MODULATION OF MARC1 EXPRESSION

Sequence Listing

The present application is being filed along with a Sequence Listing in electronic format. The Sequence Listing is provided as a file entitled BIOL0420WOSEQ_ST25.txt, created on February 25, 2022, which is 144 Kb in size. The information in the electronic format of the sequence listing is incorporated herein by reference in its entirety.

Field

Provided herein are methods, specific inhibitors, and compositions useful for reducing expression or activity of mitochondrial amidoxime reducing component 1 (hereinafter referred to as MARC1) in a subject. Also, provided herein are methods, specific inhibitors, and compositions which can be useful in treating MARCl-related diseases or conditions in a subject. Such methods, specific inhibitors, and compositions can be useful, for example, to treat a liver disease, metabolic disease such as nonalcoholic fatty liver diseases (NAFLDs) including NASH (nonalcoholic steatohepatitis), or cardiovascular disease in a subject.

Background

Nonalcoholic fatty liver diseases (NAFLDs) including NASH (nonalcoholic steatohepatitis) are considered to be hepatic manifestations of the metabolic syndrome (Marchesini G, et al. Hepatology (2003) 37 : 917-923) and are characterized by the accumulation of triglycerides in the liver of patients without a history of excessive alcohol consumption. The majority of patients with NAFLD are obese or morbidly obese and have accompanying insulin resistance (Byrne and Targher Hepatol (2015) 62(1S): S47-S64). The incidence of NAFLD/NASH has been rapidly increasing worldwide consistent with the increased prevalence of obesity, and is currently the most common chronic liver disease. Recently, the incidence of NAFLD and NASH was reported to be 46% and 12%, respectively, in a largely middle-aged population (Williams CD, et al. Gastroenterology (2011) 140: 124-131).

NAFLD can be broadly classified into asymptomatic simple steatosis (“fatty liver”), and NASH, in which intralobular inflammation and ballooning degeneration of hepatocytes is observed along with hepatic steatosis. The proportion of patients with NAFLD who have NASH is still not clear but might range from 20- 40%. NASH is a progressive disease and can lead to liver cirrhosis and hepatocellular carcinoma (Farrell and Larter Hepatology (2006) 43: S99-S112; Cohen JC, etal. Science (2011); 332: 1519-1523). Twenty percent of NASH patients are reported to develop cirrhosis, and 30-40% of patients with NASH cirrhosis experience liver- related death (McCullough J Clin Gastroenterol (2006) 40 Suppl 1: S17-S29). Recently, NASH has become the third most common indication for liver transplantation in the United States (Charlton et al. Gastroenterology (2011) 141: 1249-1253). Currently, the principal treatment for NAFLD and NASH is lifestyle modification by diet and exercise. However, pharmacological therapy is indispensable because obese patients with NAFLD and NASH often have difficulty maintaining such improved lifestyles.

Summary

Provided herein are compositions, compounds and methods for modulating expression of MARCl - associated with liver disease, metabolic disease, or cardiovascular diseases or disorders. A loss-of-fiinction variant in MARC1 has been associated with a reduced risk of certain liver diseases. N Engl J Med 2018;378: 1096-106. In certain embodiments, these compositions, compounds and methods are for modulating the expression of MARC 1. In certain embodiments, the MARC1 modulator is a MARC 1 -specific inhibitor. In certain embodiments, the MARC 1 -specific inhibitor decreases expression or activity of MARC 1. In certain embodiments, MARC 1 -specific inhibitors include nucleic acids, proteins and small molecules. In certain embodiments, the MARC 1 -specific inhibitor is a nucleic acid. In certain embodiments, the MARC 1 -specific inhibitor comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide can be single stranded or double stranded.

Certain embodiments are directed to compounds useful for inhibiting MARCl, which can be useful for treating a liver disease, metabolic disease, or cardiovascular disease or disorder. Certain embodiments are directed to antisense inhibition of MARCl resulting in improvement of symptoms or endpoints associated with liver disease, metabolic disease, or cardiovascular disease or disorder. Certain embodiments are directed to compounds useful in improving hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof.

Certain embodiments are described in the numbered embodiments below:

Embodiment LA method of treating a liver disease or disorder in a subject having, or at risk of having, a liver disease or disorder comprising administering a MARCl specific inhibitor to the subject, thereby treating the liver disease or disorder in the subject.

Embodiment 2.The method of embodiment 1, wherein the liver disease or disorder is fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, nonalcoholic fatty liver disease (NAFLD), alcoholic steatohepatitis (ASH), or nonalcoholic steatohepatitis (NASH).

Embodiment 3.The method of embodiment 1 or embodiment 2, wherein administering the MARC 1 specific inhibitor reduces or improves hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof. Embodiment 4. A method of inhibiting expression or activity of MARC1 in a cell comprising contacting the cell with an MARC1 specific inhibitor, thereby inhibiting expression or activity of MARC 1 in the cell.

Embodiment 5. The method of embodiment 4, wherein the cell is a hepatocyte.

Embodiment 6. The method of embodiment 4 or embodiment 5, wherein the cell is in a subject.

Embodiment 7.The method of embodiment 6, wherein the subject has, or is at risk of having liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH.

Embodiment 8. The method of any preceding embodiment, wherein the subject is a human subject.

Embodiment 9.The method of any of embodiments 1-8, wherein the MARC1 specific inhibitor is an antisense agent, a polypeptide, an antibody, or a small molecule.

Embodiment 10. The method of any of embodiments 1-9, wherein the MARC1 specific inhibitor is an antisense agent comprising a modified oligonucleotide, wherein the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of any of SEQ ID NOs: 1-5.

Embodiment 1 l.The method of embodiment 10, wherein the antisense agent is single-stranded.

Embodiment 12.The method of embodiment 10, wherein the antisense agent is double -stranded.

Embodiment 13. The method of any of embodiments 10-12, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Embodiment 14. The method of any of embodiments 10-13, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

Embodiment 15. The method of any of embodiments 10-14, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

Embodiment 16. The method of embodiment 14, wherein the modified sugar moiety is a bicyclic sugar moiety or a 2’-MOE sugar moiety.

Embodiment 17.The method of embodiment 14, wherein the modified sugar moiety comprises a 4'-CH(CH ₃ )- 0-2' bridge or a 4'- (CH ₂ ) _n -0-2' bridge, wherein n is 1 or 2.

Embodiment 18. The method of embodiment 15, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 19. The method of any of embodiments 10-18, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.

Embodiment 20. The method of embodiment 19, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. Embodiment 21. The method of embodiment 20, wherein each intemucleoside linkage is a phosphorothioate intemucleoside linkage.

Embodiment 22. The method of any of embodiments 19-21, wherein each intemucleoside linkage is independently selected from a phosphodiester intemucleoside linkage or a phosphorothioate intemucleoside linkage.

Embodiment 23.The method of any of embodiments 10-22, wherein the modified oligonucleotide has: a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; a 3’ wing segment consisting linked nucleosides;

Embodiment 24. The method of embodiment 23 wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

Embodiment 25.The method of any of embodiments 10-24, wherein the modified oligonucleotide has a sugar motif comprising: a 5’-region consisting of 1-6 linked 5’-region nucleosides; a central region consisting of 6-10 linked central region nucleosides; and a 3’-region consisting of 1-6 linked 3’-region nucleosides; wherein the 3 ’-most nucleoside of the 5 ’-region and the 5 ’-most nucleoside of the 3 ’-region comprise modified sugar moieties, and each of the central region nucleosides is selected from a nucleoside comprising a 2’- -D-deoxyribosyl sugar moiety and a nucleoside comprising a 2 ’-substituted sugar moiety, wherein the central region comprises at least six nucleosides comprising a 2’- -D-deoxyribosyl sugar moiety and no more than two nucleosides comprise a 2 ’-substituted sugar moiety.

Embodiment 26. The method of any of embodiments 1-25, wherein the MARC1 specific inhibitor is administered parenterally.

Embodiment 27. The method of embodiment 26, wherein the compound is administered parenterally by subcutaneous or intravenous administration.

Embodiment 28. The method of any of embodiments 1-27, comprising co-administering the compound and at least one additional therapy.

Embodiment 29.Use of a MARC1 specific inhibitor for the manufacture or preparation of a medicament for treating a liver disease or disorder.

Embodiment 30. Use of a MARC1 specific inhibitor for the treatment of a liver disease or disorder.

Embodiment 31.The use of embodiment 29 or 30, wherein the liver disease or disorder is fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. Embodiment 32.The use of any of embodiments 29-31, wherein the MARC1 specific inhibitor reduces or improves hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAS, or plasma cholesterol levels, or a combination thereof.

Embodiment 33. The use of any of embodiment 29-32, wherein the MARC1 specific inhibitor reduces hepatic steatosis, reduces liver fibrosis, reduces triglyceride synthesis, reduces plasma lipid levels, reduces hepatic lipids, reduces ALT levels, improves NAS, or reduces plasma cholesterol levels, or a combination thereof.

Embodiment 34. The use of any of embodiments 29-33, wherein the MARC1 specific inhibitor reduces levels of hydroxyproline, reduces levels of Collal, reduces levels of ORO, or reduces levels total collagen in the liver, or a combination thereof.

Embodiment 35.The use of any of embodiments 29-34, wherein the MARC1 specific inhibitor is an antisense agent, a polypeptide, an antibody, or a small molecule.

Embodiment 36. The use of any of embodiments 29-35, wherein the MARC1 specific inhibitor is an antisense agent comprising a modified oligonucleotide, wherein the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of any of SEQ ID NOs: 1-5.

Embodiment 37. The use of embodiment 36, wherein the antisense agent is single-stranded.

Embodiment 38. The use of embodiment 36, wherein the antisense agent is double-stranded

Embodiment 39.The use of any of embodiments 36-38, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Embodiment 40. The use of embodiment 39, wherein at least one of the nucleosides comprise a modified sugar moiety.

Embodiment 41.The use of embodiment 40 or embodiment 41 , wherein at least one of the nucleosides comprise a modified nucleobase.

Embodiment 42. The use of any of embodiments 39-41, wherein at least one intemucleoside linkage of the modified oligonucleotide is a a modified intemucleoside linkage.

Embodiment 43.The use of embodiment 40, wherein the modified sugar moiety is a bicyclic sugar moiety or 2’-MOE sugar moiety.

Embodiment 44. The use of embodiment 40, wherein the modified sugar moiety comprises a 4'- CH(CH ₃ )-0-2' bridge or a 4'- (CEb) _n -C)-2' bridge, wherein n is 1 or 2.

Embodiment 45.The use of embodiment 41, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 46. The use of embodiment 42, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage. Embodiment 47. The use of any of embodiments 31-46, wherein the modified oligonucleotide has: a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; a 3’ wing segment consisting linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

Embodiment 48. A method comprising administering a MARC1 specific inhibitor to a subject.

Embodiment 49. The method of embodiment 48, wherein the subject has a liver disease or is at risk for developing a liver disease.

Embodiment 50.The method of embodiment 49, wherein the liver disease is selected from fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH and NASH.

Embodiment 51. The method of any of embodiments 48-50, wherein a therapeutic amount of the MARC1 specific inhibitor is administered to the subject.

Embodiment 52.The method of any of embodiments 48-51, wherein the administration of the MARC1 specific inhibitor ameliorates at least one symptom of the liver disease.

Embodiment 53. The method of any of embodiments 48-52, wherein the administration of the MARC1 specific inhibitor reduces orimproves hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAS, or plasma cholesterol levels, or a combination thereof.

Embodiment 54. The use of any of embodiments 48-53, wherein the MARC1 specific inhibitor reduces hepatic steatosis, reduces liver fibrosis, reduces triglyceride synthesis, reduces plasma lipid levels, reduces hepatic lipids, reduces ALT levels, improves NAS, or reduces plasma cholesterol levels, or a combination thereof.

Embodiment 55. The use of any of embodiments 48-54, wherein the MARC1 specific inhibitor reduces levels of hydroxyproline, reduces levels of Collal, reduces levels of ORO, or reduces levels total collagen in the liver, or a combination thereof.

Embodiment 56. A method comprising contacting a cell with a MARC1 specific inhibitor.

Embodiment 57. The method of embodiment 56, wherein expression of MARC 1 in the cell is reduced.

Embodiment 58. The method of embodiment 56 or 57, wherein the cell is a hepatocyte.

Embodiment 59.The method of embodiment 58, wherein the cell is in a subject.

Embodiment 60.The method of embodiment 59, wherein the subject has, or is at risk of having liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH or NASH. Embodiment 61. The method of any of embodiments 1-60, wherein the subject is a human subject.

Embodiment 62. The method of any of embodiments 1-61, wherein the MARC1 specific inhibitor is an antisense agent, a polypeptide, an antibody, or a small molecule.

Embodiment 63.The method of any of embodiments 1-62, wherein the MARC1 specific inhibitor is an antisense agent comprising a modified oligonucleotide, wherein the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of any of SEQ ID NOs: 1-5.

Embodiment 64.The method of embodiment 61, wherein the antisense agent is single-stranded.

Embodiment 65.The method of embodiment 61, wherein the antisense agent is double -stranded.

Embodiment 66.The method of any of embodiments 61-65, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides.

Embodiment 67. The method of embodiment 66, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

Embodiment 68. The method of embodiment 67, wherein the modified sugar moiety is a bicyclic sugar moiety or a sugar moiety comprising a 2’-MOE sugar moiety.

Embodiment 69.The method of embodiment 67, wherein the modified sugar moiety comprises a 4'- CE^CEE)- 0-2' bridge or a 4'- (CEh) _n -0-2' bridge, wherein n is 1 or 2.

Embodiment 70. The method of any of embodiments 66-69, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

Embodiment 71. The method of embodiment 70, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 72. The method of any of embodiments 67-71, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.

Embodiment 73. The method of embodiment 72, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.

Embodiment 74.The method of any of embodiments 61-73, wherein the modified oligonucleotide has: a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; a 3’ wing segment consisting linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3 ’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

Embodiment 75. The method of any of embodiments 1-74, wherein the MARC1 specific inhibitor is administered parenterally. Embodiment 76. The method of embodiment 75, wherein the MARC1 specific inhibitor is administered parenterally by subcutaneous or intravenous administration.

Embodiment 77.The method of any of embodiments 1-76, comprising co-administering the MARC1 specific inhibitor and at least one additional therapy.

Embodiment 78.A method comprising administering a MARC1 antisense agent to a subject.

Embodiment 79. The method of embodiment 78, wherein the antisense agent comprises a modified oligonucleotide, wherein the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of any of SEQ ID NOs: 1-5.

Embodiment 80. The method of embodiment 79, wherein the modified oligonucleotide has a nucleobase sequence complementary to the nucleobase sequence of any of SEQ ID NOs: 3-5.

Embodiment 81. The method of any of embodiments 78-80, wherein the subject has a liver disease or is at risk for developing a liver disease.

Embodiment 82.The method of embodiment 81, wherein the liver disease is selected from fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH and NASH.

Embodiment 83. The method of any of embodiments 78-82, wherein a therapeutic amount of the MARC1 antisense agent is administered to the subject.

Embodiment 84.The method of any of embodiments 78-83, wherein the administration of the MARC1 specific inhibitor ameliorates at least one symptom of the liver disease.

Embodiment 85. The method of any of embodiments 78-84, wherein the administration of the MARC1 specific inhibitor reduces or improves hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAS, or plasma cholesterol levels, or a combination thereof.

Embodiment 86. The use of any of embodiments 78-85, wherein the MARC1 specific inhibitor reduces hepatic steatosis, reduces liver fibrosis, reduces triglyceride synthesis, reduces plasma lipid levels, reduces hepatic lipids, reduces ALT levels, improves NAS, or reduces plasma cholesterol levels, or a combination thereof.

Embodiment 87. The use of any of embodiments 78-86, wherein the MARC1 specific inhibitor reduces levels of hydroxyproline, reduces levels of Collal, reduces levels of ORO, or reduces levels total collagen in the liver, or a combination thereof.

Embodiment 88.The method of embodiment 87, wherein the subject has, or is at risk of having liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH or NASH.

Embodiment 89.The method of any of embodiments 78-87, wherein the antisense agent is single -stranded.

Embodiment 90.The method of embodiment 89, wherein the antisense agent is double -stranded.

Embodiment 91. The method of any of embodiments 78-90, wherein the modified oligonucleotide consists of 12 to 30 linked nucleosides. Embodiment 92.The method of any of embodiments 78-91, wherein at least one nucleoside of the modified oligonucleotide comprises a modified sugar moiety.

Embodiment 93.The method of embodiment 92, wherein the modified sugar moiety is a bicyclic sugar moiety or a sugar moiety comprising a 2’-MOE sugar moiety.

Embodiment 94. The method of embodiment 92, wherein the modified sugar moiety comprises a 4'- CH(CH3)- 0-2' bridge or a 4'- (CH2)n-0-2' bridge, wherein n is 1 or 2.

Embodiment 95.The method of any of embodiments 78-94, wherein at least one nucleoside of the modified oligonucleotide comprises a modified nucleobase.

Embodiment 96. The method of embodiment 95, wherein the modified nucleobase is a 5-methylcytosine.

Embodiment 97. The method of any of embodiments 78-96, wherein at least one intemucleoside linkage of the modified oligonucleotide is a modified intemucleoside linkage.

Embodiment 98. The method of embodiment 97, wherein the at least one modified intemucleoside linkage is a phosphorothioate intemucleoside linkage.

Embodiment 99.The method of any of embodiments 78-98, wherein the modified oligonucleotide has: a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; a 3’ wing segment consisting linked nucleosides; wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar moiety.

Embodiment 100. The method of any of embodiments 78-99, wherein the antisense agent.

Embodiment 101. The method of embodiment 100, wherein the MARC1 specific inhibitor is administered parenterally by subcutaneous or intravenous administration.

Embodiment 102.The method of any of embodiments 78-101, comprising co-administering the MARC1 specific inhibitor and at least one additional therapy.

Embodiment 103.The method of any of embodiments 78-102, wherein the subject is human.

Embodiment 104. The method or use of any of embodiments 9-103, wherein the antisense agent comprises a conjugate group.

Embodiment 105. The method or use of embodiment 104, wherein the conjugate group comprises N-acetyl galactosamine.

Embodiment 106. The method or use of any of embodiments 9-105, wherein the antisense agent is an RNase H agent capable of reducing the amount of MARC 1 nucleic acid through the activation of RNase H.

Detailed Description

It is to be understood that both the foregoing general description and the following detailed description are exemplary and explanatory only and are not restrictive of the embodiments, as claimed. Herein, the use of the singular includes the plural unless specifically stated otherwise. As used herein, the use of “or” means “and/or” unless stated otherwise. Furthermore, the use of the term “including” as well as other forms, such as “includes” and “included”, is not limiting.

