Field of Invention

The present invention provides a method for detecting a target sequence within a target region of a nucleic acid molecule, probes for use in such methods and kits including said probes. The probe is particularly suitable for detecting a target sequence containing a mutagenic or polymorphic site which is contained within a highly variable target region of a nucleic acid molecule.

Background

There are many techniques known for detecting specific target nucleic acid sequences within a sample, that are used for various purposes including research and diagnostics. Oligonucleotide probes and particularly labelled oligonucleotide probes that bind to these target sequences within a DNA molecule are frequently used in such methods. Typically, but not exclusively, they include a light emitting label such as a Fluorescent label and may make use of fluorescence energy transfer (FET). In FET one or more nucleic acid probes are labelled with fluorescent molecules, one of which acts as an energy donor molecule and the other of which acts as an energy acceptor molecule. These are sometimes known as a reporter molecule and a quencher molecule respectively. The donor molecule is excited with a specific wavelength of light which falls within its excitation spectrum and, subsequently, it emits light within its fluorescence emission spectrum. The compatible acceptor molecule is excited at this wavelength by accepting energy from the donor molecule by a variety of distance-dependent energy transfer mechanisms. A specific example of fluorescence energy transfer which can occur is Fluorescence Resonance Energy Transfer or "FRET". Generally, the acceptor molecule accepts the emission energy of the donor molecule when they are in close proximity (e.g., on the same, or a neighbouring molecule). The basis of fluorescence energy transfer detection is to monitor the changes at donor and acceptor emission wavelengths.

Examples of molecules used as donor and/or acceptor molecules in FRET systems include, amongst others, SYBRGold, SYBRGreenI, Fluorescein, rhodamine, Cy5, Cy5.5 and ethidium bromide, as well as others such as SYTO dyes as listed, for example, in WO2007/093816. WO 99/28500 describes a successful assay for detecting the presence of a target nucleic acid sequence in a sample. In this method, a DNA duplex binding agent and a probe specific for said target sequence is added to the sample. The probe comprises a reactive molecule able to absorb fluorescence from, or donate fluorescent energy to, said DNA duplex binding agent. This mixture is then subjected to an amplification reaction in which target nucleic acid is amplified, conditions being induced either during or after the amplification process in which the probe hybridises to the target sequence. Fluorescence from said sample is monitored.

As the probe hybridises to the target sequence, a DNA duplex binding agent such as an intercalating dye is trapped between the strands. In general, this would increase the fluorescence at the wavelength associated with the dye. However, where the reactive molecule is able to absorb fluorescence from the dye (i.e., it is an acceptor molecule), it accepts emission energy from the dye by means of FET, especially FRET, so it emits fluorescence at its characteristic wavelength. An increase in fluorescence from the acceptor molecule, which is of a different wavelength to that of the dye, will indicate binding of the probe in duplex form.

Similarly, where the reactive molecule is able to donate fluorescence to the dye (i.e., it is a donor molecule), the emission from the donor molecule is reduced as a result of FRET and this reduction may be detected. Fluorescence of the dye is increased more than would be expected under these circumstances.

The signal from the reactive molecule on the probe is a strand specific signal, indicative of the presence of target within the sample. Thus, the changes in fluorescent signal from the reactive molecule, which are indicative of the formation or destabilisation of duplexes involving the probe, are preferably monitored. DNA duplex binding agents, which may be used in the process, comprise any entity which adheres or associates itself with DNA in duplex form and which is capable of acting as an energy donor or acceptor. Particular examples are intercalating dyes, as are well known in the art.

The use of a DNA duplex binding agent such as an intercalating dye and a probe which is singly labelled has advantages in that these components are much more economical than other assays in which doubly labelled probes are required. By using only one probe, the length of known sequence necessary to form the basis of the probe can be relatively short and therefore the method can be used, even in difficult diagnostic situations. The assay in this case is known as ResonSense ^® .

WO02/097132 describes a variation of the ResonSense ^® method in which a particular probe type is utilised. WO2004/033726 describes a further variation in which a DNA duplex binding agent which can absorb fluorescent energy from the fluorescent label on the probe but which does not emit visible light is used, so as to avoid interfering with the signal. WO2007/093816 describes a particularly useful dye label system.

There are two commonly used types of FET or FRET probes, those using hydrolysis of nucleic acid probes to separate donor from acceptor and those using hybridisation to alter the spatial relationship of donor and acceptor molecules.

Known fluorescence polymerase chain reaction (PCR) monitoring techniques include both these types of probes in PCR thermal cycling devices. The reactions are carried out homogeneously in a closed tube format on thermal cyclers. Reactions are monitored using a fluorimeter. The precise form of the assays varies but often relies on FET between two fluorescent moieties within the system in order to generate a signal indicative of the presence of the product of amplification.

Typically, fluorescence increases due to a rise in the bulk concentration of DNA during amplifications. This increase in fluorescence can be used to measure reaction progress and to determine the target molecule copy number. Furthermore, by monitoring fluorescence with a controlled change of temperature, DNA melting curves can be generated, for example, at the end of PCR thermal cycling. The melting temperature of a DNA duplex depends on its base composition and length. All PCR products for a particular primer pair should have the same melt temperature unless there is mispriming, primer-dimer artefacts or some other problem. Melt temperature data can be used, therefore, to determine the specificity of the probes/purity of the amplified DNA.

