Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
NOVEL BIOCONTROL AGENT AND USE THEREOF FOR CONTROLLING FUNGAL DISEASES OF PLANTS
Document Type and Number:
WIPO Patent Application WO/2020/254533
Kind Code:
A1
Abstract:
The present invention relates to a novel biocontrol agent and to the use thereof for controlling fungal diseases of plants.

Inventors:
LEPORINI SOPHIE (FR)
FAGOT JULIEN (FR)
MARINKOVIC SINISA (FR)
FABRE NICOLAS (FR)
BELLOY CHRISTIAN (FR)
Application Number:
PCT/EP2020/067034
Publication Date:
December 24, 2020
Filing Date:
June 18, 2020
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
AGRO INDUSTRIE RECH ET DEVELOPPEMENTS A R D (FR)
International Classes:
C12N1/14; C12R1/885
Domestic Patent References:
WO2009116106A12009-09-24
Foreign References:
CN103484384A2014-01-01
Other References:
SAVAZZINI F ET AL: "Real-time PCR for detection and quantification of the biocontrol agent Trichoderma atroviride strain SC1 in soil", JOURNAL OF MICROBIOLOGICAL METHODS, ELSEVIER, AMSTERDAM, NL, vol. 73, no. 2, 1 May 2008 (2008-05-01), pages 185 - 194, XP022620396, ISSN: 0167-7012, [retrieved on 20080328], DOI: 10.1016/J.MIMET.2008.02.004
LONGA CLAUDIA MARIA OLIVEIRA ET AL: "Ecophysiological requirements and survival of a Trichoderma atroviride isolate with biocontrol potential", JOURNAL OF BASIC MICROBIOLOGY, WILEY - V C H VERLAG GMBH & CO. KGAA, BERLIN, DE, vol. 48, no. 4, 1 August 2008 (2008-08-01), pages 269 - 277, XP002506410, ISSN: 0233-111X, DOI: 10.1002/JOBM.200700396
VERÃ3NICA FABIANA CONSOLO ET AL: "Characterization of novelspp. isolates as a search for effective biocontrollers of fungal diseases of economically important crops in Argentina", WORLD JOURNAL OF MICROBIOLOGY AND BIOTECHNOLOGY, KLUWER ACADEMIC PUBLISHERS, DO, vol. 28, no. 4, 17 November 2011 (2011-11-17), pages 1389 - 1398, XP035037877, ISSN: 1573-0972, DOI: 10.1007/S11274-011-0938-5
BEARCHELL, S. J.FRAAIJE, B. A.SHAW, M. W.FITT, B. D. L.: "Wheat archive links long-term fungal pathogen population dynamics to air pollution", PROCEEDINGS OF THE NATIONAL ACADEMY OF SCIENCES OF THE UNITED STATES OF AMERICA, vol. 102, no. 15, 2005, pages 5438 - 42
PARRY, D. W.JENKINSON, P.MCLEOD, L.: "Fusarium ear blight (scab) in small grain cereals, a review", PLANT PATHOLOGY, vol. 44, no. 2, 1995, pages 207 - 238
ALI, S.GLADIEUX, P.LECONTE, M.GAUTIER, A.JUSTESEN, A. F.HOVMOLLER, M. S.ENJALBERT, J.DE VALLAVIEILLE-POPE, C.: "Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis fsp. tritici", PLOS PATHOGENS, vol. 10, no. 1, 2014, pages e1003903
DE VALLAVIEILLE-POPE, C.ALI, S.LECONTE, M., SPÉCIAL REPORT VIRULENCE DYNAMICS AND RÉGIONAL STRUCTURING OF PUCCINIA STRIIFORMIS F SP. TRITICI IN FRANCE BETWEEN 1984 AND 2009, 2012
ROSSI, V.RACCA, P.GIOSUE', S.PANCALDI, D.ALBERTI, I.: "A simulation model for the development of brown rust épidémies in winter wheat", EUROPEAN JOURNAL OF PLANT PATHOLOGY, vol. 103, no. 5, 1997, pages 453 - 465
FELLER ET AL.: "Phànologische entwicklungsstadien von gemüsepflanzen: II. Fruchtgemüse und hülsenfrüchte", NACHRICHTENBL. DEUT. PFLANZENSCHUTZD, 1995
HIBAR, K.DAAMI-REMADI, M.KHIAREDDINE, H.MAHJOUB, M. EL, EFFET INHIBITEUR IN VITRO ET IN VIVO DU TRICHODERMA HARZIANUM SUR FUSARIUM OXYSPORUM F. SP. RADICIS-LYCOPERSICI., 2005
STEYAERT J.RIDGWAY H.ELAD Y.STEWART A.: "Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma", NEW ZEALAND JOURNAL OF CROP AND HORTICULTURAL SCIENCE, vol. 31, no. 4, 2003, pages 281 - 291
HARDOIM, P. R.VAN OVERBEEK, L. S.BERG, G.PIRTTILÀ, A. M.COMPANT, S.CAMPISANO, A.SESSITSCH, A.: "The Hidden World within Plants: Ecological and Evolutionary Considérations for Defining Functioning of Microbial Endophytes", MICROBIOLOGY ANDMOLECULAR BIOLOGY REVIEWS, vol. 79, no. 3, 2015, pages 293 - 320
STÇPNIEWSKA, Z.KUZNIAR, A.: "Endophytic microorganisms--promising applications in bioremediation of greenhouse gases", APPLIEDMICROBIOLOGY AND BIOTEEHNOLOGY, vol. 97, no. 22, 2013, pages 9589 - 96, XP035328575, DOI: 10.1007/s00253-013-5235-9
Attorney, Agent or Firm:
GROSSET-FOURNIER, Chantal et al. (FR)
Download PDF:
Claims:
REVENDICATIONS

1. Souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants,

en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, et

de préférence, ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

2. Souche isolée de Trichoderma atroviride selon la revendication 1, sous forme de spores, produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide.

3. Souche isolée de Trichoderma atroviride selon la revendication 1 ou 2, en tant qu’ agent de lutte biologique,

en particulier en tant qu’ agent antifongique de végétaux dirigé contre un champignon pathogène pour végétaux, ledit champignon pathogène étant notamment choisi parmi Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis.

4. Composition phytosanitaire comprenant :

la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en tant que principe actif ; ou

les métabolites émis lors de la production la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en tant que principe actif ; ou la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et ses métabolites émis lors de sa production en tant que principe actif ; ou la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 en association avec au moins un autre agent de lutte biologique en tant que principe actif ; ou

la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et ses métabolites émis lors de la production de la souche en association avec au moins un autre agent de lutte biologique en tant que principe actif.

5. Composition phytosanitaire selon la revendication 4, comprenant une quantité efficace de 104 à 1012 spores/g, plus particulièrement de 107 à 109 spores/g,

ladite composition phytosanitaire étant éventuellement obtenue après une étape de préparation la rendant prête à l’épandage.

6. Utilisation de la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 ou de la composition phytosanitaire selon la revendication 4 ou 5 dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge ; et/ou

pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge.

7. Composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride selon l’une quelconque des revendications 1 à 3 et éventuellement au moins un agent de fixation.

8. Semence enrobée comprenant une graine de végétal, ladite graine de végétal étant enrobée par la composition phytosanitaire d’enrobage telle que définie selon la revendication 7 et ledit végétal appartenant notamment à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge.

9. Procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition selon la revendication 4 ou 5 sur au moins une partie dudit végétal ou du sol à proximité dudit végétal,

en particulier ladite partie dudit végétal est une feuille, un fruit, une graine, et

en particulier ledit végétal appartient à la famille des Poaceae , notamment le blé et/ou le maïs et/ou l’orge.

10. Procédé selon la revendication 9, dans lequel ladite composition est épandue

à raison de 10 à 500 L/ha, en particulier de 50 à 250 L/ha, notamment pour la pulvérisation aérienne ; ou

à raison d’une quantité efficace de 1010 à 1014 spores/ha, en particulier de 1010 à 1012 spores/ha, notamment pour les épandages aériens de type pulvérisation foliaire.

11. Procédé selon la revendication 9 ou 10, dans lequel ledit champignon pathogène est Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis.

12. Procédé selon l'une quelconque des revendications 9 à 11, dans lequel

la protection dudit végétal comprend une étape d’enrobage de la semence avec ladite composition phytosanitaire ; et/ou

la protection dudit végétal comprend la pulvérisation de ladite composition au moment du semis ou à la germination dudit végétal ; et/ou

la protection dudit végétal comprend soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire avec l’apport d’amendement organique, soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire sur la culture précédente ; et/ou

le traitement dudit végétal comprend la pulvérisation de ladite composition aux cours de différents stades phénologiques de la plante en prévention à un risque d’infection dudit champignon pathogène de l’ensemble ou une partie de la plante.

Description:
DESCRIPTION

TITRE : NOUVEL AGENT DE BIOCONTROLE ET SON UTILISATION POUR LA LUTTE CONTRE DES MALADIES FONGIQUES DE PLANTES

DOMAINE DE L’INVENTION

La présente invention concerne un nouvel agent de biocontrôle et son utilisation pour la lutte contre des maladies fongiques de plantes.

ART ANTERIEUR

Différentes maladies menacent le blé au cours de sa croissance. Elles peuvent être classées en trois catégories :

les maladies de la base des tiges (ex : piétin- verse, fusariose),

les maladies des feuilles (ex : oïdium, septoriose, helminthosporiose, rouille jaune et rouille brune) ;

et les maladies des épis (ex : fusariose de l’épi, oïdium de l’épis et septoriose).

Suivant les variétés de plantes et les conditions climatiques, des pertes quantitatives importantes des récoltes sont possibles, comme avec la septoriose qui réduit l’activité photosynthétique de la plante. De plus, d’autres maladies peuvent altérer la qualité de la récolte, telle la fusariose de l’épi qui produit des my cotoxines.

