TECHNICAL FIELD

The present disclosure relates to a polynu- cleotide, a polypeptide or protein, an expression cas- sette, a vector, a system, a kit, a host cell, a transgenic organism, a method for at least partially depleting a target polypeptide or protein in a host cell, a method for producing the host cell, and use thereof .

BACKGROUND

Targeted protein degradation, i.e. depletion, of endogenous polypeptides and proteins using small molecules as inducers, may be desirable for various purposes, for example the study of the function of in- dividual proteins or assessment of drug targets. The auxin-inducible degron (AID) technique may be used to control targeted protein degradation with the small molecule auxin or an auxin analogue.

However, in many cases the complete or par- tial basal degradation of a protein, i.e. constitutive depletion, in the absence of an inducer such as auxin or an auxin analogue, may result in adverse conse- quences. Some proteins are also essential, so that even a partial basal degradation of such a protein may result in severe consequences, for example cell death. The ability to rapidly and efficiently induce the deg- radation of proteins may therefore be very useful.

In some systems, the inducible degradation may be inefficient. Some AID systems may be sensitive to higher temperatures, for example to a temperature of 37 °C typical for mammalian cells. Furthermore, certain types of proteins may be more challenging to degrade inducibly than others. The system used for the degradation and/or the inducer thereof should prefera- bly also not cause excessive side effects.

SUMMARY

This Summary is provided to introduce a se- lection of concepts in a simplified form that are fur- ther described below in the Detailed Description. This Summary is not intended to identify key features or essential features of the claimed subject matter, nor is it intended to be used to limit the scope of the claimed subject matter.

A polynucleotide encoding a degradation sig- nal peptide is disclosed. The polynucleotide may com- prise a nucleotide sequence encoding a degradation signal peptide, wherein the degradation signal peptide has an amino acid sequence comprising a sequence that is at least 75 % identical to a sequence corresponding to amino acid residues

84-98 of SEQ ID NO: 1 (AtIAA7 ) ,

66-80 of SEQ ID NO: 2 (AtIAA3 ) ,

84-98 of SEQ ID NO: 3 (AtIAA17 ) ,

78-92 of SEQ ID NO: 4 (AtIAA14 ) ,

55-69 of SEQ ID NO: 5 (AtIAA5 ) , or

167-181 of SEQ ID NO: 6 (AtIAA8 ) ,

or a degradation signal peptide functionally and/or structurally equivalent thereto.

BRIEF DESCRIPTION OF THE DRAWINGS

The accompanying drawings, which are included to provide a further understanding of the invention and constitute a part of this specification, illus- trate embodiments of the invention and together with the description help to explain the principles of the invention. In the drawings: Figure 1 is a schematic representation of the principle of rapid protein degradation with AID;

Figure 2A shows the scheme for screening aux- in perceptive proteins and degron tags. Target protein levels in cells are analyzed by FACS of GFP at 0 h IAA for basal degradation, at 1 h IAA for early degrada- tion efficiency and at 16 h IAA for final degradation efficiency;

Figure 2B illustrates mean GFP intensity ana- lyzed as shown in Fig. 2A. miniAID as the degron (n=4, OsTIRl and AtAFB2; Ctrl (control), no auxin perceptive protein) ; or AtAFB2 as the auxin perceptive protein (n=2, miniAID; n=4, miniIAA7; Ctrl, Seipin-mEGFP with- out degron) ;

Figures 2C and 2D show FACS plots showing overlays of GFP histograms at 0 h (black line) , 1 h (grey line) and 16 h (light grey line) IAA in cells expressing the indicated constructs. Ctrl: seipin- mEGFP without degron. *: KR dipeptide in domain II; black dotted line and grey dotted line: drawings for comparison of GFP peaks. The plots show that miniIAA7 and KR-miniIAA7 had the best reduction of GFP at 1 h IAA in AtAFB2 expressing cells. KR domain as a poten- tial nuclear localization signal is unfavourable to be included in the tag;

Figure 2E shows mean GFP intensities in Figs. 2C and 2D (n=2-4) . N.D. not determined;

Figure 3A illustrates the scheme for estab- lishing cell lines with AtAFB2-miniIAA7 system to de- plete endogenous proteins. Safe harbor locus with con- trol (Ctrl) or OsTIRl were used for comparison;

Figure 3B shows mean GFP intensity analyzed by FACS in A431 cells with miniIAA7-tagged DHC1 (n=4) and A549 cells with miniIAA7-tagged EGFR (n=2) . The cells also expressed indicated auxin-perceptive pro- teins or Ctrl. N.A. not available due to inability to establish the cell line; Figure 3C shows time-lapse images of A431- DHC1 cells with or without cell division after mitotic cell rounding. Open arrowhead: cells before mitosis; filled arrowhead: cells undergoing mitotic rounding; arrow: cells after cell division;

Figure 3D shows analysis of the fraction of cell division after mitotic rounding (n= 12 fields, 124-185 cells/ condition) ;

Figure 3E shows Alexa647 EGF uptake analyzed by FACS in A549-EGFR cells (n=2);

Figure 4A illustrates the comparison of mini- IAA7-mEGFP and mEGFP-miniIAA7 as N-terminal tags in depleting endogenous XECb1b. Scheme showing establish- ment of A431 cell lines using miniIAA7-mEGFP (1.) or mEGFP-miniIAA7 (2.) to tag endogenous SEC61B N- terminally;

Figure 4B shows relative GFP intensities ana- lyzed by FACS in homozygously tagged Ctrl cells at 0 h IAA (n=3) ;

Figure 4C shows live cell airyscan images showing similar endoplasmic reticulum localization of tagged proteins;

Figure 4D shows mean GFP intensities analyzed by FACS in cells with indicated endogenously miniIAA7- tagged Sec61B and auxin-perceptive proteins or Ctrl (n=3 ) ;

Figure 5A illustrates depletion of endogenous transmembrane, cytoplasmic and nuclear proteins using AtAFB2-miniIAA7 system. Scheme for N- or C-terminal tagging of endogenous target locus with miniIAA7- mEGFP;

Figure 5B is an illustration of subcellular localization of target proteins. Numbers represent transmembrane segments; ER: endoplasmic reticulum; LD: lipid droplet; LE : late endosome; N: nucleus; PM: plasma membrane; PX: peroxisome; Figure 5C shows relative target protein lev- els analyzed by FACS of mean GFP intensity in Ctrl cell lines at 0 h IAA. All targets were tagged homozy- gously in A431 cells (n=3-5) ;

Figure 5D shows mean GFP intensity analyzed by FACS in cells with endogenously miniIAA7-tagged targets and indicated auxin-perceptive proteins or Ctrl (n=3-5) ;

Figure 5E is a scheme for increasing AtAFB2 nuclear localization (upper panel) and images of AtAFB2-mCherry without NLS, with weak or strong NLS in A431 cells;

Figure 5F shows mean GFP intensity analyzed by FACS in cells with endogenously miniIAA7-tagged nu- clear proteins and different AtAFB2-mCherry constructs (n=3 ) ;

Figures 5G-L show loss-of-function phenotypes in cells with proteins targeted for degradation using the AtAFB2-miniIAA7 system. Fig. 5G: Auxin-inducible reduction in glucose uptake in cells with tagged Glutl (n=9) ; Fig. 5H, phalloidin staining showing auxin- inducible changes in F-actin structures in cells with tagged NMIIa. Maximum intensity projections of decon- volved widefield images are shown; Fig. 51, widefield images of filipin stained cells showing auxin- inducible perinuclear cholesterol accumulation in cells with tagged NPC1; Fig. 5J, LD540 staining of li- pid droplets showing auxin-inducible changes in LDs in cells with tagged seipin. Right: quantification of fraction of tiny LDs <0.05 urn ² / cell. Data represent mean ± SEM (n>200 cells per condition); Fig. 5K, aux- in-inducible reduction in cellular cholesterol content in cells with tagged LBR (n=4); Fig. 5L, auxin- inducible reduction in peroxisomal membrane proteins in cells with tagged PEX3. Top left: western blot analysis of endogenous PMP70 levels. Top right and bottom: Images and quantification of overexpressed PMP22-mCardinal fluorescence;

Figures 6A and 6B show characterization of AtTIRl, AtAFB2 and miniIAA7 through atomistic molecu- lar dynamics simulations. Fig. 6A, schematic represen- tation, and Fig. 6B, table characterizing the amino acid residues of IAA binding pocket involved in IAA binding in AtTIRl and AtAFB2 by simulations (n=5) . At- TIRl backbone is shown in the background as transpar- ent. IAA is depicted in van der Waals representation. Residues defining IAA binding pockets are illustrated in blue/licorice representation, with AtTIRl residues in darker blue and AtAFB2 residues in lighter blue. Residue numbers refer to those of AtTIRl. Residues in larger font represent ones involved in interaction with IAA in the simulations and in the crystal struc- ture (PDB ID: 2P1P) , red residue numbers represent ones involved in IAA interaction in AtTIRl but not in AtAFB2. Degrons miniIAA7-Vl and -V2 are schematically illustrated in Fig. 6F;

Figures 6C and 6D are representative snap- shots highlighting miniIAA7-Vl and -V2 degrons in the indicated complexes at the end of 1 ms simulations (n=5) . Magenta: N-terminal KR dipeptide; brown: aa. 95-104; pink: C-terminal extension after S104;

Figure 6E shows secondary structure plots for each amino acid of miniIAA7-Vl and miniIAA7-V2. The values describing the probability of observing different secondary structures (alpha helix, coil, be- ta sheet, turn) have been averaged over the simulation period and replicas (n=5) ; and

Figure 6F shows FACS analysis of mean GFP in- tensities at 0 h (black), 1 h (grey) and 16 h (no fill) IAA in cells expressing AtAFB2 and seipin-mEGFP with the indicated truncated AtIAA7 degron inser- tions (n=2-3) . Ctrl: seipin-mEGFP without degron. *: KR dipeptide in domain II. The results show that a mini- mal degron with similar performance to miniIAA7 locat- ed in aa .82-101.

DETAILED DESCRIPTION

A polynucleotide comprising a nucleotide se- quence encoding a degradation signal peptide is dis- closed .

With the polynucleotide encoding the degrada- tion signal peptide, nucleic acid cassette, vector, system and methods according to one or more embodi- ments described in this specification, and by using an inducer such as auxin or an auxin analogue, it may be possible to deplete target polypeptides or proteins in mammalian and other host cells rapidly and highly ef- ficiently, i.e. to target them to rapid degradation. Relatively high depletion efficiencies after e.g. only 1 hour of adding auxin or an auxin analogue may be achieved .

In some embodiments, half-times of minutes may be achieved, and the targeted proteins may be de- pleted to very low, even nearly background levels. Therefore, the depletion may lead to clear phenotypes in the host cell or organism. The inducer, i.e. auxin, such as the commonly used inducer indole-3-acetic acid (IAA), or auxin analogue, may be relatively safe, eco- nomical, small in size, may be applied to a culture medium and may be reversible by washing. Few or no growth defects are typically observed, and little or no differential gene activity are typically detected in cultured cells.

It may also be possible to avoid at least partial basal degradation of the target polypeptide or protein, i.e. constitutive depletion, or reduce the extent of the at least partial basal degradation. How- ever, the extent of basal degradation may be specific to content and target polypeptide or protein. At least partial basal degradation may be challenging to com- pletely avoid, so there may in most cases be at least some basal degradation.

In the context of this specification, the term "basal degradation" may be understood as refer- ring to constitutive depletion, i.e. to degradation of the target polypeptide or protein that may occur in the absence of an inducer. Each polypeptide or protein may have a an intrinsic degradation rate, i.e. protein turnover, that is characteristic of the polypeptide or protein and is due to the cellular machinery, e.g. the proteolytic machinery, and its normal biochemical functioning. However, the presence of a functional auxin perceptive protein, polynucleotide, polypeptide or protein, fusion protein, expression cassette, vec- tor or system according to one or more embodiments de- scribed in this specification may (but does not neces- sarily) increase the extent of the degradation. Thus "basal degradation" and/or the extent thereof may, at least in some embodiments, be understood as referring to constitutive depletion, i.e. to degradation of the target polypeptide or protein that may occur in the absence of an inducer but in the presence of a func- tional auxin perceptive protein, polynucleotide, poly- peptide or protein, fusion protein, expression cas- sette, vector or system according to one or more em- bodiments described in this specification, for example in an otherwise comparable host cell. In other words, the term "basal degradation" may be understood as re- ferring to the degradation of a target polypeptide or protein in the presence of a functional inducible sys- tem for depletion of the target polypeptide or protein in an uninduced state, i.e. in the absence of an in- ducer. The basal degradation may thus be understood as accelerated degradation (as compared to the intrinsic degradation) caused by the uninduced interaction of the degradation signal peptide with the functional auxin perceptive protein. In other words, the basal degradation or the extent thereof may be calculated, for example, by measuring the proportion of the amount of the degraded target polypeptide or protein relative to the amount of the target polypeptide or protein in the absence of a functional auxin perceptive protein in the host cell (s) , tissue or organism.

In an embodiment, basal degradation of the target polypeptide or protein is at most 50 %, or at most 40 %, or at most 30 %, or at most 20 %, or at most 15 %, in the absence of an inducer but optional- ly in the presence of a functional auxin perceptive protein, the polynucleotide, the polypeptide, the ex- pression cassette, the vector, and/or of the system according to one or more embodiments described in this specification. In other words, the target polypeptide or protein is present at a level that is at most 50 %, or at most 40 %, or at most 30 %, or at most 20 %, or at most 15 %, lower in the absence of an inducer but optionally in the presence of a functional auxin per- ceptive protein, the polynucleotide, the polypeptide, the expression cassette, the vector, and/or of the system according to one or more embodiments described in this specification, in a host cell, for example in a host cell according to one or more embodiments de- scribed in this specification.

Furthermore, it may be possible to deplete target polypeptides or proteins that may be otherwise challenging to deplete, for example membrane proteins and other large proteins, or proteins the basal degra- dation of which is highly deleterious to cells.

The depletion is not particularly sensitive to higher temperatures, for example to a temperature of about 37 °C typical for maintaining mammalian cells .

The degradation signal peptide may be rela- tively short and therefore may minimize any interfer- ence to the function of the target polypeptide or pro- tein, or a moiety capable of associating with the tar- get polypeptide or protein, to which it is fused.