The section headings used herein are for organizational purposes only and are not to be construed as limiting the subject matter described. All documents, or portions of documents, cited in this application, including, but not limited to, patents, patent applications, articles, books, treatises, and GenBank and NCBI reference sequence records are hereby expressly incorporated by reference for the portions of the document discussed herein, as well as in their entirety.

It is understood that the sequence set forth in each SEQ ID NO in the examples contained herein is independent of any modification to a sugar moiety, an intemucleoside linkage, or a nucleobase. As such, compounds defined by a SEQ ID NO may comprise, independently, one or more modifications to a sugar moiety, an intemucleoside linkage, or a nucleobase. Compounds described by ISIS/IONIS number (ISIS/ION #) indicate a combination of nucleobase sequence, chemical modification, and motif.

Unless otherwise indicated, the following terms have the following meanings:

“2’-deoxynucleoside” means a nucleoside comprising 2’-H(H) fiiranosyl sugar moiety, as found in naturally occurring deoxyribonucleic acids (DNA). In certain embodiments, a 2’-deoxynucleoside may comprise a modified nucleobase or may comprise an RNA nucleobase (uracil).

“2’-MOE” means a 2’-0CH2CH20CH3 group in place of the 2’-OH group of a fiiranosyl sugar moiety. A “2’-MOE sugar moiety” means a sugar moiety with a 2’-0CH2CH20CH3 group in place of the 2’- OH group of a fiiranosyl sugar moiety. Unless otherwise indicated, a 2’-MOE sugar moiety is in the b-D- ribosyl configuration. “MOE” means O-methoxyethyl. “2’-MOE nucleoside” (also 2’-0-methoxyethyl nucleoside) means a nucleoside comprising a 2’-MOE modified sugar moiety.

“2’-OMe” means a 2’-OCH3 group in place of the 2’-OH group of a fiiranosyl sugar moiety. A“2’-0- methyl sugar moiety” or “2’-OMe sugar moiety” means a sugar moiety with a 2’-OCH3 group in place of the 2’-OH group of a fiiranosyl sugar moiety. Unless otherwise indicated, a 2’-OMe sugar moiety is in the b-D- ribosyl configuration.

As used herein, “2’-OMe nucleoside” means a nucleoside comprising a 2’-OMe sugar moiety.

“2 ’-substituted nucleoside” or “2 -modified nucleoside” means a nucleoside comprising a 2 ’-substituted or 2’-modified sugar moiety. As used herein, “2’ -substituted” or “2 -modified” in reference to a sugar moiety means a sugar moiety comprising at least one 2'-substituent group other than H or OH.

“3’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 3 ’-most nucleotide of a particular compound.

“5’ target site” refers to the nucleotide of a target nucleic acid which is complementary to the 5 ’-most nucleotide of a particular compound.

“5-methylcytosine” means a cytosine with a methyl group attached to the 5 position. “About” means within ±10% of a value. For example, if it is stated, “the compounds affected about 70% inhibition of MARC 1”, it is implied that MARC1 levels are inhibited within a range of 60% and 80%.

“Administered concomitantly” or “co-administration” means administration of two or more compounds in any manner in which the pharmacological effects of both are manifest in the patient. Concomitant administration does not require that both compounds be administered in a single pharmaceutical composition, in the same dosage form, by the same route of administration, or at the same time. The effects of both compounds need not manifest themselves at the same time. The effects need only be overlapping for a period of time and need not be coextensive. Concomitant administration or co-administration encompasses administration in parallel or sequentially.

“Ameliorate” refers to an improving or lessening of at least one indicator, sign, or symptom of an associated disease, disorder, or condition. In certain embodiments, amelioration includes a delay or slowing in the progression or severity of one or more indicators of a condition or disease. The progression or severity of indicators may be determined by subjective or objective measures, which are known to those skilled in the art.

“Antisense activity” means any detectable and/or measurable change in an amount of a target nucleic acid, or protein encoded by such target nucleic acid, attributable to the hybridization of an antisense compound to its target nucleic acid. In certain embodiments, antisense activity is a decrease in the amount of a target nucleic acid, or protein encoded by such target nucleic acid, compared to the amount of target nucleic acid, or protein encoded by such target nucleic acid, in the absence of the antisense compound. In certain embodiments, the change is detectable in a cell that has been contacted with the antisense compound or a cell lysate thereof. In certain embodiments, the change is detectable in a biological sample obtained from a subject to whom the the antisense compound has been administered. Non-limiting examples of biological samples include a liver biopsy sample, a blood sample, a plasma/serum sample, a saliva sample, and a urine sample.

“Antisense agent” means an antisense compound and optionally one or more additional features, such as a sense compound. An antisense agent includes, but is not limited to, an RNAi agent and an RNase H agent.

“Antisense compound” means an oligonucleotide, such as an antisense oligonucleotide, and optionally one or more additional features, such as a conjugate group

“Sense compound” means a sense oligonucleotide and optionally one or more additional features, such as a conjugate group.

“Antisense inhibition” means reduction of target nucleic acid levels in the presence of an antisense compound complementary to a target nucleic acid compared to target nucleic acid levels in the absence of the antisense compound.

“Antisense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of an antisense compound, that is capable of hybridizing to a target nucleic acid and is capable of at least one antisense activity. “Sense oligonucleotide” means an oligonucleotide, including the oligonucleotide portion of a sense compound, that is capable of hybridizing to an antisense oligonucleotide. “Bicyclic nucleoside” or “BNA” means a nucleoside comprising a bicyclic sugar moiety. “Bicyclic sugar” or “bicyclic sugar moiety” means a modified sugar moiety comprising two rings, wherein the second ring is formed via a bridge connecting two of the atoms in the first ring thereby forming a bicyclic structure. In certain embodiments, the first ring of the bicyclic sugar moiety is a furanosyl moiety. In certain embodiments, the bicyclic sugar moiety does not comprise a furanosyl moiety.

“Branching group” means a group of atoms having at least 3 positions that are capable of forming covalent linkages to at least 3 groups. In certain embodiments, a branching group provides a plurality of reactive sites for connecting tethered ligands to an oligonucleotide via a conjugate linker and/or a cleavable moiety.

“Cell-targeting moiety” means a conjugate group or portion of a conjugate group that is capable of binding to a particular cell type or particular cell types.

“cEt” or “constrained ethyl” means a bicyclic furanosyl sugar moiety comprising a bridge connecting the 4’-carbon and the 2’-carbon, wherein the bridge has the formula: 4’-CH(CH ₃ )-0-2’.

“Chemical modification” in a compound describes the substitutions or changes through chemical reaction, of any of the units in the compound. “Modified nucleoside” means a nucleoside having, independently, a modified sugar moiety and/or modified nucleobase. “Modified oligonucleotide” means an oligonucleotide comprising at least one modified intemucleoside linkage, a modified sugar, and/or a modified nucleobase.

“Chemically distinct region” refers to a region of a compound that is in some way chemically different than another region of the same compound. For example, a region having 2’-0-methoxyethyl nucleotides is chemically distinct from a region having nucleotides without 2’-0-methoxyethyl modifications.

“Cleavable bond” means any chemical bond capable of being split. In certain embodiments, a cleavable bond is selected from among: an amide, a polyamide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, a di-sulfide, or a peptide.

“Cleavable moiety” means a bond or group of atoms that is cleaved under physiological conditions, for example, inside a cell, an animal, or a human.

As used herein, “complementary” in reference to an oligonucleotide means that at least 70% of the nucleobases of the oligonucleotide and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. “Complementary region” in reference to a region of an oligonucleotide means that at least 70% of the nucleobases of that region and the nucleobases of another nucleic acid or one or more regions thereof are capable of hydrogen bonding with one another when the nucleobase sequence of the oligonucleotide and the other nucleic acid are aligned in opposing directions. Complementary nucleobases mean nucleobases that are capable of forming hydrogen bonds with one another. Complementary nucleobase pairs include adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), 5-methyl cytosine (mC) and guanine (G). Certain modified nucleobases that pair with natural nucleobases or with other modified nucleobases are known in the art and are not considered complementary nucleobases as defined herein unless indicated otherwise. For example, inosine can pair, but is not considered complementary, with adenosine, cytosine, or uracil. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside. Rather, some mismatches are tolerated. As used herein, “fully complementary” or “100% complementary” in reference to oligonucleotides means that oligonucleotides are complementary to another oligonucleotide or nucleic acid at each nucleoside of the oligonucleotide.

“Conjugate group” means a group of atoms that is attached to an oligonucleotide. Conjugate groups include a conjugate moiety and a conjugate linker that attaches the conjugate moiety to the oligonucleotide.

“Conjugate linker” means a group of atoms comprising at least one bond that connects a conjugate moiety to an oligonucleotide.

“Conjugate moiety” means a group of atoms that is attached to an oligonucleotide via a conjugate linker.

"Contiguous" in the context of an oligonucleotide refers to nucleosides, nucleobases, sugar moieties, or intemucleoside linkages that are immediately adjacent to each other. For example, “contiguous nucleobases” means nucleobases that are immediately adjacent to each other in a sequence.

“Designing” or “Designed to” refer to the process of designing a compound that specifically hybridizes with a selected nucleic acid molecule.

“Diluent” means an ingredient in a composition that lacks pharmacological activity, but is pharmaceutically necessary or desirable. For example, the diluent in an injected composition can be a liquid, e.g. saline solution.

“Differently modified” mean chemical modifications or chemical substituents that are different from one another, including absence of modifications. Thus, for example, a MOE nucleoside and an unmodified DNA nucleoside are “differently modified,” even though the DNA nucleoside is unmodified. Likewise, DNA and RNA are “differently modified,” even though both are naturally-occurring unmodified nucleosides. Nucleosides that are the same but for comprising different nucleobases are not differently modified. For example, a nucleoside comprising a 2’-OMe modified sugar and an unmodified adenine nucleobase and a nucleoside comprising a 2’-OMe modified sugar and an unmodified thymine nucleobase are not differently modified.

“Dose” means a specified quantity of a compound or pharmaceutical agent provided in a single administration, or in a specified time period. In certain embodiments, a dose may be administered in two or more boluses, tablets, or injections. For example, in certain embodiments, where subcutaneous administration is desired, the desired dose may require a volume not easily accommodated by a single injection. In such embodiments, two or more injections may be used to achieve the desired dose. In certain embodiments, a dose may be administered in two or more injections to minimize injection site reaction in a subject. In other embodiments, the compound or pharmaceutical agent is administered by infusion over an extended period of time or continuously. Doses may be stated as the amount of pharmaceutical agent per hour, day, week or month. “Double -stranded” in reference to an antisense agent means the antisense agent has two oligonucleotides that are sufficiently complementary to each other to form a duplex.

“MARC1” means mitochondrial amidoxime-reducing component 1 and refers to any MARC1 nucleic acid or MARC1 protein. MARC1 is also known as MTARC1 and MOSC1. In certain embodiments, MARC1 includes a DNA sequence encoding MARC1, an RNA sequence transcribed from DNA encoding MARC1 (including genomic DNA comprising introns and exons), or a MARC1 protein. The target may be referred to in either upper or lower case.

“MARC 1 -specific inhibitor” refers to any agent capable of specifically reducing MARC1 RNA or MARC1 protein in a cell relative to a cell that is not exposed to the agent. MARC 1 -specific inhibitors include nucleic acids (including antisense compounds), peptides, antibodies, small molecules, and other agents capable of inhibiting the expression or activity of MARC 1.

“Efficacy” means the ability to produce a desired effect.

“Expression” includes all the functions by which a gene’s coded information is converted into structures present and operating in a cell. Such structures include, but are not limited to the products of transcription and translation.

“Gapmer” means a modified oligonucleotide comprising an internal region positioned between external regions having one or more nucleosides, wherein the nucleosides comprising the internal region are chemically distinct from the nucleoside or nucleosides comprising the external regions, and wherein the modified oligonucleotide supports RNAse H cleavage. The internal region may be referred to as the “gap” and the external regions may be referred to as the “wings.” In certain embodiments, the internal region is a deoxy region. The positions of the internal region or gap refer to the order of the nucleosides of the internal region and are counted starting from the 5 ’-end of the internal region. Unless otherwise indicated, “gapmer” refers to a sugar motif. In certain embodiments, each nucleoside of the gap is a 2’- -D-deoxynucleoside. In certain embodiments, the gap comprises one 2 ’-substituted nucleoside at position 1, 2, 3, 4, or 5 of the gap, and the remainder of the nucleosides of the gap are 2’- -D-deoxynucleosides. As used herein, the term “MOE gapmer” indicates a gapmer having a gap comprising 2’- -D-deoxynucleosides and wings comprising 2’-MOE nucleosides. As used herein, the term “mixed wing gapmer” indicates a gapmer having wings comprising modified nucleosides comprising at least two different sugar modifications. Unless otherwise indicated, a gapmer may comprise one or more modified intemucleoside linkages and/or modified nucleobases and such modifications do not necessarily follow the gapmer pattern of the sugar modifications.

“Hybridization” means annealing of oligonucleotides and/or nucleic acids. While not limited to a particular mechanism, the most common mechanism of hybridization involves hydrogen bonding, which may be Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding, between complementary nucleobases. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an antisense compound and a nucleic acid target. In certain embodiments, complementary nucleic acid molecules include, but are not limited to, an oligonucleotide and a nucleic acid target. “Immediately adjacent” means there are no intervening elements between the immediately adjacent elements of the same kind (e.g. no intervening nucleobases between the immediately adjacent nucleobases).

"Inhibiting the expression or activity" refers to a reduction or blockade of the expression or activity relative to the expression of activity in an untreated or control sample and does not necessarily indicate a total elimination of expression or activity.

“Intemucleoside linkage” means a group or bond that forms a covalent linkage between adjacent nucleosides in an oligonucleotide. “Modified intemucleoside linkage” means any intemucleoside linkage other than a naturally occurring, phosphate intemucleoside linkage. Non-phosphate linkages are referred to herein as modified intemucleoside linkages.

“Linked nucleosides” means adjacent nucleosides linked together by an intemucleoside linkage.

“Mismatch” or “non-complementary” means a nucleobase of a first oligonucleotide that is not complementary to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned. For example, nucleobases including but not limited to a universal nucleobase, inosine, and hypoxanthine, are capable of hybridizing with at least one nucleobase but are still mismatched or non-complementary with respect to nucleobase to which it hybridized. As another example, a nucleobase of a first oligonucleotide that is not capable of hybridizing to the corresponding nucleobase of a second oligonucleotide or target nucleic acid when the first and second oligonucleotides are aligned is a mismatch or non-complementary nucleobase.

“Modulating” refers to changing or adjusting a feature in a cell, tissue, organ or organism. For example, modulating MARC1 can mean to increase or decrease the level of MARC 1 in a cell, tissue, organ or organism. A “modulator” effects the change in the cell, tissue, organ or organism. For example, a compound can be a modulator of MARC 1 that decreases the amount of MARC 1 in a cell, tissue, organ or organism.

“Monomer” refers to a single unit of an oligomer. Monomers include, but are not limited to, nucleosides and nucleotides.

“Motif’ means the pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages, in an oligonucleotide.

“Natural” or “naturally occurring” means found in nature.

“Non-bicyclic modified sugar” or “non-bicyclic modified sugar moiety” means a modified sugar moiety that comprises a modification, such as a substituent, that does not form a bridge between two atoms of the sugar to form a second ring.

“Nucleic acid” refers to molecules composed of monomeric nucleotides. A nucleic acid includes, but is not limited to, ribonucleic acids (RNA), deoxyribonucleic acids (DNA), single -stranded nucleic acids, and double-stranded nucleic acids.

“Nucleobase” means an unmodified nucleobase or a modified nucleobase. A nucleobase is a heterocyclic moiety. As used herein an “unmodified nucleobase” is adenine (A), thymine (T), cytosine (C), uracil (U), or guanine (G). As used herein, a “modified nucleobase” is a group of atoms other than unmodified A, T, C, U, or G capable of pairing with at least one other nucleobase. A “5-methylcytosine” is a modified nucleobase. A universal base is a modified nucleobase that can pair with any one of the five unmodified nucleobases. “Nucleobase sequence” means the order of contiguous nucleobases in a nucleic acid or oligonucleotide independent of any sugar or intemucleoside linkage.

“Nucleoside” means a compound comprising a nucleobase and a sugar moiety. The nucleobase and sugar moiety are each, independently, unmodified or modified. “Modified nucleoside” means a nucleoside comprising a modified nucleobase and/or a modified sugar moiety. Modified nucleosides include abasic nucleosides, which lack a nucleobase.

“Oligonucleotide” means a strand of linked nucleosides connected via intemucleoside linkages, wherein each nucleoside and intemucleoside linkage may be modified or unmodified. Unless otherwise indicated, oligonucleotides consist of 8-50 linked nucleosides. As used herein, “modified oligonucleotide” means an oligonucleotide, wherein at least one nucleoside or intemucleoside linkage is modified. As used herein, “unmodified oligonucleotide” means an oligonucleotide that does not comprise any nucleoside modifications or intemucleoside modifications. “Parent oligonucleotide” means an oligonucleotide whose sequence is used as the basis of design for more oligonucleotides of similar sequence but with different lengths, motifs, and/or chemistries. The newly designed oligonucleotides may have the same or overlapping sequence as the parent oligonucleotide.

“Parenteral administration” means administration through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration, e.g. intrathecal or intracerebroventricular administration.

“Pharmaceutically acceptable carrier or diluent” means any substance suitable for use in administering to a subject. For example, a pharmaceutically acceptable carrier can be a sterile aqueous solution, such as PBS or water-for-injection.

“Pharmaceutically acceptable salts” means physiologically and pharmaceutically acceptable salts of compounds, such as oligomeric compounds or oligonucleotides, i.e., salts that retain the desired biological activity of the parent compound and do not impart undesired toxicological effects thereto.

“Pharmaceutical agent” means a compound that provides a therapeutic benefit when administered to a subject.

“Pharmaceutical composition” means a mixture of substances suitable for administering to a subject. For example, a pharmaceutical composition may comprise one or more compounds or salt thereof and a sterile aqueous solution.

“Phosphorothioate linkage” means a modified phosphate linkage in which one of the non-bridging oxygen atoms is replaced with a sulfur atom. A phosphorothioate intemucleoside linkage is a modified intemucleoside linkage. “Phosphorus moiety” means a group of atoms comprising a phosphorus atom. In certain embodiments, a phosphorus moiety comprises a mono-, di-, or tri-phosphate, or phosphorothioate.