Hybridisation probes are available in a number of forms. Molecular beacons are oligonucleotides that have complementary 5 ' and 3 ' sequences such that they form hairpin loops. Terminal fluorescent labels are in close proximity for FRET to occur when the hairpin structure is formed. Following hybridisation of molecular beacons to a complementary sequence the fluorescent labels are separated so FRET does not occur, forming the basis of detection.

Pairs of labelled oligonucleotides may also be used. These hybridise in close proximity to one another on a PCR product strand bringing donor and acceptor molecules (e.g., fluorescein and rhodamine) together so that FRET can occur, as disclosed in W097/46714, for example. Enhanced FRET is the basis of detection. The use of two probes requires the presence of a reasonably long known sequence so that two probes which are long enough to bind specifically can bind in close proximity to each other. These are sometimes known as "Dual Hybe" assays. In either case, probes are designed to be specific for target DNA. However, in instances where a target region is highly mutagenic/polymorphic or the respective organism is rapidly evolving, as is the case with a number of viruses, it can be difficult to design a probe with the requisite specificity.

In PCR, the existence of these mutations/polymorphisms (also known as degenerate sequences) in the target region can be overcome, to some extent, by the use of a mixed population of oligonucleotide primers that amplify these variants within a known population.

Other approaches to accommodate sequence variations include the use of "agnostic" or "neutral" bases that do not conform to the standard Watson Crick base pairing scheme. These bind without preference (or reduced preference) to all nucleotides. The sequences amplified (amplicon) using primers containing agnostic bases will have sequences that may vary at these polymorphic sites compared to the template strand(s). However, the process is allowed to proceed at a level (efficiency) that is sufficient to create PCR product. Degenerate sequences may be incorporated into oligonucleotide probes to "neutralise" the effects of additional polymorphisms over and above that for which the probe is principally designed. In Taqman ^® probe methodologies, the incorporation of base changes (to accommodate polymorphisms) and/or agnostic bases may be utilised. However, common to both primers and Taqman ^® probes is the requirement that the substituted base(s) must be readable (and processed) by the polymerase to facilitate Palmer extension and/or 3 ' to 5 ' nuclease activity respectively. This reduces the choices of substituted bases that may be utilised in these types of probes.

Such bases have been found to have a variety of applications as summarised by D Loakes, Nucl. Acids Res. (2001) 29:2437-2447. For instance, agnostic or neutral bases have also been employed in probes in order to modify the dissociation or melt temperature of a particular probe in order to reduce them to a desirable range for the purpose (Zheng et al. Microb. Ecol. (2000) 39:246-262).

The applicants have found that nucleotides may be substituted with an abasic replacement and that probes comprising such substitutions are useful in melting point analysis of nucleic acids, in particular of variable regions that may contain mutagenic sites or polymorphisms.

Summary of Invention

According to a first aspect of the present invention, there is provided a method for detecting a target sequence within a variable target region of a nucleic acid molecule; said method comprising: a) providing a sample containing or suspected of containing said nucleic acid molecule; b) contacting said sample with an oligonucleotide probe complementary to the target region that includes said target sequence, in the presence of a label system that emits a signal which is different when the probe is bound to said target region as compared to when the probe is in an unbound state, and further said probe comprises at least one abasic nucleotide substitution which is positioned within said probe so that it aligns with a mutagenic/polymorphic site within the target region outside said target sequence when said probe binds to said target region, but wherein the temperature at which the probe hybridizes to the target region or dissociates from the target region is substantially unaffected by the nature/identity of the nucleotide at said mutagenic/polymorphic site in the target region; c) monitoring said signal whilst changing the temperature of the sample and determining the temperature at which the signal changes as a result of either binding of the probe to the target region or destabilization of a duplex formed by the binding of a probe to the target region; d) relating the temperature determined to the presence or absence of said target sequence within said target region.

The applicants have found that by use of a range of abasic nucleotide substitutions, probes may be designed that, in the context of melting point analysis, do not record or "see" the presence of certain mutagenic sites or polymorphisms. An "abasic nucleotide substitution" is a substitution of a nucleotide with an entity which does not comprise a nucleotide base (i.e., a nucleobase) such as, for example, a pyrimidine or a purine base. For example, the abasic nucleotide substitution may comprise any one or more of the following:

1. An abasic nucleotide substitution which introduces a stable abasic site (e.g., a DNA or RNA backbone that lacks a nucleoside, or a peptide nucleic acid (PNA) backbone that lacks a nucleobase, or another polymer backbone not having a nucleobase bound thereto).

2. A spacer, such as a phosphoramidate spacer including, for example, from 3-10 carbon atoms, that eliminates or replaces a nucleotide of the normal DNA backbone. One embodiment may be a three carbon spacer.

These all provide probes able to report the presence of a specific target sequence or nucleotide mutation/polymorphism of interest whilst neutralising the effect of a concomitant mutation/polymorphism, without detrimental effect to the PCR or probe process.

An example of an abasic nucleotide substitution may include the use of l ' ,2 '- dideoxyribose.

The ,2'-dideoxyribose modification may be used to introduce a stable abasic site within an oligonucleotide. It will block polymerase processivity.

An example of an abasic non-nucleotide substitution may include the use of a phosphoramidate spacer, as mentioned above, for example, from 3-10 carbon atoms such as a three carbon spacer or "C3 spacer". The C3 Spacer is a carbon backbone and, when used internally as it is generally in the probes of the invention, has the following structure:

5'

It maintains the probe DNA backbone without introducing any base pairing. It will block polymerase processivity.