Furthermore, degradation signal peptides which do not contain the PB1 domain of AtlAAs or amino acid sequences thereof appear to be highly efficient.

The degradation signal peptides appear to be highly efficient, when used together with AtAFB2 as the functional auxin perceptive protein.

In the context of this specification, the terms "degradation signal peptide", "destabilizing do- main", "auxin-inducible destabilizing domain", "degron" or "degron tag" may refer to a peptide, a polypeptide or a protein that is capable of targeting it and any protein or polypeptide fused to it or oth- erwise associated with it for degradation by the pro- teasome. These terms may be used interchangeably.

Generally, the term "peptide" may be under- stood as referring to a peptide chain of about 2 to 50 amino acid residues, and the term "protein" as refer- ring to a peptide chain of more than 50 amino acid residues. The term "polypeptide" may commonly be used to refer to a peptide chain of any length, or e.g. to a peptide chain of about 10 to 100 amino acid resi- dues. However, the term "peptide" may also be used to denote a peptide chain of at least 2 amino acid resi- dues, not limited to any particular length. Therefore, as a skilled person is aware, there may be a great deal of overlap between these terms, and they may be used interchangeably at least to some extent. The terms "peptide", "polypeptide" and "protein" are therefore not intended to define peptide chains of any particular length, unless otherwise indicated. The phrase "polypeptide or protein" is intended to cover peptide chains of any possible length.

In the context of this specification, the term "polynucleotide" may be understood as referring to a chain of nucleotides, such as DNA and/or RNA, of any length. The polynucleotide may be, for example, DNA, RNA, cDNA, mRNA, or any combination thereof. The polynucleotide may be, for example, linear, circular or branched. The nucleotides of the polynucleotide may be naturally occurring and/or synthetic nucleotides, for example nucleotide analogues. The polynucleotide may also comprise one or more modifications, for exam- ple a label.

In the context of this specification, the term "nucleotide sequence encoding a degradation sig- nal peptide" may be understood as referring both to the nucleotide (i.e. a polynucleotide or a part there- of) as well as to its amino acid sequence.

The terms "depleting" or "depletion" may be understood as referring to a reduction in the amount and/or concentration of a target polypeptide or pro- tein, for example in a host cell or transgenic organ- ism. The depletion may be achieved by targeted, induc- ible degradation of the target polypeptide or protein, for example using an AID system. The depletion may thus be induced by using an inducer. In the context of this specification, the terms "inducible degradation" or "inducibly degrade" may thus be understood as de- pletion, i.e. degradation of the target polypeptide or protein that may be caused by the presence and/or ad- dition of an inducer, e.g. an auxin or an auxin ana- logue. Various examples of depletion, i.e. inducible degradation are described in this specification. The depletion may further require the presence of a func- tional auxin perceptive protein, polynucleotide, poly- peptide or protein, fusion protein, expression cas- sette, vector or system according to one or more em- bodiments described in this specification.

The terms "depleting" or "depletion" may be understood as referring to partial or complete deple- tion. 100 %, i.e. complete, depletion of a protein may be challenging to achieve, so typically depletion ef- ficiencies lower than 100 % or 1, i.e. partial deple- tion, are achieved. Thus the word "depleting" or "de- pletion" may not be understood as referring to com- plete depletion, unless specifically mentioned as such. The depletion efficiency may be, for example, at least 50 %, or at least 60 %, or at least 70 %, or at least 80 %, or at least 90 %, at a given time period, for example within 1 hour. The depletion efficiency may be calculated, for example, by measuring the pro- portion of the amount of the depleted target polypep- tide or protein relative to the amount of the target polypeptide or protein at time point 0 (i.e. immedi- ately before the addition of the inducer) , or relative to the amount of the target polypeptide or protein in the absence of a functional auxin perceptive protein in the host cell (s) , tissue or organism. In other words, the depletion efficiency may be calculated rel- ative to the amount of the target polypeptide or pro- tein in host cell (s) , tissue (s) or organism which does not express or contain a functional auxin perceptive protein. The amounts or levels of the target polypep- tide or protein may further be calculated and/or nor- malized relative to the amount or level of the target polypeptide or protein in control cells or organism without a functional auxin perceptive protein at time point 0 (i.e. immediately before the addition of the inducer) . This may also allow measuring the extent of possible basal degradation.

For instance, in the present Examples, target protein levels (amounts) have been measured without the presence of a functional auxin perceptive protein at 0 h IAA to normalize all the data. This also allows for measuring the extent of basal degradation. As shown in the Examples, the depletion efficiency may be calculated as the normalized level of the target poly- peptide or protein at an indicated IAA treatment time point compared to a control without a functional auxin perceptive protein at Oh IAA (or, in other embodi- ments, another inducer) . The depletion may include ba- sal degradation and/or inducible degradation. For ex- ample, if a target polypeptide or protein is present at 90% level at 0 h IAA as compared to a control not expressing a functional auxin perceptive protein, the basal depletion efficiency is 10%. After lh IAA, the target polypeptide or protein may be present at 5% level as compared to a control not expressing a func- tional auxin perceptive protein. Then the inducible degradation is 85%, and the total depletion efficiency is 95% (10% basal+85% inducible).

In the context of this specification, the term "target polypeptide", "target protein", or "tar- get gene" may be understood as referring to the poly- peptide, protein or gene of interest for depletion. The target gene may encode the target polypeptide or protein .

In the context of this specification, the term "inducer" may be understood as referring to an auxin, an auxin analogue, or any other agent capable of binding to a functional auxin perceptive protein, thereby inducing at least a partial depletion (induced degradation) of a target polypeptide or protein. Upon the binding, the functional auxin perceptive protein may bind to the degradation signal peptide, thereby inducing the art least partial depletion of the target polypeptide or protein.

In the context of this specification, the term "auxin" may be understood as referring to any compound belonging to the auxin class of plant hor- mones. The term may encompass auxins occurring natu- rally in plants, including indole-3-acetic acid (IAA), 4-chloroindole-3-acetic acid (4-CI-IAA) , 2- phenylacetic acid (PAA) , indole-3-butyric acid (IBA), and indole-3-propionic acid (IPA), as well as synthet- ic auxins, including 2 , 4-dichlorophenoxyacetic acid (2,4-D), -naphthalene acetic acid (a-NAA) , 2-methoxy- 3, 6-dichlorobenzoic acid (dicamba) , 4-amino-3, 5, 6- trichloropicolinic acid (tordon or picloram) , and 2 , 4 , 5-trichlorophenoxyacetic acid (2,4,5-T). The term "auxin analogue" may refer to a derivative of an aux- in. For example, the auxin analogue may comprise a de- rivative of IAA, such as those compounds having a sub- stituted moiety (not H) on the 4-position of the in- dole ring of IAA. Examples include e.g. 4-methyl- indole-3-acetic acid (4-Me-IAA) , 4-chloroindole-3- acetic acid (4-Cl-IAA) , or cvxIAA (5- (3- methoxyphenyl ) indole-3-acetic acid. Other auxins and/or auxin analogues may also be contemplated, found in nature or synthesized. The auxin and/or auxin ana- logue may be capable of binding to an auxin perceptive F-box protein, such as TIR1 and/or AFB2 (e.g. OsTIRl, AtAFB2 or other auxin perceptive F-box proteins de- scribed in this specification) , or a derivative there- of, such as AtTIRl F79G mutant or an F79G mutant of any other TIR1 protein. cvxAA and the AtTIRl F79G mu- tant have been described e.g. in Uchida et al . , Nature Chemical Biology 2018, 14, 299-305.

In the context of this specification and in the context of any product, method or use disclosed herein, the terms "host cell" and/or "host genome" may be understood as referring to a host cell or host ge- nome of any genus or species. The host cell may be an animal cell or a fungal cell. The host genome may be an animal genome or a fungal genome. The host cell may be a eukaryotic cell. The host genome may be a eukary- otic genome. The host cell may be a mammalian cell, for example a human, murine, bovine, ovine, porcine, feline, canine, equine, or primate cell; a nematode cell; a fish cell; or an insect cell. The host genome may be the genome of any one of the host cells and/or transgenic organisms described in this specification. The host genome may be a mammalian genome, for example a human, murine, bovine, ovine, porcine, feline, ca- nine, equine, or primate genome; a nematode genome; a fish genome; or an insect genome. In an embodiment, the host cell is a host cell or eukaryotic cell other than a plant cell. In an embodiment, the host genome is a genome or eukaryotic genome other than a plant genome .

The degradation signal peptide may have an amino acid sequence comprising a sequence that is at least 75 % identical, or at least 80 % identical, or at least 85 % identical, or at least 90 %, or at least 95 % identical, or 100 % identical, to a sequence cor- responding to amino acid residues at positions

84-98 of SEQ ID NO: 1 (AtIAA7 ) ,

66-80 of SEQ ID NO: 2 (AtIAA3 ) ,

84-98 of SEQ ID NO: 3 (AtIAA17 ) ,

78-92 of SEQ ID NO: 4 (AtIAA14 ) ,

55-69 of SEQ ID NO: 5 (AtIAA5 ) , or

167-181 of SEQ ID NO: 6 (AtIAA8 ) ;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

Such a sequence, and various embodiments thereof described below, may be considered a core se- quence. The core sequence may provide the functionali- ty of the degradation signal peptide. Other parts and sequences of the polynucleotide may or may not affect the functionality, efficiency etc. of the degradation signal peptide the sequence encodes.

To determine the extent of identity of two sequences, methods of alignment are well known in the art. Thus, the determination of percent identity be- tween any two sequences can be accomplished using a mathematical algorithm such as the algorithm described by Lipman and Pearson (Science 1985, 227(4693), 1435-

1441) . For example, the ClustalW or ClustalW software may be used for the alignment. The sequences set forth in this specification are provided as non-limiting ex- amples. A person skilled in the art will appreciate that other sequences, e.g. paralogs or orthologs, and providing the same activity or functionality may be found in other species or genetic backgrounds or pro- duced artificially; these sequences may be considered substantially similar, i.e. representing functional and structural equivalents. The percentage identity may be relative to the full length of the reference sequence to which the sequence in question is com- pared, or based on a partial alignment.

The term "functionally and/or structurally equivalent thereto" may, in the context of this speci- fication, be understood as referring to a degradation signal peptide that does not necessarily have the same sequence or sequence identity defined in one of more embodiments described in this specification, but which is capable of performing the same function in substan- tially the same way. The functional and/or structural equivalent may have substantially the same secondary structure, fully or at least partially. However, it does not necessarily have exactly the same secondary structure. The structural equivalence of a degradation signal peptide may be assessed e.g. by molecular dy- namics simulations as described in the Examples of the present specification. For example, the C-terminal part of the degradation signal peptide may have a flexible coil structure, e.g. when interacting with a functional auxin perceptive protein capable of binding the degradation signal peptide in the presence of aux- in or an auxin analogue (e.g. AtAFB2) . This may be op- posed to e.g. an alpha-helical structure, which cer- tain IAA-derived degradation signal peptides, such as IAA7 extending to or beyond AA residue 124 of SEQ ID NO: 1, may adopt. The functional equivalence may be assessed by measuring the functioning, e.g. as de- scribed in the Examples. The degradation signal peptide may have an amino acid sequence comprising a sequence that is at least 75 % identical, or at least 80 % identical, or at least 85 % identical, or at least 90 %, or at least 95 % identical, or 100 % identical, to a sequence cor- responding to amino acid residues

84-99 of SEQ ID NO: 1 (AtIAA7 ) ,

66-81 of SEQ ID NO: 2 (AtIAA3 ) ,

84-99 of SEQ ID NO: 3 (AtIAA17 ) ,

78-93 of SEQ ID NO: 4 (AtIAA14 ) ,

55-70 of SEQ ID NO: 5 (AtIAA5 ) , or

167-182 of SEQ ID NO: 6 (AtIAA8 ) ;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

The degradation signal peptide may have an amino acid sequence comprising a sequence that is at least 75 % identical, or at least 80 % identical, or at least 85 % identical, or at least 90 %, or at least 95 % identical, or 100 % identical, to a sequence cor- responding to amino acid residues

84-100 of SEQ ID NO: 1 (AtIAA7 ) ,

66-82 of SEQ ID NO: 2 (AtIAA3 ) ,

84-100 of SEQ ID NO: 3 (AtIAA17 ) ,

78-94 of SEQ ID NO: 4 (AtIAA14 ) ,

55-71 of SEQ ID NO: 5 (AtIAA5 ) , or

167-183 of SEQ ID NO: 6 (AtIAA8 ) ;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

The degradation signal peptide may have an amino acid sequence comprising a sequence that is at least 75 % identical, or at least 80 % identical, or at least 85 % identical, or at least 90 %, or at least 95 % identical, or 100 % identical, to a sequence cor- responding to amino acid residues

84-101 of SEQ ID NO: 1 (AtIAA7 ) ,

66-83 of SEQ ID NO: 2 (AtIAA3 ) ,

84-101 of SEQ ID NO: 3 (AtIAA17 ) , 78-95 of SEQ ID NO: 4 (AtIAA14),

55-72 of SEQ ID NO: 5 (AtIAA5 ) , or

167-184 of SEQ ID NO: 6 (AtIAA8 ) ;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

The degradation signal peptide may comprise or consist of a sequence represented by formula I

X ₂ X ₂ VGWPPX ₃ X ₄ X ₅ X ₅ X ₇ X ₈

Formula I wherein

X ₁ is Q or absent;

X ₂ is absent, V, I, A, or L;

X3 is V, I, L, G, or A;

X ₄ is R, C, or K;

X ₅ is N or S;

C ₆ is Y, F, or W;

X7 is R or K; and

X8 is K or R.

The sequence represented by formula I may thus form a subsequence of the degradation signal pep- tide and/or the core sequence. The degradation signal peptide may further comprise one or more additional ( sub) sequences preceding or following the sequence represented by formula I . The one or more additional subsequences may immediately precede and/or immediate- ly follow the sequence represented by formula I. Exam- ples of such additional subsequences are described be- low in this specification.