“Portion” means a defined number of contiguous (i.e., linked) nucleobases of a nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of a target nucleic acid. In certain embodiments, a portion is a defined number of contiguous nucleobases of an oligomeric compound.

“Prodrug” means a compound in a form outside the body which, when administered to a subject, is metabolized to another form within the body or cells thereof. In certain embodiments, the metabolized form is the active, or more active, form of the compound (e.g., drug). Typically conversion of a prodrug within the body is facilitated by the action of an enzyme(s) (e.g., endogenous or viral enzyme) or chemical(s) present in cells or tissues, and/or by physiologic conditions.

“Reduce” means to bring down to a smaller extent, size, amount, or number. In certain embodiments, MARC1 (RNA or protein) is reduced in a cell or individual that is contacted or treated with a MARC1 specific inhibitor, respectively, relative to a cell or individual that is not contacted or treated with a MARC1 specific inhibitor, respectively.

“RNAi agent” means an antisense agent that acts, at least in part, through RISC or Ago2 to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. RNAi agents include, but are not limited to double-stranded siRNA, single -stranded RNAi (ssRNAi), and microRNA, including microRNA mimics. RNAi agents may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNAi agent modulates the amount and/or activity, of a target nucleic acid. The term RNAi agent excludes antisense agents that act through RNase H.

“RNase H agent” means an antisense agent that acts through RNase H to modulate a target nucleic acid and/or protein encoded by a target nucleic acid. In certain embodiments, RNase H agents are single-stranded. In certain embodiments, RNase H agents are double -stranded. RNase H compounds may comprise conjugate groups and/or terminal groups. In certain embodiments, an RNase H agent modulates the amount and/or activity of a target nucleic acid. The term RNase H agent excludes antisense agents that act principally through RISC/Ago2.

“RefSeq No.” is a unique combination of letters and numbers assigned to a sequence to indicate the sequence is for a particular target transcript (e.g., target gene). Such sequence and information about the target gene (collectively, the gene record) can be found in a genetic sequence database. Genetic sequence databases include the NCBI Reference Sequence database, GenBank, the European Nucleotide Archive, and the DNA Data Bank of Japan (the latter three forming the International Nucleotide Sequence Database Collaboration or INSDC).

“Region” is defined as a portion of the target nucleic acid having at least one identifiable structure, function, or characteristic.

“Segments” are defined as smaller or sub-portions of regions within a nucleic acid. “Single -stranded” in reference to an antisense agent means the antisense agent has only one oligonucleotide. “Self-complementary” means an oligonucleotide that at least partially hybridizes to itself. A compound consisting of one oligonucleotide, wherein the oligonucleotide of the compound is self complementary, is a single -stranded compound. A single-stranded compound may be capable of binding to a complementary compound to form a duplex.

“Sites,” are defined as unique nucleobase positions within a target nucleic acid.

“Specifically hybridizable” and “specific hybridization” refers to an oligonucleotide having a sufficient degree of complementarity between the oligonucleotide and a target nucleic acid to induce a desired effect, while exhibiting minimal or no effects on non-target nucleic acids. In certain embodiments, specific hybridization occurs under physiological conditions.

“Specifically inhibit” a target nucleic acid means to reduce or block expression of the target nucleic acid while exhibiting fewer, minimal, or no effects on non-target nucleic acids reduction and does not necessarily indicate a total elimination of the target nucleic acid’s expression.

“Subject” means a human or non-human subject selected for treatment or therapy.

“Sugar moiety” means an unmodified sugar moiety or a modified sugar moiety. “Unmodified sugar moiety” or “unmodified sugar” means a 2’-OH(H) fiiranosyl moiety, as found in RNA (an “unmodified RNA sugar moiety”), or a 2’-H(H) moiety, as found in DNA (an “unmodified DNA sugar moiety”). Unmodified sugar moieties have one hydrogen at each of the 1 ’, 3 ’, and 4’ positions, an oxygen at the 3 ’ position, and two hydrogens at the 5’ position. “Modified sugar moiety” or “modified sugar” means a modified fiiranosyl sugar moiety or a sugar surrogate. “Modified fiiranosyl sugar moiety” means a fiiranosyl sugar comprising a non hydrogen substituent in place of at least one hydrogen of an unmodified sugar moiety. In certain embodiments, a modified fiiranosyl sugar moiety is a 2 ’-substituted sugar moiety. Such modified fiiranosyl sugar moieties include bicyclic sugars and non-bicyclic sugars.

"Sugar surrogate" means a modified sugar moiety having other than a fiiranosyl moiety that can link a nucleobase to another group, such as an intemucleoside linkage, conjugate group, or terminal group in an oligonucleotide. Modified nucleosides comprising sugar surrogates can be incorporated into one or more positions within an oligonucleotide and such oligonucleotides are capable of hybridizing to complementary oligomeric compounds or nucleic acids.

“Target gene” refers to a gene encoding a target.

“Targeting” and “targeted” means specific hybridization of a compound that to a target nucleic acid in order to induce a desired effect.

“Target nucleic acid,” “target RNA,” “target RNA transcript” and “nucleic acid target” all mean a nucleic acid capable of being targeted by compounds described herein.

“Target region” means a portion of a target nucleic acid to which one or more compounds is targeted. “Target segment” means the sequence of nucleotides of a target nucleic acid to which a compound described herein is targeted. “5’ target site” refers to the 5 ’-most nucleotide of a target segment. “3’ target site” refers to the 3 ’-most nucleotide of a target segment.

"Terminal group" means a chemical group or group of atoms that is covalently linked to a terminus of an oligonucleotide.

“Therapeutically effective amount” means an amount of a compound, pharmaceutical agent, or composition that provides a therapeutic benefit to a subject.

“Treat” refers to administering a compound or pharmaceutical composition to a subject in order to effect an alteration or improvement of a disease, disorder, or condition in the subject.

Certain Embodiments

Certain embodiments provide methods, MARC 1 specific inhibitors, and compositions for treating a liver disease, metabolic disease, or cardiovascular disease condition, or a symptom thereof, in a subject by administering the compound or composition to the subject. Inhibition of MARC1 can lead to a decrease of MARC1 level or expression in order to treat a liver disease, metabolic disease, or cardiovascular disease or disorder, or a symptom thereof. In certain embodiments, MARC 1 -specific inhibitors are antisense agents, single-stranded antisense agents, double-stranded antisense agents, RNAi agents, RNase H agents, double- stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, antisense compounds, oligonucleotides, peptides, antibodies, small molecules, and other agents capable of inhibiting the expression or activity of MARC1. In certain embodiments, the subject is human. In certain embodiments, the antisense agent or RNAi agent comprises ribonucleotides and is double -stranded. In certain embodiments, the antisense agent, single- stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide.

In any of the foregoing embodiments, the modified oligonucleotide consists of 8 to 80, 10 to 30, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides.

In certain embodiments, at least one intemucleoside linkage of said modified oligonucleotide is a modified intemucleoside linkage. In certain embodiments, at least one intemucleoside linkage is a phosphorothioate intemucleoside linkage. In certain embodiments, the intemucleoside linkages are phosphorothioate linkages and phosphate ester linkages.

In certain embodiments, any of the foregoing oligonucleotides comprises at least one modified sugar. In certain embodiments, at least one modified sugar comprises a 2’-0-methoxyethyl group. In certain embodiments, at least one modified sugar is a bicyclic sugar, such as a 4’-CH(CH ₃ )-0-2’ group, a 4’-CH ₂ -0- 2’ group, or a 4’-(CH ₂ ) ₂ -0-2’group. In certain embodiments, at least one modified sugar comprises a 2’-F group or a 2’-OMe group. In certain embodiments, at least one nucleoside of said modified oligonucleotide comprises a modified nucleobase. In certain embodiments, the modified nucleobase is a 5-methylcytosine.

In certain embodiments, a compound or composition comprises a modified oligonucleotide comprising: a) a gap segment consisting of linked deoxynucleosides; b) a 5’ wing segment consisting of linked nucleosides; and c) a 3’ wing segment consisting of linked nucleosides. The gap segment is positioned between the 5 ’ wing segment and the 3 ’ wing segment and each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, at least one intemucleoside linkage is a phosphorothioate linkage. In certain embodiments, and at least one cytosine is a 5-methylcytosine.

In certain embodiments, the compounds or compositions disclosed herein further comprise a pharmaceutically acceptable carrier or diluent.

In certain embodiments, the compound or composition is co-administered with a second agent. In certain embodiments, the compound or composition and the second agent are administered concomitantly.

In certain embodiments, MARCl specific inhibitors can be used in methods of reducing expression of MARCl in a cell. In certain embodiments, MARCl specific inhibitors can be used in methods of treating a liver disease, metabolic disease, or cardiovascular disease or disorder including, but not limited to, metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, and NASH.

In certain embodiments, MARCl specific antisense agents can be used in methods of reducing expression of MARCl in a cell. In certain embodiments, MARCl specific antisense agents can be used in methods of treating a liver disease, metabolic disease, or cardiovascular disease or disorder including, but not limited to, metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, and NASH.

Certain Indications

Certain embodiments provided herein relate to methods of inhibiting MARC1 expression or activity, which can be useful for treating a disease associated with MARC1 in a subject, such as NASH, by administration of a MARC 1 specific inhibitor.

In certain embodiments, a method of inhibiting expression or activity of MARC 1 in a cell comprises contacting the cell with a compound or composition comprising a MARC 1 -specific inhibitor, thereby inhibiting expression or activity of MARCl in the cell. In certain embodiments, the cell is a hepatocyte cell. In certain embodiments, the cell is in the liver. In certain embodiments, the cell is in the liver of a subject who has, or is at risk of having a disease, disorder, condition, symptom, or physiological marker associated with a liver disease, metabolic disease, or cardiovascular disease or disorder. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the MARC 1 -specific inhibitor is an antisense agent, single-stranded antisense agent, double -stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single -stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARC1. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single -stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double-stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARC 1.

In certain embodiments, a method of treating one or more diseases, disorders, conditions, symptoms or physiological markers associated with MARC1 comprises administering to the subject a MARC 1 -specific inhibitor. In certain embodiments, a method of treating a disease, disorder, condition, symptom, or physiological marker associated with a liver disease, metabolic disease, or cardiovascular disease or disorder in a subject comprises administering to the subject a MARC 1 -specific inhibitor, thereby treating the disease. In certain embodiments, the subject is identified as having, or at risk of having, the disease, disorder, condition, symptom or physiological marker. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the MARC 1 -specific inhibitor is administered to the subject parenterally. In certain embodiments, the parenteral administration is subcutaneous administration. In certain embodiments, the subject is human. In certain embodiments, the MARC 1 -specific inhibitor is an antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double- stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARC 1. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double -stranded. In certain embodiments, the double -stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARC1. In certain embodiments, a method of reducing hepatic steatosis, liver fibrosis, hepatic triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), plasma cholesterol levels, or a combination thereof, in a subject comprises administering to the subject a MARC 1 -specific inhibitor. In certain embodiments, hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof, is reduced in a subject that is administered a MARC1 specific inhibitor, relative to hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof in the subject before administration. In certain embodiments, hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof, is reduced in a subject that is administered a MARC1 specific inhibitor, relative to hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof in a control subject that does not receive the MARC1 specific inhibitor. In certain embodiments, the subject is identified as having, or at risk of having a disease, disorder, condition, symptom, or physiological marker associated with a liver disease, metabolic disease, or cardiovascular disease or disorder. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the MARC 1 -specific inhibitor is administered to the subject parenterally. In certain embodiments, the parenteral administration is subcutaneous administration. In certain embodiments, the subject is human. In certain embodiments, the MARC 1 -specific inhibitor is an antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double -stranded siRNA, single- stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARCl. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double -stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARCL

Certain embodiments are drawn to compounds and compositions described herein for use in therapy. Certain embodiments are drawn to a compound or composition comprising a MARCl -specific inhibitor for use in treating one or more diseases, disorders, conditions, symptoms or physiological markers associated with MARC1. Certain embodiments are drawn to a compound or composition for use in treating a liver disease, metabolic disease, or cardiovascular disease or disorder, or a symptom or physiological marker thereof. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the MARC 1 -specific inhibitor is an antisense agent, single-stranded antisense agent, double- stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single -stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARC1. In certain embodiments, the antisense agent, single- stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double -stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARC1.

Certain embodiments are drawn to a MARC 1 -specific inhibitor or composition comprising a MARC1- specific inhibitor for use in reducing hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), plasma cholesterol levels, or triglyceride levels, or a combination thereof, in a subject. In certain embodiments, hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof, is reduced in a subj ect that is administered a MARC 1 specific inhibitor, relative to hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof in the subject before administration. In certain embodiments, hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof, is reduced in a subject that is administered a MARC1 specific inhibitor, relative to hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), or plasma cholesterol levels, or a combination thereof in a control subject that does not receive the MARC1 specific inhibitor. In certain embodiments, the compound or composition is provided for use in reducing hepatic steatosis in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing liver fibrosis in the subject. In certain embodiments, the compound or composition is provided for use in reducing triglyceride synthesis in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing lipid levels in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing hepatic lipids in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing ALT levels in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing NAFLD Activity Score in the subject. In certain embodiments, the compound or composition is provided for use in reducing plasma cholesterol levels in the subject. In certain embodiments, the MARC 1 -specific inhibitor or composition is provided for use in reducing triglyceride levels in the subject. In certain embodiments, the subject is identified as having, or at risk of having a disease, disorder, condition, symptom, or physiological marker associated with a liver disease, metabolic disease, or cardiovascular disease or disorder. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the subject is a human subject. In certain embodiments, the MARC 1 -specific inhibitor is an antisense agent, single-stranded antisense agent, double -stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single -stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARCl. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single -stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double-stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARC 1.

Certain embodiments are drawn to use of MARCl -specific inhibitors or compositions described herein for the manufacture or preparation of a medicament for therapy. Certain embodiments are drawn to the use of a MARCl -specific inhibitor or composition as described herein in the manufacture or preparation of a medicament for treating one or more diseases, disorders, conditions, symptoms or physiological markers associated with MARCL In certain embodiments, the compound or composition as described herein is used in the manufacture or preparation of a medicament for treating a liver disease, metabolic disease, or cardiovascular disease or disorder, or a symptom or physiological marker thereof. In certain embodiments, the liver disease, metabolic disease, or cardiovascular disease or disorder is metabolic syndrome, liver disease, fatty liver disease, chronic liver disease, liver cirrhosis, hepatic steatosis, steatohepatitis, NAFLD, ASH, or NASH. In certain embodiments, the liver disease is NASH. In certain embodiments, the MARCl -specific inhibitor is an antisense agent, single-stranded antisense agent, double -stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single -stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARC1. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single-stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double-stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double-stranded siRNA targeted to MARC 1.

Certain embodiments are drawn to the use of a MARC 1 -specific inhibitor or composition for the manufacture or preparation of a medicament for reducing hepatic steatosis, liver fibrosis, triglyceride synthesis, plasma lipid levels, hepatic lipids, ALT levels, NAFLD Activity Score (NAS), plasma cholesterol levels, or triglyceride levels, or a combination thereof, in a subject having or at risk of having a liver disease, metabolic disease, or cardiovascular disease or disorder. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor or composition in the manufacture or preparation of a medicament for reducing hepatic steatosis in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing liver fibrosis in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing triglyceride synthesis in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing lipid levels in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing hepatic lipids in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing ALT levels in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing NAFLD Activity Score in the subject. Certain embodiments are drawn to use of a compound or composition in the manufacture or preparation of a medicament for reducing plasma cholesterol levels in the subject. Certain embodiments are drawn to use of a MARC 1 -specific inhibitor in the manufacture or preparation of a medicament for reducing triglyceride levels in the subject. In certain embodiments, the compound or composition comprises an antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double-stranded siRNA, single-stranded RNAi (ssRNAi), microRNA, antisense compound, peptide, antibody, small molecule or other agent capable of inhibiting the expression or activity of the MARC1. In certain embodiments, the antisense agent, single-stranded antisense agent, double-stranded antisense agent, RNAi agent, RNase H agent, double -stranded siRNA, single -stranded RNAi (ssRNAi), microRNA, or antisense compound comprises a modified oligonucleotide consisting of 8 to 80 linked nucleosides. In certain embodiments, the modified oligonucleotide consists of 10 to 30 linked nucleosides. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be single -stranded. In certain embodiments, the antisense agent comprising a modified oligonucleotide can be double-stranded. In certain embodiments, the double-stranded antisense agent comprises an antisense compound and a sense compound. In certain embodiments, the antisense agent is a double -stranded siR A targeted to MARC1.

In any of the foregoing methods or uses, the antisense agent can comprise an antisense compound targeted to MARC1. In certain embodiments, the antisense compound comprises an oligonucleotide, for example an oligonucleotide consisting of 8 to 80 linked nucleosides, 10 to 30 linked nucleosides, 12 to 30 linked nucleosides, or 20 linked nucleosides. In certain embodiments, the oligonucleotide comprises at least one modified intemucleoside linkage, at least one modified sugar and/or at least one modified nucleobase. In certain embodiments, the modified intemucleoside linkage is a phosphorothioate intemucleoside linkage, the modified sugar is a bicyclic sugar or a 2’-0-methoxyethyl, and the modified nucleobase is a 5-methylcytosine. In certain embodiments, the modified oligonucleotide comprises a gap segment consisting of linked deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides, wherein the gap segment is positioned immediately adjacent to and between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar. In certain embodiments, the antisense agent is single-stranded. In certain embodiments, the antisense agent is double -stranded. In certain embodiments, the modified oligonucleotide consists of 12 to 30 linked nucleosides. In certain embodiments, compositions disclosed herein comprise an antisense agent described herein and a pharmaceutically acceptable carrier or diluent.

In any of the foregoing methods or uses, the compound or composition comprises or consists of a modified oligonucleotide 12 to 30 linked nucleosides in length, wherein the modified oligonucleotide comprises: a gap segment consisting of linked 2’-deoxynucleosides; a 5’ wing segment consisting of linked nucleosides; and a 3’ wing segment consisting of linked nucleosides; wherein the gap segment is positioned between the 5’ wing segment and the 3’ wing segment and wherein each nucleoside of each wing segment comprises a modified sugar.