The probe may be a linear probe (i.e., lacking any internal secondary structure) and, in a particular embodiment, does not comprise a polynucleotide minor groove binding entity, such as (but not limited to) those described as US5,801 , 155. Other minor groove binders are known in the art. Therefore, probe binding to the target region is a true probing event with simple binding kinetics, since there is no probe internal hairpin structure competing with the probe/target binding. There is no requirement for a conformational change in the probe when binding occurs.

It will be apparent to those skilled in the art that the precise design of a probe to detect a target sequence can be undertaken having regard to conventional techniques and the use of conventional programming tools. Knowledge of the sequence structure of a target region enables a complementary oligonucleotide probe to be made and knowledge of mutagenic/polymorphic sites enables the substitutions of the invention to be deployed to advantageous effect. In this way, the invention has application in the ways described herein and, moreover, in multiple species. Once designed, the optimum selection of nucleotide substitution can be determined by comparing melting points of probes containing various options for such nucleotide substitution at the appropriate mutagenic or polymorphic sites using routine methods as exemplified hereinafter. Such methods may form a further aspect of the invention.

The use of probes comprising an abasic nucleotide substitution provides particularly advantageous results, as outlined in more detail below. This is surprising, since it is typically assumed that a gap or mismatch in a probe sequence will result in altered probe binding to the target sequence. For example, a probe comprising such a gap or mismatch may behave as if two separate probes were binding, the melting of each portion (on either side of the gap or mismatch) being dependent of the sequence of that portion, rather than the overall sequence of the whole probe. This would result in different melt temperatures; this is opposite to the inventive method, in which differences in the target sequence are not reflected in an altered melting temperature for the probe binding.

Thus, the probes are of particular use in the context of variable regions of nucleic acids where the target region for a probe includes multiple polymorphisms, only some of which are of significance in a diagnostic sense. By using suitable nucleotide substitutions or omissions at the positions of the diagnostically irrelevant polymorphisms, a single probe can be used to detect any target region that includes a specific target sequence therewithin. The "target sequence" will generally comprise a mutagenic or polymorphic site that is of diagnostic significance. The melting (or hybridisation) point of the probe will be characteristic only of the polymorphisms within the target sequence.

Most suitably, the target region contains a target sequence in the form of a non- synonymous mutation or polymorphism that has phenotypic consequences of interest. For example the probe is designed to identify a particular mutation that is responsible for a particular disease condition or the conferring of a particular characteristic such as resistance to a particular drug or toxin. A particular example of interest is the identification of drug resistance in certain microorganisms and particularly viruses which are highly adaptive and so highly mutagenic/polymorphic. However, this adaptive feature means that a target region may be highly variable and therefore it can be difficult to design probes that are able to identify all target regions possessing the target sequence or mutation of interest. To this end the probe used in the method of the invention is designed to be specific for the mutation of interest but relatively unaffected by any further mutations/polymorphisms in the region of interest. These desirable characteristics are achieved by the complementary nature of the probe for the target region and the provision of said nucleotide substitution or omission. One exemplary use of the invention is the identification of the H274Y Tamiflu ^® (Oseltamivir) resistance mutation located in the neuraminidase gene in influenza virus and particularly in influenza type A, which may be of the HA sub-type HI or H5 and/or of the sub-type Nl, i.e., H1N1 or H5N1.

The invention has application in the detection of target sequences of interest in animals and microbes, particularly man, bacteria, viruses and pathogenic organisms. The invention has particular application in the detection of target sequences in highly variable target regions and so typically, but not exclusively, in highly adaptive or evolving organisms.

As used herein, the expression "substantially unaffected" used in relation to the temperature at which the probe hybridizes to the target region or dissociates from the target region means that any difference in temperature caused by the presence of one nucleotide in the target region at the polymorphism as compared to any other is sufficiently small as not to prevent a distinction being made on the basis of changes arising from differences or polymorphisms within the target sequence. This will depend to some extent on factors such as the complexity of the assay being conducted, for example, whether it is a multiplex or single sample assay, the amount of difference in melt or hybridisation temperature that is induced by polymorphisms within the target sequence, as well as the nature of the label. However, generally, it is preferable that the melt/hybridisation temperature of the probe differs by no more than 5°C, for instance no more than 3°C, in particular no more than 2°C, whatever nucleotide is present at the or each mutagenic/polymorphic site in the target region outside the target sequence. In one embodiment, the melt/hybridisation temperature of the probe is the same whatever nucleotide is present at the or each mutagenic/polymorphic site in the target region outside the target sequence.

The method may be applied in various contexts including the analysis of samples which are or have been subject to nucleic acid amplification reactions, including both isothermal and amplification reactions that require thermal cycling. During this reaction, the target region including the target sequence will be amplified. Suitable nucleic acid amplification reactions include the polymerase chain reaction (PCR), ligase chain reaction (LCR), strand displacement amplification (SDA), transcription- mediated amplification (TMA), loop-mediated isothermal amplification (LAMP), rolling circle DNA amplification, multiplex ligation-dependent probe amplification (MLPA) and multiple displacement amplification. In a particular embodiment, the method of the first aspect of the invention is used in conjunction with a polymerase chain reaction.

The probe may be added before, during or after the nucleic acid amplification reaction. In particular, however, the probe is introduced into the sample before the amplification reaction and the melting point analysis is carried out at the end of the reaction, usually directly without opening the vessel in which the amplification reaction is conducted, so as to minimise the risk of contamination.

Alternatively, in amplification reactions where thermal cycling or other temperature changes during which the probe may hybridise to or melt from the target region are induced in the course of the reaction, it may be possible to carry out the method of the invention during the amplification reaction.