The ( sub) sequence represented by formula I may be selected from the following (i.e. the degrada- tion signal peptide may comprise or consist of a se- quence selected from the following, or an amino acid sequence comprising a sequence that is at least 75 % identical, or at least 80 % identical, or at least 85 % identical, or at least 90 %, or at least 95 % iden- tical, or 100 % identical to the following, or it may be a degradation signal peptide functionally and/or structurally equivalent thereto) :

QVVGWPPVRNYRK (SEQ ID NO: 7),

QVVGWPPVRSYRK (SEQ ID NO: 8),

QIVGWPPVRSYRK (SEQ ID NO: 9),

QIVGWPPIRSYRK (SEQ ID NO: 10),

QVVGWPPIRSYRK (SEQ ID NO: 11),

QVVGWPPIRSFRK (SEQ ID NO: 12),

QVVGWPPVCSYRR (SEQ ID NO: 13),

QAVGWPPVCSYRR (SEQ ID NO: 14), and

QVVGWPPVRSYRR (SEQ ID NO: 15) .

The ( sub) sequence represented by formula I may be followed by a ( sub) sequence represented by for- mula II

X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ X ₁₈

Formula II wherein

X ₉ is N, S, T, K, or R;

X ₁₀ is M, I, V, N, S, T, or L;

X ₁₁ is M, I, L, V, S, or T;

X12 is T, A, V, G, Q, H, S, L, F, or I;

X13 is absent, Q, N, H, T, S, A, E, P, I, or

L;

X ₁₄ is absent, Q, P, C, S, Y, K, N, R, or T;

X ₁₅ is absent, K, Q, T, P, S, N, or R;

X ₁₆ is absent, S, N, T, K, P, or A; and X ₁₇ is absent, S, G, A, P, E, T, N, K, or R;

X ₁₈ is absent, S, E, T, G, or N.

The ( sub) sequence represented by formula I may be immediately followed by the ( sub) sequence rep- resented by formula II, or they may be linked e.g. via a linker. For example, the linker may be a linker of at least one amino acid residue, or 1-5, 2, 3, 4, or 5, or 1-3 amino acid residues, or 1 amino acid resi- due .

The degradation signal peptide may comprise or consist of a sequence represented by formula I

X ₂ X ₂ VGWPPX ₃ X ₄ X ₅ X ₆ X ₇ X ₈

Formula I wherein

X ₁ is Q or absent;

X ₂ is absent, V, I, A, or L;

X3 is V, I, L, G, or A;

X ₄ is R, C, or K;

X ₅ is N or S;

C ₆ is Y, F, or W;

X7 is R or K; and

Xs is K or R; optionally followed by a sequence represented by formula II

X ₉ X ₁₀ X ₁₁ X ₁₂ X ₁₃ X ₁₄ X ₁₅ X ₁₆ X ₁₇ X ₁₈

Formula II wherern

X9 is N, S, T, K, or R;

X10 i s M, I, V, N, S, T, o L;

X11 i s M, I, L, V, S, or T

X12 i s T, A, V, G, Q, H, S L, F, or I;

Xi3 i s absent, Q, N, H, T, S, A, E, P, I, or

L;

X ₁₄ i s absent, Q, P, C, S, Y, K, N, R, or T; X ₁₅ i s absent, K, Q, T, P, S, N, or R; X ₁₆ i s absent, S, N, T, K, P, or A; and

X ₁₇ i s absent, S, G, A, P, E, T, N, K, or R; X _{18 i s absent, S, E, T, G, or N;} or it may be a degradation signal peptide functionally and/or structurally equivalent thereto. In this embodiment, the ( sub) sequence represented by formula I may be immediately followed by the ( sub) sequence represented by formula II, or they may be linked e.g. via a linker. For example, the linker may be a linker of at least one amino acid residue, or 1-5, 2, 3, 4, or 5, or 1-3 amino acid residues, or 1 amino acid residue.

The ( sub) sequence represented by formula II may, in some embodiments, be selected from the follow- rng :

NMMT (SEQ ID NO: 16) ,

NIMT (SEQ ID NO: 17) ,

NUT (SEQ ID NO: 18) ,

NVMA (SEQ ID NO: 19) ,

NIMA (SEQ ID NO: 20) ,

SVMA (SEQ ID NO: 21) ,

TVMA (SEQ ID NO: 22) ,

NVMV (SEQ ID NO: 23) ,

NMMV (SEQ ID NO: 24) ,

NVMG (SEQ ID NO: 25) ,

NVLV (SEQ ID NO: 26) ,

NNIQ (SEQ ID NO: 27) ,

NNVQ (SEQ ID NO: 28) ,

NNIH (SEQ ID NO: 29) ,

NTMA (SEQ ID NO: 30) ,

NTMS (SEQ ID NO: 31) ,

KNSL (SEQ ID NO: 32) ,

KNSF (SEQ ID NO: 33) .

The ( sub) sequence represented by formula II may, in some embodiments, be selected from the follow- rng :

NMMTQQK (SEQ ID NO: 34),

NIMTQQK (SEQ ID NO: 35),

NIMTNQK (SEQ ID NO: 36),

NIITQQK (SEQ ID NO: 37), NVMANQK (SEQ ID NO: 38),

NIMANQK (SEQ ID NO: 39),

SVMAHQK (SEQ ID NO: 40),

TVMATQK (SEQ ID NO: 41),

NVMAQPK (SEQ ID NO: 42),

NVMVSCQK (SEQ ID NO: 43),

NMMVSCQK (SEQ ID NO: 44),

NVMGSCQK (SEQ ID NO: 45),

NVLVSSQK (SEQ ID NO: 46),

NVMGSYQK (SEQ ID NO: 47),

NMMVA-QK (SEQ ID NO: 48),

NNIQSKK (SEQ ID NO: 49),

NNIQTKK (SEQ ID NO: 50),

NNVQTKK (SEQ ID NO: 51),

NNIQIKK (SEQ ID NO: 52),

NNIHTKK (SEQ ID NO: 53),

NTMASSTSK (SEQ ID NO: 54),

NTMASS-SK (SEQ ID NO: 55),

NTMASNPSK (SEQ ID NO: 56),

NTMATNPSK (SEQ ID NO: 57),

NTMAANPSK (SEQ ID NO: 58),

NTMSSQSSK (SEQ ID NO: 59),

NTMASNPPK (SEQ ID NO: 60),

NTMAPNPSK (SEQ ID NO: 61),

NTMASNSAK (SEQ ID NO: 62),

NTMANNSSK (SEQ ID NO: 63),

KNSLERTK (SEQ ID NO: 64),

KNSLEQTK (SEQ ID NO: 65),

KNSFERTK (SEQ ID NO: 66) .

In the above, refers to an amino acid that is absent, i.e. not present.

In an embodiment, the degradation signal pep- tide may comprise or consist of a ( sub) sequence repre- sented by formula I according to one or more embodi- ments described in this specification, followed by a ( sub) sequence represented by formula II according to one or more embodiments described in this specifica- tion.

The degradation signal peptide may comprise or consist of a sequence represented by formula III

X ₁ X ₂ VGWPPX ₃ X ₄ X ₅ X ₆ X7X ₈ X ₉ X ₁₀ X ₁₁ X ₁₂ Formula III wherein X ₃ is Q or absent;

X ₂ is absent, V, I, A, or L;

X ₃ is V, I, L, G, or A;

X ₄ is R, C, or K;

X ₅ is N or S;

C ₆ is Y, F or W;

X ₇ is R or K;

X8 is K or R;

X ₉ is N, S, T, K, or R;

X ₁₀ is M, I, V, N, S, T, or L;

Xu is M, I, L, V, S, or T; and

Xi ₂ is T, A, V, G, Q, H, S, L, F, or I.

The degradation signal peptide may comprise or consist of a sequence represented by formula IV

X ₁ X ₂ VGWP PX ₃ X ₄ X ₅ X ₆ X ₇ X ₈ X ₉ X _{1 0} X _{1 1} X _{1 2} X _{1 3} X _{1 4} X _{1 5} X _{1 6} X _{1 7} X _{1 8} Formula IV wherein

X ₁ is Q or absent;

X ₂ is absent, V, I, A, or L;

X ₃ is V, I, L, G, or A;

X ₄ is R, C, or K;

X ₅ is N or S;

C ₆ is Y, F, or W;

X ₇ is R or K; and

X ₈ is K or R;

X ₉ is N, S, T, K, or R;

X ₁₀ is M, I, V, N, S, T, or L; Xu is M, I, L, V, S, or T;

X ₁₂ is T, A, V, G, Q, H, S, L, F, or I;

X ₁₃ is absent, Q, N, H, T, S, A, E, P, I, or

L;

X ₁₄ is absent, Q, P, C, S, Y, K, N, R, or T;

X ₁₅ is absent, K, Q, T, P, S, N, or R;

X ₁₆ is absent, S, N, T, K, P, or A; and

X ₁₇ is absent, S, G, A, P, E, T, N, K, or R;

X ₁₈ is absent, S, E, T, G, or N;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

The sequence represented by formula III may be selected from the following (i.e. the degradation signal peptide may comprise or consist of an amino ac- id sequence selected from the following) , or the deg- radation signal peptide may be a degradation signal peptide functionally and/or structurally equivalent thereto :

Extending the degradation signal peptide to the PB1 domain of IAAs, which in AtIAA7 starts at AA position 124 of SEQ ID NO: 1, may significantly reduce depletion efficiency. Corresponding positions at which the PB1 domain may be considered to start in other AtIAAs are position 92 in SEQ ID NO: 2 (AtIAA3 ) , 110 of SEQ ID NO: 3 (AtIAA17 ) , 110 of SEQ ID NO: 4 (Atl-

AA14 ) , 76 of SEQ ID NO: 5 (AtIAA5 ) , and/or 199 of SEQ

ID NO: 6 (AtIAA8) . Therefore excluding sequences starting from these positions and/or corresponding AAs from the degradation signal peptide may be desirable, as it may achieve improved depletion efficiency. In other words, the polynucleotide and/or the nucleotide sequence encoding the degradation signal peptide may not comprise a sequence encoding the PB1 domain or a portion thereof. Said portion thereof may comprise or consist of a stretch of at least 1, or at least 2, or at least 3, or at least 4 first amino acids of the PB1 domain .

The amino acid sequence of the degradation signal peptide may therefore, in some embodiments, not comprise a ( sub) sequence starting at amino acid resi- dues corresponding to positions

124 of SEQ ID NO: 1 (AtIAA7 ) ,

92 of SEQ ID NO: 2 (AtIAA3 ) ,

110 of SEQ ID NO: 3 (AtIAA17 ) ,

110 of SEQ ID NO: 4 (AtIAA14 ) ,

76 of SEQ ID NO: 5 (AtIAA5 ) , or

199 of SEQ ID NO: 6 (AtIAA8 ) ,

or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % iden- tical to said sequence. In other words, the C-terminal part of the degradation signal peptide may not extend to the amino acid residues corresponding to these po- sitions and optionally to the amino acid residues fol- lowing them.

In other words, in an embodiment, the amino acid sequence of the degradation signal peptide ends at a residue corresponding to an amino acid residue in the range of amino acid residues

98-123, or 99-123, or 100-123, or 101-122 of SEQ ID NO: 1 (AtIAA7 ) ,

80-91, or 81-91, or 82-91, or 83-90 of SEQ ID NO: 2 (AtIAA3 ) ,

98-109, or 99-109, or 100-109, or 101-108 of SEQ ID NO: 3 (AtIAA17 ) ,

92-109, or 93-109, or 94-109, or 95-108 of SEQ ID NO: 4 (AtIAA14 ) ,

69-75, or 70-75, or 71-75, or 72-74 of SEQ ID NO: 5 (AtIAA5 ) , or

181-198, or 182-198, or 183-198, or 184-197 of SEQ ID NO: 6 (AtIAA8 ) .

In this context, the phrase "ends at a resi- due" may be understood such that said residue (at which the sequence ends) is the last residue of the amino acid sequence of the degradation signal peptide. The amino acid sequence of the degradation signal pep- tide may thus be understood as comprising at least a partial sequence of the sequence set forth in the cor- responding SEQ ID preceding the residue at which the sequence ends. Said residue may be followed by other amino acid residue (s) and/or sequence (s), for example one forming a part of a linker, a tag, a target poly- peptide or protein, a moiety capable of associating with a target polypeptide or protein, or any other suitable polypeptide or protein.

In an embodiment, the residue at which the sequence ends does not necessarily have to be the ex- act amino acid residue of the corresponding SEQ ID NO: 1-6, but it may also be e.g. a conservative amino acid substitution thereof. Various examples of such resi- dues, substitutions and sequences are described in this specification.

In the context of this specification, the phrase of the format "aa:s (or AA:s) (i.e. amino acid residues) 84-98 of SEQ ID NO: 1 may be understood as referring to amino acid residues at positions 84-98 of SEQ ID NO: 1, i.e. amino acid residues corresponding to those at positions 84-98 of SEQ ID NO: 1.

The degradation signal peptide may (but does not necessarily) further comprise an additional pre- ceding subsequence.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-83, or 1-82, or 1-81, or 35-83, or 35-82, or 35-81, of SEQ ID NO: 1 (AtIAA7), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the core sequence or be linked thereto via a linker, for example any linker described in this specification. The additional preceding subsequence may thus end at an amino acid residue at position 83, 82 or 81 of SEQ ID NO: 1.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-65, or 1-64, or 1-63, or 37-65, or 37-64, or 37-63, of SEQ ID NO: 2 (AtIAA3), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the sequence or be linked thereto via a linker, for example any linker described in this specification. The additional pre- ceding subsequence may thus end at an amino acid resi- due at position 65, 64 or 63 of SEQ ID NO: 2.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-83, or 1-82, or 1-81, or 31-83, or 31-82, or 31-81, of SEQ ID NO: 3 (AtIAA17), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the sequence or be linked thereto via a linker, for example any linker described in this specification. The additional pre- ceding subsequence may thus end at an amino acid resi- due at position 83, 82 or 81 of SEQ ID NO: 3.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-77, or 1-76, or 1-75, or 30-77, or 30-76, or 30-75, of SEQ ID NO: 4 (AtIAA14), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the sequence or be linked thereto via a linker, for example any linker described in this specification. The additional pre- ceding subsequence may thus end at an amino acid resi- due at position 77, 76 or 75 of SEQ ID NO: 4.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-54, or 1-53, or 1-52, or 35-54, or 35-53, or 35-52, of SEQ ID NO: 5 (AtIAA5), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the sequence or be linked thereto via a linker, for example any linker described in this specification. The additional pre- ceding subsequence may thus end at an amino acid resi- due at position 54, 53 or 52 of SEQ ID NO: 5.