In any of the foregoing methods or uses, the compound or composition can be administered parenterally. For example, in certain embodiments the compound or composition can be administered through injection or infusion. Parenteral administration includes subcutaneous administration, intravenous administration, intramuscular administration, intraarterial administration, intraperitoneal administration, or intracranial administration. In certain embodiments, the parenteral administration is subcutaneous administration. In certain embodiments, the compound or composition is co-administered with a second agent. In certain embodiments, the compound or composition and the second agent are administered concomitantly. Certain Compounds

In certain embodiments, antisense agents described herein comprise antisense compounds. In certain embodiments, the antisense compound comprises a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, an antisense agent described herein comprises or consists of a modified oligonucleotide. In certain embodiments, the modified oligonucleotide has a nucleobase sequence complementary to that of a target nucleic acid.

In certain embodiments, an antisense agent is single-stranded. In certain embodiments, a single- stranded antisense agent comprises or consists of an antisense compound. In certain embodiments, such an antisense compound comprises or consists of an oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide of a single-stranded antisense agent or antisense compound comprises a self complementary nucleobase sequence. In certain embodiments, a single-stranded antisense agent comprises an antisense compound, which comprises a modified oligonucleotide and a conjugate group.

In certain embodiments, antisense agents are double-stranded. In certain embodiments, double- stranded antisense agents comprise a first modified oligonucleotide having a region complementary to a target nucleic acid and a second modified oligonucleotide having a region complementary to the first modified oligonucleotide. In certain embodiments, the modified oligonucleotide is an RNA oligonucleotide. In such embodiments, the thymine nucleobase in the modified oligonucleotide is replaced by a uracil nucleobase. In certain embodiments, a double-stranded antisense agent comprises a conjugate group. In certain embodiments, a double-stranded antisense agent comprises an antisense compound and a sense compound, wherein the sense compound comprises a conjugate group. In certain embodiments, each modified oligonucleotide is 12-30 linked nucleosides in length.

Examples of single-stranded and double-stranded antisense agents include but are not limited to oligonucleotides, siRNAs, microRNA targeting oligonucleotides, and single-stranded RNAi compounds, such as small hairpin RNAs (shRNAs), single-stranded siRNAs (ssRNAs), and microRNA mimics.

In certain embodiments, an antisense agent described herein comprises an oligonucleotide having a nucleobase sequence that, when written in the 5 ’ to 3 ’ direction, comprises the reverse complement of the target segment of a target nucleic acid to which it is targeted.

In certain embodiments, an antisense agent, antisense compound, or sense compound described herein comprises an oligonucleotide consisting of 10 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 12 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 12 to 22 linked nucleosides. In certain embodiments, the oligonucleotide consists of 14 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 14 to 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 15 to 30 linked linked nucleosides. In certain embodiments, the oligonucleotide consists of 15 to 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 16 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 16 to 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 17 to 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 to 30 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 to 21 linked nucleosides. In certain embodiments, the oligonucleotide consists of 18 to 20 linked nucleosides. In certain embodiments, the oligonucleotide consists of 20 to 30 linked nucleosides. In certain embodiments, oligonucleotides consist of 12 to 30 linked nucleosides, 14 to 30 linked nucleosides, 14 to 20 linked nucleosides, 15 to 30 linked nucleosides, 15 to 20 linked nucleosides, 16 to 30 linked nucleosides, 16 to 20 linked nucleosides, 17 to 30 linked nucleosides, 17 to 20 linked nucleosides, 18 to 30 linked nucleosides, 18 to 20 linked nucleosides, 18 to 21 linked nucleosides, 20 to 30 linked nucleosides, or 12 to 22 linked nucleosides. In certain embodiments, an oligonucleotide consists of 14 linked nucleosides. In certain embodiments, an oligonucleotide consists of 16 linked nucleosides. In certain embodiments, an oligonucleotide consists of 17 linked nucleosides. In certain embodiments, an oligonucleotide consists of 18 linked nucleosides. In certain embodiments, an oligonucleotide consists of 19 linked nucleosides. In certain embodiments, an oligonucleotide consists of 20 linked nucleosides. In other embodiments, an oligonucleotide consists of 8 to 80, 12 to 50, 13 to 30, 13 to 50, 14 to 30, 14 to 50, 15 to 30, 15 to 50, 16 to 30, 16 to 50, 17 to 30, 17 to 50, 18 to 22, 18 to 24, 18 to 30, 18 to 50, 19 to 22, 19 to 30, 19 to 50, or 20 to 30 linked nucleosides. In certain such embodiments, an oligonucleotide consists of 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50, 51, 52, 53, 54,

55, 56, 57, 58, 59, 60, 61, 62, 63, 64, 65, 66, 67, 68, 69, 70, 71, 72, 73, 74, 75, 76, 77, 78, 79, or 80 linked nucleosides, or a range defined by any two of the above values. In certain embodiments, the oligonucleotide is a modified oligonucleotide. In certain embodiments, the oligonucleotide is an antisense oligonucleotide. In certain embodiments, the oligonucleotide is a sense oligonucleotide.

In certain embodiments, antisense agents described herein are interfering RNA compounds (RNAi), which include double-stranded RNA compounds (also referred to as short-interfering RNA or siRNA) and single-stranded RNAi compounds (or ssRNA). Such compounds work at least in part through the RISC pathway to degrade and/or sequester a target nucleic acid (thus, include microRNA/microRNA-mimic compounds). As used herein, the term siRNA is meant to be equivalent to other terms used to describe nucleic acid molecules that are capable of mediating sequence specific RNAi, for example short interfering RNA (siRNA), double -stranded RNA (dsRNA), micro-RNA (miRNA), short hairpin RNA (shRNA), short interfering oligonucleotide, short interfering nucleic acid, short interfering modified oligonucleotide, chemically modified siRNA, post-transcriptional gene silencing RNA (ptgsRNA), and others. In addition, as used herein, the term RNAi is meant to be equivalent to other terms used to describe sequence specific RNA interference, such as post transcriptional gene silencing, translational inhibition, or epigenetics.

In certain embodiments, a double-stranded antisense agent comprises a first strand comprising the nucleobase sequence complementary to a target region of a MARC1 nucleic acid and a second strand. In certain embodiments, the double-stranded compound comprises ribonucleotides in which the first strand has uracil (U) in place of thymine (T) and is complementary to a target region. In certain embodiments, a double- stranded compound comprises (i) a first strand comprising a nucleobase sequence complementary to a target region of a MARC1 nucleic acid, and (ii) a second strand. In certain embodiments, the double -stranded antisense agent comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, the double-stranded antisense agent comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the dsRNA compound. In certain embodiments, the double-stranded antisense agent comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The double-stranded compounds may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the dsRNA contains one or two capped strands, as disclosed, for example, by WO 00/63364, filed Apr. 19, 2000. In certain embodiments, the first strand of the double-stranded antisense agent is an siRNA guide strand and the second strand of the double -stranded compound is an siRNA passenger strand. In certain embodiments, the second strand of the double-stranded antisense agent is complementary to the first strand. In certain embodiments, each strand of the double-stranded antisense agent consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.

In certain embodiments, a single-stranded antisense agent described herein can comprise any of the oligonucleotide sequences targeted to MARC1 described herein. In certain embodiments, such a single- stranded antisense agent is a single-stranded RNAi (ssRNAi) agent. In certain embodiments, a ssRNAi agent comprises the nucleobase sequence complementary to a target region of a MARC1 nucleic acid. In certain embodiments, the ssRNAi agent comprises ribonucleotides in which uracil (U) is in place of thymine (T). In certain embodiments, ssRNAi agent comprises a nucleobase sequence complementary to a target region of a MARC1 nucleic acid. In certain embodiments, a ssRNAi agent comprises one or more modified nucleotides in which the 2' position in the sugar contains a halogen (such as fluorine group; 2’-F) or contains an alkoxy group (such as a methoxy group; 2’-OMe). In certain embodiments, a ssRNAi agent comprises at least one 2’-F sugar modification and at least one 2’-OMe sugar modification. In certain embodiments, the at least one 2’-F sugar modification and at least one 2’-OMe sugar modification are arranged in an alternating pattern for at least 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 contiguous nucleobases along a strand of the ssRNAi agent. In certain embodiments, the ssRNAi agent comprises one or more linkages between adjacent nucleotides other than a naturally-occurring phosphodiester linkage. Examples of such linkages include phosphoramide, phosphorothioate, and phosphorodithioate linkages. The ssRNAi agents may also be chemically modified nucleic acid molecules as taught in U.S. Pat. No. 6,673,661. In other embodiments, the ssRNAi agent contains a capped strand, as disclosed, for example, by WO 00/63364, fded Apr. 19, 2000. In certain embodiments, the ssRNAi agent consists of 16, 17, 18, 19, 20, 21, 22, or 23 linked nucleosides.

In certain embodiments, antisense agents described herein comprise modified oligonucleotides. Certain modified oligonucleotides have one or more asymmetric center and thus give rise to enantiomers, diastereomers, and other stereoisomeric configurations that may be defined, in terms of absolute stereochemistry, as (R) or (S), as a or b such as for sugar anomers, or as (D) or (L) such as for amino acids etc. Included in the modified oligonucleotides provided herein are all such possible isomers, including their racemic and optically pure forms, unless specified otherwise. Likewise, all cis- and trans-isomers and tautomeric forms are also included.

Certain Mechanisms

In certain embodiments, antisense agents described herein selectively affect one or more target nucleic acid. Such selective antisense agents comprise a nucleobase sequence that hybridizes to one or more target nucleic acid, resulting in one or more desired antisense activity and does not hybridize to one or more non target nucleic acid or does not hybridize to one or more non-target nucleic acid in such a way that results in a significant undesired antisense activity.

In certain antisense activities, hybridization of an antisense agent described herein to a target nucleic acid results in recruitment of a protein that cleaves the target nucleic acid. For example, certain antisense agents described herein result in RNase H mediated cleavage of the target nucleic acid. RNase H is a cellular endonuclease that cleaves the RNA strand of an RNA:DNA duplex. The DNA in such an RNA:DNA duplex need not be unmodified DNA. In certain embodiments, antisense agents described herein are sufficiently “DNA-like” to elicit RNase H activity. Further, in certain embodiments, one or more non-DNA-like nucleoside in the gap of a gapmer is tolerated.

In certain antisense activities, antisense agents described herein or a portion of the antisense agent is loaded into an RNA-induced silencing complex (RISC), ultimately resulting in cleavage of the target nucleic acid. For example, certain antisense agents described herein result in cleavage of the target nucleic acid by Argonaute. In certain embodiments, antisense agents that are loaded into RISC are RNAi agents. RNAi agents may be double-stranded (siRNA) or single-stranded (ssRNA).

In certain embodiments, hybridization of antisense agents described herein to a target nucleic acid does not result in recruitment of a protein that cleaves that target nucleic acid. In certain such embodiments, hybridization of the antisense agents to the target nucleic acid results in alteration of splicing of the target nucleic acid. In certain embodiments, hybridization of the antisense agents to a target nucleic acid results in inhibition of a binding interaction between the target nucleic acid and a protein or other nucleic acid. In certain such embodiments, hybridization of the antisense agents to a target nucleic acid results in alteration of translation of the target nucleic acid. Antisense activities may be observed directly or indirectly. In certain embodiments, observation or detection of an antisense activity involves observation or detection of a change in an amount of a target nucleic acid or protein encoded by such target nucleic acid, a change in the ratio of splice variants of a nucleic acid or protein, and/or a phenotypic change in a cell or individual.

Target Nucleic Acids, Target Regions and Nucleotide Sequences

In certain embodiments, antisense agents described herein comprise or consist of an oligonucleotide comprising a region that is complementary to a MARC1 nucleic acid.

Nucleotide sequences that encode MARC1 include, without limitation, the following RefSEQ Nos.: ENSEMBL Accession No. ENSMUSG00000026621.13 from version 102: November 2020 (incorporated by reference, disclosed herein as SEQ ID NO: 1); GENBANK Accession No. NM_001290273.1 (incorporated by reference, disclosed herein as SEQ ID NO: 2); NM_022746.4 (incorporated by reference, disclosed herein as SEQ ID NO: 3), ENSEMBL Accession No. ENSG00000186205.13 from version 103: February 2021 (incorporated by reference, disclosed herein as SEQ ID NO: 4); and GenBank RefSeq NC_000001.11 truncated from 220786697 to 220819659 (incorporated by reference, disclosed herein as SEQ ID NO: 5).

Hybridization

In some embodiments, hybridization occurs between an antisense agent disclosed herein and a MARC1 nucleic acid. The most common mechanism of hybridization involves hydrogen bonding (e.g., Watson-Crick, Hoogsteen or reversed Hoogsteen hydrogen bonding) between complementary nucleobases of the nucleic acid molecules.

Hybridization can occur under varying conditions. Hybridization conditions are sequence-dependent and are determined by the nature and composition of the nucleic acid molecules to be hybridized.

Methods of determining whether a sequence is specifically hybridizable to a target nucleic acid are well known in the art. In certain embodiments, the antisense agents provided herein are specifically hybridizable with a MARCl nucleic acid.

Complementarity

An oligonucleotide is said to be complementary to another nucleic acid when the nucleobase sequence of such oligonucleotide or one or more regions thereof matches the nucleobase sequence of another oligonucleotide or nucleic acid or one or more regions thereof when the two nucleobase sequences are aligned in opposing directions. Nucleobase matches or complementary nucleobases, as described herein, are limited to adenine (A) and thymine (T), adenine (A) and uracil (U), cytosine (C) and guanine (G), and 5-methylcytosine (mC) and guanine (G) unless otherwise specified. Complementary oligonucleotides and/or nucleic acids need not have nucleobase complementarity at each nucleoside and may include one or more nucleobase mismatches. An oligonucleotide is fully complementary or 100% complementary when such oligonucleotides have nucleobase matches at each nucleoside without any nucleobase mismatches. In certain embodiments, antisense agents described herein comprise or consist of modified oligonucleotides. In certain embodiments, antisense agents described herein are antisense compounds. Non complementary nucleobases between an oligonucleotide and a MARC1 nucleic acid may be tolerated provided that the oligonucleotide remains able to specifically hybridize to a target nucleic acid. Moreover, an oligonucleotide may hybridize over one or more segments of a MARC1 nucleic acid such that intervening or adjacent segments are not involved in the hybridization event (e.g., a loop structure, mismatch or hairpin structure).

In certain embodiments, an oligonucleotide provided herein, or a specified portion thereof, are, or are at least, 70%, 80%, 85%, 86%, 87%, 88%, 89%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or 100% complementary to a MARC1 nucleic acid, a target region, target segment, or specified portion thereof. Percent complementarity of an oligonucleotide with a target nucleic acid can be determined using routine methods.

For example, an oligonucleotide in which 18 of 20 nucleobases of the oligonucleotide are complementary to a target region, and would therefore specifically hybridize, would represent 90 percent complementarity. In this example, the remaining non-complementary nucleobases may be clustered or interspersed with complementary nucleobases and need not be contiguous to each other or to complementary nucleobases. As such, an oligonucleotide which is 18 nucleobases in length having four non-complementary nucleobases which are flanked by two regions of complete complementarity with the target nucleic acid would have 77.8% overall complementarity with the target nucleic acid and would thus fall within the scope of the present invention. Percent complementarity of a oligonucleotide with a region of a target nucleic acid can be determined routinely using BLAST programs (basic local alignment search tools) and PowerBLAST programs known in the art (Altschul etal., J. Mol. Biol., 1990, 215, 403 410; Zhang and Madden, Genome Res., 1997, 7, 649 656). Percent homology, sequence identity or complementarity, can be determined by, for example, the Gap program (Wisconsin Sequence Analysis Package, Version 8 for Unix, Genetics Computer Group, University Research Park, Madison Wis.), using default settings, which uses the algorithm of Smith and Waterman (Adv. Appl. Math., 1981, 2, 482489).

In certain embodiments, oligonucleotides described herein, or specified portions thereof, are fully complementary (i.e. 100% complementary) to a target nucleic acid, or specified portion thereof. For example, an oligonucleotide may be fully complementary to a MARCl nucleic acid, or a target region, or a target segment or target sequence thereof. As used herein, “fully complementary” means each nucleobase of an oligonucleotide is capable of precise base pairing with the corresponding nucleobases of a target nucleic acid. For example, a 20 nucleobase oligonucleotide is fully complementary to a target sequence that is 400 nucleobases long, so long as there is a corresponding 20 nucleobase portion of the target nucleic acid that is fully complementary to the oligonucleotide. Fully complementary can also be used in reference to a specified portion of the first and /or the second nucleic acid. For example, a 20 nucleobase portion of a 30 nucleobase oligonucleotide can be “fully complementary” to a target sequence that is 400 nucleobases long. The 20 nucleobase portion of the 30 nucleobase oligonucleotide is fully complementary to the target sequence if the target sequence has a corresponding 20 nucleobase portion wherein each nucleobase is complementary to the 20 nucleobase portion of the oligonucleotide. At the same time, the entire 30 nucleobase oligonucleotide may or may not be fully complementary to the target sequence, depending on whether the remaining 10 nucleobases of the oligonucleotide are also complementary to the target sequence.

In certain embodiments, antisense agents described herein comprise one or more mismatched nucleobases relative to the target nucleic acid. In certain such embodiments, antisense activity against the target is reduced by such mismatch, but activity against a non-target is reduced by a greater amount. Thus, in certain such embodiments selectivity of the antisense agent is improved. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, or 8 from the 5’-end of the gap region. In certain such embodiments, the mismatch is at position 9, 8, 7, 6, 5, 4, 3, 2, 1 from the 3 ’-end of the gap region. In certain such embodiments, the mismatch is at position 1, 2, 3, or 4 from the 5’-end of the wing region. In certain such embodiments, the mismatch is at position 4, 3, 2, or 1 from the 3 ’-end of the wing region. In certain embodiments, the mismatch is specifically positioned within an oligonucleotide not having a gapmer motif. In certain such embodiments, the mismatch is at position 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 5 ’-end of the oligonucleotide. In certain such embodiments, the mismatch is at position, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, or 12 from the 3’-end of the oligonucleotide.

The location of a non-complementary nucleobase may be at the 5’ end or 3’ end of the oligonucleotide. Alternatively, the non-complementary nucleobase or nucleobases may be at an internal position of the oligonucleotide. When two or more non-complementary nucleobases are present, they may be contiguous (i.e. linked) or non-contiguous. In one embodiment, a non-complementary nucleobase is located in the wing segment of a gapmer oligonucleotide.

In certain embodiments, oligonucleotides described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 nucleobases in length comprise no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a MARC1 nucleic acid, or specified portion thereof.

In certain embodiments, oligonucleotides described herein that are, or are up to 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleobases in length comprise no more than 6, no more than 5, no more than 4, no more than 3, no more than 2, or no more than 1 non-complementary nucleobase(s) relative to a target nucleic acid, such as a MARC 1 nucleic acid, or specified portion thereof.