In such cases, the nucleic acid amplification reaction is suitably effected so that hybridisation of a probe to a target region and destabilisation of a substantially intact probe from said target region occurs during the amplification reaction. Such methods include methods such as ResonSense or Dual Hybe assays mentioned above, but would not include assays where hydrolysis of the probe is required, such as in TAQMAN™ assays.

By using 'hybridisation' rather than 'hydrolysis' assays to effect the amplification, there is no need to select nucleotide substitutions that are "read" by polymerase enzymes or are subject to 5 '-3'exonuclease activity of the polymerase. This widens the range of possible nucleotide substitutions that may be selected for incorporation within the probe. Thus, the abasic nucleotide substitution within said probe may be a polymerase enzyme non-readable nucleotide substitution, if such an entity provides a better "match" for the probe hybridisation/destabilisation melt temperature. The label system used may emit a signal directly or indirectly.

Reference herein to the label system emitting a signal directly includes a scenario where a label is able to emit a signal when bound to DNA and a distinguishable signal when in an unbound state. It is the nature of this direct signal that is monitored. Such labels may include DNA duplex binding agents such as intercalating or minor-groove binding dyes that intercalate between the probe and the target region when these are in the form of a duplex. The signal emitted under these circumstances is different to that when the dye is free in solution. Examples of suitable intercalating dyes include SYBR Green, SYBR Gold, ethidium bromide and SYTO dyes and the like as described in WO2007/093816. Alternatively, the label or an element of the label system such as the intercalating dye may be bound to the oligonucleotide probe to enhance the specificity of the signal. In such cases suitable dyes include Fluorescein and derivatives such as FAM and JOE, rhodamine dyes, and cyanine dyes such as Cy5, Cy5.5.

Reference herein to the label system emitting a signal indirectly includes a scenario where a first label works cooperatively with another label to emit a signal depending upon its bound or unbound state and it is the nature of this indirect signal that is monitored. In particular, one of the first or second labels is a fluorescent label and the other, which may or may not be fluorescent in its own right, is able to donate fluorescent energy to or absorb or quench fluorescent energy from said first label, setting up a conventional FET or FRET label system. Examples of such system using DNA duplex binding agents or one or more labelled probes or combinations of these are known in the art and include the Dual Hybe and Resonsense™ methods described above.

A particular embodiment utilises a system similar to the "Dual Hybe" system in which the oligonucleotide probe carries a first label. A second label is attached to a further oligonucleotide which is complementary to a second region of the nucleic acid molecule such that when the probe and the further probe are hybridised to the nucleic acid molecule the first and second labels are brought into proximity to one another such that a signal emitted from one label is modified by the second label. In particular, at least one of the first or second labels is a fluorescent label and the other is able to absorb or quench the signal therefrom.

Another embodiment useful in detection of two polymorphisms positioned within about 20-30 nucleotides of one another. This is disclosed in co-pending application no. PCT/GB201 1/050508. In this embodiment, the method is for detecting the presence in a sample of a first target sequence and a second target sequence within the variable target region of a nucleic acid sequence, comprising conducting a nucleic acid amplification reaction to form a forward amplicon strand and a reverse amplicon strand of the test region, contacting the forward amplicon strand with a first probe labelled with a first FRET label and capable of hybridising to the first target sequence or complement thereof in the forward amplicon strand, and contacting the reverse amplicon strand with a second probe labelled with a second FRET label and capable of hybridising to the second target sequence or complement thereof in the reverse amplicon strand; wherein the nucleic acid amplification reaction is conducted using a forward amplification primer labelled with a third FRET label and a reverse amplification primer labelled with a fourth FRET label, the forward primer being incorporated into the forward amplicon strand and the second primer being incorporated into the reverse amplicon strand during the amplification reaction; and further wherein the first and third FRET labels form a first FRET pair and the second and fourth FRET labels form a second FRET pair, each FRET pair comprising a donor label; the method further comprising the steps of exposing the sample to an excitation source having a wavelength which excites the donor label in the first FRET pair and the donor label in the second FRET pair, detecting fluorescence from the sample and relating this to the presence or absence of the first and second target sequences. The first, second, third and fourth FRET labels may be arranged on the primer/probe molecules (as applicable) as disclosed in application GB 1007867.3 and the co-pending PCT application claiming priority therefrom. In particular, in any embodiment of the present invention, the label on each amplification primer may be linked to the 5 ' end of the primer oligonucleotide. In this embodiment, suitable primers have no internal complementarity.

Suitable combinations of first and second labels are well known in the art, but a particularly useful combination is one in which fluorescein is used as one of the labels and Cy5 is used as the other.

According to a second aspect of the invention, there is provided a probe for detecting a target sequence within a target region of a nucleic acid molecule, said probe being complementary to said target region of interest and comprising at least one abasic nucleotide substitution which is positioned within said probe so that it aligns with at least one mutagenic/polymorphic site outside said target sequence when said probe binds to said target region, and wherein the temperature at which the probe hybridizes to the target region or dissociates from the target region is substantially unaffected by the nature of the nucleotide at said mutagenic/polymorphic site in the target region.

Suitably, the abasic nucleotide substitution within said probe is a polymerase enzyme non-readable abasic nucleotide substitution, in particular where such a substitution leads to a greater degree of similarity in the probe hybridisation/dissociation temperature whatever variant nucleotide is present in the target region at this site. Suitable substitutions are as described above.