The additional preceding subsequence may com- prise or consist of a sequence starting at an amino acid residue (position) in the range of amino acid residues corresponding to amino acid residues at posi- tions 1-166, or 1-165, or 1-164, or 35-166, or 35-165, or 35-164 of SEQ ID NO: 6 (AtIAA8), or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 % identical thereto. The additional preceding subsequence may immediately precede the sequence or be linked thereto via a linker, for example any linker described in this specification. The additional pre- ceding subsequence may thus end at an amino acid resi- due at position 166, 165 or 164 of SEQ ID NO: 6.

In an embodiment, the degradation signal pep- tide may comprise or consist of a ( sub) sequence repre- sented by formula I according to one or more embodi- ments described in this specification, optionally fol- lowed by a (sub) sequence represented by formula II ac- cording to one or more embodiments described in this specification, and an additional preceding subsequence according to one or more embodiments described in this specification .

In an embodiment, the degradation signal pep- tide may comprise or consist of a ( sub) sequence repre- sented by formula I according to one or more embodi- ments described in this specification, (optionally) followed by a ( sub) sequence represented by formula II according to one or more embodiments described in this specification, and preceded by an additional preceding subsequence according to one or more embodiments de- scribed in this specification.

The amino acid sequence of the degradation signal peptide may comprise or consist of a sequence - starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-84, or 1-83, or 1-82, or 1-81, or 35-83, or 35-82, or 35-81, of SEQ ID NO: 1 (AtIAA7), and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 98-123, or 99-123, or 100-123, or 101-122 of SEQ ID NO: 1 (AtIAA7 ) ;

- starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-66, or 1-65, or 1-64, or 1-63, or 37-65, or 37-64, or 37-63, of SEQ ID NO: 2 (AtIAA3) , and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 80-91, or 81-91, or 82-91, or 83-90 of SEQ ID NO: 2 (AtIAA3 ) ;

- starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-84, or 1-83, or 1-82, or 1-81, or 31-83, or 31-82, or 31-81, of SEQ ID NO: 3 (AtIAA17), and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 98-109, or 99-109, or 100-109, or 101-108 of SEQ ID NO: 3 (AtIAA17);

- starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-78, or 1-77, or 1-76, or 1-75, or 30-77, or 30-76, or 30-75, of SEQ ID NO: 4 (AtIAA14), and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 92-109, or 93-109, or 94-109, or 95-108 of SEQ ID NO: 4 (AtIAA14);

- starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-55, or 1-54, or 1-53, or 1-52, or 34-54, or 34-53, or 34-52, of SEQ ID NO: 5 (AtIAA5) , and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 69-75, or 70-75, or 71-75, or 72-74 of SEQ ID NO: 5 (AtIAA5 ) ;

- starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-167, or 1-166, or 1-165, or 1-164, or 107-166, or 107-165, or 107-164 of SEQ ID NO: 6 (AtIAA8), and ending at a residue correspond- ing to an amino acid residue in the range of amino ac- id residues at positions 181-198, or 182-198, or 183- 198, or 184-197 of SEQ ID NO: 6 (AtIAA8 ) ;

or sequences at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical thereto;

or it may be a degradation signal peptide functionally and/or structurally equivalent thereto.

In the above embodiments, the amino acid se- quence of the degradation signal peptide may be a con- tinuous sequence (a continuous series of amino acid residues) thus forming a part of SEQ ID NO: 1, 2, 3, 4, 5 or 6, or be a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to said sequence. Thus a sequence starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at spe- cific position (s) and ending at a residue correspond- ing to an amino acid residue in the range of amino ac- id residues at specific position (s) may be understood as also comprising the sequence of the respective SEQ ID NO between the starting and ending residues.

For example, the sequence starting at an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-84 of SEQ ID NO: 1 (AtIAA7), and ending at a residue corresponding to an amino acid residue in the range of amino acid residues at positions 98-123 of SEQ ID NO: 1 (AtIAA7), may be understood as being a continuous sequence extending from an amino acid residue in the range of amino acid residues corresponding to amino acid residues at positions 1-84 of SEQ ID NO: 1 to a residue corresponding to an amino acid residue in the range of amino acid residues at positions 98-123 of SEQ ID NO: 1. Said continuous sequence thus forms a continuous series of at least the amino acid residues 84-98 of SEQ ID NO: 1. It may, at least in some embod- iments, extend further along the sequence SEQ ID NO: 1 towards the N-terminus at positions 1-83 and/or to- wards the C-terminus at positions 99-123.

The length of the additional preceding subse- quence and/or the total length of the degradation sig- nal peptide is not particularly limited. For example, degradation signal peptides having a sequence corre- sponding to amino acid residues 35-104, 37-104, 37- 101, 37-98, 52-104, 76-104, 80-104, and 82-104 of SEQ ID NO: 1 may exhibit similar depletion efficiencies. A relatively short degradation signal peptide may be de- sirable e.g. for simpler constructions and fusions and/or for steric reasons, but a longer degradation signal peptide may also be contemplated.

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 84-98 of SEQ ID NO: 1 (AtIAA7) . In other embodiments, the sequence may be at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 83- 98, or 82-98, or 83-99, or 82-99, or 83-100, or 82- 100, or 83-101, or 82-101, or 83-102, or 82-102, or 83-103, or 82-103, or 83-104, or 82-104 of SEQ ID NO: 1 (AtIAA7); or it is a degradation signal peptide functionally and/or structurally equivalent thereto. Such degradation signal peptides exhibit relatively high depletion efficiencies.

In an embodiment, the amino acid sequence of the degradation signal peptide does not comprise a se- quence corresponding to amino acid residues at posi- tions 124-132 or 124-167 of SEQ ID NO: 1. In other words, the amino acid sequence of the degradation sig- nal peptide does not comprise a continuous sequence corresponding to amino acid residues at positions 124- 132 or 124-167 of the sequence set forth in SEQ ID NO: 1

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 66-80 of SEQ ID NO: 2 (AtIAA3) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto. In other em- bodiments, the sequence may be at least 75 %, or 80 %, or 85 %, or 90 %, or 95 % identical to a sequence cor- responding to amino acid residues at positions 65-80, or 64-80, or 65-81, or 64-81, or 65-82, or 64-82, or 65-83, or 64-83, or 65-84, or 64-84, or 65-85, or 64- 85, or 65-86, or 64-86 of SEQ ID NO: 2 (AtIAA3 ) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto.

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 84-98 of SEQ ID NO: 3 (AtIAA17); or it is a degradation signal peptide functionally and/or structurally equivalent thereto. In other em- bodiments, the sequence may be at least 75 %, or 80 %, or 85 %, or 90 %, or 95 % identical to a sequence cor- responding to amino acid residues at positions 83-98, or 82-98, or 83-99, or 82-99, or 83-100, or 82-100, or 83-101, or 82-101, or 83-102, or 82-102, or 83-103, or 82-103, or 83-104, or 82-104 of SEQ ID NO: 3 (Atl- AA17); or it is a degradation signal peptide function- ally and/or structurally equivalent thereto.

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 78-92 of SEQ ID NO: 4 (AtIAA14); or it is a degradation signal peptide functionally and/or structurally equivalent thereto. In other em- bodiments, the sequence may be at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corre- sponding to amino acid residues at positions 77-92, or 76-92, or 77-93, or 76-93, or 77-94, or 76-94, or 77- 95, or 76-95, or 77-96, or 76-96, or 77-97, or 76-97, or 77-98, or 76-98 of SEQ ID NO: 4 (AtIAA14 ) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto.

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 55-69 of SEQ ID NO: 5 (AtIAA5) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto. In other em- bodiments, the sequence may be at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corre- sponding to amino acid residues at positions 54-69, or 53-69, or 54-70, or 53-70, or 54-71, or 53-71, or 54- 72, or 53-72, or 54-73, or 53-73, or 54-74, or 53-74, or 54-75, or 53-75 of SEQ ID NO: 5 (AtIAA5) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto.

In an embodiment, the amino acid sequence of the degradation signal peptide comprises a sequence that is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corresponding to amino acid residues at positions 167-181 of SEQ ID NO: 6 (Atl- AA8); or it is a degradation signal peptide function- ally and/or structurally equivalent thereto. In other embodiments, the sequence may be at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to a sequence corre- sponding to amino acid residues at positions 166-181, or 165-181, or 166-182, or 165-182, or 166-182, or 165-182, or 166-183, or 165-183, or 166-184, or 165- 184, or 166-185, or 165-185, or 166-186, or 165-186, or 166-187, or 165-187 of SEQ ID NO: 6 (AtIAA8 ) ; or it is a degradation signal peptide functionally and/or structurally equivalent thereto.

The residue of the amino acid sequence corre- sponding to position 101 of SEQ ID NO: 1, to position 83 of SEQ ID NO: 2, to position 101 of SEQ ID NO: 3, to position 95 of SEQ ID NO: 4, to position 72 of SEQ ID NO: 5, or to position 184 of SEQ ID NO: 6 may be K, R or Q. In an embodiment, said residue may be K or R.

In an embodiment, the amino acid sequence of the degradation signal peptide is other than a se- quence corresponding to amino acid residues at posi- tions 63-109 of SEQ ID NO: 3 (AtIAA17), and/or a se- quence corresponding to AAs 68-132 of AtIAA17 (SEQ ID NO: 3) (i.e. mAID degron of 65 amino acids, referred herein to as miniAID) .

A polypeptide or protein is also disclosed, the polypeptide or protein comprising the degradation signal peptide encoded by the polynucleotide according to one or more embodiments described in this specifi- cation .

The polypeptide or protein may be a fusion polypeptide or a fusion protein comprising the degra- dation signal peptide fused to a target polypeptide or protein, for example directly or via a linker se- quence. The degradation signal peptide may be fused to the N-terminal part or to the C-terminal part of the target polypeptide or protein. Various suitable linker sequences, for example flexible linkers, are available to a skilled person. The skilled person may also se- lect, test and optimize the linker sequence and the fusion junction (s) such that it does not interfere with the function of the degradation signal peptide and/or of the target polypeptide or protein.

Other ways of attaching the degradation sig- nal peptide to the target polypeptide or protein may be contemplated.

An expression cassette comprising the polynu- cleotide according to one or more embodiments de- scribed in this specification is also disclosed. The expression cassette may comprise one or more sequences for expression in a host cell.

The polynucleotide may be operatively linked to the one or more sequences for expression in a host cell, and/or wherein the expression cassette comprises one or more sequences for introducing the nucleotide sequence encoding the degradation signal peptide and/or the polynucleotide to a host genome, optionally for fusing the polynucleotide to a target gene. The nucleotide sequence encoding the degradation signal peptide and/or polynucleotide, or parts thereof, and the target gene may thus form a genetic fusion, such that the degradation signal peptide and the target polypeptide or protein are translated into a single fusion polypeptide or protein. The one or more sequences for expression in a host cell may include one or more sequences that are sufficient to drive the expression of the nucleotide sequence encoding the degradation signal peptide, the polynucleotide and/or of the fusion formed by the nu- cleotide sequence encoding the degradation signal pep- tide and/or polynucleotide and the target gene in a suitable host cell or organism, such as a promoter se- quence. The term "promoter" may refer to a polynucleo- tide, for example DNA, which may be recognized and bound (directly or indirectly) by a DNA-dependent RNA- polymerase during initiation of transcription. A pro- moter may include a transcription initiation site, and binding sites for transcription initiation factors and RNA polymerase, and may comprise various other sites (e.g., enhancers), at which gene expression regulatory proteins may bind. Various promoters, terminator se- quences and other regulatory sequences for driving and/or regulating the expression in a host cell are available and may be selected based on e.g. the host cell or transgenic organism, the target polypeptide or protein, the desired specificity of expression and other considerations. In embodiments in which the nu- cleotide sequence encoding the degradation signal pep- tide and/or the polynucleotide is fused to a target gene, the (native) promoter and/or other sequences for the expression and/or regulation of the target gene may function as driving the expression of the fusion of the polynucleotide and the target gene.

The polynucleotide or the expression cassette may further comprise e.g. a linker sequence linking the nucleotide sequence encoding the degradation sig- nal peptide and the target gene or the nucleotide se- quence encoding the target polypeptide or protein. The skilled person may also select, test and optimize the linker sequence and the fusion junction (s) such that they do not interfere with the function of the degra- dation signal peptide and/or of the target polypeptide or protein.

The polynucleotide, expression cassette and/or vector may further comprise a sequence encoding a target polypeptide or protein, such that the target polypeptide or protein is fused to the degradation signal peptide. The target polypeptide or protein may be fused to the degradation signal peptide via a link- er sequence or directly. The degradation signal pep- tide may be fused to the N-terminal part or to the C- terminal part of the target polypeptide or protein. The fusion may naturally be optimized e.g. by select- ing a terminal part at which the fusion is most effec- tive and/or functional.

The polynucleotide may be operatively linked to one or more sequences for expression in a host cell and/or comprises one or more sequences for introducing the nucleotide sequence encoding the degradation sig- nal peptide and/or polynucleotide to a gene of a host genome, thereby fusing the polynucleotide to a target gene. The host cell and host genome may be any host cell or host genome described in this specification. For example, the polynucleotide may comprise homology arms for CRISPR/Cas9-mediated homology-directed repair (HDR) . The homology arms may flank the part of the polynucleotide which is intended for integrating into the host genome.

Thus the entire polynucleotide or a part thereof may be integrated into the host genome. For example, at least the nucleotide sequence encoding the the degradation signal peptide may be introduced or integrated into the host genome. However, other parts may be introduced or integrated into the host genome as well, for example a nucleotide sequence encoding the target polypeptide or protein or a moiety capable of associating with the target polypeptide or protein, the one or more sequences for expression in the host cell, a nucleotide sequence encoding a label or a tag, and/or a nucleotide sequence encoding a linker.

