FIELD This disclosure relates to method of making and using nucleic acids which can be used to express one or more transgenes. In one embodiment, a recombinase and recombining sites are cloned within a single vector.

BACKGROUND Current methods in transgenic technology provide a means to alter a genome by over- expressing a gene of interest (Stern, Haematologica 84: 64-6,1999), or deleting or modifying the endogenous allele of a gene in a tissue-specific and temporal manner (Aguzzi et al., Brain Patrol.

4: 3-20,1994; Hocker, Ann. NYAcad. Sci. 859: 160-74,1998; Pich, Ann. Med. 30: 390-6,1998).

Several of these approaches utilize technology based upon the cre/LOX system where the P 1 bacteriophage recombinase is used to act on target LOX sites to modify a genetic locus or activate transgene expression in a tissue specific manner (Sternberg, J. Mol. Biol. 150: 467-86, 1981). In this system, two distant LOX sites recombine resulting in the excision and loss of intervening nucleotide sequences.

This technology has been used to conditionally alter genetic loci where the expression of the ere recombinase is under the transcriptional control of a tissue-specific and temporally regulated promoter (for example see Akagi et al., Nuc. Acids Res. 25: 1766-73,1997; Gu et al., Science 265, 103-6,1994; Kuhn et al., Science 269: 1427-9,1995; Lakso et al., Proc. Natl. Acad. Sci. U. S. A 89: 6232-6,1992; Lobe et al., Dev. Biol. 208: 281-92,1999; Mao et al., Proc. Natl. Acad. Sci. U. S. A 96,5037-42,1999; Nagy et aL, Curr. Biol. 8: 661-4,1998; Orban et aL, Proc. Natl. Acad. Sci. U. S. A 89: 6861-5,1992; Rajewsky et aL, J. Clin. Invest. 98: 600-3,1996; Rucker et al., MoL Reprod. Dev.

48: 324-31,1997; Sauer Methods Enzymol. 225: 890-900,1993; Onge et aL, Nuc. Acids Res.

24 : 3875-7, 1996; Tsien etaL, Cell 87: 1317-26,1996; Utomo etal., NatBiotechnoL 17: 1091-6, 1999; and Wagner et al., Nuc. Acids Res. 25: 4323-30,1997). However, a major limitation of this approach is that genetically-engineered constructs used can not contain both the sequences for cre recombinase and the LOX sites in a single vector. Using currently available vector constructs, cre is expressed when present in a plasmid transformed into bacteria. If LOX sites are present in the same plasmid, cre expression results in the recombination of LOX sites and excision of genetic material contained between the LOX sites. For this reason, two separate lines of transgenic animals must be generated and bred together in order to effect cre recombination of genes flanked by LOX sites

(fLOXed genes), and two separate vectors need to be transfected into a cell, such as the cell of a subject, for transgene delivery.

Another major limitation of currently available transgenic technology and gene therapy approaches is that many tissue-specific promoters are transcriptionally weak and lead to relatively low levels of heterologous gene expression. A method to maintain tissue-specificity but amplify levels of transcription of a gene of interest is highly desirable.

SUMMARY Herein disclosed are nucleic acid sequences which can be used to express a transgene ill vitro, ex vivo and/or in vivo. Methods of making and using vectors including these nucleic acid sequences are also disclosed.

Using the vectors available in the prior art for regulating transgene expression using recombinase/recombining site technology, detectable levels of downstream gene expression are observed. To decrease the level of downstream gene expression, novel nucleic acid constructs were designed. The disclosed nucleic acids, such as a nucleic acid in a vector, allow for selective transgene expression. In one example the nucleic acid includes a nucleic acid containing a first transgene located between a first and second nucleic acid comprising a recombining site, thereby flanking the first transgene, wherein a nucleic acid containing a second transgene is out-of-frame to the first transgene. In the absence of recombinase, the first transgene is translated, but no detectable levels of the second transgene are observed. In the presence of recombinase, the first transgene is excised and thus not translated at detectable levels, but the second transgene is expressed at detectable levels.

The selective alteration of a genome using a recombinase to target the rearrangement of a nucleic acid sequence flanked by recombining sequences in the prior art required the use of two separate genetic constructs in trans, one containing the recombinase and the other containing a nucleic acid sequence flanked by recombining sequences. To address these limitations, a nucleic acid molecule including a modified recombinase was developed. The modified recombinase is expressed in a eukaryotic cell, but not in a prokaryotic cell. In one example, the recombinase is a modified cre recombinase. In another example, a vector including both a modified recombinase and recombining sites flanking a transgene are disclosed.

In one example, a recombinase is modified through an in-frame fusion of wild-type and/or mutant ligand binding domains (LBD), such as the LBD of a steroid hormone receptor, for example the androgen receptor (AR). The LBDs of steroid hormone receptors is the portion of the receptor which binds to a ligand and alters the conformation and/or activity of a receptor to transduce signaling into the nucleus which may alter the expression of one or more other genes. The receptor may require the presence of other co-factors or repressors to be functional.

Methods of using the nucleic acids and vectors of the present disclosure for transgene expression are also disclosed. A method for transforming a cell by contacting the cell with any of the

nucleic acids or vectors of the present disclosure, wherein the contact results in transformation of the cell, is disclosed. Also comprehended by the present disclosure is a pharmaceutical composition containing any of the nucleic acids or vectors of the present disclosure and a pharmaceutically acceptable carrier. In addition, a method for preventing or treating a disorder in a subject is disclosed. The methods disclosed can be used to manipulate the genome of any organism, such as a mammal.

BRIEF DESCRIPTION OF THE FIGURES FIG. 1A is a schematic drawing outlining frame-shift nucleic acids where a recombinase is added in trans.

FIGS. 1B-1F are schematic drawings outlining frame-shift nucleic acids where a recombinase is present in cis, either (B) downstream of a 3'portion of the second transgene or (C, D, E, F) upstream of a 5'portion of the second transgene and (E, F) where insulator sequences are present.

FIGS. 2A-2K are schematic drawings outlining modified recombinase nucleic acids.

FIG. 3A is schematic drawing showing a frame-switch method using a cre/LOX induced translational frame shift.

FIG. 3B is schematic drawing showing an EGFP/ß-gal gene-switch under transcriptional control of an SV40 early promoter.

FIG. 3C is a schematic drawing showing frame-shift vectors pCMV-EGFP/ß-gal and pCMVe/ß actin-EGFP/ß-gal which contain a fLOXed EGFP gene upstream of (3-gal with different promoters.

FIG. 3D is a schematic drawing showing a frame-shift vector, pCMV-EGFP/RFP, which contains a fLOXed EGFP gene upstream of RFP.

FIGS. 4A-4E are schematic drawings showing luciferase reporter gene vectors. SV, SV40 early promoter; CMVe-ßAc, CMV enhancer, P-actin promoter.

FIG. 4F is a bar graph comparing luciferase expression between cells transfected with the reporter constructs pPr-luc, pCMV-STOP-luc, or pCMV-STOP-luc with pPr-cre.

FIGS. 5A-E are schematic drawings showing a modification of cre recombinase. (A) pCMV-Cre-del is the backbone of subsequent constructs. (B) pCMV-Cre-K contains a modified 5' UTR and amino acid changes. (C) pCMV-CREM contains a chimeric/ (3-globin intron within a cre coding sequence. (D) pCMV-CREM-L contains a LOX 511 site inserted into a ere coding sequence.

(E) pCMV-RFP/CREM contains a fLOXed RFP within the cre coding sequence.

FIGS. 6A-6C are schematic drawings showing the generation of probasin-driven cre recombinase expression vectors.

FIG. 6D is a bar graph showing enhanced amplification of gene expression in the presence of a second conditional cre vector.

FIG. 6E is a line graph showing a time course of gene amplification using a second conditionally expressed cre recombinase.

FIGS. 7A and 7B are schematic drawings showing the construction of single vectors containing both modified cre recombinase and LOX-dependent conditional reporter cassettes.

FIG. 7C is a bar graph showing the evaluation of inducible and amplified gene expression using single vector constructs.

FIG. 8 is a schematic drawing showing features of the modified cre vector pCMV-CREM (Bgl II) and reporter plasmid pCMVe-ßAc-STOP-Luciferase FIG. 9 is a schematic drawing showing the strategy used to generate variants of a ligand inducible cre recombinase.

FIGS. 10A-10C are bar graphs showing the relative induction of cre recombinase activity using different ligands and constructs.

FIGS. 11A and 11B are schematic drawings showing Adeno-Cre and Adeno-CMV-Cre- AR (LnCaP), respectively.

Note that the schematic drawings are not drawn to scale.

SEQUENCE LISTING The nucleic and amino acid sequences listed in the accompanying sequence listing are shown using standard letter abbreviations for nucleotide bases, and three letter code for amino acids.

Only one strand of each nucleic acid sequence is shown, but the complementary strand is understood as included by any reference to the displayed strand.

SEQ ID NOS: 1-4 are nucleic acid sequences of synthetic oligonucleotides used to construct pSV-EGFP/ßgal (FIG. 3B).

SEQ ID NOS: 5-6 are nucleic acid sequences of synthetic oligonucleotides used to construct pSV-STOP-luc (FIG. 4A).

SEQ ID NOS: 7-8 are nucleic acid sequences of PCR primers used to amplify a 5'region of cre recombinase.

SEQ ID NOS: 9-10 are nucleic acid sequences of synthetic oligonucleotides used to construct pCMV-CreK (FIG. 5).

SEQ ID NOS: 11-12 are nucleic acid sequences of PCR primers used for PCR mutagenesis of the human p-globin intron.

SEQ ID NOS: 13-14 are nucleic acid sequences of phosphorylated oligonucleotides used to generate pCMV-CREM-L (FIG. 5).

SEQ ID NOS: 15-18 are nucleic acid sequences of synthetic oligonucleotides used to construct pCMV-RFP/CREM (FIG. 5).

SEQ ID NO: 19 is a nucleic acid sequence for a chimeric intron sequence provided in Genbank Accession No. U47119.

SEQ ID NO: 20 is a nucleic acid sequence for LOX P provided in Genbank Accession No.

U51223.

SEQ ID NO: 21 is a nucleic acid sequence for LOX 511.

SEQ ID NO: 22 is a nucleic acid sequence for QLOXh7q21.

SEQ ID NO: 23 is a nucleic acid sequence for ßCoreh7q21 SEQ ID NO: 24 is a nucleic acid sequence for a chicken 0-globin insulator provided in Genbank Accession No. U78775.

SEQ ID NO: 25 is a nucleic acid sequence for a modified ere sequence of pCMV-Cre-K (p209).

SEQ ID NO: 26 is a nucleic acid sequence for a modified ere sequence of pCMV-CREM (p210).

SEQ ID NO: 27 is a nucleic acid sequence for a modified ere sequence of pCMV-CREM-L (p218).

SEQ ID NOS: 28 and 29 are nucleic acid sequences of PCR primers used to generate pCMV-CREM.

SEQ ID NOS: 30 and 31 are nucleic acid sequences of PCR primers used to amplify an androgen receptor ligand binding domain (AR-LBD) (FIG. 9).

SEQ ID NOS: 32-33 are nucleic acid sequences of PCR primers used to generate pCMV- Cre-AR (LnCaP) (FIG. 9).

SEQ ID NOS: 34-35 are nucleic acid sequences of PCR primers used to generate pCMV- Cre-AR (T) (FIG. 9).

DETAILED DESCRIPTION OF SEVERAL EMBODIMENTS Abbreviations and Terms The following explanations of the terms and methods are provided to better describe the present disclosure and to guide those of ordinary skill in the art in the practice of the present disclosure. As used herein and in the appended claims, the singular forms"a"or"an"or"the" include plural references unless the context clearly dictates otherwise. Thus, for example, reference to"a transgene"includes a plurality of such transgenes and reference to"the vector"includes reference to one or more vectors and equivalents thereof known to those skilled in the art, and so forth.

Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood to one of ordinary skill in the art to which this disclosure belongs.

EGFP enhanced green fluorescent protein GFP green fluorescent protein MOI multiplicity of infection RFP red fluorescent protein RS recombining site

RT room temperature Affinity Tag: A nucleic acid sequence which can be included in a vector which can aid in the purification of a protein encoded by the vector. The term affinity tag refers to the nucleic acid sequence for the tag, and the tag protein sequence encoded by the nucleic acid sequence. Examples of affinity tags include, but are not limited to: histidine, such as 6X histidine, S-tag, glutathione-S- transferase (GST) and streptavidin.

Animal: Living multicellular vertebrate organisms, a category which includes, for example, mammals, primates, rodents, and birds.

Antibiotic Resistance Cassette: A nucleic acid sequence encoding a selectable marker which confers resistance to that antibiotic in a host cell in which the nucleic acid is translated.

Examples of antibiotic resistance cassettes include, but are not limited to: kanamycin, ampicillin, tetracycline, chloramphenicol, neomycin, hygromycin, and zeocin.

Antisense, Sense, and Antigene: Double-stranded DNA (dsDNA) has two strands, a 5'-> 3'strand (plus strand) and a 3'-> 5'strand (minus strand).. Because RNA polymerase adds nucleic acids in a 5'-> 3'direction, the minus strand of the DNA serves as the template for the RNA during transcription. Thus, the RNA formed will have a sequence complementary to the minus strand, and identical to the plus strand (except that the base uracil is substituted for thymine).

Antisense molecules are molecules that are specifically hybridizable or specifically complementary to either RNA or the plus strand of DNA. Sense molecules are molecules that are specifically hybridizable or specifically complementary to the minus strand of DNA. Antigene molecules are either antisense or sense molecules directed to a DNA target.

Binding/stable binding: An oligonucleotide binds or stably binds to a target nucleic acid if a sufficient amount of the oligonucleotide forms base pairs or is hybridized to its target nucleic acid, to permit detection of that binding. Binding can be detected by physical or functional properties of the target: oligonucleotide complex. Binding between a target and an oligonucleotide can be detected by any method known to one skilled in the art, including functional and physical binding assays.

Binding can be detected functionally by determining whether binding has an observable effect upon a biosynthetic process such as expression of a gene, DNA replication, transcription and translation.

Physical methods of detecting the binding of complementary strands of DNA or RNA are well known in the art, and include such methods as DNase I or chemical footprinting, gel shift and affinity cleavage assays, Northern blotting, dot blotting and light absorption detection procedures.

For example, a method which is widely used, because it is simple and reliable, involves observing a change in light absorption of a solution containing an oligonucleotide (or an analog) and a target nucleic acid at 220 to 300 nm as the temperature is slowly increased. If the oligonucleotide or analog has bound to its target, there is a sudden increase in absorption at a characteristic temperature as the oligonucleotide (or analog) and target dissociate or melt.

The binding between an oligomer and its target nucleic acid is frequently characterized by the temperature (Tm) at which 50% of the oligomer is melted from its target. A higher Tm means a stronger or more stable complex relative to a complex with a lower Tm.

Cancer: Malignant neoplasm that has undergone characteristic anaplasia with loss of differentiation, increased rate of growth, invasion of surrounding tissue, and is capable of metastasis. cDNA (complementary DNA): A piece of DNA lacking internal, non-coding segments (introns) and regulatory sequences which determine transcription. cDNA may be synthesized in the laboratory by reverse transcription from messenger RNA extracted from cells.

Comprises: A term that means"including."For example,"comprising A or B"means including A or B, or both A and B, unless clearly indicated otherwise.

Conservative substitution: One or more amino acid substitutions (for example 2,5 or 10 residues) for amino acid residues having similar biochemical properties.. Typically, conservative substitutions have little to no impact on the activity of a resulting polypeptide. For example, ideally, a ligand binding domain (LBD) including one or more conservative substitutions retains the ability to be recognized by the appropriate ligand. A polypeptide can be produced to contain one or more conservative substitutions by manipulating-the nucleotide sequence that encodes that polypeptide using, for example, standard procedures such as site-directed mutagenesis or PCR.

Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Examples of amino acids which may be substituted for an original amino acid in a protein and which are regarded as conservative substitutions include: Ser for Ala; Lys for Arg; Gln or His for Asn; Glu for Asp; Ser for Cys; Asn for Gln ; Asp for Glu; Pro for Gly; Asn or Gln for His; Leu or Val for Ile ; Ile or Val for Leu; Arg or Gln for Lys; Leu or Ile for Met; Met, Leu or Tyr for Phe; Thr for Ser; Ser for Thr ; Tyr for Trp; Trp or Phe for Tyr; and Ile or Leu for Val.

Further information about conservative substitutions can be found in, among other locations in, Ben-Bassat et al., (J. Bacteriol. 169: 751-7,1987), O'Regan et al., (Gene 77: 237-51,1989), Sahin- Toth et al., (Protein Sci. 3: 240-7, 1994), Hochuli et al., (BiolTechnology 6: 1321-5,1988) and in standard textbooks of genetics and molecular biology.

Deletion: The removal of a sequence of nucleic acid, such as DNA, the regions on either side being joined together.

DNA (deoxyribonucleic acid): DNA is a long chain polymer which comprises the genetic material of most living organisms (some viruses have genes comprising ribonucleic acid, RNA). The repeating units in DNA polymers are four different nucleotides, each of which comprises one of the four bases, adenine, guanine, cytosine and thymine bound to a deoxyribose sugar to which a phosphate group is attached. Triplets of nucleotides, referred to as codons, in DNA molecules code for amino acid in a polypeptide. The term codon is also used for the corresponding (and complementary) sequences of three nucleotides in the mRNA into which the DNA sequence is transcribed.

Exogenous: The term"exogenous"as used herein with reference to nucleic acid and a particular cell refers to any nucleic acid that does not originate from that particular cell as found in nature. Thus, a non-naturally-occurring nucleic acid is considered to be exogenous to a cell once introduced into the cell. Nucleic acid that is naturally-occurring also can be exogenous to a particular cell. For example, an entire chromosome isolated from a cell of subject X is an exogenous nucleic acid with respect to a cell of subject Y once that chromosome is introduced into Y's cell.

Flanked nucleic acid or flanked transgene: A nucleic acid sequence flanked at a 5'-and 3'-portion by recombining sites. For example, as shown in FIG. 1A, transgene 1 is a flanked transgene. In one embodiment, the nucleic acid is a transgene. In another embodiment, the recombining site is LOX. fLOXed nucleic acid or transgene: A nucleic acid sequence, such as a transgene, which is flanked at a 5'-and 3'-portion by LOX recombining sites.

Functional Deletion: A mutation in a nucleic acid or amino acid sequence that has an effect equivalent to deletion of the sequence. In one embodiment, the function of a gene or an essential gene product is eliminated by a deletion, insertion, or substitution.

Functionally Equivalent: Nucleic acid sequence alterations in a vector that yields the same results described herein. Such sequence alterations can include, but are not limited to, conservative substitutions, deletions, mutations, frameshifts, and insertions. For example, in a nucleic acid comprising a modified recombinase sequence which is expressed in eukaryotes but not prokaryotes, a functionally equivalent modified recombinase sequence may differ from the exact modified recombinase sequences disclosed herein, but maintains the ability to be expressed in eukaryotes but not prokaryotes. Methods for determining such ability are disclosed herein.

Heterologous : A sequence that is not normally (i. e. in the wild-type sequence) found adjacent to a second sequence. In one embodiment, the sequence is from a different genetic source, such as a virus or organism, than the second sequence.

Insulator: A nucleic acid sequence element that decreases or inhibits activation of a promoter by an enhancer. In one embodiment, an insulator is placed between the promoters. In another embodiment, insulator sequences flank either or both ends of a vector. In yet another embodiment, insulator sequences are placed between the promoters, and flank either or both ends of a vector. Examples of insulator sequences include, but are not limited to: the scs (Kellum and Schedl, Cell, 64: 941-50,1991; Kellum and Schedl, Mol. Cell. Biol. 12: 2424-31,1992) and gypsy (Roseman et al., EMBO J. 12: 435-42,1993) elements in Drosophila ; and the 5'end of the chicken ß-globin locus (Genbank Accession No. U78775, SEQ ID NO: 24).

