereof comprising administering to a subject identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of three or more of NKG7 (UniProt - Q16617 (human)), CCL5 (UniProt - P13501 (human)), B2M (UniProt - P61769 (human)), GZMH (UniProt - P20718 (human)), S100A4 (UniProt - P26447 (human)), IL32 (UniProt - P24001 (human)), CST7 (UniProt - 076096 (human)), TMSB4X (UniProt - P62328 (human)), GZMA (UniProt - P12544 (human)), HLA-C (UniProt - P10321 (human)), SH3BGRL3 (UniProt - Q9H299 (human)), FGFBP2 (UniProt - Q9BYJ0 (human)), HOST (UniProt - Q9UBK5 (human)), HLA-B (UniProt - Q29644 (human)) and HLA-A (UniProt - P04439 (human)) an effective amount of an agent that targets the cytotoxic CD8+ T lymphocytes. In some embodiments, prior to the administering, the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by elevated expression of three or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B, and HLA-A, relative to their average expression levels in all lymphocytes.

In some embodiments, the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, or each of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B, and HLA-A, relative to their average expression levels in all lymphocytes.

Also provided herein are methods of treating SLE in a subject in need thereof comprising administering to a subject identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by elevated expression of about fifteen or fewer of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B, and HLA-A, relative to their average expression levels in all lymphocytes. In certain embodiments, the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by elevated expression of fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B, and HLA-A, relative to their average expression levels in all lymphocytes.

One of ordinary skill in the art can monitor gene expression using methods such as the Multiplexing approach (Mux-seq) as described herein, RNA-sequencing, DNA microarrays, Real-time PCR, Chromatin immunoprecipitation (ChIP), flow cytometry, Western blotting, 2-D gel electrophoresis or immunoassays, such as ELISA, etc. In certain embodiments, the subject a human being.

In some embodiments, the methods of treatment further comprise prior to administering the agent, identifying the subject as having the cytotoxic CD8+ T lymphocytes. According to some embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises receiving a report indicating that the subject has the cytotoxic CD8+ T lymphocytes. In some embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, or each of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject.

In a certain embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of about fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject.

In a certain embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of about fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject. Presence of an expression level similar to a threshold expression level determined as disclosed herein or presence of an increased expression level as compared to a control expression level, e.g., expression level in all lymphocytes from a healthy subject(s) is indicative of SLE in the subject.

According to some embodiments, the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the approximate expression levels shown in Table 4, where the expression levels are provided as the log2 fold change relative to the average expression levels in all lymphocytes, where the log2 fold change is calculated as log2(gene expression in the CD8+ T lymphocytes) - log2(gene expression in all lymphocytes).

Table 4: Gene expression levels in cytotoxic CD8+ T lymphocytes.

In some embodiments, the agent that targets the cytotoxic CD8+ T lymphocytes described herein includes agents that targets any T cells in the subject. In some embodiments, the agent that targets the cytotoxic CD8+ T lymphocytes described herein includes agents that targets any cytotoxic CD8+ T lymphocytes in the subject. In some embodiments, the agent is a small molecule agent.

In certain embodiments, the agent is a recombinant T cell. According to some embodiments, the T cell is autologous to the subject. In some embodiments, the T cell is allogeneic. In certain embodiments, the recombinant T cell is a CAR T cell. According to some embodiments, the CAR T cell comprises a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation TRUCK. In some embodiments, the CAR T cell comprises: (a) an antigen binding domain; (b) a hinge domain; (c) a transmembrane domain; (d) and an intracellular domain. According to some embodiments, the CAR T cell comprises one or more of the following exemplary domains: (a) an anti-CD3 binding domain; (b) a hinge domain; (c) a CD28 or a CD8 a transmembrane domain; (d) one or more costimulatory regions selected from a CD28 costimulatory signaling region, a 4-1 BB costimulatory signaling region, an ICOS costimulatory signaling region, and an 0X40 costimulatory region; and (e) a CD3 zeta signaling domain.

Also described herein are methods of treatment, wherein the agent is a recombinant T cell, e.g., a recombinant regulatory T cell as disclosed herein.

Certain embodiments of this disclosure also include methods of treatment, wherein the agent is an antibody. According to some embodiments, the antibody is a humanized antibody. In certain embodiments, the antibody can be a multispecific antibody that recognizes and binds more than one target antigen, such as bispecific or a tri-specific antibody. In certain embodiments, the antibody is an anti-CD3 antibody. Non-limiting examples of anti-CD3 antibody are disclosed in U.S. Application Nos. 20180117152, 20180134798, 20180371086 and 20180057593 and U.S. Patent No. 10174124.

In certain embodiments, the agent is a steroid. In some embodiments, the agent is interleukin-2 (IL-2). In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

SLE Treatment for subject identified as having activated monocytes comprising disclosed expression profiles

Aspects of this disclosure include methods of treating SLE in a subject in need thereof comprising administering to a subject identified as having activated monocytes comprising an expression profile characterized by the expression level of about three or more of IFI6 (UniProt - P09912 (human)), ISG15 (UniProt - P05161 (human)), LY6E (UniProt - Q16553 (human)), IFI44L (UniProt - Q53G44 (human)), IFITM3 (UniProt - Q01628 (human)), TXNIP (UniProt - Q9H3M7 (human)), MT2A (UniProt - P02795 (human)), SAP30 (UniProt - 075446 (human)), IFI44 (UniProt - Q8TCB0 (human)), FKBP6 (UniProt - 075344 (human)), MNDA (UniProt - P41218 (human)), SIGLEC1 (UniProt - Q9BZZ2 (human)), CD163 (UniProt - Q86VB7 (human)), MX1 (UniProt - P20591 (human)), VCAN (UniProt - P13611 (human)), IL1 R2 (UniProt - P27930 (human)), EPSTI1 (UniProtKB - Q96J88 (human)), HMGB2 (UniProt - P26583 (human)), and OAS2 (UniProt - P29728 (human)) an effective amount of an agent that targets the activated monocytes. In some embodiments, prior to the administering, the subject is identified as having activated monocytes comprising an expression profile characterized by elevated expression of three or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells. In some embodiments, the subject is identified as having activated monocytes comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, or each of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells.

Also described herein are methods of treating SLE in a subject in need thereof comprising administering to a subject identified as having activated monocytes comprising an expression profile characterized by elevated expression of about nineteen or fewer of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells. In certain embodiments, the subject is identified as having activated monocytes comprising an expression profile characterized by elevated expression of eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells.

One of skill in the art can monitor gene expression using methods such as the Multiplexing approach (Mux-seq) as described herein, RNA-sequencing, DNA microarrays, Real-time PCR, Chromatin immunoprecipitation (ChIP), flow cytometry, Western blotting, 2-D gel electrophoresis or immunoassays, such as ELISA etc. In certain embodiments, the subject a human being.

In some embodiments, the methods of treatment further comprise prior to administering the agent, identifying the subject as having the activated monocytes. According to some embodiments, identifying the subject as having the activated monocytes comprises receiving a report indicating that the subject has the activated monocytes. In some embodiments, identifying the subject as having the activated monocytes comprises determining the expression level of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, or each of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject.

In a certain embodiments, identifying the subject as having the activated monocytes comprises determining the expression level of about nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject. According to some embodiments, the subject is identified as having activated monocytes comprising an expression profile characterized by the approximate expression levels shown in Table 5, where the expression levels are provided as the log2 fold change relative to the average expression levels in all myeloid cells, where the log2 fold change is calculated as log2(gene expression in the activated monocytes) - log2(gene expression in all myeloid cells).

Table 5: Gene expression levels in activated monocytes. In certain embodiments, the agent that targets the activated monocytes described herein includes agents that targets any monocytes in the subject. In some embodiments, the agent that targets the activated monocytes described herein includes agents that targets any activated monocytes in the subject. In some embodiments, the agent is a small molecule agent. In some embodiments, the agent is a recombinant T cell. According to some embodiments, the T cell is autologous to the subject. In some embodiments, the T cell is allogeneic. In certain embodiments, the recombinant T cell is a CAR T cell. According to some embodiments, the CAR T cell comprises a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation TRUCK. In some embodiments, the CAR T cell comprises: (a) an antigen binding domain; (b) a hinge domain; (c) a transmembrane domain; (d) and an intracellular domain. According to some embodiments, the CAR T cell comprises one or more of the following exemplary domains: (a) an antigen binding domain; (b) a hinge domain; (c) a CD28 or a CD8 a transmembrane domain; (d) one or more costimulatory regions selected from a CD28 costimulatory signaling region, a 4-1 BB costimulatory signaling region, an ICOS costimulatory signaling region, and an 0X40 costimulatory region; and (e) a CD3 zeta signaling domain.

Further described herein are methods of treatment, wherein the agent is a recombinant T cell that comprises a T cell receptor comprising a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:97-192, and/or a nucleic acid sequence encoding the same or comprising an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:1-96, and/or a nucleic acid sequence encoding the same. According to some embodiments, the recombinant T cell is a recombinant regulatory T cell.

In some embodiments, the agent is a monocyte specific type-1 interferon inhibitor. According to some embodiments, the agent is an inhibitor of interferon signaling. In certain embodiments, the agent is an inhibitor of interferon alpha receptor 1. In certain embodiments, the agent is an antibody. According to some embodiments, the antibody is a humanized antibody. In certain embodiments, the antibody can be a multispecific antibody that recognizes and binds more than one target antigen, such as bispecific or a tri-specific antibody. In certain embodiments, the antibody binds to a type I interferon receptor. In some embodiments, the antibody binds to interferon alpha receptor 1 . Non limiting examples of antibodies include Anifrolumab and anti-interferon alpha receptor 1 antibodies disclosed in U.S. Application Nos. 20060020118 and 20100104569 and U.S. Patent Nos. 10125195, 9988459 and 8460668

In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

SLE Treatment for subject identified as having macrophages comprising disclosed expression profiles

Aspects of this disclosure include methods of treating SLE in a subject in need thereof comprising administering to a subject identified as having macrophages comprising an expression profile characterized by the expression level of about three or more of IL1 R2 (UniProt - P27930 (human)), CD163 (UniProt - Q86VB7 (human)), RETN (UniProt - Q9HD89 (human)), S100A12 (UniProt - P80511 (human)), VCAN (UniProt - P13611 (human)), SAP30 (UniProt - 075446 (human)), RNASE2 (UniProt - P10153 (human)), MNDA (UniProt - P41218 (human)), CSTA(UniProt - P01040 (human)), CLEC4E (UniProt - Q9ULY5 (human)), MGST1 (UniProt - P10620 (human)), FCN1 (UniProt - 000602 (human)), MS4A6A (UniProt - Q9H2W1 (human)), GPX1 (UniProt - P07203 (human)), THBS1 (UniProt - P07996 (human)), IRS2 (UniProt - Q9Y4H2 (human)), CST3 (UniProt - P01034 (human)), BLVRB (UniProt - P30043 (human)), ARL4A (UniProt - P40617 (human)), and and CEBPD (UniProt - P49716 (human)), an effective amount of an agent that targets the macrophages. In some embodiments, prior to the administering, the subject is identified as having macrophages comprising an expression profile characterized by elevated expression of three or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all peripheral blood mononuclear cells (PBMCs).

In some embodiments, the subject is identified as having macrophages comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or each of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs. Also provided herein are methods of treating SLE in a subject in need thereof comprising administering to a subject identified as having macrophages comprising an expression profile characterized by elevated expression of about twenty or fewer of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs. In certain embodiments, the subject is identified as having macrophages comprising an expression profile characterized by elevated expression of about nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs. In certain embodiments, the macrophages are isolated from the subject’s blood. In certain embodiments, the subject is in a flare state. According to some embodiments, the subject is a human being.

One of skill in the art can monitor gene expression using methods such as the Multiplexing approach (Mux-seq) as described herein, RNA-sequencing, DNA microarrays, Real-time PCR, Chromatin immunoprecipitation (ChIP), flow cytometry, Western blotting, 2-D gel electrophoresis or immunoassays, such as ELISA etc.

In some embodiments, the methods of treatment further comprise prior to administering the agent, identifying the subject as having the macrophages. According to some embodiments, identifying the subject as having the macrophages comprises receiving a report indicating that the subject has the macrophages. In some embodiments, identifying the subject as having the macrophages comprises determining the expression level of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or each of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject.

In a certain embodiments, identifying the subject as having the macrophages comprises determining the expression level of twenty or fewer, nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject. In certain embodiments, the macrophages are isolated from the subject’s blood. In further embodiments, the subject is in a flare state. In some embodiments, the subject a human being.

According to some embodiments, the subject is identified as having macrophages comprising an expression profile characterized by the approximate expression levels shown in Table 6, where the expression levels are provided as the log2 fold change relative to the average expression levels in all lymphocytes, where the log2 fold change is calculated as log2(gene expression in the macrophages) - log2(gene expression in all PBMCs).