The the nucleotide sequence encoding the the degradation signal peptide, and/or the polynucleotide, or one or more parts of the polynucleotide may codon optimized for expression in a host cell, for example in a mammalian cell. Examples of codon optimized se- quences are shown in Table 1 below. In an embodiment, the nucleotide sequence encoding the degradation sig- nal peptide is selected from the following: SEQ ID NOs : 90, 91, 92, 93, or is at least 75 %, or at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or at least 98 %, or at least 99 %, identical thereto. The polynucleotide, the expression cassette and/or the vector may further comprises a sequence en- coding a moiety capable of associating with a target polypeptide or protein, such that the moiety is fused to the degradation signal peptide, optionally via a linker sequence. The moiety may be a polypeptide, pro- tein, domain, tag or other fusion partner. The moiety may be capable of binding the target polypeptide or protein directly or indirectly, or it may be otherwise capable of physically associating with the target pol- ypeptide or protein, such that when auxin or auxin an- alogue binds to a functional auxin perceptive protein and induces at least a partial depletion of the target polypeptide or protein by causing the auxin perceptive protein to bind to the degradation signal peptide. For example, it may be a binding agent, binding moiety or binding domain capable of binding the target polypep- tide or another moiety fused to the target polypep- tide. As an example, the moiety may be a nanobody or other antibody or antibody fragment. The moiety may be capable of binding e.g. a GFP (green fluorescent pro- tein) , other fluorescent protein, or other tag fused to the target polypeptide or protein. An exemplary em- bodiment is described in Daniel et al . , Nature Commu- nications 2018, 9, 3297 (DOI: 10.1038/s41467-018-

05855-5) , which describes an AID-nanobody capable of binding GFP-tagged proteins.

The moiety fused to the degradation signal peptide, optionally via a linker sequence, may then associate with, for example by binding directly or in- directly, the target polypeptide or protein, or other- wise bring the degradation signal peptide in physical proximity or contact of the target polypeptide or pro- tein. In the presence of a functional auxin perceptive protein and auxin or an auxin analogue, the functional auxin perceptive protein may then bind to the degrada- tion signal peptide, recruit an E2 ubiquitin conjugat- ing enzyme and polyubiquitylate the fusion protein comprising the moiety as well as the target polypep- tide or protein. The moiety associating with the tar- get polypeptide or protein may thereby result in their rapid degradation by the proteasome.

The polynucleotide and/or expression cassette may further comprise e.g. a sequence encoding a label or a tag, such as a label or a tag for detecting the fusion polypeptide or fusion protein comprising the degradation signal peptide fused to a target polypep- tide or protein and to the label or tag. For example, a sequence encoding a fluorescent polypeptide or pro- tein may be suitable for detecting and possibly e.g. quantifying the fusion polypeptide or protein and/or its depletion.

Well suited fluorescent proteins include e.g. mEGFP and mCherry, but various other fluorescent pro- teins, labels and tags may be available, for example SNAP-tag® and CLIP-tag®, HaloTag® tags and various others. The skilled person may select, test and opti- mize the label or tag and the sequence encoding it, and in particular the fusion junction (s) and/or link- er (s), such that they do not interfere with the func- tion of the degradation signal peptide and/or of the target polypeptide or protein.

They may also be selected and/or optimized such that they are optimal for the functionality of the degradation signal peptide and/or of the target polypeptide or protein. For example, mEGFP has been found to work well, in particular when the C-terminus of the degradation signal peptide is fused to the N- terminus of mEGFP, optionally via a linker. An exem- plary embodiment is shown in SEQ ID NO: 94, in which a degradation signal peptide of aa:s 37-104 of AtIAA7 (SEQ ID NO: 1) is linked via a two-AA linker (SG) to mEGFP. In other words, in an embodiment, the sequence encoding a label, such as a fluorescent polypeptide or protein, is a sequence encoding mEGFP (for example, mEGFP as set forth in SEQ ID NO: 95) . The sequence en- coding mEGFP may be fused to the C-terminus of the degradation signal peptide, optionally via a linker, but it may alternatively be fused to the N-terminus of the degradation signal peptide, again optionally via a linker .

The sequence encoding the label or tag may be fused to the target polypeptide or protein and/or to the degradation signal peptide in various different orientations, for example so that the degradation sig- nal peptide and the label or tag are fused to the N- terminal end of the target polypeptide or protein, or so that the degradation signal peptide and the label or tag are fused to the C-terminal end of the target protein or polypeptide. The order may depend e.g. on the specific target protein or polypeptide, on the la- bel or tag, on the host cell and/or other considera- tions .

The polynucleotide and/or the expression cas- sette may comprise one or more sequences for targeting and optionally integrating the nucleotide sequence en- coding the degradation signal peptide and/or the poly- nucleotide to a desired site in the host genome, for example to a safe harbor site. An example would be e.g. the AAVSl/Safe harbor locus, to which it may be targeted using e.g. the CRISPR/Cas9 technology, other knock-in technology or other targeting/genomic inte- gration technology. Other safe harbour sites and inte- gration technologies may also be contemplated, depend- ing e.g. on the host cell and genome, for example the CCR5 site, the murine Rosa26 locus and/or an ortholog thereof. The one or more sequences for targeting may include e.g. HR targeting sequences or homology arms for tagging an endogenous locus. For example, the pol- ynucleotide may be a synthetic DNA polynucleotide or a PCR fragment.

However, it is not always necessary to gener- ate a knock-in, but simply insert one or more copies of the expression cassette and/or the polynucleotide, for example for overexpression of the fusion polypep- tide or protein.

In this context, the host cell and/or the host genome may again be any host cell or host genome described in this specification.

A vector is further disclosed, the vector comprising the polynucleotide according to one or more embodiments described in this specification and/or the expression cassette according to one or more embodi- ments described in this specification.

In the context of this specification, the term "vector" may be understood as referring to a pol- ynucleotide produced by recombinant DNA techniques for delivering genetic material into a cell and optionally integrating at least a portion thereof in the genome of the cell. As is well known in the art, it may refer to a plasmid, a cosmid, an artificial chromosome, a cloning vector, an expression vector or any other suitable vector. The vector may be a DNA vector, but RNA vectors may also be contemplated. It may, alternatively or additionally, be possible to introduce a polypeptide or protein com- prising the degradation signal peptide encoded by the polynucleotide according to one or more embodiments described in this specification into a host cell or a host organism.

In the vector, the polynucleotide may be op- eratively linked to one or more sequences for expres- sion in a host cell, and/or wherein the vector com- prises one or more sequences for introducing the poly- nucleotide to a host genome, thereby fusing the poly- nucleotide to a target gene.

The vector may, as a skilled person knows, further comprise other parts or sequences, for example a backbone, sequences required for replication of the vector or for selection, etc.

The vector may comprise one or more sequences for targeting the polynucleotide sequence encoding the degradation signal peptide to a desired site in the host genome, for example to a safe harbor site. An ex- ample would be e.g. the AAVSl/Safe harbor locus, to which it may be targeted using e.g. the CRISPR/Cas9 technology. The one or more sequences for targeting may include e.g. HR targeting sequences. The vector may thus be e.g. a HR targeting (donor) vector.

The vector may, additionally or alternative- ly, suitable for transient overexpression.

A system for at least partially depleting a target polypeptide or protein in a host cell is dis- closed, the system comprising the polynucleotide ac- cording to one or more embodiments described in this specification, the expression cassette according to one or more embodiments described in this specifica- tion, and/or the vector according to one or more em- bodiments described in this specification, and

a second polynucleotide, a second expression cassette and/or a second vector comprising the second polynucleotide, wherein the second polynucleotide en- codes a functional auxin perceptive protein capable of binding the degradation signal peptide in the presence of auxin and/or an auxin analogue.

The second polynucleotide and/or the second expression cassette may, in some embodiments, be in- cluded in the same polynucleotide or vector as the polynucleotide or expression cassette according to one or more embodiments described in this specification. However, such a polynucleotide or vector may be quite large. Therefore, in other embodiments, the second polynucleotide and/or the second expression cassette may be included in a separate polynucleotide (mole- cule) , expression cassette, or vector.

In the context of this specification, the term "functional auxin perceptive protein" may refer to a polypeptide or protein, or a fragment thereof, which is capable of binding an auxin and/or an auxin analogue. Upon binding the auxin and/or auxin ana- logue, the functional auxin perceptive protein is ca- pable of binding the degradation signal peptide, thereby targeting the degradation signal peptide and any target polypeptide or protein (and any optional further parts fused thereto) to proteasomal degrada- tion. Examples of such functional auxin perceptive proteins may include e.g. auxin perceptive F-box pro- teins such as TIR and AFB2 proteins, for example

AtAFB2 (accession number NP_566800.1, SEQ ID NO: 96), OsTIRl, MnTIRl (accession number XP_010112739.2, SEQ ID NO: 97), GhAFB2 (accession number XP_016709605.1, SEQ ID NO: 98), NcAFB2 (accession number A0A1J3CY17, SEQ ID NO: 99), and/or MnAFB2 (accession number

XP_010096050.1, SEQ ID NO: 100). Also other proteins that are e.g. at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100 % identical to

AtAFB2 (SEQ ID NO: 96), OsTIRl, MnTIRl (SEQ ID NO:

97), GhAFB2 (SEQ ID NO: 98), NcAFB2 (SEQ ID NO: 99), MnAFB2 (SEQ ID NO: 100), AtTIRl, a derivative thereof, such as AtTIRl or any other TIR1 F79G mutant, or (functional) fragments thereof, may be contemplated.

The functional auxin perceptive protein may be AtAFB2 (SEQ ID NO: 96), a functional auxin percep- tive protein having a sequence that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to AtAFB2 (SEQ ID NO: 96), or a pol- ypeptide or a protein comprising at least one stretch that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to a contin- uous stretch of at least 60 amino acids of AtAFB2 (SEQ ID NO: 96), or a fragment thereof. Such functional auxin perceptive proteins, such as AtAFB2, have been found to provide good depletion efficiencies and rela- tively low constitutive depletion together with one or more embodiments of the degradation signal peptide de- scribed in this specification.

The second polynucleotide encoding the func- tional auxin perceptive protein may be codon opti- mized, for example for expression in a mammalian host cell or other host cell as described in this specifi- cation. Examples of the second polynucleotide encoding the functional auxin perceptive protein may include the following, or a sequence at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or at least 99 % identical, or 100 % identical thereto:

AtAFB2 (SEQ ID NO: 96, aa residues 1-575) (an exemplary codon optimized cDNA sequence set forth in SEQ ID NO: 101) ;

MnTIRl (SEQ ID NO: 97) (an exemplary codon optimized cDNA sequence set forth in SEQ ID NO: 102);

GhAFB2 (SEQ ID NO: 98) (an exemplary codon optimized cDNA sequence set forth in SEQ ID NO: 103);

NcAFB2 (SEQ ID NO: 99) (an exemplary codon optimized cDNA sequence set forth in SEQ ID NO: 104); MnAFB2 (SEQ ID NO: 100) (an exemplary codon optimized cDNA sequence set forth in SEQ ID NO: 105) .

The functional auxin perceptive protein may exhibit minimal basal degradation. Such functional auxin perceptive proteins may include, for example,

- AtAFB2 (SEQ ID NO: 96), a functional auxin perceptive protein having a sequence that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to AtAFB2 (SEQ ID NO: 96), or a polypeptide or a protein comprising at least one stretch that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to a continuous stretch of at least 60 amino acids of AtAFB2 (SEQ ID NO: 96); and/or

a derivative of a TIR1 protein, such as At- TIR1, containing the F79G mutation. The F79G mutation in AtTIRl has been described e.g. in Uchida et al . , Nature Chemical Biology 2018, 14, 299-305.

A functional auxin perceptive protein may be considered to exhibit minimal basal degradation, when at most 50 %, or at most 40 %, or at most 30 %, or at most 20 %, or at most 15 %, of the target polypeptide or protein is constitutively depleted in the absence of an inducer. The extent of the constitutive deple- tion may be determined e.g. as mentioned above or as shown in the Examples of the present specification.

The second polynucleotide, the second expres- sion cassette and/or the second vector may further comprise a nucleotide sequence encoding a localization sequence for directing the localization of the func- tional auxin perceptive protein. The localization se- quence may be a subcellular localization sequence. The exact localization sequence may be selected e.g. de- pending on the host cell or genome and/or the locali- zation of the target polypeptide or protein. The lo- calization sequence may thus be fused to the function- al auxin perceptive protein. For example, the locali- zation sequence may be a nuclear localization se- quence .

The term "nuclear localization sequence", "NLS" or "nuclear localization signal" may be under- stood as an amino acid sequence that directs the pro- tein to which it is fused, in this case the functional auxin perceptive protein, to the nucleus of the host cell. Examples of NLSs may include weak NLS(MycAl, AAAKRVKLD, SEQ ID NO: 106), strong NLS (Myc, PAAKRVKLD, SEQ ID NO: 107), and/or the SV40 large T antigen NLS ( PKKKRKV, SEQ ID NO: 108), although other NLSs may also be contemplated, e.g. depending on the host cell, the functional auxin perceptive protein and other considerations.

A kit is disclosed, comprising the polynucle- otide according to one or more embodiments described in this specification, the expression cassette accord- ing to one or more embodiments described in this spec- ification, the vector according to one or more embodi- ments described in this specification, and/or the sys- tem according to one or more embodiments described in this specification. The kit may further comprise in- structions for use. The kit may be suitable for per- forming the method (s) according to one or more embodi- ments described in this specification. The kit may further comprise other components and/or reagents, for example a solvent, a buffer, an enzyme (for example, an enzyme for cloning purposes and/or for polymerase chain reaction), transfection reagent (s), one or more primers (e.g. for polymerase chain reaction for clon- ing purposes), etc.

A host cell comprising the nucleotide se- quence encoding the degradation signal peptide and/or the polynucleotide according to one or more embodi- ments described in this specification, the expression cassette according to one or more embodiments de- scribed in this specification, the vector according to one or more embodiments described in this specifica- tion, and/or the system according to one or more em- bodiments described in this specification is also dis- closed. The host cell may be any host cell described in this specification, e.g. an animal cell or a fun- gal cell. For example, the host cell may be a mammali- an cell, for example a human, murine, bovine, ovine, porcine, feline, canine, equine, or primate cell; a nematode cell; or an insect cell. In an embodiment, the host cell is other than a plant cell.

