Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
PRODUCTION OF ISOPROPANOL BY IMPROVED RECOMBINANT STRAINS
Document Type and Number:
WIPO Patent Application WO/2013/054022
Kind Code:
A1
Abstract:
The present invention relates to an expression vector including: nucleic acids encoding the polypeptides forming a polypeptide complex having an enzymatic activity suitable for converting acetoacetyl-CoA into acetoacetate; optionally at least one nucleic acid encoding a polypeptide having an enzymatic activity suitable for converting acetoacetate into acetone; and at least one nucleic acid encoding a polypeptide having an enzymatic activity suitable for converting acetone into isopropanol, the expression of said nucleic acids being controlled by a single constitutive promoter located upstream from the aforementioned nucleic acids.

Inventors:
COLLAS FLORENT (NL)
MARCHAL REMY (FR)
CLEMENT BENJAMIN (FR)
LOPEZ CONTRERAS ANA MARIA (NL)
CLAASSEN PIETERNEL A M (NL)
Application Number:
PCT/FR2012/052239
Publication Date:
April 18, 2013
Filing Date:
October 03, 2012
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
IFP ENERGIES NOUVELLES (FR)
STICHTING DIENST LANDBOUWKUNDI (NL)
COLLAS FLORENT (NL)
MARCHAL REMY (FR)
CLEMENT BENJAMIN (FR)
LOPEZ CONTRERAS ANA MARIA (NL)
CLAASSEN PIETERNEL A M (NL)
International Classes:
C07C29/04; C07C31/10; C12P7/04; C12R1/01; C12R1/145; C12R1/19
Domestic Patent References:
WO2008131286A12008-10-30
WO2009103026A12009-08-20
WO2011037414A22011-03-31
Foreign References:
EP2182051A12010-05-05
US20090246842A12009-10-01
Other References:
HANAI T ET AL: "Engineered synthetic pathway for isopropanol production in Escherichia coli", APPLIED AND ENVIRONMENTAL MICROBIOLOGY DECEMBER 2007 AMERICAN SOCIETY FOR MICROBIOLOGY US, vol. 73, no. 24, December 2007 (2007-12-01), pages 7814 - 7818, XP002671906, DOI: DOI:10.1128/AEM.01140-07
TORU JOJIMA ET AL: "Production of isopropanol by metabolically engineered Escherichia coli", APPLIED MICROBIOLOGY AND BIOTECHNOLOGY, SPRINGER, BERLIN, DE, vol. 77, no. 6, 7 November 2007 (2007-11-07), pages 1219 - 1224, XP019586231, ISSN: 1432-0614, [retrieved on 20071107], DOI: 10.1007/S00253-007-1246-8
CHEN JS: "Alcohol-Dehydrogenase - Multiplicity and Relatedness in the Solvant-Producing Clostridia", FEMS MICROBIOL REV, vol. 17, 1995, pages 263 - 273
CHEN J-S; HIU SF: "Acetone-butanol-isopropanol production by Clostridiumbeijerinckii (synonym,Clostridium butylicum", BIOTECHNOL LETT, vol. 8, 1986, pages 371 - 376
GAPES JR; NIMCEVIC D; FRIEDL A: "Long-Term Continuous Cultivation of Clostridium beijerinckii in a Two-Stage Chemostat with On-Line Solvent Removal", APPL ENVIRON MICROBIOL, vol. 62, 1996, pages 3210 - 3219
GEORGE HA; JOHNSON JL; MOORE WEC; HOLDEMAN LV; CHEN JS: "Acetone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum", APPL. ENVIRON. MICROBIOL., vol. 45, 1983, pages 1160 - 1163
GOIHBERG, E. ET AL.: "Biochemical and Structural Properties of Chimeras Constructed by Exchange of Cofactor-Binding Domains in Alcohol Dehydrogenases from Thermophilic and Mesophilic Microorganisms", BIOCHEMISTRY, vol. 49, no. 9, 2010, pages 1943 - 1953
HANAI T; ATSUMI S; LIAO JC: "Engineered synthetic pathway for isopropanol production in Escherichia coli", APPL ENVIRON MICROBIOL, vol. 73, 2007, pages 7814 - 7818, XP002671906, DOI: doi:10.1128/AEM.01140-07
HEAP JT; PENNINGTON OJ; CARTMAN ST; CARTER GP; MINTON NP: "The ClosTron: A universal gene knock-out system for the genus Clostridium", J MICROBIOL METHODS, vol. 70, 2007, pages 452 - 464, XP022212053, DOI: doi:10.1016/j.mimet.2007.05.021
ISMAIEL AA; ZHU CX; COLBY GD; CHEN JS: "Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii", J BACTERIOL, vol. 175, 1993, pages 5097 - 5105, XP008120764
JOHNSON JL; TOTH J; SANTIWATANAKUL S; CHEN JS: "Clostridium acetobutylicum'' from various collections comprise Clostridium acetobutylicum, Clostridium beijerinckii, and two other distinct types based on DNA-DNA reassociation", INTERNATIONAL JOURNAL OF SYSTEMATIC BACTERIOLOGY, vol. 47, 1997, pages 420 - 424
JOJIMA T; INUI M; YUKAWA H: "Production of isopropanol by metabolically engineered Escherichia coli", APPLIED MICROBIOL BIOTECHNOL, vol. 77, 2008, pages 1219 - 1224, XP019586231, DOI: doi:10.1007/s00253-007-1246-8
JONES, D.T.; D.R. WOODS: "Acetone butanol fermentation revisited", MICROBIOLOGICAL REVIEWS, vol. 50, no. 4, 1986, pages 484 - 524, XP002425366
KEIS S; SHAHEEN R; JONES DT: "Emended descriptions of Clostridium acetobutylicum and Clostridium beijerinckii, and descriptions of Clostridium saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov", INT J SYST EVOL MICROBIOL, vol. 51, 2001, pages 2095 - 2103, XP002543381
KORKHIN Y; KALB AJ; PERETZ M; BOGIN 0; BURSTEIN Y; FROLOW E: "Oligomeric integrity - The structural key to thermal stability in bacterial alcohol dehydrogenases", PROTEIN SCIENCE, vol. 8, 1999, pages 1241 - 1249
KORKHIN Y; KALB AJ; PERETZ M; BOGIN 0; BURSTEIN Y; FROLOW F: "NADP-dependent bacterial alcohol dehydrogenases: Crystal structure, cofactor-binding and cofactor specificity of the ADHs of Clostridium beijerinckii and Thermoanaerobacter brockii", J MOLECULAR BIOL, vol. 278, 1998, pages 967 - 981, XP004455957, DOI: doi:10.1006/jmbi.1998.1750
LANGLYKKE AF; PETERSON WH; FRED EB: "Reductive Processes of Clostridium butylicum and the Mechanism of Formation of Isopropyl Alcohol", J BACTERIOL, vol. 34, 1937, pages 443 - 453
LOGSDON JE; LOKE RA: "Kirk-Othmer Encyclopedia ofChemical Technology", 2001, JOHN WILEY & SONS, INC, article "Isopropyl alcohol"
MERMELSTEIN, L.D. ET AL.: "Metabolic engineering of Clostridium acetobutylicum ATCC 824 for increased solvent production by enhancement of acetone formation enzyme activities using a synthetic acetone operon", BIOTECHNOLOGY AND BIOENGINEERING, vol. 42, no. 9, 1993, pages 1053 - 1060, XP008120762, DOI: doi:10.1002/bit.260420906
MERMELSTEIN, L.D.; E.T. PAPOUTSAKIS: "Invivo Methylation in Escherichia-Coli by the Bacillus-Subtilis Phage-Phi-3t-I Methyltransferase to Protect Plasmids from Restriction Upon Transformation of Clostridium-Acetobutylicum Atcc-824", APPLIED AND ENVIRONMENTAL MICROBIOLOGY, vol. 59, no. 4, 1993, pages 1077 - 1081, XP055144733
MUJIBUROHMAN M; SEDIAWAN WB; SULISTYO H: "A preliminary study: Distillation of isopropanol-water mixture using fixed adsorptive distillation method", SEPARATION AND PURIFICATION TECHNOLOGY, vol. 48, 2006, pages 85 - 92, XP028035369, DOI: doi:10.1016/j.seppur.2005.07.025
NOLLING, J. ET AL.: "Genome sequence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum", JOURNAL OF BACTERIOLOGY, vol. 183, no. 16, 2001, pages 4823 - 4838, XP002984946, DOI: doi:10.1128/JB.183.16.4823-4838.2001
OSBURN OL, BROWN RW; WERKMAN CH: "The butyl alcohol-isopropyl alcohol fermentation", J BIOL CHEM, vol. 121, 1937, pages 685 - 695
OULTRAM JD; PECK H; BREHM JK; THOMPSON DE; SWINFIELD TJ; MINTON NP: "Introduction of Genes for Leucine Biosynthesis from Clostridium-Pasteurianum into Clostridium-Acetobutylicum by Cointegrate Conjugal Transfer", MOL GEN GENETICS, vol. 214, 1988, pages 177 - 179
PAPA A: "Propanols. In: Ullmann's Encyclopedia of Industrial Chemistry", 2005, WILEY-VCH VERLAG GMBH & CO. KGA
PETERSEN, D.J.; G.N. BENNETT: "Purification ofacetoacetate decarboxylase from Clostridium acetobutylicum ATCC 824 and cloning of the acetoacetate decarboxylase gene in Escherichia coli", APPL ENVIRON MICROBIOL, vol. 56, no. 11, 1990, pages 3491 - 8
PERETZ M ET AL.: "Molecular cloning, nucleotide sequencing, and expression of genes encoding alcohol dehydrogenases from the thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii", ANAEROBE, vol. 3, 1997, pages 259 - 270
ROGERS P; CHEN J-S; ZIDWICK M: "The prokaryotes. A handbook on the biology of bacteria", 2006, SPRINGER, article "Organic acid and solvent production. Part III; butanol, acetone, isopropanol;1,3- and 1,2-propanediol production; and 2,3-butanediol production", pages: 672 - 755
SURVASE SA; JURGENS G; VAN HEININGEN A; GRANSTRÔM T.: "Continuous production of isopropanol and butanol using Clostridium bejeriuckii DSM 6423", APPL MICROBIOL BIOTECHNOL., vol. 91, no. 5, September 2011 (2011-09-01), pages 1305 - 13
WIESENBORN DP; RUDOLPH FB; PAPOUTSAKIS ET: "Thiolase from Clostridium acetobutylicum ATCC 824 and Its Role in the Synthesis of Acids and Solvents", APPL ENVIRON MICROBIOL, vol. 54, 1988, pages 2717 - 2722, XP055086063
YAN RT; ZHU CX; GOLEMBOSKI C; CHEN JS: "Expression of Solvent-Forming Enzymes and Onset of Solvent Production in Batch Cultures of Clostridium beijerinckii (''Clostridium butylicum", APPL ENVIRON MICROBIOL, vol. 54, 1988, pages 642 - 648, XP002607787
Attorney, Agent or Firm:
BOURGOUIN, André et al. (FR)
Download PDF:
Claims:
REVENDICATIONS