Probes may be designed for any required target as discussed above but, in particular, will be specific for target regions derived from microorganisms, such as viruses and in particular influenza virus type H1N1 or H5N1. In the latter case, the experiment may be designed so that the H274Y polymorphism is contained within the amplified sequence and the abasic nucleotide substitution is aligned with the H274Y probe for the neuraminidase gene of influenza virus. Particular examples of suitable probes are shown hereinafter. Probes of the second aspect may carry a label that comprises or is part of a label system as described above.

According to a third aspect of the invention there is provided a kit for detecting a target sequence within a target region of a nucleic acid molecule said kit including at least one oligonucleotide probe as described above, and a label system, able to detect hybridisation or destabilisation of said probe to said target region.

In particular the label system may comprise a DNA binding agent that emits a signal that is different when it is bound to double stranded DNA as compared to when it is free in solution, such as the intercalating dyes or minor groove binders known in the art. Alternatively, or additionally, the label system comprises a first label, attached to the oligonucleotide probe. This label may interact with the DNA binding agent where this is used in the system (e.g. in the ResonSense™ system). In a particular embodiment, however, the kit further includes at least one second labelled probe designed to bind to said nucleic acid molecule in the vicinity of said oligonucleotide probe such that the first label on said oligonucleotide probe and said second labelled probe interact to provide a modified signal. Suitably, one of the said first and second labels is a fluorescence donor molecule and the other is a fluorescence acceptor molecule able to absorb fluorescence from the donor molecule.

Optionally, the kit may further at least some reagents required for amplification of the nucleic acid molecule.

The work reported in this patent application describes an example for determining the affects of single base changes within the probe region of a {trans Dual-Hybe) signalling assay, although it may clearly be applied to any analysis which involves and investigation or examination of probe melt or hybridisation temperatures. The wild type sequence (SEQ ID NO:3) is a naive consensus derived from the total GeneBank H5N1 NA accessions. Sequences SEQ ID NOs: l and 2 present a number of base substitutions. At least one in each of these sequences occurs within the probe region. It should be noted that other substitutions occur within the primer regions but these have previously been shown not to affect meting peak motifs (data not shown). For the purposes of this study, the SEQ ID NO: l template may be considered a surrogate for the H274Y missense mutation and SEQ ID NO:2 may be considered of a second missense mutation that may be found close to the H247Y mutation. These substitutions are summarised in the Table 3 below.

Throughout the description and claims of this specification, the words "comprise" and "contain" and variations of the words, for example "comprising" and "comprises", mean "including but not limited to" and do not exclude other moieties, additives, components, integers or steps. Throughout the description and claims of this specification, the singular encompasses the plural unless the context otherwise requires. In particular, where the indefinite article is used, the specification is to be understood as contemplating plurality as well as singularity, unless the context requires otherwise.

Preferred features of each aspect of the invention may be as described in connection with any of the other aspects.

Other features of the present invention will become apparent from the following examples. Generally speaking, the invention extends to any novel one, or any novel combination, of the features disclosed in this specification (including the accompanying claims and drawings). Thus, features, integers, characteristics, compounds or chemical moieties described in conjunction with a particular aspect, embodiment or example of the invention are to be understood to be applicable to any other aspect, embodiment or example described herein, unless incompatible therewith. Moreover, unless stated otherwise, any feature disclosed herein may be replaced by an alternative feature serving the same or a similar purpose.

Brief description of the Figures

Embodiments of the invention will now be described by way of example only with reference to Figures 7-12 and comparative Figures l-6,wherein: Figure 1 shows the melt temperature curve for a probe not according to the invention, containing deoxyinosine when bound to WT DNA template (with reference to Table 9, curves 1-4 = Mix 3B H5N1 WT DNA, 13 & 14 = Mix 3B H5N1 NTC, 29 = Mix IB WT control);

Figure 2 shows the melt temperature curve for a probe not according to the invention, containing deoxyinosine when bound to SEQ ID NO: l DNA template (curves 5-8 = Mix 3B H5N1 SEQ1 DNA, 13 & 14 = Mix 3B H5N1 NTC, 30 = Mix IB SEQ1 control);

Figure 3 shows the melt temperature curve for a probe not according to the invention, containing deoxyinosine when bound to SEQ ID NO:2 DNA template (curves 9-12 = Mix 3B H5N1 SEQ2 DNA, 13 & 14 = Mix 3B H5N1 NTC, 31 = Mix IB SEQ2 control);

Figure 4 shows the melt temperature curve for a probe not according to the invention, containing 5-Nitroindole when bound to WT DNA template (curves 15-18 = Mix 3C H5N1 WT DNA, 27 & 28 = Mix 3C H5N1 NTC, 29 = Mix IB WT control); Figure 5 shows the melt temperature curve for a probe not according to the invention, containing 5-Nitroindole when bound to SEQ ID NO: l DNA template (curves 19-22 = Mix 3C H5N1 SEQ1 DNA, 27 & 28 = Mix 3C H5N1 NTC, 30 = Mix IB SEQ1 control); Figure 6 shows the melt temperature curve for a probe not according to the invention, containing 5-Nitroindole when bound to SEQ ID NO:2 DNA template (curves 23-26 = Mix 3C H5N1 SEQ2 DNA, 27 & 28 = Mix 3C H5N1 NTC, 31 = Mix IB SEQ2 control); Figure 7 shows the melt temperature curve for a probe according to the invention, containing l ',2'-dideoxyribose spacer when bound to WT DNA template (curves 1-4 = Mix 5B H5N 1 WT DNA, 13 & 14 = Mix 5B H5N 1 NTC, 29 = Mix I B WT control);

