SURFACE DISPLAY-BASED YEAST TWO HYBRID SCREENING SYSTEM

STATEMENT AS TO RIGHTS TO INVENTIONS MADE UNDER FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT

This invention was made with government support under Contract No. DE-AC52-06 NA 25396 awarded by the U.S. Department of Energy. The government has certain rights in the invention.

BACKGROUND OF THE INVENTION

Protein-protein interactions are central to the structure and function of the molecular networks and pathways in cells and organisms, and the discovery of interacting proteins is a key challenge for proteomics investigations. The yeast two-hybrid (Y2H) system was developed as a tool for the in vivo identification of protein-protein interactions many years ago (1). The Y2H system is a genetic screen, wherein the interaction between two proteins of interest is detected via the functional reconstitution of the distinct DNA binding and activation domains of a transcription factor, and the subsequent activation of reporter expression controlled by the transcription factor. The Y2H screening system has been used extensively in the past decade to catalogue protein-protein interactions on genome-wide scales. Besides the rapid analysis of interaction between candidate protein pairs, Y2H has been the main working horse for the discovery of novel interactions in large cDNA libraries, where a bait protein is often screened against a entire library consisting of tens of thousands expressed genes. Although several other in vivo methods have been developed (such as bacterial, mammalian two-hybrid systems and the protein complementation assays (2-4), the Y2H system is the most widely used approach for generating large-scale interactome maps in virus, bacteria, yeast, worm, fly and recently, human (5-8).

However, while advances in robotics and lab automation have increased the throughput of the Y2H analysis via rapid arraying approach (7, 8), the agar plate-

based selections of the classical Y2H remain an automation challenge for high throughput cDNA library screening. The requirement of the large numbers of plates (e.g. ~30 15-cm plates for screening of 10 ⁹ human library cells) posses a huge hurdle for high volume and large scale protein-protein interaction network discovery. In addition, the conventional Y2H system has other inherent limitations. First, the measurement of reporter gene expression, typically a nutrient marker, is generally not quantitative, and therefore provides little information about interaction strength. LacZ expression offers a potential solution, but accurate quantification is difficult and this approach is semi-quantitative at best. Second, false positive results are a widely recognized issue with Y2H methods, and necessitate extensive secondary screening and confirmation of hits. Finally, as already mentioned, the classical Y2H approach involves cell culture and colony picking on dozens of agar plates, a time- consuming, labor intensive and costly effort that is difficult to automate.

Despite the wide acceptance of yeast two hybrid (Y2H) system for protein-protein interaction analysis and discovery, conventional Y2H assays are not well suited for high throughput screening of protein interaction network ("interactome") at genomic scale due to these limitations. It would therefore be highly desirably to have a Y2H system which does not require the use of labor-intensive and expensive plate-based cell culture, and provides more reliable and quantifiable results.

SUMMARY OF THE INVENTION

The invention provides a novel surface display-based Y2H (sdY2H) library screening system with uniquely integrated surface display antigen(s) that may be utilized as affinity tags for rapid immunomagnetic capture in order to enrich for and/or substantially isolate cells harboring positive protein-protein interacting pairs. The sdY2H system may be used in combination with growth selection markers, as is well known, and provides highly efficient isolation of cells positive for protein-protein interactions. The system of the invention may be further enhanced by the use of a fluorescent protein reporter used in combination with the cell surface display reporter. Accordingly, the invention further provides a sdY2H system that also

incorporates a fluorescent protein reporter, enabling subsequent screening using flow cytometry. The incorporation of a fluorescent protein reporter enables a highly quantitative approach to selection, generating fewer false positives, particularly after the library has been very substantially enriched for positive interactions using immunomagnetic capture in the sdY2H system. In both approaches, there is no need for plate-based cell culture. Instead, the invention utilizes a liquid culture based method, thereby eliminating perhaps the biggest limitation on conventional Y2H systems.

In one embodiment, the invention provides a yeast two-hybrid assay or system in which at least one reporter is a cell surface display reporter (sdY2H). In another embodiment, such an sdY2H assay or system further comprises a fluorescent protein reporter, which in some embodiments may be the surface display reporter. In the practice of the sdY2H assays of the invention, yeast reporter cells containing prey and bait protein constructs are initially screened/captured by affinity enrichment for cells expressing the surface display reporter. Affinity enrichment may be conducted using various known methods, including immunoaffinity methods. In one embodiment, affinity enrichment is conducted using immunomagnetic affinity enrichment. In yet another embodiment, the population of cells isolated by affinity enrichment are further screened by measuring fluorescence generated by the fluorescent reporter using flow cytometry. In a specific embodiment, the fluorescent protein reporter is yEGFP. In another specific embodiment, the surface display reporter is hemagglutination antigen (HA) and the fluorescent protein reporter is yEGFP. The fluorescent protein reporter and/or the surface display reporter may be encoded within the genome of a yeast reporter cell. In some embodiments, the yeast reporter cell is a S. cerevisiae cell or a S. cerevisiae strain AH109 cell. In preferred embodiments of the sdY2H assay or system of the invention, yeast reporter cells are grown in liquid culture for at least 12 hours, more preferably 12-24 hours, and still more preferably 24 hours or longer prior to affinity enrichment for cells containing interacting protein pairs.

BRIEF DESCRIPTION OF THE DRAWINGS

FIG.1. Scheme of the sdY2H system. Upon the interaction of bait and prey protein, the DNA binding domain (BD) and the transcriptional activation domain(AD) will be reconstituted to an active transcription factor to trigger the expression of reporters including surface display HA (sdHA) and yEGFP. The sdHA positive cells can be enriched by a simple magnetic separation (MACS) before plating or sorted by flow cytometry (FACS) based on yEGFP fluorescence.

FIG. 2. Evaluation of sdHA expression and sdHA-mediated magnetic separation by flow cytometry. A. Flow cytometric measurement of the sdHA and yEGFP reporter expression in sdY2H host cells. The AH109-YDC cells containing negative (Lam/T) and positive (p53/T) control pairs were grown in SD-L-T for 16hrs before harvest. The collected cells are either directly analyzed for yEGFP expression (A, upper panels) or labeled with the PE conjugated HA antibody for sdHA expression (A, bottom panels). B. The sdHA-mediated magnetic enrichment was analyzed by the flow cytometric yEGFP measurement on the cells undergone MACS separation. The red histogram: cells containing negative control Lam/T; Blue histogram: cells containing positive control p53/T without MACS enrichment; Green histogram: cells containing positive control p53/T with MACS enrichment. The percentage of the yEGFP positive cells in M1 region was shown in the figure.

FIG. 3. Time course study of the sdHA-mediated magnetic enrichment efficiency as a function of post-mating cell growth. The AH109-YDC cells containing bait protein p53 were mated with Y187 cells containing prey T. After mating, the cell mixture was grown in SD-L-T-H selective medium for 16hrs, 20hrs, 24hrs and 40hrs respectively before harvest. The yEGFP fluorescence analysis was performed on the cells collected before (upper panel), and after the magnetic enrichment (lower panel).

DETAILED DESCRIPTION OF THE INVENTION

Definitions

Unless otherwise defined, all terms of art, notations and other scientific terminology used herein are intended to have the meanings commonly understood by those of skill in the art to which this invention pertains. In some cases, terms with commonly understood meanings are defined herein for clarity and/or for ready reference, and the inclusion of such definitions herein should not necessarily be construed to represent a substantial difference over what is generally understood in the art. The techniques and procedures described or referenced herein are generally well understood and commonly employed using conventional methodology by those skilled in the art, such as, for example, the widely utilized molecular cloning methodologies described in Sambrook et al., Molecular Cloning: A Laboratory Manual 3rd. edition (2001) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y. and Current Protocols in Molecular Biology (Ausbel et al., eds., John Wiley & Sons, Inc. 2001. As appropriate, procedures involving the use of commercially available kits and reagents are generally carried out in accordance with manufacturer defined protocols and/or parameters unless otherwise noted.