1. Vecteur d'expression comprenant :

- un acide nucléique représenté par la séquence SEQ ID NO : 1 , ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 1, codant la sous-unité A de l'acétoacétyl-CoA transférase de C. acetobutylicum et

- un acide nucléique représenté par la séquence SEQ ID NO : 2 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 2, codant la sous-unité B de l'acétoacétyl-CoA transférase de C. acetobutylicum, et

- éventuellement un acide nucléique représenté par la séquence SEQ ID NO : 4 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 4, codant l'acétoacétate décarboxylase de C. acetobutylicum, et

- un acide nucléique représenté par la séquence SEQ ID NO : 3 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 3, codant l'alcool déshydrogénase secondaire de C. beijerinckii, l'expression desdits acides nucléiques étant contrôlée par un promoteur constitutif unique situé en amont des susdits acides nucléiques, ledit promoteur étant choisi parmi le promoteur représenté par la séquence SEQ ID NO : 5 (promoteur thl) et le promoteur représenté par la séquence SEQ ID NO : 6.

2. Vecteur d'expression selon la revendication 1, caractérisé en ce que ledit vecteur comprend :

- un acide nucléique représenté par la séquence SEQ ID NO : 1 ,

- un acide nucléique représenté par la séquence SEQ ID NO : 2,

- un acide nucléique représenté par la séquence SEQ ID NO : 3,

- un acide nucléique représenté par la séquence SEQ ID NO : 4, et

- un promoteur représenté par la séquence SEQ ID NO : 5.

3. Vecteur d'expression selon la revendication 1, caractérisé en ce que ledit vecteur comprend :

- un acide nucléique représenté par la séquence SEQ ID NO : 1 , - un acide nucléique représenté par la séquence SEQ ID NO : 2,

- un acide nucléique représenté par la séquence SEQ ID NO : 3, et

- un promoteur représenté par la séquence SEQ ID NO : 5.

4. Microorganisme comprenant un vecteur d'expression selon l'une des revendications 1 à 3 .

5. Microorganisme selon la revendication 4 , caractérisé en ce que ledit microorganisme est choisi dans les bactéries du genre Clostridium, Bacillus, ou des entérobactéries.

6. Microorganisme selon la revendication 5, caractérisé en ce que ledit microorganisme est choisi parmi Clostridium acetobutylicum, Clostridium beijerinckii, Clostridium saccharoperbutyacetonicum, Clostridium saccharobutylicum.

7. Microorganisme selon la revendication 5, caractérisé en ce que ledit microorganisme est Bacillus subtilis.

8. Microorganisme selon la revendication 5, caractérisé en ce que ledit microorganisme est E.coli.

9. Méthode de production d'isopropanol, et/ou de D et L 2,3 butanediol, caractérisée en ce que ladite méthode comprend :

- cultiver un microorganisme selon l'une quelconque des revendications 4 à 8, dans un milieu de culture comprenant au moins une source de carbone et une source d'azote, dans des conditions permettant la production d'isopropanol,

- récupérer l'isopropanol, et/ou de D et L 2,3 butanediol, du milieu de culture.

Description:
PRODUCTION D'ISOPROPANOL PAR DES SOUCHES

RECOMBINANTES AMELIOREES

COLLAS Florent; CONTRERAS-LOPEZ Ana; MARCHAL Rémy and CLEMENT Benjamin.

La présente invention concerne un procédé de production d'isopropanol par des souches recombinantes améliorées.

Etude bibliographique

L'isopropanol, appelé également 2-propanol, ou alcool isopropylique, est utilisé principalement comme solvant pour la préparation des encres et des agents tensio-actifs. Ses autres applications concernent les propriétés d'antiseptique, de solvant de la carboxymethylcellulose (CMC). L'isopropanol est également utilisé dans la production de bases cosmétologiques, comme solvant des pesticides ou en tant que source de matière en synthèse organique. A titre indicatif, on peut citer que la production d'isopropanol s'élevait à 45 millions de tonnes aux USA en 1990 (Papa A, 2005).

De nos jours, l'isopropanol est produit par une méthode essentiellement chimique consistant en l'hydratation du propylène selon une voie directe ou une voie indirecte. La voie indirecte met en œuvre deux étapes. Dans la première étape, on produit un mélange d'esters sulfuriques mono- et di-isopropyliques, qui sont hydrolysés en isopropanol dans une seconde étape. La voie directe met en œuvre l'hydratation du propylène à haute pression et basse température sur un catalyseur "lit fixe" acide (Logsdon J.E. and Loke R. A, 2001).

De 1942 à 1958, l'isopropanol a été produit par voie fermentaire à Taiwan (Rogers et al. 2006). Les substrats de la fermentation étaient la patate douce, le manioc, l'amidon de blé, tandis que le microorganisme était une souche sauvage. De nos jours, ce procédé de production d'isopropanol n'est plus utilisé industriellement. En effet les faibles productions obtenues avec les souches sauvages (entre 2 et 3 g/L d'isopropanol pour Clostridium. beijerinckii) ne permettent pas la mise en place de procédés économiquement viables. Tout comme la fermentation solvantogène ABE (Acétone, Butanol, Ethanol), la fermentation IBE (Isopropanol, Butanol, Ethanol) a été abandonnée au début des années 1960 parallèlement au développement de l'industrie pétrochimique.