A transgenic organism stably transformed or transfected with the polynucleotide according to one or more embodiments described in this specification is also disclosed. The transgenic organism may therefore contain the nucleotide sequence encoding the degrada- tion signal peptide and/or the polynucleotide stably integrated into its genome. The transgenic organism may, alternatively or additionally, be stably trans- formed or transfected with the expression cassette ac- cording to one or more embodiments described in this specification, the vector according to one or more em- bodiments described in this specification, and/or the system according to one or more embodiments described in this specification. The transgenic organism may be an animal or a fungus, a mammal, e.g. a rodent such as a mouse or a rat, a fish, an insect, or a nematode, such as C. elegans, or any other host described in this specification. The term "transgenic organism" may be understood as referring to an organism in which nu- cleotide sequence encoding the degradation signal pep- tide and/or the polynucleotide or expression cassette according to one or more embodiments described in this specification is stably integrated into the genome. The term may also encompass the progeny of the trans- genic organism which is stably transformed or trans- fected . A method for at least partially depleting a target polypeptide or protein in a host cell is also disclosed. The method may comprise

introducing the polynucleotide according to one or more embodiments described in this specifica- tion, the expression cassette according to one or more embodiments described in this specification, the vec- tor according to one or more embodiments described in this specification and/or the system according to one or more embodiments described in this specification to the host cell, such that the nucleotide sequence en- coding the degradation signal peptide and/or the poly- nucleotide forms a fusion with a target gene encoding the target polypeptide or protein or a moiety capable of associating with a target polypeptide or protein, the fusion encoding a fusion protein comprising the degradation signal peptide and the target polypeptide or protein or the moiety capable of associating with the target polypeptide or protein; or providing the host cell, wherein the nucleotide sequence encoding the degradation signal peptide and/or the polynucleo- tide forms a fusion with a target gene encoding the target polypeptide or protein or a moiety capable of associating with the target polypeptide or protein, the fusion encoding a fusion protein comprising the degradation signal peptide and the target polypeptide or protein or the moiety capable of associating with the target polypeptide or protein;

expressing the fusion protein in the host cell ;

expressing a functional auxin perceptive pro- tein in the host cell; and

introducing an auxin or an auxin analogue to the host cell, such that the auxin or the auxin ana- logue binds to the functional auxin perceptive protein and induces at least a partial depletion of the fusion protein or of the target polypeptide or protein by causing the auxin perceptive protein to bind to the degradation signal peptide. The host cell may be any host cell described in this specification, for example an animal cell or a fungal cell.

The method may be performed at a temperature suitable for the growth and/or maintenance of the host cell. For example, it may be performed at a tempera- ture of about 37 °C, or of 36-38 °C.

A method for producing the host cell accord- ing to one or more embodiments described in this spec- ification is also disclosed, comprising introducing the polynucleotide according to one or more embodi- ments described in this specification, the expression cassette according to one or more embodiments de- scribed in this specification, the vector according to according to one or more embodiments described in this specification, the polypeptide according to one or more embodiments described in this specification and/or the system according to one or more embodiments described in this specification into the host cell.

In the context of any method described in this specification, the functional auxin perceptive protein may be any functional auxin perceptive protein described in this specification.

In an embodiment, the functional auxin per- ceptive protein is AtAFB2 (SEQ ID NO: 96), a function- al auxin perceptive protein having a sequence that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to AtAFB2 (SEQ ID NO: 96) , or a polypeptide or a protein comprising at least one stretch that is at least 80 %, or at least 85 %, or at least 90 %, or at least 95 %, or 100% identical to a continuous stretch of at least 60 amino acids of AtAFB2 (SEQ ID NO: 96) .

The method (s) may further comprise introduc- ing a second polynucleotide, a second expression cas- sette and/or a second vector comprising the second polynucleotide, wherein the second polynucleotide en- codes a functional auxin perceptive protein capable of binding the degradation signal peptide in the presence of auxin and/or an auxin analogue into the host cell. The second polynucleotide, the second expression cas- sette and/or second vector may be any second polynu- cleotide, any second expression cassette and/or any second vector described in this specification.

The use of the polynucleotide according to one or more embodiments described in this specifica- tion, the expression cassette according to one or more embodiments described in this specification, the vec- tor according to one or more embodiments described in this specification, the system according to one or more embodiments described in this specification, or the kit according to one or more embodiments described in this specification for at least partially depleting a target polypeptide or protein in a host cell is also disclosed .

In an embodiment, basal degradation of the target polypeptide or protein is at most 50 %, or at most 40 %, or at most 30 %, or at most 20 %, or at most 15 %, in the absence of an inducer but optional- ly in the presence of a functional auxin perceptive protein, the polynucleotide, the polypeptide, the ex- pression cassette, the vector, and/or of the system according to one or more embodiments described in this specification .

Again, the host cell may be any host cell de- scribed in this specification, for example an animal cell or a fungal cell.

EXAMPLES

Reference will now be made in detail to various embodiments, an example of which is illustrated in the accompanying drawings. The description below discloses some embodiments in such a detail that a person skilled in the art is able to utilize the embodiments based on the disclosure. Not all steps or features of the embodiments are discussed in detail, as many of the steps or features will be obvious for the person skilled in the art based on this specification.

Figure 1 illustrates schematically the function of the degradation signal peptide, i.e. degron tag, and at least partially depleting a target polypeptide or protein in a host cell. The auxin- inducible degron (AID) technique controls targeted protein degradation with the small molecule auxin or an auxin analogue. In AID, a degron sequence, i.e. a sequence encoding a degradation signal peptide, is attached to a target polypeptide or protein by genetic fusion .

Alternatively or additionally, the sequence encoding a degradation signal peptide may be attached to a moiety capable of associating with the target polypeptide or protein. For example, the degradation signal peptide may be fused to an anti-GFP nanobody capable of binding to a target polypeptide or protein fused with a GFP moiety. An example of such a system is described in Daniel et al . , Nature Communications

2018, 9, 3297 (DOI: 10.1038 /s41467-018-05855-5 ) .

Addition of a plant hormone of the auxin class, i.e. an auxin such as 3-acetic acid (IAA) or an analogue thereof, may promote the binding of the degron tag by an auxin perceptive F-box protein

TIR1/AFB. An exogenously overexpressed TIR1/AFB forms a functional Skpl-Cullin-F box type E3 ubiquitin ligase ( SCF ^TIR1/AFB ) with endogenous subunits conserved in all eukaryotic cells. The auxin-induced binding thus recruits an E2 ubiquitin conjugating enzyme and polyubiquitylates the degron fusion protein, resulting in its rapid degradation by the proteasome. EXAMPLE 1 - Construction of a new AID system

Initially seipin, a conserved transmembrane protein in the endoplasmic reticulum (ER) involved in lipid droplet (LD) biogenesis, was targeted for degra- dation. To rapidly deplete seipin from human A431 cells, an AID system, composed of TIR1 derived from Oryza sativa (OsTIRl) and mAID degron of 65 amino ac- ids corresponding to AAs 68-132 of AtIAA17 (SEQ ID NO: 3) , referred herein to as miniAID, was first employed. To this end, the endogenous seipin was homozygously tagged with mAID-mEGFP. However, seipin tagged with a degron termed miniAID (composed of AtIAA17 amino acid residues 68-132) was severely degraded in cells ex- pressing OsTIRl without IAA addition. Consequently, cells exhibited defective LD biogenesis already before IAA addition, resembling a seipin knockout phenotype (data not shown) . The results indicated that AID can deplete seipin efficiently, but that the AID system used suffered from severe constitutive depletion.

To search for an improved AID system to solve the issue, a pipeline was first established in human A431 cells to screen AID components (Fig . 2A) . Various auxin perceptive proteins and degrons were selected for screening. Several TIR1 and AFB2 proteins from different plant species were tested, as well as degrons derived from AtIAA17 (SEQ ID NO: 3), these in- cluding amino acid (aa.) 65-132 (miniAID), aa. 62-109, aa. 71-114. All these degrons were included in the screen. AtIAA17 aa.31-104, as well as homolog frag- ments derived from other AUX/IAA proteins (AtIAA3 (SEQ ID NO: 2), 7 (SEQ ID NO: 1) and 14 (SEQ ID NO: 4)), has been characterized in vitro binding assay and showed the highest IAA binding affinity. These high affinity fragments were tested, assuming higher affin- ity might translate into more efficient inducible deg- radation. Degrons with KR dipeptide deletions were tested to see if they would have an effect on enhanc- ing IAA binding affinity, IAA-inducible depletion or as part of a nuclear localization signal. PB1 domain of the AUX/IAA proteins has not been implicated in auxin-inducible degradation, so several other degrons with PB1 domain sequences homologous to miniAID were also tested.

OsTIRl was first compared to other auxin per- ceptive proteins, using miniAID as the degron. Ara- bidopsis thaliana AFB2 (AtAFB2) was identified as the best hit: compared to OsTIRl, it displayed minimal ba- sal depletion with over 5-fold higher target protein level before IAA addition (0 h IAA), and similar aux- in-inducible depletion at 16 h IAA treatment (Fig. 2B) . However, auxin-inducible depletion with AtAFB2 at 1 h IAA was inefficient. Next, miniAID was compared to other degrons, using either OsTIRl or AtAFB2. All degrons showed severe basal degradation with OsTIRl at 0 h IAA but minimal basal degradation with AtAFB2 (Figs. 2C-E) . A degron composed of AtIAA7 (SEQ ID NO: 1) amino acids (aa.) 37-104 (hereafter denoted as 'miniIAA7') was identified as an optimal degron in combination with AtAFB2. It dramatically improved aux- in-inducible depletion with over 3-fold more efficient protein reduction compared to miniAID at 1 h IAA (Fig. 2B and Figs. 2D-E) . Thus, the improved AID system com- posed of AtAFB2 and miniIAA7 showed both minimal basal degradation and rapid auxin-inducible depletion.

In both Example 1 and in Example 2 below, A431 cells (ATCC, Cat#CRL-1555) were cultured in DMEM (Lonza) , and A549 cells (ATCC, Cat#CCL-185) in F-12 Nutrient Mixture (Gibco) , both supplemented with 10% FBS, penicillin/streptomycin (100 U/ml each), L-glutamine (2 mM) at 37 °C in 5% CO2. Mycoplasma test- ing was performed regularly using PCR detection. Cells were transfected at 80-95% confluence using Lipofec- tamine LTX with PLUS Reagent (Life Technologies) , typ- ically with 1.0 mg plasmid (s) per 1.0 ml of PLUS rea- gent, 2.0 mΐ of Lipofectamine LTX and 4.0x10 ^s (A431) or 3.0x10 ⁵ (A549) cells in a 12-well. Indole-3-acetic acid sodium (IAA, Santa Cruz, sc-215171) was prepared at 100x in H20 (10 mg/ml), aliquoted, stored at -20°C and used within 2 days after thawing.

Construction of AAVS1 site specific integration vectors

AAVS1 safe harbour locus site-specific inte- gration was conducted with CRISPR/Cas9-mediated homol- ogy-directed repair (HDR) . A donor vector was generat- ed by assembling PCR amplified fragments by re- striction digestion and ligation. The resulting vector contained two homology arms (from A431 genomic DNA) flanking an overexpression cassette with puromycin se- lection marker (from pEFIRES-P) on a plasmid backbone (from pGL3-basic) . This donor vector was designated as pSH-EFIRES-P and used to express different auxin per- ceptive proteins. A second donor vector was generated by changing the puromycin selection marker on the first vector with blasticidin selection marker. This donor vector was designated as pSH-EFIRES-B and used to express seipin-mEGFP with different degrons . A third vector co-expressing Cas9 and a sgRNA (both de- rived from PX458, Addgene #48138) was designated as pCas9-sgRNA. The vector was inserted with two sgRNAs targeting AAVS1 safe harbour locus (sgAAVSl-1 target sequence: ACCCCACAGTGGGGCCACTA GGG (SEQ ID NO: 109); sgAAVSl-2 target sequence: GTCACCAATCCTGTCCCTAG TGG (SEQ ID NO: 110)) . Auxin perceptive proteins, except OsTIRl (Addgene# 72835) , and degron tags were codon- optimized and synthesized by Genscript (sequences in Table 1 ) . Auxin perceptive proteins were tagged with mCherry through overlap PCR using a 5 aa. linker GGSGG (SEQ ID NO: 111) . AtAFB2-mCherry with different NLSs were weak NLS (MycAl , AAAKRVKLD, SEQ ID NO: 106) and strong NLS (Myc, PAAKRVKLD, SEQ ID NO: 107) . The three vectors with insertions will be deposited in Addgene .

Screening of different auxin perceptive proteins and degrons

OsTIRl (Addgene# 72835) and miniAID for tag- ging endogenous seipin (Addgene# 72825) were gifts from Masato Kanemaki . OsTIRl was also used as a tem- plate for constructing NES-OsTIRl (OsTIRl with N- terminus FAR NES2 : M-LDLASLIL-SG-OsTIRl aa. 2-575; the NES peptide sequence LDLASLIL is shown as SEQ ID NO: 112) and OsTIRl-NES (OsTIRl with C-terminus NES21: OsTIRl aa. 1-575-1DELLKELADLNLD; the NES21 peptide se- quence IDELLKELADLNLD is shown as SEQ ID NO: 113) . Other auxin perceptive proteins and degron sequences were codon-optimized and synthesized by Genscript (see Table 1 for synthesized sequences of the degron tags and SEQ ID NO:s 101-105 for codon optimized cDNA se- quences for AtAFB2, MnTIRl, GhAFB2, NcAFB2, and MnAFB2, respectively) .

Generation of A431 cell pools for screening

A431 cell pools were generated to stably ex- press different combinations of auxin perceptive pro- tein and degron-fused seipin. Cells were co- transfected with a mixture of three vectors composed of pSH-EFIRES-P expressing an auxin perceptive pro- tein, pSH-EFIRES-B expressing a degron-fused seipin, and pCas9-sgAAVSl at ratio 3:3:4. Transfected cells were passaged 4-6 h after transfection at 1:5 into 6- well plates. On the next day, cells were selected with 1 mg/ml puromycin (Sigma, P8833) for 2 days, and with 5 mg/ml blasticidin (Gibco, A1113904) for 2 days, then with both antibiotics for at least 6 days before using for FACS analysis. Table 1. Degron tags and their codon optimized cDNA sequences.