A "yeast two-hybrid assay" or "yeast two-hybrid system" are used interchangeably herein and refer to an assay or system for the detection of interactions between protein pairs. In a two-hybrid screening assay/system, a transcription factor is split into two separate fragments, the binding domain (BD) and the activation domain (AD), each of which are provided on separate plasmids, and each of which is fused to a protein of interest. The yeast two-hybrid assay system comprises (i) a "bait" vector, comprising a bait protein and the BD of the transcription factor utilized in the system; (ii) a "prey" vector, comprising a prey protein (or a library of prey proteins to be screened for interaction with the bait protein) and the AD of the transcription factor; (iii) a suitable reporter yeast strain containing the activation sequence for the transcription factor used in the system, which drives the expression of one or more reporter proteins. The bait and prey vectors are introduced into the reporter yeast strain, wherein if the expressed bait and prey proteins may interact. Interacting bait and prey protein pairs result in the reconstitution and activation of the transcription factor, which then binds to its compatible activation domain provided in the reporter

yeast strain, which in turn triggers the expression of the reporter gene, which may then be detected.

A "fluorescent protein" as used herein is a protein that has intrinsic fluorescence. Typically, a fluorescent protein has a structure that includes an 1 1 -stranded beta- barrel.

As used herein, "yEGFP" refers to a yeast codon-optimized variant of Enhanced Green Fluorescent Protein(EGFP), as described in Cormack et al., 1997, Microbiol. 143: 303-311.

"Physical linkage", "link" and "join" refer to any method known in the art for functionally connecting two or more molecules or domains (which are termed "physically linked"), including without limitation, recombinant fusion with or without intervening domains, intein-mediated fusion, non-covalent association, covalent bonding (e.g., disulfide bonding and other covalent bonding), hydrogen bonding; electrostatic bonding; and conformational bonding, e.g., antibody-antigen, and biotin- avidin associations.

"Fused" refers to linkage by covalent bonding.

A "fusion protein" refers to a chimeric molecule formed by the joining of two or more polypeptides through a bond formed one polypeptide and another polypeptide. Fusion proteins may also contain a linker polypeptide in between the constituent polypeptides of the fusion protein. The term "fusion construct" or "fusion protein construct" is generally meant to refer to a polynucleotide encoding a fusion protein.

The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, a nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a nucleic acid encoding a fluorescent protein from one source and a nucleic acid encoding a peptide

sequence from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

A "reporter molecule" has a detectable phenotype. Often, the reporter molecule is a polypeptide, such as an enzyme, or a fluorescent polypeptide. A reporter polypeptide may have intrinsic activity. In the context of the methods of the invention, a reporter molecule has a detectable phenotype associated with correct folding or solubility of the reporter molecule. For example, the reporter could be an enzyme or a fluorescent polypeptide. For an enzyme, the detectable phenotype would then be the ability to turn over a substrate giving a detectable product or change in substrate concentration or physical state. For a fluorescent protein, the activity would be the emission of fluorescence upon excitation by the appropriate wavelength(s) of light.

The term "isolated," when applied to a nucleic acid or protein, denotes that the nucleic acid or protein is essentially free of other cellular components with which it is associated in the natural state. It is preferably in a homogeneous state although it can be in either a dry or aqueous solution. Purity and homogeneity are typically determined using analytical chemistry techniques such as polyacrylamide gel electrophoresis or high performance liquid chromatography. A protein which is the predominant species present in a preparation is substantially purified. In particular, an isolated gene is separated from open reading frames which flank the gene and encode a protein other than the gene of interest. The term "purified" denotes that a nucleic acid or protein gives rise to essentially one band in an electrophoretic gel. Particularly, it means that the nucleic acid or protein is at least 85% pure, more preferably at least 95% pure, and most preferably at least 99% pure.

"Nucleic acid" refers to deoxyribonucleotides or ribonucleotides and polymers thereof in either single- or double-stranded form. The term encompasses nucleic acids containing known nucleotide analogs or modified backbone residues or linkages, which are synthetic, naturally occurring, and non-naturally occurring, which have similar binding properties as the reference nucleic acid, and which are metabolized

in a manner similar to the reference nucleotides. Examples of such analogs include, without limitation, phosphorothioates, phosphoramidates, methyl phosphonates, chiral-methyl phosphonates, 2-O-methyl ribonucleotides, peptide-nucleic acids (PNAs).

Unless otherwise indicated, a particular nucleic acid sequence also implicitly encompasses conservatively modified variants thereof (e.g., degenerate codon substitutions) and complementary sequences, as well as the sequence explicitly indicated. Specifically, degenerate codon substitutions may be achieved by generating sequences in which the third position of one or more selected (or all) codons is substituted with mixed-base and/or deoxyinosine residues (Batzer et al., Nucleic Acid Res. 19:5081 (1991); Ohtsuka et al., J. Biol. Chem. 260:2605-2608 (1985); Rossolini et al., MoI. Cell. Probes 8:91-98 (1994)). The term nucleic acid is used interchangeably with gene, cDNA, mRNA, oligonucleotide, and polynucleotide.

The terms "polypeptide," "peptide" and "protein" are used interchangeably herein to refer to a polymer of amino acid residues. The terms apply to amino acid polymers in which one or more amino acid residue is an artificial chemical mimetic of a corresponding naturally occurring amino acid, as well as to naturally occurring amino acid polymers and non-naturally occurring amino acid polymer.

The term "amino acid" refers to naturally occurring and synthetic amino acids, as well as amino acid analogs and amino acid mimetics that function in a manner similar to the naturally occurring amino acids. Naturally occurring amino acids are those encoded by the genetic code, as well as those amino acids that are later modified, e.g., hydroxyproline, γ-carboxyglutamate, and O-phosphoserine. Amino acid analogs refers to compounds that have the same basic chemical structure as a naturally occurring amino acid, i.e., an α carbon that is bound to a hydrogen, a carboxyl group, an amino group, and an R group, e.g., homoserine, norleucine, methionine sulfoxide, methionine methyl sulfonium. Such analogs have modified R groups (e.g., norleucine) or modified peptide backbones, but retain the same basic chemical structure as a naturally occurring amino acid. Amino acid mimetics refers to chemical compounds that have a structure that is different from the general

chemical structure of an amino acid, but that functions in a manner similar to a naturally occurring amino acid.

Amino acids may be referred to herein by either their commonly known three letter symbols or by the one-letter symbols recommended by the IUPAC-IUB Biochemical Nomenclature Commission. Nucleotides, likewise, may be referred to by their commonly accepted single-letter codes.

As to amino acid sequences, one of skill will recognize that individual substitutions, deletions or additions to a nucleic acid, peptide, polypeptide, or protein sequence which alters, adds or deletes a single amino acid or a small percentage of amino acids in the encoded sequence is a "conservatively modified variant" where the alteration results in the substitution of an amino acid with a chemically similar amino acid. Conservative substitution tables providing functionally similar amino acids are well known in the art. For example, substitutions may be made wherein an aliphatic amino acid (G, A, I, L ₁ or V) is substituted with another member of the group.