En raison de soucis écologiques et économiques, la recherche sur la production d'isopropanol par fermentation microbiologique a suscité un regain d'intérêt ces dernières années. La fermentation productrice d'isopropanol est connue sous le nom de fermentation IBE. Elle se distingue d'une autre fermentation productrice de solvants, la fermentation ABE, en ce qu'elle produit de l'isopropanol, uniquement ou en majeure partie, aux dépens de l'acétone. Les souches productrices de solvants appartiennent au genre Clostridium. Elles ont été reclassées en quatre espèces : C. acetobutylicum, C. beijerinckii, C. aurantibutyricum, C. saccharoperbutylacetonicum (Keis et al. 2001

C. acetobutylicum est une souche utilisée fréquemment dans la fermentation ABE. Les produits principaux de fermentation avec C. acetobutylicum sont donc l'acétone, l'éthanol et le butanol. L'isopropanol n'est pas produit par les souches sauvages de C. acetobutylicum . L'isopropanol est un produit caractéristique d'un micro -organisme anciennement dénommé "Clostridium butylicum" (Osburn et al. 1937 ; Langlykke et al. 1937). En 1983, George et al. ont montré que C. butylicum était similaire à C. beijerinckii. Dans la classification actuelle, l'espèce C. beijerinckii contient donc des souches qui étaient anciennement classées en tant que C. butylicum. Cependant, toutes les souches de C. beijerinckii ne produisent pas de l'isopropanol. Par exemple, la souche C. beijerinckii NRRL B593 en produit, alors que la souche C. beijerinckii NRRL B592 n'en produit pas.

La voie de biosynthèse de l'isopropanol chez C. beijerinckii comporte les étapes suivantes :

(i) deux molécules d'acétyl-CoA sont condensées en une molécule d'acétoacétyl- CoA par l'acétyl-CoA transférase (EC 2.3.1.9), nommée également la thiolase (Thl) ;

(ii) le CoA de l'acétylCoA est transféré à l'acétate ou au butyrate par Pacétoacétyl- CoA transférase (Ca CtfAB) (EC 2.8.3.9) pour donner l'acétoacétate ;

(iii) l'acétoacétate est ensuite converti en acétone et C0 2 par l'acétate décarboxylase (Ca_Adc) ( EC 4.1.1.4) ; (iv) enfin, l'acétone est converti en isopropanol par l'alcool déshydrogénase secondaire (Cb s-Adh) (EC 1.1.1.2).

La comparaison des activités enzymatiques chez C. beijerinckii NRRL B593 et C. beijerinckii NRRL B592 (qui, respectivement, produit et ne produit pas d'isopropanol) a montré que la capacité d'excrétion de l'isopropanol était liée à l'activité alcool déshydrogénase secondaire Cb s-Adh (Y an et al. 1988). L'enzyme responsable a été purifiée à partir d'extraits acellulaires de C. beijerinckii NRRL B593 (Ismaiel et al. 1993). La déshydrogénase de C. beijerinckii NEST255 a également été purifiée à des fins de comparaison. Les alcools déshydrogénases secondaires des souches C. beijerinckii NRRL B593 et C. beijerinckii NEST255 sont dépendantes du NADP. In vitro, elles utilisent comme attendu les alcools secondaires (isopropanol), mais aussi les alcools primaires, notamment le butanol, avec une activité cependant plus faible. L'étude cinétique de l'enzyme a confirmé que le substrat physiologique de l'alcool déshydrogénase secondaire était bien l'acétone et non l'isopropanol (Chen et al. 1995). L'alcool déshydrogénase secondaire de C. beijerinckii (Cb-s-Adh) est clairement distincte de l'alcool déshydrogénase primaire issue du même micro-organisme, qui réduit, in vivo, le butyraldéhyde en butanol.

Le gène codant pour Cb s-Adh a été séquencé (Petretz et al. 1997). La structure de l'enzyme a été déterminée par les rayons X. Cb s-Adh est une enzyme homotetramérique à zinc comportant quatre chaînes polypeptidiques de 351 amino-acides. Chaque monomère est constitué de deux domaines. Le premier domaine (résidus 154-294) permet la fixation du cofacteur tandis que le second intègre le domaine catalytique (résidus 1-153 et 295-351) (Korkhin et al. 1998 ; Goihberg et al. 2010). Cb s-Adh est proche de son homologue issu de la bactérie thermophile Thermo anaeobacter brockii (Tb_s-Adh) par une identité séquence de 75%. En termes de propriétés, les deux enzymes diffèrent par leur thermostabilité (Korkin et al. 1999). Le remplacement, dans Cb s-Adh de GlnlOO par ProlOO dans la séquence d'amino- acides, augmente significativement la thermostabilité de Cb s-Adh (Goihberg et al. 2007) qui est originellement plus faible.

La capacité productive maximale d' isopropanol est relativement faible (2 à 3 g/L) avec les souches sauvages de C. beijerinckii (Chen et al, 1986). La demande de brevet

US2009/246842 décrit une méthode de production d'isopropanol dans une souche d'E.coli transformé par un vecteur d'expression comprenant le gène codant l'acétyl-CoA transférase de

C. acetobutylicum {Ca hl), les gènes codant l'acétoacétyl-CoA transférase de C. acetobutylicum (Ca_CtfAB), le gène codant une acétate décarboxylase (Ca_adc) de C. acetobutylicum et le gène codant l'alcool déshydrogénase secondaire (Cb_s-adh) de C. beijerinckii. Dans ce vecteur, l'expression de l'alcool déshydrogénase secondaire est sous le contrôle du promoteur qui est inductible par IPTG, alors que les expressions des gènes

Cajhl, Ca CtfAB et Ca_adc sont sous le contrôle du promoteur natif du gène Cajhl de C. acetobutylicum. L'inconvénient de cette méthode est qu'il est nécessaire d'utiliser un milieu de production riche, notamment l'extrait de levure (5 g.L "1 ), et un inducteur, tel que l'isopropyl-P-thiogalactopyranoside ou IPTG. Par ailleurs, l'alcool déshydrogénase secondaire est uniquement exprimée lors qu'IPTG est ajouté dans le milieu de culture, ce qui retarde la production de l'isopropanol et limite la productivité de la fermentation. La demande internationale WO 11/037414 décrit une autre méthode capable de produire l'isopropanol. Cette méthode consiste à utiliser des microorganismes du genre Clostridium transformés par un vecteur d'expression comprenant le gène codant l'acétate décarboxylase (Ca_adc) de C. acetobutylicum, les gènes codant l'acétoacétyl-CoA transférase de C. acetobutylicum (Ca_CtfAB) et le gène codant l'alcool déshydrogénase secondaire (Cb s- adh) de C. beijerinckii. Ce vecteur nécessite deux promoteurs : un promoteur constitutif Ca_thl p qui ne contrôle que l'expression de l'alcool déshydrogénase secondaire et un promoteur inductible Ca_adc p qui contrôle l'expression des protéines Ca CtfAB et Ca Adc. Etant donné que les protéines Ca CtfAB et Ca Adc ne s'expriment que pendant la phase de solvantogenèse, l'alcool déshydrogénase secondaire n'a pas de substrat (acétone) avant cette phase. De ce fait, l'isopropanol, le produit final de fermentation, n'est produit qu'après 15 heures de culture, ce qui limite la productivité de l'isopropanol par cette méthode de production.

Par conséquent, il existe toujours une nécessité de développer une méthode de production de l'isopropanol avec une meilleure productivité et un meilleur rendement.

L'objectif de la présente invention est de remédier aux inconvénients de l'art antérieur et de proposer une méthode de production de l'isopropanol par fermentation ayant une meilleure productivité et un meilleur rendement.

Description de l'invention

Les Inventeurs ont découvert qu'il était possible, de manière avantageuse, de produire de l'isopropanol en utilisant des microorganismes recombinants dans lesquels ont été introduits des vecteurs comprenant les gènes codant les enzymes de la voie métabolique menant de l'acétoacétyl-CoA à l'acétone, à savoir CoA transférase sous-unités A et B et acétoacétate décarboxylase, ainsi que le gène codant une alcool déshydrogénase secondaire de C. beijerinckii NRRL B593.

Le premier objectif de la présente invention vise à mettre en disposition d'un vecteur d'expression comprenant : - les acides nucléiques codant les polypeptides formant un complexe polypeptidique ayant une activité enzymatique permettant de convertir l'acétoacétyl-CoA en acéto-acétate,

- au moins un acide nucléique codant un polypeptide ayant une activité enzymatique permettant de convertir l'acétone en isopropanol, et - éventuellement, au moins un acide nucléique codant un polypeptide ayant une activité enzymatique permettant de convertir l'acétoacétate en acétone, l'expression desdits acides nucléiques étant contrôlée par un promoteur constitutif unique situé en amont des susdits acides nucléiques.

On entend par « vecteur d'expression » une molécule d'ADN exogène de forme circulaire, qui est capable de réplication autonome et indépendante de l'ADN chromosomique des cellules hôtes, permettant la transcription et la translation des gènes contenus dans ladite molécule d'ADN par le biais des cellules hôtes.