Figure 8 shows the melt temperature curve for a probe according to the invention, containing l ',2'-dideoxyribose spacer when bound to SEQ ID NO: l DNA template (curves 5-8 = Mix 5B H5N1 SEQ1 DNA, 13 & 14 = Mix 5B H5N1 NTC, 30 = Mix IB SEQ1 control);

Figure 9 shows the melt temperature curve for a probe according to the invention, containing l ',2'-dideoxyribose spacer when bound to SEQ ID NO:2 DNA template (curves 9-12 = Mix 5B H5N1 SEQ2 DNA, 13 & 14 = Mix 5B H5N1 NTC, 31 = Mix IB SEQ2 control);

Figure 10 shows the melt temperature curve for a probe according to the invention, containing 3C spacer as a neutral base when bound to WT DNA template (curves 15- 18 = Mix 5C H5N1 WT DNA, 27 & 28 = Mix 5C H5N1 NTC, 29 = Mix IB WT control);

Figure 1 1 shows the melt temperature curve for a probe according to the invention, containing 3C spacer as a neutral base when bound to SEQ ID NO: l DNA template (curves 19-22 = Mix 5C H5N1 SEQ1 DNA, 27 & 28 = Mix 5C H5N1 NTC, 30 = Mix IB SEQ1 control); and Figure 12 shows the melt temperature curve for a probe according to the invention, containing 3C spacer as a neutral base when bound to SEQ ID NO:2 DNA template (curves 23-26 = Mix 5C H5N1 SEQ2 DNA, 27 & 28 = Mix 5C H5N1 NTC, 31 = Mix IB SEQ2 control). Examples

Materials

Equipment

Qiagility Liquid Handling System

Roche LightCycler® 2.0 (EDLE213)

Materials

20μ1 LC glass capillaries

5ml Corbett Diluent Bijou tubes

1.5ml Eppendorf Tubes

50μ1 + 200μ1 robot tips

200μ1 Microamp tubes

Reagents

RNase-DNase free water

500mM Tris-HCl pH8.8

20mg/ml Non-acetylated BS A

lOOmM MgCl ₂

2mM DUTPs

51Ι/μ1 Taq DNA Polymerase

ΙΟμΜ T AMH5N 1 ML R 1 R Primer (unlabelled) - SEQ ID NO: 8

ΙΟμΜ T AMH5N 1 ML F 1 F Primer (FAM-labelled) - SEQ ID NO:9

ΙΟμΜ TAMMLH5N 1 H274 Y TYE665 Probe - SEQ ID NO: 10

10μΜ T AMH5N 1 ML F 1 5 ^* F Primer (5' FAM end-labelled) - SEQ ID NO:9 10μΜ T AMH5N 1 ML F 1 5 ^* SP F Primer (5' FAM end-labelled with spacer) - SEQ ID NO:9

10μΜ TAMH5N 1 ML F 1 5 YE665 F Primer (TYE665 -labelled) - SEQ ID NO:9 10μΜ T AMMLH5N 1 H274 YF AM Probe - SEQ ID NO: 10

10μΜ T AMMLH5N 1 H274 YSEQ2IN TYE665 Probe - SEQ ID NO:6

10μΜ T AMMLH5N 1 H274 YSEQ2NIt TYE665 Probe - SEQ ID NO:7

10μΜ T AMMLH5N 1 H274 YSEQ2dSP ACER TYE665 Probe - SEQ ID NO:4 10μΜ T AMMLH5N 1 H274 YSEQ2C3 SPACER TYE665 Probe - SEQ ID NO:5 H5N1 'WT' Plasmid DNA template (SEQ ID NO:3)

H5N1 'SEQ1 ' Long-oligo DNA template (SEQ ID NO: l)

H5N1 'SEQ2' Long-oligo DNA template (SEQ ID NO:2)

Methods and Results

An example of a situation where detection of several target sequences located closely together within a single nucleic acid molecule would be useful is in, for example, the field of influenza diagnosis. Influenza viruses are RNA viruses and the most common type of flu virus is Influenza A. Within Influenza A there are several serotypes categorised on the basis of antibody responses to them, of which the most well known are H5N1 (avian flu) and H1N1 (swine flu). The "H" denotes hemagglutinin and the "N" neuraminidase, both proteins expressed on the surface of the flu virus and which exhibit the variations which give rise to the different antibody responses to the different serotypes of the virus.

During the 2009 worldwide outbreak of H1N1 swine flu, the antiviral drug Tamiflu ^® was a key means of combating viral infection and inhibiting the spread of the virus. However, some strains of the virus were found to be resistant to Tamiflu ^® but identification of individuals carrying such a strain was only possible when treatment with Tamiflu ^® had been found to be ineffective, at which stage alternative treatment using a drug such as Relenza ^® would be appropriate. However, it would have been preferable to be able to identify the presence of a resistant strain before treatment began, so as to provide effective treatment more quickly and also to reduce the risk of the further transmission of the Tamiflu ^® resistant strain.

Resistance to the Tamiflu ^® drug is most commonly present when the polymorphisms causing the amino acid changes H274Y and N294S are present in the neuraminidase gene in Nl subtypes of Influenza A. A screening method to identify the presence of these polymorphisms is therefore required, which can provide rapid results at a reasonable cost. In approaching this, the inventor found that methods utilising probes would be problematic because of the highly mutagenic/polymorphic nature of the target region of interest and thus the close proximity of the target sequence to be detected, and so representative of drug resistance, and neighbouring mutagenic/polymorphic sites. In response to these problems, the probes and methods of the present invention were devised and they are exemplified below.