Similarly, an aliphatic polar-uncharged group such as C, S ₁ T, M, N, or Q, may be substituted with another member of the group; and basic residues, e.g., K, R, or H, may be substituted for one another. In some embodiments, an amino acid with an acidic side chain, E or D, may be substituted with its uncharged counterpart, Q or N, respectively; or vice versa. Each of the following eight groups contains other exemplary amino acids that are conservative substitutions for one another:

1) Alanine (A), Glycine (G);

2) Aspartic acid (D), Glutamic acid (E); 3) Asparagine (N), Glutamine (Q);

4) Arginine (R), Lysine (K);

5) lsoleucine (I), Leucine (L), Methionine (M), Valine (V);

6) Phenylalanine (F), Tyrosine (Y), Tryptophan (W);

7) Serine (S), Threonine (T); and 8) Cysteine (C), Methionine (M)

(see, e.g., Creighton, Proteins (1984)).

Such conservatively modified variants are in addition to and do not exclude polymorphic variants, interspecies homologs, and alleles of the invention.

The term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (nonrecombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all.

An "expression vector" is a nucleic acid construct, generated recombinantly or synthetically, with a series of specified nucleic acid elements that permit transcription of a particular nucleic acid in a host cell. The expression vector can be part of a plasmid, virus, or nucleic acid fragment. Typically, the expression vector includes a nucleic acid to be transcribed operably linked to a promoter.

The invention provides a surface display-based yeast two hybrid system for rapid and large cDNA library scale protein interactome networking screening at affordable cost without the involvement of time consuming plating and cell sorting. The system's principal advantage results from its utilization of a combination of surface display markers, highly efficient yeast mating resulting in high transformation efficiencies, and positive cell enrichment using a robust immunomagentic affinity purification. In addition, the system of the invention can be combined with multiparameter fluorescence markers allowing further quantitative fluorescence analysis/sorting, enabling a significant reduction in the number of false positives. In some embodiments, the system uses liquid culture, rather than plate-based culture, resulting in substantially shortened cell culturing times that significantly reduce background fluorescence, allowing better discrimination of positive cells.

The invention represents the first operational large-scale cDNA library yeast two hybrid screening method, enabling non-plating based liquid culture, and suitable for fully automated and high-throughput large scale cDNA library screening. In contrast, conventional agarose gel plating-based screening requires preparing ~100 agarose plates for each bait screening, manual picking of positive cell colonies that survive

the nutrient markers selection, followed by further qualitative confirmation using a costly beta-Gal substrate for the development of colorimetric signals (5-10 hours), which involves replica plating, a process that can not be easily automated without several sophisticated and expensive robots. The system provides a simple, cost- effective, and efficient alternative to the cumbersome processes required with conventional methods.

SURFACE DISPLAY Y2H:

Yeast surface display techniques have been developed and applied successfully in many library screening applications (9-14) and the cells with surface displayed antigen can be analyzed and sorted by either flow cytometry or magnetic beads (9, 15, 16). Magnetic separation is convenient, simple, fast and has been utilized in many applications for cell isolation (17). The pre-enrichment of target cells from a library greater than 10 ⁸ cells was previously demonstrated (18, 19).

In one aspect of the invention, a reporter protein that is expressed on the surface of yeast cells is incorporated into the Y2H system of the invention. This approach enables the use of immunological affinity capture methods to select for cells within a large library of potential interacting "prey" proteins and the "bait" protein used in the assay. In the practice of the sdY2H assay of the invention, any protein or polypeptide that can be expressed as a cell surface marker on yeast cells may be used. Antibodies, or other affinity binding ligands, may be used to immunologically capture positive cells via binding to an epitope on the cell surface displayed protein. Although virtually any immunoaffinity methodology may be used to capture positive cells from a cell library, a preferred method involves immunomagnetic capture, wherein magnetic beads functionalized with the antibody or other affinity binding ligand are used to efficiently capture positive cells from the library. A principal advantage of the inventions is the elimination of agar plate-based culture typical of all Y2H systems available today, as the invention achieves yeast growth in liquid culture. Thus, the invention provides a simple alternative to the cumbersome replica plating characteristic of conventional Y2H systems, inasmuch as positive Y2H targets are quickly isolated from library cells by a simple affinity enrichment screen.

In some embodiments, wherein only a surface display marker is used, in combination with other standard growth selection markers, immunomagnetic capture may be sufficient, alone, to capture a wide range of cells containing protein-protein interacting pairs. However, where higher and/or variable, and quantitative selections are desired, the surface display marker is combined with a fluorescent reporter enabling flow cytometric selection following an immunomagnetic enrichment step, as is further described, infra.

Another methodology which may be employed is the use of a yeast surface display system, whereby a desirable ligand may be expressed as a fusion with a yeast cell- surface expressed protein. Yeast surface display systems have been described and are widely available for screening combinatorial peptide libraries. In one such system (Boder et al., 1997, Nature Biotecchnology 15: 553-57), a protein of interest is displayed as a C-terminal fusion to the Aga2p mating adhesion receptor of Saccharomyces cerevisiae on the surface of yeast. The Aga2p protein is naturally used by yeast to mediate cell-cell contacts during yeast cell mating. As such, display of a protein via Aga2p projects the protein away from the cell surface, minimizing potential interactions with other molecules on the yeast cell wall. Similarly, in the Examples which follow, a previously described α-agglutinin gene-based yeast surface display system was used (14, 20).

Any number of cell surface proteins that can be expressed in and localized to the yeast cell surface may be used as surface display markers, including yeast proteins and a broad range of heterologous proteins. In an exemplification of the sdY2H method, Example 1 describes the use of the hemagglutination antigen (HA). Many other heterologous cell surface and transmembrane proteins (e.g., eukaryotic cell surface proteins, such as mammalian cell surface proteins) may be expressed on the yeast cell surface, as will be appreciated. Some examples include numerous CD cell markers (e.g., CD4, CD8, CD45, etc.) and transmembrane receptor molecules (e.g., EGFR ₁ G-protein coupled receptors, insulin receptor). In addition, proteins and polypeptides not naturally expressed on the cell surface may be engineered to contain targeting domains that will direct the protein to be expressed and localized to the cell surface, as will be generally appreciated by those skilled in the art.

Although any affinity capture methodology may be used to enrich for yeast cells expressing the surface display reporter, typically an immunoaffinity approach will be used. In a preferred method, magnetic (i.e., immunomagnetic) affinity capture is employed. Magnetic affinity capture refers to methods which utilize the ability of a ligand binder-functionalized magnetic bead to bind to the surface of a particle or cell, thereby permitting the application of a magnetic filed to isolate the particle or cell of interest from other contents in a sample containing such particles or cells, and include for example immunomagnetic affinity capture methodologies. The affinity ligand is typically an antibody capable of recognizing and binding to a surface display reporter. Typically, a ligand-functionalized magnetic bead is magnetic bead coated or functionalized with an antibody which recognizes and binds to a surface display reporter expressed in the yeast cell.

Contacting yeast cells expressing the surface display reporter with a ligand- functionalized magnetic bead preparation will result in the binding of the beads to the yeast cells. Applying a magnetic field to the bead-bound cells will enable separation of the (positive) yeast cells (expressing the SD marker) from cells not expressing the surface display marker. Typically, one or more washes are performed to enhance the degree of enrichment/purification (i.e., saline washes).

COMBINED SURFACE DISPLAY AND FLUORESCENT REPORTER Y2H:

In another and preferred aspect of the invention, a yeast two-hybrid system in which both surface display and fluorescent reporters are utilized is provided. In the practice of such a yeast two-hybrid assay, the interaction of a prey protein with the bait protein triggers the activation of the transcription factor and expression of the reporters under the control of the responsive promoter used in the system. Expression of the cell surface display reporter enables the use of affinity capture to enrich for positive cells. Expression of the fluorescent reporter enables flow cytometric detection and quantitation of fluorescence. The use of a flow cytometric screen (typically, following an affinity enrichment for surface display reporter expressing cells) further reduces the false positive rate based on the quantitative GFP analysis. The improved specificity attributed to the use of multiple reporters

(sdHA, GFP and conventional nutrient markers), and the convenience of cell culturing in combination offers a greatly streamlined process for high throughput and high volume library screen applications.