Dans la présente invention, le terme « vecteur » et le terme « plasmide » peuvent être remplacés l'un par l'autre. On entend par « promoteur » une région de 1ADN où se lie TARN polymérase et qui oriente cette enzyme vers le site où commencera la transcription du gène.

Les promoteurs peuvent être constitutifs ou inductibles.

On entend par « promoteur constitutif » un promoteur non régulé permettant une transcription continue du gène associé. Au contraire d'un promoteur constitutif, un promoteur inductible permet la transcription du gène associé en réponse à la présence d'un composé particulier, par exemple la présence d'IPTG, ou bien à une condition externe définie, par exemple une température élevée.

On entend par « un promoteur... situé en amont des ... acides nucléiques » un promoteur situé avant les extrémités 5' des acides nucléiques.

La conversion de l'acétoacétyl-CoA en acétoacétate est effectuée par l'acétoacétyl- CoA transférase. Dans la plupart des microorganismes, cette enzyme est formée par deux sous-unités codées par deux gènes différents. Ainsi l'acétoacétyl-CoA transférase de E.coli (Ato AD) est formée par les unités A et D, et Pacétoacétyl-CoA transférase de C. acetobutylicum (Ca_CtfAB) est formée par les unités A et B.

Dans un mode de réalisation particulier, la présente invention concerne un vecteur comprenant : - les acides nucléiques codant l'acétoacétyl-CoA transférase (Ca_CtfAB)., et au moins un acide nucléique codant pour le gène de l'alcool déshydrogénase secondaire de C. beijerinckii (Cb_s-adh); et éventuellement au moins un acide nucléique codant pour le gène de l'acétoacétate décarboxylase (Ca_adc). L'expression d u gène de l'alcool déshydrogénase secondaire de C. beijerinckii

NRRL B 593 permet d'assurer la conversion de l'acétone en isopropanol et l'excrétion de ce dernier. Une souche recombinante exprimant cette enzyme peut réduire presque la totalité de l'acétone et de l'acétoïne (3-hydroxy-2-butanone) respectivement en isopropanol et 2,3- butanediol. Bien qu'il soit connu que l'enzyme Cb s-Adh, de la souche C. beijerinckii NRRL B 593, puisse réduire l'acétone et la butanone, l'activité de cette enzyme sur l'acétoïne est constatée pour la première fois par les Inventeurs.

Dans un mode de réalisation plus particulier, la présente invention concerne un vecteur comprenant :

- un acide nucléique représenté par la séquence SEQ ID NO : 1, ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment

95% avec la séquence SEQ ID NO : 1, et

- un acide nucléique représenté par la séquence SEQ ID NO : 2 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 2, et - un acide nucléique représenté par la séquence SEQ ID NO : 3 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 3, et - éventuellement un acide nucléique représenté par la séquence SEQ ID NO : 4 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 4.

L'acide nucléique représenté par la séquence SEQ ID NO : 1 code la sous-unité A de l'acétoacétyl-CoA transférase de C. acetobutylicum ATCC 824 (Ca_ctfA).

L'acide nucléique représenté par la séquence SEQ ID NO : 2 code la sous-unité B de l'acétoacétyl-CoA transférase de C. acetobutylicum ATCC 824 (Ca_ctfB).

L'acide nucléique représenté par la séquence SEQ ID NO : 3 code l'alcool déshydrogénase secondaire de C. beijerinckii (Cb_s-adh). L'acide nucléique représenté par la séquence SEQ ID NO : 4 code l'acétoacétate décarboxylase de C. acetobutylicum (Ca_adc).

Le pourcentage d'identité entre deux séquences peptidiques ou entre deux séquences d'acides nucléiques peut être calculé selon la formule suivante :

le nombre des résidus identiques x 100

le nombre des résidus de la séquence la plus courte

Les combinaisons des susdits acides nucléiques (ou gènes) forment les opérons "ipa". L'expression des gènes des susdits opérons ipa étant contrôlée par un promoteur constitutif unique situé en amont des susdits acides nucléiques (ou gènes). Un promoteur constitutif, qui contrôle seul l'expression des opérons ipa, autorise une expression constitutive de ceux-ci, ce qui permet à une souche recombinante contenant un des vecteurs de l'invention de produire l'isopropanol dès les premières heures de fermentation.

Grâce à l'expression prématurée des gènes qui conduisent à la production d'isopropanol, le mécanisme de solvantogenèse est déclenché plus tôt dans une souche recombinante contenant un vecteur selon l'invention que dans une souche sauvage. Par conséquent, deux phases de fermentation, à savoir, l'acidogenèse et la solvantogenèse, se déroulent en même temps dans une souche recombinante contenant un vecteur selon l'invention, ce qui permet de diminuer d'au moins 20 heures la durée de fermentation. Le promoteur constitutif utilisé dans la construction du vecteur de la présente invention peut être le promoteur du gène codant la thiolase de C. acetobutylicum ATCC 824, représenté par la séquence SEQ ID NO : 5, ou le promoteur du gène de la pfiosphotransbutyrylase de C. acetobutylicum ATCC 824, représenté par la séquence SEQ ID NO : 6.

Dans un mode de réalisation particulier, le vecteur d'expression de la présente invention comprenant :

- un acide nucléique représenté par la séquence SEQ ID NO : 1 , ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%>, notamment 95% avec la séquence SEQ ID NO : 1, codant la sous-unité A de l'acétoacétyl-CoA transférase de C. acetobutylicum et

- un acide nucléique représenté par la séquence SEQ ID NO : 2 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 2, codant la sous-unité B de l'acétoacétyl-CoA transférase de C. acetobutylicum, et

- éventuellement un acide nucléique représenté par la séquence SEQ ID NO : 4 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 4, codant l'acétoacétate décarboxylase de C. acetobutylicum, et

- un acide nucléique représenté par la séquence SEQ ID NO : 3 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 3, codant l'alcool déshydrogénase secondaire de C. beijerinckii, l'expression desdits acides nucléiques étant contrôlée par un promoteur constitutif unique situé en amont des susdits acides nucléiques, ledit promoteur étant choisi parmi le promoteur représenté par la séquence SEQ ID NO : 5 (promoteur thl) et le promoteur représenté par la séquence SEQ ID NO : 6.

Dans un mode de réalisation particulier, le vecteur de la présente invention comprend : - un acide nucléique représenté par la séquence SEQ ID NO : 1,

- un acide nucléique représenté par la séquence SEQ ID NO : 2, - un acide nucléique représenté par la séquence SEQ ID NO : 3,

- un acide nucléique représenté par la séquence SEQ ID NO : 4, et

- un promoteur représenté par la séquence SEQ ID NO : 5.

Ce vecteur désigné pFC007 contient, dans l'ordre de l'extrémité 5' vers 3 ', le gène codant l'alcool déshydrogénase secondaire (Cb_s-adh) de C beijerinckii NRRL B 593 ainsi que le gène codant l'acétoacétate décarboxylase (Ca_adc) et les gènes codant les sous unités A et B de la coenzyme A transferase (Ca CtfAB) de C. acetobutylicum ATCC 824. Le vecteur pFC007 permet la surexpression des gènes de l'opéron "ipa7" sous le contrôle d'un seul et unique promoteur constitutif, celui du gène de l'acétyl-CoA transferase (thiolase, Ca hl) de C. acetobutylicum ATCC 824. Par conséquent, la production de leurs enzymes respectives (Cb s-Adh, Ca Adc and Ca CtfAB) commence dès les premières heures de la fermentation (après environ 4 et 10 heures).

Dans un autre mode de réalisation particulier, le vecteur de la présente invention comprend :

- un acide nucléique représenté par la séquence SEQ ID NO : 1 ,

- un acide nucléique représenté par la séquence SEQ ID NO : 2,

- un acide nucléique représenté par la séquence SEQ ID NO : 3, et

- un promoteur représenté par la séquence SEQ ID NO : 5.

Ce vecteur désigné pFC006 contient le gène codant l'alcool déshydrogénase secondaire (Cb_s-adh) de C. beijerinckii NRRL B 593 (DSMZ 6423) ainsi que les gènes codant les sous unités A et B de la coenzyme A transferase (Ca CtfAB) de C acetobutylicum ATCC 824. Ces gènes sont sous le contrôle d'un seul et unique promoteur constitutif du gène de Pacétyl-CoA transferase (ou thiolase ou Cajhl) de C. acetobutylicum ATCC 824.