The following cDNA sequence corresponds to a consensus sequence for a portion of the RNA sequence from all known strains of H5N1 influenza viruses. This part of the sequence includes the codons which, when altered, result in the H274Y and N294S mutations in the neuraminidase protein:

Wildtype DNA (SEQ ID NO:3):

AAAGGGAAAGTGGTTAAATCAGTCGAATTGGATGCTCCTAATTATCACTA TGAGGAGTGCTCCTGTTATCCTTTTGATGCCGGCGAAATCACATGTGTGTG CAGGGATAATTGGCATGGCTCAAATAGGCCATGGGTATCTTTCAATCAAA ATT

SEQ ID NO: l DNA:

AGTAGAATTGGATGCTCCTAATTACCACTATGAGGAGTGCTCCTGTTATC CTTTTGATGCCGGCGAAATCACATGTGTGTGCAGGGATAATTGGCATGGT TCAAATAGGCCATGGGT

SEQ ID NO:2 DNA:

AGTCGAATTGGATGCTCCCAATTATCACTATGAGGAATGCTCCTGTTATC

CTTTTGATGCCGGCGAAATCACATGTGTGTGCAGGGATAATTGGCATGGC

TCAAATCGGCCATGGGT The underlined sequence represents the forward and reverse primer regions. The underlined codon "CAC" is that encoding the amino acid Histamine at position 274 in the neuraminidase protein. Alteration of this to TAT or TAC results in expression of Tyrosine at this position. The underlined codon "AAT" is that encoding the amino acid Asparagine at position 294. Alteration of this from AAT to TCT, TCC, TCA or TCG results in expression of Serine at this position. The bold letters represent either mismatch in the primers or a polymorphism adjacent the CAC codon (SEQ ID NO: l) or downstream from the CAC codon (SEQ ID NO:2). Modified Probes:

GGA TAA CAG GAG CAN TCC TCA TAG TGA TA

1 (SEQ ID NO:6) 3TYE665, N deoxylnosine

GGA TAA CAG GAG CAN TCC TCA TAG TGA TA

2 (SEQ ID NO:7) 3TYE665, N 5-Nitroindole

GGA TAA CAG GAG CAN TCC TCA TAG TGA TA

3 (SEQ ID NO:4) 3TYE665, N l ',2'-Dideoxyribose (dSpacer) GGA TAA CAG GAG CAN TCC TCA TAG TGA TA

4 (SEQ ID NO:5) 3TYE665, N C3 Spacer

The above sets of primers and hybridisation probes were identified, by methods routinely used by the skilled person (use of the open-source software JALVIEW in combination with the EMBL search toolset), as being suitable for amplification of regions of the above sequences which encompassed the two polymorphic sites. Probes for the N294S polymorphism were developed so as to be complementary to the reverse amplicon strand and are labelled with TYE705. For the purposes of this study the sequence 1 template may be considered a surrogate for the H274Y missense mutation, and sequence 2 may be considered of a second missense mutation that may be found close to the H247Y mutation. The base substitution X in the probes 1 to 4 should neutralise the affects of the substitution in SEQ ID NO:2, wilst allowing the polymorphism in SEQ ID NO: l to be identified. To this end, the 3C spacer substitution was best at completely neutralising the SEQ ID NO: 2 polymorphism, as shown below.

Polymerase chain reactions were carried out using the above sets of primers and probes and, at the conclusion of the PCR, a melt analysis was carried out for each sample.

The reagents used are set out in Table 1 : Table 1: components of PCR reaction mixtures

Table 2 shows the PCR temperature cycling conditions:

Table 2: PCR and melt analysis conditions

By way of example, the melt analysis results from an experiment conducted using primer/probe above and detection of fluorescence at 670nm are shown in Figure 1 (in which panel A shows the amplification curve), to show detection of binding of the H274Y probe to the target. Figure IB shows the melting curves for a wild type sample as well as the melting peaks for the deoxyinosine probe when used to detect wildtype DNA.

SEQ ID NO: l above and SEQ ID NO:2 were also analysed using this probe and the results are shown in Figures 2 and 3 respectively. The results are summarised in Table 4 below. Similar results using other probes listed in Table 8 below in respect of wild-type (SEQ ID NO:3), SEQ ID NO: l and SEQ ID NO:2 are shown in Figures 4-12 as detailed above. Results are summarised in Tables 5-7 below.

Table 3: Nucleotide substitutions in sequences 1 and 2 (from wild type).

There were four possible base substitutions that were considered for inclusion in the probes to neutralise the affect of the sequence variation in sequence 2. The substitutions tested are summarised in Table 8 below.

For each experiment (four agnostic substitutions) the data shows the following:

1. Wild type template generates a Gaussian melt peak motif that is consistent with previous experimentation.

2. The surrogate H274Y base substitution in SEQ ID NO: l reduces the melting motif of the signal in all probes tested (compared to wild type). For a given probe the shift in the melting temperature from that of the wild type probe was different depending upon the modification it contained. This showed that the agnostic bases did not affect the probes' ability to detect mutations for which there was no neutral base substitution.

3. The unmodified probe produced significantly lower peaks when tested with SEQ ID NO:2 showing that, thermodynamically, the probe is behaving as two oligomers (being displaced at a lower temperature).

4. The modified probes produced a peak when tested with SEQ ID NO:2 that is within one °C of the wild type, showing that the modifications had neutralised the substitution (i.e., they behave agnostically).