Plus précisément :

[1] La septoriose. dont l’agent pathogène est Septoria tritici (= Mycosphaerella graminicola ), est, sur le blé tendre, la maladie la plus fréquente et la plus dommageable quantitativement avec par exemple 17 q/ha de baisse de rendement moyen à l’échelle du territoire sur les dix dernières années. La « septoriose du blé » désigne deux maladies :

la septoriose des épis causée par le champignon Phaeosphaeria nodorum (anamorphe / forme asexuée : Stagonospora nodorum) qui attaque les feuilles mais aussi les épis et les grains de blé ; et

la septoriose des feuilles causée par le champignon Mycosphaerella graminicola (anamorphe / forme asexuée : Septoria tritici , récemment renommée Zymoseptoria tritici) qui attaque les feuilles et les gaines de blé. La septoriose à P. nodorum a été l’espèce prédominante en France jusque dans les années 80, de nos jours la forme majoritaire est la septoriose à M. graminicola , sans doute pour des raisons écologiques (Bearchell, S. J., Fraaije, B. A., Shaw, M. W., & Fitt, B. D. L. (2005). Wheat archive links long-term fungal pathogen population dynamics to air pollution. Proceedings of the National Academy of Sciences of the United States of America, 102(15), 5438-42.).

[2] La fusariose. dont l’agent pathogène est Gibberella zeae (= Fusarium graminearum ), est un terme générique qui désigne un groupe de maladies cryptogamiques. Dans le cas du blé, cette maladie peut dévaster une culture quelques semaines avant la récolte. Outre le blé, elle est également retrouvée sur d’autres espèces comme le maïs et l’orge. Contrairement à la septoriose, la fusariose peut infecter toutes les parties de la plante, depuis les racines jusqu’aux épis, et ceci à tous les stades de développement. Le terme « fusariose » des céréales regroupe trois types de symptômes (Parry, D. W., Jenkinson, P., & McLeod, L. (1995). Fusarium ear blight (scab) in small grain cereals, a review. Plant Pathology , 44(2), 207- 238.) :

la fusariose des semences ;

la fusariose du collet ; et

la fusariose de l’épi.

Cette dernière, la fusariose de l’épi est associée à un complexe d’espèces de champignons appartenant aux genres Fusarium et Microdochium. Le genre Fusarium a été décrit pour la première fois en 1809 par Link et doit son nom du latin « fusus » (fuseau) en rapport à l’allure fusiforme de ses spores. Il appartient à la division des ascomycètes, à l’ordre des Hypocreales et à la famille des Nectriaceae. Parmi la vingtaine d’espèces du genre Fusarium pouvant causer la fusariose de l’épi, F. graminearum, est l’une des espèces la plus problématique en France de par sa production de mycotoxines dont le trichothécène déoxynivalenol (DON).

[3] La rouille brune du blé dont l’agent pathogène est Puccinia recondita , est une maladie qui apparaît généralement assez tardivement au printemps. Elle peut provoquer d'importants dégâts si elle est mal contrôlée. Le champignon hiverne essentiellement sur les repousses de céréales et les cultures à semis précoces sous forme d’urédospores. Ces urédospores germent en présence d’eau libre et pour des températures comprises entre 15 et 25°C. La période de sporulation est de 5 à 25 jours selon les températures et les variétés. En conditions favorables, plus de 3000 urédospores peuvent être produites par pustule, ce qui explique le caractère explosif de la maladie. Les spores sont disséminées principalement par le vent (Ali, S., Gladieux, P., Leconte, M., Gautier, A., Justesen, A. F., Hovmoller, M. S., Enjalbert, J., de Vallavieille-Pope, C. (2014). Origin, Migration Routes and Worldwide Population Genetic Structure of the Wheat Yellow Rust Pathogen Puccinia striiformis f.sp. tritici. PLoS Pathogens , 10(1), el003903 ; De Vallavieille-Pope, C., Ali, S., & Leconte, M. (2012). Spécial Report Virulence Dynamics and Régional Structuring of Puccinia striiformis f sp. tritici in France Between 1984 and 2009.).

[4] La rouille jaune du blé dont l’agent pathogène est Puccinia striiformis , est une maladie qui peut être très nuisible sur des variétés sensibles en cas d’attaques précoces. Les conditions fraîches et humides sont favorables à son développement. La rouille jaune passe l’hiver sous forme de mycélium ou de spores actives sur les repousses de céréales ou les cultures semées tôt à l’automne. Ce champignon résiste à des températures négatives et survit généralement à l’hiver sur des plants infectés. Au printemps, la rouille jaune commence à se développer et produit des spores actives, et ce d’autant plus que le temps est frais et humide. Les conditions optimales pour la germination des spores sont réunies lorsque les températures sont comprises entre 10 et 13°C avec un taux d’humidité relative à 100 %. Les spores sont disséminées principalement par le vent (Rossi, V., Racca, P., Giosue’, S., Pancaldi, D., & Alberti, F (1997). A simulation model for the development of brown rust épidémies in winter wheat. European Journal of Plant Pathology, 103(5), 453-465.).

Parmi les différentes méthodes de lutte disponibles pour lutter contre ces maladies, notamment la septoriose et la fusariose et leurs conséquences, il existe la lutte chimique (fongicides), la résistance variétale, les stimulateurs de défenses des plantes (SDN ou « éliciteurs »), la lutte agronomique (travail du sol, précédents culturaux, gestion des résidus de culture ou des repousses, date et densité de semis, fertilisation azotée...). Toutefois, celles- ci présentent soit des inconvénients environnementaux liés à la pollution de sols et des nappes phréatiques, soit impliquent un coût humain et temporel important.

Dans un souci de respect de l’environnement, il a alors été développé des moyens de lutte biologique naturelle à l’aide de microorganismes. Cette dernière, également appelée lutte microbiologique directe, consiste à introduire des antagonistes microbiens spécifiques dans le sol ou sur le matériel végétal. Ces antagonistes, également appelés agents de lutte biologique ou BCA ( Biological Control Agent ), peuvent interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler. Pour ce faire, les agents de lutte biologique ou BCA peuvent contrôler les pathogènes cibles grâce à un ou plusieurs modes d’action :

1/ la compétition laquelle peut avoir lieu entre le BCA et l’agent pathogène pour l’oxygène, pour l’espace, ou encore pour les nutriments ;

2/ l’antibiose. laquelle correspond aux interactions impliquant au moins un composé diffusible de faible masse moléculaire ou un antibiotique produit par un microorganisme qui inhibe la croissance d’un autre microorganisme;

3/ le parasitisme et la production d’enzymes hydrolytiques et/ou de métabolites antibiotiques au détriment d’un autre organisme hôte ; et/ou

4/ l’induction de résistance chez la plante hôte (« élicitation ») à l’image des bactéries de la rhizosphère, connues sous le nom de PGPR Plant Growth Promoting Rhizobacteria ), lesquelles sont capables d'induire chez la plante une résistance systémique induite (ISR, Induced Systemic Résistance) qui permet d'accroître la résistance aux pathogènes grâce à un phénomène de potentialisation (ou priming ), qui correspond à un état de veille permettant une réponse immunitaire plus rapide et plus intense de la plante.

Le genre Trichoderma comprenant diverses espèces de champignons susceptibles d’être des agents de biocontrôle, leur mode d’action a fait l’objet de nombreux travaux. Ils font notamment état d’une capacité de ce champignon filamenteux à intervenir selon divers mécanismes : mycoparasitisme, antagonisme (compétition), antibiose (production d’antibiotiques), stimulation racinaire, stimulation de la croissance par solubilisation de minéraux fertilisants, stimulation des défenses naturelles des plantes, etc. Ils colonisent les racines des plantes herbacées et ligneuses sans aucun dommage. En outre, ce champignon peut pénétrer dans les racines et favoriser le développement, la nutrition et la résistance aux maladies. Toutefois, les effets sont inégaux d’une espèce à l’autre voire d’une souche à l’autre car un bon agent de lutte biologique doit être un bon colonisateur et un bon antagoniste mais surtout, il doit également être compatible avec la rhizosphère et avec les plantes.

BREF APERÇU

Dans ce contexte de lutte contre des maladies fongiques, telles que la septoriose et la fusariose, un premier but de l’invention consiste donc à la mise à disposition d’une souche efficace, comme un agent de lutte biologique (ou agent de biocontrôle). Un second but de l’invention est de fournir des compositions phytosanitaires pour la prévention et/ou le traitement de maladies fongiques de végétaux.

Un troisième but de l’invention est également de fournir des compositions phytosanitaires d’enrobage où, en association avec une semence de plante, la souche de l’invention est utilisée comme un agent d’accélération de la germination de ladite semence.

Un autre but de l’invention est la mise à disposition des procédés permettant de fabriquer lesdites compositions et de mettre en œuvre la prévention et/ou le traitement de maladies fongiques de végétaux, et l’accélération de la germination.

DESCRIPTION DETAILLEE

Un premier aspect de l’invention concerne une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

De manière surprenante, il est apparu que la souche de Trichoderma atroviride TAL-17 développée par les inventeurs, dont le gène ech42 a été séquencé, possède d’excellentes propriétés stimulatrices de croissance, des propriétés antagonistes utiles en agriculture ainsi qu’une grande stabilité en matière de viabilité. De fait, elle constitue un agent de biocontrôle idéal pour lutter efficacement contre des maladies fongiques de plantes.