Les vecteurs d'expression selon la présente invention peuvent comprendre en outre tout autre élément nécessaire pour la transcription et la traduction des enzymes susmentionnées, tel qu'une région RBS (ribosome binding site), un ou plusieurs gènes de sélection.

Une région RBS permet la fixation du ribosome à la molécule d'ARN messager avant le codon d'initiation d'un gène. La séquence de région RBS utilisée dans les vecteurs de la présente invention peut être une séquence quelconque de région RBS d'origine procaryote connue de l'homme du métier. La présence d'un gène de sélection dans un vecteur selon l'invention permet de sélectionner les microorganismes transformés avec succès. Un gène de sélection dans un vecteur permet aux microorganismes comprenant ledit gène de survivre dans certaines conditions particulières, ou bien d'aboutir à la présence d'une molécule repérable facilement. Le gène de sélection utilisé dans les vecteurs de la présente invention peut être tous gènes de sélection connus de l'homme du métier, notamment un gène permettant aux microorganismes de résister un antibiotique, tel que le gène Amp, ou ErmB.

Les vecteurs d'expression comportent également des origines de réplication, qui permettent l'initiation de la réplication desdits vecteurs dans les microorganismes hôtes. L'origine de réplication utilisée dans les vecteurs de la présente invention peut être une quelconque origine connue de l'homme du métier.

La présente invention vise également à mettre à disposition un microorganisme recombinant pour la production de l'isopropanol avec une meilleure productivité et un meilleur rendement.

Ledit microorganisme comprend un vecteur d'expression tel que décrit dans la présente invention.

Particulièrement, ledit microorganisme comprend un vecteur comprenant :

- un acide nucléique représenté par la séquence SEQ ID NO : 1, ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment

95% avec la séquence SEQ ID NO : 1, et

- un acide nucléique représenté par la séquence SEQ ID NO : 2 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 2, et

- un acide nucléique représenté par la séquence SEQ ID NO : 3 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 3, et

- éventuellement un acide nucléique représenté par la séquence SEQ ID NO : 4 ou un acide nucléique ayant une identité de séquence d'au moins 85%, particulièrement 90%, notamment 95% avec la séquence SEQ ID NO : 4,

l'expression desdits acides nucléiques étant contrôlée par un promoteur constitutif unique situé en amont des susdits acides nucléiques, ledit promoteur étant choisi parmi le promoteur représenté par la séquence SEQ ID NO : 5 (promoteur thl) et le promoteur représenté par la séquence SEQ ID NO : 6. Dans un mode de réalisation avantageux, ledit microorganisme comprend le vecteur pFC007.

Dans un autre mode de réalisation avantageux, ledit microorganisme comprend le vecteur pFC006.

Ledit microorganisme de la présente invention peut être choisi parmi les bactéries du genre Clostridium, telles que C. acetobutylicum, C. beijerinckii, C. saccharoperbutyacetonicum, C. saccharobutylicum, les bactéries du genre Bacillus, telles que Bacillus subtilis, ou des entérobactéries, telles que E.coli.

Dans un mode de réalisation particulier, le microorganisme selon l'invention est C. acetobutylicum.

Dans un mode de réalisation plus particulier, le microorganisme selon l'invention est la souche C. acetobutylicum ATCC 824.

Dans un mode de réalisation particulièrement avantageux, l'invention concerne une souche recombinante de C. acetobutylicum ATCC 824 comprenant le vecteur pFC007. . La souche recombinante est nommée ATCC 824(pFC007).

Dans un autre mode de réalisation particulièrement avantageux, l'invention concerne une souche recombinante de C. acetobutylicum ATCC 824 comprenant le vecteur pFC006. La souche recombinante est nommée ATCC 824(pFC006).

Pour les deux souches recombinantes (ATCC 824(pFC007) et ATCC 824(pFC006)), la production d'isopropanol peut être détectée dès les 10 premières heures de culture, alors que la trace de solvants (ABE) n'est pas détectable dans la souche sauvage de C. acetobutylicum ATCC 824 ou la souche recombinante de C. acetobutylicum ATCC 824 dans laquelle est inséré un vecteur qui ne comprend que le gène codant l'alcool déshydrogénase secondaire (Cb_s-adh) de C. beijerinckii NRRL B 593.

La présente invention a également pour objectif de mettre à disposition une méthode de production d'isopropanol, et/ou de D et L 2,3 butanediol, avec une meilleure productivité et un meilleur rendement.

Ladite méthode comprend au moins les étapes suivantes : cultiver un microorganisme selon l'invention dans un milieu de culture comprenant au moins une source de carbone et une source d'azote, dans des conditions permettant la production d'isopropanol, par exemple le milieu de culture décrit par Gapes et al. (Gapes, 1996) - récupérer l'isopropanol, et/ou de D et L 2,3 butanediol, du milieu de culture.

Les milieux de culture sont connus de l'homme du métier.

La source de carbone peut être l'amidon, le glucose, le xylose, les hydrolysats lignocellulosiques.

La source d'azote peut être l'ammoniaque, l'extrait de levure, la peptone, l'urée.

Les conditions de culture de microorganisme du genre Clostridium, Bacillus ou des bactéries E. coli sont connues de l'homme du métier.

La récupération de l'isopropanol, et/ou de D et L 2,3 butanediol, du milieu de culture est mise en œuvre par distillation (Mujiburohman et al. 2006).

Les exemples et figures présentés ci-après permettent d'illustrer plus en détail la présente invention. Cependant, la portée de la présente d'invention ne doit en aucun cas être limitée à ces exemples ou figures. Figures

Figure 1 : cette figure illustre la construction du vecteur pFC007 à partir du plasmide pMTL500E.

Figure 2 : cette figure présente les sites de restriction du plasmide pMTL500E.

Figure 3 : cette figure illustre la carte de restriction du vecteur pFC007.

Exemples

Matériels et méthodes

Matériel

Les kits utilisés lors des travaux de biologie moléculaire (construction des vecteurs plasmidiques) sont présentés dans le Tableau 1.

Tableau 1 : Kits et matériels utilisés lors des travaux de biologie moléculaire

Nom du kit Utilisation Fournisseur

Enzymes de restriction : apal, Digestion enzymatiques des ADN New England spel, sphl, xbal et xhol plasmidiques Biolabs (NEB)

High Fidelity PCR Master Mix™ Amplification PCR Roche

DreamTaq™ Amplification PCR Fermentas

Oligonucléotides (Tableau 3) Amorces pour les réactions de PCR, créées BaseClear

par les inventeurs

Alkaline phosphatase déphosphorylation des extrémités 5' des New England

vecteurs linéarisés empêchant l'autoligation Biolabs

T4 DNA ligase ligation de fragment dADN New England

Biolabs (NEB)

GenJETTM plasmid miniprep Extraction de 1ADN plasmidique à partir de Fermentas

cultures d' E. coli

GenElute™ Bacterial Genomic Extraction de 1ADN génomique de Sigma-Aldrich

DNA bactéries (gram positif et négatif)

Z-Competent™ E.coli Production de bactéries E.coli XL1 blue et Zymo Research transformation E. coli BW25113 chimiocompétentes

Les souches utilisées dans les exemples de la présente invention sont :

• C. acetobutylicum ATCC 824, provenant de la collection ATCC

• C. beijerinckii NRRL B 593, provenant de la collection DSMZ (numéro 6423) · E.coli XL1 bleu, utilisée pour le clonage et le maintien des plasmides

• E.coli DH10B (PAN2), utilisée pour la méthylation des plasmides

Dosage des solvants (acétone, acétoïne, isopropanol, butanol, butanediol) et acides carboxyliques (acides butyrique et acétique)

Les échantillons de fermentation (2 mL) sont centrifugés 5 minutes à 20 000 g et les surnageants sont utilisés pour le dosage des métabolites de fermentations (glucose, acide acétique et butyrique, 2, 3 -butanediol, acétone, éthanol, isopropanol et butanol). Pour chaque échantillon, un equivolume d'une solution acid (0.5 mM H 2 SO 4 ) contenant l'étalon interne (30 mM de 4-methylvaleric acid) est ajoutée, le mélange est ensuite homogénéisé et filtré (0,2 10 d'échantillon sont ensuite injectés et analysés dans une colonne Shodex lonpack KC-811 (RP). Les composés dosés sont détectés en sortie de colonne grâce à deux détecteurs : un refractomètre (Waters 2487) et un spectrophotomètre (Waters 2487) mesurant l'absorbance à 210 nm. L'éluant utilisé est une solution d'acide sulfurique à 3 mM, le débit de l'éluant est de 1 mL/min et la température de la colonne est fixée 85 °C.

