Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
METHODS AND USES RELATED TO RETT SYNDROME
Document Type and Number:
WIPO Patent Application WO/2019/010583
Kind Code:
A1
Abstract:
Methods and uses for treating a neurodevelopmental disorder such as Rett Syndrome are provided. In particular, the present disclosure provides methods and uses relating to treating a subject with the neurodevelopmental disorder by targeting CtIP activity and/or expression. The present disclosure further provides methods and uses of at least one inhibitor that targets CtIP activity and/or expression in the brain and/or liver to the subject in need thereof.

Inventors:
JUSTICE MONICA (CA)
ENIKANOLAIYE ADEBOLA (CA)
Application Number:
PCT/CA2018/050856
Publication Date:
January 17, 2019
Filing Date:
July 13, 2018
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
HOSPITAL FOR SICK CHILDREN (CA)
International Classes:
A61K38/46; A61K31/44; A61K31/713; A61P1/16; A61P3/00; A61P5/50; A61P25/00; C07D213/73; C12N9/22; C12N15/113
Domestic Patent References:
WO2007094818A22007-08-23
Foreign References:
US20160199437A12016-07-14
Other References:
MAKHARASHVILI, N. ET AL.: "CtIP: A DNA damage response protein at the intersection of DNA metabolism", DNA REPAIR, vol. 32, 2015, pages 75 - 81, ISSN: 1568-7864
WANG, H.: "The interaction of CtIP and Nbsl connects CDK and ATM to regulate HR -mediated double-strand break repair", P LOS GENETICS, vol. 9, no. 2, 2013, pages e1003277, ISSN: 1553-7404
KYLE, S.M.: "MeCP2 co-ordinates liver lipid metabolism with the NCoR1/HDAC3 corepressor complex", HUMAN MOLECULAR GENETICS, vol. 25, 2016, pages 3029 - 3041, XP055567286, ISSN: 0964-6906
LIN, Z.P. ET AL.: "Triapine disrupts CtIP-mediated homologous recombination repair and sensitizes ovarian cancer cells to PARP and topoisomerase inhibitors", MOLECULAR CANCER RESEARCH, vol. 12, 2014, pages 381 - 393, XP055227290, ISSN: 1541-7786
Attorney, Agent or Firm:
BERESKIN & PARR LLP/S.E.N.C.R.L., S.R.L. (40th FloorToronto, Ontario M5H 3Y2, CA)
Download PDF:
Claims:
CLAIMS:

1 . A use of at least one inhibitor that targets Ctl P activity and/or expression in the brain for treating a subject with a non-cancer neurodevelopmental disorder associated with dysregulation in Ctl P-associated pathway. 2. The use of claim 1 , wherein the neurodevelopmental disorder comprises MECP2-associated disease, disorder, or condition.

3. The use of claim 1 , wherein the neurodevelopmental disorder comprises Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome or Friedrich's ataxia. 4. The use of claim 2, wherein the MECP2-associated disease, disorder, or condition comprises Rett Syndrome.

5. The use of any one of claims 1 -4, wherein the inhibitor targets CtIP activity.

6. The use of any one of claims 1 -5, wherein the inhibitor that targets CtIP activity comprises Triapine.

7. The use of any one of claims 1 -5, wherein the inhibitor that targets CtIP activity comprises an inhibitor of ATR kinase activity.

8. The use of claim 7, wherein the inhibitor of ATR kinase activity comprises VE-821 or VX-970/VE-822. 9. The use of any one of claims 1 -4, wherein the inhibitor comprises at least one siRNA or shRNA molecule that inhibits expression of a CtIP.

10. The use of claim 9, wherein the siRNA comprises a sequence as shown in SEQ ID NO: 1 .

1 1 . The use of claim 9, wherein the shRNA comprises a sequence as shown in SEQ ID NO: 1 .

12. The use of any one of claims 1 -4, wherein the inhibitor comprises at least one antisense oligonucleotide molecule that targets CtlP.

13. The use of claim 12, wherein the antisense oligonucleotide molecule comprises any one of SEQ ID NOs: 2-10. 14. The use of any one of claims 1 -4, wherein the inhibitor comprises a CRISPR-Cas9 complex to modulate transcriptional activity at the endogenous CtlP locus.

15. The use of claim 14, wherein the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA). 16. The use of any one of claims 1 -15, where the subject is human.

17. The use of any one of claims 1 -16, wherein the at least one inhibitor is used at least once per day.

18. The use of any one of claims 1 -16, wherein the at least one inhibitor is used at least once per week. 19. The use of any one of claims 1 -16, wherein the at least one inhibitor is used at least twice per week.

20. The use of any one of claims 1 -16, wherein the at least one inhibitor is used at least four times per two weeks.

21 . The use of any one of claims 1 -20, wherein the at least one inhibitor is used subcutaneously, intraperitoneally, intravenously, or orally.

22. The use of any one of claims 1 -21 , wherein the effect of the at least one inhibitor is assessed by measuring homologous recombination frequency in cells.

23. A use of at least one inhibitor that targets CtIP activity and/or expression in the liver for treating a subject with MECP2-associated disease, disorder, or condition.

24. The use of claim 23, wherein the MECP2-associated disease, disorder, or condition comprises fatty liver disease, metabolic syndrome and/or insulin resistance.

25. The use of claim 23 or 24, wherein the inhibitor targets CtIP activity.

26. The use of any one of claims 23-25, wherein the inhibitor that targets CtIP activity comprises Triapine. 27. The use of any one of claims 23-25, wherein the inhibitor that targets CtIP activity comprises an inhibitor of ATR kinase activity.

28. The use of claim 27, wherein the inhibitor of ATR kinase activity comprises VE-821 or VX-970/VE-822.

29. The use of claim 23 or 24, wherein the inhibitor comprises at least one siRNA or shRNA molecule that inhibits expression of a CtIP.

30. The use of claim 29, wherein the siRNA comprises a sequence as shown in SEQ ID NO: 1 .

31 . The use of claim 30, wherein the shRNA comprises a sequence as shown in SEQ ID NO: 1 . 32. The use of claim 23 or 24, wherein the inhibitor comprises at least one antisense oligonucleotide molecule that targets CtIP.

33. The use of claim 32, wherein the antisense oligonucleotide molecule comprises any one of SEQ ID NOs: 2-10.

34. The use of claim 23 or 24, wherein the inhibitor comprises a CRISPR- Cas9 complex to modulate transcriptional activity at the endogenous CtIP locus.

35. The use of claim 34, wherein the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA).

36. The use of any one of claims 23-35, where the subject is human.

37. The use of any one of claims 23-36, wherein the at least one inhibitor is used at least once per day.

38. The use of any one of claims 23-36 wherein the at least one inhibitor is used at least once per week.

39. The use of any one of claims 23-36, wherein the at least one inhibitor is used at least twice per week.

40. The use of any one of claims 23-36, wherein the at least one inhibitor is used at least four times per two weeks. 41 . The use of any one of claims 23-40, wherein the at least one inhibitor is used subcutaneously, intraperitoneally, intravenously, or orally.

42. The use of any one of claims 23-41 , wherein the effect of the at least one inhibitor is assessed by measuring homologous recombination frequency in cells.

Description:
TITLE: METHODS AND USES RELATED TO RETT SYNDROME

CROSS-REFERENCE TO RELATED APPLICATION

[0001] The present application claims the benefit of priority from U.S. Provisional Application No. 62/532,438 filed on July 14, 2017, which is incorporated herein by reference in its entirety.

FIELD

[0002] The present disclosure relates to novel methods and uses for treating neurodevelopmental disorders associated with defects in DNA repair pathways, such as Rett Syndrome. In particular, the present disclosure relates to treating neurodevelopmental disorders by targeting the CtBP binding protein (CtlP)-associated pathway.

BACKGROUND

[0003] Double stranded breaks (DSBs) amassed over time are detrimental to neuronal development and maintenance because the phosphate backbones of both strands are broken leaving the cell vulnerable to further physical and chemical assault and resulting in lost or damaged bases, the formation of abnormal DNA structures or apoptosis. Although such DNA damage is commonly associated with cancer, the developing nervous system is also particularly susceptible to defects in DNA repair because unrepaired lesions can have huge effects on the formation of the nervous system. The cell has developed various repair pathways to combat this kind of DNA damage. Defects in any of the pathways that affect DNA repair can lead to noncancerous diseases that have neurological symptoms, including Immunodeficiency with microcephaly Ligase IV syndrome, Ataxia Telangiectasia (A-T) and its associated A-T like disorder, ataxia with oculomotor apraxia 1 (AOA1 ), Nijmegen breakage Syndrome (NBS), spinocerebellar ataxia with axonal neuropathy (SCAN1 ), Fragile X syndrome, Friedrich's ataxia and other neurodevelopmental disorders. Most of these diseases result from single gene mutations in DNA damage repair genes and have intersecting but also distinct sets of clinical phenotypes (Jackson and Bartek, 2009;Madabhushi et al., 2014;McKinnon, 2013). These disorders constitute neurodevelopmental disorders that do not involve neurodegeneration or neuronal death.

[0004] Although both in vitro and mouse studies have provided insight into these diseases, understanding how DNA repair pathways function to preserve genomic stability in the brain remains a challenge. One promising approach is to identify modifying genes which point to novel pathways that reverse or prevent progression of symptoms and can serve as rational therapeutic targets.

[0005] Rett Syndrome (RTT) is an X-linked progressive neurodevelopmental disorder caused by mutations in methyl-CpG binding protein 2 (MECP2). While boys with MECP2 mutations die at birth, girls affected with RTT suffer loss of speech and motor skills at about 6-24 months of age. While there are a few documented cases of girls homozygous for the MECP2 mutation, the vast majority are heterozygous. Note that random X-chromosome inactivation leads to phenotypic variability in girls. Boys that carry a mutation in MECP2 commonly die at birth, therefore, most mutations that have a large impact on the protein arise de novo in the parental germline.