Intron: An intragenic nucleic acid sequence in eukaryotes that is not expressed in a mature RNA molecule. Introns of the present disclosure include full-length intron sequences, or a portion thereof, such as a part of a full-length intron sequence. One non-limiting example is the nucleic acid sequence shown in SEQ ID NO: 19 (the chimeric intron sequence of nucleotides 857-989 of Genbank Accession No. U47119).

Isolated: An isolated biological component (such as a nucleic acid, peptide or protein) has been substantially separated, produced apart from, or purified away from other biological components in the cell of the organism in which the component naturally occurs, i. e., other chromosomal and extrachromosomal DNA and RNA, and proteins. Nucleic acids, peptides and proteins which have been isolated include nucleic acids and proteins purified by standard purification methods. The term also embraces nucleic acids, peptides and proteins prepared by recombinant expression in a host cell as well as chemically synthesized nucleic acids.

Ligand binding domain (LBD): A sequence, such as a receptor sequence, which is recognized by a particular ligand, for example a hormone. In some examples, the binding of a ligand to a LBD is accompanied by conformational changes in the receptor which results in alterations in the interaction of the receptor with other protein co-activators or repressors which may augment or suppress transcriptional activity of one or more genes.

In another example, a LBD is a mutated LBD. Mutation of an LBD can alter the specificity of ligand binding, which can result in alterations in receptor activity and gene expression when the LBD binds to other ligands, which may act as agonists or antagonists to the wild-type LBD. In other examples, other ligands unrelated to the naturally occurring ligands may also alter the activity of the receptor leading to increased or decreased gene expression.

Many LBD sequences are publicly available. Examples of LBDs include, but are not limited to the androgen receptor LBD (Genbank Accession No. M20132), glucocorticoid receptor LBD (Genbank Accession No. M10901), thyroid hormone receptor (Genbank Accession No. NM003250), estrogen receptor LBD (Genbank Accession No. M12674), and progesterone receptor LBD (Genbank Accession No. NM000926).

LOX sequence: A target recombining site sequence recognized by the bacterial cre recombinase (cre). Specific, non-limiting examples include, but are not limited to, the sequence listed as Genbank accession No. M10494.1; LOX P (Genbank Accession No. U51223, SEQ ID NO: 20); LOX 511 (SEQ ID NO: 21; Bethke and Sauer, Nuc. Acid. Res. 25: 282-34,1997); LOXh7q21 (SEQ ID NO: 22; Thyagarajan et al., Gene, 244: 47-54,2000), ç Coreh7q21 (SEQ ID NO: 23; Thyagarajan et al., Gene, 244: 47-54,2000) as well as the lox sites disclosed in Table 1 of Thyagarajan et al. (Gene, 244: 47-54,2000, herein incorporated by reference). In one example, LOX P sites are defined by the sequence ATAACTTCGTATAATGTATGCTATACGAAGTTAT (SEQ ID NO: 20).

A"minimal"LOX sequence is the minimal sequence recognized by cre. In one emb example, minimal LOX sequence is as described in Hoekstra et al., Proc. Nat. Acad. Sci. 88: 5457- 61,1991. In another example, 5'and 3'LOX sequences are identical.

As used herein, LOX sequences are located upstream and downstream (5'and 3', respectively) to a nucleic acid sequence, for example a nucleic acid sequence encoding a transgene, such as a transgene encoding a therapeutic polypeptide, or a marker polypeptide. In another embodiment, the nucleic acid sequence is a stop cassette.

Long Terminal Repeat (LTR): A DNA sequence repeated at the 5'and 3'end of an integrated retrovirus genome (the provirus) which is not found in the retroviral RNA genome. LTRs are generated through a replication process prior to integration and consist of three structural regions: U3, R and U5. The LTR generally contains an enhancer sequence (s), promoter sequence (s), 3'RNA processing sequence (s), and integration (att) sequence (s). In a replication competent retrovirus, the LTR may also contain an active RNA polymerase II promoter which allows transcription of the integrated provirus by host cell RNA polymerase II to generate new copies of the retroviral RNA genome. Examples include, but are not limited to the LTR of HIV1 (Patricia et al., AIDS Res. Hum.

Retroviruses 3: 41-55,1987); MMTV (Lee et aL, Virology 159: 39-48,1987); MLV, and RSV (Yamamoto et al., Cell 22 : 787-97,1980).

Mammal: This term includes both human and non-human mammals. Similarly, the terms "subject,""patient,"and"individual"include human and veterinary subjects.

Marker or reporter polypeptide: A polypeptide used to identify cells that express the polypeptide. A marker polypeptide can be detected using methods known to one of skill in the art, including enzymatic assays and assays utilizing antibodies (e. g. ELISA or immunohistochemistry).

Specific non-limiting examples of a maker protein are luciferase,. EGFP, GFP, RFP, and LacZ galactosidase).

Modified Recombinase: A recombinase sequence which has been altered such that the resulting modified recombinase has substantially reduced expression in prokaryotic cells (such as no detectable expression), but is expressed at detectable levels in eukaryotic cells. A modified recombinase can be any recombinase known in the art, including, but not limited to, cre, Flp, Tn3 recombinase, transposon gamma/delta, and transposon mariner, whose nucleic acid sequence has been altered such that the resulting modified recombinase is not expressed in prokaryotic cells, but is expressed in eukaryotic cells.

In one embodiment, a modified recombinase is not expressed in a bacterial cell, but is expressed in a mammalian cell. In another embodiment, a modified recombinase is a modified cre recombinase wherein the 5'UTR is shortened; the Kozak translational start site has been optimized; and part of an intron sequence has been inserted within the native cre recombinase sequence. In yet another embodiment, a modified recombinase is the modified ere recombinase disclosed in EXAMPLE 3. In another embodiment, a modified recombinase is the modified ere recombinase disclosed in SEQ ID NO: 25,26 or 27.

Neoplasm: Abnormal growth of cells.

Normal cells: Non-tumor, non-malignant cells.

Nucleic acid: A sequence composed of nucleotides, including the nucleotides that are found in DNA and RNA.

Oligonucleotide : A linear polynucleotide sequence of up to about 200 nucleotide bases in length, for example a polynucleotide (such as DNA or RNA) which is at least 6 nucleotides, for example at least 15,25,50,75,100 or even 200 nucleotides long.

Operably linked: A first nucleic acid sequence is operably linked with a second nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the second nucleic acid sequence. For instance, a promoter is operably linked to a coding sequence if the promoter affects the transcription or expression of the coding sequence. Generally, operably linked DNA sequences are contiguous and, where necessary to join two protein coding regions, in the same reading frame.

ORF (open reading frame): A series of nucleotide triplets (codons) coding for amino acids without any termination codons. These sequences are usually translatable into a peptide.

Ortholog: Two nucleotide sequences are orthologs of each other if they share a common ancestral sequence, and diverged when a species carrying that ancestral sequence split into two species. Orthologous sequences are also homologous sequences.

PCR (polymerase chain reaction: Describes a technique in which cycles of denaturation, annealing with primer, and then extension with DNA polymerase are used to amplify the number of copies of a target DNA sequence.

Polynucleotide : A linear nucleic acid sequence of any length. Therefore, a polynucleotide includes molecules which are at least about 15,25,50,100,150,200, or 500 (oligonucleotides) and also nucleotides as long as a full length cDNA.

Probes and primers: A probe comprises an isolated nucleic acid attached to a detectable label or reporter molecule. Typical labels include radioactive isotopes, ligands, chemiluminescent agents, and enzymes. Methods for labeling and guidance in the choice of labels appropriate for various purposes are discussed, e. g., in Sambrook et al., Molecular Cloning : A Laboratory Manual, Cold Spring Harbor Laboratory Press (1989); and Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences (1987).

Primers are short nucleic acids, for example DNA oligonucleotides at least 15 nucleotides in length, and/or no longer than about 15,17,20,25,50,75,100,150,200 or 500 nucleotides in length.

Primers may be annealed to a complementary target DNA strand by nucleic acid hybridization to form a hybrid between the primer and the target DNA strand, and then extended along the target DNA strand by a DNA polymerase enzyme. Primer pairs can be used for amplification of a nucleic acid sequence, e. g., by PCR or other nucleic-acid amplification methods known in the art.

Methods for preparing and using probes and primers are described, for example, in Sambrook et al. (Molecular Cloning : A Laboratory Manual1 Cold Spring Harbor Laboratory Press, 1989), Ausubel et al., Current Protocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences (1987), and Innis et al., PCR Protocols, A Guide to Methods and Applications, 1990, Innis et al. (eds.), 21-27, Academic Press, Inc., San Diego, California. PCR primer pairs can be derived from a known sequence, for example, by using computer programs intended for that purpose such as Primer (Version 0.5,0 1991, Whitehead Institute for Biomedical Research, Cambridge, MA).

Probes and primers disclosed herein comprise at least 15 nucleotides of a nucleic acid sequence, although a shorter nucleic acid may be used as a probe or primer if it specifically hybridizes under stringent conditions with a target nucleic acid by methods well known in the art.

The disclosure thus includes isolated nucleic acid molecules that include specified lengths of the disclosed sequences. One of skill in the art will appreciate that the specificity of a particular probe or primer increases with its length. Thus, for example, a primer comprising 20 consecutive nucleotides of a gene will anneal to a target sequence contained within a genomic DNA library with a higher specificity than a corresponding primer of only 15 nucleotides. To enhance specificity, longer probes and primers can be used, for example probes and primers that comprise at least 20,30,40,50,60,70, 80,90,100 or more consecutive nucleotides from any region of the disclosed sequences. By way of example, the sequences disclosed herein may be apportioned into halves or quarters based on sequence length, and the isolated nucleic acid molecules may be derived from the first or second halves of the molecules, or any of the four quarters.

When referring to a probe or primer, the term"specific for (a target sequence)"indicates that the probe or primer hybridizes under stringent conditions substantially only to the target sequence in a given sample comprising the target sequence.

Promoter: An array of nucleic acid control sequences which direct transcription of a nucleic acid. A promoter includes necessary nucleic acid sequences near the start site of transcription, such as, in the case of a polymerase II type promoter, a TATA element. In one example, a promoter includes an enhancer. In another example, a promoter includes a repressor element. In these examples, a chimeric promoter is created (a promoter/enhancer chimera or a promoter/repressor chimera, respectively).

Enhancer and repressor elements can be located adjacent to, or distal to the promoter, and can be located as much as several thousand base pairs from the start site of transcription. Examples of promoters that can be used include, but are not limited to the SV40 promoter, the CMV enhancer- promoter, the CMV enhancer/pactin promoter, and the tissue-specific promoter probasin.

Other promoter sequences which can be used to construct the nucleic acids and practice the methods disclosed herein include, but are not limited to: the lac system, the trp system, the tac system, the trc system, major operator and promoter regions of phage lambda, the control region of fd coat protein, the early and late promoters of SV40, promoters derived from polyoma, adenovirus, retrovirus, baculovirus and simian virus, the promoter for 3-phosphoglycerate kinase, the promoters of yeast acid phosphatase, the promoter of the yeast alpha-mating factors, any retroviral LTR promoter such as the RSV promoter; inducible promoters, such as the MMTV promoter; the metallothionein promoter; heat shock promoters; the albumin promoter; the histone promoter; the a-actin promoter; TK promoters; B19 parvovirus promoters; the SV10 late promoter; the ApoAI promoter and combinations thereof.

In one example, a promoter is a strong promoter, which promotes transcription of RNA at high levels, for example at levels such that the transcriptional activity of the promoter generally accounts for about 25% of transcriptional activity of all transcription within a cell. The strength of a promoter is often tissue-specific and thus may vary from one cell type to another. For example, CMV is a classic

strong promoter because it generates high levels of transcriptional activity in many cell types.

Examples of strong promoters include, but are not limited to: CMV; CMV/chicken ß-actin ; elongation factors 1A and 2A; SV40; RSV; and the MoLV LTR.

In another example, a promoter is a tissue-specific promoter, which promotes transcription in a single cell type or narrow range of tissues. Examples of tissue-specific promoters include, but are not limited to: probasin (which is promotes expression in prostate cells), an immunoglobulin promoter; a whey acidic protein promoter; a casein promoter; glial fibrillary acidic protein promoter; albumin promoter; ß-globin promoter; and the MMTV promoter.

In yet another embodiment, a promoter is a hormone-responsive promoter, which promotes transcription only when exposed to a hormone. Examples of hormone-responsive promoters include, but are not limited to: probasin (which is responsive to testosterone and other androgens); MMTV promoter (which is responsive to dexamethazone, estrogen, and androgens); and the whey acidic protein promoter and casein promoter (which are responsive to estrogen).

Purified: The term purified does not require absolute purity; rather, it is intended as a relative term. Thus, for example, a purified protein preparation is one in which the protein is more pure than the protein in its natural environment within a cell. In one embodiment, a preparation of a protein is purified such that the protein represents at least 50%, for example at least 70%, of the total protein content of the preparation.

Recombinant: A recombinant nucleic acid is one that has a sequence that is not naturally occurring or has a sequence that is made by an artificial combination of two otherwise separated segments of sequence. This artificial combination is often accomplished by chemical synthesis or, more commonly, by the artificial manipulation of isolated segments of nucleic acids, e. g., by genetic engineering techniques, such as those described in Sambrook et al. (In: Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989).

Recombining site: A nucleic acid sequences that include inverted palindromes separated by an asymmetric sequence (such as a transgene) at which a site-specific recombination reaction can occur. In one specific, non-limiting example, a recombining site is a Lox site, such as Lox P or Lox 511 (see above). In another specific non-limiting example, a recombining site is a Frt site. Frt consists of two inverted 13-base-pair (bp) repeats and an 8-bp spacer that together comprise the minimal Frt site, plus an additional 13-bp repeat which may augment reactivity of the minimal substrate (e. g. see U. S. Patent No. 5,654,182). In other, specific non-limiting examples, a recombining site is a recombining site from a TN3, a mariner, or a gamma/delta transposon.

Recombinase: A protein which catalyses recombination of recombining sites (reviewed in Kilby et al., TIG, 9: 413-21,1993; Landy, Curr. Opin. Genet Devel., 3: 699-707,1993; Argos et aL, EMBO J., 5: 433-40,1986). One specific, non-limiting example of a recombinase is cre. Another specific, non-limiting example of a recombinase is a Flp protein. Other specific, non-limiting examples of a recombinase are Tn3 recombinase, the recombinase of transposon gamma/delta, and the recombinase from transposon mariner.

The ere and Flp proteins belong to the lambda/integrase family of DNA recombinases. The ere and Flp recombinases are similar in the types of reactions they carry out, the structure of their target sites, and their mechanism of recombination (Jayaram, TIBS, 19: 78-82,1994; Lee et al., J.

Biol. Chez. 270: 4042-52,1995). For instance, the recombination event is independent of replication and exogenous energy sources such as ATP, and functions on both supercoiled and linear DNA templates.

Recombinases exert their effects by promoting recombination between two of their recombining sites. In the case of cre, the recombining site is a Lox site (see U. S. Patent No.

4,959,317 to Sauer), and in the case of Flp the recombining site is a Frt site. Similar sites are found in transposon gamma/delta, TN3, and transposon mariner. These recombining sites are comprised of inverted palindromes separated by an asymmetric sequence (Mack et al., Nuc. Acids Res., 20: 4451-5, 1992; Hoess et al., Nuc. Acids Res. 14: 2287-300,1986; Kilby et al., TIG, 9: 413-21,1993).

Recombination between target sites arranged in parallel (so-called"direct repeats") on the same linear DNA molecule results in excision of the intervening DNA sequence as a circular molecule.

Recombination between direct repeats on a circular DNA molecule excises the intervening DNA and generates two circular molecules. Both the cre/Lox and flp/frt recombination systems have been used for a wide array of purposes such as site-specific integration into plant, insect, bacterial, yeast and mammalian chromosomes has been reported (Sauer et al., Proc. Natl. Acad. Sci. USA, 85,5166-70, 1988). Positive and negative strategies for selecting or screening recombinants have been developed (Sauer et al., J. Mol. Biol., 223,911-28,1992). The use of the recombinant systems or components thereof in transgenic mice, plants and insects among others reveals that hosts express the recombinase genes with no apparent deleterious effects, thus confirming that the proteins are generally well- tolerated (Orbin et al., Proc. Natl. Acad. Sci. USA 89: 6861-5,1992).

Sample: Includes biological samples containing genomic DNA, RNA, and/or protein obtained from the cells of a subject, such as those present in peripheral blood, urine, saliva, tissue biopsy, surgical specimen, fine needle aspirates, amniocentesis samples and autopsy material.

Selectable Marker: A polypeptide used to identify a cell of interest that express the polypeptide. A selectable marker can be detected using any method known to one of skill in the art, including enzymatic assays, spectrophotometric assays, antibiotic resistance assays, and assays utilizing antibodies (e. g. ELISA or immunohistochemistry). Specific non-limiting examples of a selectable maker are luciferase, GFP, RFP, EGFP or LacZ (ß-galactosidase). In one embodiment, a selectable marker is an enzyme. In another embodiment, a selectable marker is a fluorescent molecule. In further embodiment, a selectable marker is an antigenic epitope. Specific, non-limiting examples of selectable markers of use are proteins that make a cell drug resistance (e. g. zeomycin, hygromycin, tetracycline, puromycin or bleomycin resistant).

Sequence identity: The identity between two or more nucleic acid sequences, or two or more amino acid sequences, is expressed in terms of the identity between the sequences. Sequence identity can be measured in terms of percentage identity (or similarity or homology); the higher the percentage,

the more identical the sequences are. Homologs or orthologs of nucleic acid or amino acid sequences possess a relatively high degree of sequence identity when aligned using standard methods. This homology is more significant when orthologous proteins or cDNAs are derived from species which are more closely related (e. g., human and mouse sequences), compared to species more distantly related (e. g., human and C. elegans sequences).

Methods of alignment of sequences for comparison are well known in the art. Various programs and alignment algorithms are described in: Smith & Waterman, Adv. Appl. Math. 2: 482, 1981 ; Needleman & Wunsch, J. Mol. Biol. 48: 443,1970; Pearson & Lipman, Pi-oc. Natl. Acad. Sci.

USA 85: 2444,1988; Higgins & Sharp, Gene, 73: 237-44,1988; Higgins & Sharp, CABIOS 5: 151-3, 1989; Corpet et al., Nuc. Acids Res. 16: 10881-90,1988; Huang et al. Corriputer Appls. in the Biosciences 8,155-65,1992; and Pearson et al., Metli. Mol. Bio. 24 : 307-31, 1994. Altschul et al., J.

Mol. BioL 215: 403-10,1990, presents a detailed consideration of sequence alignment methods and homology calculations.

The NCBI Basic Local Alignment Search Tool (BLAST) (Altschul et al., J. MoL Biol.

215 : 403-10,1990) is available from several sources, including the National Center for Biological Information (NCBI, National Library of Medicine, Building 38A, Room 8N805, Bethesda, MD 20894) and on the Internet, for use in connection with the sequence analysis programs blastp, blastn, blastx, tblastn and tblastx. Additional information can be found at the NCBI web site.

For comparisons of amino acid sequences of greater than about 30 amino acids, the Blast 2 sequences function is employed using the default BLOSUM62 matrix set to default parameters, (gap existence cost of 11, and a per residue gap cost of 1). When aligning short peptides (fewer than around 30 amino acids), the alignment should be performed using the Blast 2 sequences function, employing the PAM30 matrix set to default parameters (open gap 9, extension gap 1 penalties). Proteins with even greater identity to the reference sequence will show increasing percentage identities when assessed by this method, such as at least 70%, 75%, 80%, 85%, 90%, 92%, 95%, 98%, or 99% sequence identity, when using gapped blastp with databases such as the nr or swissprot database. Queries searched with the blastn program are filtered with DUST (Hancock and Armstrong, 1994, C07nput. AppL Biosci.

10: 67-70). Other programs use SEG. When less than the entire sequence is being compared for sequence identity, homologs typically possess at least 75% sequence identity over short windows of 10- 20 amino acids, and may possess sequence identities of at least 85%, 90%, 92%, 95%, 98%, or 99% depending on their identity to the reference sequence. Methods for determining sequence identity over such short windows are described at the NCBI web site. One of skill in the art will appreciate that these sequence identity ranges are provided for guidance only ; it is entirely possible that significant homologs can be obtained that fall outside of the ranges provided.