Table 6: Gene expression levels in macrophages.

In certain embodiments, the agent that targets the macrophages described herein includes agents that target any macrophages in the subject. Non-limiting examples of agents that target macrophages are disclosed in Cassetta et al. Nat Rev Drug Discov.

2018;17(12):887-904. In some embodiments, the agent is a small molecule agent. In some embodiments, the agent is a recombinant T cell. According to some embodiments, the recombinant T cell is autologous to the subject. In some embodiments, the recombinant T cell is allogeneic. In certain embodiments, the recombinant T cell is a CAR T cell.

According to some embodiments, the CAR T cell comprises a first generation CAR, a second generation CAR, a third generation CAR, or a fourth generation TRUCK. In some embodiments, the CAR T cell comprises: (a) an antigen binding domain; (b) a hinge domain;

(c) a transmembrane domain; (d) and an intracellular domain. According to some embodiments, the CAR T cell comprises one or more of the following exemplary domains:

(a) an antigen binding domain; (b) a hinge domain; (c) a CD28 or a CD8 a transmembrane domain; (d) one or more costimulatory regions selected from a CD28 costimulatory signaling region, a 4-1 BB costimulatory signaling region, an ICOS costimulatory signaling region, and an 0X40 costimulatory region; and (e) a CD3 zeta signaling domain.

In certain embodiments, the recombinant T cell comprises a T cell receptor comprising a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:97-192, and/or a nucleic acid sequence encoding the same. In certain embodiments, the recombinant T cell comprises a T cell receptor comprising an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:1-96, and/or a nucleic acid sequence encoding the same. According to some embodiments, the recombinant T cell is a recombinant regulatory T cell.

Also provided herein are methods of treatment, wherein the agent is an antibody. According to some embodiments, the antibody is a humanized antibody. In certain embodiments, the antibody can be a multispecific antibody that recognizes and binds more than one target antigen, such as bispecific or a tri-specific antibody.

In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

Diagnostics

Assaying cytotoxic CD8+ T lymphocytes comprising disclosed expression profiles

Aspects of this disclosure include methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of three or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A. One of skill in the art can assay gene expression using methods such as the Multiplexing approach (Mux-seq) as described herein, RNA-sequencing, DNA microarrays, Real-time PCR, Chromatin immunoprecipitation (ChIP), flow cytometry, Western blotting, 2-D gel electrophoresis or immunoassays, such as ELISA etc. In certain embodiments, the subject a human being. According to some embodiments, the sample is a blood sample. In some embodiments, the methods comprise assaying a sample obtained from a subject having or suspected of having SLE for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, or each of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B, and HLA-A, relative to their average expression levels in all lymphocytes.

Further described herein are methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of about fifteen or fewer of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A. In certain embodiments, the methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of about fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A.

According to some embodiments, the cytotoxic CD8+ T lymphocytes assayed comprise a T cell receptor comprising an a chain and a b chain CDR3 amino acid sequence of any one of SEQ ID NOs:1-96, or a nucleic acid sequence encoding the same.

In some embodiments, the methods further comprise identifying the subject as having the cytotoxic CD8+ T lymphocytes. According to some embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises receiving a report indicating that the subject has the cytotoxic CD8+ T lymphocytes. In some embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of about two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, or each of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HOST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject. In a certain embodiments, identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of about fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject.

In certain embodiments, the cytotoxic CD8+ T lymphocytes assayed comprise a T cell receptor comprising an a chain and a b chain CDR3 amino acid sequence of one or more of SEQ ID NOs: 1-96, or a nucleic acid sequence encoding the same.

According to some embodiments, the subject has or is suspected of having SLE when the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the approximate expression levels shown in Table 4.

According to some embodiments, the methods may further comprise treating the SLE of the subject. In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

Assaying activated monocytes comprising disclosed expression profiles

Aspects of this disclosure include methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of activated monocytes comprising an expression profile characterized by the expression level of three or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2.

In some embodiments, the methods comprise assaying a sample obtained from a subject having or suspected of having SLE for a population of activated monocytes comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, or each of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells. Also provided herein are methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of activated monocytes comprising an expression profile characterized by elevated expression of about nineteen or fewer of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells. In certain embodiments, the methods comprise assaying a sample obtained from a subject having or suspected of having SLE for a population of activated monocytes comprising an expression profile characterized by elevated expression of eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2, and OAS2, relative to their average expression levels in all myeloid cells.

In some embodiments, the methods further comprise identifying the subject as having the activated monocytes. According to some embodiments, identifying the subject as having the activated monocytes comprises receiving a report indicating that the subject has the activated monocytes. In some embodiments, identifying the subject as having the activated monocytes comprises determining the expression level of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, or each of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject.

In a certain embodiments, identifying the subject as having the activated monocytes comprises determining the expression level of about nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject.

According to some embodiments, the subject has or is suspected of having SLE when the subject is identified as having activated monocytes comprising an expression profile characterized by the approximate expression levels shown in Table 5. According to some embodiments, the methods may further comprise treating the SLE of the subject. In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

Assaying macrophages comprising disclosed expression profiles

Aspects of this disclosure include methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of macrophages comprising an expression profile characterized by the expression level of three or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD. In certain embodiments, the subject is a human subject. According to some embodiments, the sample is a blood sample. Accordingly, in certain embodiments, the macrophages are isolated from the subject’s blood. In further embodiments, the subject is in a flare state.

In some embodiments, the methods comprise assaying a sample obtained from a subject having or suspected of having SLE for a population of macrophages comprising an expression profile characterized by elevated expression of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or each of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs.

Further provided herein are methods comprising assaying a sample obtained from a subject having or suspected of having SLE for a population of macrophages comprising an expression profile characterized by elevated expression of about twenty or fewer of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs. In certain embodiments, the methods comprise assaying a sample obtained from a subject having or suspected of having SLE for a population of macrophages comprising an expression profile characterized by elevated expression of about nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A, and CEBPD, relative to their average expression levels in all PBMCs.

In some embodiments, the methods comprise identifying the subject as having the macrophages. According to some embodiments, identifying the subject as having the macrophages comprises receiving a report indicating that the subject has the macrophages. In some embodiments, identifying the subject as having the macrophages comprises determining the expression level of two or more, three or more, four or more, five or more of, six or more, seven or more, eight or more, nine or more, ten or more, eleven or more, twelve or more, thirteen or more, fourteen or more, fifteen or more, sixteen or more, seventeen or more, eighteen or more, nineteen or more, or each of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject.

In a certain embodiments, identifying the subject as having the macrophages comprises determining the expression level of twenty or fewer, nineteen or fewer, eighteen or fewer, seventeen or fewer, sixteen or fewer, fifteen or fewer, fourteen or fewer, thirteen or fewer, twelve or fewer, eleven or fewer, ten or fewer, nine or fewer, eight or fewer, seven or fewer, six or fewer, five or fewer, four or fewer, three or fewer, or two of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject.

According to some embodiments, the subject has, or is suspected of having SLE, or the subject is in a flare state, or is suspected to be in a flare state when the subject is identified as having macrophages comprising an expression profile characterized by the approximate expression levels shown in Table 6.

According to some embodiments, the methods may further comprise treating the SLE of the subject. In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

NUCLEIC ACIDS

Provided by the present disclosure are nucleic acids encoding a T cell receptor comprising a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:97-192. Also provided by the present disclosure are nucleic acids encoding a T cell receptor comprising an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:1-96. Because the genetic code is degenerate, there are many nucleotide sequences that may encode the T cell receptor CDR3 amino acid sequence of the present disclosure. Some of these polynucleotides may bear minimal homology to the nucleotide sequence of any native gene. Polynucleotides that vary due to differences in codon usage are specifically contemplated in particular embodiments, for example polynucleotides that are optimized for human and/or primate codon selection.

Also provided are expression vectors comprising any of the nucleic acids of the present disclosure encoding the T cell receptor a chain and b chain CDR3 amino acid sequences described above. A “vector” is a nucleic acid molecule capable of transferring nucleic acid sequences to target cells (e.g., viral vectors, non-viral vectors, particulate carriers, and liposomes). Typically, “vector construct,” “expression vector,” and “gene transfer vector,” mean any nucleic acid construct capable of directing the expression of a nucleic acid of interest and which can transfer nucleic acid sequences to target cells. Thus, the term includes cloning and expression vehicles, as well as viral vectors. Also provided are viruses that include any of the T cell receptor b chain CDR3 amino acid sequences or T cell receptor a chain and b chain CDR3 amino acid sequences, nucleic acids, and/or expression vectors of the present disclosure.

In order to express the desired T cell receptor, a nucleotide sequence encoding the T cell receptor can be inserted into an appropriate vector, e.g., using recombinant DNA techniques known in the art. Exemplary viral vectors include, without limitation, retrovirus (including lentivirus), adenovirus, adeno-associated virus, herpesvirus (e.g., herpes simplex virus), poxvirus, papillomavirus, and papovavirus (e.g., SV40). Illustrative examples of expression vectors include, but are not limited to, pCIneo vectors (Promega) for expression in mammalian cells; pLenti4/V 5-DEST™, pLenti6/V 5- DEST™, murine stem cell virus (MSCV), MSGV, moloney murine leukemia virus (MMLV), and pLenti6.2/V5-GW/lacZ (Invitrogen) for lentivirus-mediated gene transfer and expression in mammalian cells. In certain embodiments, a nucleic acid sequence encoding the T cell receptor b chain CDR3 amino acid sequences of the present disclosure or the T cell receptor a chain and b chain CDR3 amino acid sequences may be ligated into any such expression vectors for expression in mammalian cells.

Expression control sequences, control elements, or regulatory sequences present in an expression vector are those non-translated regions of the vector - e.g., origins of replication, selection cassettes, promoters, enhancers, translation initiation signals (Shine Dalgarno sequence or Kozak sequence), introns, a polyadenylation sequence, 5' and 3' untranslated regions, and/or the like - which interact with host cellular proteins to carry out transcription and translation. Such elements may vary in their strength and specificity, and can be selected by one skilled in the art depending on the vector system and host to be used for each particular construct. Depending on the vector system and host utilized, any number of suitable transcription and translation elements, including ubiquitous promoters and inducible promoters may be used.

Components of the expression vector are operably linked such that they are in a relationship permitting them to function in their intended manner. In some embodiments, the term refers to a functional linkage between a nucleic acid expression control sequence (such as a promoter, and/or enhancer) and a second polynucleotide sequence, e.g., a nucleic acid encoding the T cell receptor b chain CDR3 amino acid sequences or T cell receptor a chain and b chain CDR3 amino acid sequences, where the expression control sequence directs transcription of the nucleic acid encoding the T cell receptor amino acid sequences.

In some embodiments, the expression vector is an episomal vector or a vector that is maintained extrachromosomally. As used herein, the term “episomal” refers to a vector that is able to replicate without integration into the host cell’s chromosomal DNA and without gradual loss from a dividing host cell also meaning that the vector replicates extrachromosomally or episomally. Such a vector may be engineered to harbor the sequence coding for the origin of DNA replication or “ori” from an alpha, beta, or gamma herpesvirus, an adenovirus, SV40, a bovine papilloma virus, a yeast, or the like. The host cell may include a viral replication transactivator protein that activates the replication. Alpha herpes viruses have a relatively short reproductive cycle, variable host range, efficiently destroy infected cells and establish latent infections primarily in sensory ganglia. Illustrative examples of alpha herpes viruses include HSV 1 , HSV 2, and VZV. Beta herpesviruses have long reproductive cycles and a restricted host range. Infected cells often enlarge. Non-limiting examples of beta herpes viruses include CMV, HHV-6 and HHV-7. Gamma- herpesviruses are specific for either T or B lymphocytes, and latency is often demonstrated in lymphoid tissue. Illustrative examples of gamma herpes viruses include EBV and HHV- 8.

Other gene delivery systems which may be used include mRNA electroporation, CRISPR-Cas9, TALENs, zinc fingers, transposase vectors, and the like. See, e.g., Labanieh et al. (2018) Nature Biomedical Engineering 2:377-391 . CELLS

Aspects of the present disclosure include recombinant T cells comprising a T cell receptor comprising a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:97-192, and/or a nucleic acid sequence encoding the same. Further aspects of the present disclosure include recombinant T cells comprising a T cell receptor comprising an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence comprising 70% or greater, 75% or greater, 80% or greater, 85% or greater, 90% or greater, 95% or greater, or 100% identity to any one of SEQ ID NOs:1-96, and/or a nucleic acid sequence encoding the same. According to some embodiments, the T cell is autologous to a subject. In some embodiments, the T cell is allogeneic. According to some embodiments, the recombinant T cell is a recombinant regulatory T cell. In some embodiments, the T cell is not a CD8+ T cell.