[0006] Other symptoms include stereotypic hand movements, difficulty walking, sporadic episodes of rapid respiration, apnoea and seizures (Amir et al., 1999;Bienvenu and Chelly, 2006). Lifespan and severity of disease may vary and there are no cures for RTT. Mouse models that carry Mecp2 mutations closely recapitulate most RTT symptoms. Although Rett syndrome is a disease primarily of girls, Mecp2/Y male mice are the primary model, because they have completely penetrant symptoms that are early onset. Mecp2/Y male mice are Mecp2-null and the terms are used herein interchangeably. Mecp2/Y males are normal until 35 days of age after which they start to develop symptoms such as hypo-activity, limb clasping, tremors, motor impairment and abnormal breathing. These symptoms progress in their severity, eventually leading to death by 6-16 weeks of age (Guy et al., 2001 ). Female mice start to develop symptoms by five months of age and their symptoms vary widely due to random X-chromosome inactivation. [0007] Increased L1 neuronal transcription and retrotransposition are reported in neurons (Muotri et al., 2010). Retrotransposons can increase genomic instability causing insertions and deletions among other things, but can also be a secondary effect of double stranded breaks in DNA. Alternatively, increased retrotransposition can be caused by accessible chromatin, as may be present in Mecp2/Y mice. In addition, studies in non-neuronal cells show that loss of MECP2 is associated with hypomethylation and impaired DNA damage repair (Squillaro et al. , 2010). Therefore, the incidence, cause and effect of genomic instability in RTT neurons is poorly understood.

[0008] CtIP, a DNA exonuclease initially identified as a binding partner for CtBP and tumour suppressor proteins RB1 and BRCA1 , is a critical factor in the repair of DNA DSBs (Wong et al., 1998;Yu et al., 1998). DSBs are repaired by three main pathways, namely Homologous Recombination (HR), Microhomology Mediated End Joining (MMEJ) and Non-Homologous End Joining (NHEJ). While HR occurs during S and G2 phase where sister chromatid sequences are used as templates for accurate repair, MMEJ and NHEJ occur primarily during the GO and G1 phase where broken DNA ends are ligated without requiring significant sequence complementarity (Huertas, 2010; Jackson and Bartek, 2009;Symington and Gautier, 201 1 ). The major event that controls which pathway will be employed to repair DSBs is DNA resection. DNA resection is 5'-to-3' nucleolytic degradation of DNA at the site of the break, leading to the exposure of 3' single-strand DNA tails required for strand invasion. Once DNA resection begins, NHEJ is inhibited and cells are committed to HR and MMEJ. CtIP is a regulator of DNA resection and DSB pathway choice (Huertas, 2010;Makharashvili et al., 2014;Sartori et al., 2007).

SUMMARY

[0009] The present disclosure shows that CtIP levels are elevated in Mecp2/Y brain and liver, and DSB-mediated activation of critical early response neuronal genes is attenuated. Together these findings point to perturbations of the DSB pathways. The use of Triapine and ATR inhibitors VE-821 and VX- 970/VE-822 to attenuate the activity of CtIP in the Mecp2-null (in males also referred to as Mecp2/Y) brain may help to alleviate not only RTT symptoms but also may be used to treat other neurodevelopmental diseases in which perturbations of the DSB repair pathways have been implicated. Moreover, siRNA, shRNA, antisense or CRISPR-mediated knockdown of CtIP may be beneficial.

[0010] Accordingly, the present disclosure provides a method of treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtI P activity and/or expression in the brain to the subject in need thereof. Also provided is use of at least one inhibitor that targets CtIP activity and/or expression in the brain for treating a subject with a neurodevelopmental disorder associated with dysregulation in Ctl P-associated pathway. Also provided is use of at least one inhibitor that targets CtIP activity and/or expression in the brain in the manufacture of a medicament for treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway. Even further provided is at least one inhibitor that targets CtIP activity and/or expression in the brain for use in treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP- associated pathway.

[0011] In an embodiment, the neurodevelopmental disorder is not a cancer.

[0012] In another embodiment, the neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway is a MECP2- associated disease, disorder, or condition. In another embodiment, the neurodevelopmental disorder is Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome or Friedrich's ataxia. In a specific embodiment, the neurodevelopmental disorder is Rett Syndrome.

[0013] The present disclosure further provides a method of treating a subject with a MECP2-associated disease, disorder, or condition with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtIP activity and/or expression in the liver to the subject in need thereof. In an embodiment, the MECP2-associated disease, disorder, or condition is fatty liver disease, metabolic syndrome and/or insulin resistance.

[0014] In one embodiment, the inhibitor targets CtIP activity. In a particular embodiment, the inhibitor that targets CtIP activity comprises Triapine. In another embodiment, the inhibitor that targets CtIP activity comprises an ATR inhibitor. In a specific embodiment, the ATR inhibitor is VE- 821 or VX-970/VE-822.

[0015] In an embodiment, the inhibitor comprises at least one siRNA or shRNA molecule that inhibits expression of CtIP. In one embodiment, the siRNA comprises the sequence 5'- GCUAAAACAGGAACGAAUC-3' (SEQ ID NO: 1 ). In another embodiment, the shRNA comprises the sequence 5'- GCUAAAACAGGAACGAAUC-3' (SEQ ID NO: 1 ).

[0016] In one embodiment, the inhibitor comprises at least one antisense oligonucleotide molecule directed to mouse CtIP. In one embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- CTTCCACAGCCGCTTCCTGA-3' (SEQ ID NO: 2). In another embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- TTACCAGGCTTCACCCTTCT-3' (SEQ ID NO: 3). In another embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- TCTTTGGATTGTTGAAATAC-3' (SEQ ID NO: 4). In yet another embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- AGGACAGCTGTGCTTTCATT-3' (SEQ ID NO: 5). In a further embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- GAAGCTGGGAAAGAAAATGA-3' (SEQ ID NO: 6).

[0017] In another embodiment, the inhibitor comprises at least one antisense oligonucleotide molecule directed to human CtIP. In one embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- CTTCCACAGCTGCTTCCCG-3'(SEQ ID NO: 7). In another embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- TTAATATGCTCCACACTTCT -3' (SEQ ID NO: 8). In a further embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- TCTTTGGACAGGTCAAATAC -3'(SEQ ID NO: 9). In another embodiment, the antisense oligonucleotide molecule comprises the sequence 5'- CCCAGATATCCTCATTTACC -3' (SEQ ID NO: 10). In another embodiment, the antisense oligonucleotide molecule comprises the sequence ASO 3: 5'- GGGGAAGGAAAGAATAAGGA -3' (SEQ I D NO: 1 1 ).

[0018] In another embodiment, the inhibitor comprises a CRISPR-Cas9 complex to modulate transcriptional activity at the endogenous CtIP locus. In a specific embodiment, the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA) that targets CtIP. In one embodiment, the synthetic sgRNA comprises the sequences 5'- CCACGTTTGGCAGATAGCTTCTCCC-3' (SEQ ID NO: 15) and 5'- AAACGGGAGAAGCTATCTGCCAAAC-3' (SEQ ID NO: 16). In another embodiment, the synthetic sgRNA comprises the sequences 5'- CCACGCTTCTCCCAGGTACCAGATG-3' (SEQ I D NO: 17) and 5'- AAACCATCTGGTACCTGGGAGAAGC-3' (SEQ ID NO: 18).

[0019] In an embodiment, the subject is human.

[0020] In one embodiment, the at least one inhibitor is administered at least once per day. In an embodiment, the at least one inhibitor is administered at least once per week. In another embodiment, the at least one inhibitor is administered at least twice per week. In a further embodiment, the at least inhibitor is administered at least four times per two weeks.

[0021] In another embodiment, the at least one inhibitor is administered subcutaneously, intraperitoneally, intravenously, or orally.

[0022] In a further embodiment, the effect of the at least one inhibitor is assessed by measuring homologous recombination frequency in cells.

[0023] Other features and advantages of the present disclosure will become apparent from the following detailed description. It should be understood, however, that the detailed description and the specific Examples while indicating preferred embodiments of the disclosure are given by way of illustration only, since various changes and modifications within the spirit and scope of the disclosure will become apparent to those skilled in the art from this detailed description.

BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Embodiments are described below in relation to the drawings in which:

[0025] Figure 1 shows CtIP is required for DNA Resection. DSBs are initially detected by sensor complexes called the Mre1 1 -Rad50-Nbs1 (MRN) complex, leading to the activation of the ATM kinase and subsequent phosphorylation of several downstream targets such as H2AX. CtI P is recruited to the site of the damage in a BRCA1 -dependent manner to carry out the initial 5' to 3' resection of DNA. Extensive resection carried out by EXO to generate a 3' single stranded tail, which is then coated and stabilized by the single stranded binding protein RPA. Another kinase ATR is recruited and it hyper- phosphorylates more target proteins including RPA2. RPA is exchanged for RAD51 recombinase with the help of Brca2 to form a nucleoprotein filament, which initiates strand invasion of a homologous DNA duplex (adapted from (Chowdhury et al., 2013)).

[0026] Figure 2 shows that a nonsense codon mutation in CtIP improves longevity in the Mecp2/Y background. A. The ENU-induced nonsense mutation occurs at position p.Q743X within the critical C-terminal domain of the mouse CtIP gene leading to a truncated protein. B. A percent survival curve shows improved longevity of mice carrying the CtIP suppressor mutation in the Mecp2/Y background (N = 23) when compared to control Mecp2/Y mice alone (N = 74).

[0027] Figure 3 (A. and B.) shows Mecp2/Y CtIP suppressor mutant is poorly expressed in vitro. Transcript and protein levels of mutant CtIP were very low in Neuroblastoma (Neuro2A) cells. While mutant transcript levels were comparable to wildtype levels in human osteosarcoma (U20S) cells, mutant CtIP protein was poorly expressed. *p<0.05, wt = wildtype, mt = mutant.

[0028] Figure 4 shows double strand break repair genes are modulated in Mecp2/Y mouse brain. A. Transcript levels of DSB repair genes CtIP, Brcal and Brca2 are unchanged at pre-symptomatic time point of 4 weeks, however by the post-symptomatic time point of 8 weeks, CtIP transcripts are increased. B. Homologous recombination genes NBS1 and ATR are also increased in the Mecp2/Y brain while 53BP1, a gene implicated in non-homologous end joining is decreased. *p<0.05, #p<0.01 . wildtype (+/Y) N = 3, Mecp2/Y N = 3. All error bars represent SEM.