One indication that two nucleic acid molecules are closely related is that the two molecules hybridize to each other under stringent conditions. Stringent conditions are sequence-dependent and vary under different environmental parameters. Nucleic acid molecules that hybridize under stringent conditions to a target nucleic acid (or a sequence complementary thereto) typically hybridize to a probe

based on either an entire a target nucleic acid (or a sequence complementary thereto) or selected portions of a target nucleic acid (or a sequence complementary thereto), respectively, under wash conditions as described in EXAMPLE 8.

Nucleic acid sequences that do not show a high degree of identity may nevertheless encode similar amino acid sequences, due to the degeneracy of the genetic code. Changes in nucleic acid sequence can be made using this degeneracy to produce multiple nucleic acid molecules that all encode substantially the same protein. Such homologous peptides may, for example, possess at least 75%, 80%, 90%, 92%, 95%, 98%, or 99% sequence identity determined by this method. When less than the entire sequence is being compared for sequence identity, homologs may, for example, possess at least 75%, 85% 90%, 92%, 95%, 98% or 99% sequence identity over short windows of 10-20 amino acids.

Methods for determining sequence identity over such short windows can be found at the NCBI web site. One of skill in the art will appreciate that the sequence identity ranges are provided for guidance only; it is possible that significant homologs or other variants can be obtained that fall outside the ranges provided.

For comparisons of nucleic acid sequences, sequence identity can be determined by comparing the nucleotide sequences of two nucleic acids using the BLAST sequence analysis software, for instance, the NCBI BLAST 2.0 program gapped blastn set to default parameters. (One example of such default settings would be: expect = 10, filter = default, descriptions = 500 pairwise, alignments = 500, alignment view = standard, gap existence cost = 11, per residue existence = 1, per residue gap cost = 0.85). Nucleic acids with even greater identity to a reference nucleic acid sequence will show increasing percentage identities when assessed by this method, such as at least 50%, 60%, 70%, 75%, 80%, 90%, 92%, 95%, 98%, or 99% sequence identity of the nucleotides.

An alternative (and not necessarily cumulative) indication that two nucleic acid sequences are substantially identical is that the polypeptide which the first nucleic acid encodes is immunologically cross reactive with the polypeptide encoded by the second nucleic acid.

Stop cassette : A nucleic acid sequence which prevents gene expression. In one embodiment, the cassette includes a poly A signal, a splice donor, and a stop codon such as amber (UAG), ochre (UAA), or (opal) UGA. A particular, non-limiting example is the stop cassette in the plasmid pBS302 (available from GIBCO/BRL, Gaithersburg, MD). In another embodiment, a stop cassette is a frame- shift which results in the expression of one gene but not another gene (for example, see FIG. 1A) Subject: Living multicellular vertebrate organisms, a category which includes, both human and veterinary subjects for example, mammals, birds, rodents, and primates.

Supernatant: The culture medium in which a cell is grown. The culture medium may include material from the cell. If the cell is infected with a virus, the supernatant can include viral particles.

Target Nucleic Acid: Refers to a nucleic acid, such as ssDNA, dsDNA or RNA, that hybridizes with a probe or primer. The conditions under which hybridization occurs can vary with the size and sequence of the probe and the target sequence. By way of illustration only, a hybridization experiment can be performed by hybridization of a DNA probe (for example, a probe

derived from a transgene labeled with a radioactive isotope) to a target nucleic acid electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Sambrook et al.

(Molecular Cloni7lg : A Laboratory Manual, Cold Spring Harbor, New York, 1989). Further discussion of hybridization conditions are given below in EXAMPLE 8.

In another embodiment, the target nucleic acid, upon hybridization to a therapeutically effective antisense oligonucleotide or oligonucleotide analog, results in the inhibition of expression of the target sequence. Either an antisense or a sense molecule can be used to target a portion of dsDNA, since both will interfere with the expression of that portion of the dsDNA. The antisense molecule can bind to the plus strand, and the sense molecule can bind to the minus strand. Thus, target nucleic acids can be ssDNA, dsDNA, and RNA.

Therapeutically Effective Amount: An amount sufficient to achieve a desired biological effect. In one example, it is an amount effective to allow a functional level of expression of a nucleic acid, for example a transgene, of interest. In particular examples, it is a concentration of a herein disclosed nucleic acid or vector containing at least one transgene, effective to allow expression of a transgene, the expression of which is desired in a subject, sufficient to achieve a desired effect in the subject. For instance, it can be an amount necessary to improve signs and/or symptoms of a disease, for example by expression of one or more transgenes in the vector. Diseases include, but are not limited to, a neurological, immunological, cardiovascular, muscular, cell proliferative, or genetic disorder. Other diseases include tumors, such as cancer.

In another embodiment, it is an amount effective to decrease (such as inhibit) expression of a nucleic acid, for example a gene of interest. In particular embodiments, it is a concentration of a herein disclosed nucleic acid or vector containing at least one therapeutically effective oligonucleotide, effective to allow expression of a therapeutically effective oligonucleotide, the expression of which is desired in a subject, sufficient to achieve a desired effect in the subject. For instance, it can be an amount necessary to improve signs and/or symptoms a disease, for example by expression of one or more therapeutically effective oligonucleotide in the vector. Complete inhibition is not necessary for therapeutic effectiveness. Therapeutically effective oligonucleotides are characterized by their ability to inhibit the expression of the gene of interest. Inhibition is any reduction in expression seen when compared to production in the absence of the oligonucleotide or oligonucleotide analog. Additionally, some oligonucleotides will be capable of inhibiting the expression of a gene of interest by at least 10%, 15%, 30%, 40%, 50%, 60%, or 70%, or more.

Therapeutically effective oligonucleotides are additionally characterized by being sufficiently complementary to nucleic acid sequences encoding a gene of interest. As described herein, sufficiently complementary means that the therapeutically effective oligonucleotide can specifically disrupt the expression of a gene, and not significantly alter the expression of other genes.

An effective amount of a nucleic acid or vector containing at least one transgene, such as a therapeutically effective oligonucleotide can be administered in a single dose, or in several doses, for example daily, during a course of treatment. However, the effective amount of the vector will be

dependent on many factors, including, but not limited to: the vector administered; the subject being treated; the condition of the subject being treated; the severity and type of the condition being treated; the body weight or surface area of the subject to be treated; the age, weight, and sex of the subject to be treated; as well as the existence, nature, and extent of any adverse side-effects that accompany the administration of a particular vector, or transduced cell type in a particular subject, and the manner of administration of the vectors disclosed herein.

The general term"subject being treated"is understood to include all animals (e. g. humans, apes, dogs, cats, horses, rodents, pigs, and cows) that require expression of the vectors disclosed herein which contain a transgene.

Therapeutically effective dose: A dose sufficient to be therapeutically effective, for example to allow functional expression of a transgene and/or therapeutically effective oligonucleotide, resulting in a desired effect in a subject being treated, or which is capable of relieving signs or symptoms caused by a pathological condition, or which is capable of preventing signs or symptoms caused by a pathological condition.

Therapeutic polypeptide: A polypeptide which can be used to alleviate or relieve a symptom of a disorder in a subject being treated. Specific, non-limiting examples of therapeutic polypeptides are cytokines or irnmunomodulators, hormones, neurotransmitters, enzymes, and regulatory factors which regulate/modulate the expression of other genes, such as a transcription factor. In yet another embodiment, a therapeutic polypeptide is an immunogenic polypeptide.

Transduced and Transformed: A virus or vector transduces or transfects a cell when it transfers nucleic acid into the cell. A cell is"transformed"by a nucleic acid transduced into the cell when the DNA becomes stably replicated by the cell, either by incorporation of the nucleic acid into the cellular genome, or by episomal replication. As used herein, the term transformation encompasses all techniques by which a nucleic acid molecule might be introduced into such a cell, including transfection with viral vectors, transformation with plasmid vectors, and introduction of naked DNA by electroporation, lipofection, and particle gun acceleration.

Transgene: An exogenous nucleic acid sequence. In one example, a transgene is a gene sequence, for example a sequence which encodes a marker polypeptide which can be detected using methods known to one of skill in the art. In another example, the transgene encodes a therapeutic polypeptide which can be used to alleviate or relieve a symptom of a disorder. In yet another example, the transgene encodes a therapeutically effective oligonucleotide, for example an antisense oligonucleotide, wherein expression of the oligonucleotide inhibits expression of a target nucleic acid sequence. In a further example, the transgene encodes an antisense nucleic acid or a ribozyme. In yet another embodiment, a transgene is a stop cassette.

In other examples, a transgene contains native regulatory sequences operably linked to the transgene (e. g. the wild-type promoter, found operably linked to the gene in a wild-type cell).

Alternatively, a heterologous promoter can be operably linked to the transgene. In yet another embodiment, a viral LTR can be used to express the transgene.

Transgenic Cell: Transformed cells which contain foreign, non-native DNA.

U3: A non-coding region of a LTR located upstream of the transcription start site. Forms the 5'end of the provirus after reverse transcription and contains the promoter elements responsible for transcription of the provirus.

U5: A non-coding region of the LTR. It is the first part of the genome to be reverse transcribed, forming the 3'end of the provirus genome.

Variant sequences: A variation of a nucleic acid sequence is a nucleic acid sequence having one or more nucleotide substitutions, one or more nucleotide deletions, and/or one or more nucleotide insertions, so long as the variant nucleic acid sequence substantially retains the activity of the original nucleic acid sequence, or has sufficient complementarity to a target sequence.

In one example, a variant nucleic acid sequence can also hybridize with the target DNA or RNA, under stringency conditions as described above. In yet another embodiment, a variant nucleic acid sequence also exhibits sufficient complementarity with the target DNA or RNA of the original oligonucleotide or analog as described above.

Vector: A nucleic acid molecule as introduced into a cell, thereby producing a transformed cell. A vector can include nucleic acid sequences that permit it to replicate in the cell, such as an origin of replication. A vector can also include one or more marker or therapeutic transgenes and other genetic elements known in the art.

In one embodiment, a vector is a non-viral vector, such as a bacterial vector. In another embodiment, a vector is a viral vector. Examples of viral vectors include, but are not limited to adenoviral vectors, retroviral vectors, and Herpes viral vectors.

The present disclosure utilizes standard laboratory practices for the cloning, manipulation and sequencing of nucleic acids, purification and analysis of proteins and other molecular biological and biochemical techniques, unless otherwise stipulated. Such techniques are explained in detail in standard laboratory manuals such as Sambrook et al. (In : Molecular Cloning : A Laboratory Manual Cold Spring Harbor, New York, 1989), Coffin et al. (Retroviruses, Cold Spring Harbor Laboratory Press, 1997) and Ausubel et al., CurrentProtocols in Molecular Biology, Greene Publishing Associates and Wiley-Intersciences (1987).

Additional terms commonly used in molecular genetics can be found in Benjamin Lewin, Genes Vpublished by Oxford University Press, 1994 (ISBN 0-19-854287-9); Kendrew et al (eds.), The Encyclopedia of Molecular Biology, published by Blackwell Science Ltd., 1994 (ISBN 0-632- 02182-9); and Robert A. Meyers (ed.), Molecular Biology and Biotechnology : a Comprehensive Desk Reference, published by VCH Publishers, Inc., 1995 (ISBN 1-56081-569-8).

Frame-shift Vectors Disclosed herein are nucleic acids, such as a nucleic acid in a vector, which allow for selective transgene expression using a recombinase and a recombining site. To decrease (such as inhibit, reduce, or prevent) downstream transgene expression in the absence of a recombinase, the

expression of one transgene,"transgene l,"is selectively turned off with the simultaneous activation of another transgene"transgene 2,"by placing flanked transgene 1 within the coding sequence of transgene 2, wherein the nucleotide sequence of transgene 2 is out-of-frame to transgene 1 (FIG. 1A).

This arrangement results in the correct transcription and translation of transgene 1, but not transgene 2 in the absence of recombinase. In the presence of recombinase, transgene 1 is excised, restoring the correct reading frame of transgene 2 and transgene 2 expression.

In one example, a nucleic acid having a first transgene located between a recombining site, generating a flanked first transgene, is located within the coding sequence of a second transgene, which is out-of-frame with respect to a first transgene, is provided. In one example, the nucleic acid is in a vector. In another embodiment, the nucleic acid also contains a promoter, which is operably linked upstream of the 5'recombining site (FIG. 1A). In the absence of a recombinase, the first transgene is correctly transcribed and translated, but the second transgene is not. However, in the presence of a recombinase the first transgene is excised, and the second transgene translated. In yet another example, the nucleic acid also contains a recombinase sequence, which can be located downstream of the second transgene. Expression of the recombinase can be achieved by placing an internal ribozyme entry site (IRES) (FIG. 1B) or a promoter 5'to a portion of the expressing cassette (FIGS. 1C and 1D). In yet another example, the nucleic acid also contains an insulator sequence (FIGS. 1E and 1F). An insulator sequence can be located at one or both ends of the nucleic acid sequence, and/or can be located between promoter sequences. FIGS. 1E and lF show nucleic acid sequences containing a set of insulator sequences at both ends, and between promoter sequences.

One skilled in the art will recognize that the position of the flanked first transgene within the coding sequence of second transgene is not critical, although the position should not interfere with the correct transcription and translation of the second transgene. That is, a functional second transgene protein should be produced in the presence of a recombinase in trans.

Recombinases that can be used to make and use the nucleic acids disclosed herein include any recombinase known to those skilled in the art. Examples, include, but are not limited to: cre recombinase, Flp recombinase, and lambda recombinase. The recombinase used will depend on the recombining site used. For example, if the recombining site is a LOX recombining site, such as LOX P or LOX 511, cre recombinase is used. If the recombining site is Frt, Flp recombinase is used. In another example, recombinase is a modified recombinase, such as a modified cre recombinase, such as SEQ ID NO: 25,26, or 27. In one embodiment, recombinase is expressed in tramas, such as on a separate vector from the recombining site (see FIG. 1A). In another example, recombinase is expressed in cis, such as on the same vector as the recombining site (see FIGS. 1B and 1C).

Promoters that can be used to make and use the nucleic acids disclosed herein include any promoter known to those skilled in the art. For example, the promoter can be a strong promoter, such as CMV or CMV/chicken ß-actin. In another example, the promoter is a tissue-specific promoter, such as probasin. In yet another example, the promoter is a hormone-responsive promoter. In other examples, the promoter is SV40. Other promoters are disclosed herein.

The transgene sequences present in the nucleic acids disclosed herein include any exogenous nucleic acid sequence. In one example, the transgene encodes for a therapeutic polypeptide or marker polypeptide. Non-limiting examples of marker polypeptides include fluorescent proteins, such as luciferase, enhanced green fluorescent protein (EGFP), red fluorescent protein (RFP), and green fluorescent protein (GFP). Non-limiting examples of therapeutic polypeptides include cytokines, immunomodulators, hormones, neurotransmitters, enzymes, regulatory factors which regulate/modulate the expression of other genes, such as a transcription factor, and immunogenic polypeptides. In another example, the nucleic acid sequence of the first transgene is a stop cassette and the nucleic acid sequence of the second transgene encodes for a therapeutic polypeptide or marker polypeptide.

The insulator sequences that can be used to make and use the nucleic acids disclosed herein include any insulator sequence known to those skilled in the art. For example, the scs (Kellum and Schedl, Cell, 64: 941-50,1991; Kellum and Schedl, Mol. Cell. Biol. 12: 2424-31,1992) and gypsy (Roseman et aL, EMBO J 12: 435-42,1993) elements in Drosophila ; and the 5'end of the chicken globin locus (Genbank Accession No. U78775, SEQ ID NO: 24) can be used to practice the present disclosure.

Recombinase Expression in Eukaryotic but not Prokaryotic Cells Also disclosed herein are modified recombinase nucleic acid sequences (CREM) which are expressed at detectable levels in eukaryotic cells, but not prokaryotic cells, and methods of their use.

In one example, a modified recombinase contains at least a partial intron nucleic acid sequence located within a coding sequence of a recombinase, and an optimized Kozak translational start site located 3' (downstream) to a 5'UTR portion of the recombinase (FIG. 2A). In one example, the at least a partial intron nucleic acid sequence is located between a portion of the recombinase located downstream of the 5'portion of the recombinase, and a 3'portion of the recombinase (FIG. 2A). In another example, a modified recombinase nucleic acid also contains a recombining site located 3'to the Kozak site and upstream of the intron sequence (FIG. 2B). In yet another example, the modified recombinase nucleic acid further contains an additional recombining site located 3'to the first recombining site, and a first transgene located between the two recombining sites, generating a flanked first transgene located 3'to the Kozak site (FIG. 2C). In another example, the modified recombinase also contains a promoter sequence operably linked to a 5'UTR portion of the modified recombinase.

Disclosed herein is a modified recombinase nucleic acid which contains a promoter operably linked to the modified recombinase (FIG. 2A), which drives expression of the modified recombinase.

In another example, the nucleic acid further contains an insulator sequence located 3'to the 3'portion of the modified recombinase (FIG. 2D, insulators #2), and/or an insulator sequence located 5'to the 5' portion of the promoter (FIG. 2D, insulators #1). In a particular example, the promoter is a tissue- specific promoter, such as probasin.

In other examples, a modified recombinase nucleic acid also contains a modified recombinase located 5' (upstream) to a nucleic acid comprising a fLOXed first transgene or 3'to a nucleic acid comprising a second transgene (FIGS. 2E and 2F, respectively). In yet another examples, a promoter is operably linked to a 5'portion of the recombining site and a promoter is operably linked to a 5'portion of the modified recombinase (FIGS. 2E-2H). In another embodiment, an insulator nucleic acid sequence, such as a chicken (3-globin insulator nucleic acid sequence (such as SEQ ID NO: 24), is located between a 3'end of the modified recombinase and the promoter operably linked to the 5'portion of the first recombining site (FIGS. 21 and 2J, insulators #2). In another example, an insulator nucleic acid sequence flanks the 5'and/or 3'end of a vector (FIGS. 21 and 2J, insulators #1 and #3, respectively). In one example, an insulator sequence flanks the 5'and/or 3'end of a vector and is located between a 3'end of the modified recombinase and the promoter operably linked to the 5'portion of the first recombining site (FIGS. 21 and 2J).

In a particular example, the modified recombinase also contains a LBD, such as an AR-LBD located downstream of the 3'portion of the recombinase (FIG. 2K). In specific examples, the LBD has wild-type activity (such as a wild-type LBD sequence or a sequene including variant substitutions which do not substantially alter LBD activity), and in other examples the LBD has mutant activity (such as a mutant LBD sequence). Examples of LBD sequences which can be used, include, but are not limited to AR-LBD (Genbank Accession No. (Genbank Accession No. M20132), glucocorticoid receptor LBD (Genbank Accession No. M10901), thyroid hormone receptor (Genbank Accession No.

NM003250), estrogen receptor LBD (Genbank Accession No. M12674), and progesterone receptor LBD (Genbank Accession No. NM000926). Insulator sequences can also be included in the vector shown in FIG. 2K for example as shown in FIG. 2J or FIG. 2D. An LBD sequence can be added at the 3'end of the cre by in frame fusion of an LBD sequence to any vector disclosed herein which includes cre (for example the vectors shown in FIG. 2).

In one example, the modified recombinase is not active unless a recombinase is expressed in trans. In yet another embodiment, a flanked first transgene is expressed in the absence of a trans recombinase. In a specific embodiment, the modified recombinase is a modified cre recombinase, and the recombining site is a LOX P (SEQ ID NO: 20) or a LOX 511 (SEQ ID NO: 21) sequence.

One skilled in the art will understand that the examples provided herein can be used to manipulate any recombinase sequence, to generate a modified recombinase which is expressed in eukaryotic, but not prokaryotic cells, for example using standard methods known to one skilled in the art (Sambrook et al. In: Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989).