In preferred embodiments of this aspect of the invention, the fluorescent protein yEGFP is used as the fluorescent protein reporter. In a particular, and preferred, embodiment, yEGFP is integrated into the yeast reporter strain genome. An example of such a yeast reporter cell line is the S. cerevisiae AH 109 strain used in the Matchmaker™ Y2H system available from Clontech Laboratories (Mountain View, California) (see Examples, infra). The yEGFP expressing AH109 strain may be used in combination with the Matchmaker™ Y2H bait and prey plasmids, also available from Clontech. This system is a GAL4-based Y2H system, and it has been thoroughly characterized in the Examples, infra. The "Matchmaker™ GAL4 Two- Hybrid System 3 & Libraries User Manual" from Clontech may be obtained from Clontech and is hereby specifically incorporated by reference herein in its entirety.

However, many other embodiments involving other types of Y2H systems are envisioned, as the nature of the transcription factor, yeast reporter strain, particular bait/prey plasmids, and the like used in the assay may not be critical. For example, a variety of yeast strains maybe used in the practice of the invention. Strains of the yeast Saccharomyces cerevisiae are particularly suitable in embodiments of the invention, in part because their genome has been extensively studied, and because they enjoy GRAS ("Generally Regarded As Safe") status with the Food and Drug Administration. Saccharomyces cerevisiae is recognized as a model eukaryote capable of rapid growth and with a versatile DNA transformation system. Background information and exemplary methods and media for growing, testing an d preserving yeast in general and S. cerevisiae in particular may be found, for example, in Sherman, F., "Getting Started with Yeast," Dept. of Biochem. and Biophysics, Univ. of Rochester Med. Sch. (August 2003) (adapted from Sherman, F., "Getting Started with Yeast," Methods Enzymol., 350:3-41 (2002) (hereinafter "Sherman (I)"); and in Sherman, F., "An Introduction to the Genetics and Molecular Biology of the Yeast Saccharomyces cerevisiae," Dept. of Biochem. and Biophysics, Univ. of Rochester Med. Sch. (1998) (modified from Sherman, F., "Yeast Genetics,"

The Encyclopedia of Molecular Biology and Molecular Medicine," 6:302-325 (edited by R. A. Meyers, Weinheim, Germany, 1997); and Burke, D., et al., "Methods in Yeast Genetics: A Cold Spring Harbor Laboratory Course Manual" (Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y., 2000); Colby, et al. "Engineering Antibody Affinity by Yeast Surface Display" Methods Enzymol. 388:348-58 (2004). Additionally, many Y2H systems are known and commercially available. While some, like the exemplary system described herein, are GAL4 based systems, other systems based on other transcription factors such as LexA are known and available. In each case, an existing system may be modified by integrating yEGFP as at least one of the reporters whose expression is driven by the transcription factor that is activated upon protein-protein interacting pairs. Thus, many other Y2H systems may be similarly improved by introducing yEGFP into the yeast reporter strain genome, as will be appreciated by those skilled in the art.

Various transcription factors useful in yeast two-hybrid systems have been described and/or are commercially available, including without limitation GAL4, GCN4, ARD1 , the human estrogen receptor, E. coli LexA and B42 proteins, herpes simplex virus VP16, NF-kB p65, and the like. In addition, hybrid transcriptional activators composed of a DNA binding domain from one transcriptional activator and an activation domain from another transcriptional activator are also known. Examples of transcription suppressors include the Kruppel protein, the engrailed protein, the knirps protein, the paired protein and the even-skipped protein, all from Drosophila; the SIN3, GAL80, and TUP1 proteins, all from Saccharomyces cerevisiae; the tet repressor; the EgM , WT1 , RARa, KRAB, verbA, YY1 , ADE1 B, E4B4, SCIP, kid-1 , Znf2, and kox-1 proteins; and the like. The corresponding transcriptional elements specifically interacting with the transcriptional activators or repressors are well known in the art (see, for example, Hanna-Rose and Hansen, 1996, Trends. Genet., 12:229-234).

A variety of fluorescent proteins are known and are suitable for use as a fluorescent protein marker/reporter for enabling cell sorting. Fluorescent proteins, such as the prototypic the Green Fluorescent Protein isolated from Aequorea victoria (GFP), generally share a common tertiary structure comprising an 11 -stranded beta-barrel

structure surrounding a centrally-located self-activating chromophore. One group of fluorescent proteins Aequorea victoria GFP, as well as a number of GFP variants, such as cyan fluorescent protein, blue fluorescent protein, yellow fluorescent protein, etc. A number of color shift mutants of GFP have been developed and may be employed in the directed evolution methods of the present invention. These color- shift GFP mutants have emission colors blue to yellow-green, increased brightness, and photostability (Tsien et al., 1998, Annual Review of Biochemistry 67: 509-544). Additional GPF-based variants having modified excitation and emission spectra (Tsien et al., U.S. Patent Appn. 20020123113A1), enhanced fluorescence intensity and thermal tolerance (Thastrup et al., U.S. Patent Appn. 20020107362A1 ; Bjorn et al., U.S. Patent Appn. 20020177189A1), and chromophore formation under reduced oxygen levels (Fisher, U.S. Patent No. 6,414,1 19) have also been described. Most recently, GFPs from the anthozoans Renilla reniformis and Renilla kollikeri were described (Ward et al., U.S. Patent Appn. 20030013849).

In another embodiment, the surface display and fluorescent protein reporters are one in the same. More specifically, the fluorescent protein reporter (e.g., yEFGP) is expressed on the surface of the yeast cell as a fusion protein with a protein capable of orienting the fluorescent protein on the cell surface using well known yeast surface display methodologies. Affinity enrichment may be conducted using, e.g., an antibody specific for yEGFP, and fluorescence measured by flow cytometry.

Additional/multiple reporters/selection markers may also be incorporated into the reporter strains, as is common in existing Y2H systems today. In particular, it is desirable to include a positive selection reporter, such various nutrient selection reporters. Various auxotrophic markers are common and include without limitation URA3, HIS3, TRP1 , LEU2, LYS2, ADE2, and the like. The HIS3 gene, encoding a protein required for histidine synthesis; the LEU2 gene, encoding a protein required for leucine synthesis; and the URA3 gene, encoding a protein required for uracil synthesis, are frequently used. Typically, for purposes of positive selection with such a selection marker, the yeast host cells transformed with bait vector and/or prey vector are cultured in a medium lacking a particular nutrient. Only yeast cells transformed with bait and prey vectors that result in a positive interaction between

the bait and prey fusion proteins will survive selection on media requiring the expression of the nutrient selector. As will be appreciated buy those skilled in the art, selection markers complement the host strains in which the bait and/or prey vectors are expressed - i.e., a yeast strain lacking the selection marker gene (or having mutation in the corresponding gene) is used as yeast reporter strain. Numerous yeast strains and derivatives thereof corresponding to various selection markers are well known in the art and/or commercially available, many of which have been developed specifically for yeast two-hybrid systems. The application and optional modification of such strains with respect to the present invention is well within the ordinary skill in the art.

Other selectable markers are not based on auxotrophies, but rather on resistance or sensitivity to an antibiotic or other xenobiotics. Examples include, but are not limited to, chloramphenicol acetyl transferase (CAT) gene, which confers resistance to chloramphenicol; CAN1 gene, which encodes an arginine permease and thereby renders cells sensitive to canavanine (see Sikorski et al., 1991 , Meth. Enzymol., 194:302-318); the bacterial kanamycin resistance gene, which renders eucaryotic cells resistant to the aminoglycoside G418 (see Wach et al., 1994, Yeast, 10:1793- 1808); and CYH2 gene, which confers sensitivity to cycloheximide (see Sikorski et al., 1991 , Meth. Enzymol., 194:302-318). Selection markers may be used alone or in combination, as is well known in the art. One or more selection markers can be included in a particular bait or prey vector. The bait vector and prey vector may have the same or different selection markers. In addition, the selection pressure can be placed on the transformed host cells either before or after mating the haploid yeast cells., including but not limited to.