[0029] Figure 5 shows increased levels of DSB repair protein γΗ2ΑΧ, in Mecp2/Y neurons treated with DSB-inducing agent neocarzinostatin (NCS) (200ng/ml_ for 3 hours). A. Immunofluorescence analysis shows more γΗ2ΑΧ foci in neuronal cells isolated from Mecp2/Y E15.5 mouse cortex. B. Quantification of number of foci per cell shows Mecp2/Y neurons have more foci per cells than wildtype (+/Y) controls. p<0.0001 . wildtype (+/Y) N=3, Mecp2/Y N=4.

[0030] Figure 6 shows double strand break repair proteins are modulated in Mecp2/Y mouse liver. Western blot of Mecp2/Y liver tissue shows increased CtIP and γΗ2ΑΧ protein levels when compared to wildtype (+/Y).

[0031] Figure 7 shows CtIP suppressor mutation leads to decreased homologous recombination (HR) frequency. A. Western blot showing siRNA knockdown of CtIP (siCtIP) while a non-targeting control siRNA (siCTRL) has no effect on CtIP levels. B. Representative western blot showing over- expression of siRNA-resistant wild-type in the presence of siRNA knockdown of endogenous CtIP (siCtIP). The mutant suppressor CtIP protein however, is not expressed under the same conditions. C. HR frequency, as determined by the DR-GFP assay in U20S cells transfected with a non-targeting siRNA (siCTRL) or siRNA against CtIP (siCtIP) in the presence of wild-type CtIP or mutant CtIP. The results of each assay were normalized to the non-targeting siRNA (siCTRL). Data are presented as mean ± SEM where each bar represents the mean of three independent experiments. *p<0.05, wt = wildtype, mt = mutant. D. HR frequency, as measured by the DR-GFP assay in mouse embryonic fibroblasts (MEFs) isolated from WT and Mecp2/Y E15.5 embryos, stably expressing the DR-GFP plasmid. Data are represented as mean SEM where each bar represents the mean of three independent experiments. *p<0.05, Mecp2/Y-1 = Mecp2/Y DR-GFP clone 1 and Mecp2/Y-2 = Mecp2/Y DR-GFP clone 2.

[0032] Figure 8 (A. and B.) shows that neuronal early response genes are modulated in Mecp2/Y mouse brain. Transcript levels of neuronal early response genes, c-Fos, Fos-b, Nsapa4 and Egr1 are reduced as early as 4 weeks in the Mecp2/Y brains. *p<0.05. wildtype N = 3, Mecp2/Y N = 3. All error bars represent SEM.

DETAILED DESCRIPTION

[0033] Unless otherwise indicated, the definitions and embodiments described in this and other sections are intended to be applicable to all embodiments and aspects of the present disclosure herein described for which they are suitable as would be understood by a person skilled in the art.

[0034] In understanding the scope of the present disclosure, the term "comprising" and its derivatives, as used herein, are intended to be open ended terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but do not exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The foregoing also applies to words having similar meanings such as the terms, "including", "having" and their derivatives. The term "consisting" and its derivatives, as used herein, are intended to be closed terms that specify the presence of the stated features, elements, components, groups, integers, and/or steps, but exclude the presence of other unstated features, elements, components, groups, integers and/or steps. The term "consisting essentially of", as used herein, is intended to specify the presence of the stated features, elements, components, groups, integers, and/or steps as well as those that do not materially affect the basic and novel characteristic(s) of features, elements, components, groups, integers, and/or steps.

[0035] As used herein, the singular forms "a", "an" and "the" include plural references unless the content clearly dictates otherwise. [0036] The term "treating" and its derivatives, as used herein, refer to improving the condition, such as reducing or alleviating symptoms associated with the condition or improving the prognosis or survival of the subject.

[0037] The present inventors have identified CtlP-associated pathway as a target for treatment for a neurodevelopmental disorder, such as Rett Syndrome. CtlP-associated pathway is in involved in DNA damage and repair, which have not previously been implicated in RTT. However, there is evidence for a role for DNA damage and repair in other neurodevelopmental diseases such as Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome and Friedrich's ataxia.

[0038] Accordingly, herein provided is a method of treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP- associated pathway comprising administering at least one inhibitor that targets CtIP activity and/or expression to the subject in need thereof. Also provided herein is use of at least one inhibitor that targets CtIP activity and/or expression for treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway. Further provided is use of at least one inhibitor that targets CtIP activity and/or expression in the manufacture of a medicament for treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway. Even further provided is at least one inhibitor that targets CtIP activity and/or expression for use in treating a subject with a neurodevelopmental disorder associated with dysregulation in CtlP-associated pathway.

[0039] The term "neurodevelopmental disorder" or its derivative, as used herein, refers to or describes a disease or disorder of the developing central and/or peripheral nervous system in mammals. Examples of neurodevelopmental disorders associated with defects in DNA repair pathways, such as defects in homologous recombination, are Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome and Friedrich's ataxia. Further, the neurodevelopmental disorder includes a MECP2-associated disease, disorder, or condition such as Rett Syndrome. The term "neurodevelopmental disorder" does not include disorders that involve neurodegeneration or neuronal death, such as Alzheimer's disease.

[0040] Accordingly, in one embodiment, the neurodevelopmental disorder is a MECP2-associated disease, disorder, or condition. In another embodiment, the neurodevelopmental disorder is Rett Syndrome, Ataxia telangiectasia, Nijmegen breakage syndrome, Fragile X syndrome or Friedrich's ataxia. In a specific embodiment, the neurodevelopmental disorder is Rett Syndrome.

[0041] In another embodiment, the neurodevelopmental disorder is not a cancer. In another embodiment, the neurodevelopmental disorder is a non- cancer neurodevelopmental disorder.

[0042] The present disclosure further provides a method of treating a subject with a MECP2-associated disease, disorder, or condition with dysregulation in CtlP-associated pathway comprising using or administering at least one inhibitor that targets CtIP activity and/or expression in the liver to the subject in need thereof. In an embodiment, the MECP2-associated disease, disorder, or condition is fatty liver disease, metabolic syndrome and/or insulin resistance.

[0043] The term "inhibitor" and its derivatives, as used herein, refers to an agent that reduces, decreases, or otherwise blocks expression or activity of its target, and includes any substance that is capable of inhibiting the expression or activity of the target and includes, without limitation, small molecules, antisense oligonucleotide molecules (antisense nucleic acid molecules), siRNAs or shRNAs, aptamers, proteins, antibodies (and fragments thereof), gene editing agents and other substances directed at the target expression or activity.

[0044] The term "CtIP" as used herein refers to the carboxy-terminal binding protein (CTBP) interacting protein, which is also known as the retinoblastoma-binding protein 8 (RBBP8) (GenBank Accession Nos. NC_000084 (mouse) and NG_012121 (human); OMIM No 604124). [0045] The term "CtIP activity and/or expression" and its derivatives, as used herein, refers to transcriptional, translational, functional and/or enzymatic activity, and/or protein and/or mRNA expression, involving CtIP and components of CtlP-associated pathway, such as ATR, which phosphorylates CtIP. CtIP activity includes DNA resection, DSB repair, homologous recombination, and/or ATR kinase activity.

[0046] The terms "CtIP dysregulation", "dysregulation in CtlP-associated pathway" and their derivatives, as used herein, are intended to encompass any aberration, perturbation, impairment, and/or abnormality in CtIP and/or CtlP- associated pathway that enhances CtIP activity and/or expression as compared to a comparable normal reference or control.

[0047] The term "CtIP inhibitor" and its derivatives, as used herein, refers to an agent whose presence, level, state and/or form correlates with a reduction in CtIP level and/or activity. That is, observed CtIP level and/or activity is detectably lower in the presence of the agent (or when the agent is at a particular level, or in a particular state or form) as compared to its absence and/or as compared to a comparable reference.

[0048] Accordingly, in an embodiment, the inhibitor is an inhibitor of CtlP- associated activity and/or expression.

[0049] Phosphorylation of CtIP is necessary for its activation and Triapine (CAS No. 236392-56-6) is an inhibitor of ribonucleotide reductase that blocks the phosphorylation of CtIP. The term "Triapine" as used herein refer to a compound having the following chemical structure:

[0050] Accordingly, in an embodiment, the inhibitor is Triapine. [0051] In another embodiment, the inhibitor that targets CtIP activity and/or expression comprises inhibitors of ATR kinase activity.

[0052] The term "ATR" as used herein refers to ataxia telangiectasia and Rad3-related protein, which is also known as Serine/threonine kinase ATR or FRAP-related protein 1 (FRP1 ) (GenBank Accession Nos. NC_000075 (mouse) and NG_008951 (human); OMIM No 601215).

[0053] The term "ATR inhibitor" and its derivatives, as used herein, refers to an agent whose presence, level, state and/or form correlates with a reduction in ATR kinase activity. That is, observed ATR kinase activity is detectably lower in the presence of the agent (or when the agent is at a particular level, or in a particular state or form) as compared to its absence and/or as compared to a comparable reference.

[0054] ATR is responsible for the transduction of signals from the DSB sensor complexes. VE-821 (CAS No. 1232410-49-9) and VX-970/VE-822 (CAS No. 1232416-25-9) are ATR inhibitors.

[0055] The term "VE-821 " as used herein refer to a compound having the following chemical structure:

[0056] The term "VX-970" or "VE-822" as used herein refer to a compound having the following chemical structure:

[0057] Accordingly, in another embodiment, the inhibitor is an ATR inhibitor. In a specific embodiment, the ATR inhibitor is VE-821 or VX-970/VE- 822.

[0058] Aptamers are short strands of nucleic acids that can adopt highly specific 3-dimensional conformations. Aptamers can exhibit high binding affinity and specificity to a target molecule. These properties allow such molecules to specifically inhibit the functional activity of proteins and are included as agents that inhibit CtIP and ATR kinase activity. Accordingly, in another embodiment, the inhibitor is an aptamer that inhibits CtIP or ATR kinase activity.