FACS analysis

For FACS analysis, cells were seeded at 1:5 (for A431) or 1:3 (for A549) into 6-well plate in me- dium without selection on day 0. On day 1, medium was changed to 2 ml fresh medium without (for 0 h and 1 h IAA samples) or with (for 16 h IAA samples) 0.5 mM IAA. On day 2, the 1 h samples were supplemented with 0.5 ml medium containing 2.5 mM IAA (final 0.5 mM) and incubated for 1 h at 37 °C. After treatment, cells were detached with 0.5 ml trypsin at 37 °C for 5-8 min (A549) or 8-12 min (A431), put on ice, and transferred to 1.5 ml Eppendorf tubes containing 0.5 ml serum-free CO2 independent medium (Gibco) . The cell suspensions were centrifuged at 4°C, resuspended in 0.3 ml ice- cold serum-free FluoroBrite DMEM (Gibco) and stored on ice prior to FACS analysis. FACS analysis was per- formed on a BD Influx cell sorter (BD Biosciences-US ) with lOOym nozzle at 4-8 °C using BD FACS Sortware. Cells were gated with SSC, FSC and trigger pulse width for singlets and 100 000 cells were analyzed for each sample. GFP was excited with 488nm laser and detected with 530/40 detector; mCherry was excited with 561nm lasers and detected with 615/20 detector. Data was an- alyzed with BD FACS Sortware. Background subtracted mean fluorescence intensity was used for analysis.

EXAMPLE 2 - Testing of AtAFB2-miniIAA7 system for rapidly depleting endogenous proteins and reveal- ing acute phenotypes

The AtAFB2-miniIAA7 system ( Fig . 3A) was tested for rapidly depleting endogenous proteins and revealing acute phenotypes. Dynein heavy chain (DHC1) and epidermal growth factor receptor (EGFR) were cho- sen as the first targets. DHC1 is an essential protein that could not be rapidly depleted by using the OsTIRl-miniAID system in a previous study (Natsume et al . , 2016, Cell Rep. 15, 210-218) . EGFR is a transmem- brane receptor with a canonical function in EGF uptake that can be acutely assessed after protein depletion. Endogenous target loci were tagged homozygously in hu- man cells with miniIAA7-mEGFP through Cas 9-mediated homology-directed repair (Fig. 3A) . DHC1 was tagged homozygously but it was only possible to tag EGFR het- erozygously in A431 cells, likely due to its high copy numbers in this cell type (data not shown) . However, homozygous tagging of EGFR was achieved in human A549 cells. AtAFB2, or OsTIRl for comparison, was then ex- pressed by introducing it into the AAVS1 loci of the homozygous knock-in clones. The parental cell lines not expressing an auxin perceptive protein were used as controls (Fig. 3A) . It was found that both DHC- AtAFB2 (DHC1 homozygously tagged with miniIAA7-mEGFP and AtAFB2 expressed) and EGFR-AtAFB2 cells showed minimal basal degradation at 0 h IAA, and efficient auxin-inducible depletion at 1 h IAA and at longer times (Fig. 3B) . In comparison, DHCl-OsTIRl cells died out during selection, and EGFR-OsTIRl cells showed se- vere basal depletion at 0 h IAA (Fig. 3B) .

Next it was assessed whether rapid auxin- inducible depletion revealed acute phenotypes. Fig. 3C shows time-lapse images of A431-DHC1 cells with or without cell division after mitotic cell rounding. Open arrowhead: cells before mitosis; filled arrow- head: cells undergoing mitotic rounding; arrow: cells after cell division. In DHCl-AtAFB2 cells, the frac- tion of mitotic rounding cells that completed cell di- vision was 0% after IAA addition for 30 min, compared to 100% without IAA addition (Fig. 3D) . In EGFR-AtAFB2 cells, EGF uptake was reduced by 75% pending on 1 h IAA treatment, while severe IAA-independent reduction of EGF uptake happened in EGFR-OsTIRl cells (Fig. 3E) . The inducer IAA per se did not affect cell division or EGF uptake as shown in the controls (Figs. 3D and 3E) . Overall, these results demonstrate the improved per- formance of the AtAFB2-miniIAA7 system in rapidly de- pleting endogenous proteins and revealing acute pheno- types .

In previous experiments, miniIAA7 was used as a C-terminal tag. Next, miniIAA7 was tagged N- terminally to an endogenous protein. SEC61B was chosen as it is a common target tagged N-terminally through homology-directed repair. It was found that N- terminally tagged SEC61B can be depleted efficiently in 1 h with the AtAFB2-miniIAA7 system (Figs. 4A-D) . Interestingly, the orientation miniIAA7-mEGFP instead of mEGFP-miniIAA7 in the tag provided for optimal de- pletion kinetics (Figs. 4A-D) . Thus, miniIAA7 works for both N- and C-terminal tagging when using mini- IAA7-mEGFP as a fixed unit.

Then the overall performance of the AtAFB2- miniIAA7 system in depleting different endogenous pro- teins was evaluated. A diverse set of endogenous loci was tagged homozygously with miniIAA7-mEGFP N- or C- terminally (Fig. 5A) and AtAFB2 or OsTIRl were intro- duced into the AAVS1 locus (as in Fig. 3A) . The target proteins represented different subcellular localiza- tions and a variable number of transmembrane segments, including the original target seipin and a long-lived protein LMNB1 (Fig. 5B) . The expression levels of the target proteins in the established cell lines varied by ~50-fold (ranging from 0.19 for seipin to 9.21 for LMNA; Fig. 5C) . When examining the performance of AtAFB2-miniIAA7 system with these targets, it was found that all targets had minimal basal degradation (86-109% levels of control) at 0 h IAA, and were de- pleted to 2-5% levels at 16 h IAA (Fig. 5D) . Notably, the targets showed variable depletion efficiency at 1 h IAA. Non-nuclear targets expressed at low levels (seipin, NPC1, PEX3 and Glutl) were depleted to 2-5%. A non-nuclear target expressed at high level (NMIIa) and a nuclear target expressed at low level (LBR) were also depleted to less than 12%. However, highly ex- pressed nuclear proteins (LMNA and LMNB1) were not as efficiently depleted (Fig. 5D) . The OsTIRl-miniIAA7 combination exhibited some basal degradation at 0 h IAA (12-37%) and a depletion efficiency of 2-7% at 16 h IAA with all targets (Fig. 5D) .

The depletion of LMNA and LMNB1 was further improved using AtAFB2-miniIAA7 system. Because AtAFB2- mCherry localized predominantly to cytosol (Fig. 5E) , the nuclear localization of AtAFB2-mCherry was in- creased by fusing nuclear localization signals (NLSs) to it (Fig. 5E) . Both weak and strong NLSs increased the nuclear localization of AtAFB2-mCherry and sub- stantially improved auxin-inducible depletion of LMNA and LMNB1 at 1 h IAA (Fig. 5E, F) . Of note, LBR that is not restricted to the nucleus showed efficient aux- in-inducible depletion with the weak but not with the strong NLS construct (Fig. 5F) . In summary, these re- sults demonstrate the AtAFB2-miniIAA7 system rapidly depleted all selected endogenous transmembrane, cyto- plasmic and nuclear proteins at 1 h with minimal basal degradation. These data also underscore that for rapid protein depletion, the depletion may beimproved if AtAFB2 is present at sufficient levels in the compart- ment where the target protein resides.

It was found that depletion of the endogenous targets with the AtAFB2-miniIAA7 system revealed ro- bust and expected phenotypes as early as 1 h after IAA addition, depending on the functional readouts. These included reduced glucose uptake in Glutl degron cells (cells with AtAFB2-miniIAA7 system targeting Glutl), massive changes of F-actin structures in NMIIa degron cells, accumulation of cholesterol in late endosomal compartments in NPC1 degron cells, lipid droplet bio- genesis defects in seipin degron cells, reduction of cellular cholesterol levels in LBR degron cells, and extensive degradation of peroxisomal membrane proteins in PEX3 degron cells (Figs. 5G-L) .

Construction of vectors for endogenous tagging

Degron tagging of endogenous loci was con- ducted with CRISPR/Cas9-mediated HDR. Donor vectors with 2 homology arms flanking the degron tag, and Cas9 vectors with specific sgRNAs were constructed for each target. For constructing donor vectors, homology arms were amplified from A431 genomic DNA. MiniIAA7-mEGFP tags were amplified from established templates in the screens above. Overlap PCR was then performed to as- semble PCR fragments. Nested PCR primers were used to improve the PCR efficiency and specificity. All PCR amplification steps were performed with Q5 Hot Start High-Fidelity DNA Polymerase (NEB) . The PCR fragments were cloned into plasmid backbones using HiFi DNA as- sembly kit (NEB) or through restriction ligation. Some of the donor vectors were generated by changing the inserts on the established donor vectors through re- striction ligation. For constructing Cas9 vectors, target sites were searched manually for -NGG PAM se- quence within 18 bp after insertion sites or CCN- PAM within 18 bp before insertion sites. These position restraints were set for both high-efficient integra- tion and for avoiding further mutations after success- ful HDR. The DHC1 target sites were selected at the 3 ' -UTR as no target site was available in the search- ing range. A pCas 9/QRVR-sgRNA vector was later con- structed through PCR mutagenesis of pCas9-sgRNA to en- able use of target sites with -NGA (or TCN-) PAM in the searching range. SgRNAs were synthesized as two unphosphorylated primers, annealed and inserted into Bbsl-cut pCas9-sgRNA or pCas 9/VRQR-sgRNA vector. In- formation about endogenous targets and HDR templates is provided in Table 2. Table 2. HDR templates and sgRNAs used

Generation of homozygously tagged cell lines

For generation of homozygously tagged cell lines, HDR pools were first generated, followed by FACS enrichment of high GFP expressing cells and lim- iting dilution in 96-well plates to obtain single clones. Single clones were screened first by fluores- cence microscopy for proper GFP expression and subcel- lular localization, then by genomic PCR to check for homozygous tagging. A detailed protocol is described below .

For generation of HDR pools, A431 or A549 cells in 12-well plates were first transfected with a donor vector (0.6 yg) plus a Cas9/sgRNA vector encod- ing puromycin resistance gene (0.4 yg) . After 4-6 h, cells were passaged into 10 cm dishes. The next day, medium was changed to 1 mg/ml puromycin for 2 days, then to normal medium without puromycin. This proce- dure eliminated efficiently untransfected cells with- out selecting for stable puromycin resistant cells. After culturing in normal medium for 4 days, the cells were passaged to fresh medium for 2 days and the re- sulting cells were considered as the HDR pools. For each target, typically 2-3 sgRNAs were tried in dupli- cate, and HDR efficiency in the pools was assessed roughly by fluorescence microscopy. HDR pools with the highest efficiency were used for FACS analysis as above, and cells with the highest 1-5% GFP intensity were gated for sorting. The sorted cells were used for single clone isolation with limiting dilution in 96- well plates. For each pool, 10-20 clones were isolat- ed, from which 2-3 clones were picked with fluorescent microscopy for high GFP signal and proper subcellular localization. These clones were further tested for ho- mozygous tagging using genomic PCR. The best sgRNAs and their efficiency in HDR pools analysed by FACS are listed in Table 2 .

Generation of degron cell lines Homozygously tagged single clones were used to generate degron cells overexpressing an auxin per- ceptive protein. Auxin perceptive proteins were intro- duced into the AAVS1 safe harbour loci of single clones through Cas9 mediated HDR. Cells were trans- fected with 0.4 yg pCas9-sgAAVSl and 0.6 yg pSH- EFIRES-P plasmid encoding an auxin perceptive protein. Transfected cells were passaged at 1:5 after 4-6 h. The next day, cells were selected with 1 mg/ml puromy- cin for 6 days before passaging for experiments or further culturing. The resulting cell pools were used for FACS analysis and loss-of-function studies without single cloning. 5 mg/ml of puromycin was used occa- sionally to improve the expression level of the auxin perceptive proteins in the A431 pools. FACS sorting was performed to enrich A549-EGFR pools responsive to IAA treatment. For sorting, A549 pools were treated with 1 h IAA and sorted for cells with lower GFP.

Live cell Airyscan imaging

Cells cultured in FluoroBrite DMEM with 10% FBS in 8-well Lab-Tek II #1.5 coverglass slides (Ther- mofisher) were imaged with a Zeiss LSM 880 equipped with an Airyscan detector using a 63 ^c Plan-apochromat oil objective NA 1.4. Live cell imaging was performed at 37°C, 5% CO2 with incubator insert PM SI. Images were Airyscan processed automatically using the Zeiss Zen2 software package.

Analysis of cell division in A431 cells with tagged DHC1

Cells were plated on y-slide 8-well ibiTreat dishes at 0.1x10 ^s cells per well 2 days before the ex- periment. On the experiment day, cells were loaded with 2 yM CellTracker™ Red CMTPX (Thermo, CAT# C34552) in complete medium for 15-30 min at 37 °C. Medium was then changed to FluroBrite containing 10% FBS and in- cubated at 37 °C for 1-2 h before imaging to equili- brate the labelling. Cells were imaged with Nikon Eclipse Ti-E microscope equipped with 20x air objec- tive, Nikon Perfect Focus System 3, Hamamatsu Flash 4.0 V2 scientific CMOS and Okolab stage top incubator system. Before recording, 6 fields for each of the 8 wells were selected with CellTracker™ Red fluores- cence. IAA was then added at a final 0.5 mM concentra- tion to IAA-treated cells, mixed well with pipetting, and time lapse imaging started immediately recording every 30 min for 16 h. Mitotic rounding cells were counted manually in the videos from 0.5 h to 6 h. Mi- totic rounding cells without cell division were fol- lowed till 13 h.

EGF uptake in A549 cells with tagged EGFR

A549 cells were seeded at 0.4x10 ^s cells per 4-well for 3 days. Medium was changed to fresh medium with or without 0.5 mM IAA for 1 h. Cells were washed twice with ice-cold serum free medium with 1% BSA and 0.2 ml of 2 mg/ml Alexa Fluor™ 647 EGF complex (Ther- moFisher, E35351) in serum free medium with 1% BSA was added. Cells were further incubated at 37 °C for 20 min before harvesting with trypsin. Samples were kept on ice before FACS analysis. Alexa Fluor™ 647 was ex- cited with 640nm laser and detected with 720/40 detec- tor, analysing 20 000 cells per sample. Negative con- trol samples were cells incubated in medium without EGF complex. Background subtracted mean fluorescence intensity was used for analysis.