Reporter proteins are preferably integrated into the yeast reporter strain chromosome, as in the specific embodiments described by way of the Examples, infra. However, as will be appreciated, plasmid-based reporters may also be utilized. For example, expression vectors in which the reporter proteins are under the transcriptional control of the GaI 1 promoter may be used. Vectors enabling PCR cloning of desired reporters into the vector are commercially available (i.e. pYM vectors, EUROSCARF, Frankfurt, Germany).

The bait and prey vectors may be introduced into the yeast cell by various means, including by co-transformation. Alternatively, these vectors may be introduced into two yeast cells having different mating types, which are subsequently mated. In a preferred embodiment, the optimized interaction-mating protocol of Soellick and Uhrig is used (22) (see, also, Example 1, infra). This method requires far fewer cells for magnetic separation (MACS), 1X10 ⁹ versus 10 ¹⁰ cells using a standard transformation approach. Introduction efficiency is also higher using this mating protocol versus standard transformation.

In the Examples which follow, introduction of a surface reporter (sdHA) into a yEGFP based Y2H system resulted in the rapid isolation of positive Y2H targets from library cells by a simple magnetic separation without large plating. Moreover, the simultaneous scoring of multiple reporters including sdHA, GFP and conventional nutrient markers greatly increased the specificity of the Y2H assay. The feasibility of the sdY2H assay on large cDNA library screening was also demonstrated by successfully recovering positive P53/T interaction pairs at a target to background ratio of 1 :1 ,000,000 (see Example 1). Together with massive parallel DNA sequencing technology, the method of the invention provides a powerful proteomic tool for high throughput interactome mapping at genomic scales.

As described in Example 1 , infra, a highly flexible reporter cassette containing five reporter genes including yEGFP, surface displayed HA tag, HIS3, MEL1 and LacZ was constructed to allow simultaneous selection of conventional nutrient markers, surface display markers and yEGFP fluorescence markers in liquid cultures. The results obtained showed that the sufficient surface display HA reporter expression can be triggered by positive bait and prey interactions (Fig.2A), and subsequently mediate an efficient enrichment of positive cells from large numbers of library cells via a simple immune-magnetic separation (Fig. 2B and Table 1). Significantly, the data shows that the sdHA-mediated enrichment was able to select positive cells with lower levels of marker expression than fluorescence-based analysis of yEGFP and or PE-anti-HA. Thus, while the surface display immune-magnetic selection lacks the

quantitative features of the fluorescence selections, it is an extremely sensitive and efficient means to enrich interaction-positive cells.

By virtue of the invention's liquid culture approach (compared to traditional agar plate based culture), the invention is adaptable to high-throughput format and can be used for large-scale cDNA screening for interacting proteins with high sensitivity and low signal: noise ratios. The invention's Y2H assay/system offers convenient, quantitative and faster reporter analysis compatible with existing liquid handling robots, and also reduces labor requirements in screening cDNA libraries.

Applicants have found that rapid liquid culture growth enables significant amplification of target cell population (~60 fold) as well as surface display marker expression after one-day growth period. One time course study revealed that a 24- hour cell growth post-mating was sufficient for reporter expression and HA-mediated enrichment (Fig. 3), a dramatic reduction from the conventional 3-day colony plating method. Although the exact time point dependents on particular applications, e.g. longer time point may be preferred for isolating weak interaction, the data obtained with the invention's Y2H system suggests that cell culture-based screening allows the screening at earlier time point than the conventional 3-day plating method. It is also important to note that the careful optimization of growth time is critical in all Y2H screening methods, as growth-induced biases may lead to the domination of faster growing clones.

The invention's sdY2H system may be particularly useful in large scale library screening. As shown in Example 1 , infra, the sdY2H system's performance demonstrates that it is a simple yet powerful approach with single copy sensitivity for a typical human cDNA library (consisting of one million independent clones, with the target to background ratio of 1 :1 ,000,000). The sensitivity of sdY2H screening is at least comparable with the classical Y2H plating method, if not better (as evidenced by the capability of recovering the spike T targets in Table 2). The library screening of T/p53 model system (Example 1) also demonstrated the superior specificity of the sdY2H system, almost all the positive candidates screened from the sdY2H approached are true positives (Table 2, as judged by the standard MEL1/α-X-gal

confirmation after the initial screening with SD-L-T-H plus sdHA enrichment) compared to a ~20% (7/38, Table 2) of positive rate using the conventional Y2H approach. This superior specificity can be explained by simultaneous scoring of multiple reporters including the conventional nutrient marks, HIS3 as well as the sdHA and yEGFP reporter in the liquid cultures.

Various aspects of the invention are further described and illustrated by way of the several examples which follow, none of which are intended to limit the scope of the invention.

EXAMPLES

EXAMPLE 1 : sdY2H ASSAY/SYSTEM DEVELOPMENT AND EVALUATION

Experimental Procedures

Bacterial strains, plasmids and molecular cloning techniques: Plasmid construction and molecular cloning were performed in E.coli DH5α (Invitrogen) following the standard protocol. The Y2H kit "Matchmaker system" was ^' obtained from Clontech

(San Jose, CA). The kit includes the bait vector pGBKT7 (containing GAL4 DNA binding domain) and prey vector pGADT7 (containing GAL4 activation domain) along with the negative interaction control pGBKT7-Lam/pGADT7-T pair (Lam/T), and the positive interaction control pGBKT7-p53/pGADT7-T pair (p53/T). The bait p53 is a mouse p53 gene segment encoding the amino acid residues from 72 to 390. The prey T is the large T antigen of the SV40 virus. A strong trigger of reporter gene expression, PCL1 plasmid encoding an intact Gal4 transcription factor was also included in the kit.

The yEGFP reporter cassettes and the toolbox for PCR based tagging kit were purchased from EUROSCARF (EUROpean Saccharomyces cerevisiae ARchive for Functional analysis). The yeast surface display system based on α-agglutinin gene

(14, 20) was constructed as follows. Firstly, two complementary oligos encoding the secretion signal of the glucoamylase precursor protein:

GluSSP-XbaF 5'CTAGACTCTAATGCAACTGTTCAATTTGCCATTGAAAGTTTCATTCTTTCTCGT CCTCTCTTACTTTTCTTTGCTCGTTTCTGCTGCAAGCG3' [SEQ ID NO: 1]

and,

GluSSP-EcoR

5'AATTCGCTTGCAGCAGAAACGAGCAAAGAAAAGTAAGAGAGGACGAGAAAGA ATGAAACTTTCAATGGCAAATTGAACAGTTGCATTAGAGA3' [SEQ ID NO: 2]

were synthesized, annealed and cloned into EcoR\/Xba\ sites of pYM-N22 vector, resulting the pYM-N22S plasmid.

Secondly, two primers,

AGG-F 5'AAGGCCTATGCGGCCGCGCCAAAAGCTCTTTTATCa' [SEQ ID NO: 3]

and

AGG-R 5' CCGTTAACTTTGATTATGTTCTTTCTAT-3' [SEQ ID NO: 4]

were synthesized to amplify the C-terminal of α-agglutinin genes from AH 109 yeast cells. The amplified PCR products were digested with Sfi\ and Hpa\ and inserted into the corresponding sites of pYMN22S, resulting the pYM-N22S-Agg plasmid.