Provided are cells comprising any of the above T cell receptors comprising the b chain CDR3 amino acid sequences, nucleic acids, and/or expression vectors of the present disclosure. Also provided are cells comprising any of the above T cell receptors comprising the a chain and the b chain CDR3 amino acid sequences, nucleic acids, and/or expression vectors of the present disclosure. In some embodiments, the cells are eukaryotic cells. Eukaryotic cells of interest include, but are not limited to, yeast cells, insect cells, mammalian cells, and the like. Mammalian cells of interest include, e.g., murine cells, non human primate cells, human cells, and the like. In some embodiments, the cell is not a CD8+ T cell.

The terms “recombinant host cells,” “host cells,” “cells,” “cell lines,” “cell cultures,” and other such terms refer to cells which can be, or have been, used as recipients for a recombinant vector or other transferred DNA, and include the progeny of the cell which has been transfected. Host cells may be cultured as unicellular or multicellular entities (e.g., tissue, organs, or organoids) including an expression vector of the present disclosure.

In some embodiments, the cells provided herein include immune cells. Non-limiting examples of immune cells which may include any of the cells, nucleic acids, and/or expression vectors of the present disclosure include T cells, B cells, natural killer (NK) cells, a macrophages, monocytes, neutrophils, dendritic cells, mast cells, basophils, and eosinophils. In some embodiments, the immune cell comprises a T cell. Exemplary T cell types include naive T cells (TN), cytotoxic T cells (TCTL), memory T cells (TMEM), T memory stem cells (TSCM), central memory T cells (TCM), effector memory T cells (TEM), tissue resident memory T cells (TRM), effector T cells (TEFF), regulatory T cells (TREG _S ), helper T cells (TH, TH1 , TH2, TH17) CD4+ T cells, CD8+ T cells, virus-specific T cells, alpha beta T cells (T _ab ), and gamma delta T cells (T _Ud ). In some embodiments, the cell is a T cell and the protein of interest is a CAR, e.g., any of the CARs described herein.

Also provided are methods of making the cells of the present disclosure. In some embodiments, such methods include transfecting or transducing cells with a nucleic acid or expression vector of the present disclosure. The term “transfection” or “transduction” is used to refer to the introduction of foreign DNA into a cell. A cell has been “transfected” when exogenous DNA has been introduced inside the cell membrane. A number of transfection techniques are generally known in the art. See, e.g., Sambrook et al. (2001) Molecular Cloning, a laboratory manual, 3 ^rd edition, Cold Spring Harbor Laboratories, New York, Davis et al. (1995) Basic Methods in Molecular Biology, 2nd edition, McGraw- Hill, and Chu et al. (1981) Gene 13:197. Such techniques can be used to introduce one or more exogenous DNA moieties into suitable host cells. The term refers to both stable and transient uptake of the genetic material.

In some embodiments, a cell of the present disclosure is produced by transfecting the cell with a viral vector encoding the protein of interest. In some embodiments, the protein of interest is a CAR or a TCR and the cell is a T cell, such that provided are methods of producing a CAR T cell or a recombinant T cell, in which cell surface expression of the CAR or the TCR is regulatable. By “cell surface expression” or “expressed on the surface of the cell” is meant the cell surface molecule - when no longer associated with the protein localization tag (e.g., ER localization tag, Golgi localization tag, or the like) has been trafficked to the cell membrane such that - in the case of a cell surface receptor (e.g., a CAR, TCR, etc.) - the extracellular binding domain is displayed on the cell surface, the transmembrane portion passes through the cell membrane, and the one or more intracellular signaling domains are disposed adjacent to the intracellular side of the cell membrane. Upon binding of the extracellular binding domain to the target ligand/antigen, the intracellular signaling domain of the cell surface receptor participates in transducing the signal from the binding into the interior of the cell (e.g., an effector cell, such as a T cell, to elicit effector cell function).

In some embodiments, when the protein of interest is a CAR or TCR, the methods of producing a CAR T cell or a recombinant T cell include activating a population of T cells (e.g., T cells obtained from an individual to whom a CAR T cell or recombinant T cell therapy will be administered), stimulating the population of T cells to proliferate, and transducing the T cell with a viral vector encoding the CAR or the TCR. In certain embodiments, the T cells are transduced with a retroviral vector, e.g., a gamma retroviral vector or a lentiviral vector, encoding the CAR or the TCR. In some embodiments, the T cells are transduced with a lentiviral vector encoding the CAR or the TCR. Cells of the present disclosure may be autologous/autogeneic (“self”) or non-autologous (“non-self,” e.g., allogeneic, syngeneic or xenogeneic). In some embodiments, the cells are T cells obtained from a mammal. In some embodiments, the mammal is a primate. In some embodiments, the primate is a human.

T cells may be obtained from a number of sources including, but not limited to, peripheral blood, peripheral blood mononuclear cells, bone marrow, lymph node tissue, cord blood, thymus tissue, tissue from a site of infection, ascites, pleural effusion and spleen tissue. In certain embodiments, T cells can be obtained from a unit of blood collected from an individual using any number of known techniques such as sedimentation, e.g., FICOLL™ separation. In some embodiments, an isolated or purified population of T cells is used. In some embodiments, TCTL and TH lymphocytes are purified from PBMCs.

In order to achieve therapeutically effective doses of T cell compositions, the T cells may be subjected to one or more rounds of stimulation, activation and/or expansion. T cells can be activated and expanded generally using methods as described, for example, in U.S. Patents 6,352,694; 6,534,055; 6,905,680; 6,692,964; 5,858,358; 6,887,466; 6,905,681 ; 7,144,575; 7,067,318; 7,172,869; 7,232,566; 7,175,843; 5,883,223; 6,905,874; 6,797,514; and 6,867,041 , each of which is incorporated herein by reference in its entirety for all purposes. In some embodiments, T cells are activated and expanded for about 1 to 21 days, e.g., about 5 to 21 days. In some embodiments, T cells are activated and expanded for about 1 day to about 4 days, about 1 day to about 3 days, about 1 day to about 2 days, about 2 days to about 3 days, about 2 days to about 4 days, about 3 days to about 4 days, or about 1 day, about 2 days, about 3 days, or about 4 days prior to introduction of a nucleic acid (e.g., expression vector) encoding the polypeptide into the T cells.

In some embodiments, the T cells are activated and expanded for about 6 hours, about 12 hours, about 18 hours or about 24 hours prior to introduction of a nucleic acid (e.g., expression vector) encoding the cell surface receptor the into the T cells. In some embodiments, T cells are activated at the same time that a nucleic acid (e.g., an expression vector) encoding the cell surface receptor is introduced into the T cells.

In some embodiments, conditions appropriate for T cell culture include an appropriate media (e.g., Minimal Essential Media or RPMI Media 1640 or, X-vivo 15, (Lonza)) and one or more factors necessary for proliferation and viability including, but not limited to serum (e.g., fetal bovine or human serum), interleukin-2 (IL-2), insulin, IFN-g, IL- 4, IL-7, IL-21 , GM-CSF, IL-10, IL-12, IL-15, TGFp, and TNF-a or any other additives suitable for the growth of cells known to the skilled artisan. Further illustrative examples of cell culture media include, but are not limited to RPMI 1640, Clicks, AEVI-V, DMEM, MEM, a- MEM, F-12, X-Vivo 15, and X-Vivo 20, Optimizer, with added amino acids, sodium pyruvate, and vitamins, either serum-free or supplemented with an appropriate amount of serum (or plasma) or a defined set of hormones, and/or an amount of cytokine(s) sufficient for the growth and expansion of T cells.

In some embodiments, the nucleic acid (e.g., an expression vector) encoding the cell surface receptor is introduced into the cell (e.g., a T cell, such as Treg cell) by microinjection, transfection, lipofection, heat-shock, electroporation, transduction, gene gun, microinjection, DEAE-dextran-mediated transfer, and the like. In some embodiments, the nucleic acid (e.g., expression vector) encoding the cell surface receptor is introduced into the cell (e.g., a T cell) by AAV transduction. The AAV vector may comprise ITRs from AAV2, and a serotype from any one of AAV1 , AAV2, AAV3, AAV4, AAV5, AAV6, AAV7, AAV8, AAV9, or AAV 10. In some embodiments, the AAV vector comprises ITRs from AAV2 and a serotype from AAV6. In some embodiments, the nucleic acid (e.g., expression vector) encoding the cell surface receptor is introduced into the cell (e.g., a T cell) by lentiviral transduction. The lentiviral vector backbone may be derived from HIV-1 , HIV-2, visna-maedi virus (VMV) virus, caprine arthritis-encephalitis virus (CAEV), equine infectious anemia virus (EIAV), feline immunodeficiency virus (FI V), bovine immune deficiency virus (BIV), or simian immunodeficiency virus (SIV). The lentiviral vector may be integration competent or an integrase deficient lentiviral vector (TDLV). In one embodiment, IDLV vectors including an HIV-based vector backbone (i.e., HIV cis-acting sequence elements) are employed.

Further provided are methods of treating SLE in a subject in need thereof comprising administering to the subject an effective amount of the recombinant T cell or the compositions disclosed herein. In some embodiments, the subject is a human. In certain embodiments, the treatment methods may comprise a combination of the agents or therapies disclosed herein.

COMPOSITIONS

Also disclosed herein are compositions comprising a carrier and one or more of: the nucleic acids, expression vectors and/or cells of this disclosure. In some embodiments, the compositions include any of the nucleic acids, expression vectors, and/or cells of the present disclosure present in a liquid medium. The liquid medium may be an aqueous liquid medium, such as water, a buffered solution, or the like. One or more additives such as a salt (e.g., NaCI, MgCh, KCI, MgS0 ₄ ), a buffering agent (a Tris buffer, N-(2- Hydroxyethyl)piperazine-N'-(2-ethanesulfonic acid) (HEPES), 2-(N-

Morpholino)ethanesulfonic acid (MES), 2-(N-Morpholino)ethanesulfonic acid sodium salt (MES), 3-(N-Morpholino)propanesulfonic acid (MOPS), N-tris[Hydroxymethyl]methyl-3- aminopropanesulfonic acid (TAPS), etc.), a solubilizing agent, a detergent (e.g., a non-ionic detergent such as Tween-20, etc.), a nuclease inhibitor, glycerol, a chelating agent, and the like may be present in such compositions.

In certain embodiments, the carrier is a pharmaceutically acceptable carrier. The pharmaceutical compositions generally include a therapeutically effective amount of the cells. An effective amount can be administered in one or more administrations. The T cells of the present disclosure can be incorporated into a variety of formulations for therapeutic administration. More particularly, the cells of the present disclosure can be formulated into pharmaceutical compositions by combination with appropriate, pharmaceutically acceptable excipients or diluents.

Formulations of the recombinant T cells suitable for administration to a patient (e.g., suitable for human administration) are generally sterile and may further be free of detectable pyrogens or other contaminants contraindicated for administration to a patient according to a selected route of administration.

The recombinant T cells (e.g. Treg cells) may be formulated for parenteral (e.g., intravenous, intra-arterial, intraosseous, intramuscular, intracerebral, intracerebroventricular, intrathecal, subcutaneous, etc.) administration, or any other suitable route of administration.

Pharmaceutical compositions that include the cells of the present disclosure may be prepared by mixing the cells having the desired degree of purity with optional physiologically acceptable carriers, excipients, stabilizers, surfactants, buffers and/or tonicity agents. Acceptable carriers, excipients and/or stabilizers are nontoxic to recipients at the dosages and concentrations employed, and include buffers such as phosphate, citrate, and other organic acids; antioxidants including ascorbic acid, glutathione, cysteine, methionine and citric acid; preservatives (such as ethanol, benzyl alcohol, phenol, m-cresol, p-chlor-m- cresol, methyl or propyl parabens, benzalkonium chloride, or combinations thereof); amino acids such as arginine, glycine, ornithine, lysine, histidine, glutamic acid, aspartic acid, isoleucine, leucine, alanine, phenylalanine, tyrosine, tryptophan, methionine, serine, proline and combinations thereof; monosaccharides, disaccharides and other carbohydrates; low molecular weight (less than about 10 residues) polypeptides; proteins, such as gelatin or serum albumin; chelating agents such as EDTA; sugars such as trehalose, sucrose, lactose, glucose, mannose, maltose, galactose, fructose, sorbose, raffinose, glucosamine, N-methylglucosamine, galactosamine, and neuraminic acid; and/or non-ionic surfactants such as Tween, Brij Pluronics, Triton-X, or polyethylene glycol (PEG).

An aqueous formulation of the nucleic acids, expression vectors and/or cells of this disclosure may be prepared in a pH-buffered solution, e.g., at pH ranging from about 4.0 to about 7.0, or from about 5.0 to about 6.0, or alternatively about 5.5. Examples of buffers that are suitable for a pH within this range include phosphate-, histidine-, citrate-, succinate- , acetate-buffers and other organic acid buffers. The buffer concentration can be from about 1 mM to about 100 mM, or from about 5 mM to about 50 mM, depending, e.g., on the buffer and the desired tonicity of the formulation.