Par « une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 », on entend une identité de séquence d’au moins 98,5%, d’au moins 99% voire d’au moins 99,5% avec la séquence SEQ ID NO : 1 représentée par la séquence d’acide nucléique suivante :

AC AG T AT AAG CAT AT C G GAGAAAT G C CAC CAC C AG C AAC G T T G C T AGAC T T G G C GAG G T G C G GCATAGT TCAGTGATAT TGCGCCGGGGCATCCCCTGGATATGCT TATCT TCTGAATCTGGGG AACT TGGGAAT TCTACGAGTCGACAGCCGCCGAGCCCTGGGCACGGGACAGGGGCCACAAGC T C T T G CAC GAT G G CAC T AT T C T AGAG C AGAAG T GAG CAT AAC G T T G C GAT T GAC CAT G T T G G C AAAG CAT G G G T T AC AT AC C TAC T C G T G C T AAGAAC C C C GAAAG G GAAG C T T CAT AAG T T GA C T T CAGAT T T CGC T GAACAATAGGAGGC T CCACAAT CAC T TATAAATAT GC T GCATAT CC T T CCAGCACT TCG GAT G AAAAT TCCATCCAGCAGCAG C AAC T T G G AG AG CTCT T T TCAGCAGCA ACT TCT TCCT T TCAAAGCATCTCT TGACAACCT T TGCTGAATCTCAAACACT TCACCATGT T GGGCT TCCTCGGAAAATCCGTGGCCCTGCT TGCTGCGCTGCAGGCCACTCTCAT T TCTGCAT

CTCCTGTAACTGCAAACGACGTCTCTGT TGAGAAGAGAGCCAGTGGATACGCAAACGCCGTC TAC T T CAC C AAC T G G T AAG T GAAG C T G C T T C AGAG T CAT GAAAAT C AG GAC T AAC CAT T G G T GATTAAAGGGGTATTTACGGCCGCAACTTCCAGCCTCAGAACCTGGTCGCGTCGGACATC AC TCATGTCATCTACTCGTTCATGAACTTCCAAGCAGACGGCACTGTGTAAGTTTTGAAGAC AA GAGTCAAGATATTCTAATTTCCATATCCAGTGACTAATCTTTTCACTTATAGCGTCTCTG GA GAT G C C TAC G C C GAT T AT C AGAAG CAC T AT GAC GAC GAT T G T AT G C T AG C C C TAC T C C C T T T GTTCTCTCCTGTTTTTGAGCTCTTCAGGTATACTAACGTCTACAACAGCTTGGAACGACG TC GGTAACAATGCGTACGGCTGTGTGAAGCAGCTGTTCAAGCTGAAGAAGGCCAACCGCAAC TT GAAGGTTATGCTTTCCATCGGTGGCTGGACCTGGTCCACCAACTTTCCTTCTGCAGCAAG CA CCGATGCCAACCGCAAGAACTTTGCCAAGACTGCCATCACCTTCATGAAGGACTGGGGTT TC GATGGTATTGACGTCGATTGGGAGTACCCCGCCGATGATACCCAGGCCACCAACATGGTT CT TCTGCTCAAGGAGATCCGATCTCAGCTAGATGCCTATGCTGCGCAATACGCTCCGGGCTA CC ACTTCCTTCTTTCCATTGCTGCCCCCGCTGGCCCAGAGCACTACTCTTTCCTGCACATGT CC GACCTTGGCCAAGTTCTCGACTATGTCAACCTCATGGCCTACGACTATGCTGGTTCTTGG AG CAGCTACTCCGGACACGATGCCAACTTGTTTGCCAACCCGTCCAACCCCAACTCTTCACC AT AC AAC AC C GAT C AAG C T AT C AAG GAC TATAT C AAG G GAG GTGTTCCCG C AAG C AAGAT C G T T CTTGGCATGCCCATCTACGGACGAGCTTTTGAGAGCACCGGTGGCATTGGCCAGACCTAC AG TGGAATTGGATCTGGAAGCTGGGAGAACGGTATTTGGGACTACAAGGTTCTTCCCAAGGC CG G C G C CAC AG T C C AG T AT GAC T C T G T C G CAC AG G CAT AC T AC AG C T AT GAC C C C AG C AG C AAG GAGCTCATCTCTTTCGATACCCCTGACATGATCAACACCAAGGTCTCTTACCTCAAGAAC CT CGGCCTGGGAGGCAGCATGTTCTGGGAAGCTTCTGCTGACAAGACTGGCTCTGACTCCTT GA T C G G AAC AAG C CAC AG AG C T T T G G GAAG C C T AG AC T C CAC T C AG AAC T T G C T GAG C T AC C C C AACTCCCAGTATGATAACATCCGAAGCGGTCTCAACTAGAGATCTTTCTTCTTCTTATCT TT TTCTTTTACTTCCCCTATGGTTGTACCAACATTTCACACACGTTATGCGAAACGATTATG CA G G GAG CGTTATTTTTTAG T AAAT AG TTGCCCTTT GAGAT AT AT G AAC C T G T AC AT AAAGAAC TAC T AG C AG T AT AT AAG GAGAC AT G C AG G .

Au sens de l’Invention, l’identité de séquence est mesurée par les outils classiques de comparaison de séquences connues de l’Homme du métier tels que les algorithmes de la plateforme BLAST ou le programme MatGat (Campanella, Bitincka and Smalley, 2003).

Plus particulièrement, un des objets de l’invention est la souche isolée de Trichoderma atroviride déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants.

Par « souche isolée », on entend la culture d’un microorganisme unique qui a été isolée à partir de différents microorganismes présents sur et/ou dans les tissus d’un fragment de feuille de blé cultivé en champs. Par « un de ses mutants », on entend des souches mutantes obtenues par mutations ou manipulations génétiques d’une souche de référence, laquelle dans le contexte de l’invention est la souche isolée de Trichoderma atroviride TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333. Ces mutants conservent toutefois les mêmes propriétés physiologiques que la souche de référence voire peuvent présenter des propriétés physiologiques améliorées ( e.g . amélioration des capacités de biocontrôle).

Au vu de ce qui précède, on comprend donc qu’un des objets de l’Invention concerne également une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants,

en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333 et/ou un de ses mutants, et de préférence, ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

L’ensemble de ces souches (i.e. TAL-17 et ses mutants), peuvent par ailleurs être facilement identifiées via la méthode dite de Polymerase Chain Reaction en temps réel (qPCR). Les inventeurs ont en effet développé des outils spécifiques de celles-ci à savoir, une sonde TaqMan ® GS285741-P1 et un couple d’amorces nucléotidiques associé GS285741-F1 et GS285741-R1 ( cf Tableau 1), lesquelles permettent d’amplifier une séquence spécifique aux souches de l’invention {cf. Tableau 2).

Nom Séquence SEQ ID NO : Tm (°C)

GS285741-R1 AAC-GAG-ACT-TGA-CAG-TAG-CG 3 60,0

GS285741-P1 FAM-ACG-GCG-TAT-ATT-GTT-GAC-AAA- 4

CAA-GAT-GC-MGB

Tableau 1 : Amorces nucléotidiques (Fl et RI) et Sonde TaqMan ® (PI)

FAM : 6-carboxyfluorescéine, MGB : minor groove binder. SEQ ID

Nom Séquence

NO :

Dell 1_285741 GCAATAAC T GC T CGTAT TAC T CCAGAAAAAGGGGCAAGT C TA 5 Ins (251-264) TCAACAGCCGCCGCTGCCAAGAATACGGGCTGGTCCTAGT TC

AAAT TGT TCATCGTCGCT TGGTGCTGCGTAGTCT TGAGCTAA AT GT T TAGCCAAT T C T CAAACGC T T GGCAGATAAAT T T TAT T AT T TAC C C T AGAAT AT G G T CAT T G G C GAAT G C C AGAC GAAT C AATC T GGAT GAT GCC T T CAACAGAT GGCCAT GCATCT TGT T T GTCAACAATATACGCCGT TGATGGGGCGCTACTGTCAAGTCT CGT T T TGATACTCTAGT T TCTCTCTCGTGATATATCAGCCGC CAC C T T AT G T AAAAC AG C C T G C AT CAAT T C T C CAAAT T GAC A T T GT T GTATAAAGAGGAAGGCGC T CATAGAT GC TATACAT CA T GAT T AACAAAGG T T AT T T AC T ACAAT T C T T C T T G T T AT GC T CGCAAT TCTCTACT TCTGATGGAATGTCCACGTGCGTAGCT T GTGTAGTACT

Tableau 2 : Séquence cible des oligonucléotides et de la sonde TaqMan ® chez la souche TAL-17 et/ou ses mutants

De façon très particulière, un des objets de l’invention concerne une souche isolée de Trichoderma atroviride dont le gène ech42 possède une identité de séquence d’au moins 98% avec la séquence SEQ ID NO : 1 du gène ech42 de la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333,

en particulier ladite souche isolée de Trichoderma atroviride est la souche TAL-17 déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

Plus particulièrement encore, un des objets de l’invention est la souche isolée de Trichoderma atroviride déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

Selon ce même aspect, un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention sous forme de spores, produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide.

Par « sous forme de spores », on entend sous forme de conidiospores ou chlamydospore, (plus particulièrement conidiospores) assurant la fonction de multiplication asexuée chez le champignon. Par « fermentation en milieu solide (FMS) », on entend tout procédé permettant le développement du micro-organisme à la surface et/ou à l’intérieur d’une matrice de production poreuse solide et humidifiée, en absence d’eau libre.

Par « fermentation liquide », on entend tout procédé permettant le développement du micro organisme à l’aide d’une matrice de production avec présence d’eau libre.

Par « matrice de production », on entend tout substrat naturel et/ou synthétique, qui permet le développement du micro-organisme et induit la production de biomasse, et/ou d’enzymes, et/ou de métabolites primaires et/ou secondaires. Des exemples de familles d’enzyme ou d’enzyme produites par le champignon sont des protéases, des chitinases et la bêta- 1,3- glucanase.

Par « spores [...] sous forme purifiées », on entend les spores concentrées suite à l’élimination de la majeure partie du reste de la matrice après production n’ayant pas servi à la formation des spores, avec l’aide d’un procédé de tamisage par exemple.

Par « spores [...] dans la matrice de production », on entend les spores restées dans la matrice de production à l’issue du process de fabrication, sans étape de purification.

Un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention en tant qu’agent de lutte biologique.

Par « agent de lutte biologique », on entend qu’une souche de Trichoderma atroviride selon l’invention peut interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler et ce, via l’un ou plusieurs des modes d’action décrits précédemment (e.g. via le développement de sa biomasse et/ou sa production d’enzymes et/ou de métabolites secondaires). Par exemple, un des moyens de mettre en évidence qu’une souche de Trichoderma atroviride selon l’invention est un agent de lutte biologique est la réalisation d’un test Dual culture sur milieu de culture en boîte de Pétri comme ceux présentés parmi les exemples ci-après. Plus précisément par « test Dual culture », on entend un test sur boîte de Pétri en laboratoire sur milieu de culture, où la souche du microorganisme agent de lutte biologique et la souche du pathogène sont mises en culture sur la même boîte afin d’observer l’effet d’une souche sur une autre au cours du temps et vice versa.