Thirdly, two oligos,

HA-F

5 ¹ AATTCTACCCATACGATGTTCCTGACTATGCGGGCTATCCCTATGACGTCCCG GACTATGCAGGATCCTATCCATATGACGTTCCAGATTACGCTGATS' [SEQ ID NO: 5]

and

HA-R

5 ¹ ATCAGCGTAATCTGGAACGTCATATGGATAGGATCCTGCATAGTCCGGGACG TCATAGGGATAGCCCGCATAGTCAGGAACATCGTATGGGTAGS' [SEQ ID NO: 6]

encoding 3 repeats of HA antigen were synthesized, annealed and inserted into EcoR\ IEcoFN sites of pYM-N22S-Agg plasmid, resulting the pYM-N22-YDC plasmid. The resulting surface display DNA fragment cassette containing the GaM promoter, glucoamylase secretion signal, 3HA and the c-terminal of the α-agglutinin gene was further PCR amplified with two primers,

OJC-145

S'- AAGTCGACCGAGCTCTAGTACGGATTAG-S' [SEQ ID NO: 7]

and

OJC-137

5'-CCAGATCTGCAGGTTAACTTTGATTATGTTC-S' [SEQ ID NO: 8]

before inserted into the Sa/I /BgIU sites of pYM-16 vector, resulting the final yeast surface display plasmid pYM16-GaIYDC.

Yeast strains, culture, and transformation: The Y2H recipient (host) strain of the Matchmaker system, S. cerevisiae AH109 has the genotypes of (MATa, trp1-901, leu2-3, 112, ura3-52, his3-200, gal4δ, gal80δ, LYS::GAL 1UAS-GAL1 _T ATA-HIS3, GAL2 _UA S-GAL2TATA-ADE2, URA3::MEL1 _υAS -MEL1 _TATA -lacZ). The culturing of all yeast strains was performed using the standard protocol suggested by the manufacture. Nutrient selective plates were made with minimum synthetic medium

SD (Clontech) supplemented with the amino acids of the appropriate Dropout Mixture (Clontech). The protein-protein interaction assays were performed essentially according to the instruction manual provided by Clontech.

The yEGFP-AH109 cells were made by replacing the ADE2 coding region with the yEGFP gene in AH 109 cells (21). The AH109-YDC cells were made by replacing the non-coding gene fragment downstream of MEL1 gene with the HA surface display cassette in pYM16-GaIYDC plasmid. Briefly, the HA surface display cassette, including the GaM promoter, 3HA and agglutinin gene, and the hygromycine resistance gene in pYM16-GaIYDC plasmid was amplified with two primers

OJC-153

S'GACATTTCACGAAGAGGAACAACAGCTTCAGGAGTACATACAAACGCGAGTCT AGTACGGATTAGS ¹ [SEQ ID NO: 9]

and

OJC-154

5'GGATCCCGAGTTTCTCAGAGTGCTTGGTGAAGCCTGGTAGAGTGAGACTAAT TACATGACTCGAG3' [SEQ ID NO: 10]

The PCR products were cleaned with the Qiagen gel extraction kit and then transformed into the yEGFP-AH109 strains by standard LiAc/PEG method. The hygromycine resistant colonies were selected on the YPD plates supplemented with 100μg/ml G418 and 400μg/ml Hygromycine. Three independent colonies were picked for further evaluation as the HA surface display reporter host. The positive plasmid controls, p53/ T and PCL1/PGBKT7 pairs, and the negative control plasmid pair, Lam/ T, were transformed into these three hygromycine resistant yeast hosts respectively and spread onto SD-L-T (SD medium lacking amino acids, Leucine and Tryptophan) plate supplemented with 100μg/ml G418 and 100μg/ml hygromycine. The transformants were stained with PE (phycoerythrin)-conjugated anti-HA antibody and yeast cell fluorescence measured by flow cytometry as described below. The candidates that generated the highest PE signals upon the triggering of PCL1 and

p53/T positive controls were picked and named AH109-YDC. The chromosomal integration of the HA display cassette gene fragment was further confirmed by PCR and sequencing.

Flow cytometric fluorescence analysis of activated AH109-YDC yeast cells: AH 109- YDC cells were evaluated upon activation by two positive triggers (PCL1 , p53/ T) and a negative trigger (Lam/ T). After the transformants grew up on the SD-L-T plates, 3 individual colonies were picked into SD-L-T liquid media and grew over night. The AH109-YDC reporter yeast host cells carrying various bait and prey pairs were grown on SD-T-L+G418+Hyg selective medium to ensure all the yeast cells were under the same growth and selection conditions. The yeast cells were harvested, washed once with the incubation buffer (PBS/0.5%BSA), resuspended in 250μl incubation buffer plus 1 μg mouse PE-conjugated HA antibody (Santa Cruz), and incubated on ice for 30 minutes. The stained cells were washed once with the incubation buffer and the PE and yEGFP fluorescent signals were measured using a FACSCalibur flow cytometer (Becton Dickson, San Jose, CA^ USA). The instrument settings were as follows: Log forward scatter (FSC) E00; Log side scatter (SSC) at 299V; Log FL1 fluorescence at 600 V; Log FL2 fluorescence at 580 V. Both the PE and the yEGFP reporter were excited at 488nm. The PE fluorescence was collected through 585/42nm bandpass filter on the FL2 channel and the yEGFP fluorescence was collected through 530/30nm bandpass filter on the FL1 channel. The yeast singlet cell population was gated on FSC and SSC. The typical sampling rate was 12 μl/min (~200 cell/second) and the typical sample size was 10,000 cells per measurement unless otherwise stated. The data were analyzed with WinMDI 2.8 software (Joseph Trotter/The Scripps Research Institute).

Antibody staining of the yeast cells and magnetic separation: The MACS purification system from Miltenyi Biotech (Auburn, CA) was used for magnetic separation of the sdHA positive cells. The antibody staining and the MACS purification process were performed as suggested by the manufacture. Briefly, the yeast cells were grown, harvested and washed once with MACS buffer (PBS/0.5%BSA/2mM EDTA), suspended in 250 μl MACS buffer supplemented with 1 μg mouse anti-HA antibody (Santa Cruz) and incubated at 4°C for 10 minutes. The stained cells were washed

twice with MACS buffer, resuspended in 70μl MACS buffer supplemented with Goat anti-mouse IgG microbeads (Miltenyi Biotech, 20μl beads per 10 ⁷ cells) and incubated for 15 minutes at 4 degree. The stained cells were washed once with MACS buffer and resuspended in MACS buffer (500μl per 10 ⁸ cells). The 500μl cells were loaded onto the pre-equilibrated MS column and washed three times with MACS buffer. Then the column was removed from the magnetic stand apparatus, and the cells were eluted with 1 ml MACS buffer. The eluted cells were either analyzed directly by flow cytometry or spread onto the plates containing selective media.

cDNA library screening using conventional plating, magnetic sorting and magnetic sorting plus flow sorting: A set of cDNA library samples was prepared by spiking 10000, 1000, 100 Y187/T (prey target) into a pre-transformed human HeIa cell cDNA library in Y187 (10 ⁸ cfu, Clontech). Bait protein p53 containing cells (~3x10 ⁸ AH109- YDC-p53) were mated with the prey library cells according to the protocol described by Soellick and Uhrig (22). After mating, an aliquot of mating mixture was taken and spread onto SD-L-T plates to determine the mating efficiency. The rest of mating mixtures was split into two parts, one was used to carry out the conventional plating- based screening by spreading the cells onto fifteen 15cm SD-L-T-H (SD medium lacking amino acids, Leucine, Tryptophan and Histidine) plates (P), and the other was used to perform sdY2H screening by growing the cells in SD-L-T-H liquid medium for 24hrs before the magnetic enrichment. The cells harvested from sdY2H culturing was then labeled with the anti-HA antibody, and mixed with anti-lgG microbeads before passing through the MACS affinity column. The captured cells were eluted with 5ml PBS buffer, and then split into two 2.5 ml aliquots with one being spread onto the SD-L-T-H plates to obtain single colonies (M+P), the other one being sorted (FACSAria, Becton Dickson, San Jose, CA, USA) according to yEGFP fluorescence and subsequently plated onto the SD-L-T-H plates (M+F+P). Following the standard Y2H confirmation process, the sd-L-T-H positive colonies (after a 3-day growth period) were picked onto a master plate, and then replicated onto MEL1/α-X- gal plates to determine the real Y2H positive cells. The positive clones were further confirmed with the sequence analysis using either colony PCR test or Sanger sequencing described below.