For example, the modified ere recombinase sequences disclosed herein can be modified, yet still retain the functional characteristic of a modified recombinase, the ability to be expressed in eukaryotic, but not prokaryotic cells. In one embodiment, a modified recombinase comprises at least 100 nucleotides having at least 70%, 80%, 85%, 90%, 92%, 95%, 97%, 98%, or 99% identity to SEQ ID NO: 25,26 or 27. In another embodiment, a modified recombinase contains the sequence

disclosed in SEQ ID NO: 25,26 or 27. In yet another embodiment, the a modified recombinase contains at least 50 nucleotides, such as at least about 60,70,80,90,96,100,250, or 600 nucleotides, that hybridize with a complement of a SEQ ID NO: 25,26 or 27, wherein hybridization conditions comprise wash conditions of 0.1 X SSC, 0.5% SDS at 62°C.

Nucleic Acids in a Vector The nucleic acids herein disclosed can be in any vector known to one skilled in the art.

Vectors achieve the basic goal of delivering into the target cell the nucleic acid sequence and control elements needed for transcription. The vector can be a non-viral or viral vector. The vector chosen may depend on the cell or subject in which nucleic acid expression is desired.

Non-Viral Vectors The nucleic acids sequences disclosed herein can be ligated into non-viral vectors, such as bacterial expression vectors. Methods and vectors are described in Sambrook et aL (Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989, herein incorporated by reference).

Vector systems suitable for the nucleic acids of the present disclosure include, but are not limited to: the pUR series of vectors (Ruther and Muller-Hill, EMBO J. 2: 1791,1983), pEXl-3 (Stanley and Luzio, EMBO J. 3: 1429,1984), pMR100 (Gray et al., Proc. Natl. Acad. Sci. USA 79: 6598,1982,), pKC30 (Shimatake and Rosenberg, 1981, Nature 292: 128), pKK177-3 (Amann and Brosius, Gene 40 : 183,1985) andpET-3 (StudiarandMoffatt, J. Mol. BioL 189: 113,1986), pMAM- neo (Clontech), pSVL (Amersham Pharmacia Biotech, Piscataway, NJ), pBPV (Amersham Pharmacia Biotech), pMSG (Amersham Pharmacia Biotech), or any other commercially available expression vector. The nucleic acids disclosed herein can also be cloned into other cloning vehicles, such as other plasmid vectors, bacteriophages, cosmids, and yeast artificial chromosomes (YACs) (Burke et al., Science 236: 806-12,1987). Vectors containing the nucleic acids herein disclosed can be introduced into a variety of cells or into a whole organism such as bacteria, fungi (Timberlake and Marshall, Science 244: 1313-7,1989), invertebrates, plants (Gasser and Fraley, Science 244: 1293, 1989), andmammals (Purseletal., Science 244: 1281-8,1989), thereby rendering the resulting cell or organism transgenic.

For expression in mammalian cells, nucleic acids can be introduced into mammalian cells, such as a mouse, monkey, or human cell, to achieve transient or long-term expression (Gluzman, Cell 23: 175-82,1981). The stable integration of a nucleic acid can be maintained in mammalian cells by biochemical selection, such as neomycin (Southern and Berg, J. Mol. Appl. Genet. 1: 327-41,1982) and mycophoenolic acid (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78: 2072-6,1981).

Nucleic acid sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence-

alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with PCR.

The nucleic acids disclosed herein can be introduced into eukaryotic expression vectors by conventional techniques. These vectors permit the transcription of the cDNA eukaryotic cells by providing regulatory sequences that initiate and enhance the transcription of the cDNA and ensure its proper splicing and polyadenylation. Vectors containing the promoter and enhancer regions of the SV40 or long terminal repeat (LTR) of the Rous Sarcoma virus and polyadenylation and splicing signal from SV40 can be used (Mulligan and Berg, Proc. Natl. Acad. Sci. USA 78: 2072-6,1981; German et al., Proc. Natl. Acaa7. Sci USA 78: 6777-81,1982). The level of expression can be manipulated by using promoters that have different activities (for example, the baculovirus pAC373 can express cDNAs at high levels in S. frugiperda cells (Summers and Smith, Genetically Altered Viruses and the Environment, Fields et aL (Eds.) 22: 319-328, Cold Spring Harbor Laboratory Press, Cold Spring Harbor, New York. 1985) or using vectors that contain promoters amenable to modulation, for example, the glucocorticoid-responsive promoter from the mouse mammary tumor virus (Lee et al., 1982, Nature 294 : 228). The expression of the cDNA can be monitored in the recipient cells 24 to 72 hours after introduction (transient expression).

In addition, vectors can contain selectable markers such as the gpt (Mulligan and Berg, 1981, Proc. Natl. Acad. Sci. USA 78: 2072-6) or neo (Southern and Berg, 1982, J. Mol. Appl. Genet.

1 : 327-41) bacterial genes. Selectable markers permit selection of transfected cells that exhibit stable, long-term expression of the vector. The vectors can be maintained in the cells as episomal, freely replicating entities by using regulatory elements of viruses such as papilloma (Sarver et al., 1981, Mol. CellBiol. 1: 486) or Epstein-Barr (Sugden et al., 1985, Mol. CellBiol. 5: 410). Alternatively, one can also produce cell lines that have integrated the vector into genomic DNA. Both of these types of cell lines produce the transgene product on a continuous basis. One can also produce cell lines that have amplified the number of copies of the vector (and therefore of the transgene as well) to create cell lines that can produce high levels of the transgene product (Alt et al., 1978, J. Biol. Chem.

253: 1357).

The transfer of nucleic acids into eukaryotic, such as human or other mammalian cells, is a conventional technique. The vectors can be introduced into a recipient cells as pure DNA (transfection) by, for example, precipitation with calcium phosphate (Graham and vander Eb, 1973, Virology 52: 466) or strontium phosphate (Brash et al., 1987, Mol. Cell Biol. 7: 2013), electroporation (Neumann et al., 1982, EMBO J. 1: 841), lipofection (Felgner et aL, 1987, Proc. Natl. Acad. Sci USA 84: 7413), DEAE dextran (McCuthan et al., 1968, J. Natl. Cancerlnsí 41 : 351), micromjection (Mueller et al., 1978, Cell 15 : 579), protoplast fusion (Schafner, 1980, Proc. Natl. Acad. Sci. USA 77: 2163-7), or pellet guns (Klein et al., 1987, Nature 327: 70).

Viral Vectors The nucleic acids disclosed herein can be in a viral vector. Viral vectors include any viral vector known to one skilled in the art, including, but not limited to: retroviruses (Bernstein et aL, 1985, Gen. Engrg. 7: 235), adenoviruses (Ahmad et aL, 1986, J. ViroL 57: 267), or Herpes virus (Spaete et aL, 1982, Cell 30 : 295). In one embodiment, the vector is incorporated in a viral particle.

In another embodiment, the vector is not replication competent in a mammalian cell.

Adenoviral vectors can include essentially the complete adenoviral genome (Shenk et al., CM Top. MicrobioL Immu7701. 111: 1-39,1984). Alternatively, an adenoviral vector is a modified adenoviral vector in which at least a portion of the adenoviral genome has been deleted. In one embodiment, the vector includes an adenoviral 5'ITR; an adenoviral 3'ITR; an adenoviral encapsidation signal; a nucleic acid sequence containing at least one flanked transgene, such as a therapeutic or marker gene; and a promoter. In another embodiment, the nucleic acid also includes a modified recombinase. The vector is free of at least the majority of adenoviral E1 and E3 DNA sequences, but is not necessarily free of all of the E2 and E4 DNA sequences, and DNA sequences encoding adenoviral proteins transcribed by the adenoviral major late promoter. In another embodiment, the vector may be an adeno-associated virus (AAV) such as described in U. S. Patent No. 4,797,368 (Carter et al.) and in McLaughlin et al. (J. ViroL 62: 1963-73,1988) and AAV type 4 (Chiorini et al. J. Vi. roL 71: 6823-33,1997) and AAV type 5 (Chiorini et aL J ViroL 73: 1309-19, 1999).

Such a vector may be constructed according to standard techniques, using a shuttle plasmid which contains, beginning at the 5'end, an adenoviral 5'ITR, an adenoviral encapsidation signal, and an Ela enhancer sequence; a promoter (which can be an adenoviral promoter or a foreign promoter); a tripartite leader sequence, a multiple cloning site; a poly A signal; and a DNA segment which corresponds to a segment of the adenoviral genome. The DNA segment serves as a substrate for homologous recombination with a modified or mutated adenovirus, and may encompass, for example, a segment of the adenovirus 5'genome no longer than from base 3329 to base 6246. The vector can also include a selectable marker and an origin of replication. The origin of replication can be a bacterial origin of replication. A transgene encoding a therapeutic or marker polypeptide can be inserted into the multiple cloning site of the vector.

The vector can be used to produce an adenoviral vector by homologous recombination with a modified or mutated adenovirus in which at least the majority of the E1 and E3 adenoviral DNA sequences have been deleted. Homologous recombination can be effected through co-transfection of the plasmid vector and the modified adenovirus into a helper cell line, such as 293 cells, by CaP04 precipitation. Homologous recombination produces a recombinant adenoviral vector which includes DNA sequences derived from the shuttle plasmid between the Not I site and the homologous recombination fragment, and DNA derived from the E1 and E3 deleted adenovirus between the homologous recombination fragment and the 3'ITR.

In one embodiment, the adenovirus can be constructed using a yeast artificial chromosome (YAC) containing an adenoviral genome according to the method of Ketner et aL (Proc. NatL Acad.

Sci. USA, 91: 6186-90,1994), in conjunction with the teachings contained herein. In this embodiment, the adenovirus YAC is produced by homologous recombination in vivo between adenoviral DNA and YAC plasmid vectors carrying segments of the adenoviral left and right genomic termini. The nucleic acids disclosed herein then can be cloned into the adenoviral DNA.

The modified adenoviral genome then is excised from the adenovirus YAC to be used to generate adenoviral vector particles as hereinabove described.

In another embodiment, the viral vector is a retroviral vector. Retroviruses have a high efficiency of infection and stable integration and expression (Orkin et aL, Prog. Med. Genet. 7: 130- 42,1988). The nucleic acids herein disclosed can be cloned into a retroviral vector using standard molecular biology methods. Transgene expression can be driven from any promoter disclosed herein, for example the retroviral LTR (long terminal repeat). Examples of retroviral vectors which can be employed include, but are not limited to: Moloney Murine Leukemia Virus, spleen necrosis virus, Rous Sarcoma Virus, Harvey Sarcoma Virus, avian leukosis virus, human immunodeficiency virus, bovine leukaemia virus, myeloproliferative sarcoma virus, murine leukaemia virus, Mason-Pfizer monkey virus, human spumavirus, and mammary tumor virus, including any vector derived from such retroviruses. The vector is generally a replication defective retrovirus particle.

Retroviral vectors can be used to effect retroviral-mediated transgene transfer into eukaryotic cells. Retroviral vectors are generally constructed such that the majority of sequences coding for the structural genes of the virus are deleted and replaced by the nucleic acid sequences, such as those of the present disclosure. Most often, the structural genes (i. e., gag, pol, and env) are removed from the retroviral backbone using genetic engineering techniques known in the art, such as digestion with the appropriate restriction endonuclease or with Bal 31 exonuclease to generate fragments containing appropriate portions of the packaging signal.

Other viral transfection systems can also be utilized including vaccinia virus (Moss et aL, 1987, Annu. Rev. ImmunoL 5: 305-24), Bovine Papilloma virus (Rasmussen et aL, 1987, Methods Enzymol. 139: 642-54), members of the herpes virus group such as Epstein-Barr virus (Margolskee et al., MoL Cell. BioL 8: 2837-47,1988) or recombinant HSV, poxviruses (vaccinia) or a recombinant lentivirus (such as HIV). In addition, the use of RNA-DNA hybrid oligonucleotides, as described by Cole-Strauss et aL (Science 273: 1386-9,1996), can be utilized. This technique can allow for site- specific integration of cloned sequences, permitting accurately targeted gene replacement.

Transforming Cells with a Nucleic Acid The present disclosure teaches a cell infected with any nucleic acid disclosed herein. In specific non-limiting examples, the cell is a mammalian cell, such as a human or non-human mammalian cell, for example a mouse cell. In one example, a non-human mammalian cell is infected with any nucleic acid disclosed herein and the nucleic acid, such as a nucleic acid in a vector, is

integrated into the genome of the non-human mammalian cell, using methods known to one skilled in the art (Sambrook et aL In: Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York, 1989).

Also disclosed herein is a method for transforming a cell in vitro, ex vivo, or in vivo by contacting a cell with a nucleic acid of the present disclosure, wherein the nucleic acid contains a transgene, and contact results in transducing the cell. In a particular example, the nucleic acid is in a vector, such as a viral vector, such as an adenoviral or retroviral vector. Viral vectors stably integrate into the cellular genome once introduced into a cell. In one example, the viral vector is not replication competent (replication defective) in a mammalian cell, such as a mouse or human cell. In another example, the nucleic acid of a viral vector is integrated into a chromosome of the cell. In yet another example, no other viral vector, such as a helper vector, is introduced into the cell.

The present disclosure provides a method for expressing one or more transgenes in vivo, such as in a cell, such as the cell of a subject, using the nucleic acids disclosed herein. In one example, the nucleic acids herein disclosed can be administered to a subject to alleviate the symptoms of or even treat a disease, such as chronic infectious diseases, such as HIV, as well as non-infectious diseases such as cancer and birth defects, such as genetic defects, such as enzyme deficiencies in a subject.

In one example, a nucleic acid of the present disclosure, such as a nucleic acid in a vector, is administered to a cell, such as the cell of a subject. Cells can be removed from a subject having deletions or mutations of a gene, and then a vector containing a therapeutic transgene (s) is introduced into the cell. These transfected cells will thereby produce functional transgene protein (s) and can be reintroduced into the patient. Methods described in U. S. Patent No. 5,162,215 (Bosselman et aL) teach how to detect the presence and expression of a transgene of interest in target cells. Methods described in U. S. Patent No. 5,741,486 (Pathak et aL) teach the use of viral vectors for transgene delivery. Such methods can be applied to the vectors of the present disclosure, for example in in vivo expression of a transgene.

In addition, vectors containing one or more transgenes can be introduced into a subject in vivo. The scientific and medical procedures required for mammalian cell transfection are now routine. For example, immunotherapy of melanoma patients using genetically engineered tumor- infiltrating lymphocytes (TILs) has been reported by Rosenberg et aL (N. Engl. J. Med. 323: 570-8, 1990). In that study, a retroviral vector was used to introduce a gene for neomycin resistance into TILs. A similar approach can be used to introduce a transgene into a subject using the vectors disclosed herein.

In some examples, the present disclosure relates to a method of treating a subject which underexpresses a gene, or in which greater expression of a gene is desired. These methods can be accomplished by introducing a transgene coding for the underexpressed gene into a vector, such as a viral vector, which is subsequently introduced into the subject. A general strategy for transferring transgenes into a cell is disclosed in U. S. Patent No. 5,529,774, incorporated by reference. Generally,

a transgene is cloned into a viral vector, which is introduced into the target organism. The virus infects the cells, and produces the protein sequence ira vivo, where it has its desired therapeutic effect.

See, for example, Zabner et aL (Cell 75 : 207-16,1993). In other examples, the present disclosure relates to a method of treating a subject which overexpresses a gene, or in which decreased expression of a gene is desired. These methods can be accomplished by introducing a transgene including an antisense sequence of the overxpressed gene into a vector, such as a viral vector, which is subsequently introduced into the subject as described above.

In some of the foregoing examples, it may only be necessary to introduce the nucleic acids into only certain cells or tissues. However, in some instances (i. e. tumors), it may be more therapeutically effective and simple to treat all of a subject's cells, or more broadly disseminate the vector, for example by intravascular administration.

Vectors can be administered to a subject by any method which allows the vectors to reach the appropriate cells. These methods include injection, infusion, deposition, implantation, or topical administration. Injections can be intradermal or subcutaneous.

In addition, vectors can be designed to use different promoters to express a transgene (s). In one embodiment, a retroviral LTR sequence can serve as a promoter for expression of the transgene.

Thus, in one example, a therapeutic nucleic acid is placed under the control of a retroviral LTR promoter. In another embodiment, the transgene is operatively linked to a heterologous promoter (e. g. a CMV promoter). In yet another embodiment, the transgene is operatively linked to a tissue- specific promoter (e. g. an immunoglobulin promoter or a probasin promoter), such that the expression of the transgene occurs only in a tissue of interest. Other suitable promoters which can be employed include, but are not limited to, the gene's native promoter, any retroviral LTR promoter such as the RSV promoter; inducible promoters, such as the MMTV promoter; the metallothionein promoter; heat shock promoters; the albumin promoter; the histone promoter; the a-actin promoter; TK promoters ; B 19 parvovirus promoters; the ApoAI promoter; and hormone-inducible promoters.

However the scope of the disclosure is not limited to specific transgenes or promoters.

Ex Vivo Transfection of Cells Ex vivo methods for introducing a nucleic acid involve removing a cell or tissue (such as a graft) from a subject and subsequently transducing the cell ex vivo, and then introducing the cell into the subject. For example, a nucleic acid of the present disclosure can be used to treat autologous cells isolated from a subject. In one embodiment, the cells are obtained or cultured from a subject such as lymphocytes, macrophages or stem cells. Alternatively, the cells can be heterologous cells such as those stored in a cell bank (e. g., a blood bank).

In one embodiment, the cells are T cells. Several techniques are known for isolating T cells.

In one method, Ficoll-Hypaque density gradient centrifugation is used to separate PBMC from red blood cells and neutrophils according to established procedures. Cells are washed with modified AIM-V (which consists of AIM-V (GIBCO) with 2 mM glutamine, 10 llg/ml gentamicin sulfate, 50

ug/ml streptomycin supplemented with 1% FBS). Enrichment for T cells is performed by negative or positive selection with appropriate monoclonal antibodies coupled to columns or magnetic beads according to standard techniques. An aliquot of cells is analyzed for desired cell surface phenotype (e. g., CD4, CD8, CD3, CD 14, etc.). Transduced cells are prepared for reinfusion according to established methods. See, Abraharnsen et al., J. Clin. Apheresis 6: 48-53,1991; Carter et al., J. Clin.

Arpheresis 4 : 113-7,1988; Aebersold et al., J. Immunol. Methods 112: 1-7,1988; Muul et al., J.

Immunol. Methods 101 : 171-81,1987; and Carter et al., Transfusion 27 : 362-5,1987).

In another example, a nucleic acid of the present disclosure can be used to treat a heterologous graft which is then transplanted into a subject. For example, a viral vector can be used to infect a liver, which is subsequently transplanted into a subject requiring a liver transplant. In other non-limiting embodiments, the graft is a bone marrow graft, lung graft, heart graft, bone graft, or vascular graft.

In Vivo Transfection of Cells Viral particles containing a viral vector including at least one transgene encoding a therapeutic or marker protein (s) can be administered directly to a subject for transduction of cells in vivo. Administration is by any of the routes normally used for introducing a molecule into cells. The packaged nucleic acids are administered in any suitable manner, such as with pharmaceutically acceptable carriers. Suitable methods of administering such packaged nucleic acids in the context of the present disclosure to a subject are available, and although more than one route can be used to administer a particular composition, a particular route can often provide a more immediate and more effective reaction than another route.

In determining the effective amount of a vector to be administered in the treatment of a disease, the physician or other clinician evaluates symptom or clinical parameters, including the progression of the disease (and other factors listed above). In general, the dose equivalent of a naked nucleic acid from a vector is from about 1 llg to 100 jig for a typical 70 kilogram subject.

Viral particles are administered in an amount effective to produce a therapeutic effect in a subject. The exact dosage of viral particles to be administered is dependent upon a variety of factors, including the age, weight, and sex of the subject to be treated, and the nature and extent of the disease or disorder suffered by the subject. Viral particles can be administered as part of a preparation having a titer of viral particles of at least 1 x 10'°pfu/ml, and in general not exceeding 2 x 10Il pfu/ml. Viral particles can be administered in combination with a pharmaceutically acceptable carrier in a volume up to 10 ml.