[0059] The inhibitors described herein may also contain or be used to obtain or design "peptide mimetics". For example, a peptide mimetic may be made to mimic the function of an inhibitor. "Peptide mimetics" are structures which serve as substitutes for peptides in interactions between molecules (Morgan and Gainor, 1989). Peptide mimetics include synthetic structures which may or may not contain amino acids and/or peptide bonds but retain the structural and functional features. Peptide mimetics also include molecules incorporating peptides into larger molecules with other functional elements. Peptide mimetics also include peptoids, oligopeptoids (Simon et ai, 1972) and peptide libraries containing peptides of a designed length representing all possible sequences of amino acids corresponding to an inhibitor peptide disclosed herein.

[0060] Peptide mimetics may be designed based on information obtained by systematic replacement of L-amino acids by D-amino acids, replacement of side chains with groups having different electronic properties, and by systematic replacement of peptide bonds with amide bond replacements. Local conformational constraints can also be introduced to determine conformational requirements for activity of a candidate peptide mimetic. The mimetics may include isosteric amide bonds, or D-amino acids to stabilize or promote reverse turn conformations and to help stabilize the molecule. Cyclic amino acid analogues may be used to constrain amino acid residues to particular conformational states. The mimetics can also include mimics of the secondary structures of the proteins described herein . These structures can model the 3-dimensional orientation of amino acid residues into the known secondary conformations of proteins. Peptoids may also be used which are oligomers of N-substituted amino acids and can be used as motifs for the generation of chemically diverse libraries of novel molecules.

[0061 ] The term "nucleic acid molecule" and its derivatives, as used herein, are intended to include unmodified DNA or RNA or modified DNA or RNA. For example, the nucleic acid molecules or polynucleotides of the disclosure can be composed of single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, and RNA that is a mixture of single- and double-stranded regions, hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically double-stranded or a mixture of single- and double-stranded regions. In addition, the nucleic acid molecules can be composed of triple-stranded regions comprising RNA or DNA or both RNA and DNA. The nucleic acid molecules of the disclosure may also contain one or more modified bases or DNA or RNA backbones modified for stability or for other reasons. "Modified" bases include, for example, tritiated bases and unusual bases such as inosine. A variety of modifications can be made to DNA and RNA; thus "nucleic acid molecule" embraces chemically, enzymatically, or metabolically modified forms. The term "polynucleotide" shall have a corresponding meaning.

[0062] The term "siRNA" refers to a short inhibitory RNA that can be used to silence gene expression of a specific gene. The siRNA can be a short RNA hairpin (e.g. shRNA) that activates a cellular degradation pathway directed at mRNAs corresponding to the siRNA. Methods of designing specific siRNA molecules or shRNA molecules and administering them are known to a person skilled in the art. It is known in the art that efficient silencing is obtained with siRNA duplex complexes paired to have a two nucleotide 3' overhang. Adding two thymidine nucleotides is thought to add nuclease resistance. A person skilled in the art will recognize that other nucleotides can also be added.

[0063] Accordingly, in another embodiment, the inhibitor is at least one siRNA or shRNA molecule that inhibits expression of Ctl P. In a specific embodiment, the siRNA has a sequence as shown in SEQ ID NO: 1 . In another specific embodiment, the shRNA has a sequence as shown in SEQ I D NO: 1 .

[0064] The term "antisense oligonucleotide" or "antisense nucleic acid" and its derivatives, as used herein, mean a nucleotide sequence that is complementary to its target transcription product. The nucleic acid can comprise DNA, RNA or a chemical analog that binds to the messenger RNA produced by the target gene. Binding of the antisense oligonucleotide prevents translation and thereby inhibits or reduces target protein expression. Antisense oligonucleotide molecules may be chemically synthesized using naturally occurring nucleotides or variously modified nucleotides designed to increase the biological stability of the molecules or to increase the physical stability of the duplex formed with mRNA or the native gene e.g. phosphorothioate derivatives and acridine substituted nucleotides. The antisense sequences may be produced biologically using an expression vector introduced into cells in the form of a recombinant plasmid, phagemid or attenuated virus in which antisense sequences are produced under the control of a high efficiency regulatory region, the activity of which may be determined by the cell type into which the vector is introduced. Accordingly, in one embodiment, the inhibitor is at least one antisense oligonucleotide molecule that is complementary to Ctl P, for example human or mouse CtlP. In a specific embodiment, the antisense oligonucleotide molecule has a sequence as shown in any one of SEQ ID NOs: 2-1 1 .

[0065] The term "gene" and its derivatives, as used herein, refer to a genomic DNA sequence that comprises a coding sequence associated with the production of a polypeptide or polynucleotide product (e.g., rRNA, tRNA). [0066] The term "gene editing agents" and its derivatives, as used herein, refer to Cre recombinases, CRISPR-Cas9 complex, TALE transcriptional activators, Cas9 nucleases, nickases, transcriptional regulators or combinations thereof. In an embodiment, the inhibitor comprises a CRISPR- Cas9 complex to modulate transcriptional activity at the endogenous CtIP locus. In a specific embodiment, the CRISPR-Cas9 complex comprises Cas9 nuclease complexed with a synthetic single guide RNA (sgRNA) that targets CtIP. In another specific embodiment, the synthetic sgRNA comprises the sequences 5'-CCACGTTTGGCAGATAGCTTCTCCC-3' (SEQ ID NO: 15) and 5'-AAACGGGAGAAGCTATCTGCCAAAC-3' (SEQ ID NO: 16). In another specific embodiment, the synthetic sgRNA comprises the sequences 5'- CCACGCTTCTCCCAGGTACCAGATG-3' (SEQ I D NO: 17) and 5'- AAACCATCTGGTACCTGGGAGAAGC-3' (SEQ ID NO: 18).

[0067] The corresponding CtIP mutation in humans is a p.Q746X mutation and the corresponding nucleotide change is c.2236C>T. Accordingly, to design suitable sgRNAs for use in humans, an input sequence surrounding the region of interest (1 kb) can be entered into an online CRISPR design tool such as http://crispr.mit.edu:8079/?, http://crispr.mit.edu/v2, or http://crispor.tefor.net/, as described in Hsu et ai, 2013 and Haeussler et ai, 2016. Such software identifies suitable sgRNAs, ranks them and predicts off- targets sites. Alternatively, guide sequences can be manually selected by identifying the 20-bp "protospacer sequence" directly upstream of any 5'NGG sequence ("protospacer adjacent motif" or PAM) around the sequence of interest, as described in Ran et ai, 2013.

[0068] The term "subject" as used herein refers to any member of the animal kingdom, optionally, a human. In an embodiment, the subject is human.

[0069] The inhibitor of the present disclosure may be formulated into a pharmaceutical composition, such as by mixing with a suitable excipient, carrier, and/or diluent, by using techniques that are known in the art. For example, the inhibitor can be used or administered in the form of tablets, capsules, ovules, elixirs, solutions or suspensions, which may contain flavouring or colouring agents, for immediate-, delayed-, modified-, sustained-, pulsed- or controlled-release applications.

[0070] The tablets may contain excipients such as microcrystalline cellulose, lactose, sodium citrate, calcium carbonate, dibasic calcium phosphate and glycine, disintegrants such as starch (preferably corn, potato or tapioca starch), sodium starch glycollate, croscarmellose sodium and certain complex silicates, and granulation binders such as polyvinylpyrrolidone, hydroxypropylmethylcellulose (HPMC), hydroxypropylcellulose (HPC), sucrose, gelatin and acacia. Additionally, lubricating agents such as magnesium stearate, stearic acid, glyceryl behenate and talc may be included.

[0071] Solid compositions of a similar type may also be employed as fillers in gelatin capsules. Preferred excipients in this regard include lactose, starch, a cellulose, milk sugar or high molecular weight polyethylene glycols. For aqueous suspensions and/or elixirs, the inhibitor may be combined with various sweetening or flavouring agents, colouring matter or dyes, with emulsifying and/or suspending agents and with diluents such as water, ethanol, propylene glycol and glycerin, and combinations thereof.

[0072] As used herein, the term "pharmaceutically acceptable carrier" is intended to include any and all solvents, dispersion media, coatings, isotonic and absorption delaying agents, and the like, compatible with pharmaceutical use or administration. Suitable carriers are described in the most recent edition of Remington's Pharmaceutical Sciences, a standard reference text in the field, which is incorporated herein by reference. Optional examples of such carriers or diluents include, but are not limited to, water, saline, ringer's solutions, dextrose solution, and 5% human serum albumin.

[0073] In one embodiment, the active ingredient is prepared with a carrier that will protect it against rapid elimination from the body, such as a sustained/controlled release formulation, including implants and microencapsulated delivery systems. Biodegradable, biocompatible polymers can be used, such as ethylene vinyl acetate, polyanhydrides, polyglycolic acid, collagen, polyorthoesters, and polylactic acid. Methods for preparation of such formulations will be apparent to those skilled in the art.

[0074] A pharmaceutical composition is formulated to be compatible with its intended route of use or administration. The use or administration of inhibitor to a subject comprises ingestion, inhalation, or injection. The route of injection includes but not limited to intradermal, subcutaneous, intramuscular, intravenous, intraosseous, intraperitoneal, intrathecal, epidural, intracardiac, intraarticular, intracavernous, intravitreal, intracerebral, intracerebroventricular, or intraportal.

[0075] In an embodiment, the at least one inhibitor is administered subcutaneously, intraperitoneally, intravenously, or orally.

[0076] In one embodiment, oral or parenteral compositions are formulated in dosage unit form for ease of administration and uniformity of dosage. Dosage unit form as used herein refers to physically discrete units suited as unitary dosages for the subject to be treated; each unit containing a predetermined quantity of active ingredient calculated to produce the desired therapeutic effect in association with the required pharmaceutical carrier. The specification for the dosage unit forms are dictated by and directly dependent on the unique characteristics of the active ingredient and the particular therapeutic effect to be achieved, and the limitations inherent in the art of preparing such an active ingredient for the treatment of individuals.