Glucose uptake in A431 cells with tagged

Glutl

Cells were plated at 0.6x10 ⁵ cells on 4-well plates 2 days prior the experiment. On the experiment day, cells were treated with or without 0.5 mM IAA for 1 h at 37 °C, then washed with DPBS (Gibco, 14040117 with calcium, magnesium) . Glucose uptake was measured by incubating cells with 1 mM 2-DG in DPBS for 10 min at RT and subsequent steps were performed according to the manufacturer's protocol (Promega, Cat# J1341). Lu- minescent signal was measured in a 96 black well mi- croplate (SCREENSTAR, Cat# 655866) with VICTOR X3 mul- timode plate reader ( PerkinElmer) . Cells incubated with DPBS only were used as background. Protein con- centrations were measured with BioRad DC assay. Glu- cose uptake after background subtraction was normal- ized to protein concentration.

F-actin staining in A431 cells with tagged

NMIIa

Cells were plated at 0.3x105 on m-slide 8- well ibiTreat chambers 1 day before the experiment. On the experiment day, cells were treated with or without 0.5 mM IAA for 2 h at 37 °C, then washed with PBS, fixed with 4 % PFA in 250 mM Hepes, pH 7.4, 100 mM

CaCl2 and 100 mM MgCl2 for 20 min, followed by quench- ing in 50 mM NH ₄ C1 for 10 min and 3 washes with PBS. Cells were then stained with 0.132 mM Alexa Fluor 568 Phalloidin (Molecular probes A-12380) in PBS for 30 min at RT . Z-stacks spanning the whole cell (step size 0.3 pm) were acquired with Nikon Eclipse Ti-E micro- scope, 60X PlanApo VC oil objective NA 1.4, with 1.5x zoom. Image stacks were automatically deconvolved us- ing the Huygens batch processing application (Scien- tific Volume Imaging) , and deconvolved image stacks were maximum intensity projected in ImageJ FIJI.

Filipin staining in A431 cells with tagged

NPC1

Cells on coverslips in complete medium were treated with or without 0.5 mM IAA for 16 h, fixed and quenched as above. Fixed cells were then stained with 50 pg/ml filipin in PBS for 30 min at 37 °C. Cells were washed twice with PBS and mounted with mowiol- DABCO. Imaging was performed on a Nikon Eclipse Ti-E microscope equipped with lOOx oil objective NA 1.4.

Lipid droplet biogenesis in A431 cells with tagged seipin Cells were delipidated by culturing in se- rum-free medium supplemented with 5% lipoprotein- deficient serum for 3 days and treated with or without 0.5 mM IAA for the final 16 h on m-slide 8-well ibi- Treat slides. For LD biogenesis, cells were loaded with 0.2 mM oleic acid (oleic acid prepared as 1 mM OA-BSA complex at 10:1 molar ratio to BSA in serum- free DMEM) for the final 2 h, fixed and quenched as above. Lipid droplets were stained with LD540 (synthe- sized by Princeton BioMolecular Research, 0.1 mg/ml) and nuclei with DAPI (Sigma, D9542, 10 pg/ml) . Z- stacks spanning the whole cell (step size 0.3 pm) were acquired with Nikon Eclipse Ti-E microscope, 60x Plan- Apo VC oil objective NA 1.4, with 1.5x zoom lens, and image stacks were automatically deconvolved using the Huygens batch processing application (Scientific Vol- ume Imaging) , and deconvolved image stacks maximum in- tensity projected by custom MATLAB scripts. Cell seg- mentation, LD detection and LD size distribution anal- ysis was performed with CellProfiler and custom MATLAB software generated for post-processing.

Cholesterol measurement in A431 cells with tagged LBR

Cells were delipidated by culturing in se- rum-free medium supplemented with 5% lipoprotein- deficient serum for 3 days and treated with or without 0.5 mM IAA for the final 48 h. Cells were washed and harvested with ice-cold PBS. Cell pellets were used for measurement. Cholesterol was measured by gas- liquid chromatography (GLC) analysis. The chloroform- methanol extracts of cellular lipids were saponified with potassium hydroxide in ethanol, extracted with hexan, and silylated with trichloromethylsilane . Cho- lesterol was separated from noncholesterol sterols and squalene and quantified by capillary GLC with flame ionization detection and using a 50-m capillary column (Ultra 2; Agilent Technologies, Wilmington, DE, USA) with 5 -cholestane as the internal standard. Protein concentration was measured from an aliquot of the same samples with Bio-Rad DC Protein assay.

Western blotting

Cells were lysed in buffer containing 1.0% Igepal CA-630, 0.5% sodium deoxycholate, 0.1% sodium dodecyl sulfate, 250 mM Tris-HCl, pH. 7.5 and 150 mM NaCl with protease inhibitors. Equal amounts of pro- tein (measured using DC Protein assay) were loaded on- to 12% Mini-Protean TGX Stain-Free gels and trans- ferred onto LF PVDF membrane (Bio-Rad) . Membranes were blotted with Odyssey blocking buffer (LI-COR) at RT for 0.5-1.0 h, incubated with first antibody (rabbit anti-GFP: ab290 Abeam; Mouse anti-alpha Tubulin: Sigma B-5-1-2; Mouse anti-PMP70: Sigma SAB4200181) at 4 °C overnight. Detection was performed with IRDye 800CW goat anti-mouse (Li-cor 926-32210) and Alexa 680 goat anti-rabbit antibodies (Invitrogen A21109) and images were acquired with a ChemiDoc Imaging System (Bio- Rad) .

Analysis of PMP22-mCardinal fluorescence in A431 cells with tagged PEX3

Cells were transfected with mCardinal-PMP-N- 10 (Addgene plasmid # 56173, a gift from Michael Da- vidson) . Single clones with low mCardinal-PMP-N-10 expression and proper subcellular localization were isolated after FACS sorting of low mCardinal fluores- cent cells. Cells were treated with or without 0.5 mM IAA for 14 days and seeded on m-slide 8-well ibiTreat chambers for the final 2 days. Cells were fixed and quenched as above. Nuclei were stained with DAPI (Sig- ma, D9542, 10 pg/ml) . Z-stacks spanning the whole cell (step size 0.3 pm) were acquired with Nikon Eclipse Ti-E microscope, 60x PlanApo VC oil objective NA 1.4, with 1.5x zoom lens. Maximum intensity projections were generated in FIJI and cells segmented in CellPro- filer as described above for LD analysis. Background subtracted PMP22-mCardinal fluorescence intensity was analyzed from the segmented images using a custom MATLAB software generated for post-processing.

EXAMPLE 3 - Characterization of the new AID system with molecular dynamics simulations

Finally, atomistic molecular dynamics simula- tions were conducted to gain insight into the AtAFB2- miniIAA7 system. The simulations revealed that the in- teractions between IAA and its binding pocket are sub- stantially weaker in AtTIRl compared to AtAFB2 at 37 °C (Fig. 6A, B) . This is consistent with AtAFB2 work- ing robustly in mammalian cells at 37 °C (the present Examples) and AtTIRl only being functional at lower temperatures, as shown in yeast. Simulations of AtAFB2 with variants of miniIAA7 demonstrated profound sec- ondary structure changes in aa. 95-104 of miniIAA7 (Aa. 95-104 of SEQ ID NO: 1) . Aa . 95-104 represent a previously uncharacterized stretch. It adopts an al- pha-helical structure when followed by an extended C- terminus but maintains a flexible coil structure when lacking the extension (Fig. 6C-E) . The simulations thus suggest that the presence of the C-terminal seg- ment (aa. 105-146) increases the structural stability of aa. 95-104, and this likely hampers IAA-inducible rapid target degradation (Figs. 6F) . The simulations further predict the critical importance of aa. 95-104, which was confirmed by experiments showing ablation of auxin-inducible degradation upon its removal (Fig. 6F) . Further refinement of the miniIAA7 degron re- vealed that aa.82-101 behave similarly to miniIAA7 (Figure 6F) .

Figures 6A and 6B show characterization of AtTIRl, AtAFB2 and miniIAA7 through atomistic molecu- lar dynamics simulations. Fig. 6A, schematic represen- tation, and Fig. 6B, table characterizing the amino acid residues of IAA binding pocket involved in IAA binding in AtTIRl and AtAFB2 by simulations (n=5) . At- TIR1 backbone is shown in the background as transpar- ent. IAA is depicted in van der Waals representation. Residues defining IAA binding pockets are illustrated in blue/licorice representation, with AtTIRl residues in darker blue (reference number 1) and AtAFB2 resi- dues in lighter blue (2) . Residue numbers refer to those of AtTIRl. Residues in larger font represent ones involved in interaction with IAA in the simula- tions and in the crystal structure (PDB ID: 2P1P) , red residue numbers represent ones involved in IAA inter- action in AtTIRl but not in AtAFB2.

Figures 6C and 6D are representative snap- shots highlighting miniIAA7-Vl and -V2 degrons in the indicated complexes at the end of 1 ms simulations (n=5) . Magenta: N-terminal KR dipeptide (3); brown: aa. 95-104 (4); pink: C-terminal extension after S104

(5) .

Together, these findings emphasize the im- portance of maintaining structural flexibility of aa. 95-104 in miniIAA7 and help to explain why miniIAA7- mEFGP works as a fixed unit.

Atomistic molecular dynamics simulations

Atomic co-ordinates for AtTIRl were obtained from the protein data bank (PDB ID: 2P1P) . The two AtIAA7 (SEQ ID NO: 1) peptide sequences used (mini- IAA7-V1 and miniIAA7-V2) were modeled using multiple templates: aa. 35-81 had no homologous structure available and were modeled ab initio using the I- TASSER online software (for protein structure and function predictions c-score -1.45); aa. 82-94 were modeled based on the structure of the peptide in the crystal structure (PDB ID: 2P10) ; aa . 95-104 for mini- IAA7-V1 and aa. 95-146 for miniIAA7-V2 were modeled on the solution NMR structure of a homologous protein IAA17 (PDB ID: 2MUK) . AtTIRl, in complex with IAA, in- ositol hexakisphosphate (IHP), and miniIAA7-Vl was generated ensuring that the orientation of AtIAA7 (aa. 82-94) matched its crystal structure in complex with AtTIRl ( PDB ID: 2P10) . The homology model of AtAFB2 was designed using the crystal structure of AtTIRl as the template (PDB ID: 2P1P) . A similar protocol was followed for obtaining AtAFB2 in complex with IAA, IHP and miniIAA7-Vl or AtAFB2 in complex with IAA, IHP and miniIAA7-V2. Stability of the homology models was val- idated based on the structural deviations from their initial conformation after simulation of these models for 200 ns. Further validation included comparison of simulation results and experiments described in this specification .

For simulations, the system was solvated in a box of 12 x 12 x 12 nm ³ with KC1 concentration of 150 mM. The CHARMM36 force field was used for proteins, IAA and IHP. Mol2 files for IAA and IHP were generated using Openbabel (O' Boyle, N. M. et al . J. Cheminform. 3, 33 (2011)) which were subsequently uploaded to Paramchem server (https://cgenff.umaryland.edu/) to obtain Toppar stream files (STR) for use with CgenFF, version 3.0.1 (Vanommeslaeghe, K. et al . J. Comput . Chem. 31, NA-NA (2009)) . The STR files were converted to GROMACS topology file using cgenff_charmm2gmx . py script

(http://mackerell.umaryland.edu/charmm_ff.shtml) . The TIP3P-CHARMM model was used for water. Simulations were performed using GROMACS 5.1.4 (Van Der Spoel, D. et al . J. Comput. Chem. 26, 1701-1718 (2005)). Each system was energy minimized. With position restraints applied on the protein, the system was simulated under constant NpT conditions using the V-rescale thermostat (Bussi et al . , J. Chem. Phys . 126, 014101 (2007)) (300 K) and the Parrinello-Rahman barostat (Parrinello & Rahman, J. Appl . Phys. 52, 7182-7190 (1981)) (1 atm pressure isotropically applied along all dimensions) for 1 ns to allow solvent equilibration around the protein. A time step of 2 fs was used for integrating equations of motion. The LINCS algorithm (Hess, P- LINCS: A Parallel Linear Constraint Solver for Molecu- lar Simulation, (2007), doi : 10.1021/CT700200B) was em- ployed to constrain the motions of covalently bonded hydrogen atoms. Neighbor list was updated using the Verlet cut-off scheme. A cut-off radius of 1 nm was applied to calculate van der Waals (Lennard-Jones ) in- teractions, however the forces were smoothly switched to zero between 1.0 and 1.2 nm. Long-range electro- static interactions (with a cut-off of 1.0 nm for the real-space component) were calculated using the Parti- cle Mesh Ewald (PME) method (Darden et al . , J. Chem. Phys . 98, 10089-10092 (1993)). Following equilibra- tion, position restraints on the protein were removed and the simulations were continued for 1 ms . 5 repli- cate simulations with different initial conditions were carried out for each of the 4 systems.

To examine the interaction of IAA with auxin perceptive proteins, the average distance between the center-of-mass of backbone of binding pocket residues and IAA was estimated. Binding pocket was defined as residues in auxin perceptive proteins within 0.4 nm of IAA (taken from the initial conformation similar to that observed in the crystal structure PDB ID: 2P1P) . The stability of IAA interaction also characterized by estimating the number of hydrogen bonds it formed with the residues of the binding pocket. Values were aver- aged over the entire simulation period and across all the replicas for all analyses.

Overall, these results demonstrate that the new AID system is suitable for loss-of-function stud- ies to reveal both acute phenotypes (DHC1, Glutl and MHY9; 0.5-2.0 h) and chronic phenotypes (Seipin and LBR; 16-48 h) with dramatic and specific IAA inducible changes. In addition, most of targets here are trans- membrane proteins that have not been successfully de- pleted at the protein level using AID before, demon- strating that the new AID system is broadly applica- ble .

It is obvious to a person skilled in the art that with the advancement of technology, the basic idea may be implemented in various ways. The embodiments are thus not limited to the examples described above; instead they may vary within the scope of the claims.

The embodiments described hereinbefore may be used in any combination with each other. Several of the embodiments may be combined together to form a further embodiment. A method, a product, a system, or a use, disclosed herein, may comprise at least one of the embodiments described hereinbefore. It will be understood that the benefits and advantages described above may relate to one embodiment or may relate to several embodiments. The embodiments are not limited to those that solve any or all of the stated problems or those that have any or all of the stated benefits and advantages. It will further be understood that reference to 'an' item refers to one or more of those items. The term "comprising" is used in this specification to mean including the feature (s) or act(s) followed thereafter, without excluding the presence of one or more additional features or acts.