Un autre des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention, en tant qu’agent antifongique de végétaux.

Par « agent antifongique de végétaux », on entend qu’une souche de Trichoderma atroviride selon l’invention est capable de lutter contre les champignons phytopathogènes. Par exemple, un des moyens de mettre en évidence qu’une souche de Trichoderma atroviride selon l’invention est un agent antifongique de végétaux est la réalisation d’un test Dual culture comme ceux présentés parmi les exemples ci-après.

De façon très particulière, un des objets de l’invention concerne la souche isolée de Trichoderma atroviride de l’invention en tant qu’ agent de lutte biologique,

en particulier en tant qu’ agent antifongique de végétaux dirigé contre un champignon pathogène pour végétaux, ledit champignon pathogène étant notamment choisi parmi Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis.

Un second aspect de l’invention concerne l’utilisation de la souche isolée de Trichoderma atroviride de l’invention, en particulier dans le domaine de la malterie.

Plus particulièrement, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride dans la prévention et/ou le traitement de maladies fongiques du blé et/ou du maïs et/ou de l’orge.

L’invention concerne également l’utilisation de ladite souche isolée de Trichoderma atroviride pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de ladite souche isolée de Trichoderma atroviride pour favoriser la germination d’une semence de blé et/ou de maïs et/ou d’orge. Concernant cet aspect particulier, il convient de noter que l’aide à la germination permet avantageusement et en même temps la prévention et/ou le traitement de maladies fongiques au moment du semis. Le développement d’une maladie après le semis est ainsi évité et le rendement est optimisé via l’aspect biostimulant de la souche de l’invention. Avantageusement, cet aspect permet également d’éviter un ralentissement important du développement de la culture si quelques temps après le semis une période de sécheresse se présente (ce qui peut arriver au printemps) et donc d’éviter des pertes de rendements à la récolte.

Un troisième aspect de l’invention concerne une composition phytosanitaire comprenant : la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif ; ou

les métabolites émis lors de la production la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif ; ou

la souche isolée de Trichoderma atroviride de l’invention et ses métabolites émis lors de sa production en tant que principe actif ; ou

la souche isolée de Trichoderma atroviride de l’invention en association avec au moins un autre agent de lutte biologique (BCA) en tant que principe actif ; ou la souche isolée de Trichoderma atroviride de l’invention et ses métabolites émis lors de la production de la souche en association avec au moins un autre agent de lutte biologique en tant que principe actif.

Par « métabolites émis lors de la production de la souche » ou « ses métabolites émis lors de sa production », on entend toute molécule produite par la souche de l’invention au cours de son développement. Par exemple et de manière non limitative, de tels métabolites peuvent être des enzymes produites par le champignon telles que des protéases, des chitinases et la bêta- 1,3-glucanase.

Par « agent de lutte biologique », on entend un microorganisme pouvant interférer avec la croissance et/ou la survie des agents pathogènes permettant ainsi de les contrôler. La souche de l’invention TAL-17 (déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333) en est un exemple, mais au sens de l’invention il s’agit ici de combiner la souche de l’invention à au moins un autre agent de lutte biologique, lequel est différent de la souche de l’invention. Par « au moins un autre agent de lutte biologique », on entend que la composition phytosanitaire de l’invention peut contenir 2 agents de lutte biologique (celui de l’invention et un autre), tout comme elle peut en contenir 3, 4 ou 5 (celui de l’invention et 2, 3 ou 4 autres).

Plus particulièrement, un des objets de l’invention concerne la composition phytosanitaire précédemment décrite, ladite composition phytosanitaire se présentant à la base (à l’achat) sous la forme d’une composition solide ou liquide concentrée. Une telle composition solide ou liquide concentrée peut être, par exemple, obtenue grâce à une formulation particulière des spores de la souche isolée de Trichoderma atroviride de l’invention produites par fermentation en milieu solide ou liquide, lesdites spores pouvant être sous forme purifiée ou dans la matrice de production, ladite matrice de production étant solide ou liquide.

Par « composition [...] concentrée », on entend une composition dans laquelle la concentration du principe actif (i.e. la souche de l’invention, laquelle peut être sous forme de spores) est supérieure à une quantité efficace de 10 7 spores/g soit 10 7 UFC/g. Aussi, un aspect particulier de l’invention concerne la composition phytosanitaire comprenant la souche isolée de Trichoderma atroviride de l’invention en tant que principe actif, ladite composition phytosanitaire se présentant sous la forme d’une composition solide ou liquide concentrée dans laquelle la concentration du principe actif est supérieure à une quantité efficace de 10 7 spores/g.

Par « supérieure à une quantité efficace de 10 7 spores/g », on entend également supérieure à une quantité efficace de 10 8 spores/g, supérieure à une quantité efficace 10 9 spores/g, supérieure à une quantité efficace 10 10 spores/g, supérieure à une quantité efficace 10 11 spores/g ou supérieure à une quantité efficace 10 12 spores/g.

L’utilisateur de la susdite composition doit alors incorporer ou mettre en suspension celle-ci dans un milieu solide ( e.g . terreau, etc.) ou aqueux (e.g. eau) pour obtenir une composition diluée comprenant une quantité efficace de 10 4 à 10 12 spores/g de la souche Trichoderma atroviride de l’invention, laquelle peut être sous forme de spores. La composition solide ou liquide diluée obtenue peut alors être épandue sur les plantes dont la prévention et/ou le traitement d’une maladie fongique de plante est souhaité.

Au sens de l’Invention, l’épandage de la susdite composition comprend notamment les techniques d’épandage classiques connues de l’Homme du métier, lesquelles servent à répandre sur une zone à traiter des matières solide (e.g. boues d’épuration, fumier, etc.) ou liquide (e.g. pesticides, etc.) présentant un intérêt agronomique.

Plus particulièrement, un des objets de l’invention concerne la composition phytosanitaire précédemment décrite, comprenant une quantité efficace de 10 4 à 10 12 spores/g, plus particulièrement de 10 7 à 10 9 spores/g,

ladite composition phytosanitaire étant éventuellement obtenue après une étape de préparation (e.g. dilution par mise en suspension ou mélange) la rendant prête à l’épandage.

Par « quantité efficace de spores/g », on entend le nombre de spores capables de former une colonie sur milieu de culture (UFC= unité formant colonie) par g (gramme) de produit.

De plus, l’expression « de 10 4 à 10 12 spores/g » peut également signifier de 10 4 à 10 5 spores/g, de 10 4 à 10 6 spores/g, de 10 4 à 10 7 spores/g, de 10 4 à 10 8 spores/g, de 10 4 à 10 9 spores/g, de 10 4 à 10 10 spores/g, de 10 4 à 10 11 spores/g, de 10 5 à 10 6 spores/g, de 10 5 à 10 7 spores/g, de 10 5 à 10 8 spores/g, de 10 5 à 10 9 spores/g, de 10 5 à 10 10 spores/g, de 10 5 à 10 11 spores/g, de 10 5 à 10 12 spores/g, de 10 6 à 10 7 spores/g, de 10 6 à 10 8 spores/g, de 10 6 à 10 9 spores/g, de 10 6 à 10 10 spores/g, de 10 6 à 10 11 spores/g, de 10 6 à 10 12 spores/g, de 10 7 à 10 8 spores/g, de 10 7 à 10 9 spores/g, de 10 7 à 10 10 spores/g, de 10 7 à 10 11 spores/g, de 10 7 à 10 12 spores/g, de 10 8 à 10 9 spores/g, de 10 8 à 10 10 spores/g, de 10 8 à 10 11 spores/g, de 10 8 à 10 12 spores/g, de 10 9 à 10 10 spores/g, de 10 9 à 10 11 spores/g, de 10 9 à 10 12 spores/g, de 10 10 à 10 11 spores/g, de 10 10 à 10 12 spores/g ou de 10 11 à 10 12 spores/g.

Au sens de l’invention, celle-ci concerne également une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention et éventuellement au moins un agent de fixation, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée. L’invention concerne donc aussi bien une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée ; qu’une composition phytosanitaire d’enrobage comprenant la souche isolée de Trichoderma atroviride de l’invention et au moins un agent de fixation, ladite composition phytosanitaire d’enrobage permettant de produire une semence enrobée.

Un des objets de l’invention concerne par conséquent une semence enrobée comprenant une graine de végétal, ladite graine de végétal étant enrobée par ladite composition phytosanitaire d’enrobage et ledit végétal appartenant notamment à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. Par « semence enrobée », on entend une graine sélectionnée pour être semée, ladite graine ayant subi un traitement particulier lequel a permis son enrobage dans une composition phytosanitaire d’enrobage. De manière avantageuse, l’invention concerne la semence enrobée telle que décrit ci-dessus, ledit végétal étant du blé et/ou du maïs et/ou de l’orge. De manière avantageuse, l’invention concerne également la semence enrobée telle que décrit ci-dessus, ladite semence enrobée comprenant une quantité efficace de 10 5 à 10 8 (ou de 10 6 à 10 7 ) spores/semence enrobée, préférentiellement 10 6 (ou 10 7 ) spores/semence enrobée.

Un quatrième aspect de l’invention concerne, l’utilisation de la composition de l’invention. Plus particulièrement, l’invention concerne l’utilisation de la composition de l’invention dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de la composition de l’invention dans la prévention et/ou le traitement de maladies fongiques du blé et/ou du maïs et/ou de l’orge. L’invention concerne également l’utilisation de la composition de l’invention pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne l’utilisation de la composition de l’invention pour favoriser la germination d’une semence de blé et/ou de maïs et/ou d’orge.