Sequence analysis by colony PCR and Sanger sequencing: T antigen specific PCR test was designed with the amplification primers,

T-F δ'-GTGATGATGAGGCTACTGCTG-S' [SEQ ID NO: 11]

and

T-R δ'-ATGCTCCTTTAACCCCACCTG-S' [SEQ ID NO: 12]

to amplify T target specifically. The colony PCR was performed according a standard experimental protocol established in applicants' laboratory. Approximately

30 MEL1 positive colonies obtained from the library screening experiments were picked for colony PCR analysis to determine if the positive colonies contained the spiked T antigen. For the 9 colonies that are T-negative, plasmid DNA was extracted, transformed into E.coli, and extracted again for Sanger sequencing analysis.

Results

Design and construction of a yeast surface display two-hybrid system: Applicants have developed a new flow cytometry based Y2H system using yEGFP as an alternative reporter gene that could be easily quantified by flow cytometry (see, reference 21). This system allows selections using nutrient selection in liquid culture and fluorescence selection by fluorescence cell sorting, eliminating the need for plate-based culture. However, given flow cytometry single cell analysis rates of 10 ⁷ - 10 ⁸ cells per hour, fluorescence-activated cell sorting of large libraries still requires many hours. To increase the speed of the screening, another Y2H system was developed, this one using both a surface display affinity tag (in this example, HA) into the yEGFP-based Y2H reporter system, resulting in dual reporter expression of

yEGFP and sdHA triggered upon the interaction of bait and prey fusion proteins. The surface displacement of the HA tags enables a rapid enrichment of positive cells via a simple immuno-magnetic separation, therefore tremendously reduced the number of cells to be analyzed by cell sorter or plating (Fig. 1).

To construct the surface display Y2H reporter system, the reporter cassette containing the GaM promoter, glucoamylase secretion signal, 3HA and the c-terminal of α -agglutinin gene was constructed (14, 20) as described, supra. The surface display reporter cassette along with a hygromycine resistance gene were integrated into the yEGFP-AH109 strains resulting AH109-YDC, which has five reporter genes including yEGFP, sdHA, HIS3, MEL1 and LacZ.

Evaluation of HA surface expression in sdY2H system: To evaluate if surface HA reporter could be co-expressed with the yEGFP reporter in the sdY2H system, a positive interaction control, p53/T, was employed to trigger yEGFP/HA expression. Surface HAs were labeled with PE conjugated HA antibodies, and yEGFP and PE fluorescence measured by flow cytometry (Fig.2A). The yEGFP fluorescence analysis revealed that ~30% p53/T cells produced clear yEGFP signals (MFI=I 07.8, CV=18.4), whereas no detectable signal was obtained with the Lam/T negative control. Meanwhile, PE-anti-HA fluorescence analysis revealed that ~20% p53/T cells produced clear PE signals (MFI=327.1 , CV=18.7), and no PE signal was detected for the negative control Lam/T. In addition, ~17% cells are doubly positive for PE/yEGFP demonstrating the co-expression of dual HA and yEGFP reporters of the sdY2H system. As previously described (21), not all of the positive control cells are positive for the reporter markers. This may reflect a cell cycle-dependence of bait, prey, and reporter expression that is not visible in plate-based growth selection over multiple generations.

The sdHA reporter-mediated immune-magnetic affinity enrichment: To demonstrate the enrichment by HA-mediated magnetic separation, ~10 ⁷ AH109-YDC cells expressing p53/T or Lam/T control interaction pairs were prepared, labeled with HA- antibody, and the cell mixture applied to magnetic separation column. Recovery efficiency was determined by counting the cells before and after the magnetic

separation. The cell count study revealed a recovery of 56.1 % for p53/T positive control cells (compared to a background of 0.17% for Lam/T negative control). Flow cytometry analysis for yEGFP on the enriched p53/T cell population showed that 82% of cells are yEGFP-positive (Fig 2B) ₁ indicating that some enriched sdHA cells are not detectable by a threshold-based analysis (% positive) of yEGFP fluorescence. Given the fact that the magnetic enrichment did not result any significant numbers of cells from the negative control experiment (0.17% on Lam/T negative control cells), HA-mediated immune-magnetic enrichment is able to select cells with lower amounts of reporter expression than threshold-based fluorescence (% positive) analysis.

To further evaluate if such magnetic separation approach is suitable for isolating rare targets from a large library (often consists of ~10 ⁹ cells), a library was prepared by spiking -1500 target cells (AH109-YDC cells bearing p53/T) into 10 ⁹ AH109-YDC cells, carried out magnetic enrichment, and determined the recovery of the target cells (Table 1). With a single passage through the MACS separation column, 600 out of 1500 targets cells were recovered (40%) and a high depletion efficiency of 99.2% was observed. The second round of MACS separation yielded the overall recovery of 28% and an extremely high depletion efficiency of 99.997%. Enrichment factors of 50-fold and 9100-fold were obtained with single and double MACS passages, respectively. These results demonstrated that surface HA display-mediated enrichment allows rapid and efficient isolation of rare target cells from a large population of library cells suggesting its utility in Y2H screening in large complex prey libraries.

Optimization of post-mating cell growth time to enable sufficient HA reporter display: As shown above, efficient recovery can be achieved using HA affinity-based magnetic separation as long as sufficient numbers of HA reporters are displayed on the cell surface. Initial data suggested that a minimal 16-hour culturing post-mating was required for surface protein expression using the yeast surface display system. To determine the optimal post-mating liquid culture time for sufficient magnetic enrichment, a time course study was conducted after the mating AH109-YDC/p53 with Y187/T cells. Aliquots of post-mating culture of 16, 20, 24, and 40 hrs were

taken and applied for magnetic separation. The cell number before and after magnetic separation was obtained by spreading the cells onto SD-L-T plates and counting colonies. The recovery efficiency was determined by the ratio of the cell counts before and after magnetic separation. The recovery efficiencies were 2.6%, 8.4%, 42.7% and 43.4% at 16, 20, 24 and 40 hrs, respectively, with the plateau at 24 hr time point. Further yEGFP fluorescence analysis on enriched cell population also showed that the 24-hour growth dramatically enriched yEGFP positive cells yielding to 27.5% positive rate (Fig. 3). These data showed that a 24-hour post-mating cell growth was optimal for HA surface expression-mediated magnetic enrichment of p53/T positive cells. This 24-hour time point was used for the cDNA library screening described immediately following.