[0077] In one embodiment, the at least one inhibitor is used or administered at least once per day. In an embodiment, the at least one inhibitor is administered at least once per week. In another embodiment, the at least one inhibitor is administered at least twice per week. In a further embodiment, the at least one inhibitor is administered at least four times per two weeks.

[0078] In a further embodiment, the effect of the at least one inhibitor is assessed by measuring homologous frequency in cells.

[0079] The following non-limiting Examples are illustrative of the present disclosure: Example 1 : Forward Genetic Screen Identified CtlP-associated Pathway as a Target For the Treatment of RETT Syndrome

Results

[0080] The use of a genetic screen to identify modifying genes that reverse or prevent progression of RTT symptoms was particularly attractive because the re-expression of Mecp2 in mutant mice after the onset of symptoms was able to rescue neurological deficits and improve function and longevity (Guy et al., 2007;Jugloff et al., 2008). This suggests that RTT is not caused by a requirement for MECP2 during neuronal development but is instead required for neuronal maintenance after birth and throughout life. Further, this suggests that RTT symptoms can be reversed even after the onset of disease. While gene therapy targeting MECP2 is challenging because MECP2 levels are very tightly regulated in the brain, there may be other as-yet uncovered genes and pathways that are more amenable to gene therapy. To identify other such pathways that could serve as candidates for therapeutics, the present inventors carried out a dominant /V-ethyl-/V-nitrosourea (ENU) mutagenesis screen in Mecp2/Y mice.

[0081] This suppressor screen led to the identification of over 32 modifiers, three of which were in genes involved in DNA damage and repair. Of particular interest was a nonsense mutation identified in retinoblastoma binding protein 8 (Rbbp8), more commonly called CtBP interacting protein (CtIP). ATR and NBS1 were not identified in the screen although they are dysregulated in Mecp2/Y mice at the RNA level.

[0082] CtIP is a 5' endonuclease primarily responsible for the resection of DNA at sites of double stranded breaks. This leads to the generation of 3' single-stranded intermediates required for the initiation of homologous recombination. CtIP not only supports these initial steps of DNA processing but also interacts with and is required for the recruitment of other DNA repair proteins (Figure 1 ). The suppressor mutation identified in CtIP is a cytosine to a thymine substitution in exon 15 of the gene, resulting in a premature stop codon and what is predicted to be a C-terminally truncated protein (Figure 2A). [0083] Thus, by carrying out a dominant /V-ethyl-/V-nitrosourea (ENU) mutagenesis screen, the present inventors identified a nonsense mutation in DNA resection factor CtIP (i.e. a suppressor mutation) that rescues some of the pathophysiological phenotypes of Rett Syndrome and improves longevity.

[0084] Mecp2/Y mice carrying the CtIP suppressor mutation demonstrated significantly improved life spans when compared to the Mecp2/Y mice alone (Figure 2B).

[0085] In vitro expression studies showed that the CtIP suppressor mutant was poorly expressed in mouse Neuroblastoma (Neuro2A) cells, at both the transcript and protein level. Similar experiments in human Osteosarcoma cells (U20S) showed that while CtIP transcripts levels were comparable to wildtype, the mutant CtIP protein (whether in the presence or absence of siRNA-mediated knock-down of endogenous CtIP) was poorly expressed (Figure 3 and Figure 7B).

[0086] The present inventors also demonstrated that CtIP transcripts were increased in Mecp2/Y mouse brain at post-symptomatic time points (Figure 4A). In addition, expression of NBS1 (Nijmegen breakage syndrome 1 ), a member of the MRN complex, which detects DSBs and initiates the series of events required for DSB repair, as well as the serine/threonine kinase ATR (ATM-and Rad3-Related), which is responsible for the transduction of signals from the DSB sensor complexes, were also increased in the Mecp2/Y mouse brain. Conversely p53 binding protein (53BP1), a factor also critical for the control of DSB repair was decreased in the Mecp2/Y animals (Figure 4B). 53BP1 functions in a manner antagonistic to CtIP, in that it blocks resection in a Brcal -dependent manner thereby promoting NHEJ (Daley and Sung, 2014;Panier and Boulton, 2014). These results suggest that while some components of the HR pathway are up-regulated in the Mecp2/Y mouse, opposing factors responsible for promoting NHEJ, the major DSB pathway in the mostly post-mitotic brain, are down-regulated. Collectively, hyperactivity of the HR pathway combined with a decrease in NHEJ would result in increased genomic instability within the Mecp2Y brain. [0087] Immunofluorescence of primary neuronal cells isolated from E15.5 Mecp2/Y embryonic cortex showed that upon treatment with the DSB- inducing agent NCS (200ng/ml_ for 3 hours), the numbers of phospho-Histone H2AX (γΗ2ΑΧ) foci, a marker of DSBs, were increased when compared to wildtype (Figure 5A). Quantification of these images indicated that these differences were statistically significant (Figure 5B) showing that Mecp2/Y mouse brains have increased DNA damage in the form of DSBs, which are then targeted for repair as marked by localization of γΗ2ΑΧ to the breaks.

[0088] RTT is not solely a neurodevelopmental disorder, but it has significant systemic metabolic components in the brain as well as the liver (Buchovecky et al., 2013c; Kyle et al., 2016). Loss of Mecp2 in the liver results in fatty liver disease, metabolic syndrome and/or insulin resistance. Examination of Mecp2/Y liver showed increased expression of CtIP protein (Figure 6). In addition, phospho-Histone H2AX (γΗ2ΑΧ), a marker of DSBs, was also increased.

[0089] Further, in vitro expression studies showed that unlike wild-type CtIP, the CtIP suppressor mutant was poorly expressed when transfected into U20S cells, suggesting nonsense-mediated RNA decay (Figure 7B). Direct Repeat (DR)-GFP assays measuring the frequency of HR in U20S cells showed that siRNA-mediated knock down of CtIP leads to lower HR frequency (Figure 7C). While lower HR frequency and consequently diminished repair of DSBs is generally considered disadvantageous to the cell, the persistence of DSBs is also important for many cellular processes. For example, Spo1 1 - mediated DSBs are required for the initiation of meiosis and topoisomerase II- induced breaks are important during replication and transcription. In addition, neurons when stimulated show increased DSBs which coincides with increased transcription of important neuronal genes. In Figure 7C, when wild-type CtIP is re-expressed in the presence of knockdown of endogenous CtIP, wild-type CtIP is able to rescue HR frequencies to levels similar to endogenous levels. However, when the mutant CtIP (suppressor of Rett mutation) is re-expressed in the presence of endogenous knock down, HR frequencies cannot be rescued to endogenous levels. It is shown in Figure 4A that CtIP mRNA levels are up- regulated in the Mecp2/Y brains. Concomitantly, HR frequencies are also up- regulated in the Mecp2/Y mouse embryonic fibroblasts (MEFs), presumably as a result of increased CtIP (Figure 7D). Based on these results, without being bound by theory, it is predicted that the presence of a mutant CtI P allele (suppressor of Rett mutation) in the Mecp2/Y animals would lead to down- regulation of CtIP and down-regulation of HR frequencies, an outcome that could be beneficial and help ameliorate RETT symptoms in the Mecp2/Y mice for reasons explained above.

[0090] Neuronal activity causes the formation of Topoisomerase I IB- dependent DSBs, which facilitates the transcriptional activation of early response genes including c-Fos, Fos-b, Egr1 and Nspa4 (Madabhushi et ai, 2015). These genes are important for neurite outgrowth, synapse development and maturation, balance between excitatory and inhibitory synapses, learning and memory. Studies have shown these neuronal processes to be defective in Mecp2/Y mice. Here, the present inventors have shown that these early response genes are expressed at lower levels as early as 4 weeks in Mecp2/Y brains (Figure 8). Without wishing to be bound by theory, the modulation of DSB repairfactors may affect the rates of DSBs in Mecp2/Y mice leading to the reduction of these critical neuronal genes.

[0091] Thus, without wishing to be bound by theory, it is suggested that when the CtI P suppressor mutation is present in a Mecp2/Y background, the mutation acts to counter the effects of dysregulated CtIP.

Materials and Methods

Animal Experiments

[0092] The animal Care and Use Committees at the AALAC-accredited Baylor College of Medicine or the CCAC-accredited Toronto Center for Phenogenomics approved all animal experiments. The 129.Mecp2 f/77l iS rc, /Y mouse line was used in the suppressor screen and gene expression studies.

Primary Neuronal Cultures [0093] Mouse cortex was isolated from E15.5 mouse embryos in ice-cold Hanks' Balanced Salt Solution (HBSS). Tissues was enzymatically digested in 1 % trypsin at 37 °C for 15 min. Single cell suspensions were then plated on laminin-coated coverslips at density of 2.0 X10 5 cells/well in a 12-well plate. Cultures were maintained in Neurobasal media supplemented with 10% horse serum, 1X serum free B-27 supplement, 2mM Glutamax I, 10μΜ β- mercaptoethanol. 50% of media was replenished every second day.

Immunofluorescence

[0094] Cells were fixed with 2% paraformaldehyde in 1 X PBS for 10 min and then extracted with 0.5% Triton in 1X PBS for 5 min. Cells were then blocked with 5% Donkey Serum in 0.1 % Triton/1X PBS for 30 min. Cells were treated with anti-phospho-Histone H2AX (Ser 139) (Millipore, 05-636) at a concentration of 1 :400 in 0.1 % Triton/1 X PBS for 1 hour at room temperature, followed by three washes in 1X PBS, for 5 min each. Cells were then incubated in 594-chicken-anti-mouse secondary antibody at a concentration of 1 : 1000 in 0.1 % Triton/1 X PBS for 1 hour at room temperature, followed by three washes in 1X PBS as above. Cover slips were then mounted on slides using Prolong Gold Antifade mount with DAPI. Images were visualized using a Nikon A1 R confocal microscope and quantification of yH2AX foci was carried out using the Perkin Elmer Volocity software.

qRT-PCR

[0095] Whole brain tissue was homogenized using a 5mm stainless bead and Qiagen TissueLyser II in QIAzol Reagent according to manufacturer's instructions. RNA was isolated using an RNeasy Lipid Tissue Mini Kit (Qiagen) and reverse transcription was performed using the Superscript VILO cDNA synthesis kit (Invitrogen, CA, USA). Quantitative PCR was performed in triplicate for each sample on a Viia7 instrument (ABI) using Power SYBR Green PCR Master Mix (Invitrogen). The PCR conditions were as follows: 95 °C for 10 min, 40 cycles of 95 °C for 15 s and 60 °C for 60 s. Single-product amplification was confirmed by agarose gel electrophoresis and disassociation curves. Gene expression was normalized to TATA-binding protein (tbp) internal loading control and analyzed using the 2 ~(ΔΔ Γ) method. Gene expression was displayed as the expression in Mecp2 Y mice relative to that of wild-type mice.