De façon très particulière, un des objets de l’invention concerne l’utilisation de la souche isolée de Trichoderma atroviride de l’invention ou de la composition phytosanitaire décrite ci-dessus dans la prévention et/ou le traitement de maladies fongiques de végétaux, notamment de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge ; et/ou

pour favoriser la germination d’une semence de végétaux appartenant à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge.

Un cinquième aspect de l’invention concerne un procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition de l’invention sur au moins une partie dudit végétal ou du sol à proximité dudit végétal.

Plus particulièrement, l’invention concerne ledit procédé de l’invention, où ladite partie dudit végétal est une feuille, un fruit, une graine.

De façon très particulière, un des objets de l’invention concerne un procédé de protection et/ou de traitement d‘un végétal contre une maladie provoquée par un champignon pathogène pour végétaux comprenant l’application de la composition de l’invention sur au moins une partie dudit végétal ou du sol à proximité dudit végétal,

en particulier ladite partie dudit végétal est une feuille, un fruit, une graine, et

en particulier ledit végétal appartient à la famille des Poaceae , notamment le blé et/ou le maïs et/ou l’orge.

Toujours selon ce cinquième aspect, l’invention concerne le procédé ci-dessus décrit, dans lequel ladite composition est épandue

à raison de 10 à 500 L/ha, en particulier de 50 à 250 L/ha, notamment pour la pulvérisation aérienne ; ou à raison d’une quantité efficace de 10 10 à 10 14 spores/ha, en particulier de 10 10 à 10 12 spores/ha, notamment pour les épandages aériens de type pulvérisation foliaire.

L’expression « de 10 à 500 L/ha (litre/hectare) » signifie également de 10 à 400 L/ha, de 10 à 300 L/ha, de 10 à 200 L/ha, de 10 à 100 L/ha, de 100 à 500 L/ha, de 200 à 500 L/ha, de 300 à 500 L/ha, de 400 à 500 L/ha, de 50 à 500 L/ha, de 50 à 250 L/ha ou de 250 à 500 L/ha. L’expression « de 10 10 à 10 14 spores/ha » signifie également de 10 10 à 10 11 spores/ha, de 10 10 à 10 13 spores/ha, de 10 11 à 10 12 spores/ha, de 10 11 à 10 13 spores/ha, de 10 11 à 10 14 spores/ha, de 10 12 à 10 13 spores/ha, de 10 12 à 10 14 spores/ha ou de 10 13 à 10 14 spores/ha.

L’invention concerne plus particulièrement le procédé ci-dessus décrit, dans lequel ledit végétal appartient à la famille des Poaceae , en particulier le blé et/ou le maïs et/ou l’orge. De manière avantageuse, l’invention concerne le procédé ci-dessus décrit, dans lequel ledit végétal est le blé et/ou le maïs et/ou l’orge.

L’invention concerne préférentiellement le procédé ci-dessus décrit, dans lequel ledit champignon pathogène est Septoria tritici ou Gibberella zeae (= Fusarium graminearum) ou Puccinia recondita ou Puccinia striiformis.

Par « Septoria tritici », on entend l’agent pathogène de la septoriose.

Par « Gibberella zeae (= F. graminearum ) », on entend l’agent pathogène de la fusariose.

Par « Puccinia recondita », on entend l’agent pathogène de la rouille brune du blé.

Par « Puccinia striiformis », on entend l’agent pathogène de la rouille jaune du blé.

L’invention concerne plus particulièrement le procédé ci-dessus décrit, dans lequel

la protection dudit végétal comprend une étape d’enrobage de la semence avec ladite composition phytosanitaire ; et/ou

la protection dudit végétal comprend la pulvérisation de ladite composition au moment du semis ou à la germination dudit végétal ; et/ou

la protection dudit végétal comprend soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire avec l’apport d’amendement organique, soit une application préventive au niveau du sol avant le semis de ladite composition phytosanitaire sur la culture précédente ; et/ou

le traitement dudit végétal comprend la pulvérisation de ladite composition aux cours de différents stades phénologiques de la plante en prévention d’un risque d’infection dudit champignon pathogène de l’ensemble ou une partie de la plante. Par « différents stades phénologiques », on entend de la graine jusqu’à la floraison (BBCH000 à BBCH619 selon l’échelle BBCH des stades phénologiques des légumes dans la famille des Solanacées (Feller et al., 1995 - Phànologische entwicklungsstadien von gemüsepflanzen: II. Fruchtgemüse und hülsenfrüchte ; Nachrichtenbl. Deut. Pflanzenschutzd)).

S’agissant du procédé ci-dessus, il convient de noter que sa mise en œuvre pour le traitement de la fusariose au stade floraison de la plante implique préférentiellement que la souche de l’invention soit active rapidement et en ce sens, que ladite composition soit plutôt sous forme liquide et ne contient pas de « formulants » non compatibles avec la souche qui pourraient gêner le développement et le mode d’action de ladite souche de l’invention. Par « formulants », on entend des adjuvants mouillants ou agents protecteur de conservation.

A tout égard, il convient de noter que les différents aspects de l’invention, tout comme les différents modes de réalisation de celle-ci sont interdépendants. Ces derniers peuvent donc être combinés entre eux à foison pour obtenir des aspects et/ou des modes de réalisation préférés de l’invention non explicitement décrits. Ceci est également valable pour l’ensemble des définitions fourni dans la présente description, lequel s’applique à tous les aspects de l’invention et ses modes de réalisation.

La présente invention est par ailleurs illustrée, sans toutefois s'y limiter, par les figures et exemples suivants.

LISTE DES FIGURES

La figure 1 représente les observations visuelles du test Dual culture contre Fusarium graminearum , à gauche des boîtes de Pétri, à 6 (A et B) et 10 (C et D) jours de cultures pour la souche TAL-17 (A et C) et la souche BCA C (B et D), à droite des boîtes de Pétri.

La figure 2 représente l’observation microscopique (grossissement xlOO) avec un microscope inversé des mycéliums de F. graminearum (flèche noire) et de la souche TAL-17 (flèche blanche) sur boite de Pétri contenant du milieu PDA (pomme de terre, dextrose, agar), après 8 jours de croissance.

La figure 3 représente la surface occupée (en %) et les photographies associées de la face avant d’une boite de Pétri inoculée au râteau avec trois souches de microorganismes (F. graminearum , TAL-17 et BCA C seuls ou en mélanges après 7 jours de croissance. Moyenne ± s.d. Des lettres différentes indiquent une différence significative entre les modalités (ANOVA 1 facteur, p<0,05).

La figure 4 représente l’évolution de la surface occupée par les microorganismes BCA TAL- 17 et Fusarium graminearum seuls ou en mélange après dépôt de 30 pL au centre d’une boîte de culture avec milieu PDA au bout de 72 h (A) et au bout de 96 h (B) de culture à 25°C sous hotte lumineuse.

La figure 5 représente l’évolution du pourcentage d’inhibition de Fusarium graminearum sur boîte en fonction de la formulation utilisée.

La figure 6 représente le pourcentage de tubes CIV présentant des tâches de septoriose en fonction du traitement après 18 jours et 26 jours d’inoculation de la maladie.

La figure 7 représente le pourcentage de grains sains observés à la récolte au cours des essais en salle phytotronique.

La figure 8 représente la masse de grains par épis à la récolte au cours des essais en salle phytotronique.

La figure 9 représente le pourcentage de symptômes visuels de contamination sur épis par la fusariose au cours des essais en salle phytotronique.

La figure 10 représente la masse de grains par épis à la récolte au cours des essais en salle phytotronique.

La figure 11 représente le pourcentage de grains fusariés à la récolte au cours des essais en salle phytotronique réalisés.

La figure 12 représente la germination de plants de maïs après 6 jours de croissance avec un traitement au semis d’une suspension de spores de TAL-17 à 1.10 5 spores UFC/graine ou 1.10 8 spores UFC/graine. Un traitement aérien est réalisé plus tard lors du stade 5 feuilles et ne rentre pas en compte au moment de la mesure de la germination. Moyenne ± s.d. Des lettres différentes indiquent une différence significative entre les différentes modalités (ANOVA 1 facteur, p<0,05).

La figure 13 représente la mesure de la taille en hauteur de plants de maïs après 25 jours de croissance avec un traitement au semis d’une suspension de spores de TAL-17 à 1.10 5 spores UFC/graine ou 1.10 8 spores UFC/graine. Un traitement aérien est réalisé plus tard lors du stade 5 feuilles et ne rentre pas en compte au moment de la mesure de la germination. Moyenne ± s.d. Des lettres différentes indiquent une différence significative entre les différentes modalités (ANOVA 1 facteur, p<0,05).

La figure 14 représente le pourcentage de germination de graines de blé de printemps (Calixo) en présence ou non de spores en suspension de Trichoderma atroviride TAL-17 au semis. Culture en chambre phytotronique avec photopériode. Moyenne ± s.d. Différence significative entre la modalité eau et la modalité TAL-17 (ANOVA 1 facteur, p<0,05).

La figure 15 comprend des photographies (A) et un graphique (B).

(A) Observations visuelles du test Dual culture contre Fusarium graminearum , à droite des boîtes de Pétri, à 6 et 10 jours de co-cultures avec la souche TAL-17 (panel du haut) ou la souche BCA D (panel du centre), à gauche des boîtes de Pétri. Le panel du bas correspond à la culture de Fusarium graminearum seule. Les flèches blanches indiquent la zone de recouvrement de la souche TAL-17 sur Fusarium graminearum.

(B) Représentation graphique de la longueur du recouvrement du pathogène F. graminearum (F. gram) par le BCA en Dual culture sur gélose PDA (25°C sans photopériode).

La figure 16 comprend des photographies (A) et un graphique (B).