A tonicity agent may be included in the formulation to modulate the tonicity of the formulation. Example tonicity agents include sodium chloride, potassium chloride, glycerin and any component from the group of amino acids, sugars as well as combinations thereof. In some embodiments, the aqueous formulation is isotonic, although hypertonic or hypotonic solutions may be suitable. The term “isotonic” denotes a solution having the same tonicity as some other solution with which it is compared, such as physiological salt solution or serum. Tonicity agents may be used in an amount of about 5 mM to about 350 mM, e.g., in an amount of 100 mM to 350 mM.

A surfactant may also be added to the formulation to reduce aggregation and/or minimize the formation of particulates in the formulation and/or reduce adsorption. Example surfactants include polyoxyethylensorbitan fatty acid esters (Tween), polyoxyethylene alkyl ethers (Brij), alkylphenylpolyoxyethylene ethers (Triton-X), polyoxyethylene- polyoxypropylene copolymer (Poloxamer, Pluronic), and sodium dodecyl sulfate (SDS). Examples of suitable polyoxyethylenesorbitan-fatty acid esters are polysorbate 20, (sold under the trademark Tween 20™) and polysorbate 80 (sold under the trademark Tween 80™). Examples of suitable polyethylene-polypropylene copolymers are those sold under the names Pluronic® F68 or Poloxamer 188™. Examples of suitable Polyoxyethylene alkyl ethers are those sold under the trademark Brij™. Example concentrations of surfactant may range from about 0.001% to about 1% w/v.

In some embodiments, the pharmaceutical composition includes the cells of the present disclosure, and one or more of the above-identified agents (e.g., a surfactant, a buffer, a stabilizer, a tonicity agent) and is essentially free of one or more preservatives, such as ethanol, benzyl alcohol, phenol, m-cresol, p-chlor-m-cresol, methyl or propyl parabens, benzalkonium chloride, and combinations thereof. In other embodiments, a preservative is included in the formulation, e.g., at concentrations ranging from about 0.001 to about 2% (w/v).

In certain embodiments, provided is a pharmaceutical composition that includes a therapeutically effective amount of the recombinant T cells of the present disclosure. A “therapeutically effective amount” of such cells may vary according to factors such as the disease state, age, sex, and weight of the individual, and the ability of the cells to elicit a desired response in the individual. A therapeutically effective amount is also one in which any toxic or detrimental effects of the cells are outweighed by the therapeutically beneficial effects. The term “therapeutically effective amount” includes an amount that is effective to “treat” an individual, e.g., a patient. When a therapeutic amount is indicated, the precise amount of the compositions contemplated in particular embodiments, to be administered, can be determined by a physician in view of the specification and with consideration of individual differences in age, weight, and condition of the patient (individual).

KITS

Also provided are kits comprising one or more of: the cells, the nucleic acids, the expression vectors and/or the compositions of this disclosure and instructions for the manufacture of the recombinant T cells and compositions, and optionally, instructions for their therapeutic use as described herein. The kits find use in a variety of in vitro, ex vivo, and in vivo applications.

In certain embodiments, provided are kits that include one or more of: the nucleic acids, the expression vectors and/or the cells of the present disclosure, and instructions for introducing the nucleic acid or expression vector into a cell. The kits of the present disclosure may further include any other reagents useful for regulatable signaling of the cell surface receptor, such as transfection/transduction reagents useful for introducing the nucleic acid or expression vector into cells of interest, e.g., immune cells (e.g., T cells) or other cells of interest.

These instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. One form in which these instructions may be present is as printed information on a suitable medium or substrate, e.g., a piece or pieces of paper on which the information is printed, in the packaging of the kit, in a package insert, etc. Yet another means would be a computer readable medium, e.g., CD, DVD, Bluray, computer readable memory device (e.g., a flash memory drive), etc., on which the information has been recorded. Yet another means that may be present is a website address which may be used via the Internet to access the information at a removed site. Any convenient means may be present in the kits.

The following examples are offered by way of illustration and not by way of limitation.

EXPERIMENTAL

Systemic lupus erythematosus (SLE) is defined by a broad range of symptoms that disproportionately affects women. Knowledge of which immune cells mediate the pathogenesis of the disease remains incomplete. Identifying pathogenic cells using bulk gene expression analysis is confounded by the functional overlap and frequency variation of immune cell types. Multiplexed single-cell RNA-seq (Mux-seq) was used to profile ~1 million peripheral blood mononuclear cells from 136 SLE cases and 58 controls. Cases were marked by a reduction of naive CD4 ⁺ T cells, increase and repertoire restriction of effector memory CD8 ⁺ T cells, and expression of interferon-stimulated genes in classical monocytes. An additional 17 cases experiencing disease flares presented macrophages in circulation not seen in managed disease. On average, composition accounted for more inter-individual expression variability in differentially expressed genes while cell-type- specific expression contributed to more variability overall. For thousands of genes, genetic variants were identified, including SLE-associations, associated with their expression in specific cell types. Mux-seq reveals changes in cell composition and state associated with SLE, and when integrated with genetic data, ascribes function to disease-associated variants.

Materials and Methods

Sample preparation:

Informed consent was obtained from all patients sequenced in this study. 119 SLE samples were collected from the California Lupus Epidemiological Study (CLUES) cohort, and 17 SLE flare patients and 8 matching healthy controls were collected from the UCSF Rheumatology Clinic. These studies were approved by the Institutional Review Board of the University of California, San Francisco. Peripheral blood mononuclear cells were isolated from patient donors, Ficoll separated, and cryopreserved by the UCSF Core Immunologic Laboratory (CIL). Frozen peripheral blood samples from 46 healthy controls were collected from the Immune Variation project (Immvar).

PBMC processing:

PBMCs were thawed, suspended and multiplexed according to the protocol in Kang et al. and loaded onto the 10x Chromium instrument. Following library prep according to the published 10X protocol, libraries were sequenced on the Hiseq4000 at a depth of 6,306- 29,862 reads/cell.

Single cell preprocessing:

A total of 1 ,352,730 droplets from cells in the healthy ImmVar, Flare, and California Lupus Epidemiological Study cohorts were sequenced. Demuxlet was used with an error probability of 0.1 to assign each cell to a donor of origin, preserving a total of 991 ,016 singlets. Using Scanpy version 1 4(Wolf, Angerer, and Theis 2018), the cross-sectional and flare cohort were preprocessed separately by first adjusting for pool using COMBAT(Johnson, Li, and Rabinovic 2007), then regressing total nUMIs, percentage mitochondrial UMIs, gender, and principal components capturing a platelet signature. Regression for the platelet signature was performed because of the detection of platelet markers across cell types that likely reflect low levels of contamination due to imperfect ficoll in the CLUES cohort. This claim is supported by the detection of platelet markers only in controls samples pooled with case samples but not with each other. After an initial round of regressing for total nUMIs, percentage mitochondrial UMIs and gender, principal components were computed and those correlated with the expression of PF4 (R>0.4) were identified as platelet specific. Cell filtering and expression normalization followed default settings. Subsequently, k-nearest neighbor (knn) graph construction, leiden clustering were performed and UMAP projections were plotted. For performing diffusion pseudotime along each trajectory, an interferon stimulation reference transcriptome was created by taking transcriptomes of PBMCs that were stimulated with interferon beta(Kang et al. 2018) and taking the mean for each cell type. For each cell in the dataset, the distance (L2) between its transcriptome to the reference was computed.

Cell Type Annotation and Proportion Calculations:

Scanpy version 1.4 was used to cluster singlets into leiden communities with parameter settings of resolution of 3 and controlling for random state. For the flare cohort, a resolution of 3 was used. Differentially expressed genes between communities were found in addition to most abundantly expressed genes for each community. Gene expression profiles of known cell type populations identified in previous literature were used to identify the communities. The proportion of cells for each cell type was calculated as the number of cells belonging to the cell type divided by the total number of cells assigned to the sample. 2 samples with less than 100 cells total were excluded from the analyses. Cell type counts were calculated by multiplying the proportions by the total white blood cell count for each patient.

Electronic health record query:

SLE cases with available monocyte and lymphocyte counts were selected according to the following criteria: 4532 healthy female controls were selected according to previous work condutec with the UCSF EHR database(Rappoport et al. 2018). In short, outpatients without abnormal findings of adult patients aged 20-90 was extracted from the EHR system at the University of California, San Francisco (UCSF ) Medical Center Data was extracted at February 2018, covering about 6 years of medical service coverage. In case there were multiple healthy encounters were found for a subject, a single random one was chosen. 403 Cases where defined as patients in the same age range who have a diagnosis of an ICD- 10 code M32. ^* appearing at least twice 30 days apart. Lab tests results for cases were taken from encounters for which MS was assigned as a primary diagnosis or principal problem diagnosis. Patients with a monocyte count less than 5 and a lymphocyte count less than 6 were excluded.

Mendelian randomization:

To test putative causal associations between risk factors and diseases performed Mendelian randomization using the GSMR (Generalized Summary-data-based Mendelian Randomization) package in gcta_1 .91 .5beta(Zhu et al. 2018). A search for causal associations was carried out between blood count quantitative trait loci (qtls) in UK biobank (lymphocytes, monocytes, red blood cells, white blood cells, and platelets) and lupus qtls. 1000 genomes phase3 was used as a reference, a gwas significance threshold of 5e-18, heidi outlier threshold of 0.15, and a linkage disequilibrium threshold of 0.01.

Cell Type Specific Differential Expression:

For each cell type, a bulk profile summing all of the counts for each individual was calculated. The DESeq2 R package was used to estimate the log2 fold change and the p- value of gene expression differences between the SLE and the healthy cohorts, and batch was included as a covariate. For visualization and variance decomposition, COMBAT (R package sva) was used to adjust batch effects across all genes and all batches. With the batch adjusted matrix, the differential expression signature was calculated as the first principal component of gene expression corresponding to the 190 differentially expressed genes from PBMCs.

Variance Decomposition of PBMC expression:

Raw counts for each cell type were normalized to the total number of PBMCs per donor. The PBMC variance of each gene (y) was decomposed first into cell composition components using linear regression and the following model: y = b _r1 x c _pl + b _r2 x C _p2 T.. . +b _rh x c - l, where c _pi is the proportion of cell type / and b _rί is the coefficient. The residual from this fit was then regressed with the expression of each cell type: y _res = b _eΐ ^{x c} _ei + b _e 2 ^{x c} _e 2+- +b _eh x c _en - 1, where c _ei is the expression of the same gene in cell type / and b _eί is the coefficient. The contribution from each cell type / (for both proportion and cell-type-specific expression) was computed using the following:

This model accounts for both the variance contribution from each cell type but also allocates the covariance between any pair of cell types equally to each cell type.

TCR Sequencing and Analysis:

Approximately 10% of the barcoded cDNA from the 10X workflow was utilized for TCR analysis. The cDNA was further amplified with Template switch oligo (TSO) primer and the Truseq Read 1 primer with KAPA HiFi hotstart readymix (Kapa Biosystems, Thermo Fisher Scientific) for 12 cycles at the conditions 98°C for 15 seconds, 67°C for 20 seconds and 72°C for 1 minute. A pool of forward Valpha and Vbeta primers containing the lllumina read 2 primer sequence were used in conjunction with the Truseq Read 1 primer to amplify CDR3 sequences from the TCR alpha and beta loci with NEBNext Ultra II Q5 Master Mix (New England Biolabs Inc.) for 25 cycles at the conditions 98°C for 10 seconds, 68°C for 30 seconds and 72°C for 1 minute. An additional amplification step using primers containing the lllumina P5 adapter, i5 index sequences and Truseq Read 1 primer sequence with the lllumina P7 adapter, i7 index sequences and Truseq Read 2 with NEBNext Ultra II Q5 Master Mix was carried out for 8 cycles at the conditions 98°C for 15 seconds and 72°C for 1 minute and 20 seconds to create final TCR libraries for sequencing. High-throughput sequencing was done on an lllumina Hiseq 2500 Rapid run with separate lanes for the TCR alpha and TCR beta sequencing. Read 1 sequenced 26 bp containing the 10x barcode and UMIs, and Read 2 sequenced 251 bp containing the variable TCR regions plus the TCR alpha or beta CDR3 sequences.