Methods for Transgene Expression Using the nucleic acid sequences and vectors disclosed herein, methods are provided for transgene expression. In one example, a cell, such as a eukaryotic or prokaryotic cell, is transfected with a nucleic acid of having a first transgene flanked by a recombining site (a flanked first

transgene), a second transgene which is out-of-frame to the nucleic acid of the first transgene, and wherein the flanked first transgene is within the coding sequence of the second transgene, and a promoter operably linked upstream of the first nucleic acid encoding the recombining site; and transfected with a nucleic acid having a tissue-specific promoter that controls expression of a recombinase, wherein expression of the recombinase results in expression of the second transgene. In an alternative example, the flanked first transgene is upstream (5') of the coding sequence of the second transgene, instead of within it (for example see FIGS. 3D and 4D). In one example, expression of the second transgene increases by at least 5-fold, for example by at least 10-fold, 14- fold or 15-fold, when compared to the expression of a control.

In other example a cell is transfected with a nucleic acid containing a modified recombinase (CREM); a nucleic acid containing a tissue-specific promoter which controls expression of a nucleic acid encoding a recombinase ; and with a nucleic acid of having a stop cassette flanked by a recombining site (a flanked stop cassette), a transgene encoding a therapeutic polypeptide or marker polypeptide out-of-frame to the nucleic acid sequence of the stop cassette and wherein the flanked stop cassette is within the coding sequence of the therapeutic or marker polypeptide, and a promoter operably linked 5'upstream of the first nucleic acid encoding the recombining site, wherein expressing the recombinase and modified recombinase results in expression of the therapeutic polypeptide or marker polypeptide. In one example, expression of the therapeutic polypeptide or marker polypeptide increases by at least 5-fold, for example by at least 7-fold, when compared to the expression of a control.

Also disclosed is a method for transgene expression by transfecting a cell with a nucleic acid having a first transgene flanked by a recombining site (a flanked first transgene), a second transgene out-of-frame to the nucleic acid sequence of the first transgene wherein the flanked first transgene is within the coding sequence of the second transgene, a promoter operably linked to a 5'portion of the first nucleic acid encoding the recombining site, a modified recombinase located 5'to the first transgene or 3'to the second transgene, a promoter operably linked to a 5'portion of the recombining site, and a promoter operably linked to the 5'portion of the modified recombinase, and an insulator nucleic acid sequence located between a 3'end of the modified recombinase and the promoter operably linked to a 5'portion of the recombining site, wherein transfection of this nucleic acid results in expression of a nucleic acid encoding the second transgene. In one example, expression of the second transgene increases by at least 100-fold, for example by at least 300-fold, when compared to the expression of a control.

Also disclosed are cells tranfected with a vector which includes an LBD fused in-frame to the 3'end of cre recombinase (such as CREM). In such cells, cre-recombinase activity is generally suppressed unless an appropriate ligand is added. The ligand binds to a wild-type LBD or to a mutant LBD, depending upon the specificity of the particular form of the LBD. When a ligand binds to the LBD, a conformational change in the LBD may occur that allows the cre-recombinase to become active. Depending upon the particular LBD used and whether it has been mutated, naturally-occuring

ligands or antagonists, or synthetic ligand agonists or antagonists may activate a particular LBD.

This allows one to attach various LBDs to cre to induce or suppress cre activity when appropriate ligands are added. In one example, expression of a second transgene increases by at least 5-fold, for example by at least 10-fold, or example by at least 14-fold when compared to the expression of a control.

Control expression can be determined using any method known to one skilled in the art. In one example, control expression is the level of transgene expression, such as a therapeutic or marker polypeptide, under control of a tissue-specific promoter. In another embodiment, control expression is the level of tissue-specific expression of a second transgene.

Also disclosed herein is a method for producing a nucleic acid having both a modified recombinase and a recombining site, in a prokaryotic cell, such as a bacterial cell. In one embodiment, a cell is transfected with a nucleic acid of having a first transgene flanked by a recombining site (a flanked first transgene), a second transgene which is out-of-frame to the nucleic acid of the first transgene wherein the flanked first transgene is within the coding sequence of the second transgene, a promoter operably linked to a 5'portion of the first nucleic acid encoding the recombining site, and a modified recombinase located 5'to the nucleic acid comprising the first transgene or 3'to the nucleic acid comprising the second transgene, such that the modified recombinase is not expressed in the prokaryotic cell. This permits the nucleic acid having both a modified recombinase and a recombining site to be replicated in prokaryotic cells. In one embodiment, the nucleic acid is in a vector, for example a plasmid, which can be replicated in prokaryotic cells. Introduction of a nucleic acid having both a modified recombinase and a recombining site into eukaryotic cells results in recombination at the recombining site, and expression of the second transgene.

In an alternate embodiment, the flanked stop cassette is located upstream (5') of the second transgene, and the flanked stop cassette sequence and the coding sequence of the second transgene can be in-frame or out-of-frame.

The methods herein disclosed also provide for expressing a transgene in a eukaryotic cell by introducing into the cell a nucleic acid having a first domain and a second domain. The first domain contains a 5'and a 3'portion of a recombinase, with an at least partial intron nucleic acid sequence is located between the 5'and 3'portion of the recombinase, generating a modified recombinase, and a promoter operably linked to a 5'portion of the recombinase. The second domain contains a stop codon flanked by a recombining site. The recombining site has a first and second end, with a promoter operably linked to the first end. A transgene is located 3'to the second end. Introduction results in expression of the modified recombinase and recombination of the recombining site, such that the transgene is expressed.

In one embodiment, the nucleic acid of the first transgene is a stop cassette, the second transgene encodes for a marker polypeptide or therapeutic polypeptide, and the promoter is a strong promoter, such as CMV.

Therapeutic Uses The nucleic acid sequences of the present disclosure can be introduced into a cell, using methods known to those skilled in the art, for example using vectors (Sambrook et al. In: Molecular Cloning : A Laborato7y Manual, Cold Spring Harbor, New York, 1989). The transfer of nucleic acids, such as a transgene, into a cell provides a means to determine gene function. In another embodiment, the transfer of nucleic acids can be used to alleviating the symptoms of, treat, or prevent diseases of a genetic basis. In addition, gene transfer provides the basis for high-level protein expression, used by molecular researchers to study protein function and to produce new protein drugs. The introduction of genes into animals, such as mice, can also produce useful animal models of human diseases.

A method for preventing, alleviating the symptoms of, preventing, or treating a disease in a subject is also disclosed. The method involves introducing into a subject's cell a therapeutically effective amount of a nucleic acid disclosed herein, such as a nucleic acid in a vector, such as a viral vector, wherein the nucleic acid contains at least one transgene, introduction results in the stable genetic transduction of the cell and expression of at least one transgene, and the transgene expression results in alleviating a symptom of the disorder or preventing the disorder. In specific non-limiting examples, disorder is a neurological, immunological, cardiovascular, muscular, cell proliferative, or genetic disorder. In other embodiment, the disorder is a cancer. The nucleic acid can be introduced into a subject's cells ex vivo and the cells reintroduced into the subject. Subjects of the present disclosure include mammals, such as humans and mice.

In another embodiment the method involves contacting a cell of the subject with an therapeutically effective amount of any viral vector disclosed herein, that is replication-defective and contains a transgene. Contact results in the viral vector integrating into a chromosome of the cell and expressing the transgene in the cell, wherein the cell is not contacted with any other virus, and the expression of the transgene treats, alleviates, or prevents a disease in the subject. In one embodiment the transgene is a therapeutic polypeptide or an antisense sequence.

Also encompassed by the present disclosure is a method for preventing, alleviating the symptoms of, or treating disorder in a subject by contacting a cell of the subject with a therapeutically effective amount of a nucleic acid having a flanked first transgene located within the coding sequence of a second transgene, wherein the second transgene is out-of-frame to first transgene. In addition, the vector is replication defective and contact results in stable genetic transformation of the cell and expression of the first or second transgene in the cell, and expression of the first or second transgene results in alleviating a symptom of, treating, or preventing the disorder.

In another embodiment, the nucleic acids disclosed herein can be used for short-term (for example for immunization) and long-term (for example for gene replacement therapy for missing or defective genes) expression of a transgene.

Also provided herein are pharmaceutical compositions containing any of the nucleic acids or vectors disclosed herein, and a pharmaceutically acceptable carrier.

Testing Nucleic Acids in Disease Models The nucleic acids described herein, such as viral vectors, can be tested for their ability to express at least one transgene in vivo, using animal models which have been generated for various diseases, or to produce new animal disease models.

A nucleic acid can be introduced into any organism whose genome has been altered by in vib o manipulation of the early embryo or fertilized egg or by any transgenic technology to induce a specific gene knockout. A gene knockout is the targeted disruption of a gene in vivo with complete loss of function that has been achieved by any transgenic technology familiar to those in the art. In one embodiment, transgenic animals having gene knockouts are those in which the target gene has been rendered nonfunctional by an insertion targeted to the gene to be rendered nonfunctional by homologous recombination. The nucleic acids of the present disclosure which include a recombinase and a recombination site in cis can be introduced into an animal produced by any transgenic technology, using any method known to one of skill in the art.

In another embodiment, the nucleic acids of the present disclosure can be used to transform mouse embryos. Transgenic animals can be produced by introducing into embryos (e. g. a single celled embryo) a vector of the present disclosure, in a manner such that the polynucleotides are stably integrated into the DNA of germ line cells of the mature animal and inherited in normal Mendelian fashion. Advances in technologies for embryo micromanipulation now permit introduction of heterologous DNA into fertilized mammalian ova. For instance, totipotent or pluripotent stem cells can be transformed by microinjection, calcium phosphate mediated precipitation, liposome fusion, viral infection or other means disclosed herein or known to one skilled in the art, the transformed cells are then introduced into the embryo, and the embryo then develops into a transgenic animal. In one embodiment, developing embryos are infected with a vector containing a desired flanked transgene and a recombinase in cis, and transgenic animals produced from the infected embryo. In another embodiment, a vector containing a desired flanked transgene and a recombinase in cis, are injected into the pronucleus of a single-cell embryo, using microinjection methods known by those skilled in the art, and transgenic animals produced from the injected embryo.

For example, mice which are functionally deleted for a gene are infected with a viral vector containing a transgene designed to complement the gene deficiency. Mice are then screened for their ability to express the missing gene as a transgene, and for the ability of the transgene to correct the phenotypic affect of the gene deletion. In one embodiment, the nucleic acid contains a transgene is flanked by a recombination site, such as a fLOXed transgene, and a recombinase, such as cre in cis.

Mice are then screened for their ability to express the transgene, and the ability of the transgene to correct the phenotypic affect of the gene deletion.

In one method DNA is injected into the pronucleus or cytoplasm of embryos, preferably at the single cell stage, and the embryos allowed to develop into mature transgenic animals. These techniques are well known. For instance, reviews of standard laboratory procedures for microinjection of heterologous DNAs into mammalian (such as mouse, pig, rabbit, sheep, goat, cow) fertilized ova include: Hogan et al., Manipulating the Mouse Embryo, Cold Spring Harbor Press, 1986; Krimpenfort et aL, BiolTeclzfaology 9: 86,1991; Palmiteretal., Cell 41 : 343,1985; Kraemer et al., Genetic Manipulation of the Early Mammalian Emb7yo, Cold Spring Harbor Laboratory Press, 1985; Hammer et al., Nature, 315: 680,1985; Purcel et al., Science, 244: 1281,1986; Wagner et al., U. S. Patent No. 5,175,385; Krimpenfort et aL, U. S. patent No. 5,175,384, the respective contents of which are incorporated by reference.

The nucleotide sequence of interest can be fused in proper reading frame under the transcriptional and translational control of a promoter to produce a genetic construct. The genetic construct is then amplified, for example, by preparation in a bacterial vector, according to conventional methods. See, for example, the standard work: Sambrook et al., Molecular Cloning : a Laboratory Manual, Cold Spring Harbor Press, 1989, the contents of which are incorporated by reference. The amplified construct is thereafter purified for use in producing transgenic animals.

Disruption of Gene Expression The nucleic acids disclosed herein, such as a nucleic acid in a vector, can be used to disrupt gene expression in a cell. In one embodiment, the transgene present in a nucleic acid of the present disclosure is an antisense molecule, which disrupts expression of a target gene. In general, an antisense molecule binds complementarily to a target nucleic acid, such as a target gene.

Complementary binding occurs when the base of one molecule forms a hydrogen bond with another molecule. Normally the base adenine (A) is complementary to thymidine (T) and uracil (U), while cytosine (C) is complementary to guanine (G). Therefore, the sequence 5'-TCGT-3'of the antisense molecule will bind to ACUC of the target RNA, or 5'-ACTC-3'of the target DNA. Additionally, in order to be effective, the antisense and sense molecules do not have to be 100% complementary to the target RNA or DNA. In some embodiments, the antisense molecules are at least 60%, 70%, 80%, 90%, 95% or 99% complementary to the target nucleic acid.

To design antisense oligonucleotides, the mRNA sequence from a target nucleic acid is examined. Regions of the sequence containing multiple repeats, such as TTTTTTTT, are not as desirable because they will lack specificity. Several different regions of a target nucleic acid can be chosen. Of those, oligonucleotides are selected by the following characteristics: those having the best conformation in solution; those optimized for hybridization characteristics; and those having less potential to form secondary structures. Antisense molecules having a propensity to generate secondary structures are less desirable.

Antisense nucleic acids are polynucleotides, and can be oligonucleotides (ranging from 6 to about 100 oligonucleotides). In some embodiments, the oligonucleotide is at least about 10,15, or

100 nucleotides, or a polynucleotide of at least 200 nucleotides. However, an antisense nucleic acid can be much longer. Generally, a longer complementary region will give rise to a molecule with higher specificity. When a nucleic acid containing a therapeutic antisense molecule is introduced into a cell, the cell supplies the necessary components for transcription of the therapeutic antisense molecule.

The nucleotide can be modified at the base moiety, sugar moiety, or phosphate backbone, and can include other appending groups such as peptides, or agents facilitating transport across the cell membrane (Letsinger et al., Proc. AM. Acad. Sci. USA, 86: 6553-6,1989; Lemaitre et al., Proc.

Natl. 4cad. Sci. USA 84: 648-52,1987; PCT Publication No. WO 88/09810) or blood-brain barrier (PCT Publication No. WO 89/10134), hybridization triggered cleavage agents (Krol et al., BioTechniques 6: 958-76,1988) or intercalating agents (Zon, Phare. Res. 5: 539-49,1988).

The antisense polynucleotide can be modified at any position on its structure with substituents generally known in the art. For example, a modified base moiety can be 5-fluorouracil, 5-bromouracil, 5-chlorouracil, 5-iodouracil, hypoxanthine, xanthine, acetylcytosine, 5- (carboxyhydroxylmethyl) uracil, 5-carboxymethylaminomethyl-2-thiouridine, 5- carboxymethylaminomethyluracil, dihydrouracil, beta-D-galactosylqueosine, inosine, N-6- sopentenyladenine, 1-methylguanine, 1-methylinosine, 2,2-dimethylguanine, 2-methyladenine, 2- methylguanine, 3-methylcytosine, 5-methylcytosine, N6-adenine, 7-methylguanine, 5- methylaminomethyluracil, methoxyarninomethyl-2-thiouracil, beta-D-mannosylqueosine, 5'- methoxycarboxymethyluracil, 5-methoxyuracil, 2-methylthio-N6-isopentenyladenine, uracil-5- oxyacetic acid, pseudouracil, queosine, 2-thiocytosine, 5-methyl-2-thiouracil, 2-thiouracil, 4- thiouracil, 5-methyluracil, uracil-5-oxyacetic acid methylester, uracil-S-oxyacetic acid, 5-methyl-2- thiouracil, 3- (3-amino-3-N-2-carboxypropyl) uracil, and 2,6-diaminopurine.

In another embodiment, the polynucleotide includes at least one modified sugar moiety such as arabinose, 2-fluoroarabinose, xylose, and hexose, or a modified component of the phosphate backbone, such as phosphorothioate, a phosphorodithioate, a phosphoramidothioate, a phosphoramidate, a phosphordiamidate, a methylphosphonate, an alkyl phosphotriester, or a formacetal or analog thereof.

Catalytic nucleic acid and other oligomeric molecules can be designed which degrade target sequences and included in a vector of the disclosure. Such catalytic antisense molecules can contain complementary regions that specifically hybridize to the target sequence, and non-complementary regions which typically contain a sequence that gives the molecule its catalytic activity. Conjugates of antisense with a metal complex, e. g. terpyridylCu (II), capable of mediating mRNA hydrolysis, are described in Bashkin et al., AppL Bioche7n Biotechnol. 54: 43-56,1995.

A particular type of catalytic nucleic acid antisense molecule is a ribozyme or anti-sense conjugates, which may be used to inhibit gene expression. (PCT publication WO 9523225, and Beigelman et aL Nucl. Acids Res. 23: 4434-42,1995). Examples of oligonucleotides with catalytic activity are described in WO 9506764, WO 9011364, and Sarver et al., Science 247: 1222-5,1990.

The relative ability of an oligomer such as a polynucleotide to bind to a complementary strand is compared by determining the Tm of a hybridization complex of a polypeptide and its complementary strand. The T,,,, denotes the temperature in degrees Centigrade at which 50% helical versus coiled (unhybridized) forms are present. Base stacking, which occurs during hybridization, is accompanied by a reduction in LTV absorption (hypochromicity). A reduction in W absorption indicates a higher Tm. The higher the Tm the greater the strength of the binding of the hybridized strands. As close to optimal fidelity of base pairing as possible achieves optimal hybridization of a polynucleotide to its target RNA.

Gene expression levels can be downregulated by the various antisense methods disclosed herein, and those known to one skilled in the art. Disruption of gene expression can be used prophylactially, for example to inhibit or prevent progression of a disease in which expression of a particular gene is not desired. Such administration is indicated where the disruption of gene expression is shown to have utility for treatment or prevention of the disorder. The prophylactic use is indicated in conditions known or suspected of preceding progression to diseases associated with an undesired amount of gene expression.

EXAMPLE 1 Frame-Shift Vectors for Selective Transgene Expression The regulation of gene expression using cre/LOX technology has previously relied on the use of either a fLOXed"stop cassette"inserted into the 5'untranslated region (5'UTR) of the gene of interest (Lakso et al., Proc. Natl. Acad. Sci. U. S. A 89: 6232-6,1992; andTsienetal., Cell 87 : 1317- 26,1996) or a fLOXed gene cassette upstream of a second gene to be expressed (Lobe et al., Dev.

BioL 208: 281-92,1999; and Orban et al., Proc. Natl. Acad. Sci. U. S. A 89: 6861-5,1992). In the later case, the second gene of interest is out of frame for proper translation and is therefore not expressed. In the presence of ere recombinase (cre), the fLOXed gene or stop cassette is removed allowing the downstream gene of interest to be expressed. However, due to occasional read-through of transcription and protein translation despite the stop cassette, even in the absence of cre, detectable background levels of downstream gene expression have been observed. Thus, highly transforming genes or genes whose biologic activity only requires very low levels of expression can still be transcribed despite the presence of the stop cassette leading to unwanted biological activities.

To overcome this limitation, a novel vector was developed in which the switch in expression from one gene to another was achieved by altering the translational reading frame upon recombination of recombining sites, such as LOX sites, in the presence of a recombinase, such as a cre recombinase.

To prevent downstream gene expression in the absence of a recombinase such as cre, a novel vector system was developed. In this system, the expression of one transgene,"transgene 1" (TG 1), is selectively turned off with the simultaneous activation of another gene"transgene 2" (TG 2), by placing fLOXed transgene 1 within the coding sequence of transgene 2 whose nucleotide

sequence is out-of-frame to transgene 1 (FIGS. 3A-3C). As demonstrated below, this arrangement results in appropriate translation of transgene 1, but not transgene 2 in the absence of cre. In the presence of cre, transgene 1 is excised and the correct reading frame of transgene 2 restored, resulting in transgene 2 expression.