(A) Observations visuelles du test Dual culture contre Fusarium graminearum à 6 jours de co-cultures avec la souche TAL-17 (panel de gauche) ou la souche SCI (panel de droite). La ligne 1 (celle du haut) correspond au BCA seul à la dose de 1.10 4 UFC/mL, la ligne 2 correspond au mélange BCA/Fusa ratio 2/1 (BCA à 1.10 4 UFC/mL et Fusa à 5.10 3 UFC/mL), la ligne 3 correspondant au mélange BCA/Fusa ratio 1/1 (BCA à 1.10 4 UFC/mL et Fusa à 1.10 4 UFC/mL) et la ligne 4 correspond au mélange BCA/Fusa ratio 1/2 (BCA à 1.10 4 UFC/mL et Fusa à 2.10 4 UFC/mL). Le panel du bas correspond à la culture de Fusarium graminearum seule, de gauche à droite, à la dose de 2.10 4 , 1.10 4 et 5.10 3 UFC/mL.

(B) Représentation graphique du pourcentage d’occupation du BCA (TAL-17 ou SCI) et du pathogène F. graminearum (F. gram) à l’issue du test en Dual culture sur gélose PDA (25°C sans photopériode).

La figure 17 comprend des photographies (A) et un graphique (B).

(A) Observations visuelles du test Dual culture contre Fusarium graminearum à 10 jours de co-cultures avec la souche TAL-17 (panel de gauche) ou la souche SCI (panel de droite). La ligne 1 (celle du haut) correspond au BCA seul à la dose de 1.10 4 UFC/mL, la ligne 2 correspond au mélange BCA/Fusa ratio 2/1 (BCA à 1.10 4 UFC/mL et Fusa à 5.10 3 UFC/mL), la ligne 3 correspondant au mélange BCA/Fusa ratio 1/1 (BCA à 1.10 4 UFC/mL et Fusa à 1.10 4 UFC/mL) et la ligne 4 correspond au mélange BCA/Fusa ratio 1/2 (BCA à 1.10 4 UFC/mL et Fusa à 2.10 4 UFC/mL). Le panel du bas correspond à la culture de Fusarium graminearum seule, de gauche à droite, à la dose de 2.10 4 , 1.10 4 et 5.10 3 UFC/mL.

(B) Représentation graphique du pourcentage d’occupation du BCA (TAL-17 ou SCI) et du pathogène F. graminearum (F. gram) à l’issue du test en Dual culture sur gélose PDA (25°C sans photopériode).

EXEMPLES

(I) Isolement de la souche de Trichoderma atroviride TAL-17

Souche isolée d’une feuille de blé cultivé en champs.

Le prélèvement de feuille de la culture du blé a été broyé puis mis au contact en infiniment mélangé d’une gélose de PDA ( Potato Dextrose Agar ) à 50°C qui contient des spores de Fusarium graminearum. La boîte a été mise en culture à 25°C sous hotte lumineuse. Ainsi seules les souches étant capables de se reproduire en présence de Fusarium graminearum se sont développées sur la boîte. Parmi ces souches TAL-17 était présente. Un prélèvement spécifique d’une zone présentant un intérêt dans la boîte et plusieurs repiquages successifs ont permis d’isoler la souche TAL-17, laquelle a ensuite été déposée le 03 juillet 2018 à la CNCM sous le numéro CNCM 1-5333.

(II) Etude in vitro de l’efficacité et du mode d’action du TAL-17 contre F. sraminearum

Compétitivité, mycoparasitisme et antibiose 1/ Tests Dual-culture côte à côte sur boîte de Pétri

Plusieurs tests de Dual-culture avec les BCA vs F. graminearum ont été réalisés en proximité sur milieu PDA ( Potato Dextrose Agar). On inocule 30 pL contenant 1.10 4 spores/mL (sp/mL) de F. graminearum , à 2 cm de l’extrémité d’une boîte de Pétri de 8,5 cm de diamètre contenant du milieu PDA, et 30 pL contenant 1.10 6 spores/mL d’un autre microorganisme (TAL-17 ou un autre Trichoderma BCA C) à l’autre extrémité de la boîte de Pétri. Les boîtes de Pétri ont été incubées à 23-27°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 BriteGro ® ). Des observations macroscopiques ont été réalisées à 6 jours et 10 jours après l’inoculation (Figure 1). Des témoins de F. graminearum seuls et des BCA seuls ont été réalisés. Les souches testées ont été la souche TAL-17 et une autre souche de référence également référencée comme un Trichoderma atroviride utilisé dans le Biocontrôle (= BCA C > Référence : ATCC ® 20476).

Les souches TAL-17 et BCA C ont toutes 2 présenté une capacité à occuper l’espace, par contre la souche TAL-17 contrairement à la souche BCA C est capable de se développer sur le mycélium de Fusarium graminearum (Figure 1). La souche TAL-17 présente donc un potentiel mycoparasitisme beaucoup plus important que l’autre souche de référence BCA C. Des observations au microscope du mycélium de la souche TAL-17 en présence de mycélium de Fusarium graminearum ont révélé par ailleurs un enroulement du mycélium de la souche TAL-17 autour de Fusarium graminearum (Figure 2), lequel phénomène n’a pas été observé avec l’autre souche de Trichoderma atroviride (= BCA C) testée.

Par rapport à la bibliographie existante sur le sujet, le mycoparasitisme du genre Trichoderma , lequel correspond au genre de la souche TAL-17, a été étudié à de nombreuses reprises et sur de nombreuses cibles. Hibar et al. (Hibar, K., Daami-Remadi, M., Khiareddine, H., & Mahjoub, M. El. (2005). Effet inhibiteur in vitro et in vivo du Trichoderma harzianum sur Fusarium oxysporum f. sp. Radicis-lycopersici .) ont présenté un effet inhibiteur in vivo et vitro de Trichoderma harzianum sur Fusarium oxysporum , notamment par des observations microscopiques de la zone de contact entre les deux souches qui met en évidence une lyse importante, accompagnée d’un enroulement de la souche de T harzianum sur F. oxysporum. Steyaert et al. (Steyaert J., Ridgway H., Elad Y., Stewart A. (2003). Genetic basis of mycoparasitism: A mechanism of biological control by species of Trichoderma. New Zealand Journal of Crop and Horticultural Science ; 31(4), 281-291) ont mis en évidence le mycoparasitisme d’une souche de Trichoderma atroviride autour d’un hyphe d’une souche de Botrytis cinerea. Les résultats microscopiques précédemment décrits confirment de ce fait le potentiel mycoparasitisme accru de la souche TAL-17, notamment par rapport à la souche BCA C.

De plus ces essais sur boîtes ont montré une zone d’inhibition créée par la souche TAL-17 signe d’un potentiel effet d’antibiose et un autre test utilisant du filtrat de culture de la souche TAL-17 a montré quant à lui un effet inhibiteur sur la croissance du pathogène Fusarium graminearum (données non montrées).

2/ Essais en mélange dépôt sur l’ensemble de la surface

Un autre test de Dual-culture avec les BCA us F. graminearum a été réalisé sur milieu PDA, mais cette fois-ci en mélange, avec étalement de 100 mΐ sur l’ensemble de la boîte de Pétri (diamètre 8,5 cm). Au centre d’une boîte de Pétri de 8,5 cm contenant du milieu PDA, sont étalés en surface 100 pL d’un mélange contenant 1.10 4 spores/mL de A. graminearum et 1.10 4 spores/mL du BCA (ou 0,5.10 4 spores/mL de chaque BCA pour la modalité mélange BCA), de plus pour certaines modalités ce mélange contient également 0,5% de la formulation Appyphyt, laquelle est une émulsion d’esters d’huile végétale (Esters d’huile végétale : 60- 80% ; Emulsionnant biosourcé ; 1-5% ; Qsp Eau). Le mélange a été inoculé après 2 h de contact. Les boîtes de Pétri ont été incubées à 25°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 Britegro). Des mesures de la croissance de F. graminearum (en cm) ont été prises après 48, 72, 96 et 168 h ( i.e . de 2 à 7 jours) de culture après l’inoculation. Des témoins de F. graminearum seul et des BCA seuls ont été réalisés. Les souches testées ont été TAL-17 et BCA C.

Lors de ce test le TAL-17 a été le plus performant, son mycoparasitisme permettant de recouvrir 100% de la boîte face avant à 7 jours (Figure 3).

(III) Essais sur plante afin d’observer si le mode d’action du TAL-17 a un caractère endophyte

Le terme endophyte provient de deux mots grecs « endon » et « phuton » qui signifie respectivement « à l’intérieur » et « végétal ». La définition d’endophyte a très souvent changé au cours du temps. Tout d’abord, la définition concernait tout organisme pouvant vivre à l’intérieur d’une plante. Aujourd’hui, les organismes endophytes sont des organismes ayant un mode de vie avec la plante dit « endophisme ». C’est-à-dire que les espèces endophytes sont capables de coloniser les structures internes des végétaux de façon asymptomatique (Hardoim, P. R., van Overbeek, L. S., Berg, G., Pirttilà, A. M., Compant, S., Campisano, A., ... Sessitsch, A. (2015). The Hidden World within Plants: Ecological and Evolutionary Considérations for Defining Functioning of Microbial Endophytes. Microbiology and Molecular Biology Review s, 79(3), 293-320.). Les endophytes peuvent être des microorganismes comme les champignons. Ils peuvent coloniser la plante à différents niveaux selon le micro-organisme. Les organes concernés peuvent être suivant les cas : la tige, les racines, les segments de feuilles, les fruits, les bourgeons, les graines mais aussi dans les cellules hyalines mortes et creuses des plantes (Stçpniewska, Z., & Kuzniar, A. (2013). Endophytic microorganisms— promising applications in bioremediation of greenhouse gases. Applied Microbiology and Biotechnology, 97(22), 9589-96.).

Méthode préparation des échantillons pour observation

Le bleu de coton (LACP-00D-100 Labkem ® ) au lactophénol a été utilisé dans cette étude comme colorant pour la mise en évidence des champignons. Des échantillons de feuille de blé de 1 x 0,5 cm et de maïs de 2,5 x 1,5 cm ont été prélevés pour chaque modalité étudiée. La démarche est la suivante pour le traitement des coupes :

1. Mordançage à l’eau de javel (3 min)

2. Lavage dans l’eau ultra pure

3. Coloration dans le bleu coton lactophénol (3 min)

4. Rinçage dans le lactoglycérol

5. Les échantillons sont ensuite placés sous lame et lamelle pour une observation microscopique (x 400).

1/ Essais sur le blé

6 graines de blé ont été semées par pot de 0,5 L et percé au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les graines ont été humidifiées la veille du semis pendant 24 h à 4°C. Une fois le semis réalisé, les pots ont été placés sous hotte lumineuse à 25°C (photopériode 16/8 heures) et ont été arrosés trois fois par semaine.