Whole Cell Protein Extraction

[0096] Whole brain tissue was homogenized using a 5mm stainless bead and Qiagen TissueLyser II in high salt whole cell extraction buffer (20 mM Tris pH 8.0, 500 mM NaCI, 1 .5 mM MgCI 2 , 1 mM EGTA, 1 % Triton, 10% Glycerol and 1 mM DTT) according to manufacturer's instructions. Homogenized tissue was then sonicated for 5 cycles of 30 pulses each using a Biodisruptor 300 (Diagnote) and then centrifuged at 12 000 g for 15 min at 4 °C. Protein lysates were quantified using a Pierce Coomassie protein assay kit (Thermo Fisher Scientific) before processing for western blotting.

Nuclear Extraction

[0097] Frozen brain tissue was washed with 1X volume of ice-cold PBS and centrifuged at 500 g for 5 min at 4 °C. Tissue was incubated on ice for 45 min in a dounce homogenizer containing 0.5 ml of cold NP40 lysis buffer (10 mM HEPES pH 7.9, 10 mM KCI, 3 mM MgCI 2 , 0.5% NP40, 0.5 mM DTT and Complete EDTA-free protease inhibitor cocktail (Roche, CA, USA)). Tissue was then homogenized with 10 strokes of the tight pestle in the dounce tissue homogenizer. Homogenized tissue was transferred on ice into a new microfuge tube and centrifuged at 2000 g for 10 min at 4 °C. The supernatant was removed and the pellet was resuspended in 250 μΙ of Benzonase extraction buffer (10 mM HEPES pH 7.9, 280 mM NaCI, 3 mM MgC , 0.2 mM EDTA pH 8.0, 0.5% NP40, 0.5 mM DTT, 250 U of Benzonase, and Complete EDTA-free protease inhibitor cocktail). Nuclei were incubated in extraction buffer for 1 h on at rotator at 4 °C after which lysates were centrifuged at 17 000 g for 20 min at 4 °C and quantified as above before processing for western blotting.

Western Blotting

[0098] The following antibodies were used for western blotting: anti-Ctl P (santa cruz, sc-5969) at a concentration of 1 :50 in 5% Milk-TBST, anti-Ctl P (abeam ab70163) at a concentration of 1 :2000 in 5% Milk-TBST; anti-GAPDH (Cell Signaling 5174) at a concentration of 1 :5000 in 5% Milk-TBST; anti- phospho-Histone H2AX (Ser 139) (Millipore, 05-636) at a concentration of 1 :2000 in 5% Milk-TBST.

Site Directed Mutagenesis

[0099] To recapitulate the CtIP Rett suppressor mutation in vitro, site directed mutagenesis was carried out on human and mouse CtIP expression vectors using the QuikChange II XL Site-Directed Mutagenesis Kit (Qiagen) and the following primers: Forward 5'-ggcagatagcttctcctaggtaccagatgagg-3' (SEQ ID NO: 12) and Reverse 5'-cctcatctggtacctaggagaagctatctgcc-3' (SEQ I D NO: 13).

DR-GFP Assay

[00100] To evaluate the effect of the CtIP suppressor mutant on HR- mediated DSB repair, DR-GFP assay was performed to measure the frequency of HR as described (Stark et ai, 2004). U20S DR-GFP (Nakanishi et al., 201 1 ) cells were grown in DM EM medium supplemented with 10% fetal bovine serum (FBS) and 100 U/ml penicillin, and 100 μg/ml streptomycin. Briefly, U20S DR- GFP cells stably expressing the DR-GFP plasmid (Pierce et al., 1999) were transfected using Lipofectamine 3000 (Invitrogen), with 10 nM siRNA (Dharmacon) against CtIP (SEQ ID NO: 1 ) and non-targeting siRNA 5'- U AAG G C U A U G AAG AG A U AC U U -3' (SEQ ID NO: 14), sequences of which have been previously described (Tkac et al., 2016). Twenty-four hours after the first transfection, cells were then co-transfected with siRNA resistant wildtype or mutant CtIP as well as the Seel endonuclease vector pCBAScel (Addgene #26477) and mCherry-expressing vector for transfection efficiency. DSBs generated by cleavage of the l-Scel sites are repaired by HR, which restores GFP expression. GFP expression was then determined by flow cytometry, where the rate of GFP-positive cells is indicative of the rate of recombination events. The results were normalized to non-targeting siCTRL.

Example 2

[00101] The use of small molecule inhibitors that target the CtIP pathway, as well as siRNA, shRNA, antisense, or CRISPR-Cas9 mediated knock down of CtIP may be used to mimic the effects of the suppressor mutation and ameliorate symptoms of Rett Syndrome as well as other neurodevelopmental disorders in which CtI P dysregulation is implicated.

[00102] The use of pharmacologic inhibitors, i.e. the knock down of CtIP activity by small molecule inhibitors, may prove a feasible therapeutic avenue for the treatment of RTT. Triapine is an inhibitor of ribonucleotide reductase that blocks the phosphorylation of CtIP, which is necessary for its activation. In addition, Triapine blocks CtlP-mediated DNA resection (Finch et al., 1999;Finch et al. , 2000;Lin et al., 2014;Liu et al., 1992). The efficacy of Triapine for treating cancer is currently being explored in various stages of clinical trials, and can be re-purposed for the treatment of RTT.

[00103] Phosphorylation of CtIP by the protein kinase Ataxia Telangiectasia and Rad3-related (ATR), in response to DSBs, is critical for its DNA resection activity. Non-phosphorylated CtIP cannot bind chromatin or initiate resection. ATR inhibitors such as VE-821 and its close analog VX- 970/VE-822 inhibit the ability of ATR to phosphorylate CtI P, thereby affecting DNA resection (Fokas et al., 2012;Fokas et al., 2014;Hall et al., 2014;Peterson et al., 2013). ATR inhibitors VE-821 and VX-970/VE-822 are currently in various stages of clinical trials for cancer-combination therapies. VX-970/VE-822 is also being tested in phase II trials in patients with DNA repair defects.

In vitro Drug Studies

[00104] The effects of Triapine (M308Abmole, M3084), or the ATR kinase inhibitors VE-821 (Selleck Chemicals, S8007), and VX-970/VE-822 (Selleck Chemicals, S7102) on DSB repair and HR are assayed in wildtype or Mecp2/Y MEFs engineered to express DR-GFP, using methods as described previously (Barker et al., 2006; Fokas et al., 2012;Ratner et al., 2016). Briefly, cells are transfected with the Seel endonuclease vector pCBAScel. Five hours after transfection cells are treated with various concentrations of Triapine. For HR assays, 48-72h later, cells are then processed for Flow cytometry to determine the rate of HR as described above. To determine the effects of Triapine on DSBs, cells are processed for immunofluorescence and western blot using an antibody against phospho-Histone H2AX (Ser 139) (Millipore, 05-636). The knockdown of CtIP levels by Triapine and of ATR-mediated CtIP phosphorylation by VE-821 and VX-970/VE-822 in Mecp2/Y MEFSs reduces HR activity and phospho-H2AX protein to levels closer to or comparable with wildtype MEFs.

Animal Drug Studies

[00105] Triapine is suspended in 0.9% NaCI and administered to 5-week old Mecp2 Y mice and wildtype littermates by i.p. at a dose of 0.01 ml_ of Triapine per gram of mouse body weight (Finch et al., 2000). The frequency of dose is determined based on preliminary studies to determine the lowest dose tolerated by wildtype mice. In addition, doses administered to human patients are considered as outlined in (Buchovecky et al., 2013a). For example, in studies looking at the toxicity of Triapine in patients with head or neck squamous cell carcinomas, patients received the drug by i.v. infusion daily for 4 days every 14 days at a dose of 96 mg/m 2 /day (Nutting et al., 2009). In similar studies in pancreatic cancer, patients received 24 mg/m 2 , 48 mg/m 2 and 72mg/m 2 in a 3x3 design dose escalation study (Martin et al., 2012).

[00106] Similarly Mecp2 Y mice and wildtype littermates are treated with either vehicle alone or 30-60 mg/kg of ATR inhibitors VE-821 and VX-970/VE- 822 suspended in 10% D-a-Tocopherol polyethylene glycol 1000 succinate. Drugs are provided by oral gavage (Fokas et al. , 2012; Williamson et al., 2016). While studies to determine the safety, tolerability and pharmacokinetics of VX- 970/VE-822 in conjunction with other treatments are currently under way (ClinicalTrials.gov Identifiers NCT02157792 and NCT02487095), another patient study recommends dose levels of 240 mg/m 2 when an ATR inhibitor is administered alone.

[00107] Drug-treated mice are monitored up until 24 weeks for recovery of RTT symptoms such as motor skills, neurological defects and longevity using parameters as previously described (Buchovecky et al., 2013a; Buchovecky et al., 2013b). Liver lipids will be monitored by serum levels of cholesterol and triglycerides. In some cases, results will be confirmed by assessing liver lipids directly using high power liquid chromatography (HPLC). The knockdown of CtIP levels by Triapine and of ATR-mediated CtIP phosphorylation by VE-821 and VX-970/VE-822 in Mecp2/Y MEFSs leads to reduction of RTT neurological symptoms but does not affect or has little effect on liver lipids.