In certain embodiments, oligonucleotides described herein also include those which are complementary to a portion of a target nucleic acid. As used herein, “portion” refers to a defined number of contiguous (i.e. linked) nucleobases within a region or segment of a target nucleic acid. A “portion” can also refer to a defined number of contiguous nucleobases of an oligonucleotide. In certain embodiments, the oligonucleotides are complementary to at least an 8 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 9 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 10 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least an 11 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 12 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 13 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 14 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 15 nucleobase portion of a target segment. In certain embodiments, the oligonucleotides are complementary to at least a 16 nucleobase portion of a target segment. Also contemplated are oligonucleotides that are complementary to at least a 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, 20, or more nucleobase portion of a target segment, or a range defined by any two of these values.

Identity

The oligonucleotides provided herein may also have a defined percent identity to a particular nucleotide sequence, SEQ ID NO, or compound represented by a specific ION number, or portion thereof. An oligonucleotide is identical to a sequence disclosed herein if it has the same nucleobase pairing ability. For example, a RNA which contains uracil in place of thymidine in a disclosed DNA sequence would be considered identical to the DNA sequence since both uracil and thymidine pair with adenine. Shortened and lengthened versions of the oligonucleotides described herein as well as oligonucleotides having non-identical bases relative to the oligonucleotides provided herein also are contemplated. The non-identical bases may be adjacent to each other or dispersed throughout the oligonucleotide. Percent identity of an oligonucleotide is calculated according to the number of bases that have identical base pairing relative to the sequence to which it is being compared.

Certain Modified Oligonucleotides

In certain embodiments, antisense agents and antisense compounds described herein comprise or consist of oligonucleotides consisting of linked nucleosides. Oligonucleotides may be unmodified oligonucleotides (RNA or DNA) or may be modified oligonucleotides. Modified oligonucleotides comprise at least one modification relative to unmodified RNA or DNA (i.e., comprise at least one modified nucleoside (comprising a modified sugar moiety and/or a modified nucleobase) and/or at least one modified intemucleoside linkage).

A. Modified Nucleosides

Modified nucleosides comprise a modified sugar moiety or a modified nucleobase or both a modifed sugar moiety and a modified nucleobase.

1. Modified Sugar Moieties In certain embodiments, sugar moieties are non-bi cyclic modified sugar moieties. In certain embodiments, modified sugar moieties are bicyclic or tricyclic sugar moieties. In certain embodiments, modified sugar moieties are sugar surrogates. Such sugar surrogates may comprise one or more substitutions corresponding to those of other types of modified sugar moieties.

In certain embodiments, modified sugar moieties are non-bicyclic modified sugar moieties comprising a furanosyl ring with one or more acyclic substituent, including but not limited to substituents at the 2 ’ , 4 ’ , and/or 5 ’ positions . In certain embodiments one or more acyclic substituent of non-bicyclic modified sugar moieties is branched. Examples of 2 ’-substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 2’-F, 2'-0O¾ (“OMe” or “O-methyl”), and 2'-0(0H ₂ ) ₂ 0O¾ (“MOE”). In certain embodiments, 2 ’-substituent groups are selected from among: halo, allyl, amino, azido, SH, CN, OCN, CF3, OCF3, O-Ci-Cio alkoxy, O-Ci-Cio substituted alkoxy, O-Ci-Cio alkyl, O-Ci-Cio substituted alkyl, S-alkyl, N(R _m )-alkyl, O-alkenyl, S-alkenyl, N(R _m )-alkenyl, O-alkynyl, S-alkynyl, N(R _m )-alkynyl, O-alkylenyl-O-alkyl, alkynyl, alkaryl, aralkyl, O-alkaryl, O-aralkyl, ( CEEESCEE, 0(CH ₂ ) ₂ 0N(R _m )(Rn) or OCH ₂ C(=0)-N(R _m )(Rn), where each R _m and R _n is, independently, H, an amino protecting group, or substituted or unsubstituted C1-C10 alkyl, and the 2 ’-substituent groups described in Cook et ah, U.S. 6,531,584; Cook et ah, U.S. 5,859,221; and Cook et ah, U.S. 6,005,087. Certain embodiments of these 2'-substituent groups can be further substituted with one or more substituent groups independently selected from among: hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro (NO2), thiol, thioalkoxy, thioalkyl, halogen, alkyl, aryl, alkenyl and alkynyl. Examples of 4’- substituent groups suitable for linearlynon-bicyclic modified sugar moieties include but are not limited to alkoxy ( e.g ., methoxy), alkyl, and those described in Manoharan et ah, WO 2015/106128. Examples of 5’- substituent groups suitable for non-bicyclic modified sugar moieties include but are not limited to: 5 ’-methyl (R or S), 5'-vinyl, and 5 ’-methoxy. In certain embodiments, non-bicyclic modified sugars comprise more than one non-bridging sugar substituent, for example, 2'-F-5'-methyl sugar moieties and the modified sugar moieties and modified nucleosides described in Migawa et ah, WO 2008/101157 and Rajeev et ak, US2013/0203836.

In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, NEE, N ₃ , OCF _3, OCH ₃ , 0(CH ₂ )3NH ₂ , CH ₂ CH=CH ₂ , OCH ₂ CH=CH ₂ , OCH ₂ CH ₂ OCH3, 0(CH ₂ ) ₂ SCH3, 0(CH ₂ ) ₂ 0N(R _m )(R _n ),

OfUEEEOfUEbENfUEEK and N-substituted acetamide (OCH ₂ C(=0)-N(R _m )(Rn)), where each R _m and R _n is, independently, H, an amino protecting group, or substituted or unsubstituted C ₁ -C ₁₀ alkyl.

In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, OCF3 _, OCH3, OCH2CH2OCH3, 0(CH ₂ ) ₂ SCH3, 0(CH ₂ )20N(CH ₃ )2, 0(CH2)20(CH ₂ )2N(CH ₃ )2, and 0CH ₂ C(=0)-N(H)CH ₃ (“NMA”).

In certain embodiments, a 2 ’-substituted nucleoside or 2’- non-bicyclic modified nucleoside comprises a sugar moiety comprising a linear 2 ’-substituent group selected from: F, OCH ₃ , and OCH ₂ CH ₂ OCH3. Nucleosides comprising modified sugar moieties, such as non-bicyclic modified sugar moieties, are referred to by the position(s) of the substitution(s) on the sugar moiety of the nucleoside. For example, nucleosides comprising 2 ’-substituted or 2-modified sugar moieties are referred to as 2 ’-substituted nucleosides or 2-modified nucleosides.

Certain modifed sugar moieties comprise a bridging sugar substituent that forms a second ring resulting in a bicyclic sugar moiety. In certain such embodiments, the bicyclic sugar moiety comprises a bridge between the 4' and the 2' furanose ring atoms. Examples of such 4’ to 2’ bridging sugar substituents include but are not limited to: 4'-CH ₂ -2', 4'-(CH ₂ ) ₂ -2', 4'-(CH ₂ ) ₃ -2', 4'-CH ₂ -0-2' (“LNA”), 4'-CH ₂ -S-2', 4'-(CH ₂ ) ₂ -0-2' (“ENA”), 4'-CH(CH ₃ )-0-2' (referred to as “constrained ethyl” or “cEt” when in the S configuration), 4’-CH ₂ - 0-CH ₂ -2’, 4’-CH ₂ -N(R)-2’, 4'-CH(CH ₂ 0CH ₃ )-0-2' (“constrained MOE” or “cMOE”) and analogs thereof (see, e.g., Seth et al., U.S. 7,399,845, Bhat et al., U.S. 7,569,686, Swayze et al., U.S. 7,741,457, and Swayze et al., U.S. 8,022,193), 4'-C(CH ₃ )(CH ₃ )-0-2' and analogs thereof (see, e.g., Seth et al., U.S. 8,278,283), 4'-CH ₂ - N(0O¾)-2' and analogs thereof (see, e.g., Prakash et al., U.S. 8,278,425), 4'-CH ₂ -0-N(CH ₃ )-2' (see, e.g., Allerson et al., U.S. 7,696,345 and Allerson et al., U.S. 8,124,745), 4'-CH ₂ -C(H)(CH ₃ )-2' (see, e.g., Zhou, et al, J. Org. Chem., 2009, 74, 118-134), 4'-CH ₂ -C(=CH ₂ )-2' and analogs thereof (see e.g.,, Seth et al., U.S. 8,278,426), 4’-C(R _a R _b )-N(R)-0-2’, 4’-C(R _a R,)-0-N(R)-2’, 4'-CH ₂ -0-N(R)-2', and 4'-CH ₂ -N(R)-0-2', wherein each R, R _a , and R, is, independently, H, a protecting group, or Ci-Ci ₂ alkyl (see, e.g. Imanishi et al., U.S. 7,427,672).

In certain embodiments, such 4’ to 2’ bridges independently comprise from 1 to 4 linked groups independently selected from: -|C(R _a )(R _b )| _n -. -|C(R _a )(R _b )| _n -0-. -C(R _a )=C(R _b )-. -C(R _a )=N-, -C(=NR _a )-, -C(=0)- , -C(=S)-, -0-, -Si(R _a ) ₂ -, -S(=0) _x -, and -N(R _a )-; wherein: x is 0, 1, or 2; n is 1, 2, 3, or 4; each R _a and R, is, independently, H, a protecting group, hydroxyl, Ci-Ci ₂ alkyl, substituted Ci-Ci ₂ alkyl, C ₂ - Ci ₂ alkenyl, substituted C ₂ -Ci ₂ alkenyl, C ₂ -Ci ₂ alkynyl, substituted C ₂ -Ci ₂ alkynyl, C ₅ -C ₂₀ aryl, substituted C ₅ - C ₂ o aryl, heterocycle radical, substituted heterocycle radical, heteroaryl, substituted heteroaryl, C ₅ -C ₇ alicyclic radical, substituted C ₅ -C ₇ alicyclic radical, halogen, OJi, NJJ ₂ , SJi, N ₃ , COOJi, acyl (C(=0)-H), substituted acyl, CN, sulfonyl (S(=0) ₂ -Ji), or sulfoxyl (S(=0)-Ji); and each Ji and J ₂ is, independently, H, Ci-Ci ₂ alkyl, substituted Ci-Ci ₂ alkyl, C ₂ -Ci ₂ alkenyl, substituted C ₂ -Ci ₂ alkenyl, C ₂ -Ci ₂ alkynyl, substituted C ₂ -Ci ₂ alkynyl, C ₅ -C ₂₀ aryl, substituted CVC ₂ n aryl, acyl (C(=0)-H), substituted acyl, a heterocycle radical, a substituted heterocycle radical, Ci-Ci ₂ aminoalkyl, substituted Ci-Ci ₂ aminoalkyl, or a protecting group.

Additional bicyclic sugar moieties are known in the art, see, for example: Freier et al, Nucleic Acids Research, 1997, 25(22), 4429-4443, Albaek et al, J. Org. Chem., 2006, 71, 7731-7740, Singh et al., Chem. Commun., 1998, 4, 455-456; Koshkin et al., Tetrahedron, 1998, 54, 3607-3630; Wahlestedt et al., Proc. Natl Acad. Sci. U. S. A., 2000, 97, 5633-5638; Kumar et al., Bioorg. Med. Chem. Lett., 1998, 8, 2219-2222; Singh et al., J. Org. Chem., 1998, 63, 10035-10039; Srivastava et al., J. Am. Chem. Soc., 20017, 129, 8362-8379; Elayadi et al, Curr. Opinion Invens. Drugs, 2001, 2, 558-561; Braasch et al, Chem. Biol., 2001, 8, 1-7; Orum et al, Curr. Opinion Mol. Ther., 2001, 3, 239-243; Wengel et al.,U.S. 7,053,207, Imanishi et al., U.S. 6,268,490, Imanishi et al. U.S.. 6,770,748, Imanishi et al., U.S. RE44,779; Wengel et al., U.S. 6,794,499, Wengel et al., U.S. 6,670,461; Wengel et al., U.S.7,034,133, Wengel et al., U.S. 8,080,644; Wengel et al., U.S. 8,034,909; Wengel et al., U.S. 8,153,365; Wengel et al., U.S. 7,572,582; and Ramasamy et al., U.S. 6,525,191, Torsten et al., WO 2004/106356, Wengel et al., WO 91999/014226; Seth et al.,WO 2007/134181; Seth et al., U.S. 7,547,684; Seth et al., U.S. 7,666,854; Seth et al., U.S. 8,088,746; Seth et al., U.S. 7,750,131; Seth et al., U.S. 8,030,467; Seth et al., U.S. 8,268,980; Seth et al., U.S. 8,546,556; Seth et al., U.S. 8,530,640; Migawa et al., U.S. 9,012,421; Seth et al., U.S. 8,501,805; and U.S. Patent Publication Nos. Allerson et al., US2008/0039618 and Migawa et al., US2015/0191727.

In certain embodiments, bicyclic sugar moieties and nucleosides incorporating such bicyclic sugar moieties are further defined by isomeric configuration. For example, an UNA nucleoside (described herein) may be in the a-U configuration or in the b-D configuration.

LNA (b-D-configuration) a-L-LNA (a-L-configuration) bridge = 4'-CH ₂ -0-2' bridge = 4'-CH ₂ -0-2' a-U-methyleneoxy (4’-CH ₂ -0-2’) or a-U-UNA bicyclic nucleosides have been incorporated into oligonucleotides that showed antisense activity (Frieden et al., Nucleic Acids Research, 2003, 21, 6365-6372). Herein, general descriptions of bicyclic nucleosides include both isomeric configurations. When the positions of specific bicyclic nucleosides (e.g., FNA or cEt) are identified in exemplified embodiments herein, they are in the b-D configuration, unless otherwise specified.

In certain embodiments, modified sugar moieties comprise one or more non-bridging sugar substituent and one or more bridging sugar substituent (e.g., 5 ’-substituted and 4’-2’ bridged sugars).

In certain embodiments, modified sugar moieties are sugar surrogates. In certain such embodiments, the oxygen atom of the sugar moiety is replaced, e.g., with a sulfur, carbon or nitrogen atom. In certain such embodiments, such modified sugar moieties also comprise bridging and/or non-bridging substituents as described herein. For example, certain sugar surrogates comprise a 4’-sulfur atom and a substitution at the 2'- position (see, e.g., Bhat et al., U.S. 7,875,733 and Bhat et al., U.S. 7,939,677) and/or the 5’ position.

In certain embodiments, sugar surrogates comprise rings having other than 5 atoms. For example, in certain embodiments, a sugar surrogate comprises a six-membered tetrahydropyran (“THP”). Such tetrahydropyrans may be further modified or substituted. Nucleosides comprising such modified tetrahydropyrans include but are not limited to hexitol nucleic acid (“HNA”), anitol nucleic acid (“ANA”), manitol nucleic acid (“MNA”) (see e.g., Ueumann, CJ. Bioorg. &Med. Chem. 2002, 10, 841-854), fluoro HNA:

(“F-HNA”, see e.g., Swayze et ak, U.S. 8,088,904; Swayze et ak, U.S. 8,440,803; Swayze et ak, U.S. ; and Swayze et ak, U.S. 9,005,906, F-HNA can also be referred to as a F-THP or 3'-fluoro tetrahydropyran), and nucleosides comprising additional modified THP compounds having the formula: wherein, independently, for each of said modified THP nucleoside: Bx is a nucleobase moiety; T3 and T4 are each, independently, an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide or one of T3 and T4 is an intemucleoside linking group linking the modified THP nucleoside to the remainder of an oligonucleotide and the other of T3 and T4 is H, a hydroxyl protecting group, a linked conjugate group, or a 5' or 3'-terminal group; qi, q2, q3, q4, qs, qe and q _? are each, independently, H, Ci- C ₆ alkyl, substituted C1-C6 alkyl, C2-C6 alkenyl, substituted C2-C6 alkenyl, C2-C6 alkynyl, or substituted C2-C6 alkynyl; and each of Ri and R2 is independently selected from among: hydrogen, halogen, substituted or unsubstituted alkoxy, NJ1J2, SJi, N3, OC(=X)Ji, 0C(=X)NJJ ₂ , NJ3C(=X)NJJ2, and CN, wherein X is O, S or NJi, and each Ji, J2, and J3 is, independently, H or C1-C6 alkyl.

In certain embodiments, modified THP nucleosides are provided wherein qi, q2, q3, q4, qs, qe and q _? are each H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q _? is other than H. In certain embodiments, at least one of qi, q2, q3, q4, qs, qe and q7 is methyl. In certain embodiments, modified THP nucleosides are provided wherein one of Ri and R2 is F. In certain embodiments, Ri is F and R2 is H, in certain embodiments, Ri is methoxy and R2 is H, and in certain embodiments, Ri is methoxyethoxy and R2 is H.

In certain embodiments, sugar surrogates comprise rings having more than 5 atoms and more than one heteroatom. For example, nucleosides comprising morpholino sugar moieties and their use in oligonucleotides have been reported (see, e.g., Braasch et ak, Biochemistry, 2002, 41, 4503-4510 and Summerton et ak, U.S. 5,698,685; Summerton et ak, U.S. 5,166,315; Summerton et ak, U.S.5, 185, 444; and Summerton et ak, U.S. 5,034,506). As used here, the term “morpholino” means a sugar surrogate having the following structure:

In certain embodiments, morpholinos may be modified, for example by adding or altering various substituent groups from the above morpholino structure. Such sugar surrogates are refered to herein as “modifed morpholinos.”

In certain embodiments, sugar surrogates comprise acyclic moieites. Examples of nucleosides and oligonucleotides comprising such acyclic sugar surrogates include but are not limited to: peptide nucleic acid (“PNA”), acyclic butyl nucleic acid (see, e.g., Kumar et al., Org. Biomol. Chem., 2013, 11, 5853-5865), and nucleosides and oligonucleotides described in Manoharan et al., WO2011/133876.

Many other bicyclic and tricyclic sugar and sugar surrogate ring systems are known in the art that can be used in modified nucleosides.

2. Modified Nucleobases

Nucleobase (or base) modifications or substitutions are structurally distinguishable from, yet functionally interchangeable with, naturally occurring or synthetic unmodified nucleobases. Both natural and modified nucleobases are capable of participating in hydrogen bonding. Such nucleobase modifications can impart nuclease stability, binding affinity or some other beneficial biological property to oligonucleotides described herein.

In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising an unmodified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more nucleoside that does not comprise a nucleobase, referred to as an abasic nucleoside.