An exemplary construct containing an SV40 promoter-driven plasmid containing fLOXed EGFP (transgene 1) inserted into a Lac Z (transgene 2) reading frame, which encodes P-galactosidase (P-gal), was developed as follows. Plasmid pEGFP-CI (Clontech, Palo Alto, CA) was digested with Bgl II/Bam HI and religated. Synthetic oligonucleotides 5' CTAGCGGTACCGATAACTTCGTATAGCATACATTATACGAAGTTATCA 3' (SEQ ID NO: 1) and 5'CCGGTGATAACTTCGTATAATGTATGCTATACGAAGTTATCGGTACCG 3' (SEQ ID NO: 2), designed to contain a LOX site flanked by 5'Nhe I and Kpn I sites and a 3'Age I site, were cloned into the Nhe I and Age I sites of the modified pEGFP-CI vector resulting in plasmid p 138. A second set of synthetic oligonucleotides 5' CGCGTATAACTTCGTATAGCATACATTATACGAAGTTATCGGTACCACTAC 3' (SEQ ID NO: 3) and 5'GTGGTACCGATAACTTCGTATAATGTATGCTATACGAAGTTATA 3' (SEQ ID NO: 4) containing the recognition sequence for LOX flanked by Mlu I at the 5'portion and Kpn I and Dra III at the 3'portion, were inserted into the Mlu I and Dra III sites of pl38 resulting in the generation of pl42 in which EGFP is flanked by LOX sites. The fLOXed EGFP cassette was removed from pl42 by digestion with Kpn I and cloned into the Kpn I site of pSV-P-Galactosidase (Promega, Madison WI) resulting in pSV-EGFP/ß-gal (FIG. 3B).

As shown in FIG. 3B, the translational start site and first 18 amino acids of E. coli GPT (5' portion of gpt) are upstream of the fLOXed EGFP followed by E. coli gpt amino acids 19-47 (3' portion of gpt) fused in-frame to P-gal. To maintain the open reading frame between gpt and EGFP but disrupt the reading frame of 0-gal, an additional cytosine was added at the 3'end of LOX I. The insertion of this cytosine also resulted in the generation of a translational stop codon upstream of the P-gal reading frame within the LOX II recognition sequence. The cre-mediated excision of the fLOXed EGFP restores the correct reading frame for P-gal.

Similar constructs were made using the CMV enhancer promoter (pCMV-EGFP/ßgal) or the CMV enhancer/ß-actin promoter (pCMV/ßAc-EGFP/ßgal) (FIG. 3C). The Stu I/Sal I fragment from pSV-EGFP/P-gal containing the fLOXed EGFP was removed and ligated into the Sma I/Sal I sites of pCMV-ß-gal (Clontech, Palo Alto, CA) resulting in pCMV-EGFP/P-gal containing the fLOXed EGFP gene switch cassette driven by the CMV promoter (FIG. 3C). A second construct utilizing the CMV enhancer/chicken ß-actin promoter was also generated. The Stu I/Sal I fragment containing the fl ; OXed EGFP/ß-gal from pSV-EGFP/ß-gal (FIG. 3B) was inserted into the Xho I site of pCAGGS (Niwa et al., Gene 108; 193-9,1991) resulting in pCMV/ßAc-EGFP/ß-gal (FIG 3C).

To determine the level of expression of gene 1 (EGFP) and gene 2 (0-gal) in the presence or absence of cre, CHO-K1 cells were transfected with pSV-EGFP/P-gal alone or with pCMV-cre and

analyzed as follows. CHO-KI cells (American Type Culture Collection (ATCC), Manassas, VA) were propagated in RPMI-1640 medium supplemented with 10% fetal calf serum (FCS) (Life Technologies, Rockville, MD), 1 mM sodium pyruvate, 10 mM Hepes buffer, 2 mM glutamine, 50 units/ml of penicillin G sodium and 50 ug/ml of streptomycin sulfate.

Cells were plated at a density of 1.5 x105 cells/well in 3 ml of culture media 24 hours prior to transfection using 6-well plates (Costar, Coming, NY). On the morning of transfection, 2 ml of fresh media supplemented with 4 nM of mibolerone (NEN, Boston, MS) was added to plates.

Transfections were performed one hour later with a total of 2 ig of plasmid DNA per 6 1ll of FUGEN TU 6 (Roche, Indianapolis, IN) in a total of 100 ul of transfection solution containing serum free culture media per well. Fresh media with mibolerone was added daily. Transfections were performed in triplicate and experiments repeated at least three times. Assays were performed 48 hours post-transfection. Cells were assayed for ß-galactosidase activity according to the manufacturer's instructions (Stratagene, #200384, LaJolla, CA). Cells were assayed for fluorescence using a Zeiss-G436 fluorescent microscope. EGFP was visualized using a 436 nm excitation, 510 nm emission, filter. RFP was visualized using a 546 nm excitation, 580 nm emission filter. Dual fluorescence was observed using a 460-490 nm, excitation, 510 nm emission filter.

Transfection of pSV-EGFP/ (3-gal alone (FIG. 3G) resulted only in EGFP expression; no background level ouf (3-gal expression was detected. However, co-transfection with pCMV-cre resulted in the excision of EGFP (and loss of EGFP expression) and the functional expression of LacZ, as detected by (3-gal expression. These results demonstrate that the frame-shift strategy for the tight regulation of switching gene expression is effective.

Since (3-gal activity cannot be assayed in vivo, reporter construct pCMV-EGFP/RFP (red fluorescent protein) was constructed. The Kpn I fragment from pSV-EGFP/ß-gal (FIG. 3B) containing the fLOXed EGFP cassette was cloned into the Kpn I site of pDSRedl-Nl (Clontech) upstream of (not within) the coding sequence for RFP resulting in pCMV-EGFP/RFP (p212) (FIG.

3D). Expression of EGFP and RFP can be assayed in vivo, for example, using fluorescence microscopy as described above.

CHO-KL cells were transfected with pCMV-EGFP/RFP in the absence or presence of pCMV-cre and assayed using fluorescence microcopy as described above. EGFP, but not RFP, was expressed in the absence of cre. However, in the presence of cre, the EGFP gene was excised and RFP expression detected.

EXAMPLE 2 Amplification of Gene Expression Using Alternate Promoters To increase expression levels while maintaining tissue-specificity, vectors which utilized the tissue-specific expression of cre in combination with the gene-switch approach described in EXAMPLE 1, as well as a gene activation approach under the transcriptional control of a strong, ubiquitously expressed promoter, was developed.

The 428-bp prostate-specific, androgen-responsive, probasin promoter was used to drive the expression of ere (pPr-cre). The gene-switch expression vectors described in EXAMPLE 1, employ the SV40 early region promoter or a strong CMV promoter to direct the expression of a gene (gene 2) only in the presence of ere. This example describes a vector which maintains tissue-specific expression of a desired gene, since ere is expressed under control of the tissue-specific probasin promoter, but amplifies the expression of the desired gene under transcriptional control of a CMV promoter.

To quantitate the change in gene expression that results from switching transcriptional regulation from a probasin promoter to a CMV enhancer/p-actin promoter (CMVe-ßAc), a series of luciferase reporter constructs were generated (FIGS. 4A-4E). An SV40 early promoter-STOP-luc vector was generated as follows. Oligonucleotides 5' CTAGGATAACTTCGTATAGCATACATTATACGAAGTTATA 3' (SEQ ID NO: 5) and 5' AGCTTATAACTTCGTATAATGTATG. CTATACGAAGTTATC 3' (SEQ ID NO: 6) containing a LOX site flanked by Avr II and Hind III sites were ligated to the Hind III-Avr II fragment of pGL-3 Control (Promega, Madison, WI). A 2.2 kb Sal I-Stu 1 fragment and 3 kb Sal I-Avr II fragment were separately isolated from the resulting plasmid. The Hind III (blunted)-Spe I fragment of plasmid p302 containing the STOP cassette (Life Technologies, Rockville, MD) was isolated. The three individual fragments described above were ligated to generate pSV-STOP-luc (FIG. 4B).

A CMVe-ßAc driven luciferase gene vector was generated as follows. The Sal I and Xho I fragment of pCAGGS containing the CMVe-ßAc transcriptional control unit was inserted into the Xho I site of pGL3-Basic (Promega, Madison, WI) to generate pCMVe-ßAc-luc (FIG. 4C).

A CMVe-ßAc driven luciferase reporter gene containing a fLOXed stop-cassette was generated as follows. pCMVe-ßAc-luc was digested with Bgl II, blunt-ended, and digested with Hind III. pSV-STOP-luc was digested with Stu I/Hind III and the fragment containing the fLOXed STOP cassette was isolated and cloned into the Hind III site of pCMVe-ßAc-luc m which the Bgl II site had been previously removed by blunt-ending. This resulted in pCMVe-ßAc-STOP-luc (FIG.

4D).

A probasin-luciferase reporter construct was generated as follows. Plasmid prPb-tva950 (Pam Schwartzenberg, NCI) was digested with Nde I, blunt-ended, and digested with Kpn I. The fragment containing the probasin promoter was isolated and cloned into the Sma I/Bgl II sites of pGL-3 Basic, resulting in pPr-luc (FIG. 4E).

To express murine androgen receptor, the vector pCMV-mAR was constructed as follows.

The cDNA for mouse androgen receptor was modified by PCR mutagenesis to place a Bgl II site 9 bp upstream of the ATG and the 2.8 kb Bgl II-Pst I fragment was inserted into the Bgl II-Pst I sites of pEGFP-Cl vector (Clontech, Palo Alto, CA) after which the EGFP coding sequence was removed by digestion with Age I and Bgl II which were blunt-ended and religated.

PC-3 cells (ATCC) were cultured as described in EXAMPLE 1, except that prior to transfection, the cells were trypsinized (Life Technologies, Rockville, MD), washed in culture media

and centrifuged at 190Xg for five minutes at room temperature (RT). Cells pellets were resuspended in lxPBS, centrifuged, and resuspended in RPMI 1640 without phenol red and supplemented with charcoal/dextran treated FCS (HyCLONE, Logan, UT).

PC-3 cells were co-transfected with pCMV-mAR to express murine androgen receptor and reporter construct pPr-luc (FIG. 4E) in the presence of the androgen analogue mibolerone (FIG. 4F).

In a parallel set of experiments, PC-3 cells were transfected with another construct, pCMVe-ßAc- STOP-luc in the presence or absence of pPr-cre. Following transfection (48 hours), cells were assayed for luciferase activity as follows. The Dual-Luciferase Tm Reporter assay system (Promega, Madison, WI) was used to determine activity of Firefly Luciferase (Plzotinus pyralisus) and sea pansy Renilla Luciferase (Renilla renifornais) according to the manufacturer's instructions. Cells were washed in IxPBS and 500 ul passive lysis solution was added per well. Lystate was collected after 15 minutes and centrifuged at 13,000 rpm for 30 seconds. The resulting supernatant (20 ul) was used for luciferase assays. InStatR (GraphPad Software Inc, San Diego, Ca) statistical package program was used for all statistical analysis described herein.

As shown in FIG. 4F, luciferase activity increased at least 15-fold when the pCMVe-#Ac- STOP-luc was activated in the presence of Pr-cre compared to the level of luciferase activity generated directly under the transcriptional regulation of the probasin promoter by pPr-luc. In the presence of pPr-luc alone, luciferase expression is controlled by the weak probasin promoter. This results in low levels of luciferase activity. In contrast, in the presence of pPr-cre with pCMVe-ßAc- STOP-luc, ere expression is driven by the weak probasin promoter. The resulting ere protein catalyzes recombination of the LOX sites within pCMVe-ßAc-STOP-luc, thereby removing the STOP cassette, allowing luciferase expression to be driven by the strong CMVe-ß actin promoter.

The resulting expression from this combination of vectors results in higher gene expression. These results demonstrate that gene expression can be amplified by using a weak, tissue-specific promoter to express a recombinase such as cre, which in turn allows the activation of transcription from a strong promoter which drives expression of a transgene.

EXAMPLE 3 Modification of cre recombinase for Expression in Eukaryotes but not Prokaryotes A major limitation of methodologies in the prior art using the cre/LOX system is that the cre and LOX sequences must be expressed on different vectors because if ere is expressed during amplification of the vector, the genetic material between the LOX sites is excised.

To prevent cre recombinase translation in bacteria, modifications were made to ere which allowed for its translation in eukaryotic, but not prokaryotic cells. A modified ere recombinase was developed as follows, and is outlined in FIG. 5. Plasmid pBS185 (Life Technologies, Rockville, MD) containing a CMV enhancer/promoter driving expression of wild-type cre was digested with EcoRI, partially digested with Hind III, blunt-ended and religated to remove a 1.0 kb fragment containing a KpnI site generating pCMV-Cre-del (FIG. 5A). Plasmid pCMV-Cre-del was digested

with XhoI and BssHII to remove a 5'region of cre. A 5'portion of cre was PCR amplified using oligo 5'CGCCAGAATTCCAAAATTTGCCTGCATTACCGGTCGATGCAACG 3' (SEQ ID NO: 7) and 5'GACCGCGCGCCTGCAGATATAGAAGATAATCGCGAACATCTT 3' (SEQ ID NO: 8) which contains an internal Pst I restriction site generated by a silent mutation. PCR was performed using 10-100 ng of DNA template, 1 mM MgS04, 0.3 mM dNTPs, 0.3 uM primers, and 1.25 units of PFX-polymerase (Life Technologies, Rockville, MD) in a total reaction volume or 50 ul.

Thermocycle parameters were: 94° C for 2 minutes, 50° C for 30 seconds, 68° C for 1 minute for 1 cycle, followed by 94° C for 15 seconds, 55° C for 30 seconds and 68° C for 1 minute for a total of 34 cycles. The resulting product was digested with EcoRI and BssHII.

The pCMV-Cre-del Xho I/BssH II fragment, cre amplification product and the synthetic double-stranded oligonucleotides 5' CTGAGCGGCCGCCTAGGCCCATGGCGAATTTACTGACGGTACCAG 3' (SEQ ID NO: 9) and 5'AATTCTGGTACCGTCAGTAAATTCGCCATGGCCTAGGCGGCCGC 3' (SEQ ID NO: 10) were ligated to form pCMV-Cre-K (FIG. 5B).

These modifications resulted in: shortening the 5'UTR from 484 to 19 bp (shortened 5'UTR not shown in FIGS. 5B-5E, but see for example FIG. 2A); an optimized Kozak translational start site (Kozak Nucleic, 4cids Res. 15: 8125-48, 1987) ; and the introduction of an EcoRI site at nucleotide (nt) 509 and a Pst I restriction site through a silent T to G mutation at nt 718 within the coding region of ere to allow for additional alterations of ere. These alterations resulted in amino acid changes as shown in FIG. 5B. The second amino acid was changed from Ser to Ala, the eighth amino acid was changed from His to Pro and codons for Glu and Phe were inserted at amino acid positions 9 and 10.

The resulting modified cre sequence is shown in SEQ ID NO: 25.

The human p-globin intron from plasmid pCI (Promega) was altered by PCR mutagenesis to place a PstI site at the 5'end and a BssHII site at the 3'end using PCR primers 5' GCGATCTGCAGGTAAGTATCAAGGTTACAAGACAGG 3' (SEQ ID NO: 11) and 5' ATATGCGCGCCTGTGGAGAGAAAGGCAAAGTGGAT 3' (SEQ ID NO: 12). SEQ ID NO: 11 contains a Pst I restriction site and the first 35 nucleotides of the p-globin intron (position 953 to 881 in pCI) and SEQ ID NO: 12 contains a BssH II restriction site and 26 nucleotides of the 3'portion of the (3-globin intron (position 890 to 965 in pCI). The modified human p-globin intron was PCR amplified using the conditions described above, and the resulting product cloned into the PstI/BssH II sites of pCMV-Cre-K to generate pCMV-CREM (FIG. 5C). The resulting modified cre sequence is shown in SEQ ID NO: 26.

An aliquot of plasmid pCMV-CREM was digested with Kpn I and another aliquot digested with EcoRI. Both aliquots were treated with calf intestinal alkaline phosphatase (CIP) and subsequently digested with ScaI. The Scal/Kpnl fragment containing the CMV promoter and 5' region of cre and the ScaI/EcoRI fragment containing the remaining portion of ere were isolated and ligated with a phosphorylated oligonucleotides 5' CAATAACTTCGTATAATGTATACTATACGAAGTTATTCG 3' (SEQ ID NO: 13) and 5'

AATTCGAATAACTTCGTATAGTATACATTATACGAAGTTATTGGTAC 3' (SEQ ID NO: 14) containing KpnI and EcoRI sites at the 5'and 3'ends of the LOX 511 sequence (SEQ ID NO: 21 ; Hoess et al., Nuc. Xcids Res. 14: 2287-300,1986; herein incorporated by reference) to generate pCMV-CREM-L (FIG. 5D). The resulting modified cre sequence is shown in SEQ ID NO: 27.

Plasmid pDsRedl-Nl (Clontech, Palo Alto, CA) was digested with DraIII. An aliquot of this digest was digested with KpnI and the resulting 3.5 kb DraIII/KpnI fragment isolated. Another aliquot was digested with AgeI and the 1.1 kb DraIII/AgeI fragment isolated. The two isolated fragments were ligated with oligonucleotides 5' CAATAACTTCGTATAATGTATACTATACGAAGTTATCTAGA 3' (SEQ ID NO: 15) and 5' CCGGTCTAGATAACTTCGTATAGTATACATTATACGAAGTTATTGGTAC 3' (SEQ ID NO: 16) containing the LOX 511 sequence flanked by KpnI and AflII restriction sites resulting in the generation of p221. p221 was digested with Kpn I and AflII to isolate the fragment containing a single LOX 511 recognition sequence upstream of an RFP gene. pCMV-CREM-L (FIG. 5D) was digested with KpnI and EcoRI to remove the LOX 511 site. These two fragments were ligated together with the synthetic oligonucleotides. 5' TTAAGAATAACTTCGTATAATGTATACTATACGAAGTTATTCG 3' (SEQ ID NO: 17) and 5' AATTCGAATAACTTCGTATAGTATACATTATACGAAGTTATTC 3' (SEQ ID NO: 18) containing a LOX 511 site flanked by AflII and EcoRI. Therefore, the LOX 511 sequence was inserted into the 5'region of cre. The resulting plasmid containing the fLOXed RFP inserted within the coding sequence of cre recombinase was designated pCMV-RFP/CREM (FIG. 5E). Vector pCMV-RFP/CREM uses the same frame-shift methods as those described above for the EGFP/ß-gal reporter constructs (see EXAMPLE 1) except that LOX 511 target sequences (SEQ ID NO: 21) flank the RFP gene. LOX 511 sequences were chosen to avoid potential recombination with LOX P sequences used in the other vector constructs described in the above examples. The cre present in pCMV-RFP/CREM is not active unless ere is supplied in trans.

To determine whether ere recombinase activity was maintained following these extensive modifications to ere, pCMV-CREM or pCMV-CREM-L was co-transfected with pCMV-EGFP/RFP (FIG. 3D) in CHO-KI cells as assayed for EGFP and RFP expression as described in EXAMPLE 1.

A switch from EGFP to RFP expression was observed with co-transfection of pCMV-CREM or pCMV-CREM-L, demonstrating that functional ere recombinase activity was maintained with these ere modifications (including the presence of a LOX 511 sequence within the ere coding region) in eukaryotic cells.

EXAMPLE 4 Addition of a ere Amplification Step Further Enhances Gene Expression To further amplify the expression of a gene, a vector in which ere expression is conditionally amplified using a strong promoter was constructed. This would occur following the

initial expression of ere by the relatively weak, tissue-specific and hormone-inducible probasin promoter using the plasmid Pr-cre (FIG. 6A).

A probasin-driven ere recombinase was constructed as follows. The 428 bp probasin promoter fragment was isolated from prPb-tva950 (Pam Schwartzenberg, NCI) following digestion and blunt-ending of the NdeI site, and digestion with KpnI. The resulting fragment was cloned into the SmaI/KpnI site of pß-gal-Basic (Clontech, Palo Alto, CA) resulting in pPr-P-gal. pPr-p-gal was digested with ClaI, filled-in, and digested with XhoI to remove the coding sequence for P-gal. The Mlu I (blunt-ended)-XhoI fragment from pBS 185 (Life Technologies, Rockville, MD) containing the coding sequence for ere recombinase was isolated and inserted into the XhoI/ClaI (blunt-ended) fragment of p 150 resulting in pPr-cre (FIG. 6A).