TRA and TRB CDR3 nucleotide reads were demultiplexed by matching reads to 10X barcodes from cells with existing expression data that passed filtering in the Cell Ranger pipeline. Following demultiplexing of the TRA and TRB CDR3s, reads were aligned against known TRA/TRB CDR3 sequences then assembled into clonotype families using miXCR (Bolotin et al., 2015) with similar methodologies to a previous study (Zemmour et al., 2018). For any given 10X barcode, the most abundant TRA or TRB clonotype was accepted for further analysis; if 2 TRA or TRB clonotypes were equally abundant for a given 10X barcode, the clonotype with the highest UMI reads was used for further analysis. Only cells with paired TRA and TRB were used for further downstream analysis. Paired TCR Gini coefficients were calculated based on the number of unique cells sharing a specific TRA/TRB clonotype sequence across the sample’s entire cell population. Analysis involving both TCR clonotype and function was restricted to cells with both a mapped TRA/TRB and a functional population from clustering. The TCR sequencing was performed using the singleTCR package available at https://qithub.com/tli71193/sinqleTCR.

Sample Genotyping:

CLUES SLE patients were genotyped on the Affymetrix World LAT Array and the Immvar and flaring SLE patients were genotyped on the OmniExpressExome54 chip. A total of 21 ,412,068 SNPs were imputed from the Haplotype Reference Consortium version 1 .1 with a MAF < 0.01 . eQTL discovery:

1 ,220,450 SNPs with a MAF < 0.1 were used to map cis-eQTLs within a cis window +/- 10Okbp of each gene, and a total of 8,905 genes were tested. Gene expression for each cell type was normalized using the rlog function in the DESeq2 package, and eQTLs were called using the MatrixEQTL package. The first 10 principal components of gene expression and 7 genotype PCs were included as covariates in all of the eQTL linear models. For the IFN interaction model, an additional interaction term with the IFN signature and genotype, and the effect size and significance of the interaction term were calculated. The IFN signature was calculated as the first principal component of gene expression of the 25 type I interferon genes as listed in Crow et al.

ATAC-seq and GWAS enrichment:

Cell type specific ATAC-seq peaks were downloaded from Calderon et al (https://web.stanford.edu/qroup/pritchardlab/dataArchive/imm une atlas web/index.html). For each set of eQTLs and peaks, a Mann-Whitney test was applied to determine the enrichment for significant SNPs residing within each set of cell type specific peaks. GWAS enrichment was calculated using the GREGOR package, and the set of significant SNPs for each disease were downloaded from the UCSC Genome Browser.

GEMMA

GEMMA 0.98.1 (Zhou and Stephens 2012) was run using the genotypes from SLE patients in PLINK binary format. Both a standardized kinship matrix and gender were adjusted for in the results. Lymphocyte and monocyte counts from the EHR of the SLE patients were used.

Ab-seq protocol:

PBMCs were thawed, suspended and multiplexed according to the protocol in Kang et al.

After multiplexing, cells were resuspended in 100 uL of EasySep buffer (STEMCELL Technologies) + 5% Human TruStain FcX (Biolegend 422301) to block non-specific staining. Cells incubated in this solution at room temperature for 10 minutes. Immunostaining antibodies (AbSeq, Becton Dickinson) were pooled at 2 uL per antibody, and the pool was added to cell solution after blocking. Cells stained for 45 minutes on ice, and were then washed 3 times in EasySep buffer. The cells were resuspended in EasySep and strained using a 40-micron FlowMi strainer (Sigma BAH 136800040). Cells were then loaded onto the 10x Chromium instrument. Following library prep according to the standard 10x protocol, libraries were sequenced on the Novaseq S4 flow cell.

Data Availability: All data is available in the Human Cell Atlas Data Coordination Platform and at the GEO Accession Number GSE137029.

Code Availability: https://aithub.com/velabucsf/lupus paper

Materials and Methods References

Johnson, W. Evan, Cheng Li, and Ariel Rabinovic. 2007. “Adjusting Batch Effects in Microarray Expression Data Using Empirical Bayes Methods.” Biostatistics 8 (1): 118-27.

Kang, Hyun Min, Meena Subramaniam, Sasha Targ, Michelle Nguyen, Lenka Maliskova, Elizabeth McCarthy, Eunice Wan, et al. 2018. “Multiplexed Droplet Single-Cell RNA-Sequencing Using Natural Genetic Variation.” Nature Biotechnology 36 (1): 89-94.

Rappoport, Nadav, Hyojung Paik, Boris Oskotsky, Ruth Tor, Elad Ziv, Noah Zaitlen, and Atul J. Butte. 2018. “Comparing Ethnicity-Specific Reference Intervals for Clinical Laboratory Tests from EHR Data.” The Journal of Applied Laboratory Medicine 3 (3): 366- 77.

Wolf, F. Alexander, Philipp Angerer, and Fabian J. Theis. 2018. “SCANPY: Large- Scale Single-Cell Gene Expression Data Analysis.” Genome Biology 19 (1): 15.

Zhou, Xiang, and Matthew Stephens. 2012. “Genome-Wide Efficient Mixed-Model Analysis for Association Studies.” Nature Genetics 44 (7): 821-24.

Zhu, Zhihong, Zhili Zheng, Futao Zhang, Yang Wu, Maciej Trzaskowski, Robert Maier, Matthew R. Robinson, et al. 2018. “Causal Associations between Risk Factors and Common Diseases Inferred from GWAS Summary Data.” Nature Communications 9 (1): 224.

A cross-sectional dataset of 834,096 cell profiles across 169 donors (119 cases from the California Lupus Epidemiology Study ¹³ and 50 controls from the ImmVar Consortium ^{14- 17} ) was generated. PBMCs were profiled using Mux-seq in 13 pools each containing 16 donors ¹² (FIG. 1 Panel A). A total of 1 ,134,700 cell-containing droplets were sequenced to an average depth of 18,201 reads per droplet. 834,096 cells remained after quality control filtering and removal of droplets containing two cells using demuxlet ¹² (doublet rate 26.5%, expected 22-25%). Sample demultiplexing using demuxlet resulted in 4,590 singlets (+/- 1 ,572) assigned to each donor.

From the single cell profiles, the composition of circulating immune cells per sample were estimated and assessed for the robustness of the estimates. Following batch correction, normalization, principal component analysis, /c-nearest neighbor graph construction, and Leiden clustering (see Materials and Methods), each of 32 resulting clusters were assigned to 11 immune cell types based on known gene signatures including: classical (cM) and non-classical monocytes (ncM), conventional (cDCs) and plasmacytoid dendritic cells (pDCs), CD4 ⁺ (T4) and CD8 ⁺ T cells (T8), natural killer cells (NK), B cells (B ), proliferating lymphocytes (Prolif), megakaryocytes (MK), and progenitor cells (Progen). Uniform Manifold Approximation and Projection (UMAP) ¹⁸ revealed distinct regions of the embedding occupied by cells of different types (FIG. 1 Panel B) and to a lesser extent by cells from cases versus controls (FIG. 1 Panel C). For each sample, a personalized projection was constructed and obtained highly reproducible estimates of cell composition between biological replicates (Mean Ft ² = 0.81) (FIG. 1 Panel D). Notably for 107 cases, estimates of monocyte (ncM+cM) and lymphocyte (T4+T8+NK+B ) abundances are extremely well correlated with those measured by automated white blood cell counts with differential reported in the UCSF Electronic Health Records (EHR) (Rmono = 0.88, P < 9.30x1 O ³⁶ , Riympho= 0.97, P < 1.40x1 O ⁶³ , (FIG. 1 Panel E).

Least squares regression was used weighted by the total number of cells per donor to quantify composition differences between cases and controls. Cases were marked by higher percentages of monocytes (cM: +10.7%, P < 1.68x10 ^-8 ; ncM: +1.7%, P < 5.32x10 ^-4 ) and a corresponding lower T4 percentage because composition estimates are relative (- 13.3%, P < = -0.41) (FIG. 1 Panel F). Additionally, SLE patients have higher percentages of Prolif (+0.34%, 4.29x10 ^-4 ), and a lower percentage of pDCs (-0.55%, P < 5.16x1 O ²⁴ ) consistent with most reports ¹⁹ . No significant effects of treatment on composition were detected in patients currently receiving mycophenolate mofetil, hydroxychloroquine, or oral steroids, consistent with reports that suggest mycophenolate mofetil has no effect on white blood cells ²⁰ and prednisone has only transient effects on CD4 ⁺ T cells ²¹ · ²² .

A higher ratio of monocytes to T4 cells could be due to mutually antagonistic regulation of myeloid versus lymphoid lineages during hematopoiesis or the enrichment or depletion of one lineage. Analysis of lymphocyte and monocyte abundances reported in the EHR of an additional 117 cases and 1 ,688 matched controls found no difference in the abundance of monocytes but depletion of lymphocytes in cases (Caucasians: P < 8.00x10 ^{_ 9} , African Americans: P < 1.81x10 ^-5 , Asians: P < 1.66x10 ^-14 , (FIG. 1 Panel G). To assess if lymphocyte depletion is causative for disease, Mendelian randomization using Generalised Summary-data-based Mendelian Randomisation (GSMR) ²³ was performed using summary statistics on SLE and blood composition traits from the UK Biobank ²⁴ . The causal effect size of SLE-associated variants on disease status is negatively correlated with their effect sizes on lymphocyte ( s _LE.iymph = -0.11 , P < 0.03; (FIG. 1 Panel H) but not monocyte abundances.

Example 2: Detection of composition that accounts for more inter-individual expression variability in SLE

Bulk profiling of circulating immune cells have identified transcriptomic signatures linked to interferon signaling, lymphocyte activation, and cytolytic function in SLE ⁴ . However, pinpointing the pathogenic cells underlying bulk transcriptional signatures may be confounded by the functional overlap and frequency variation of immune cell types. To identify expression changes across cell types in SLE, pseudobulk PBMC or cell-type- specific profiles for each sample were computed and 141 differentially expressed (DE) genes in PBMCs and an additional 57 in at least one of eight cell types between cases and controls were identified (cM, ncM, cDC, pDC, T4, T8, NK, or B ) (FDR < 0.01 , abs(logFC ) > 1 ; (FIG. 2 Panel A). The 198 DE genes clustered into 6 up-regulated and two down- regulated modules in SLE (FIG. 2 Panel B). Down-regulated modules M _P DC and MT4 are comprised of lineage-specific genes reflective of the decrease in the frequencies of T4 (i.e. CCR7) and pDC (i.e. LILRA4). The up-regulated modules include Mp _an , enriched for interferon-stimulated genes (ISG) across all cell types, and two modules expressing genes specific to the myeloid lineage. Mp _a n and MM _O ™ capture 21/30 previously described ISG genes in SLE ⁵ while M _n M is composed of components of the complement system. A pseudobulk ISG signature score calculated over all PBMCs is positively correlated with myeloid cell percentage (R = 0.58) and negatively correlated with lymphoid cell percentage (R = -0.22) (FIG. 2 Panel C).

Additional up-regulated modules Mi_ _y mph, MTS and MB consist of genes expressed in T4, T8 and B cells including cytotoxicity (MT _S : GZMB, GZMH), activation and checkpoint (Mi_ymph : TIGIT, KLRB1), and major histocompatibility complex molecules and cytokines (MB: HLA-DRB5, IL6). Genes in these modules were largely not differentially expressed in PBMCs likely due to the low frequency of cells in circulation (e.g. T8 and Bs) and the opposing actions of cell depletion and increased expression (e.g. T4), highlighting an important advantage of single-cell analysis.

Leveraging the ability to simultaneously estimate the frequency and expression profile of each cell type, variance component analysis was used to quantify the contribution of cellular composition (V _CO mp) and cell-type-specific expression (V _exp ) to inter-individual expression variability. Composition explains more variability for differentially expressed genes (V _CO mp = 48%) than all genes (V _CO mp = 25%) (FIG. 2 Panel D). Partitioning of V _CO mp and V _ex p implicates specific cell types responsible for the variability of each module. For Mp _an , inter-individual variability is mostly determined by the percentage (31%) and expression (25%) of cMs with composition contributing substantially more in cases than controls (V _C M _, com = 25% vs 1 .2%) (FIG. 2 Panel E). For MT _S , highlighted by IFNG, T8 percentage contributes most to inter-individual variability and was higher in cases than controls (Vis.comp = 32% vs 13%) (FIG. 2 Panel E). Beyond modules, an intriguing example is the proinflammatory cytokine IL6, one of the only genes whose inter-individual variability is determined by B cells in cases but not controls (VB,com = +16.8%, Ve.exp = +19.2%) (FIG. 2 Panel F). While IL6 is known to induce B cell hyperactivity in SLE ²⁵²⁶ , its expression by the cognate cells it activates suggests autoregulatory mechanisms orthogonal to canonical sources, possibly through the spontaneous formation of germinal centers ²⁷ , to promote the production of autoantibodies and systemic autoimmunity.