In certain embodiments, modified nucleobases are selected from: 5-substituted pyrimidines, 6- azapy rim i ^o dines alkyl or alkynyl substituted pyrimidines, alkyl substituted purines, and N-2, N-6 and 0-6 substituted purines. In certain embodiments, modified nucleobases are selected from: 2-aminopropyladenine,

5 -hydroxymethyl cytosine, 5-methylcytosine, xanthine, hypoxanthine, 2-aminoadenine, 6-N-methylguanine,

6-N-methyladenine, 2-propyladenine , 2-thiouracil, 2-thiothymine and 2-thiocytosine, 5-propynyl (CºC-CH3) uracil, 5-propynylcytosine, 6-azouracil, 6-azocytosine, 6-azothymine, 5-ribosyluracil (pseudouracil), 4- thiouracil, 8-halo, 8-amino, 8-thiol, 8-thioalkyl, 8-hydroxyl, 8-aza and other 8-substituted purines, 5-halo, particularly 5-bromo, 5-trifluoromethyl, 5-halouracil, and 5-halocytosine, 7-methylguanine, 7-methyladenine, 2-F-adenine, 2-aminoadenine, 7-deazaguanine, 7-deazaadenine, 3-deazaguanine, 3-deazaadenine, 6-N- benzoyladenine, 2-N-isobutyrylguanine, 4-N-benzoylcytosine, 4-N-benzoyluracil, 5-methyl 4-N- benzoylcytosine, 5-methyl 4-N-benzoyluracil, universal bases, hydrophobic bases, promiscuous bases, size- expanded bases, and fluorinated bases. Further modified nucleobases include tricyclic pyrimidines, such as l,3-diazaphenoxazine-2-one, l,3-diazaphenothiazine-2-one and 9-(2-aminoethoxy)-l,3-diazaphenoxazine-2- one (G-clamp). Modified nucleobases may also include those in which the purine or pyrimidine base is replaced with other heterocycles, for example 7-deaza-adenine, 7-deazaguanosine, 2-aminopyridine and 2-pyridone. Further nucleobases include those disclosed in Merigan et al., U.S. 3,687,808, those disclosed in The Concise Encyclopedia Of Polymer Science And Engineering, Kroschwitz, J.E, Ed., John Wiley & Sons, 1990, 858-859; Englisch etal., Angewandte Chemie, International Edition, 1991, 30, 613; Sanghvi, Y.S., Chapter 15, Antisense Research and Applications, Crooke, S.T. and Lebleu, B., Eds., CRC Press, 1993, 273-288; and those disclosed in Chapters 6 and 15, Antisense Drug Technology, Crooke S.T., Ed., CRC Press, 2008, 163-166 and 442-443.

Publications that teach the preparation of certain of the above noted modified nucleobases as well as other modified nucleobases include without limitation, Manoharan et al., US2003/0158403, Manoharan et al., US2003/0175906; Dinh et al., U.S. 4,845,205; Spielvogel et al., U.S. 5,130,302; Rogers et al., U.S. 5,134,066; Bischofberger et al., U.S. 5,175,273; Urdea et al., U.S. 5,367,066; Benner et al., U.S. 5,432,272; Matteucci et al., U.S. 5,434,257; Gmeiner et al., U.S. 5,457,187; Cook et al., U.S. 5,459,255; Froehler etal., U.S. 5,484,908; Matteucci et al., U.S. 5,502,177; Hawkins et al., U.S. 5,525,711; Haralambidis et al., U.S. 5,552,540; Cook et al., U.S. 5,587,469; Froehler et al., U.S. 5,594,121; Switzer et al., U.S. 5,596,091; Cook et al., U.S. 5,614,617; Froehler et al., U.S. 5,645,985; Cook et al., U.S. 5,681,941; Cook et al., U.S. 5,811,534; Cook et al., U.S. 5,750,692; Cook et al., U.S. 5,948,903; Cook et al., U.S. 5,587,470; Cook et al., U.S. 5,457,191; Matteucci et al., U.S. 5,763,588; Froehler et al., U.S. 5,830,653; Cook et al., U.S. 5,808,027; Cook et al., 6,166,199; and Matteucci et al., U.S. 6,005,096.

In certain embodiments, modified oligonucleotides comprise one or more modified nucleobases. In certain embodiments, the modified nucleobase is 5-methylcytosine. In certain embodiments, each cytosine is a 5-methylcytosine.

3. Modified Internucleoside Linkages

The naturally occuring intemucleoside linkage of RNA and DNA is a 3' to 5' phosphodiester linkage. In certain embodiments, oligonucleotides described herein having one or more modified, i.e. non-naturally occurring, intemucleoside linkages are often selected over oligonucleotides having naturally occurring intemucleoside linkages because of desirable properties such as, for example, enhanced cellular uptake, enhanced affinity for target nucleic acids, and increased stability in the presence of nucleases.

In certain embodiments, oligonucleotides comprise one or more modified intemucleoside linkages. In certain embodiments, the modified intemucleoside linkages are phosphorothioate linkages. In certain embodiments, each intemucleoside linkage of the oligonucleotide is a phosphorothioate intemucleoside linkage.

In certain embodiments, oligonucleotides having modified intemucleoside linkages include intemucleoside linkages that retain a phosphorus atom as well as intemucleoside linkages that do not have a phosphorus atom. Representative phosphorus containing intemucleoside linkages include, but are not limited to, phosphodiesters, phosphotriesters, methylphosphonates, phosphoramidate, and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing linkages are well known.

In certain embodiments, nucleosides of modified oligonucleotides may be linked together using any intemucleoside linkage. The two main classes of intemucleoside linking groups are defined by the presence or absence of a phosphorus atom. Representative phosphorus-containing intemucleoside linkages include but are not limited to phosphates, which contain a phosphodiester bond (“P=0”) (also referred to as unmodified or naturally occurring linkages), phosphotriesters, methylphosphonates, phosphoramidates, and phosphorothioates (“P=S”), and phosphorodithioates (“HS-P=S”). Representative non-phosphorus containing intemucleoside linking groups include but are not limited to methylenemethylimino (-CH2-N(CH3)-0-CH2-), thiodiester, thionocarbamate (-0-C(=0)(NH)-S-); siloxane (-0-SiH2-0-); and N,N'-dimethylhydrazine (-CH2- N(CH3)-N(CH3)-). Modified intemucleoside linkages, compared to naturally occurring phosphate linkages, can be used to alter, typically increase, nuclease resistance of the oligonucleotide. In certain embodiments, intemucleoside linkages having a chiral atom can be prepared as a racemic mixture, or as separate enantiomers. Representative chiral intemucleoside linkages include but are not limited to alkylphosphonates and phosphorothioates. Methods of preparation of phosphorous-containing and non-phosphorous-containing intemucleoside linkages are well known to those skilled in the art.

Neutral intemucleoside linkages include, without limitation, phosphotriesters, methylphosphonates, MMI (3'-CH2-N(CH3)-0-5'), amide-3 (3'-CH2-C(=0)-N(H)-5'), amide-4 (3'-CH2-N(H)-C(=0)-5'), formacetal (3'-0-CH2-0-5'), methoxypropyl, and thioformacetal (3'-S-CH2-0-5'). Further neutral intemucleoside linkages include nonionic linkages comprising siloxane (dialkylsiloxane), carboxylate ester, carboxamide, sulfide, sulfonate ester and amides (See for example: Carbohydrate Modifications in Antisense Research; Y.S. Sanghvi and P.D. Cook, Eds., ACS Symposium Series 580; Chapters 3 and 4, 40-65). Further neutral intemucleoside linkages include nonionic linkages comprising mixed N, O, S and CH2 component parts.

B. Certain Motifs

In certain embodiments, oligonucleotides can have a motif, e.g. a pattern of unmodified and/or modified sugar moieties, nucleobases, and/or intemucleoside linkages. In certain embodiments, modified oligonucleotides comprise one or more modified nucleoside comprising a modified sugar. In certain embodiments, modified oligonucleotides comprise one or more modified nucleosides comprising a modified nucleobase. In certain embodiments, modified oligonucleotides comprise one or more modified intemucleoside linkage. In such embodiments, the modified, unmodified, and differently modified sugar moieties, nucleobases, and/or intemucleoside linkages of a modified oligonucleotide define a pattern or motif. In certain embodiments, the patterns of sugar moieties, nucleobases, and intemucleoside linkages are each independent of one another. Thus, a modified oligonucleotide may be described by its sugar motif, nucleobase motif and/or intemucleoside linkage motif (as used herein, nucleobase motif describes the modifications to the nucleobases independent of the sequence of nucleobases). 1. Certain Sugar Motifs

In certain embodiments, antisense agents and antisense compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise one or more type of modified sugar and/or unmodified sugar moiety arranged along the oligonucleotide or region thereof in a defined pattern or sugar motif. In certain instances, such sugar motifs include but are not limited to any of the sugar modifications discussed herein.

In certain embodiments, modified oligonucleotides comprise or consist of a region having a gapmer motif, which comprises two external regions or “wings” and a central or internal region or “gap.” The three regions of a gapmer motif (the 5 ’-wing, the gap, and the 3 ’-wing) form a contiguous sequence of nucleosides wherein at least some of the sugar moieties of the nucleosides of each of the wings differ from at least some of the sugar moieties of the nucleosides of the gap. Specifically, at least the sugar moieties of the nucleosides of each wing that are closest to the gap (the 3’-most nucleoside of the 5’-wing and the 5’-most nucleoside of the 3 ’-wing) differ from the sugar moiety of the neighboring gap nucleosides, thus defining the boundary between the wings and the gap (i.e., the wing/gap junction). In certain embodiments, the sugar moieties within the gap are the same as one another. In certain embodiments, the gap includes one or more nucleoside having a sugar moiety that differs from the sugar moiety of one or more other nucleosides of the gap. In certain embodiments, the sugar motifs of the two wings are the same as one another (symmetric gapmer). In certain embodiments, the sugar motif of the 5'-wing differs from the sugar motif of the 3'-wing (asymmetric gapmer).

In certain embodiments, the wings of a gapmer comprise 1-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 2-5 nucleosides. In certain embodiments, the wings of a gapmer comprise 3-5 nucleosides. In certain embodiments, the nucleosides of a gapmer are all modified nucleosides.

In certain embodiments, the gap of a gapmer comprises 7-12 nucleosides. In certain embodiments, the gap of a gapmer comprises 7-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 8-10 nucleosides. In certain embodiments, the gap of a gapmer comprises 10 nucleosides. In certain embodiment, each nucleoside of the gap of a gapmer is an unmodified 2’-deoxy nucleoside.

In certain embodiments, the gapmer is a deoxy gapmer. In such embodiments, the nucleosides on the gap side of each wing/gap junction are unmodified 2’-deoxy nucleosides and the nucleosides on the wing sides of each wing/gap junction are modified nucleosides. In certain such embodiments, each nucleoside of the gap is an unmodified 2 ’-deoxy nucleoside. In certain such embodiments, each nucleoside of each wing is a modified nucleoside.

In certain embodiments, a modified oligonucleotide has a fully modified sugar motif wherein each nucleoside of the modified oligonucleotide comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif wherein each nucleoside of the region comprises a modified sugar moiety. In certain embodiments, modified oligonucleotides comprise or consist of a region having a fully modified sugar motif, wherein each nucleoside within the fully modified region comprises the same modified sugar moiety, referred to herein as a uniformly modified sugar motif. In certain embodiments, a fully modified oligonucleotide is a uniformly modified oligonucleotide. In certain embodiments, each nucleoside of a uniformly modified comprises the same 2’- modification.

2. Certain Nucleobase Motifs

In certain embodiments, antisense agents and antisense compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified nucleobases arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, each nucleobase is modified. In certain embodiments, none of the nucleobases are modified. In certain embodiments, each purine or each pyrimidine is modified. In certain embodiments, each adenine is modified. In certain embodiments, each guanine is modified. In certain embodiments, each thymine is modified. In certain embodiments, each uracil is modified. In certain embodiments, each cytosine is modified. In certain embodiments, some or all of the cytosine nucleobases in a modified oligonucleotide are 5-methylcytosines.

In certain embodiments, modified oligonucleotides comprise a block of modified nucleobases. In certain such embodiments, the block is at the 3 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 3 ’-end of the oligonucleotide. In certain embodiments, the block is at the 5 ’-end of the oligonucleotide. In certain embodiments the block is within 3 nucleosides of the 5 ’-end of the oligonucleotide.

In certain embodiments, oligonucleotides having a gapmer motif comprise a nucleoside comprising a modified nucleobase. In certain such embodiments, one nucleoside comprising a modified nucleobase is in the central gap of an oligonucleotide having a gapmer motif. In certain such embodiments, the sugar moiety of said nucleoside is a 2’-deoxyribosyl moiety. In certain embodiments, the modified nucleobase is selected from: a 2- thiopyrimidine and a 5-propynepyrimidine.

3. Certain Internucleoside Linkage Motifs

In certain embodiments, antisense agents and antisense compounds described herein comprise oligonucleotides. In certain embodiments, oligonucleotides comprise modified and/or unmodified intemucleoside linkages arranged along the oligonucleotide or region thereof in a defined pattern or motif. In certain embodiments, essentially each intemucleoside linking group is a phosphate intemucleoside linkage (P=0). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is a phosphorothioate (P=S). In certain embodiments, each intemucleoside linking group of a modified oligonucleotide is independently selected from a phosphorothioate and phosphate intemucleoside linkage. In certain embodiments, the sugar motif of a modified oligonucleotide is a gapmer and the intemucleoside linkages within the gap are all modified. In certain such embodiments, some or all of the intemucleoside linkages in the wings are unmodified phosphate linkages. In certain embodiments, the terminal intemucleoside linkages are modified. Certain Conjugated Antisense Agents and Antisense Compounds

In certain embodiments, antisense agents and antisense compounds described herein comprise or consist of an oligonucleotide (modified or unmodified) and, optionally, one or more conjugate groups and/or terminal groups. Conjugate groups consist of one or more conjugate moiety and a conjugate linker which links the conjugate moiety to the oligonucleotide. Conjugate groups may be attached to either or both ends of an oligonucleotide and/or at any internal position. In certain embodiments, conjugate groups are attached to the 2'-position of a nucleoside of a modified oligonucleotide. In certain embodiments, conjugate groups that are attached to either or both ends of an oligonucleotide are terminal groups. In certain such embodiments, conjugate groups or terminal groups are attached at the 3’ and/or 5 ’-end of oligonucleotides. In certain such embodiments, conjugate groups (or terminal groups) are attached at the 3’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 3 ’-end of oligonucleotides. In certain embodiments, conjugate groups (or terminal groups) are attached at the 5 ’-end of oligonucleotides. In certain embodiments, conjugate groups are attached near the 5 ’-end of oligonucleotides. In certain embodiments, the antisense agent is an RNAi agent comprising a conjugate group. In certain embodiments, the RNAi agent comprises an antisense compound and a sense compound, wherein the sense compound comprises a conjugate group. In certain embodiments, the sense compound comprises a sense oligonucleotide and a conjugate group attached to the sense oligonucleotide. In certain embodiments, the conjugate group is attached to the 3’ end of the sense oligonucleotide.

In certain embodiments, the oligonucleotide is modified. In certain embodiments, the oligonucleotide has a nucleobase sequence that is complementary to a target nucleic acid. In certain embodiments, oligonucleotides are complementary to a messenger RNA (mRNA). In certain embodiments, oligonucleotides are complementary to a pre-mRNA. In certain embodiments, oligonucleotides are complementary to a sense transcript.

Examples of terminal groups include but are not limited to conjugate groups, capping groups, phosphate moieties, protecting groups, modified or unmodified nucleosides, and two or more nucleosides that are independently modified or unmodified.

In certain embodiments, oligonucleotides are covalently attached to one or more conjugate groups. In certain embodiments, conjugate groups modify one or more properties of the attached oligonucleotide, including but not limited to pharmacodynamics, pharmacokinetics, stability, binding, absorption, tissue distribution, cellular distribution, cellular uptake, charge and clearance. In certain embodiments, conjugate groups impart a new property on the attached oligonucleotide, e.g., fluorophores or reporter groups that enable detection of the oligonucleotide. Certain conjugate groups and conjugate moieties have been described previously, for example: cholesterol moiety (Letsinger et ah, Proc. Natl. Acad. Sci. USA, 1989, 86, 6553-6556), cholic acid (Manoharan et ah, Bioorg. Med. Chem. Lett., 1994, 4, 1053-1060), athioether, e.g., hexyl-S-tritylthiol (Manoharan et ah, Ann. NY. Acad. Sci., 1992, 660, 306-309; Manoharan et ah, Bioorg. Med. Chem. Lett., 1993, 3, 2765-2770), a thiocholesterol (Oberhauser et al., Niicl. Acids Res., 1992, 20, 533- 538), an aliphatic chain, e.g., do-decan-diol or undecyl residues (Saison-Behmoaras et al., EMBO J, 1991,

10, 1111-1118; Kabanov et al., FEBS Lett., 1990, 259, 327-330; Svinarchuk et al., Biochimie, 1993 , 75, 49- 54), a phospholipid, e.g., di-hexadecyl-rac -glycerol or triethyl -ammonium l,2-di-0-hexadecyl-rac-glycero-3- H-phosphonate (Manoharan et al., Tetrahedron Lett., 1995, 36, 3651-3654; Shea et al., Nucl. Acids Res.,

1990, 18, 3777-3783), a polyamine or a polyethylene glycol chain (Manoharan et al., Nucleosides & Nucleotides, 1995, 14, 969-973), or adamantane acetic acid a palmityl moiety (Mishra et al., Biochim.

Biophys. Acta, 1995, 1264, 229-237), an octadecylamine or hexylamino-carbonyl-oxycholesterol moiety (Crooke et al., J. Pharmacol. Exp. Ther., 1996, 277, 923-937), a tocopherol group (Nishina et e ., Molecular Therapy Nucleic Acids , 2015, 4, e220; and Nishina ct al.. Molecular Therapy, 2008, 16, 734-740), or a GalNAc cluster (e.g., WO2014/179620).

1. Conjugate Moieties

Conjugate moieties include, without limitation, intercalators, reporter molecules, polyamines, polyamides, peptides, carbohydrates (e.g., GalNAc), vitamin moieties, polyethylene glycols, thioethers, polyethers, cholesterols, thiocholesterols, cholic acid moieties, folate, lipids, phospholipids, biotin, phenazine, phenanthridine, anthraquinone, adamantane, acridine, fluoresceins, rhodamines, coumarins, fluorophores, and dyes.