A probasin-modified cre recombinase plasmid was constructed as follows. The XhoI/EcoR V fragment from plasmid pCMV-CREM containing the modified ere recombinase (EXAMPLE 3; FIG. 5C ; SEQ ID NO: 26) was substituted for the XhoI and EcoRV fragment of plasmid Pr-cre generating pPr-CREM (FIG. 6B).

A plasmid containing probasin-modified ere flanked by insulators was generated as follows.

The vector backbone of pPr-CREM was isolated following digestion with Dra III and partially digested with SalI. The Dra III and BamHI fragment of pPr-CREM containing the probasin promoter and modified ere recombinase was isolated separately. Plasmid pJC13. 1 (G. Felsenfeld, NCI) was digested with SalI and BamHI and the fragment containing a pair of chicken (3-globin insulators (see Genbank Accession No. U78775, SEQ ID NO: 24; Felsenfeld, Gene 135: 119-24,1993; Chung et al.

Cell 74 : 505-14,1993; Chung etal. Proc. Natl. Acad. Sci. U. S. A 94: 575-80,1997; Bell and Felsenfeld, Curr. Opin. Genet. Dev. 9: 191-8,1999) All three isolated fragments were ligated together to generate pPr-CREM/Ins (FIG. 6C). Note that although the insulators shown in FIG. 6C are located at the 3'end of the vector, an additional set of (or alternative set of) insulators can be placed at the 5'end (for example see FIGS. 21 and 2J, insulators #1) PC-3 cells were transfected with the murine androgen receptor producing-plasmid pCMV- mAR (0.06 pmol) in combination with the indicated plasmids shown in FIG. 6D (0.1 pmol) in the presence or absence of 4 nM mibolerone as described in EXAMPLE 2. Luciferase activity was measured 48 hours post-transfection. As shown in FIG. 6D, the presence of the second conditionally expressed modified cre-containing plasmid pCMV-RFP/CREM resulted in an at least 7-fold increase in luciferase activity compared to transfections in the absence of the second conditionally expressed cre.

To further demonstrate the effect of ere amplification by pCMV-RFP/CREM on luciferase expression using pCMV-STOP-luc, transfection of PC-3 cells was performed over several hours using varying amounts of Pr-cre (0.01 to 0.001 pmol) alone or with an additional inducible cre recombinase using pCMV-RFP/CREM (FIG. 6E). PC-3 cells were transfected with pCMV-mAR (0.06 pmol) and the indicated plasmids. Except as indicated in FIG. 6E, 0.1 pmol of each plasmid was used in transfections. pTK-RL (0.1 pmol; Promega, Madison, WI) which uses the TK promoter

to direct expression of Renilla renformis luciferase, was used to normalize for transfection efficiency.

As shown in FIG. 6E, an at least 32-fold increase in luciferase activity was observed using the gene expression amplification approach (Pr-cre and CMV-STOP-luc) compared to an equimolar amount of Pr-luc alone (FIG. 6E, 3 vs. 1). The addition of pCMV-RFP/CREM further increased the level of luciferase activity by at least 9-fold (FIG. 6E, 4 vs. 3). Thus, there was an approximately an at least 300-fold amplification of luciferase activity using the gene amplification method with the second conditional cre construct compared to luciferase activity from Pr-cre alone. These results demonstrate that the addition of a second conditionally active ere can increase the effective expression from other weak promoters.

Without cre expression, RFP was expressed from pCMV-RFP/CREM (FIG. 5E) and the modified ere was out of frame and not expressed. In the presence of cre, RFP was excised and the modified ere correctly translated and expressed.

Although numerous tissue-specific expression vectors exist, levels of transcriptional activity are often low. In order to increase the levei of transcription, method is described herein in which the level of gene expression from a relatively weak but tissue-specific promoter can be amplified through the cre-induced transcriptional activation using a very strong promoter. Using this approach, the level of transcription using the prostate-specific probasin promoter can be amplified 30--fold. When the use of a second, conditionally-expressed cre was employed, the amplification of the reporter increased an additional 10-fold resulting in a total amplification of reporter gene expression of 3 00- fold. This method can readily be applied to other tissue-specific but relatively weak promoters, including, but not limited to: the prostate specific antigen (PSA) promoter; the prostate specific membrane antigen (PSMA) promoter; the whey acidic protein (WAP) promoter; the C3 (1), prostatein family of protein promoters; the albumin promoter; the ß-globin promoter; the neural-specific enolase promoter; the glial fibrillary promoter; the keratin promoter; and probasin.

EXAMPLE 5 Generation of a Single Vector Containing a Recombinase and Recombination Sites A limiting feature of previous cre-LOX technology is that it has not been possible to develop single constructs in which an active cre recombinase could be contained in cis with a pair of LOX recombination sites since the LOX sites would be combined when grown in bacteria. This has necessitated the use of two separate genetic constructs in which cre and LOX sites exist in trans.

This requires the generation of two separate lines of transgenic animals or the less efficient introduction of two separate constructs in in vitro or gene therapy strategies.

The modifications to ere recombinase allow for the placement of a modified ere in the same vector containing LOX recombination sites. As demonstrated in EXAMPLE 3, modified cre maintained full activity for recombination of LOX target sequences. To generate a single vector, pPr- CREM (FIG. 6B, EXAMPLE 4) was placed in cis with pCMVe-ßAc-STOP luc (EXAMPLE 2, FIG.

4D) as follows. The Dra III and EcoRICI fragment containing CMV-STOP-luc was isolated from pCMVe-ßAc-STOP-luc (FIG. 4D) and ligated to the Dra III and Eco47 III fragment of pPr-CREM to create plasmid pPr-CREM/CMV-STOP-luc (FIG. 7A).

To prevent the strong enhancer activity of the strong CMV promoter from activating the upstream, tissue-specific probasin promoter (which is driving cre expression), an additional vector was constructed by placing a set of chicken globin insulators between the Pr-CREM and CMV- STOP-luc cassettes. The region containing the probasin-modified cre with insulators was isolated from pPr-CREM/Ins following digestion with Dra III and Eco47 III and ligated into the EcoRIC I/Dra III fragment of pCMVe-ßAc-STOP-luc. This resulted in a single vector pPr-CREM/Ins/CMV- STOP-luc containing the modified cre under the transcriptional regulation of probasin separated from the cre-dependent CMV-STOP-luc cassette by insulators (FIG. 7B). Note that an additional insulators can be placed at the 5'and/or 3'end of pPr-CREM/Ins/CMV-STOP-luc (for example, insulators #1 and #3, respectively, shown in FIGS. 21 and 2J).

The vectors were assayed in transient transfection experiments as described in the above examples to determine whether the expression of the marker genes was inducible by mibolerone and whether the insulators reduced potential background activity that might otherwise occur through the action of the CMV enhancer on the probasin promoter. PC-3 cells were transfected with pCMV- mAR in the presence or absence of 4 nM mibolerone and additional plasmids (0.1 pmol) as indicated in FIG. 7C.

To determine whether chicken globin insulators would alter the level of expression from Pr- cre, insulators were added to flank Pr-cre to generate pPr-CREM/Ins (FIG. 6A) and co-transfected with pCMV-STOP-luc. No difference in luceriferase activity was observed whether insulators did or did not flank Pr-cre (FIG. 7C, columns 4,6 ere, P =0.161 Mann-Whitney test). When the single construct containing pPr-CREM/CMV-STOP-luc was transfected in the absence of miboloerone, a significant basal level of luciferase activity was observed compared to co-trasfection of the separate constructs Pr-CREM and CMV-STOP-luc (FIG. 7C, columns 3,7). This was likely due to the strong transcriptional activating effect of the CMV enhancer on the probasin promoter. However, when the set of insulators was placed between the Pr-CREM and CMV-STOP-luc cassettes (pPr- CREM/Ins/CMV-STOP-luc), the induced level of luciferase activity was reduced about 5-fold compared to the single construct without insulators (FIG. 7C, columns 7,9, P = 0.0001, Mann- Whitney test). The levels of mibolerone-induced luciferase activities were similar whether or not the insulators were present (FIG. 7C, columns 8,10, P= 0.297 Mann-Whitney test).

No significant difference in inducible luciferase activities were observed using the single Pr- CREM/CMV-STOP-luc or Pr-CREM/Ins/CMV-STOP-luc vectors comparing to the co-transfection of the individual constructs (FIG. 7C, columns 4,8,10, P = 0.681, Kruskal-Wallis test). These results demonstrate that the single vector containing the modified ere under an inducible promoter and the reporter cassette in cis worked equally as well as separate constructs in trans.

EXAMPLE 6 Addition of a Ligand Binding Domain To add an additional level of regulation to the modified cre-recombinase adaptation described above, the ligand binding domain (LBD) of the wild-type androgen receptor (AR), or a mutant form of the AR, were added to the modified cre-recombinase (CREM). One skilled in the art will understand that other LBDs can be used, such as the LBD of estrogen receptor, progesterone receptor, thyroid hormone receptor and glucocorticoid receptor. In addition, additional LBDs can be identified for other orphan receptors.

To generate pCMV-CREM (Bgl II) (FIG. 8), plasmid p218 (FIG. 5D), which contains a coding sequences for a modified cre recombinase (EXAMPLE 3), was used as template for PCR amplification using 5'-CTTCAGGCGCGCGGTCTGGCAGTAAAAACTATCCA-3' (SEQ ID NO: 28) and 5'-TAGACGCGTCATAGATCTCCATCTTCCAGCAGGCGCACCATTGCCC-3' (SEQ ID NO: 29). The PCR conditions were as follows: 10 ng of DNA plasmid template; 300 uM dNTP ; 1 mM MgS04 ; 300 nM primers; and 2.5 units of PFX polymerase in a 50 ul reaction volume.

Themocycler settings were 94°C for 2 minutes for oDe cycle; followed by 94°C for 30 seconds, 68°C for 30 seconds, and 72°C for 1 minute (30 cycles); followed by 72°C for 7 minutes. The resulting amplification product was digested with Bam H1 and Mlu I, gel purified, and ligated to a Bam Hl/Msc I fragment from p218 containing the 5'-end of a cre gene and a Msc I-Mlu I fragment from' pBS I85 (Life Teclmologies, Rockville, MD) containing a polyadenylation sequence. This resulted in plasmid pCMV-CREM (Bgl II) (FIG. 8).

To test the functionality of this altered form of CREM, pCMV-EGFP/RFP (FIG. 3D) was co-transfected with or without pCMV-CREM (Bgl II), and the cells assayed by microscopy as described in EXAMPLE 1. Transfection of pCMV-EGFP/RFP resulted in only EGFP expression, and not RFP, demonstrating that no detectable level of lox recombination occurred in the absence of pCMV-CREM (Bgl II). However, addition of pCMV-CREM (Bgl II) led to lox recombination as evidenced by the expression of RFP in the cells. This demonstrates that modification to CREM by the addition of a Bgl II site does not inhibit detectable cre recombinase activity.

Having established that the Bgl II site in CREM was not deleterious to CREM function, three forms of the LBD of the human androgen receptor (hAR) were added separately to pCMV- CREM (Bgl II) (see FIG. 9). In one construct, wild-type AR LBD was fused to CREM resulting in pCMV-CREM-AR (wt) (p260). First, p258 was generated as follows. Plasmid containing cDNA of hAR was used as template for PCR amplification of LBD using SEQ ID NO: 30 (5'- ATTCTAGATCTGATGACTCTGGGAGCCCGGAAGCTGAAGAAACCTGG-3') and SEQ ID NO: 31 (5'-GTAGGATCCACGCGTTCATTGGGTGTGGAAATAGATGGGCTTGAC-3'). PCR was performed as described above. The resulting product was digested with Xba I and Bam HI and ligated into Xba I and Bgl II sites in pSP-72 (Promega) resulting in p258 (FIG. 9). Plasmid p258 was digested with Bgl II and Mlu I and the fragment encoding the LBD isolated. pCMV-CREM (Bgl II) was digested with Sca I/Bgl II and Mlu I. The three fragments resulting from the digestions

described above (LBD, pCMV-CREM (BglII) ScaI/BglII and pCMV-CREM (BglII) ScaI/MluI fragments) were ligated together resulting in pCMV-Cre-AR (WT) (FIG. 9).

Another construct, pCMV-CREM-AR (LnCaP) (p270), contained CREM fused to an AR LBD containing a mutation identified in the AR LBD in LnCaP cells (Kleinerman et al., J. Urology 155: 624A, 1996; mutation of codon 877 from thryonine to alanine (a o g nucleotide mutation). To generate pCMV-CREM-AR (LnCaP), plasmid p258 was digested with Bgl I and Bsg I, and the resulting 1.8 kb fragment isolated. The resulting fragment was ligated to double stranded (ds) oligo nucleotides (5'TGCATCAGTTCGCTTTTGACCTGCTAATCAAGTCACACATG-3' (SEQ ID NO: 32) and 5'-GTGTGACTTGATTAGCAGGTCAAAAGCGAACTGATGCAGC-3' (SEQ ID NO: 33)) resulting, in p264 (containing the LnCaP mutation). Plasmid pCMV-CREM (Bgl II) was digested with Mlu I and Bgl II and a fragment containing mutated AR-LBD (LnCaP) from p264 (Mlu I-Bgl II) was cloned into it resulting in pCMV-Cre-AR (LnCaP).

The third construct contained CREM fused to a mutated AR-LBD in which a stop codon was introduced early in the coding sequence of the LBD (pCMV-CREM-. AR (T), p274). This construct was designed to have no LBD function and serves as a control for CREM induction in the absence of LBD regulation. To generate pCMV-CREM-AR (T), p258 was digested with Bgl 1 and Dra III, and the 1. 3 kb fragment isolated. he resulting fragment was ligated to ds oligonucleotides (5'-TGTAGCAGTTCACTTTTGACCTGCTAATCAAGTCACACATG-3' (SEQ ID NO: 34) and 5'- GTGTGACTTGATTAGCAGGTCAAAAGTGAACTGCTACAGC-3' (SEQ ID NO: 35)), resulting in p267 (early termination). Plasmid pCMV-CREM (Bgl II) was digested with Mlu I and Bgl II and a Mlu I-Bgl II fragment containing mutated AR-LBD (early termination) from p267 was cloned into it resulting in pCMV-Cre-AR (T).

The specificity of cre recombinase induction using various androgen analogues was tested as follows. CHO-K1 cells were cultured and transiently co-transfected with reporter plasmid pCMV- EGFP/RFP (0.95 jug, FIG. 3D) and with 0.75 llg of pCMV-Cre-AR (wt), pCMV-Cre-AR (LnCaP), or pCMV-Cre-AR (T) as described in EXAMPLE 1. Culture medium was replaced 24 hours later with fresh medium supplemented with or without ligands (100 nM mibolerone or 100 nM OH-flutamide) and cells maintained in this medium for additional 24 hours. Fluorescence microscopy was performed as described in EXAMPLE 1,48 hours after exposure to the ligand. Co-transfection of pCMV-CREM-AR (wt) with pCMV-EGFP/RFP resulted in induction of cre activity only by the addition of the androgen agonist mibolerone, and not by the addition of the androgen antagonist OH- flutamide. However, when pCMV-CREM-AR (LnCaP) containing the mutant LBD was co- transfected with pCMV-EGFP/RFP, both mibolerone and OH-flutamide induced cre activity. When pCMV-CREM-AR (T) was co-transfected with pCMV-EGFP/RFP neither mibolerone nor OH- flutamide induced cre activity. This demonstrates that androgen analogues can control CREM activation, by controlling the LBD sequence used.

To quantify the induction of cre activity by various ligands, the pCMV-CREM-AR variants (0.1 pmole) described above were co-transfected with reporter construct pCMVe-jSAc-STOP-luc (0.1

pmole) (FIG. 4D) into PC-3 cells as described in EXAMPLE 2. Cells were incubated in the presence or absence of ligand as described above for 48 hours. Luciferase activities were performed 48 hours post-transfection using the methods described in EXAMPLE 2. Transfection efficiency was normalized with p-TK-RI. Mibolerone addition resulted in about a 5-fold increase in luciferase activity when pCMV-CREM-AR (wt) was used, while OH-flutamide had no significant effect on luciferase activity (FIG. 10A). However, both mibolerone and OH-flutamide induced about a 5-fold increase in luciferase activity when pCMV-CREM-AR (LnCaP) was used (FIG. 1 OA). As expected, no detectable induction of luciferase expression was observed when pCMV-CREM-AR (T) was used.

The ability and specificity of other ligands to induce cre activity of pCMV-CREM- AR (LnCaP) was tested as described above. Dehydrotestosterone (1 nM) gave the highest induction of about 14-fold, followed by about a 10-fold induction with 100 nM OH-flutamide (FIG. 10B) and about a 5-fold increase in luciferase activity when 1.0 nM OH-flutamide or 100 nM of 17-OH- estradiol was used. The anti-estrogen, tamoxifen, did not lead to a significant induction of the luciferase activity (FIG. 10B). pCMV-CREM-AR (LnCaP) was also responsive to the progesterone analogue RU-486 and minimally responsive to dexamethasone (FIG. 10C). Therefore, when wild- type AR-LBD is fused to CREM, cre recombinase activity is induced by androgen agonists (such as testosterone, dehydrotestosterone and mibolerone), but not by androgen antagonists (such as OH- flutamide). In contrast, when the ligand specificity of AR LBD is altered, for example by mutation, the ligand inducibility of ere activity is similarly altered. Here, cre activity was induced by both androgen agonists and the anti-androgen OH-flutamide. Cre activity was slightly induced at high concentration of E2, but not by an anti-estrogen (such as tamoxifen or dexamethasone).

To measure the inducible expression of cre activity by adenoviral delivery, the coding sequence for cre recombinase with modifications for improved translation (Adeno-Cre, AD-292, FIG.

11A) and the CREM-AR (LnCaP) coding sequence were individually inserted into an adenoviral vector and viral particles produced. Adeno-Cre was generated as follows. A DNA fragment coding for Cre recombinase was excised from pCM-Cre-K (p209, FIG. 5B) or pCMV-Cre-AR (LnCaP) (FIG.

9) with Xba I, blunt ended and individually ligated to pAdenoVator-CMV5 transfer vector (Qbiogene) previously linearized with Pme I. To obtain infectious adenovirus containing Cre recombinase, transfer plasmids were processed according to the manufacturers instructions, resulting in Adeno-Cre and Adeno-Cre-AR (LnCaP) (FIG. 11A and 11B, respectively).

CHO-KI or QBI293A cells were plated 24 hours before transfection/infection in 6-well plates as described above. Two hours before transfection/infection, 2 ml of culture medium supplemented with charcoal-striped serum culture medium was replaced with fresh medium containing ligand. Cells were transfected with 0.95 ug of reporter plasmid pCMV-EGFP/RFP (FIG.

3D) using the FuGene-6 (Roche) transfection method. Two hours post-transfection, cells were infected with 500 ill of supernatant collected from adenoviral packaging cell line producing recombinant adenovirus-cre recombinase. Fresh aliquots of 100 nM OH-Flutamide were added to cells every 24 hours.

When cells were transfected with pCMV-EGFP/RFP (FIG. 3D) and subsequently infected with Adeno-cre (FIG. 11A), lox recombination occurred and RFP expression was observed.

Therefore, adeno-cre is effective in infecting cells and results in active ere expression. When cells were transfected with pCMV-EGFP/RFP and subsequently infected with adeno-CREM-AR (LnCaP), ere recombinase activity was induced by OH-flutamide. No recombination (as determined by the absence of RFP expression) was observed without infection of adeno-CREM-AR (LnCaP). These results demonstrate that cre-induction can be elicited using an adenoviral delivery system.

In summary, an additional level of inducible CREM expression is achieved by fusing variant forms of an LBD, such as the LBD of the AR, to CREM, such that CREM activation is dependent upon the ligand binding properties of the particular LBD variant.

The AR LBD can be used to activate ere activity when used with ligands which activate a particular LBD. This system can be used to induce expression of ere activity at a particular stage of development in a transgenic animal, or at a particular time-point for in vivo or in vitro gene expression. For example, developing a ere regulatory system in female mice, particularly those involving the study of mammary biology or cancer, can be complicated if steroid ligands are used, since the steroids may interfere with normal estrogen signaling in a target tissue. However, as described herein, androgen ligands which would not directly interfere with normal estrogen signaling in the mammary gland, such as the androgen antagonist OH-flutamide, can be used in combination with the vectors disclosed herein.