Construction des vecteurs

Les structures génétiques des vecteurs utilisés ou construits dans les exemples de la présente invention sont résumées dans le Tableau 2 ci-après. Tableau 2 : Structures génétiques des vecteurs

Clostridium/E. coli

Plasmide Description Référence

marqueur sélectif

pMTL500E ermB/amp R Vecteur vide Oultram et al, 1988 pFC002 ermB/amp Ca_thl p [Cb_s-adh] Ce document

pFC005 ermB/amp Ca_thl p [ Cb_s-adh; Ce document

Ca_adc]

pFC006 ermB/amp Ca_thl p [ Cb_s-adh; Ce document

Ca_ctfAB]

pFC007 ermB/amp Ca_thl p [ Cb_s-adh; Ce document

Ca_adc; Ca_ctfAB]

pAN2 ttc (Mermelstein, 1993;

Heap, 2009)

ermB : gène de résistance à l ' érythromycine ; amp : gène de résistance à l ' ampicilline; ttc : gène de résistance à la tetracycline; Ca : ce préfixe indique que le gène provient de C. acetobutylicum ATCC 824 ; Cb : ce préfixe indique que le gène provient de C. beijerinckii NRRL B593 ; Ca hl : gène de la thiolase ; Cb_s-adh : gène de la déshydrogénase secondaire de C. beijerinckii NRRL B593; Ca_adc : gène de l'acétate décarboxylase de C. acetobutylicum ATCC 824 ; Ca CtfAB : gène de la CoA transférase de C. acetobutylicum ATCC 824.

La construction du vecteur pFC007 à partir du plasmide pMTL500E (figure 2) nécessite au moins 3 étapes (figure 1).

Etape 1 : Construction du vecteur pFC002

Le vecteur pFC002 est construit à partir du plasmide pMTL500E. Ce dernier est digéré par les enzymes de restriction sphi et xhol sur le gène lacZ. Le produit de digestion est ensuite déphosporylé. Les sites de restriction sphi et apal sont ajoutés respectivement en 5' et 3' de la séquence d'ADN du promoteur Pthl, par la technique PCR en utilisant les amorces Ca_thlp-for et Ca_thlp_rev provenant de l'ADN génomique de C. acetobutyliccum ATCC 824 (Nolling, J., et al, 2001) (NCBI référence : NC_003030.1 (http:/yvvww.ncbi.nlm.nih.gov/miccore/NC__00303Q) (Tableau 3). Les sites de restriction apal et xhol sont ajoutés respectivement en 5' et 3' de la séquence d'ADN du gène Cb_s-adh de C. beijerinckii NRRL B593, par la technique PCR en utilisant les amorces Cb_s-adh-for et Cb s- adh-rev (Tableau 3).

Le produit de PCR ainsi obtenu est digéré par les enzymes de restriction apal et xhol. Le plasmide digéré, le promoteur digéré et le gène digéré issus de la PCR sont ligaturés ensemble pour donner un vecteur appelé pFC002 (figure 2). Ce vecteur est maintenu et multiplié dans la souche E coli XL1 blue.

Etape 2 : Construction du vecteur pFC006 à partir du plasmide pFC002

Le vecteur pFC002 est digéré par les enzymes de restriction xhol et Xbal. Les gènes codant Ca CtfAB sont amplifiés ensemble à partir de l'ADN génomique de C. acetobutylicum ATCC 824, en utilisant les amorces Ca CtfAB for et Ca CtfAB rev (Tableau 3). Le produit de PCR est digéré par les enzymes de restriction xhol et spel. Le vecteur pFC002 digéré et le fragment d'ADN digéré contenant le gène Ca CtfAB sont ligaturés ensemble. Le vecteur ainsi obtenu est désigné pFC006 (Figure 1). Le vecteur est maintenu et multiplié dans la souche E.coli XL1 blue.

Etape 3 : Construction du vecteur pFC007 à partir du plasmide pFC006

Le vecteur pFC006 est digéré par les enzymes de restriction xhol et Xbal. Le gène codant Ca_Adc est amplifié à partir de l'ADN génomique de C. acetobutylicum ATCC 824, en utilisant les amorces Ca_adc for et Ca_adc rev (Tableau 3). Le produit de PCR est digéré par les enzymes xhol et Spel. Le vecteur pFC006 digéré et le fragment d'ADN digéré contenant le gène Ca_adc sont ligaturés ensemble. Le vecteur ainsi obtenu est désigné pFC007 (Figures 1 et 3). Le vecteur est maintenu et multiplié dans la souche E.coli XL1 blue. Tableau 3 : Amorces utilisées pour la construction des opérons ipa

Amorces Séquence (5'-3')

Cajhlp-for GCATGCGAATTTAGAATGAAGTTTCTTATGCA (SEQ ID NO : 7) Ca_thlp_rev GGGCCCCCATAGTTTATCCCTAATTTATACG (SEQ ID NO : 8)

Cb_s-adh-for GGGCCCTTAGACTATTAAAGGAATATTTTTAAGG (SEQ ID NO : 9)

Cb s-adh-rev TTTTCTCGAGGTATAATCCTCCATGATCTATTATG (SEQ ID NO: 10)

CAACTACTCGAGATAATTTTTCTAGAGAATTTAAAAGGAGGGATTAAAATG

ctfA &B for

(SEQ ID NO : 11)

Ca ctfA &B rev (SEQ ID NO : 12)

AAACAACTCGAGTTATAATCTAGATATAAATAAATAGGACTAGAGGCG

Ca adc for

(SEQ ID NO : 13)

AAAAATACTAGTTACCATTTAAGTCGACTCTTATTTTTATTACTTAAG

Ca adc rev

(SEQ ID NO : 14)

Les sites de restriction ajoutés (sphl, apal, xhol, Sali, xbal and spel) sont soulignés. Les sites de fixation des ribosomes sont indiqués en gras.

Le préfixe "Ca" signifie que l'amorce est utilisée sur de l'ADN génomique de C.

acetbutylicum

Le préfixe Cb signifie que l'amorce est utilisée sur de l'ADN génomique C. beijerinckii

NR L B 593

Par des méthodes similaires, le gène codant Ca Adc peut être inséré dans le vecteur pFC002 pour obtenir le vecteur pFC005 .

Selon des méthodes similaires, les gènes codant Ca CtfAB peuvent être ensuite insérés dans le vecteur pFC005 pour obtenir le vecteur pFC008.

Transformation de C. acetobutylicum

Les vecteurs pFC002, pFC006 et pFC007 sont d'abord méthylés respectivement par cotransformation avec le plasmide pANl dans la souche E.coli DH10B.

La souche sauvage de C. acetobutylicum ATCC 824 est ensuite transformée respectivement par les vecteurs pFC002, pFC006 et pFC007 méthylés selon le protocole décrit par Oultram (1988). Les souches de C. acetobutylicum ATCC 824 transformées par pFC002, pFC006 et pFC007 sont nommées ATCC 824(pFC002), ATCC 824(pFC006) et ATCC 824(pFC007), respectivement.

Caractérisation génétique des souches recombinantes

Afin de confirmer la présence de l'un des vecteurs décrits ci-dessus dans la souche C. acetobutylicum ATCC 824 après la transformation, une PCR spécifique au plasmide est effectuée avec différent couple d'amorces. Les résultats montrés dans le Tableau 4 confirment la présence de vecteurs dans les souches recombinantes analysées.

Tableau 4 : Identification des vecteurs pFC005, pFC006 ou pFC007 dans C. acetobutylicum ATCC 824 par PCR

Taille de fragments PCR attendues [kbp] pour les couples d'amorces :

PCR mix Cb thlp for Cb s-adh for Cb s-adh for Ca adc for Ca ctfAB for Cb s-adh rev Ca adc rev Ca ctfAB rev Ca ctfAB rev Ca adc rev pFC002 1 ,4

pFC005 1 ,4 2,0 No No No pFC006 1 ,4 No 2,5 No No pFC007 1 ,4 2,0 3,4 2,3 No pFC008 1 ,4 3,4 2,5 No 2,3

Fermentation des souches recombinantes

Des fermentations ont été réalisées dans un milieu de culture décrit par Gapes et al. (GAPES et al, 1996), contenant 90g/L de glucose avec des souches sauvages, C. beijerinckii NPvRL B 593 et C. acetobutylicum ATCC 824, et les souches recombinantes à savoir C. acetobutylicum ATCC 824 transformé respectivement par les vecteurs pFC006 et pFC007. Les résultats de fermentation sont présentés dans le Tableau 5.