In certain embodiments, a conjugate moiety comprises an active drug substance, for example, aspirin, warfarin, phenylbutazone, ibuprofen, suprofen, fen-bufen, ketoprofen, (.V)-(+)-pranoprofcn carprofen, dansylsarcosine, 2,3,5-triiodobenzoic acid, fingolimod, flufenamic acid, folinic acid, a benzothiadiazide, chlorothiazide, a diazepine, indo-methicin, a barbiturate, a cephalosporin, a sulfa drug, an antidiabetic, an antibacterial or an antibiotic.

2. Conjugate linkers

Conjugate moieties are attached to oligonucleotides through conjugate linkers. In certain antisense agents and antisense compounds, the conjugate linker is a single chemical bond (i.e., the conjugate moiety is attached directly to an oligonucleotide through a single bond). In certain antisense antisense agents and antisense compounds, a conjugate moiety is attached to an oligonucleotide via a more complex conjugate linker comprising one or more conjugate linker moieities, which are sub-units making up a conjugate linker. In certain embodiments, the conjugate linker comprises a chain structure, such as a hydrocarbyl chain, or an oligomer of repeating units such as ethylene glycol, nucleosides, or amino acid units.

In certain embodiments, a conjugate linker comprises one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether, and hydroxylamino. In certain such embodiments, the conjugate linker comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and amide groups. In certain embodiments, the conjugate linker comprises groups selected from alkyl and ether groups. In certain embodiments, the conjugate linker comprises at least one phosphorus moiety. In certain embodiments, the conjugate linker comprises at least one phosphate group. In certain embodiments, the conjugate linker includes at least one neutral linking group.

In certain embodiments, conjugate linkers, including the conjugate linkers described above, are bifunctional linking moieties, e.g., those known in the art to be useful for attaching conjugate groups to parent compounds, such as the oligonucleotides provided herein. In general, a bifunctional linking moiety comprises at least two functional groups. One of the functional groups is selected to bind to a particular site on a parent compound and the other is selected to bind to a conjugate group. Examples of functional groups used in a bifunctional linking moiety include but are not limited to electrophiles for reacting with nucleophilic groups and nucleophiles for reacting with electrophilic groups. In certain embodiments, bifunctional linking moieties comprise one or more groups selected from amino, hydroxyl, carboxylic acid, thiol, alkyl, alkenyl, and alkynyl.

Examples of conjugate linkers include but are not limited to pyrrolidine, 8-amino-3,6-dioxaoctanoic acid (ADO), succinimidyl 4-(N-maleimidomethyl) cyclohexane- 1-carboxylate (SMCC) and 6-aminohexanoic acid (AHEX or AHA). Other conjugate linkers include but are not limited to substituted or unsubstituted Ci- Cio alkyl, substituted or unsubstituted C2-C10 alkenyl or substituted or unsubstituted C2-C10 alkynyl, wherein a nonlimiting list of preferred substituent groups includes hydroxyl, amino, alkoxy, carboxy, benzyl, phenyl, nitro, thiol, thioalkoxy, halogen, alkyl, aryl, alkenyl and alkynyl.

In certain embodiments, conjugate linkers comprise 1-10 linker-nucleosides. In certain embodiments, such linker-nucleosides are modified nucleosides. In certain embodiments such linker-nucleosides comprise a modified sugar moiety. In certain embodiments, linker-nucleosides are unmodified. In certain embodiments, linker-nucleosides comprise an optionally protected heterocyclic base selected from a purine, substituted purine, pyrimidine or substituted pyrimidine. In certain embodiments, a cleavable moiety is a nucleoside selected from uracil, thymine, cytosine, 4-N-benzoylcytosine, 5-methylcytosine, 4-N-benzoyl-5- methylcytosine, adenine, 6-N-benzoyladenine, guanine and 2-N-isobutyrylguanine. It is typically desirable for linker-nucleosides to be cleaved from the compound after it reaches a target tissue. Accordingly, linker- nucleosides are typically linked to one another and to the remainder of the compound through cleavable bonds. In certain embodimements, such cleavable bonds are phosphodiester bonds.

Herein, linker-nucleosides are not considered to be part of the oligonucleotide. Accordingly, in embodiments in which an antisense agent or antisense compound comprises an oligonucleotide consisting of a specified number or range of linked nucleosides and/or a specified percent complementarity to a reference nucleic acid and the antisense agent or antisense compound also comprises a conjugate group comprising a conjugate linker comprising linker-nucleosides, those linker-nucleosides are not counted toward the length of the oligonucleotide and are not used in determining the percent complementarity of the oligonucleotide for the reference nucleic acid. For example, an antisense agent or antisense compound may comprise (1) a modified oligonucleotide consisting of 8-30 nucleosides and (2) a conjugate group comprising 1-10 linker- nucleosides that are contiguous with the nucleosides of the modified oligonucleotide. The total number of contiguous linked nucleosides in such an antisense agent or antisense compound is more than 30. Alternatively, an antisense agent or antisense compound may comprise a modified oligonucleotide consisting of 8-30 nucleosides and no conjugate group. The total number of contiguous linked nucleosides in such a compound is no more than 30. Unless otherwise indicated conjugate linkers comprise no more than 10 linker- nucleosides. In certain embodiments, conjugate linkers comprise no more than 5 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 3 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 2 linker-nucleosides. In certain embodiments, conjugate linkers comprise no more than 1 linker-nucleoside.

In certain embodiments, it is desirable for a conjugate group to be cleaved from the oligonucleotide. For example, in certain circumstances antisense agents or antisense compounds comprising a particular conjugate moiety are better taken up by a particular cell type, but once the antisense agent or antisense compound has been taken up, it is desirable that the conjugate group be cleaved to release the unconjugated or parent oligonucleotide. Thus, certain conjugate linkers may comprise one or more cleavable moieties. In certain embodiments, a cleavable moiety is a cleavable bond. In certain embodiments, a cleavable moiety is a group of atoms comprising at least one cleavable bond. In certain embodiments, a cleavable moiety comprises a group of atoms having one, two, three, four, or more than four cleavable bonds. In certain embodiments, a cleavable moiety is selectively cleaved inside a cell or subcellular compartment, such as a lysosome. In certain embodiments, a cleavable moiety is selectively cleaved by endogenous enzymes, such as nucleases.

In certain embodiments, a cleavable bond is selected from among: an amide, an ester, an ether, one or both esters of a phosphodiester, a phosphate ester, a carbamate, or a disulfide. In certain embodiments, a cleavable bond is one or both of the esters of a phosphodiester. In certain embodiments, a cleavable moiety comprises a phosphate or phosphodiester. In certain embodiments, the cleavable moiety is a phosphate linkage between an oligonucleotide and a conjugate moiety or conjugate group.

In certain embodiments, a cleavable moiety comprises or consists of one or more linker-nucleosides. In certain such embodiments, the one or more linker-nucleosides are linked to one another and/or to the remainder of the antisense agent or antisense compound through cleavable bonds. In certain embodiments, such cleavable bonds are unmodified phosphodiester bonds. In certain embodiments, a cleavable moiety is 2'-deoxy nucleoside that is attached to either the 3' or 5'-terminal nucleoside of an oligonucleotide by a phosphate intemucleoside linkage and covalently attached to the remainder of the conjugate linker or conjugate moiety by a phosphate or phosphorothioate linkage. In certain such embodiments, the cleavable moiety is 2'-deoxyadenosine.

3. Certain Cell-Targeting Conjugate Moieties

In certain embodiments, a conjugate group comprises a cell-targeting conjugate moiety. In certain embodiments, a conjugate group has the general formula: [Ligand Tether]— [Branching group [—[Conjugate Linker]- — [ Cleavable Conj. ] — Linker Moiety ^ J

Cell-targeting Y conjugate moiety Conjugate Linker wherein n is from 1 to about 3, m is 0 when n is 1, m is 1 when n is 2 or greater, j is 1 or 0, and k is 1 or 0.

In certain embodiments, n is 1, j is 1 and k is 0. In certain embodiments, n is 1, j is 0 and k is 1. In certain embodiments, n is 1, j is 1 and k is 1. In certain embodiments, n is 2, j is 1 and k is 0. In certain embodiments, n is 2, j is 0 and k is 1. In certain embodiments, n is 2, j is 1 and k is 1. In certain embodiments, n is 3, j is 1 and k is 0. In certain embodiments, n is 3, j is 0 and k is 1. In certain embodiments, n is 3, j is 1 and k is 1.

In certain embodiments, conjugate groups comprise cell-targeting moieties that have at least one tethered ligand. In certain embodiments, cell-targeting moieties comprise two tethered ligands covalently attached to a branching group. In certain embodiments, cell-targeting moieties comprise three tethered ligands covalently attached to a branching group.

In certain embodiments, the cell-targeting moiety comprises a branching group comprising one or more groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain embodiments, the branching group comprises a branched aliphatic group comprising groups selected from alkyl, amino, oxo, amide, disulfide, polyethylene glycol, ether, thioether and hydroxylamino groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino, oxo, amide and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl, amino and ether groups. In certain such embodiments, the branched aliphatic group comprises groups selected from alkyl and ether groups. In certain embodiments, the branching group comprises a mono or polycyclic ring system.

In certain embodiments, each tether of a cell-targeting moiety comprises one or more groups selected from alkyl, substituted alkyl, ether, thioether, disulfide, amino, oxo, amide, phosphodiester, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, thioether, disulfide, amino, oxo, amide, and polyethylene glycol, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, phosphodiester, ether, amino, oxo, and amide, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, ether, amino, oxo, and amid, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl, amino, and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and oxo, in any combination. In certain embodiments, each tether is a linear aliphatic group comprising one or more groups selected from alkyl and phosphodiester, in any combination. In certain embodiments, each tether comprises at least one phosphorus linking group or neutral linking group. In certain embodiments, each tether comprises a chain from about 6 to about 20 atoms in length. In certain embodiments, each tether comprises a chain from about 10 to about 18 atoms in length. In certain embodiments, each tether comprises about 10 atoms in chain length.

In certain embodiments, each ligand of a cell-targeting moiety has an affinity for at least one type of receptor on a target cell. In certain embodiments, each ligand has an affinity for at least one type of receptor on the surface of a mammalian liver cell. In certain embodiments, each ligand has an affinity for the hepatic asialoglycoprotein receptor (ASGP-R). In certain embodiments, each ligand is a carbohydrate. In certain embodiments, each ligand is, independently selected from galactose, N-acetyl galactoseamine (GalNAc), mannose, glucose, glucoseamine and fucose. In certain embodiments, each ligand is N-acetyl galactoseamine (GalNAc). In certain embodiments, the cell-targeting moiety comprises 3 GalNAc ligands. In certain embodiments, the cell-targeting moiety comprises 2 GalNAc ligands. In certain embodiments, the cell targeting moiety comprises 1 GalNAc ligand.

In certain embodiments, each ligand of a cell-targeting moiety is a carbohydrate, carbohydrate derivative, modified carbohydrate, polysaccharide, modified polysaccharide, or polysaccharide derivative. In certain such embodiments, the conjugate group comprises a carbohydrate cluster (see, e.g., Maier et ah, “Synthesis of Antisense Oligonucleotides Conjugated to a Multivalent Carbohydrate Cluster for Cellular Targeting,” Bioconjugate Chemistry, 2003, 14, 18-29 or Rensen et ah, “Design and Synthesis of Novel N- Acetylgalactosamine-Terminated Glycolipids for Targeting of Lipoproteins to the Hepatic Asiaglycoprotein Receptor,” J. Med. Chem. 2004, 47, 5798-5808). In certain such embodiments, each ligand is an amino sugar or a thio sugar. For example, amino sugars may be selected from any number of compounds known in the art, such as sialic acid, a-D-galactosamine, b-muramic acid, 2-deoxy-2-methylamino-L-glucopyranose, 4,6- dideoxy-4-formamido-2,3-di-0-methyl-D-mannopyranose, 2-deoxy-2-sulfoamino-D-glucopyranose and N- sulfo-D-glucosamine, and A-glycoloyl-a-ncuraminic acid. For example, thio sugars may be selected from 5- Thio- -D-glucopyranose, methyl 2.3.4-tri-G-acctyl- 1 -thio-6-G-trityl-a-D-glucopyranosidc. 4-0iίo-b-O- galactopyranose, and ethyl 3,4,6,7-tetra-0-acetyl-2-deoxy-l,5-dithio-a-D-g/wco-heptopyr anoside. In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula: o

AcHN In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, conjugate groups comprise a cell-targeting moiety having the formula:

In certain embodiments, antisense agents and antisense compounds comprise a conjugate group described herein as “LICA-1” (or THA-GalNAc), wherein THA-GalNAc has the formula: In certain embodiments, antisense agents and antisense compounds described herein comprise LICA- 1 and a cleavable moiety within the conjugate linker have the formula:

Cell targeting conjugate moiety wherein oligo is an oligonucleotide. Representative United States patents, United States patent application publications, international patent application publications, and other publications that teach the preparation of certain of the above noted conjugate groups, compounds comprising conjugate groups, tethers, conjugate linkers, branching groups, ligands, cleavable moieties as well as other modifications include without limitation, US 5,994,517, US 6,300,319, US 6,660,720, US 6,906,182, US 7,262,177, US 7,491,805, US 8,106,022, US 7,723,509, US 2006/0148740, US 2011/0123520, WO 2013/033230 and WO 2012/037254, Biessen et ak, J. Med Chem.

1995, 38, 1846-1852, Uee et ak, Bioorganic & Medicinal Chemistry 2011,79, 2494-2500, Rensen et ak, J. Biol. Chem. 2001, 276, 37577-37584, Rensen et ak, J. Med. Chem. 2004, 47, 5798-5808, Sliedregt et ak, J. Med. Chem. 1999, 42, 609-618, and Valentijn et ak, Tetrahedron, 1997, 53, 759-770.

In certain embodiments, modified oligonucleotides comprise a gapmer or fully modified sugar motif and a conjugate group comprising at least one, two, or three GalNAc ligands. In certain embodiments, antisense agents comprise a conjugate group found in any of the following references: Uee, Carbohydr Res, 1978, 67, 509-514; Connolly et ak, J Biol Chem, 1982, 257, 939-945; Pavia et ak, Int J Pep Protein Res, 1983, 22, 539-548; Uee et ak, Biochem, 1984, 23, 4255-4261; Uee et ak, Glycoconjugate J, 1987, 4, 317-328; Toyokuni et ak, Tetrahedron Lett, 1990, 31, 2673-2676; Biessen et ak, JMed Chem, 1995, 38, 1538-1546; Valentijn et al., Tetrahedron, 1997, 53, 759-770; Kim et al., Tetrahedron Lett, 1997, 38, 3487-3490; Lee et al., Bioconjug Chem, 1997, 8, 762-765; Kato et al., Glycohiol, 2001, 11, 821-829; Rensen et al., J Biol Chem, 2001, 276, 37577-37584; Lee et al., Methods Enzymol, 2003, 362, 38-43; Westerlind et al., Glycoconj J,

2004, 21, 227-241; Lee et al., Bioorg Med Chem Lett, 2006, 16(19), 5132-5135; Maierhofer et al., Bioorg Med Chem, 2007, 15, 7661-7676; Khorev et al., Bioorg Med Chem, 2008, 16, 5216-5231; Lee et al., Bioorg Med Chem, 2011, 19, 2494-2500; Kornilova et al., Analyt Biochem, 2012, 425, 43-46; Pujol et al., Angew Chemie Int Ed Engl, 2012, 51, 7445-7448; Biessen et al., J Med Chem, 1995, 38, 1846-1852; Sliedregt et al., JMed Chem, 1999, 42, 609-618; Rensen et al., JMed Chem, 2004, 47, 5798-5808; Rensen et al., Arterioscler Thromb Vase Biol, 2006, 26, 169-175; van Rossenberg et al., Gene Ther, 2004, 11, 457-464; Sato et al., J Am Chem Soc, 2004, 126, 14013-14022; Lee et al., JOrg Chem, 2012, 77, 7564-7571; Biessen et al., FASEB J, 2000, 14, 1784-1792; Rajur et al., Bioconjug Chem, 1997, 8, 935-940; Duff et al., Methods Enzymol, 2000, 313, 297-321; Maier et al., Bioconjug Chem, 2003, 14, 18-29; Jayaprakash et al., OrgLett, 2010, 12, 5410- 5413; Manoharan, Antisense Nucleic Acid Drug Dev, 2002, 12, 103-128; Merwin et al., Bioconjug Chem, 1994, 5, 612-620; Tomiya et al., Bioorg Med Chem, 2013, 21, 5275-5281; International applications WO1998/013381; WO2011/038356; WO1997/046098; W02008/098788; W02004/101619;

WO2012/037254; WO2011/120053; WO2011/100131; WO2011/163121; WO2012/177947; W02013/033230; W02013/075035; WO2012/083185; WO2012/083046; W02009/082607; WO2009/134487; W02010/144740; W02010/148013; WO1997/020563; W02010/088537; W02002/043771; W02010/129709; WO2012/068187; WO2009/126933; W02004/024757;

WO2010/054406; WO2012/089352; WO2012/089602; WO2013/166121; WO2013/165816; U.S. Patents

4,751,219; 8,552,163; 6,908,903; 7,262,177; 5,994,517; 6,300,319; 8,106,022; 7,491,805; 7,491,805;

7,582,744; 8,137,695; 6,383,812; 6,525,031; 6,660,720; 7,723,509; 8,541,548; 8,344,125; 8,313,772;

8,349,308; 8,450,467; 8,501,930; 8,158,601; 7,262,177; 6,906,182; 6,620,916; 8,435,491; 8,404,862;

7,851,615; Published U.S. Patent Application Publications US2011/0097264; US2011/0097265; US2013/0004427 ; US2005/0164235; US2006/0148740; US2008/0281044; US2010/0240730; US2003/0119724; US2006/0183886; US2008/0206869; US2011/0269814; US2009/0286973; US2011/0207799; US2012/0136042; US2012/0165393; US2008/0281041; US2009/0203135; US2012/0035115; US2012/0095075; US2012/0101148; US2012/0128760; US2012/0157509; US2012/0230938; US2013/0109817; US2013/0121954; US2013/0178512; US2013/0236968; US2011/0123520; US2003/0077829; US2008/0108801; and US2009/0203132.

In certain embodiments, antisense agents comprising a conjugate group are single -stranded. In certain embodiments, antisense agents comprising a conjugate group are double-stranded.

Compositions and Methods for Formulating Pharmaceutical Compositions

Antisense agents described herein may be admixed with pharmaceutically acceptable active or inert substances for the preparation of pharmaceutical compositions or formulations. Compositions and methods for the formulation of pharmaceutical compositions are dependent upon a number of criteria, including, but not limited to, route of administration, extent of disease, or dose to be administered.