The disclosed system can be also be used for high throughput screening of one or more compounds, to identify compounds or agents which affect steroid hormone signaling, based upon the ability of the compound to bind various forms of a particular LBD, such as an AR-LBD. Using the gene switch reporter system activated by ere recombinase, whether a particular compound binds to the LBD and activates ere can be determined, using the methods described herein. This technology can be utilized to screen for compounds activate hormone signaling pathways, inhibit or decrease such signaling, or which are active when LBDs undergo particular mutations. Compounds which result in the production of the reporter gene product, such as RFP or luciferase, are identified as an activator of a particular LBD. This approach can be used to identify environmental toxins or carcinogens. Compounds identified in this manner can be further tested for their therapeutic or toxicologic potentials.

The strategies and modifications to cre recombinase presented herein have broad application to developing tissue-specific inducible gene expression systems. In addition, the results disclosed herein demonstrate several novel modifications of cre-LOX technology which can be applied to both human in vivo gene expression and transgenic animal manipulations including the cre-inducible activation or switching of gene expression, tissue-specific gene expression amplification and the development of single vectors containing both a modified ere recombinase and LOX recognition sequences.

EXAMPLE 7 Transfer of DNA into Cells The transfer of DNA into eukaryotic, such as human or other mammalian cells is now a conventional technique. For example, vectors of the present disclosure can be introduced into recipient cells as pure DNA (transfection) by precipitation with calcium phosphate (Graham and vander Eb, 1973, Virology 52: 466) or strontium phosphate (Brash et al., 1987, Mol. Cell Biol.

7: 2013), electroporation (Neumann et al., 1982, EMBO J. 1: 841), lipofection (Felgner et al., 1987, P7-oc. Natl. Acad. Sci USA 84: 7413), DEAE dextran (McCuthan et aL, 1968, J. Natl. Cancer Iiist.

41: 351), microinjection (Mueller et al., 1978, Cell 15 : 579), protoplast fusion (Schafner, 1980, Proc.

Natl. Acad. Sci. USA 77: 2163-7), or pellet guns (Klein et al., 1987, Nature 327: 70). Alternatively, the DNA can be introduced by infection with viral vectors. Systems are developed that use, for example, retroviruses (Bernstein et aL, 1985, Gen. E7zgrg. 7: 235), adenoviruses (Ahmad et al., 1986, J. Virol. 57: 267), or Herpes virus (Spaete et al., 1982, Cell 30: 295). The nucleic acids disclosed herein can be delivered as part of a viral vector, such as a retroviral vector, avipox viruses, recombinant vaccinia vims, replication-deficient adenovirus strains or poliovirus, or as a non- infectious form such as naked DNA or liposome encapsulated DNA.

EXAMPLE 8 Sequence Variants Having presented a format of nucleic acids of the present disclosure, including vectors, and the sequence of a modified cre recombinase, this disclosure also facilitates the creation of DNA molecules derived from those disclosed but which vary in their precise nucleotide or amino acid sequence from those disclosed. Such variants may be obtained through a combination of standard molecular biology laboratory techniques and the nucleotide sequence information disclosed by this disclosure DNA sequences can be manipulated with standard procedures such as restriction enzyme digestion, fill-in with DNA polymerase, deletion by exonuclease, extension by terminal deoxynucleotide transferase, ligation of synthetic or cloned DNA sequences, site-directed sequence- alteration via single-stranded bacteriophage intermediate or with the use of specific oligonucleotides in combination with PCR.

Variant DNA molecules include those created by standard DNA mutagenesis techniques, for example, M13 primer mutagenesis. Details of these techniques are provided in Sambrook et al. (In: Molecular Cloni7zg : 24 Laboratory Manual, Cold Spring Harbor, New York, 1989, Ch. 15, herein incorporated by reference). By the use of such techniques, variants can be created which differ in minor ways from those disclosed. Nucleotide sequences which are derivatives of those specifically disclosed herein and which differ from those disclosed by the deletion, addition or substitution of

nucleotides while still encoding a protein, such as a modified recombinase which possesses the functional characteristics of the recombinase, but which is not expressed in prokaryotic cells.

Also within the scope of this disclosure are small oligonucleotides derived from the disclosed nucleic acids, such as the modified recombinase nucleic acid sequences. Oligonucleotides are suitable for use as hybridization probes or PCR primers. For the purposes of PCR, oligonucleotides include at least 20-50 consecutive nucleotides of the modified recombinase nucleic acid sequences disclosed herein. Nucleotide sequences derived from the disclosed modified recombinase nucleic acid sequences as described above can also be defined as nucleic acid sequences which hybridize under stringent conditions to the modified recombinase nucleic acid sequences disclosed, or fragments thereof.

Hybridization conditions resulting in particular degrees of stringency will vary depending upon the nature of the hybridization method of choice and the composition and length of the hybridizing DNA used. Generally, the temperature of hybridization and the ionic strength (especially the Na+ concentration) of the hybridization buffer will determine the stringency of hybridization.

Calculations regarding hybridization conditions required for attaining particular degrees of stringency are discussed by Sambrook et al. (In: Molecular Cloning : A Laboratory Manual, Cold Spring Harbor, New York ; 1989 ch. 9 and 11), herein incorporated by reference. By way of illustration only, a hybridization experiment can be performed by hybridization of a DNA molecule (for example, a modified recombinase sequence) to a target DNA molecule (for example, a wild-type modified recombinase sequence) which has been electrophoresed in an agarose gel and transferred to a nitrocellulose membrane by Southern blotting (Southern, J. Mol. Biol. 98: 503,1975), a technique well known in the art and described in Sambrook et al. (Molecular Cloning : A Laborato7y Manual, Cold Spring Harbor, New York, 1989).

Hybridization with a target probe labeled with [32P]-dCTP is generally carried out in a solution of high ionic strength such as 6xSSC at a temperature that is 20-25°C below the melting temperature, Tm. For such Southern hybridization experiments where the target DNA molecule on the Southern blot contains 10 ng of DNA or more, hybridization is typically carried out for 6-8 hours using 1-2 ng/ml radiolabeled probe (of specific activity equal to 109 CPM/pLg or greater). Following hybridization, the nitrocellulose filter is washed to remove background hybridization. The washing conditions should be as stringent as possible to remove background hybridization but to retain a specific hybridization signal. Tm represents the temperature above which, under the prevailing ionic conditions, the radiolabeled probe molecule will not hybridize to its target DNA molecule. The Tm of such a hybrid molecule may be estimated from the following equation (Bolton and McCarthy, Proc.

Natl. Acad. Sci. USA 48: 1390,1962): Tm = 81.5°C-16.6 (logio [Na+]) + 0.41 (% G+C)-0.63 (% formamide)- (600/1); where 1 = the length of the hybrid in base pairs.

This equation is valid for concentrations of Na+ in the range of 0.01 M to 0.4 M, and it is less accurate for calculations of Tm in solutions of higher [Na+]. The equation is also primarily valid for DNAs whose G+C content is in the range of 30% to 75%, and it applies to hybrids greater than

100 nucleotides in length (the behavior of oligonucleotide probes is described in detail in Ch. 11 of Sambrook et al. (Molecular Cloniizg : A Laboratory Manual, Cold Spring Harbor, New York, 1989).

Thus, by way of example, for a 150 base pair DNA probe derived from a modified recombinase nucleic acid sequence (with a hypothetical % GC = 45%), a calculation of hybridization conditions required to give particular stringencies may be made as follows: For this example, it is assumed that the filter will be washed in 0. 3 xSSC solution following hybridization, thereby: [Na+] = 0.045 M; % GC = 45%; Formamide concentration = 0; 1 = 150 base pairs; Tm=81. 5-16.6 (logio [Na+]) + (0.41 x 45)- (600/150); and so Tm = 74.4°C.

The Tm of double-stranded DNA decreases by 1-1.5°C with every 1% decrease in homology (Bonner et al., J. Mol. Biol. 81: 123,1973). Therefore, for this given example, washing the filter in 0.3 xSSC at 59.4-64.4°C will produce a stringency of hybridization equivalent to 90%; that is, DNA molecules with more than 10% sequence variation relative to the target transgene DNA will not hybridize. Alternatively, washing the hybridized filter in 0.3 xSSC at a temperature of 65. 4-68.4°C will yield a hybridization stringency of 94%; that is, DNA molecules with more than 6% sequence variation relative to a modified recombinase will not hybridize. The above example is given entirely by way of theoretical illustration. One skilled in the art will appreciate that other hybridization techniques may be utilized and that variations in experimental conditions will necessitate alternative calculations for stringency.

In particular embodiments of the present disclosure, stringent conditions can be defined as those under which DNA molecules with more than 25%, 15%, 10%, 6% or 2% sequence variation (also termed"mismatch") will not hybridize.

The degeneracy of the genetic code further widens the scope of the present disclosure as it enables major variations in the nucleotide sequence of a DNA molecule while maintaining the amino acid sequence of the encoded protein. For example, the second amino acid residue of modified cre recombinase is alanine (see FIG. 5B). This is encoded in the modified cre recombinase DNA by the nucleotide codon triplet GCG. Because of the degeneracy of the genetic code, other nucleotide codon triplets, could encode the C-terminal amino acid residue (e. g. GCT and GCC), as they also code for alanine. Thus, the nucleotide sequence of the modified cre recombinase could be changed at this position to any of these three codons without affecting the amino acid composition of the encoded protein or the characteristics of the protein. Based upon the degeneracy of the genetic code, variant DNA molecules may be derived from the cDNA molecules disclosed herein using standard DNA mutagenesis techniques as described above, or by synthesis of DNA sequences. DNA sequences which do not hybridize under stringent conditions to the cDNA sequences disclosed by virtue of sequence variation based on the degeneracy of the genetic code are herein also comprehended by this disclosure.

The disclosure also includes DNA sequences that are substantially identical to any of the DNA sequences disclosed herein, where substantially identical means a sequence that has identical nucleotides in at least 70%, 75%, 80%, 85%, 90%, 95%, 98% or 99% of the aligned sequences.

One skilled in the art will recognize that the DNA mutagenesis techniques described above may be used not only to produce variant DNA molecules, but will also facilitate the production of proteins which differ in certain structural aspects from modified recombinase, yet which proteins are clearly derivative of this protein and which maintain the essential characteristics of a modified recombinase (the ability to be expressed in eukaryotic, but not prokaryotic cells). Newly derived proteins may also be selected in order to obtain variations on the characteristic of a modified recombinase protein, as will be more fully described below. Such derivatives include those with variations in amino acid sequence including minor deletions, additions and substitutions.

While the site for introducing an amino acid sequence variation is predetermined, the mutation per se need not be predetermined. For example, in order to optimize the performance of a mutation at a given site, random mutagenesis may be conducted at the target codon or region and the expressed protein variants screened for the optimal combination of desired activity. Techniques for making substitution mutations at predetermined sites in DNA having a known sequence as described above are well known.

Amino acid substitutions are typically of single residues; insertions usually will be on the order of about from 1 to 10 amino acid residues ; and deletions will range about from 1 to 30 residues.

Deletions or insertions may be made in adjacent pairs, i. e., a deletion of 2 residues or insertion of 2 residues. Substitutions, deletions, insertions or any combination theieof may be combined to arrive at a final construct. Obviously, the mutations that are made in the DNA encoding the protein must not place the sequence out of reading frame and ideally will not create complementary regions that could produce secondary mRNA structure.

Substitutional variants are those in which at least one residue in the amino acid sequence has been removed and a different residue inserted in its place. Such substitutions generally are made conservatively, as defined above.

Substantial changes in function or immunological identity are made by selecting substitutions that are less conservative than those defined above, i. e., selecting residues that differ more significantly in their effect on maintaining (a) the structure of the polypeptide backbone in the area of the substitution, for example, as a sheet or helical conformation, (b) the charge or hydrophobicity of the molecule at the target site, or (c) the bulk of the side chain. The substitutions which in general are expected to produce the greatest changes in protein properties will be those in which (a) a hydrophilic residue, e. g., seryl or threonyl, is substituted for (or by) a hydrophobic residue, e. g., leucyl, isoleucyl, phenylalanyl, valyl or alanyl; (b) a cysteine or proline is substituted for (or by) any other residue; (c) a residue having an electropositive side chain, e. g., lysyl, arginyl, or histadyl, is substituted for (or by) an electronegative residue, e. g., glutamyl or aspartyl; or (d) a residue having a bulky side chain, e. g., phenylalanine, is substituted for (or by) one not having a side chain, e. g., glycine.

The effects of these amino acid substitutions or deletions or additions can be assessed for derivatives of the modified recombinase by assays in which the ability of the modified recombinase is expressed in eukaryotic, but not prokaryotic cells, is assessed, using the methods disclosed herein.

EXAMPLE 9 Pharmaceutical Compositions and Modes of Administration Various delivery systems for administering the nucleic acids, including a nucleic acid in a vector, of the present disclosure are known, and include e. g., encapsulation in liposomes, microparticles, microcapsules, expression by recombinant cells, receptor-mediated endocytosis (see Wu and Wu, J. Biol. Chenu. 1987,262: 4429-32), and construction of a therapeutic nucleic acid as part of a viral or other vector. Methods of introduction include, but are not limited to, intradermal, intramuscular, intraperitoneal, intravenous, subcutaneous, intranasal, and oral routes. The compositions may be administered by any convenient route, for example by infusion or bolus injection, by absorption through epithelial or mucocutaneous linings (e. g., oral mucosa, rectal and intestinal mucosa, etc.) and can be administered together with other biologically active agents, such as other therapeutic molecules. Administration can be systemic or local. In addition, the pharmaceutical compositions may be introduced into the central nervous system by any suitable route, including intraventricular and intrathecal injection; intraventricular injection may be facilitated by an intraventricular catheter, for example, attached to a reservoir, such as an Ommaya reservoir.

In one embodiment, the pharmaceutical compositions of the disclosure are delivered locally to the area in need of treatment, for example, by local infusion during surgery, topical application, e. g., in conjunction with a wound dressing after surgery, by injection, through a catheter, by a suppository or an implant, such as a porous, non-porous, or gelatinous material, including membranes, such as silastic membranes, or fibers. In one embodiment, administration can be by direct injection at the site (or former site) of a malignant tumor or neoplastic or pre-neoplastic tissue.

The use of liposomes as a delivery vehicle is another delivery method. The liposomes fuse with the target site and deliver the contents of the lumen intracellularly. The liposomes are maintained in contact with the target cells for a sufficient time for fusion to occur, using various means to maintain contact, such as isolation and binding agents. Liposomes may be prepared with purified proteins or peptides that mediate fusion of membranes, such as Sendai virus or influenza virus. The lipids can be any useful combination of known liposome forming lipids, including cationic lipids, such as phosphatidylcholine. Other potential lipids include neutral lipids, such as cholesterol, phosphatidyl serine, phosphatidyl glycerol, and the like. For preparing the liposomes, the procedure described by Kato et al. (J. Biol. Cliem. 266: 3361, 1991) can be used.

Delivery systems The present disclosure also provides pharmaceutical compositions which include a therapeutically effective amount of the nucleic acids disclosed herein, alone or with a

pharmaceutically acceptable carrier. The pharmaceutically acceptable carriers useful in this disclosure are conventional. Reraington's Pharrnaceutical Seiefaces, by E. W. Martin, Mack Publishing Co., Easton, PA, 15th Edition (1975), describes compositions and formulations suitable for pharmaceutical delivery of the nucleic acids herein disclosed. Embodiments of the disclosure comprising medicaments can be prepared with conventional pharmaceutically acceptable carriers, adjuvants and counterions as would be known to those of skill in the art.

In general, the nature of the carrier will depend on the particular mode of administration being employed. For instance, parenteral formulations usually comprise injectable fluids that include pharmaceutically and physiologically acceptable fluids such as water, physiological saline, balanced salt solutions, aqueous dextrose, glycerol, ethanol, sesame oil, combinations thereof, or the like, as a vehicle. The medium may also contain conventional pharmaceutical adjunct materials such as, for example, pharmaceutically acceptable salts to adjust the osmotic pressure, buffers, preservatives and the like. The carrier and composition can be sterile, and the formulation suits the mode of administration.

For solid compositions (e. g., powder, pill, tablet, or capsule forms), conventional non-toxic solid carriers can include, for example, pharmaceutical grades of mannitol, lactose, starch, sodium saccharine, cellulose, magnesium carbonate, or magnesium stearate. In addition to biologically- neutral carriers, pharmaceutical compositions to be administered can contain minor amounts of non- toxic auxiliary substances, such as wetting or emulsifying agents, preservatives, and pH buffering agents and the like, for example sodium acetate or sorbitan monolaurate.

The composition can be a liquid solution, suspension, emulsion, tablet, pill, capsule, sustained release formulation, or powder. The composition can be formulated as a suppository, with traditional binders and carriers such as triglycerides.

The amount of vector that will be therapeutically effective for a particular disorder or condition will depend on the nature of the disorder or condition, and can be determined by standard clinical techniques. In addition, in vitro assays can optionally be employed to help identify optimal dosage ranges. The precise dose to be employed in the formulation will also depend on the route of administration, and the seriousness of the disease or disorder, and should be decided according to the judgment of the practitioner and each subject's circumstances. Effective doses may be extrapolated from dose-response curves derived from in vitro or animal model test systems.

The disclosure also provides a pharmaceutical pack or kit comprising one or more containers filled with one or more of the ingredients of the pharmaceutical compositions. Optionally associated with such container (s) can be a notice in the form prescribed by a governmental agency regulating the manufacture, use or sale of pharmaceuticals or biological products, which notice reflects approval by the agency of manufacture, use or sale for human administration. Instructions for use of the composition can also be included.

The pharmaceutical compositions or methods of treatment can be administered in combination with other therapeutic treatments, such as other anti-neoplastic or anti-tumorigenic therapies.

Admi) istratio) t of Nucleic Acid Molecules The present disclosure includes all forms of nucleic acid delivery, including synthetic oligos, naked DNA, plasmid and viral, integrated into the genome or not. In an embodiment in which a nucleic acid is employed for transgene delivery, the analog is delivered intracellularly (e. g., by expression from a nucleic acid vector or by receptor-mediated mechanisms). In a specific embodiment where the therapeutic molecule is a nucleic acid, administration can be achieved by an appropriate nucleic acid expression vector which is administered so that it becomes intracellular, e. g., by use of a viral vector (see U. S. Patent No. 4,980,286), or by direct injection, or by use of microparticle bombardment (e. g., a gene gun; Biolistic, Dupont), or coating with lipids or cell-surface receptors or transfecting agents, or by administering it in linkage to a homeobox-like peptide which is known to enter the nucleus (see e. g., Joliot et al., Proc. Natl. Acad. Sci. USA 8 : 1864-8,1991).

Alternatively, the nucleic acid can be introduced intracellularly and incorporated within the nucleic acid of a cell for expression, by homologous recombination.

The vector pcDNA, is an example of a method of introducing a nucleic acid of the present disclosure into a cell under the control of a strong viral promoter (such as CMV) to drive the expression. However, other vectors can be used. Other retroviral vectors (such as pRETRO-ON, Clontech), also use this promoter but have the advantages of entering cells without any transfection aid, integrating into the genome of target cells only when the target cell is dividing (as cancer cells do, especially during first remissions after chemotherapy) and they are regulated. It is also possible to turn on the expression of the vector nucleic acid by administering tetracycline when these plasmids are used. Hence these plasmids can be allowed to transfect the cells, then administer a course of tetracycline with a course of chemotherapy to achieve better cytotoxicity.

Having illustrated and described the principles of constructing and using the nucleic acids and vectors of the present disclosure, it should be apparent to one skilled in the art that the disclosure can be modified in arrangement and detail without departing from such principles. In view of the many possible embodiments to which the principles of our disclosure may be applied, it should be recognized that the illustrated embodiments are only examples of the disclosure and should not be taken as a limitation on the scope of the disclosure. Rather, the scope of the disclosure is in accord with the following claims. We therefore claim as our invention all that comes within the scope and spirit of these claims.