Antisense Oligonucleotide or siRNA Molecules

[00108] There has been a recent rise in the use of antisense oligonucleotide molecules to treat neurodevelopmental disorders, for example, to reverse phenotypes in MECP2 duplication syndrome (Sztainberg et al., 2015). In addition, the uses of antisense oligonucleotide molecules in clinical trials for amyotrophic lateral sclerosis and spinal muscular atrophy have shown promising results (Evers et al., 2015;Reddy and Miller, 2015).

[00109] Antisense oligonucleotides designed against multiple regions of mouse CtIP pre-mRNA are synthesized by lonis Pharmaceuticals. Preliminary tests are carried out in tissue culture to confirm reduced CtIP levels as well as tests for cytotoxicity in wildtype mice. Based on these results, 500 μg of each selected antisense oligonucleotide (SEQ I D NOs: 2-6) is dissolved in 100 μΙ saline and gradually infused into brains of 7 - 8 weeks old Mecp2 Y and wildtype littermate mice over a period of 4 weeks using micro-osmotic pumps as previously described (Meng et al., 2016; Sztainberg et al., 2015). The most effective ASO at targeting the gene as assessed in cells in culture will be assayed singly or with another (two at one time) ASO for the best effect. Mice are then assayed for RTT-associated symptoms as described above.

[00110] The antisense oligonucleotides and siRNA directed against CtIP in Mecp2/Y brains leads to reduction of RTT symptoms as outlined above.

CRISPR-Cas9 Mediated Knock down

[00111] The advent of CRISPR-Cas9 technology has provided a powerful genome-editing tool with which to study gene function. The use of CRISPR- Cas9 to knock-out and knock-in genes in the mouse brain and liver has been successfully demonstrated (Shinmyo et al., 2016;Staahl et al., 2017;Swiech et al., 2015;Uemura et al., 2016;Xue et al., 2014). CRISPR-Cas9-mediated technology is used to knockdown CtIP levels. [00112] Down-regulation of CtIP levels is carried out using CRISPR-Cas9 technology previously described (Ran et ai, 2013). The present inventors have identified and validated two 25-nucleotide single guide RNAs (sgRNAs) in the vicinity of suppressor mutation (IDT DNA technologies); Forward 5'- ccacgtttggcagatagcttctccc-3' (SEQ ID NO: 15), Reverse 5'- aaacgggagaagctatctgccaaac-3' (SEQ ID NO: 16) and Forward 5'- ccacgcttctcccaggtaccagatg-3' (SEQ ID NO: 17), Reverse 5'- aaaccatctggtacctgggagaagc-3' (SEQ ID NO: 18). The sgRNAs are cloned into the Bbsl site of the Cas9 vector px330 (Addgene #42230) and this vector is delivered by in utero electroporation of E13.5 or E15.5 pups as previously described (Shinmyo et al., 2016). Briefly, male 129S6/SvEvTac are mated to 129.Mecp2 tm1 1 Bird /+ female mice ^ 29.Mecp2 tm1 1Bird /Y). Pregnant Mecp2 tm1 1 Bird /+ female mice are anesthetised and the uterine horns are exposed. 1 -2 μΙ of DNA solutions mixed with 0.005% fast green are injected into the lateral ventricles of embryos using a pulled glass micropipette. Each embryo is placed between tweezers-type electrodes, 3-5 mm in diameter and electroporated with five square electric pulses (35 V, 50 msec, 1 Hz) at 1 sec intervals. The embryos are quickly returned to the abdominal cavity to allow continuous development. Similar experiments are carried out in the liver by electroporation or hydrodynamic injection as previously described (Jaichandran et al., 2006;Xue et al., 2014), and assessed for CtI P and γΗ2ΑΧ expression. Adult mice are then be assayed for recovery of RTT-associated symptoms as described above.

[00113] The use of CRISPR/Cas9 technology to down-regulate CtIP levels in Mecp2/Y brain and liver leads to reduction of RTT symptoms as outlined above.

[00114] While the present disclosure has been described with reference to what are presently considered to be the preferred example, it is to be understood that the disclosure is not limited to the disclosed example. To the contrary, the disclosure is intended to cover various modifications and equivalent arrangements included within the spirit and scope of the appended claims. [00115] All publications, patents and patent applications are herein incorporated by reference in their entirety to the same extent as if each individual publication, patent or patent application was specifically and individually indicated to be incorporated by reference in its entirety.

Table 1 . Table of Sequences

REFERENCES

Amir, R. E., Van den Veyver, I. B., Wan, M., Tran, C. Q., Francke, U. and Zoghbi,

H. Y. (1999). Rett Syndrome is Caused by Mutations in X-Linked MECP2, Encoding Methyl-CpG-Binding Protein 2. Nat. Genet. 23, 185-188.

Barker, C. A., Burgan, W. E., Carter, D. J., Cerna, D., Gius, D., Hollingshead, M. G., Camphausen, K. and Tofilon, P. J. (2006). In vitro and in Vivo Radiosensitization Induced by the Ribonucleotide Reductase Inhibitor Triapine (3-Aminopyridine-2- Carboxaldehyde-Thiosemicarbazone). Clin. Cancer Res. 12, 2912-2918.

Bienvenu, T. and Chelly, J. (2006). Molecular Genetics of Rett Syndrome: When DNA Methylation Goes Unrecognized. Nat. Rev. Genet. 7, 415-426.

Buchovecky, C. M., Hill, M. G., Borkey, J. M., Kyle, S. M. and Justice, M. J. (2013a). Evaluation of Rett Syndrome Symptom Improvement by Metabolic Modulators in Mecp2-Mutant Mice. Curr. Protoc. Mouse Biol. 3, 187-204.

Buchovecky, C. M., Turley, S. D., Brown, H. M., Kyle, S. M., McDonald, J. G., Liu, B., Pieper, A. A., Huang, W., Katz, D. M., Russell, D. W. et al. (2013c). A Suppressor Screen in Mecp2 Mutant Mice Implicates Cholesterol Metabolism in Rett Syndrome. Nat. Genet. 45, 1013-1020.

Chowdhury, D., Choi, Y. E. and Brault, M. E. (2013). Charity Begins at Home: Non- Coding RNA Functions in DNA Repair. Nat. Rev. Mol. Cell Biol. 14, 181 -189.

Daley, J. M. and Sung, P. (2014). 53BP1 , BRCA1 , and the Choice between Recombination and End Joining at DNA Double-Strand Breaks. Mol. Cell. Biol. 34, 1380-1388.

Evers, M. M., Toonen, L. J. and van Roon-Mom, W. M. (2015). Antisense Oligonucleotides in Therapy for Neurodegenerative Disorders. Adv. Drug Deliv. Rev. 87, 90-103.

Finch, R. A., Liu, M., Grill, S. P., Rose, W. C, Loomis, R., Vasquez, K. M., Cheng, Y. and Sartorelli, A. C. (2000). Triapine (3-Aminopyridine-2-Carboxaldehyde- Thiosemicarbazone): A Potent Inhibitor of Ribonucleotide Reductase Activity with Broad Spectrum Antitumor Activity. Biochem. Pharmacol. 59, 983-991 .

Finch, R. A., Liu, M. C, Cory, A. H., Cory, J. G. and Sartorelli, A. C. (1999). Triapine (3-Aminopyridine-2-Carboxaldehyde Thiosemicarbazone; 3-AP): An Inhibitor of Ribonucleotide Reductase with Antineoplastic Activity. Adv. Enzyme Regul. 39, 3-12.

Fokas, E., Prevo, R., Hammond, E. M., Brunner, T. B., McKenna, W. G. and Muschel, R. J. (2014). Targeting ATR in DNA Damage Response and Cancer Therapeutics. Cancer Treat. Rev. 40, 109-1 17.

Fokas, E., Prevo, R., Pollard, J. R., Reaper, P. M., Charlton, P. A., Cornelissen, B., Vallis, K. A., Hammond, E. M., Olcina, M. M., Gillies McKenna, W. et al. (2012). Targeting ATR in Vivo using the Novel Inhibitor VX-970 Results in Selective Sensitization of Pancreatic Tumors to Radiation. Cell. Death Dis. 3, e441 . Guy, J., Gan, J., Selfridge, J., Cobb, S. and Bird, A. (2007). Reversal of Neurological Defects in a Mouse Model of Rett Syndrome. Science 315, 1 143-1 147.

Guy, J., Hendrich, B., Holmes, M., Martin, J. E. and Bird, A. (2001). A Mouse Mecp2-Null Mutation Causes Neurological Symptoms that Mimic Rett Syndrome. Nat. Genet. 27, 322-326.

Hall, A. B., Newsome, D., Wang, Y., Boucher, D. M., Eustace, B., Gu, Y., Hare, B., Johnson, M. A., Milton, S., Murphy, C. E. ef al. (2014). Potentiation of Tumor Responses to DNA Damaging Therapy by the Selective ATR Inhibitor VX-970. Oncotarget 5, 5674-5685.

Haeussler, M., Schonig, K., Eckert, H., Eschstruth, A., Mianne, J., Renaud, J.B., Schneider-Maunoury, S., Shkumatava, A., Teboul, L, et al. (2016). Evaluation of off-target and on-target scoring algorithms and integration into the guide RNA selection tool CRISPOR. Genome Biol. 17, 148.

Hsu, P.D., Scott, D.A., Weinstein, J.A., Ran, F.A., Konermann, S., Agarwala, V., Li, Y., Fine, E.J., Wu, X., Shalem, O., Cradick, T.J., Marraffini, L.A., Bao, G., Zhang,

F. (2013). DNA targeting specificity of RNA-guided Cas9 nucleases. Nat Biotechnol 31 , 827-832.

Huertas, P. (2010). DNA Resection in Eukaryotes: Deciding how to Fix the Break. Nat. Struct. Mol. Biol. 17, 1 1 -16.

Jackson, S. P. and Bartek, J. (2009). The DNA-Damage Response in Human Biology and Disease. Nature 461 , 1071 -1078.