An antisense agent described herein targeted to a MARC1 nucleic acid can be utilized in pharmaceutical compositions by combining the antisense agent with a suitable pharmaceutically acceptable diluent or carrier. In certain embodiments, a pharmaceutically acceptable diluent is water, such as sterile water suitable for injection. Accordingly, in one embodiment, employed in the methods described herein is a pharmaceutical composition comprising an antisense agent targeted to a MARC1 nucleic acid and a pharmaceutically acceptable diluent. In certain embodiments, the pharmaceutically acceptable diluent is water. In certain embodiments, the antisense agent comprises or consists of a modified oligonucleotide provided herein.

Pharmaceutical compositions comprising antisense agents provided herein encompass any pharmaceutically acceptable salts, esters, or salts of such esters, or any other oligonucleotide which, upon administration to a subject, including a human, is capable of providing (directly or indirectly) the biologically active metabolite or residue thereof. Suitable pharmaceutically acceptable salts include, but are not limited to, sodium and potassium salts.

A prodrug can include the incorporation of additional nucleosides at one or both ends of an antinse agent which are cleaved by endogenous nucleases within the body, to form the active compound.

In certain embodiments, the antisense agents or compositions further comprise a pharmaceutically acceptable carrier or diluent.

Certain Combinations and Combination Therapies

In certain embodiments, an antisense agent described herein is co-administered with one or more secondary agents. In certain embodiments, such second agents are designed to treat the same disease, disorder, or condition as the first agent described herein. In certain embodiments, such second agents are designed to treat a different disease, disorder, or condition as the first agent described herein. In certain embodiments, a first agent is designed to treat an undesired side effect of a second agent. In certain embodiments, second agents are co-administered with the antisense agent to treat an undesired effect of the antisense agent. In certain embodiments, such second agents are designed to treat an undesired side effect of one or more pharmaceutical compositions as described herein. In certain embodiments, second agents are co-administered with the antisense agent to produce a combinational effect. In certain embodiments, second agents are co-administered with the antisense agent to produce a synergistic effect. In certain embodiments, the co-administration of the antisense and second agents permits use of lower dosages than would be required to achieve a therapeutic or prophylactic effect if the agents were administered as independent therapy. EXAMPLES

Non-limiting disclosure and incorporation by reference

While certain antisense agents, compositions and methods described herein have been described with specificity in accordance with certain embodiments, the following examples serve only to illustrate the compounds described herein and are not intended to limit the same. Each of the references recited in the present application is incorporated herein by reference in its entirety.

Example 1: Effect of 3-10-3 cEt uniform phosphorothioate modified oligonucleotides on mouse MARC1 RNA in vitro, single dose

Modified oligonucleotides complementary to mouse MARC1 nucleic acid were designed and tested for their single dose effects on MARC1 RNA in vitro.

The modified oligonucleotides in the table below are 3-10-3 cEt modified oligonucleotides with phosphorothioate intemucleoside linkages. The modified oligonucleotides are 16 nucleosides in length, wherein the central gap segment consists of ten 2’- -D-deoxynucleosides, and wherein the 5’ and 3’ wing segments each consist of three cEt nucleosides. The sugar motif for the modified oligonucleotides is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2’- -D-deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for the modified oligonucleotides is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine.

“Start site” indicates the 5 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3 ’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. Each modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (ENSEMBL Accession No. EN SMU SG00000026621.13 from version 102: November 2020), to SEQ ID NO: 2 (GENBANK Accession No. NM_001290273.1), or to both. “N/A” indicates that the modified oligonucleotide is not 100% complementary to that particular target nucleic acid sequence.

Primary mouse hepatocytes were treated with modified oligonucleotide at a concentration of 2000 nM by free uptake at a density of 15,000 cells per well. After a treatment period of approximately 24 hours, total RNA was isolated from the cells and MARC1 RNA levels were measured by quantitative real-time RTPCR. MARC1 RNA levels were measured by mouse primer-probe set RTS49033 (forward sequence GAAACGGGTGATGGCTTGTA, designated herein as SEQ ID NO: 6; reverse sequence

GCGGTAGCTCTTCAGTGTTT, designated herein as SEQ ID NO: 7; probe sequence

CTTCCTGTCCGAGATGCCAGTGTC, designated herein as SEQ ID NO: 8). MARC1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MARC 1 RNA is presented in the table below as percent MARCl RNA relative to the amount in untreated control cells (% UTC). Table 1. Reduction of mouse MARC1 RNA by 3-10-3 cEt modified oligonucleotides with uniform phosphorothioate intemucleoside linkages

Example 2: Dose-dependent inhibition of mouse MARC1 in primary mouse hepatocytes by modified oligonucleotides

Modified oligonucleotides selected from the examples above were tested at various doses in primary mouse hepatocytes. Primary mouse hepatocytes at a density of 15,000 cells per well were treated by free uptake with various concentrations of modified oligonucleotide as specified in the tables below. After a treatment period of approximately 24 hours, total RNA was isolated from the cells, and MARC1 RNA levels were measured by quantitative real-time RTPCR. Mouse MARC1 primer-probe set RTS49033 (described herein above) was used to measure RNA levels as described above. MARC1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MARC 1 RNA is presented in the tables below as percent MARC1 RNA, relative to untreated control cells (% UTC).

The half maximal inhibitory concentration (IC ₅₀ ) of each modified oligonucleotide was calculated using a linear regression on a log/linear plot of the data in Excel and is also presented in the tables below. In some cases, IC ₅₀ could not be reliably calculated, and such cases are denoted by “N.C” (Not Calculated).

Table 2. Dose-dependent reduction of mouse MARC1 RNA in primary mouse hepatocytes by modified oligonucleotides Example 3: Activity of modified oligonucleotides complementary to mouse MARC1 in wildtype mice

Wildtype C57BL/6 mice (Jackson Laboratory) were treated with modified oligonucleotides selected from studies described above. Groups of four male C57BL/6 mice were injected subcutaneously once a week for four weeks (for a total of five treatments) with 25 mg/kg of modified oligonucleotides. One group of four male C57BL/6 mice was injected with saline. The mice were euthanized seventy-two hours post the final administration of modified oligonucleotide.

Mice were sacrificed on Day 32 and RNA was extracted from liver tissue for quantitative real time RTPCR analysis of MARC 1 RNA using mouse primer probe set Mm01315446_ml (Thermo Fisher Scientific). MARCl RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MARCl RNA is presented in the table below as percent MARCl RNA relative to the amount in tissue from saline control animals (% control).

Table 3. Reduction of mouse MARCl RNA in wildtype mice

Example 4: Effect of modified oligonucleotides complementary to mouse MARCl in a GAN NASH model

Gubra-Amylin NASH (GAN) diet-fed mice represent a model of Non-Alcoholic SteatoHepatitis (NASH). Groups of nine male C57BL/6 mice (Jackson Laboratories) were fed a GAN diet rich in fat (40kcal%), fructose (20kcal%) and cholesterol (2keal%) for six months (Research Diets Cat# D09100310) to induce NASH. The mice were then injected subcutaneously once a week for sixteen weeks (a total of seventeen treatments) with 25 mg/kg of modified oligonucleotides. One group of eight male GAN diet fed C57BL/6 mice was injected with saline. The mice were euthanized seventy-two hours after the final treatment.

Compound No 549144, a control modified oligonucleotide with a sequence (from 5’ to 3’) of GGCCAATACGCCGTCA (SEQ ID NO: 14), was designed to not target MARCl. The sugar motif for Compound No 549144 is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2 -b-ϋ- deoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for Compound No 549144 is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine. RNA analysis

Mice were sacrificed on Day 116, and RNA was extracted from liver tissue for quantitative real time RTPCR analysis of MARC 1 RNA using mouse primer probe set Mm01315446_ml (Thermo Fisher Scientific). MARCl RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MARCl RNA is presented in the table below as percent MARCl RNA relative to the amount in liver tissue from saline control animals (% control).

Table 4. Reduction of mouse MARCl RNA in mouse NASH model

{ indicates that fewer than 9 samples were available

Body and organ weights Body weights of C57BL/6 mice were measured on days 1 and 114, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 116), and the average organ weights for each group are presented in the tables below.

Table 5. Body and organ weights (in grams)

{ indicates that fewer than 9 samples were available Plasma chemistry markers

Plasma was collected when mice were sacrificed on Day 116. To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), total bilirubin (TBIL), cholesterol (CHOL), high-density lipoproteins (HDL), low- density lipoproteins (LDL), triglycerides (TRIG), and blood urea nitrogen (BUN) were measured using an automated clinical chemistry analyzer (Hitachi Olympus AU400c, Melville, NY). The results were averaged for each group of mice and are presented in the tables below. Treatment of the GAN diet fed mice with modified oligonucleotides complementary to MARC1 resulted in decreases in ALT, AST, CHOL, and LDL relative to GAN diet fed mice that did not receive a modified oligonucleotides complementary to MARC1 (saline and control) as shown below.

Table 6. Plasma chemistry markers in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC 1

{ indicates that fewer than 9 samples were available

Liver triglycerides

Liver triglyceride levels were measured using the Triglycerides Liquid Reagents from Pointe Scientific (Cat# T7532). The results were normalized to liver punch weights. Data is presented as liver TRIG (mg)/liver (g).

Treatment of a mouse NASH model with MARC1 modified oligonucleotides led to a decrease in liver triglycerides compared to saline treated controls.

Table 7. Liver triglyceride in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC 1

Fibrosis markers

To evaluate the effect of modified oligonucleotides on fibrosis, liver levels of hydroxyproline, Collal, Mac2 and collagen were measured.

Liver hydroxyproline was quantified using the QuickZyme hydroxyproline kit (QuickZyme Biosciences, Cat. #QZBHYPR05). The results were normalized to total protein levels measured using QuickZyme Biosciences total protein assay kit (Cat. #QZBTOTPROT5. The results were averaged for each group of mice and are presented in the tables below. Liver levels of Collal were quantified histologically using IHC staining with LSBio antibody LS- C343921-100, and scored using Visiopharm Image Analysis software. The Collal levels are presented as a percentage of total liver area.

Liver levels of Macl were quantified histologically using IHC staining with Cedarlane antibody CL8942AP and scored using Visiopharm Image Analysis software. The Macl levels are presented as a percentage of total liver area.

Liver levels of collagen were quantified using Picro-Sirius Red staining and scored using Visiopharm Image Analysis software. PSR stain levels are presented as a percentage of total liver area.

Treatment of a NASH model with modified oligonucleotides complementary to MARC1 resulted in a decrease in fibrosis markers compared to saline treated controls.

Table 8. Fibrosis markers in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC 1

{ indicates that fewer than 9 samples were available

Example 5: Design of GalNAc conjugated cEt gapmer complementary to a mouse MARC1 nucleic acid

A modified oligonucleotide complementary to a mouse MARC1 nucleic acid was designed and synthesized. “Start site” indicates the 5’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. “Stop site” indicates the 3’-most nucleoside to which the modified oligonucleotide is complementary in the target nucleic acid sequence. The modified oligonucleotide listed in the table below is 100% complementary to SEQ ID NO: 1 (described herein above), to SEQ ID NO: 2 (described herein above), or to both.

The modified oligonucleotide in Table 9 below is a 3-10-3 cEt gapmer with uniform phosphorothioate intemucleoside linkages. The modified oligonucleotide is 16 nucleosides in length, wherein the central gap segment consists of ten 2 ^‘ -[l-D-dco.xy nucleosides. and wherein the 5’ and 3’ wing segments each consist of three cEt nucleosides. The sugar motif for the modified oligonucleotide is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2 ^‘ -[l-D-dcoxyribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for the modified oligonucleotide is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methylcytosine. The modified oligonucleotide is conjugated to a THA-C6-GalNAc ₃ conjugate (designated as [THA-GalNAc-]) at the 5’ end of the modified oligonucleotide. THA-GalNAc (or “LICA-1”) is represented by the structure below, wherein the phosphate group is attached to the 5’-oxygen atom of the 5’-nucleoside:

THA-GalNAc

Table 9

GalNAc conjugated 3-10-3 cEt gapmer with uniform phosphorothioate intemucleoside linkages complementary to mouse M ARC 1

Example 6: Tolerability and activity of modified oligonucleotides complementary to mouse MARC1 in a GAN NASH model

Gubra-Amylin NASH (GAN) diet-fed mice represent a model of Non-Alcoholic SteatoHepatitis (NASH). Male C57BL/6 mice (Taconic) were fed a GAN diet rich in fat (40kcal%), fructose (20kcal%), and cholesterol (2kcal%) for 32 weeks (Research Diets Cat# D09100310) to induce NASH then treated with modified oligonucleotides selected from studies described above and evaluated for changes in the levels of various plasma chemistry markers.

Treatment

Groups of eight male GAN diet fed C57BL/6 mice each were injected subcutaneously once a week for 16 weeks (for a total of 17 treatments) with various doses of modified oligonucleotides indicated in the tables below. One group of eight male GAN diet fed C57BL/6 mice was injected with saline. The mice were euthanized seventy-two hours post the final administration of modified oligonucleotide.

Compound No 792169, a control modified oligonucleotide with a sequence (from 5’ to 3’) of CGCCGATAAGGTACAC (SEQ ID NO: 93), was designed to not target MARC1. The sugar motif for Compound No 792169 is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2’ -b-D-deoxyribosyl sugar moiety, and each

“k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for Compound No 792169 is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5- methyl cytosine. Compound No 1287694, a control modified oligonucleotide with a sequence (from 5’ to 3’) of CGCCGATAAGGTACAC (SEQ ID NO: 93), was designed to not target MARC1. The sugar motif for Compound No 1287694 is (from 5’ to 3’): kkkddddddddddkkk; wherein each “d” represents a 2 ^‘ -[l-D-dco.\yribosyl sugar moiety, and each “k” represents a cEt modified sugar moiety. The intemucleoside linkage motif for Compound No 1287694 is (from 5’ to 3’): sssssssssssssss; wherein each “s” represents a phosphorothioate intemucleoside linkage. Each cytosine residue is a 5-methyl cytosine. Compound No 1287694 is conjugated to a THA-C6-GalNAc ₃ conjugate (designated as [THA- GalNAc-]) at the 5’ end of the modified oligonucleotide. The structure of THA-GalNAc is described herein above, wherein the phosphate group is attached to the 5’-oxygen atom of the 5’-nucleoside.

Body and organ weights Body weights of C57BL/6 mice were measured on days 1 and 115, and the average body weight for each group is presented in the table below. Liver, kidney, and spleen weights were measured on the day the mice were sacrificed (day 115), and the average organ weights for each group are presented in the tables below.

Table 10

Body and organ weights (in grams)

RNA analysis

Mice were sacrificed on Day 115 and RNA was extracted from liver tissue for quantitative real time RTPCR analysis of MARC1 RNA using mouse primer probe set Mm01315446_ml (Thermo Fisher Scientific). MARC1 RNA levels were normalized to total RNA content, as measured by RIBOGREEN®. Reduction of MARC1 RNA is presented in the table below as percent MARC1 RNA relative to the amount of MARC1 RNA from saline control animals (% control).

Table 11

Reduction of mouse MARC1 RNA in wildtype mice on a GAN diet

Plasma chemistry markers

To evaluate the effect of modified oligonucleotides on liver and kidney function, plasma levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), blood urea nitrogen (BUN), and total bilirubin (TBIL), cholesterol (CHOL), high-density lipoprotein (HDL), low-density lipoprotein (LDL), and triglycerides (TRIG) were measured on the day the mice were sacrificed (day 115) using an automated clinical chemistry analyzer (Beckman Coulter AU480 Chemistry Analyzer, Marietta GA). The results were averaged for each group of mice and are presented in the tables below.

Treatment of a mouse NASH model with MARC1 modified oligonucleotides led to a decrease in plasma lipids compared to saline and negative control treated animals.

Table 12

Plasma chemistry markers in C57BL/6 mice

Steatosis markers

Liver triglyceride levels were measured using the Triglycerides Liquid Reagents from Pointe Scientific (Cat# T7532). The results were normalized to liver punch weights. Data is presented as liver triglyceride (mg)/liver (g).

Liver levels of neutral lipids were quantified on frozen sections using Oil Red O solution (EMS cat#26079-15) and scored using Visiopharm Image Analysis software. The ORO levels are presented as a percentage of total liver area. Treatment of a mouse NASH model with MARC1 modified oligonucleotides led to a decrease in liver triglycerides and ORO levels compared to saline and negative control treated animals.

Table 13

Liver trigycerides and ORO levels in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC1

$ Indicates less than 8 samples available

Liver total cholesterol levels were measured using enzymatic colorimetric reagents from Fujifilm Healthcare Americas Corporation (Cat# 999-02601). The results were normalized to liver punch weights. Data is presented as liver total cholesterol (mg)/liver (g).

Liver free cholesterol levels were measured using enzymatic colorimetric reagents from Fujifdm Healthcare Americas Corporation (Cat# 999-02501). The results were normalized to liver punch weights. Data is presented as liver free cholesterol (mg)/liver (g).

Liver esterified cholesterol levels were calculated by formula (total cholesterol-free cholesterol) ^c 1.67. The results were normalized to liver punch weights. Data is presented as liver lipid (mg)/liver (g).

Treatment of a mouse NASH model with MARC1 modified oligonucleotides led to a decrease in liver total, free, and esterified cholesterol compared to saline and negative control treated subjects.

Table 14

Liver cholesterol in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC1

$ Indicates less than 8 samples available

Fibrosis markers

To evaluate the effect of modified oligonucleotides on fibrosis, liver levels of hydroxyproline, Collal, and total collagen were measured.

Liver hydroxyproline was quantified using the QuickZyme hydroxyproline kit (QuickZyme Biosciences, Cat. #QZBHYPR05). The results were normalized to total protein levels measured using QuickZyme Biosciences total protein assay kit (Cat. #QZBTOTPROT5). The results were averaged for each group of mice and are presented in the tables below. Liver levels of Collagen, type I, alpha 1 (Collal) were quantified histologically using IHC staining with LSBio antibody LS-C343921-100, and scored using Visiopharm Image Analysis software. The Collal levels are presented as a percentage of liver area.

Liver levels of collagen were quantified using Picro-Sirius Red staining (EMS cat#26357-07) and scored using Visiopharm Image Analysis software. PSR stain levels are presented as a percentage of total liver area.

Treatment of a NASH model with modified oligonucleotides complementary to MARC1 resulted in a decrease in fibrosis markers compared to saline and negative control treated animals.

Table 15

Fibrosis markers in mouse NASH model treated with modified oligonucleotides complementary to mouse MARC1

$ Indicates less than 8 samples available