If refined estimates of cellular composition and cell-type-specific expression could better predict disease status and activity than known bulk expression features was also assessed. Using elastic nets, all models except one that only used monocyte/lymphocyte composition were highly predictive of disease status (10-fold cross-validation Ft ² > 0.93, (FIG. 2 Panel G). Within cases, although no model predicted the Systemic Lupus Erythematosus Disease Activity Index (SLEDAI) particularly well (Ft ² ~ 0.09-0.23), a model that used only 11 composition features better predicted individual SLEDAI components than one that used the pseudobulk expression of the 30 published ISG genes ⁵ (low complement Ft ² : 0.71 vs 0.66, anti-dsDNA Ft ² : 0.60 vs 0.59, rash Ft ² : 0.87 vs 0.80, (FIG. 2 Panel G). Lupus nephritis is a major complication of SLE and a model that included both cell-type- specific expression and composition components was able to predict past kidney complications significantly better than one that used the pseudobulk expression of ISG genes (kidney Ft ² : 0.60 vs 0.53, (FIG. 2 Panel G). activity

The significant inter-individual variability explained by their intrinsic expression in myeloid populations suggests additional heterogeneity within the myeloid compartment that underlies the bulk ISG signature in SLE. To test this, cM, ncM, pDC, cDC were reclustered into 10 clusters including resting cell populations differentiating the monocyte lineage (cM: CD14 ⁺ classical, ncM: CD16 ⁺ non-classical) and the dendritic cell lineage (cDC1 : CLEC9A ⁺ conventional, cDC2: FCER1A ⁺ conventional, pDC: IRF7 ⁺ plasmacytoid) (FIG. 3 Panels A and B). Importantly, several functionally distinct clusters were also detected including IL1B ⁺ pro-inflammatory monocytes (cM _mf ), activated monocytes expressing ISGs (cM _{a t} ), complement-expressing monocytes (ncM _C om ), and two populations of macrophages (Mac1 and Mac2, both expressing CSF3R and distinguished by the expression of ISG15) (FIG. 3 Panels A and B). CM _{a t} , cM _f , and the macrophage clusters all express CD14 indicative of their origin from classical monocytes while ncM _¥ mp expresses FCGR3A ( CD16 ) indicative of their origin from non-classical monocytes (FIG. 3 Panel B).

Monocytes defined by function and dendritic cells defined by lineage occur at different frequencies between cases and controls. As a percentage of all PBMCs, pDCs remain reduced in cases while the two cDC populations do not change in frequency (FIG. 3 Panel D). Two monocyte populations, cM _act (+5.66%, P < 2.47x10 ^-5 ) and ncM _¥ mp (+0.27%, P < 3.72x10-5) and Mac2 (+0.19%, P < 1.99x10 ^-5 ) are notably increased in frequency (FIG. 3C,D). The percentages of these cell types are positively correlated with the pseudobulk ISG signature score across all donors (cM _act : R = 0.60, P < 6.95x10 ^-14 ; ncMcomp: R = 0.45, P < 1 .01 x10 ⁷ ; Mac2: R = 0.52, 2.87x10 ^-7 ) and in cases (cM _act : R = 0.57, P < 2.52x10 ¹¹ ; ncM _C om _P : R = 0.41 , P < 4.27x10 ⁶ ; Mac2: R = 0.46, 3.00x10 ⁷ ) suggesting that these myeloid populations are the main producers of the ISG signature (FIG. 3 Panel E). This is confirmed by the elevated expression of the ISG signature score component modules (Mp _an , in these clusters in cases but not controls (FIG. 3 Panel F). Ordering myeloid cells along a diffusion pseudotime (DPT) based on the degree of IFN activation for each module revealed a shift toward higher activation in cases as a function of the SLEDAI (FIG. 3 Panel G). This shift was also observed when ordering cells based on comparison to an independent in vitro stimulation dataset ¹² but not observed when ordering cells by the expression of lineage markers CD14 and FCGR3A (FIG. 3 Panel G). Compared to controls, even cells from cases with 0 SLEDAI are shifted toward higher IFN activation indicative of subclinical disease.

While lymphopenia is near-universal in pediatric and adult SLE, precisely which lymphocyte subpopulations are depleted during disease remains unknown. Initial analysis provided evidence for the depletion of CD4 ⁺ T cells in cases while the abundances of CD8 ⁺ , natural killer, and B cells remain unchanged. To further characterize the changes in the composition and state of the lymphoid compartment, T4, T8, NK, B and Prolif cells were reclustered into 19 clusters (FIG. 4 Panel A).

In the T cell compartment, canonical subpopulations of naive (T4 _naiVe : annotated by CCR7 expression) and central memory CD4 ⁺ cells (T4 _c : annotated by ANXA 1 and IL7R expression), and the corresponding CD8 ⁺ cells (T8 _naiVe : CCR7 and CD8B, T8 _c : SBF2) were identified (FIG. 4 Panels A and B). Additional populations detected include regulatory (T4 _reg : RTKN2, TIGIT, and FOXP3) and interferon-activated cells (T N: tagged ISGs such as ISG15) within the CD4 lineage; mucosal-associated invariant cells (T8 _e m,MAu: KLRB1 ⁺ /GZMK ⁺ ) and two effector memory populations (T8 _e m,cytoi and T8 _e m,cyto2) within the CD8 lineage (FIG. 4 Panels A and B). The effector memory T8 populations both express the chemokine CCL5, effector molecules PRF1 and GZMA, and exhaustion markers LAG3 and PDCD1, and can be distinguished by the expression of granzymes (T8 _e m,cytoi : GZMB and GZMH, T8 _e m,c _y to2: GZMK ⁺ /KLRB1 FIG. 4 Panel B).

The distribution of T cells, especially CD8s, was shifted toward effector phenotypes in cases versus controls (FIG. 4 Panel C). While both T4 _na ive and T8 _na ive percentages were reduced (T4: -11.8%, P < 2.27x1 O ²³ , T8: -3.51%, P < 4.00x10- ⁸ , FIG. 4D), T4 _naiV e but not T8 _{na e} percentage is negatively correlated with the pseudobulk PBMC ISG signature score (R = -0.62, P < 4.63x1 O ¹⁵ vs R = -0.08, P < 0.39) (FIG. 4 Panel E). Strikingly, both T8 _e m,c _y toi and T8em,cyto2 percentages were significantly increased (+4.52%, P < 1.66x1 O ⁴ ; +1.05%, P < 1.23x1 O ² ) while T8 _e m,MAu percentages were decreased (-2.04%, P < 3.52x10 ^-19 ) (FIG. 4 Panel D). Previous studies have implicated GZMB ⁺ /PRF1 ⁺ CD8 ⁺ s in SLE pathogenesis possibly by generating nontolerogenic granzyme-B mediated autoantigen fragments that may overwhelm physiologic clearance pathways and contribute to antigenic feeding of dendritic cells ²⁸ .

To investigate the potential causal role for changes in the T cell compartment, the CDR3 region of the T cell receptor (TCR) were amplified and sequenced, recovering productive paired TCRA and TCRB sequences from 10.2% of T4s and 8.7% of T8s with no differences in recovery between 119 cases and 22 controls. Intriguingly, T8 cells from 48 of 119 cases (compared to 8 of 22 controls) and T4 cells from 1 case (compared to no controls) expressed at least one TCR sequence in at least two cells suggestive of clonal expansion of T8 and not T4 cells in SLE. This was confirmed by a higher Gini coefficient (a measure of repertoire restriction) in cases for T8 (P < 0.006, t-test) but not T4 cells (P < 0.62; FIG. 4 Panel F. Expanded T8 clones (defined as those detected in more than 1 cell) were enriched within the T8 _e ,cytoi (P < 0.004) and T8 _e ,cyto2 (P < 0.03) clusters (FIG. 4 Panel G). As a positive control, clones expressing the invariant TRAV1-2 and TRAJ33 chain were enriched within the T8 _e m,MAu cluster. The lack of correlation between the percentages of the T8 subsets and the ISG signature score within cases suggests that the expansion of effector memory T8 cells is independent of type 1 interferon activation.

Within other lymphocyte compartments, more subtle changes in cases was observed. Three NK cell subpopulations distinguished by XCL1/2 (NKbnght), PRF1 (NKdim and NK3) and HBA1 (NK3) and four B cell subpopulations distinguished by TCL1A (B _naiVe ), HLA-DRA (all B cells), MZB1 (B _pia sm _a ) and cytotoxic markers including GZMB and PRF1 (Bdoubiets) (FIG. 4 Panel A) were identified. In cases, the NK clusters did not change in frequency while B _me m percentages were decreased (-2.73%, P < 1.96x1 O ⁷ ). The percentage of Bdoubiets cells, expressing high levels of cytolytic and B cell markers, was also increased in cases. These cells resemble the recently described interacting pairs of B cells and either NK or T8 cells ²⁹ .

Example 5: Detection of context specific genetic effects on gene expression

The integration of multiplexed dscRNA-seq and dense genotyping provides an opportunity to examine the prevalence and magnitude of genetic effects associated with composition, cell-type-specific expression, and cellular response to prolonged stimulation in disease states. No genetic variants were associated at genome-wide significance with either lymphocyte or monocyte percentage, likely reflective of the small effect sizes of common variants ³⁰ and the effect of disease and treatment on these traits. On the other hand, using the bulk gene expression in each of 119 individuals (118 for pDCs), hundreds to thousands of cis expression quantitative loci (c/ ^' s-e QTLs) in each cell type were detected (1 ,118 in T4, 1 ,180 in T8, 403 in NK cells, 538 in B cells, 1 ,686 in cM, 889 in ncM, 337 in cDCs, and 39 in Mkc; FDR < 0.1). Out of the 3,092 c/ ^' s-e QTLs detected in at least one cell type, 2,132 were not detected in pseudobulk PBMCs, suggesting that the majority of cis- eQTLs have heterogeneous effects across cell types. While the genetic correlations of cis- eQTLs between pairs of cell types are generally high (rG = 0.25-0.61), clustering based on either the genetic correlations or the number of overlapping c/ ^' s-e QTLs reflected the known lineage relationships between circulating immune cell types (FIG. 5 Panel A). Further, compared to c/ ^' s-e QTLs detected in PBMCs, c/ ^' s-e QTLs detected in each cell type were more enriched for accessible regions of the genome measured in the same cell type by bulk ATAC-seq ³¹ (Mann-Whitney test, FIG. 5 Panel B.

The published GWAS data was integrated to assess the enrichment of cell-type- specific c/ ^' s-e QTLs for autoimmune disease loci. T4-specific and T8-specific c/ ^' s-e QTLs were most enriched for SLE-associated loci and were higher than the average enrichment for other autoimmune diseases suggesting T lymphocytes as potential mediators for genetic variants causal for disease (FIG. 5 Panel C). One example of an SLE-associated variant is rs6671847, which has a significant effect on the expression of HSPA6 in T8 cells (FIG. 5 Panel D). HSPA6 is also within a risk locus for Ulcerative Colitis, and part of a family of heat shock proteins known to influence autoimmunity and tumor immunity ³² _’ ³³ . Another example is the SLE-associated variant rs7258015 ³⁴ , which is associated with the expression of ICAM3 only in ncM cells (FIG. 5 Panel D). Circulating ICAM3 is upregulated in patients with autoimmune diseases ³⁵ and serum levels of ICAM3 can be used as an indicator of lymphocyte stimulation in PBMCs ³⁶ . Beyond SLE, enrichment of type-1 diabetes variants within T4 and NK cis-e QTLs, and multiple sclerosis variants within B cell cis-e QTLs was also found consistent with the known pathogenesis of each disease.

It has been previously shown that in vitro stimulation with recombinant IFNB can modify the effects of genetic variants on the expression of myeloid cells ¹⁵ _’ ³⁷ . If the ISG signature reflective of type-1 interferon activation in vivo can similarly modify genetic effects (c/s-IFN-eQTLs) on gene expression in SLE was assessed. Using a model that explicitly tests for interactions between genetic variants and the ISG signature score (Materials and Methods), 1 c/s-IFN-eQTL in cMs and 4 c/s-IFN-eQTLs in PBMCs (FDR < 0.1) was detected. Despite the limited power, previous interferon response eQTLs ³⁸ featured a more prominent deviation from null in the quantile-quantile plot compared to all variants (FIG. 5 Panel E). The paucity of signals could be due to imperfect estimates of in vivo interferon activation, small interacting effect sizes, and population heterogeneity of the samples. Results from population-specific analyses mirrored those from the full cohort: of the top 100 c/s-IFN-eQTLs in all cases, 53 were nominally significant (P < 0.05) in the European cases (P < 8.81x1 O ⁴² , binomial test) and 42 in the Asian cases (P < 3.53x10 ^-28 , binomial test), suggesting minimal effects due to population heterogeneity.