Jaichandran, S., Yap, S. T., Khoo, A. B., Ho, L. P., Tien, S. L. and on, O. L. (2006). In Vivo Liver Electroporation: Optimization and Demonstration of Therapeutic Efficacy. Hum. Gene Ther. 17, 362-375.

Jugloff, D. G., Vandamme, K., Logan, R., Visanji, N. P., Brotchie, J. M. and Eubanks, J. H. (2008). Targeted Delivery of an Mecp2 Transgene to Forebrain Neurons Improves the Behavior of Female Mecp2-Deficient Mice. Hum. Mol. Genet. 17, 1386-1396.

Kyle, S. M., Saha, P. K., Brown, H. M., Chan, L. C. and Justice, M. J. (2016). MeCP2 Co-Ordinates Liver Lipid Metabolism with the NCoR1/HDAC3 Corepressor Complex. Hum. Mol. Genet. 25, 3029-3041 .

Lin, Z. P., Ratner, E. S., Whicker, M. E., Lee, Y. and Sartorelli, A. C. (2014). Triapine Disrupts CtlP-Mediated Homologous Recombination Repair and Sensitizes Ovarian Cancer Cells to PARP and Topoisomerase Inhibitors. Mol. Cancer. Res. 12, 381-393.

Liu, M. C, Lin, T. S. and Sartorelli, A. C. (1992). Synthesis and Antitumor Activity of Amino Derivatives of Pyridine-2-Carboxaldehyde Thiosemicarbazone. J. Med. Chem. 35, 3672-3677.

Madabhushi, R., Gao, F., Pfenning, A. R., Pan, L., Yamakawa, S., Seo, J., Rueda, R., Phan, T. X., Yamakawa, H., Pao, P. C. et al. (2015). Activity-Induced DNA Breaks Govern the Expression of Neuronal Early-Response Genes. Cell 161 , 1592-1605. Madabhushi, R., Pan, L. and Tsai, L. H. (2014). DNA Damage and its Links to Neurodegeneration. Neuron 83, 266-282.

Makharashvili, N., Tubbs, A. T., Yang, S. H., Wang, H., Barton, O., Zhou, Y., Deshpande, R. A., Lee, J. H., Lobrich, M., Sleckman, B. P. et al. (2014). Catalytic and Noncatalytic Roles of the CtIP Endonuclease in Double-Strand Break End Resection. Mol. Cell 54, 1022-1033.

Martin, L. K., Grecula, J., Jia, G., Wei, L., Yang, X., Otterson, G. A., Wu, X., Harper, E., Kefauver, C, Zhou, B. S. ef al. (2012). A Dose Escalation and Pharmacodynamic Study of Triapine and Radiation in Patients with Locally Advanced Pancreas Cancer. Int. J. Radiat. Oncol. Biol. Phys. 84, e475-81.

McKinnon, P. J. (2013). Maintaining Genome Stability in the Nervous System. Nat. Neurosci. 16, 1523-1529.

Meng, X., Jiang, Q., Chang, N., Wang, X., Liu, C, Xiong, J., Cao, H. and Liang, Z.

(2016). Small Activating RNA Binds to the Genomic Target Site in a Seed-Region- Dependent Manner. Nucleic Acids Res. 44, 2274-2282.

Morgan, B.A., and Gainor, J.A. (1989) Approaches to the Discovery of Non-Peptide Ligands for Peptide Receptors and Peptidases. Annual Reports in Medicinal Chemistry 24, 243-252.

Muotri, A. R., Marchetto, M. C, Coufal, N. G., Oefner, R., Yeo, G., Nakashima, K. and Gage, F. H. (2010). L1 Retrotransposition in Neurons is Modulated by MeCP2. Nature 468, 443-446.

Nakanishi, K., Cavallo, F., Brunet, E. and Jasin, M. (201 1). Homologous Recombination Assay for Interstrand Cross-Link Repair. Methods Mol. Biol. 745, 283- 291 .

Nutting, C. M., van Herpen, C. M., Miah, A. B., Bhide, S. A., Machiels, J. P., Buter, J., Kelly, C, de Raucourt, D. and Harrington, K. J. (2009). Phase II Study of 3-AP Triapine in Patients with Recurrent Or Metastatic Head and Neck Squamous Cell Carcinoma. Ann. Oncol. 20, 1275-1279.

Panier, S. and Boulton, S. J. (2014). Double-Strand Break Repair: 53BP1 Comes into Focus. Nat. Rev. Mol. Cell Biol. 15, 7-18.

Peterson, S. E., Li, Y., Wu-Baer, F., Chait, B. T., Baer, R., Yan, H., Gottesman, M. E. and Gautier, J. (2013). Activation of DSB Processing Requires Phosphorylation of CtIP by ATR. Mol. Cell 49, 657-667.

Pierce, A. J., Johnson, R. D., Thompson, L. H. and Jasin, M. (1999). XRCC3 Promotes Homology-Directed Repair of DNA Damage in Mammalian Cells. Genes Dev. 13, 2633-2638.

Ran, F. A., Hsu, P. D., Wright, J., Agarwala, V., Scott, D. A. and Zhang, F. (2013). Genome Engineering using the CRISPR-Cas9 System. Nat. Protoc. 8, 2281 -2308. Ratner, E. S., Zhu, Y. L, Penketh, P. G., Berenblum, J., Whicker, M. E., Huang, P. H., Lee, Y., Ishiguro, K., Zhu, R., Sartorelli, A. C. et al. (2016). Triapine Potentiates Platinum-Based Combination Therapy by Disruption of Homologous Recombination Repair. Br. J. Cancer 114, 777-786.

Reddy, L. V. and Miller, T. M. (2015). RNA-Targeted Therapeutics for ALS. Neurotherapeutics 12, 424-427.

Sartori, A. A., Lukas, C, Coates, J., Mistrik, M., Fu, S., Bartek, J., Baer, R., Lukas, J. and Jackson, S. P. (2007). Human CtIP Promotes DNA End Resection. Nature 450, 509-514.

Shinmyo, Y., Tanaka, S., Tsunoda, S., Hosomichi, K., Tajima, A. and Kawasaki,

H. (2016). CRISPR-Cas9-Mediated Gene Knockout in the Mouse Brain using in Utero Electroporation. Sci. Rep. 6, 2061 1 .

Simon, R.J., Kania, R.S., Zuckermann, R.N., Huebner, V.D., Jewell, D.A., Banville, S., Ng, S., Wang, L, Rosenberg, S. and Marlowe, C.K. (1992) Peptoids: a modular approach to drug discovery. Proceedings of the National Academy of Sciences 89, 9367-9371 .

Squillaro, T., Alessio, N., Cipollaro, M., Renieri, A., Giordano, A. and Galderisi, U.

(2010). Partial Silencing of Methyl Cytosine Protein Binding 2 (MECP2) in Mesenchymal Stem Cells Induces Senescence with an Increase in Damaged DNA. FASEB J. 24, 1593-1603.

Staahl, B. T., Benekareddy, M., Coulon-Bainier, C, Banfal, A. A., Floor, S. N., Sabo, J. K., Urnes, C, Munares, G. A., Ghosh, A. and Doudna, J. A. (2017). Efficient Genome Editing in the Mouse Brain by Local Delivery of Engineered Cas9 Ribonucleoprotein Complexes. Nat. Biotechnol.

Swiech, L., Heidenreich, M., Banerjee, A., Habib, N., Li, Y., Trombetta, J., Sur, M. and Zhang, F. (2015). In Vivo Interrogation of Gene Function in the Mammalian Brain using CRISPR-Cas9. Nat. Biotechnol. 33, 102-106.

Symington, L. S. and Gautier, J. (201 1). Double-Strand Break End Resection and Repair Pathway Choice. Annu. Rev. Genet. 45, 247-271 .

Sztainberg, Y., Chen, H. M., Swann, J. W., Hao, S., Tang, B., Wu, Z., Tang, J., Wan, Y. W., Liu, Z., Rigo, F. ef al. (2015). Reversal of Phenotypes in MECP2 Duplication Mice using Genetic Rescue Or Antisense Oligonucleotides. Nature 528, 123-126.

Tkac, J., Xu, G., Adhikary, H., Young, J. T., Gallo, D., Escribano-Diaz, C, Krietsch, J., Orthwein, A., Munro, M., Sol, W. et al. (2016). HELB is a Feedback Inhibitor of DNA End Resection. Mol. Cell 61 , 405-418.

Uemura, T., Mori, T., Kurihara, T., Kawase, S., Koike, R., Satoga, M., Cao, X., Li, X., Yanagawa, T., Sakurai, T. ef al. (2016). Fluorescent Protein Tagging of Endogenous Protein in Brain Neurons using CRISPR-Cas9-Mediated Knock-in and in Utero Electroporation Techniques. Sci. Rep. 6, 35861 . Williamson, C. T., Miller, R., Pemberton, H. N., Jones, S. E., Campbell, J., Konde, A., Badham, N., Rafiq, R., Brough, R., Gulati, A. et al. (2016). ATR Inhibitors as a Synthetic Lethal Therapy for Tumours Deficient in ARID1A. Nat. Commun. 7, 13837. Wong, A. K., Ormonde, P. A., Pero, R., Chen, Y., Lian, L., Salada, G., Berry, S., Lawrence, Q., Dayananth, P., Ha, P. et al. (1998). Characterization of a Carboxy- Terminal BRCA1 Interacting Protein. Oncogene 17, 2279-2285.

Xue, W., Chen, S., Yin, H., Tammela, T., Papagiannakopoulos, T., Joshi, N. S., Cai, W., Yang, G., Bronson, R., Crowley, D. G. ef al. (2014). CRISPR-Mediated Direct Mutation of Cancer Genes in the Mouse Liver. Nature 514, 380-384.

Yu, X., Wu, L. C, Bowcock, A. M., Aronheim, A. and Baer, R. (1998). The C- Terminal (BRCT) Domains of BRCA1 Interact in Vivo with CtIP, a Protein Implicated in the CtBP Pathway of Transcriptional Repression. J. Biol. Chem. 273, 25388-25392.