Différentes traitements ont été réalisés. Pour le traitement au semis, 1 mL de la solution de TAL-17 à la concentration souhaitée a été ajouté sur la graine semée (500 pL avant le dépôt de la graine et 500 pL après). Pour le témoin et les autres conditions testées, les graines n’ont pas reçu de traitement de BCA mais 1 mL d’eau de forage stérile. Le traitement en pulvérisation a été effectué lors du stade 2 feuilles ou lors du stade floraison. Les pots ne recevant pas de traitements au BCA ont été traités avec de l’eau de forage par le même dispositif. Les premières feuilles situées au plus bas de la plante ont été utilisées pour cet essai.

Du mycélium de champignon a été observé dans les feuilles et racines de la plante traitée au semis contrairement à la plante témoin non traité au semis.

2/ Essais sur le maïs

3 graines sont semées par pot de 5 L percés au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les pots ont été arrosés trois fois par semaine avec un volume d’eau osmosée croissant en fonction du développement de la plante.

Pour le traitement au semis, 1 mL de la solution de TAL-17 à la concentration souhaitée (10 5 ou 10 8 /mL) a été ajouté sur la graine semée (500 pL avant le dépôt de la graine et 500 pL après). Pour le témoin et les autres conditions testées, les graines n’ont pas reçu de traitement de BCA mais 1 mL d’eau de forage stérile. Le traitement en pulvérisation a été effectué lors du stade 5 feuilles.

Du mycélium de champignon a été observé dans les feuilles et racines de la plante traitée au semis contrairement à la plante témoin non traité au semis.

Finalement, ces tests ( cf exemples II et III) ont montré que la souche TAL-17 est capable d’agir contre Fusarium graminearum de différentes façons. Elle cumule compétition, antibiose, my coparasitisme et est capable de pénétrer dans la plante. (IV) Stratégie d’inoculation du BCA

Développement de formulations 1/ Essais en mélange avec dépôt au centre

Un autre test de Dual-culture avec les BCA us F. graminearum a été réalisé sur milieu PDA, mais cette fois-ci en mélange, avec dépôt d’une goutte au centre de la boîte (30 mΐ). Dans ce test seule TAL-17 a été testée. Des mesures de la croissance de F. graminearum (en cm) ont été prises après 48, 72 et 96 h de culture (Figure 4).

Au centre d’une boîte de Pétri de 8,5 cm contenant du milieu PDA, ont été inoculés 30 pL d’un mélange contenant 1.10 4 spores/mL de F. graminearum et 1.10 4 spores du BCA, de plus pour certaines modalités ce mélange contient également 0,5% de la formulation Appyphyt, laquelle est une émulsion d’esters d’huile végétale (Esters d’huile végétale : 60-80% ; Emulsionnant biosourcé ; 1-5% ; Qsp Eau). Le mélange a été inoculé après 2 h de contact. Les boîtes de Pétri ont été incubées à 23-27°C sous lumière artificielle (24h/24) (tube fluorescent F36WT8/2084 BriteGro ® ). Des mesures de la croissance de F. graminearum ont été réalisées de 2 à 7 jours après l’inoculation. Des témoins de F. graminearum seul et du BCA seul ont été réalisés.

La souche TAL-17 a permis une réduction de l’ordre de 63% du développement de Fusarium graminearum sur boîte de Pétri à 72 h et 78% à 96 h. Cette réduction est montée à 77% à 72 h et à 85% à 96 h lorsqu’elle est couplée à la formulation Appyphyt (Figure 5). Il convient de noter qu’à 96 h la formule Appyphyt seule n’a pas montré d’inhibition sur la croissance de Fusarium graminearum.

2/ Enrobage de graines

Les résultats précédents, lesquels ont démontré l’aspect endophyte, indiquent un intérêt potentiel à enrober les graines des cultures visés avec la souche TAL-17. Cet intérêt a été confirmé par les essais de bio stimulation sur la germination (voir ci-après). (V) Effet des BCA sur la protection des plantes

Etude en salle phytotronique 1/ Septoriose

La culture in vitro a été développée pour réaliser un screening des potentiels BCAs sélectionnés contre la septoriose du blé Septoria tritici. Le milieu de culture in vitro standard a été modifié en enlevant le saccharose afin d’éviter d’éventuelles contaminations.

Deux tests ont été réalisés.

La maladie et le BCA ont été appliqués simultanément par pulvérisation dans des conditions se rapprochant le plus possible du champ.

Les pourcentages de plants présentant des tâches de septoriose suivant les modalités sont présentés Figure 6. Deux Trichoderma atroviride ont été testés dont TAL-17. Cette dernière s’est révélée être la plus intéressante contre cette maladie. A noter la quantité de BCA est en nombre de spores viables (équivalent 5.10 11 spores viables/hectare).

2/ Fusariose

La salle phytotronique a la possibilité de monter à 90% d’humidité HR pendant l’infection au moment de la floraison des épis. Le plateau permet de tester 30 jardinières de 15 plants. Les tests ont été réalisés avec le blé de printemps « Calixo ».

Les traitements avec BCA ont été pour ces tests exclusivement réalisés au moment de la floraison et les BCA utilisés sont :

TAL-17 (cf. Exemple I) ;

BCA A > Trichoderma asperellum (Réf : ATCC ® 52438) et

BCA B > Trichoderma atroviride (Réf. Interne : BCA B- 15).

Un premier test a montré un intérêt pour la souche TAL-17 (Figures 7 et 8). Cet intérêt a été confirmé grâce à un nouveau test (Figures 9, 10 et 11). Ce dernier a mis en évidence un intérêt à l’utilisation du TAL-17 (équivalent 10 11 spores UFC/ha) avec la formulation Appyphyt (équivalent lL/ha) sur le blé pour les symptômes visuels de la maladie et sur la masse de grains par épis qui sont alors tous deux statistiquement différents de la modalité contaminée au Fusarium graminearum seul. Cependant la masse de grains par épis quand le blé a été traité avec le TAL-17 et la formule Appyphyt n’atteint pas la masse du blé témoin non contaminé (i.e. 0,831 g/épis pour la figure 8 et 0,77 g/épis pour la figure 10).

En conclusion la souche TAL-17 a montré un intérêt pour une application au stade floraison du blé mais au vu de son caractère endophyte, une application beaucoup plus précoce présente un intérêt dans la lutte contre la fusariose de l’épi.

De plus une stratégie de traitement avec demi-dose de fongicide est possible.

Etude en salle phytotronique / serre / biostimulation 1/ Essais en serre sur maïs

Trois graines ont été semées par pot de 5 L percés au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée. Les pots ont été arrosés trois fois par semaine avec un volume d’eau osmosée croissant en fonction du développement de la plante.

Les traitements réalisés ont été identiques à ceux de l’Exemple (III), 1/.

Pour rappel, le témoin (A) n’a pas reçu de traitement ; le traitement au semis (B et C) a été réalisé avec une solution de TAL-17 de 1.10 5 ou 1.10 8 spores/graine (sp/graine) ; le traitement en pulvérisation au stade 5 feuilles (D et E), soit 21 jours de croissance, a été réalisé avec une solution de TAL-17 de 1.10 11 ou 5.10 11 spores/ha.

Les résultats obtenus pour le pourcentage de germination sur des plants âgés de 6 jours sont représentés sur la figure 12. Les valeurs pour les plants de maïs n’ayant pas (témoin) ou pas encore (pulvérisation aérienne) reçus de traitements au TAL-17 sont statistiquement identiques et de l’ordre de 80%. De même avec le traitement au BCA au semis à 1.10 5 spores/graine, aucune différence significative n’est visible par rapport au témoin non traité. Par contre, avec le traitement au semis de 1.10 8 spores/graine, soit une concentration lOOOx supérieures à la précédente, le pourcentage de germination atteint les 100% dès 6 jours après le semis. Après 9 jours de croissance (données non présentées), le taux de germination tend vers 97% pour les modalités ayant reçu le traitement au semis à 1.10 5 spores/graine et pour celles n’ayant pas encore reçu le traitement aérien. La modalité témoin, sans traitement, augmente jusqu’à un pourcentage de germination de 93%.

Les résultats des mesures de la taille en hauteur des plants âgés de 25 jours représentés sont présentés en figure 13, et ont mis en évidence une différence statistique du traitement au semis du TAL-17 face au traitement en pulvérisation aérienne et au témoin. Les traitements au semis à 1.10 5 et 1.10 8 spores/graine (spores viables) permettent une croissance des plants de l’ordre de 105 cm, tandis que les traitements aériens, réalisé 4 jours plus tôt et le témoin, ne permettent qu’une croissance allant de 97 cm pour le témoin, à 100,5 cm pour le traitement aérien à 1.10 11 spores/ha et 101 cm pour le traitement à 5.10 11 spores/ha. Ces valeurs sont retrouvées dans un même groupe statistique.

2/ Essais en salle phytotronique sur blé

Culture :

6 graines de blé ont été semées par pot de 0,5 L et percé au fond pour le drainage. Le substrat utilisé est un mélange de terreau universel et de vermiculite expansée (0,5-10 mm) (2: 1 v/v). Le substrat a été humidifié 24 h avant le semis avec de l’eau osmosée.

Pour la disposition des pots dans la salle phytotronique, ils ont été regroupés par groupe de 3 dans une soucoupe de jardinières. 12 « jardinières » ont été ensemencées avec 0,5 mL d’une suspension de spores de TAL-17 à 10 6 spores UFC/graines dans 0,5 mL et 18 jardinières ont été ensemencées avec 0,5 ml d’eau de forage stérile afin de s’affranchir d’un apport d’eau différents suivant les traitements.