The most striking example of a c/s-IFN-eQTL is associated with APOBEC3B (P < 9.55 x 10 ⁷ ) (FIG. 5 Panel F) where IFN activation as captured by the ISG signature score significantly modifies the effect of rs12628403 on APOBEC3B expression in monocytes (positive for major homozygotes and negative for heterozygotes). This results in low APOBEC3B expression variability in cases with low ISG signature scores and high variability in cases with high ISG signature scores. APOBEC3B is a cytidine deaminase implicated in RNA-editing and autoimmunity, and it has been shown to be upregulated in SLE patients with managed disease ³⁹ and further upregulated during flares ⁴⁰ . These results suggest that polymorphisms at the APOBEC3B locus could contribute to increased variability of its expression resulting in the heterogeneous clinical presentation of SLE related to the function of the gene.

Example 6: Detection of periods of heightened disease marked by the presence of macrophages

One of the clinical complications of SLE is the development of flares that require a change of therapeutic strategy. To characterize the molecular features of SLE during periods of heightened disease, an additional 8 healthy controls and 17 SLE flare patients (Flare) were recruited, 8 of whom provided an additional sample three months after change in treatment (Treated) (FIG. 6 Panel A). To facilitate comparisons, 10 healthy controls and 5 non-flaring SLE patients (Managed) from the original cross-sectional cohort were sampled again (FIG. 1 Panel A). Using a panel of 20 oligo-tagged antibodies, sample multiplexed Ab-seq (BD Bioscience) of four pools (ranging from 8 to 17 individuals per pool) (FIG. 6 Panel A) was performed. In this longitudinal cohort, a total of 218,030 cell-containing droplets were sequenced to an average depth of 42,268 reads per droplet, 153,955 were retained after quality control filtering and removal of droplets containing more than one cell using demuxlet (29.38%, expected 22-25%).

37 Leiden clusters were identified and assigned them to 11 immune cell types (FIG. 6 Panel B. Changes in composition between flare cases and controls were highly correlated with those observed between cross-sectional cases and controls (R = 0.81 , P < 0.005) (FIG. 6 Panel C). To further validate and refine the observed differences in cellular composition, each of 37 clusters was assigned to one of 24 subpopulations that transcriptionally overlaps well with the same subpopulation identified in the cross-sectional cohort (FIG. 6 Panel D). Analysis of the subpopulations between flare cases and controls generally confirmed the findings from the cross-sectional cohort (R = 0.73, P <1.22x10 ^-4 ) including the following: decreased percentage of T4 _na ive (-10.18%, P < 8.54x10 ^-5 ), T8MAIT (-2.59%, P < 4.23x10 ^-6 ), pDC (-0.53%, P < 1.14x1 O ⁴ ); increased percentages of T8 _e m _, cytoi (+9.40%, P < 1.97x10 ^-4 ), cMact (+5.21%, P < 5.90x1 O ⁴ ), and ncM _COmp (+0.56%, P < 3.44x10 ⁴ ) cells (FIG. 6 Panel E). Surprisingly, a significant increase in macrophages in flare cases was observed that were not observed in the cross-sectional (+4.00%, P < 6.38x10 ^-5 , Wilcoxon rank-sum, FIG. 6 Panel F. Although no significant differences were found in response to treatment overall, all three patients receiving rituximab were depleted of B cells. mRNA and protein abundances for 20 cell-surface markers was further compared to identify differences between the two feature types. The correlations between pseudoboulk protein and mRNA abundances spanned a range from 0.004 (KLRB1) to 0.87 (CD8A) (Pearson R). Leiden clustering and UMAP projection using protein features revealed cluster assignments that broadly recapitulated those obtained from using mRNA features. The notable exception was T8 _e m _,C ytoi identified from the mRNA analysis which projected onto both T4 and T8 regions of the protein UMAP (FIG. 6 Panel G and expressed both CD4 and CD8 proteins (FIG. 6 Panel H). Only the percentages of effector memory cytotoxic T8 and not T4 cells increased in abundance in flare cases (T8: +6.27%, P < 2.7x10 ^-4 ; FIG. 6 Panel I). These results further support GZM&/PRF1 ⁺ CD8 ⁺ cytotoxic T cells as a potential mediator of SLE, possibly through the production of IFNG, resulting in the recruitment of macrophages to initiate the recurrence of disease as was observed in flare patients.

Notwithstanding the appended claims, the present disclosure is further defined by the following embodiments:

1 . A method of treating Systemic Lupus Erythematosus (SLE) in a subject in need thereof comprising: administering to a subject identified as having cytotoxic CD8+ T lymphocytes comprising (i) T cell receptors comprising an a chain and a b chain CDR3 amino acid sequence at least 80% identical to one or more of SEQ ID NOs:1-96; and/or (ii) an expression profile characterized by the expression level of three or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A an effective amount of an agent that targets the cytotoxic CD8+ T lymphocytes.

2. The method of embodiment 1 , wherein the subject is identified as having cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of seven or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A.

3. The method of embodiment 1 , wherein the cytotoxic CD8+ T lymphocytes comprise T cell receptors comprising an a chain and a b chain CDR3 amino acid sequence at least 80% identical to one or more of SEQ ID NOs:1-96.

4. The method of any one of embodiments 1 to 3, further comprising, prior to administering the agent, identifying the subject as having the cytotoxic CD8+ T lymphocytes.

5. The method of embodiment 4, wherein identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises receiving a report indicating that the subject has the cytotoxic CD8+ T lymphocytes.

6. The method of embodiment 4, wherein identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining the expression level of three or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject.

7. The method of embodiment 4, wherein identifying the subject as having the cytotoxic CD8+ T lymphocytes comprises determining expression the expression level of seven or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A in the cytotoxic CD8+ T lymphocytes of the subject.

8. The method of any one of embodiments 1 to 7, wherein the expression profile is characterized by the expression level of fifteen or fewer of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A. 9. The method of any one of embodiments 1 to 8, wherein the agent is a small molecule agent.

10. The method of any one of embodiments 1 to 8, wherein the agent is a recombinant T cell.

11. The method of embodiment 10, wherein the recombinant T cell comprises a T cell receptor comprising a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs:97-192, wherein optionally, the b chain CDR3 amino acid sequence is at least 80% identical to the b chain CDR3 amino acid sequence expressed by at least one of the cytotoxic CD8+ T lymphocytes of the subject.

12. The method of embodiment 10, wherein the recombinant T cell is a chimeric antigen receptor (CAR) T cell.

13. The method of any of embodiments 10 to 12, wherein the recombinant T cell is a recombinant regulatory T cell.

14. The method of any one of embodiments 1 to 8, wherein the agent is an antibody.

15. The method of embodiment 14, wherein the antibody is an anti-CD3 antibody.

16. The method of any one of embodiments 1 to 8, wherein the agent is a steroid.

17. The method of any one of embodiments 1 to 8, wherein the agent is interleukin-2

(IL-2).

18. A method of treating SLE in a subject in need thereof comprising: administering to a subject identified as having activated monocytes comprising an expression profile characterized by the expression level of three or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 an effective amount of an agent that targets the activated monocytes.

19. The method of embodiment 18, wherein the subject is identified as having activated monocytes comprising an expression profile characterized by the expression level of seven or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2.

20. The method of embodiment 18 or embodiment 19, further comprising, prior to administering the agent, identifying the subject as having the activated monocytes.

21. The method of embodiment 20, wherein identifying the subject as having the activated monocytes comprises receiving a report indicating that the subject has the activated monocytes. 22. The method of embodiment 20, wherein identifying the subject as having the activated monocytes comprises determining the expression level of three or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject.

23. The method of embodiment 20, wherein identifying the subject as having the activated monocytes comprises determining the expression level of seven or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2 in the activated monocytes of the subject.

24. The method of any one of embodiments 18 to 23, wherein the expression profile is characterized by the expression level of nineteen or fewer of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2.

25. The method of any one of embodiments 18 to 24, wherein the agent is a small molecule agent.

26. The method of any one of embodiments 18 to 24, wherein the agent is a recombinant T cell or a chimeric antigen receptor (CAR) T cell.

27. The method of any one of embodiments 18 to 24, wherein the agent is a monocyte specific type-1 interferon inhibitor.

28. The method of any one of embodiments 18 to 24, wherein the agent is an inhibitor of interferon signaling.

29. The method of embodiment 28, wherein the agent is an inhibitor of interferon alpha receptor 1 .

30. The method of any one of embodiments 18 to 24, wherein the agent is an antibody.

31. The method of embodiment 30, wherein the antibody binds to a type I interferon receptor.

32. The method of embodiment 30, wherein the antibody is Anifrolumab.

33. A method of treating SLE in a subject in need thereof comprising: administering to a subject identified as having macrophages comprising an expression profile characterized by the expression level of three or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD an effective amount of an agent that targets the macrophages.

34. The method of embodiment 33, wherein the subject is identified as having macrophages comprising an expression profile characterized by the expression level of seven or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD.

35. The method of embodiment 33 or embodiment 34, wherein the subject is in a flare state.

36. The method of any one of embodiments 33 to 35, further comprising, prior to administering the agent, identifying the subject as having the macrophages.

37. The method of embodiment 36, wherein identifying the subject as having the macrophages comprises receiving a report indicating that the subject has the macrophages.

38. The method of embodiment 36, wherein identifying the subject as having the macrophages comprises determining the expression level of three or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject.

39. The method of embodiment 36, wherein identifying the subject as having the macrophages comprises determining the expression level of seven or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD in the macrophages of the subject.

40. The method of any one of embodiments 33 to 39, wherein the expression profile is characterized by the expression level of twenty or fewer of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD.

41 . The method of any one of embodiments 33 to 40, wherein the macrophages are isolated from the subject’s blood.

42. The method of any one of embodiments 33 to 41 , wherein the agent is a small molecule agent. 43. The method of any one of embodiments 33 to 41 , wherein the agent is an antibody, a recombinant T cell or a chimeric antigen receptor (CAR) T cell.

44. A recombinant T cell comprising a T cell receptor comprising a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs:97-192.

45. The recombinant T cell of embodiment 44, wherein the recombinant T cell is a recombinant regulatory T cell.

46. A method of treating SLE in a subject in need thereof comprising administering to the subject an effective amount of the recombinant T cell of embodiment 44 or embodiment 45.

47. A method comprising: assaying a sample obtained from a subject having or suspected of having SLE for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of three or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HOST, HLA-B and HLA-A.

48. The method of embodiment 47 comprising: assaying the sample for a population of cytotoxic CD8+ T lymphocytes comprise an expression profile characterized by the expression level of seven or more of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HOST, HLA-B and HLA-A.

49. The method of embodiment 47 or embodiment 48, comprising assessing whether the cytotoxic CD8+ T lymphocytes comprise T cell receptors comprising an a chain and a b chain CDR3 amino acid sequence of one or more of SEQ ID NOs: 1-96.

50. The method of any one of embodiments 47 to 49 comprising: assaying the sample for a population of cytotoxic CD8+ T lymphocytes comprising an expression profile characterized by the expression level of fifteen or fewer of NKG7, CCL5, B2M, GZMH, S100A4, IL32, CST7, TMSB4X, GZMA, HLA-C, SH3BGRL3, FGFBP2, HCST, HLA-B and HLA-A.

51 . A method comprising: assaying a sample obtained from a subject having or suspected of having SLE for a population of activated monocytes comprising an expression profile characterized by the expression level of three or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2. 52. The method of embodiment 51 , comprising: assaying the sample for a population of activated monocytes comprising an expression profile characterized by the expression level of seven or more of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2.

53. The method of embodiment 51 or embodiment 52 comprising: assaying the sample for a population of activated monocytes comprising an expression profile characterized by the expression level of nineteen or fewer of IFI6, ISG15, LY6E, IFI44L, IFITM3, TXNIP, MT2A, SAP30, IFI44, FKBP6, MNDA, SIGLEC1 , CD163, MX1 , VCAN, IL1 R2, EPSTI1 , HMGB2 and OAS2.

54. A method comprising: assaying a sample obtained from a subject having or suspected of having SLE for a population of macrophages comprising an expression profile characterized by the expression level of three or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD.

55. The method of embodiment 54 comprising: assaying the sample for a population of the macrophages comprising an expression profile characterized by the expression level of seven or more of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD.

56. The method of embodiment 54 or embodiment 55 comprising: assaying the sample for a population of activated monocytes comprising an expression profile characterized by the expression level of twenty or fewer of IL1 R2, CD163, RETN, S100A12, VCAN, SAP30, RNASE2, MNDA, CSTA, CLEC4E, MGST1 , FCN1 , MS4A6A, GPX1 , THBS1 , IRS2, CST3, BLVRB, ARL4A and CEBPD.

57. The method of any one of embodiments 54 to 56, wherein the sample is a blood sample.

58. The method of any one of embodiments 54 to 57, wherein the subject is in a flare state.

59. The method of any one of embodiments 47 to 58, further comprising treating the

SLE of the subject. 60. A recombinant nucleic acid comprising a polynucleotide encoding a T cell receptor comprising a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs:97-192.