Tableau 5: Performances finales sur glucose par des souches sauvages et recombinantes de C. beijerinckii NRRL B 593 et de C. acetobutylicum ATCC 824

NRRL B ATCC 824 ATCC 824 ATCC 824 ATCC 824

593 type (pFC002) (pFC006) (pFC007)

Caractéristique type sauvage

sauvage

Glucose consommé [g/L] 34,30 61,99 54,82 69,26 67,79

Acide lactique [g/L] 0,55 0,00 -0,16 0,17 0,19

Acide acétique [g/L] 0,83 2,86 4.61 3,24 1,61

Acetoïne [g/L] 0,00 0,59 0,10 0,06 0,05

2,3-Butanediol [g/L] 0,00 0,08 0,48 0,91 0,88

Acide butyrique [g/L] 0,21 2,02 2.51 1,08 1,06

Acétone [g/L] 0,17 5,70 0.05 0,35 0,09

Ethanol [g/L] 0,12 1,26 0.31 1,34 1,71

Isopropanol [g/L] 4,47 0,10 4.25 7,27 8,37

Butanol [g/L] 8,08 8,98 8.22 11,80 12,95

IBE ou ABE [g/L] 12,83 16,04 12.82 20,76 23,12

Durée de fermentation [h] * 33,5 49,5 >45 29,9 28,0

Productivité maximale en

0,41 0,41 0.33 0,69 0,81

IBE ou ABE [g/L.h]

Rendement en IBE ou ABE

0,37 0,26 0.24 0,30 0,34

[g/g substrat.]

Sélectivité en isopropanol

0,35 0,01 0.33 0,35 0,36

[g/g solvants]

Sélectivité en acétone

0,01 0,36 <0.01 0,02 0,00

[g/g solvants]

temps nécessaire pour atteindre 95% de la production finale de solvant. Fermentation du glucose par la souche sauvage C. acetobutylicum ATCC 824

Il faut environ 50 heures de fermentation, pour atteindre 95% de la production finale de solvants. La présence de solvant (butanol) ne peut être détectée qu'après 11 heures d'inoculation. Ni l'isopropanol ni 2,3-butanediol ne sont produits par la souche sauvage C. acetobutylicum ATCC 824. La production d'acétone et celle d'acétoïne atteignent respectivement 5,7 g/L et 0,6 g/L. Les productions finales en butanol et en éthanol atteignent respectivement 9,0 g/L et 1,3 g/L. Fermentation du glucose par la souche recombinante C. acetobutylicum ATCC 824(pFC002)

C. acetobutylicum ATCC 824(pFC002) est une souche recombinante ayant reçu le vecteur pFC002. Le vecteur pFC002 permet, à son hôte, l'expression constitutive du gène de l'alcool déshydrogenase secondaire de C. beijerinckii NRRL B 593 (Cb_s-adh) codant pour l'enzyme Cb s-Adh. La production de Cb s-Adh dans la souche recombinante ATCC 824(pFC002) permet d'hydrogéner l'acétone et l'acétoïne respectivement en isopropanol et 2,3-butanediol. L'acétoïne est produite naturellement par la souche sauvage de C. acetobutylicum ATCC 824. Cependant, cette souche recombinante n'est pas capable de produire plus d'isopropanol que la souche sauvage de C. beijerinckii NRRL B593. De plus, la souche ATCC 824(pFC002) présente des performances de fermentations médiocres, ainsi la production d'isopropanol, et de solvants en générale, de la souche ATCC 824(pFC002) est inférieure de 25% à la production d'acétone et de 20 % à la production de solvants de la souche sauvage de C. acetobutylicum ATCC 824. L'acétate et le butyrate restent des produits majoritaires en fin de la fermentation. La production importante d'acides provoque la chute du rendement en solvants, puis qu'une partie des glucides est utilisée pour la production d'acides.

Fermentation du glucose par la souche recombinante C. acetobutylicum ATCC 824(pFC006)

Comme la souche recombinante ATCC 824(pFC002), la souche recombinante

ATCC 824(pFC006) produit de l'isopropanol et du 2,3-butanediol au lieu d'acétone et d'acétoïne. Cependant, au contraire du profil de production pour la souche recombinante ATCC 824(pFC002), la souche recombinante ATCC 824(pFC006) peut atteindre un niveau élevé de production de solvants sur une durée de temps plus courte. Le temps nécessaire pour atteindre 95% de la production finale de solvant pour cette souche est d'environ 30 heures. La consommation de l'acide butyrique est plus efficace que celle de la souche sauvage ou de la souche recombinante ATCC 824(pFC002), mais reste incomplète. La production de solvants dans cette souche commence plus tôt que pour la souche sauvage ou pour la souche recombinante ATCC 824(pFC002). La production d'isopropanol peut être détectée dès les 10 premières heures de culture de la souche ATCC 824(pFC006), alors que des traces de solvants ne sont pas encore détectables dans la souche sauvage ou dans la souche ATCC 824(pFC002).

De plus, l'incorporation de l'acétate et celle du butyrate dans la souche ATCC 824(pFC006) sont toutes deux améliorées par rapport à celles dans la souche sauvage, ce qui permet de d'avoir un rendement pour l'isopropanol meilleur que le rendement en acétone de la souche sauvage. Pour la souche ATCC 824(pFC007), les titres respectifs de l'isopropanol, du butanol et de l'éthanol est de 7,3 g/L, 11,8 g/L et 1,37 g/L, autrement dit 28 %, 31 % et 6 % supérieur à ceux de la souche sauvage. La productivité est augmentée de 0,41 g/L.h pour une souche sauvage à 0,69 g/L.h pour la souche ATCC 824(pFC007).

La souche ATCC 824(pFC006) produit deux fois plus de 2,3-butanediol que la souche ATCC 824(pFC002), cette augmentation de la production de 2,3-butanediol peut être due à un flux métabolique globalement amélioré.

Il s'avère que l'amélioration de l'incorporation d'acides permet à la souche ATCC 824(pFC006) de produire moins d'acides et d'augmenter sa production de solvants.

Cependant, malgré la surexpression de l'enzyme Ca CtfAB, la production finale d'acétate est plus élevée dans la souche ATCC 824(pFC006) que dans la souche sauvage, ce qui peut être dû à la production élevée d'acides du fait d'un flux métabolique globalement amélioré.

Fermentation du glucose par la souche recombinante C. acetobutylicum ATCC 824 transformé par pFC007

La souche ATCC 824(pFC007) présente un profil de fermentation similaire à celui de la souche ATCC 824(pFC006). Le temps pour atteindre 95 % de la production finale de solvants est de moins de 30 heures. L'acidogénèse commence normalement. La production de solvants dans la souche ATCC 824(pFC007) commence pendant la phase exponentielle et plus tôt que dans la souche sauvage. La présence d'isopropanol peut être détectée dans le milieu de culture de la souche ATCC 824(pFC007), 4 heures seulement après l'inoculation alors que l'acétone n'est pas encore détectable dans le milieu de culture d'une souche sauvage.

De plus, l'incorporation de l'acétate et celle du butyrate dans la souche ATCC

824(pFC007) sont toutes deux améliorées par rapport à celles dans la souche ATCC 824(pFC006), ce qui permet de d'avoir un meilleur rendement pour l'isopropanol par rapport à celui de la souche ATCC 824(pFC006), ou d'autres souches décrites précédemment. Dans la souche ATCC 824(pFC007), les titres respectifs de l'isopropanol, du butanol et de l'éthanol est de 8,4 g/L, 13,0 g/L et 1,71 g/L, autrement dit 46 %, 44 % et 36 % supérieurs à ceux de la souche sauvage. La productivité est augmentée de 0,41 g/L. h pour une souche sauvage à 0,81 g/L.h pour la souche ATCC 824(pFC007).

La production de 2,3-butanediol, de la souche ATCC 824(pFC007) est similaire à celle de la souche ATCC 824(pFC006). Comme pour la souche ATCC 824(pFC006), cette augmentation de la production de 2,3-butanediol peut être dû à un flux métabolique globalement amélioré.

Fermentation du glucose par la souche sauvage C. beijerinckii NRRL B 593

La souche sauvage C. beijerinckii NRRL B 593 est cultivée dans les mêmes conditions que la souche C. acetobutylicum ATCC 824 sauvage ou recombinante.