The specific effects observed in the data are summarised in Tables 3-7. From the sequences tested, the C3 spacer had the most significant neutralising affect on probe melting peak, so that there was no difference in probe Tm when binding to SEQ ID NO:3 (wild type) or SEQ ID NO:2. The 1 ' ,2'-dideoxyribose substitution maintained the most significant difference between wild type and the SEQ ID NO: l polymorphism, enabling this readily to be detected.

The comparative results shown in Table 4 shows the comparative melt temperature peak Tm of the deoxyinosine probe (not according to the invention) for the above sequences when compared to a standard complementary probe for the relevant region;

Table 4

Differences are small and may be accommodated in an assay format.

The comparative results shown in Table 5 shows the comparative melt temperature peak Tm of the 5-Nitroindole probe (not according to the invention) for the above sequences when compared to a standard complementary probe for the relevant region;

Table 5

Standard probe Tm Nitroindole probe

Sequence Type

CO Tm CO

WT DNA (SEQ ID NO:3) 68 63

SEQ ID NO:l 64 60

SEQ ID NO:2 62 64

ASeql to WT -4 -3

ASeq2 to WT -5 +1 In this case, the range by which the temperature varies is even smaller, and thus again, it may be accommodated within an assay format.

Table 6 shows the comparative melt temperature peak Tm of the l ',2'-dideoxyribose spacer probe (in accordance with the invention) for the above sequences when compared to a standard complementary probe for the relevant region;

Table 6

Table 7 shows the comparative melt temperature peak Tm of the 3C spacer probe (in accordance with the invention) for the above sequences when compared to a standard complementary probe for the relevant region;

Table 7

Table 8 shows details of the probe structures tested (sequences listed above); Table 8

Table 9 shows a summary of the melt temperatures obtained for the experiments illustrated in the figures. It appears, from these results, that all base substitutions offer a credible approach to neutralising concomitant missense mutations in melting point experiments using fiuorogenic probes. Of those tested l ' ,2 '-dideoxyribose and C3 substitutions maintained the most neutrality with respect to the melting peak temperature, i.e., the polymorphism in SEQ ID NO:2 was neutralised, whilst the polymorphism in SEQ ID NO: 1 was detected.

The substitutions tested offer one practical (technical and commercial) approach to increasing the specificity of fiuorogenic probe melting peak analysis of missense (and other) mutations such as the Influenza A NA Oseltamivir H274Y mutation.

Table 9: Summary of PCR & Melt Analysis Data

Average Average Melt ATm

Target Cone

Modification PCR CT WT Tm WT DNA standard Remarks

(copies/μΙ)

DNA (°C) mix (°C)

1e4 WT DNA 26.91 68.02

MIX1B - TAMH5N1MLF1 1e3 WT DNA 30.77 67.16

(FAM) + 1e4SEQ1 DNA 27.79 64.17 -3.85 Standard H5N1 TRANS-

|TAMMLH5N1_H274Y 1e3SEQ1 DNA 31.05 64.33 -2.83 DH assay

(TYE665) 1e4SEQ2 DNA 26.36 62.08 -5.94

1e3SEQ2 DNA 30.16 62.1 -5.92

1e4 WT DNA 27.16 63.85 -4.17

MIX 3B-TAMH5N1MLF1 1e3 WT DNA 30.78 63.98 -3.18

H274Y probe, C position (FAM) + 1e4SEQ1 DNA 27.68 59.58 -4.59

15 substituted for an

|TAMMLH5N1_H274YSEQ 1e3SEQ1 DNA 31.5 59.64 -4.69 internal deoxyinosine 2IN (TYE665) 1e4SEQ2 DNA 26.23 65.09 3.01

1e3SEQ2 DNA 30.17 65.15 3.05

1e4 WT DNA 27.68 63.3 -4.72

MIX 3C-TAMH5N1MLF1 1e3 WT DNA 31.47 63.37 -3.79

H274Y probe, C position (FAM) + 1e4SEQ1 DNA 27.95 59.62 -4.55

15 substituted for an

|TAMMLH5N1_H274YSEQ 1e3SEQ1 DNA 32.07 59.67 -4.66 internal 5-Nitroindole 2Nit (TYE665) 1e4SEQ2 DNA 26.87 63.9 1.82

1e3SEQ2 DNA 30.42 63.94 1.84

1e4 WT DNA 26.83 62.63 -5.39

MIX 5B-TAMH5N1MLF1 1e3 WT DNA 30.69 61.65 -5.51

H274Y probe, C position (FAM) + 1e4SEQ1 DNA 27.1 57.46 -6.71

15 substituted for an

TAMMLH5N1_H274YSEQ 1e3SEQ1 DNA 30.9 57.46 -6.87

internal d spacer dS PACER (TYE665) 1e4SEQ2 DNA 25.8 61.89 -0.19

1e3SEQ2 DNA 34.16 62.4 0.3

1e4 WT DNA 26.94 62.43 -5.59

MIX 5C-TAMH5N1MLF1 1e3 WT DNA 30.73 61.47 -5.69

H274Y probe, C position (FAM) + 1e4SEQ1 DNA 27.46 57.05 -7.12

15 substituted for an

|TAMMLH5N1_H274YSEQ 1e3SEQ1 DNA 31.44 57.05 -7.28

internal C3 spacer 2C3S PACER (TYE665) 1e4SEQ2 DNA 26.37 61.64 -0.44

1e3SEQ2 DNA 34.2 61.83 -0.27