Les pots ont été placés dans la salle phytotronique (photopériode 16/8h) et ont été arrosés deux fois par semaine.

Le pourcentage de germination a été observé à 4 et 11 jours suivant les modalités.

Ce pourcentage moyen est calculé par jardinière (soit sur 18 graines) puis l’ensemble des données des jardinières pour chaque modalité a été traité statistiquement par ANOVA (p<0.05). Il en ressort que les modalités inoculées avec la souche TAL-17 ont présenté un taux de germination supérieur à la modalité témoin eau de 5% à 11 jours (Figure 14). Cette différence est significative statistiquement.

(VI) Comparaison de la souche TAL-17 à d’autres BCA

Tests Dual-culture côte à côte sur boîte de Pétri (suite de la partie (II) 1/)

Le protocole expérimental a été le même que celui décrit précédemment. La souche TAL-17 a été comparée à la souche BCA D (= Trichoderma atroviride, Réf. : 1-12137). Le test Dual culture a été réalisé avec 30 mΐ de BCA ou de F. graminearum déposés aux extrémités de la boite de Pétri. Après 6 et 10 jours de culture à 25°C sur PDA sous hotte lumineuse avec photopériode de 16 h, les boîtes ont été observées (Figure 15 A) et la longueur du recouvrement du pathogène par le BCA a été mesuré (Figure 15B).

Dans cet exemple également, la souche TAL-17 a présenté la particularité de se développer sur le mycélium du pathogène au cours du temps, contrairement au BCA D.

(VII) Essai de spécificité de la sonde TaqMan ® GS285741-P1 et du couple de primer associé GS285741-F1 et GS285741-R1 vis-à-vis de la souche de l’Invention (TAL- 17 et/ou un de ses mutants)

Protocole

Afin de tester la spécificité des outils moléculaires (sonde TaqMan ® GS285741-P1 et le couple de primer associé GS285741-F1 et GS285741-R1), il a été mis en œuvre une analyse classique par Polymerase Chain Reaction en temps réel (qPCR) sur 3 souches distinctes, à savoir :

la souche de Trichoderma viride de l’espèce T. asperellum (TV) ;

la souche Trichoderma atroviride TAS ; et

la souche Trichoderma atroviride de l’invention (TAL-17).

Un étalon interne contrôle est également réalisé avec de F ADN génomique extrait de la souche de l’invention, lequel a été dilué en série. L’ensemble des essais de qPCR ont été réalisés en utilisant un thermocycleur CFX 96 touch de Biorad ® . Le programme d’amplification utilisé est celui recommandé par le fournisseur avec une température d’hybridation de 60°C. Pour la méthode TaqMan ® , le mélange réactionnel Luna ® universel Probe qPCR Master Mix (NEB ® ) a été utilisé. Le programme d’amplification est de 95°C 2 min suivi de 40X 95°C 15” et 60°C 30”.

Résultats

Les résultats de cette analyse sont présentés dans le Tableau 3 ci-après.

Cq Mean

Echantillon (nombre de cycle d'amplification nécessaire pour obtenir un signal fluorescent caractéristique) dilution 1 23,66

dilution 2 26,84

Etalon interne

dilution 3 29,99

(5 ng)

(dilution en série dilution 4 33,36

d’ADN génomique dilution 5 37,4

de la souche TAL- dilution 6 38,28

17)

dilution 7 N.D. (pas assez d’ADN)

dilution 8 N.D. (pas assez d’ADN)

puits 1 N.D.

Souche TV

puits 2 N.D.

(5 ng)

puits 3 N.D.

puits 1 N.D.

Souche TAS

puits 2 N.D.

(5 ng)

puits 3 N.D.

puits 1 21,46

Souche TAL-17

puits 2 21,46

(5 ng)

puits 3 21,46

Tableau 3 : Détection spécifique par qPCR de la souche de l’Invention

Conclusion

La sonde TaqMan ® GS285741-P1 et le couple de primer associé GS285741-F1 et GS285741- R1 n’ont permis de détecter que la souche TAL-17. Ces outils permettent donc bien la détection et l’identification dans un échantillon de la présence de la souche de l’Invention TAL-17 et/ou un de ses mutants. (VIII) Comparaison de l’efficacité de la souche TAL-17 versus celle de la souche SCI

Tests Dual-culture en mélange sur boîte de Pétri

L’effet biocontrôle de la souche TAL-17 sur le développement de F graminearum a été comparé à celui de la souche SCI (= Trichoderma atroviride isolée présente dans le produit Vintec ® ). Pour cela, un test Dual culture a été réalisé sur lequel 100 pL d’un mélange F. graminearum/T. atroviride (Fusa/BCA) a été étalé sur milieu PDA en boite de Pétri.

Les mélanges utilisés ont été les suivants :

Mélange BCA/Fusa (ratio 1/2) : BCA à 1.10 4 UFC/mL et Fusa à 2.10 4 UFC/mL (mélange lmL de BCA à 2.10 4 UFC/mL + lmL de fusa à 4.10 4 UFC/mL).

Mélange BCA/Fusa (ratio 1/1) : BCA à 1.10 4 UFC/mL et Fusa à 1.10 4 UFC/mL (mélange lmL de BCA à 2.10 4 UFC/mL + lmL de fusa à 2.10 4 UFC/mL).

Mélange BCA/Fusa (ratio 2/1) : BCA à 1.10 4 UFC/mL et Fusa à 5.10 3 UFC/mL (mélange lmL de BCA à 2.10 4 UFC/mL + lmL de fusa à 1.10 4 UFC/mL).

Après 6 et 10 jours de culture à 25°C sur PDA sous hotte lumineuse avec photopériode de 16 h, les boîtes ont été observées (Figures 16A et 17 A) et une évaluation visuelle du pourcentage d’occupation de l'espace par les différentes souches a été réalisées (Figure 16B et 17B). Ce dernier correspond à l'intensité de sporulation du BCA (TAL-17 ou SCI) sachant que le témoin = 100%. Celui de F graminearum est estimé en soustrayant la surface totale de la boite moins la surface estimée d’occupation en BCA.

In fine , comparé à la souche Trichoderma atroviride SCI, la souche de l’invention TAL-17 à la même dose combat d’avantage Fusarium graminearum. Ceci est d’ailleurs nettement visible pour le ratio 2 UFC de Fusa / 1 UFC de BCA. En effet, dans ces conditions, la souche SCI décroche contrairement à la souche TAL-17.

(IX) Essai en champs et comparaison de l’efficacité de la souche TAL-17 versus celle d’une souche de T. atroviride sur la rouille brune du blé

Protocole

Après le semis de la variété de blé Pakito, la parcelle semée a été divisée en 4 microparcelles de l’ordre de 20 m 2 par modalité ( cfi Tableau 4) et l’essai à proprement parler a pu débuter. Pour cela, deux traitements ont été réalisé au stade‘épis 6 à 8’ (Tl) et‘début floraison’ (T2) avec des traitement conventionnel (Onnel ® , Faxer ® , Librax ® ) en dose usuelle (0,6 L/ha) ou en demi-dose (0,3 L/ha) en combinaison ou non avec un mélange de BCA (souche TAL-17 [BCA 1] ou une autre souche de T. atroviride [BCA 2]) à la dose de 1.10 11 UFC/ha et d’ Appyphyt à la dose de 1 kg/ha ( cf Tableau 4).

Tableau 4. Conditions testées lors de cet essai en champ

Un mois après le dernier traitement, l’évaluation du développement de la rouille brune (i.e. Puccinia recondita ) a été mesuré.

Analyse statistique

L’analyse statistique a été réalisée grâce au logiciel d’analyse et de traitement statistique StatBox ® . Il se couple au logiciel Excel ® et en enrichi les fonctionnalités. Il a permis de réaliser les ANOVA qui seront présentées dans la partie résultats. Les comparaisons de moyennes sont effectuées selon le test de Newman-Keuls au seuil 5%. Des groupes statistiques homogènes sont déterminés, les modalités associées à la même lettre ne sont pas statistiquement différentes.

Résultats

(voir tableau ci-après)

Moyenne générale 97,2 44,33 44,33 6, 18

Ecart-type résiduel 1,69 0,72 0,72 0,87

Coefficient de

variation 1,7 1,6 1,6 14

Tableau 5. Effet des traitements appliqués sur le rendement et l’évolution de la rouille brune

S’agissant de la note évaluant la rouille brune, plus la note est élevée moins il y a de maladie (échelle 1 à 10 : 10 = zéro symptômes de maladie). Les lettres symbolisent les statistiques calculées.

Conclusion

Le BCA 1 ( i.e . souche TAL-17) s’est montré efficace pour lutter contre la rouille brune (i.e. Puccinia recondita ) contrairement à la souche BCA 2 (autre souche de Trichoderma atroviride). Cette différence d'efficacité est statistiquement différente quand on compare la modalité No. 9 à la modalité No. 7 de l’essai et que l’on regarde les notes sur la rouille brune. En effet, pour ces deux modalités le BCA a été appliqué seul au premier traitement et a également été appliqué au second traitement avec une demi-dose fongicide conventionnel Librax ® . Ainsi la souche TAL-17 a montré dans cet essai un intérêt statistique sur les symptômes physique de la rouille brune.

De plus, la souche TAL 17 lorsqu’elle est appliqué ( cf. modalité No. 9), elle a permis d’obtenir une note de rouille brune du même groupe statistique que la meilleure modalité ( cf. modalité No. 4) pour la notation de rouille brune.

Finalement, l’ensemble de ces essais a montré une efficacité statistique contre la rouille brune en microparcelle de la souche de l’invention TAL-17 par rapport à une autre souche de T. atroviride avec un traitement en Tl et un traitement en T2 complété avec une demi-dose de Librax ® . PCT

(original sous forme électronique)

(Cette feuille ne fait pas partie de la demande internationale ni ne compte comme une feuille de celle-ci)

RESERVE A L'OFFICE RECEPTEUR

RÉSERVÉ AU BUREAU INTERNATIONAL




 
Previous Patent: MULTI-PLAYER GAME

Next Patent: A TUFTING MACHINE