Après 34 heures de fermentation, la souche sauvage de C. beijerinckii atteint 95% de la production finale de solvants. En revanche, les productions finales de cette souche ne sont que 4,5 g/L pour l'isopropanol, 8,1 g/L pour le butanol et 0,1 g/L pour l'éthanol, ce qui est plus faible que pour la souche sauvage C. acetobutylicum ATCC 824 et pour les souches C. acetobutylicum ATCC 824 recombinantes (souches ATCC 824(pFC006) et ATCC 824(pFC007).

Comme attendu, la souche C. beijerinckii NRRL B 593 sauvage ne produit ni l'acétoïne ni butanediol.

Conclusion

Les souches recombinantes ATCC 824(pFC006) et ATCC 824(pFC007) présentent toutes deux une meilleure productivité en solvants que la souche sauvage C. acetobutylicum ATCC 824 ou que la souche sauvage C. beijerinckii NRRL B 593. La productivité de solvants est multipliée respectivement par un facteur 1,8 avec la souche ATCC 824(pFC006) et par facteur 2 avec la souche ATCC 824(pFC007). Ces résultats montrent que ces deux souches peuvent produire plus de solvants sur une durée de temps plus courte que les souches sauvages. De plus, la souche ATCC 824(pFC007) a montré une bonne aptitude à la culture en continue mono-étagé (une seul fermenteur). Les productions d'isopropanol, butanol et éthanol observées étaient à celles connues pour la souche C. beijerinckii NRRL B 593 (Shrikant A., 2011) et C. acetohutylicum ATCC824(pFC007) (Godin et al, 1990)

Référence Bibliographiques

Chen JS (1995) Alcohol-Dehydrogenase - Multiplicity and Relatedness in the Solvant-

Producing Clostridia. FEMS Microbiol Rev 17:263-273

Chen J-S, Hiu SF (1986) Acetone-butanol-isopropanol production by Clostridiumbeijerinckii

(synonym,Clostridium butylicum). Biotechnol Lett 8:371-376

Gapes JR, Nimcevic D, Friedl A (1996) Long-Term Continuous Cultivation of Clostridium beijerinckii in a Two-Stage Chemostat with On-Line Solvent Removal. Appl Environ

Microbiol 62:3210-3219

George HA, Johnson JL, Moore WEC, Holdeman LV, Chen JS (1983) Acétone, Isopropanol, and Butanol Production by Clostridium beijerinckii (syn. Clostridium butylicum) and Clostridium aurantibutyricum. Appl. Environ. Microbiol. 45 : 1160-1163

Goihberg, E., et al, Biochemical and Structural Properties of Chimeras Constructed by Exchange of Cofactor-Binding Domains in Alcohol Dehydrogenases from Thermophilic and Mesophilic Microorganisms. Biochemistry, 2010. 49(9): p. 1943-1953

Hanai T, Atsumi S, Liao JC (2007) Engineered synthetic pathway for isopropanol production in Escherichia coll. Appl Environ Microbiol 73:7814-7818

Heap JT, Pennington OJ, Cartman ST, Carter GP, Minton NP (2007) The ClosTron: A universal gene knock-out System for the genus Clostridium. J Microbiol Methods 70:452-464

Ismaiel AA, Zhu CX, Colby GD, Chen JS (1993) Purification and characterization of a primary-secondary alcohol dehydrogenase from two strains of Clostridium beijerinckii.

J Bacteriol 175:5097-5105

Johnson JL, Toth J, Santiwatanakul S, Chen JS (1997) Cultures of "Clostridium acetobutylicum" from various collections comprise Clostridium acetobutylicum,

Clostridium beijerinckii, and two other distinct types based on DNA-DNA reassociation.

International Journal of Systematic Bacteriology 47:420-424

Jojima T, Inui M, Yukawa H (2008) Production of isopropanol by metabolically engineered

Escherichia coli. Applied Microbiol Biotechnol 77: 1219-1224

Jones, D.T. and D.R. Woods, Acétone butanol fermentation revisited Microbiological

Reviews, 1986. 50(4): p. 484-524 Keis S, Shaheen R, Jones DT (2001) Emended descriptions of Clostridium acetobutylicum and Clostridium beijerinckii, and descriptions of Clostridium saccharoperbutylacetonicum sp. nov. and Clostridium saccharobutylicum sp. nov. Int J Syst Evol Microbiol 51 :2095-2103

Korkhin Y, Kalb AJ, Peretz M, Bogin O, Burstein Y, Frolow E (1999) Oligomeric integrity - The structural key to thermal stability in bacterial alcohol dehydrogenases. Protein Science 8: 1241-1249

Korkhin Y, Kalb AJ, Peretz M, Bogin O, Burstein Y, Frolow F (1998) NADP-dependent bacterial alcohol dehydrogenases: Crystal structure, cofactor-binding and cofactor specifïcity of the ADHs of Clostridium beijerinckii and Thermoanaerobacter brockii. J

Molecular Biol 278:967-981

Langlykke AF, Peterson WH, Fred EB (1937) Reductive Processes of Clostridium butylicum and the Mechanism of Formation of Isopropyl Alcohol. J Bacteriol 34:443-453

Logsdon JE, Loke RA (2001) Isopropyl alcohol. In: Kirk-Othmer Encyclopedia of Chemical Technology. John Wiley & Sons, Inc.

Mermelstein, L.D., et al., Metabolic engineering of Clostridium acetobutylicum ATCC 824 for increased solvent production by enhancement of acétone formation enzyme activities using a synthetic acétone operon. Biotechnology and Bioengineering, 1993. 42(9): p. 1053-1060

Mermelstein, L.D. and E.T. Papoutsakis, Invivo Methylation in Escherichia-Coli by the Bacillus-Subtilis Phage-Phi-3t-I Methyltransferase to Protect Plasmids from Restriction Upon Transformation of Clostridium- Acetobutylicum Atcc-824. Applied and Environmental Microbiology, 1993. 59(4): p. 1077-1081 Mujiburohman M, Sediawan WB, Sulistyo H (2006) A preliminary study: Distillation of isopropanol-water mixture using fixed adsorptive distillation method. Séparation and Purification Technology 48:85-92

Nolling, J., et al, Génome séquence and comparative analysis of the solvent-producing bacterium Clostridium acetobutylicum Journal of Bacteriology, 2001. 183(16): p. 4823- 48380sburn OL, Brown RW, Werkman CH (1937) The butyl alcohol-isopropyl alcohol fermentation. J Biol Chem 121 :685-695

Oultram JD, Peck H, Brehm JK, Thompson DE, Swinfïeld TJ, Minton NP (1988) Introduction of Gènes for Leucine Biosynthesis from Clostridium-Pasteurianum into Clostridium- Acetobutylicum by Cointegrate Conjugal Transfer. Mol Gen Genetics 214: 177-179 Papa A (2005) Propanols. In: Ullmann's Encyclopedia of Industrial Chemistry,. Wiley-VCH

Verlag GmbH & Co. KGa, Weinheim

Petersen, D.J. and G.N. Bennett, Purification of acetoacetate decarboxylase from Clostridium acetobutylicum ATCC 824 and cloning of the acetoacetate decarboxylase gene in

Escherichia coli. Appl Environ Microbiol, 1990. 56(11): p. 3491-8

Peretz M et al. (1997) Molecular cloning, nucleotide sequencing, and expression of gènes encoding alcohol dehydrogenases from the thermophile Thermoanaerobacter brockii and the mesophile Clostridium beijerinckii. Anaerobe 3:259-270

Rogers P, Chen J-S, Zidwick M (2006) Organic acid and solvent production. Part III; butanol, acétone, isopropanol;l,3- and 1 ,2-propanediol production; and 2,3-butanediol production. In: Dworkin M (ed) The prokaryotes. A handbook on the biology of bacteria.

3rd édition. Springer, New York, USA, pp 672-755

Survase SA, Jurgens G, van Heiningen A, Granstrôm T. (2011) Continuous production of isopropanol and butanol using Clostridium beijerinckii DSM 6423. Appl Microbiol

Biotechnol. Sep;91(5): 1305-13.

Wiesenborn DP, Rudolph FB, Papoutsakis ET (1988) Thiolase from Clostridium acetobutylicum ATCC 824 and Its Rôle in the Synthesis of Acids and Solvents. Appl

Environ Microbiol 54:2717-2722

Yan RT, Zhu CX, Golemboski C, Chen JS (1988) Expression of Solvent-Forming Enzymes and Onset of Solvent Production in Batch Cultures of Clostridium beijerinckii

^Clostridium butylicum"). Appl Environ Microbiol 54:642-648