61. The recombinant nucleic acid of embodiment 60, wherein the polynucleotide is operably linked to a regulatory sequence heterologous to the polynucleotide sequence.

62. An expression vector comprising a nucleic acid encoding a T cell receptor comprising a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs: 97-192.

63. An expression vector comprising a first nucleic acid and a second nucleic acid encoding a T cell receptor, the first nucleic acid encoding a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs: 97-192 and the second nucleic acid encoding an a chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs:193-288.

64. The expression vector of embodiment 63, wherein the T cell receptor comprises an a chain CDR3 amino acid sequence and a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs:1-96.

65. A first expression vector comprising a first nucleic acid encoding a b chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs: 97-192 and a second expression vector comprising a second nucleic acid encoding an a chain CDR3 amino acid sequence at least 80% identical to any one of SEQ ID NOs: 193-288.

66. A recombinant cell comprising the recombinant nucleic acid of embodiment 60 or 61 , the expression vector of any one of embodiments 62-64, or the first expression vector and the second expression vector of embodiment 65.

Accordingly, the preceding merely illustrates the principles of the present disclosure. It will be appreciated that those skilled in the art will be able to devise various arrangements which, although not explicitly described or shown herein, embody the principles of the invention and are included within its spirit and scope. Furthermore, all examples and conditional language recited herein are principally intended to aid the reader in understanding the principles of the invention and the concepts contributed by the inventors to furthering the art, and are to be construed as being without limitation to such specifically recited examples and conditions. Moreover, all statements herein reciting principles, aspects, and embodiments of the invention as well as specific examples thereof, are intended to encompass both structural and functional equivalents thereof. Additionally, it is intended that such equivalents include both currently known equivalents and equivalents developed in the future, i.e., any elements developed that perform the same function, regardless of structure. The scope of the present invention, therefore, is not intended to be limited to the exemplary embodiments shown and described herein.

REFERENCES

1. Carter, E. E., Barr, S. G. & Clarke, A. E. The global burden of SLE: prevalence, health disparities and socioeconomic impact. Nat. Rev. Rheumatol. 12, 605- 620 (2016).

2. Kaul, A. et al. Systemic lupus erythematosus. Nat Rev Dis Primers 2, 16039

(2016).

3. Sharma, S. et al. Widely divergent transcriptional patterns between SLE patients of different ancestral backgrounds in sorted immune cell populations. J. Autoimmun. 60, 51-58 (2015).

4. Banchereau, R. et al. Personalized Immunomonitoring Uncovers Molecular Networks that Stratify Lupus Patients. Ce//165, 1548-1550 (2016).

5. Crow, M. K. Type I Interferon in the Pathogenesis of Lupus. The Journal of Immunology 192, 5459-5468 (2014).

6. Lauwerys, B. R., Ducreux, J. & Houssiau, F. A. Type I interferon blockade in systemic lupus erythematosus: where do we stand? Rheumatology 53, 1369-1376 (2014).

7. Guerra, S. G., Vyse, T. J. & Cunninghame Graham, D. S. The genetics of lupus: a functional perspective. Arthritis Res. Ther. 14, 211 (2012).

8. Dozmorov, M. G. etal. B-Cell and Monocyte Contribution to Systemic Lupus Erythematosus Identified by Cell-Type-Specific Differential Expression Analysis in RNA- Seq Data. Bioinform. Biol. Insights 9, 11-19 (2015).

9. Kaminski, D. A., Wei, C., Rosenberg, A. F., Lee, F. E.-H. & Sanz, I. Multiparameter flow cytometry and bioanalytics for B cell profiling in systemic lupus erythematosus. Methods Mol. Biol. 900, 109-134 (2012).

10. Liu, M.-F. & Wang, C.-R. Increased Th17 cells in flow cytometer-sorted CD45RO-positive memory CD4 T cells from patients with systemic lupus erythematosus. Lupus Sci Med 1 , e000062 (2014).

11. Mostafavi, S. et al. Parsing the Interferon Transcriptional Network and Its Disease Associations. Ce// 164, 564-578 (2016).

12. Kang, H. M. et al. Multiplexed droplet single-cell RNA-sequencing using natural genetic variation. Nat. Biotechnol. 36, 89-94 (2018).

13. Lanata, C. M. et al. Genetic contributions to lupus nephritis in a multi-ethnic cohort of systemic lupus erythematous patients. PLoS One 13, e0199003 (2018). 14. Ye, C. J. etal. Intersection of population variation and autoimmunity genetics in human T cell activation. Science 345, 1254665 (2014).

15. Lee, M. N. et al. Common genetic variants modulate pathogen-sensing responses in human dendritic cells. Science 343, 1246980 (2014).

16. Raj, T. etal. Polarization of the effects of autoimmune and neurodegenerative risk alleles in leukocytes. Science 344, 519-523 (2014).

17. De Jager, P. L. etal. ImmVar project: Insights and design considerations for future studies of ‘healthy’ immune variation. Semin. Immunol. 27, 51-57 (2015).

18. Mclnnes, L., Healy, J. & Melville, J. UMAP: Uniform Manifold Approximation and Projection for Dimension Reduction. arXiv [stat.ML] (2018).

19. Klarquist, J., Zhou, Z., Shen, N. & Janssen, E. M. Dendritic Cells in Systemic Lupus Erythematosus: From Pathogenic Players to Therapeutic Tools. Mediators Inflamm. 2016, 5045248 (2016).

20. Subedi, A., Magder, L. S. & Petri, M. Effect of mycophenolate mofetil on the white blood cell count and the frequency of infection in systemic lupus erythematosus. Rheumatol. Int. 35, 1687-1692 (2015).

21. Yu, D. T. et al. Human lymphocyte subpopulations. Effect of corticosteroids. J. Clin. Invest. 53, 565-571 (1974).

22. Slade, J. D. & Hepburn, B. Prednisone-induced alterations of circulating human lymphocyte subsets. J. Lab. Clin. Med. 101 , 479-487 (1983).

23. Zhu, Z. etal. Causal associations between risk factors and common diseases inferred from GWAS summary data. Nat. Commun. 9, 224 (2018).

24. Bycroft, C. et al. The UK Biobank resource with deep phenotyping and genomic data. Nature 562, 203-209 (2018).

25. Jourdan, M. et al. IL-6 supports the generation of human long-lived plasma cells in combination with either APRIL or stromal cell-soluble factors. Leukemia 28, 1647- 1656 (2014).

26. Stoycheva, D. etal. IFN-g regulates CD8+ memory T cell differentiation and survival in response to weak, but not strong, TCR signals. J. Immunol. 194, 553-559 (2015).

27. Arkatkar, T. et al. B cell-derived IL-6 initiates spontaneous germinal center formation during systemic autoimmunity. J. Exp. Med. 214, 3207-3217 (2017).

28. Blanco, P. et al. Increase in activated CD8+ T lymphocytes expressing perforin and granzyme B correlates with disease activity in patients with systemic lupus erythematosus. Arthritis Rheum. 52, 201-211 (2005).

29. Jelcic, I. et al. Memory B Cells Activate Brain-Homing, Autoreactive CD4+ T Cells in Multiple Sclerosis. Cell 175, 85-100.e23 (2018). 30. Astle, W. J. et al. The Allelic Landscape of Human Blood Cell Trait Variation and Links to Common Complex Disease. Ce// 167, 1415-1429. e19 (2016).

31. Calderon, D. et al. Landscape of stimulation-responsive chromatin across diverse human immune cells. bioRxiv 409722 (2018). doi:10.1101/409722

32. Anderson, C. A. et al. Meta-analysis identifies 29 additional ulcerative colitis risk loci, increasing the number of confirmed associations to 47. Nat. Genet. 43, 246-252 (2011).

33. Calderwood, S. K., Stevenson, M. A. & Murshid, A. Heat shock proteins, autoimmunity, and cancer treatment. Autoimmune Dis. 2012, 486069 (2012).

34. Marquez, A. etal. A combined large-scale meta-analysis identifies COG6 as a novel shared risk locus for rheumatoid arthritis and systemic lupus erythematosus. Ann. Rheum. Dis. 76, 286-294 (2017).

35. Martin, S. et al. Circulating forms of ICAM-3 (clCAM-3). Elevated levels in autoimmune diseases and lack of association with clCAM-1. J. Immunol. 154, 1951-1955 (1995).

36. Pino-Otin, M. R. et al. Existence of a soluble form of CD50 (intercellular adhesion molecule-3) produced upon human lymphocyte activation. Present in normal human serum and levels are increased in the serum of systemic lupus erythematosus patients. J. Immunol. 154, 3015-3024 (1995).

37. Gamazon, E. R. et al. Using an atlas of gene regulation across 44 human tissues to inform complex disease- and trait-associated variation. Nat. Genet. 50, 956-967 (2018).

38. Ye, C. J. et al. Genetic analysis of isoform usage in the human anti-viral response reveals influenza-specific regulation of ERAP2 transcripts under balancing selection. Genome Res. 28, 1812-1825 (2018).

39. Roth, S. H. et al. Increased RNA Editing May Provide a Source for Autoantigens in Systemic Lupus Erythematosus. Cell Rep. 23, 50-57 (2018).

40. Crow, M. K., Olferiev, M. & Kirou, K. A. Identification of Candidate Predictors of Lupus Flare. Trans. Am. Clin. Climatol. Assoc. 126, 184-196 (2015).

41. Petri, M. et al. Derivation and validation of the Systemic Lupus International Collaborating Clinics classification criteria for systemic lupus erythematosus. Arthritis Rheum. 64, 2677-2686 (2012).

42. Kalunian, K. C. et al. A Phase II study of the efficacy and safety of rontalizumab (rhuMAb interferon-a) in patients with systemic lupus erythematosus (ROSE ). Ann. Rheum. Dis. 75, 196-202 (2016). 43. Alert, N. P. R. & T cells, C. A. R. Update on TULIP 1 Phase III trial for anifrolumab in systemic lupus erythematosus.

44. Amissah-Arthur, M. B. & Gordon, C. Contemporary treatment of systemic lupus erythematosus: an update for clinicians. Ther. Adv. Chronic Dis. 1 , 163-175 (2010).

45. Chatham, W. W. & Kimberly, R. P. Treatment of lupus with corticosteroids. Lupus 10, 140-147 (2001).

46. Baechler, E. C. et al. Interferon-inducible gene expression signature in peripheral blood cells of patients with severe lupus. Proc. Natl. Acad. Sci. U. S. A. 100, 2610-2615 (2003).

47. Chan, V. S.-F. etal. Distinct roles of myeloid and plasmacytoid dendritic cells in systemic lupus erythematosus. Autoimmun. Rev. 11 , 890-897 (2012).

48. Shiow, L. R. et al. CD69 acts downstream of interferon-a/b to inhibit S1 P1 and lymphocyte egress from lymphoid organs. Nature 440, 540-544 (2006).

49. Mato, T. et al. Correlation of clonal T cell expansion with disease activity in systemic lupus erythematosus. Int. Immunol. 9, 547-554 (1997).

50. Perl, A. Oxidative stress in the pathology and treatment of systemic lupus erythematosus. Nat. Rev. Rheumatol. 9, 674 (2013).

51. Romano, M., Fanelli, G., Albany, C. J., Giganti, G. & Lombardi, G. Past, Present, and Future of Regulatory T Cell Therapy in Transplantation and Autoimmunity. Front. Immunol. 10, (2019).

52. Walport, M. J., Davies, K. A. & Botto, M. C1q and systemic lupus erythematosus. Immunobiology 199, 265-285 (1998).

53. Siegert, C., Daha, M., Westedt, M. L., van der Voort, E. & Breedveld, F. IgG autoantibodies against C1q are correlated with nephritis, hypocomplementemia, and dsDNA antibodies in systemic lupus erythematosus. J. Rheumatol. 18, 230-234 (1991).

54. Coremans, I. E. etal. Changes in antibodies to C1q predict renal relapses in systemic lupus erythematosus. Am. J. Kidney Dis. 26, 595-601 (1995).

55. Fremeaux-Bacchi, V., Weiss, L., Demouchy, C., Blouin, J. & Kazatchkine, M. D. Autoantibodies to the collagen-like region of C1q are strongly associated with classical pathway-mediated hypocomplementemia in systemic lupus erythematosus. Lupus 5, 216- 220 (1996).

56. Bots, Michael, and Jan Paul Medema. "Granzymes at a glance." Journal of cell science 119.24 (2006): 5011 -5014.

57. Casciola-Rosen, Livia, et al. "Cleavage by granzyme B is strongly predictive of autoantigen status: implications for initiation of autoimmunity." Journal of Experimental Medicine 190.6 (1999): 815-826. 58. Faroudi M, et at. Lytic versus stimulatory synapse in cytotoxic T lymphocyte/target cell interaction: manifestation of a dual activation threshold. Proc Natl Acad Sci USA 2003 ;100: 14145-14150.