Human cDNA library screening using the sdY2H system: To demonstrate the utility of the new sdY2H approach, the p53/T interaction complex from a human HeIa cDNA library cells were screened. Pre-transformed human HeIa cDNA library cells (~10 ⁸ live cells) containing different T target/library cell ratios of 1 :10,000, 1:100,000, and 1 :1 ,000,000 were prepared and used to mate with the p53 bait containing AH109-YDC cells respectively. To ensure a good statistical coverage of independent clones in a human cDNA library (which typically contains ~1 millions of independent clones), at least 5 million co-transformants were screened (Table 2, Row 2). After mating, three screening approaches were undertaken, including conventional plating (P), magnetic separation followed by plating (M + P), and magnetic separation followed by FACS sorting and plating (M+F+P), to compare the assay sensitivity and specificity. Naturally, the culturing-based M+P and M+F+P methods recovered many more positive SD-L-T-H cells than direct plating (P) attributed to the post-mating cell growth, e.g. yielding 560 and 440 positive cells vs. 38 positive colonies (in 1:1,000,000 experiment, Row 3, Column 5, Table 2). Since the standard yeast two hybrid screen practice only considers the candidates as true positives after a secondary confirmation (e.g. LacZ or MEL1 assay), a subsequent MEL1 reporter analysis was conducted on the positive colonies for identifying true positives.

The data revealed that the sdY2H-mediated M+P and M+F+P approaches generally yielded much higher real positive rates compared to the direct plating method (Table

2, Row 4). In the experiment of 1 :1 ,000,000 screening, M+P and M+F+P produced 95% (54/57) and 97% (63/65) real MEL1 positives respectively vs. 20% (7/38) positives from the direct plating. In the experiment of 1 :100,000 screening, 98% (52/53) and 100% (50/50) positive rates were obtained from sdY2H methods vs. 60% (54/92) MEL1 positive rate from the direct plating. In the cases where the targets are abundant in a library, 1 :10,000 ratio (equivalent to 10,000 copies of T targets per 10 ⁸ library cells), both sdY2H and the conventional Y2H approaches produced high 100% MEL1 positive rate suggesting the dominating growth of the cells containing p53/T interaction pairs. These results demonstrated that the employment of the additional surface HA in the sdY2H system greatly reduced the false positive rates (due to the leaky HIS3 reporter expression) and thus improved the screening specificity.

To further determine the identities of positive candidates, colony PCR tests were employed to identify the spiked T target-containing clones and then DNA sequencing on the non-T clones. The PCR results showed that both conventional Y2H and the sdY2H approach successfully recovered T targets, e.g. in the 1 :1 ,000,000 experiment, 6 out of 7 (P), 19 out of 28 (M+P), and 19 out of 27 (M+F+P) clones were found to be T target clones respectively (Table 2, Row5). To identify the candidates that are negative in T antigen PCR test, follow up DNA sequencing was conducted (Table 2, Row 6). The sequencing analysis of the non-T colony in plating experiment yielded the gene PCBP1 (poly(rC) binding protein 1), a RNA binding protein involved in the signal-dependent regulation in transcription, splicing and translation. Since its interaction with p53 is currently unknown, the possibility of a false positive remains. The sequencing of the 9 non-T clones in the sdY2H screen (M+P) revealed that two human proteins, p53 (amino acid residue 206-393) and CKAP5 (amino acid residues 1331-1972). p53 is known to form dimmers and tetramers, and the dimerization domains (amino acid residues 325-356) are highly conserved between the mouse and human p53 proteins (23). Accordingly, the p53 dimer interaction identified from this screen is probably authentic. The CKAP5 protein, cytoskeleton associated protein 5, was previously reported to be in the complex of TACC1-CKAP5-AuroraA, and the p53 is known to be a substrate of AuroraA suggesting the possible interaction of p53 and CKAP5 (24-26). The

identification of genes other than the spiked T targets further validated the sdY2H- mediated screening approach.

One more interesting observation was that the secondary flow sorting after the magnetic enrichment step did not seem to significantly increase the screening specificity in this experiment. For instance, for the experiments of 1 :10,000, 1:100,000, and 1 :1000,000, magnetic sorting had yielded 81/81 , 52/53 and 54/57 positive clones respectively whereas magnetic sorting plus flow sorting approach also yielded similar rates of 64/64, 50/50 and 63/65 respectively. Such data indicated the possibility that the use of nutrient markers in combination with the surface HA markers may be sufficient for the initial target screening from a human cDNA library, and flow cytometric yEGFP analysis can be used for the secondary confirmation of individual targets to replace the conventional MEL1/LacZ assay.

TABLE I

Evaluation of the sdHA-mediated magnetic isolation of rare targets from large excess library cells

Target 1500 600 420 28% (2 ^nd ) 99.997%(2 ^nd )

A library sample containing 1500 targets (AH109-YDC cells containing p53/T) and 10 ⁹ background cells (AH109-YDC cells) was labeled with the HA antibody and subjected to the MACS separation procedure. The cell count for the background and target cells was determined by spreading an aliquot of sample onto YPD and SD-L-T plates respectively. The recovery efficiency was determined by the ratio of the target cell count before and after the MACS separation. The depletion efficiency was determined by the ratio of the background cell count before and after MACS separation.

TABLE Il Comparison of the conventional Y2H and the new sdY2H cDNA library screening

Target/library cell ratio 1 :10,000 1 :100,000 1 :1 ,000,000

Transformants screened (million) 12 4.8 5

P 1260 101 38

Total colonies obtained from M+P 60,000 4,000 560 library screening

M+F+P 44,000 3,200 440

P 135/135 54/92 7/38

Confirmation of candidates by MEL1/α-X-gal colorimetric assay M+P 81/81 52/53 54/57

M+F+P 64/64 50/50 63/65

P 28/30 28/30 6/7

Identification of T targets by T- specific colony PCR analysis M+P 30/30 28/30 19/28

M+F+P 30/30 30/30 19/27

P ND ND 1/7: PCBP1

Identification of non-T targets by DNA sequencing [6/28: p53 M+P ND ND 3/28:CKAP5]

M+F+P ND ND ND

The comparison of the conventional Y2H and the new sdY2H library screening was performed on a set of human HeIa cDNA library samples containing different T antigen target to background ratios of 1 :10,000, 1 :100,000 and 1 : 1 ,000,000. Briefly, 100, 1000, 10000 T target cells were spiked into a pretransformed library cells (~10 ⁸ cfu). After mating with the AH 109- YDC cells containing p53 bait, an aliquot of cells was spread onto the SD-L-T plates for calculating the mating efficiency and the total transformants (Row 2). The rest of library cells were split into two aliquots, one was used for direct plating (P method) and the other was grown in liquid cultures for 24 hours before application to magnetic separation. The cells eluted from the magnetic column were further split into two parts, one was plated on the SD-L-T-H plate (M+P method), and the other one was applied to a flow cytometric sorting. The sorted cells were plated onto the SD-L-T-H plates (M+F+P). The number of colonies grown on SD-L-T-H plate from three different methods was normalized and recorded (Row 3). The secondary confirmation of the candidates was performed by MEL1/a-X-gal analysis (Row 4). The final sequence identification of the candidates was performed by T-specific colony PCR (for the identification of T targets, Row 5) and DNA sequencing (for the identification of non-T targets, Row 6). ND: not determined.

LITERATURE CITED BY REFERENCE NUMBERS

1. Fields, S. & Song, O. (1989) A novel genetic system to detect protein-protein interactions. Nature 340, 245-6. 2. Shioda, T., Andriole, S., Yahata, T. & Isselbacher, K. J. (2000) A green fluorescent protein-reporter mammalian two-hybrid system with extrachromosomal maintenance of a prey expression plasmid: application to interaction screening. Proc Natl Acad Sci U S A 97, 5220-4.

3. Jeong KJ, S. M., Iverson BL and Georgious G (2007) APex 2-hybrid, a quantitative protein-protein interaction assay for antibody discovery and engineering. PNAS 104, 8247-8252.

4. Park, K., Yi, S. Y., Lee, C. S., Kim, K. E., Pai, H. S., Seol, D. W., Chung, B. H. & Kim, M. (2007) A split enhanced green fluorescent protein-based reporter in yeast two-hybrid system. Protein J 26, 107-16. 5. Kuroda, K., Kato, M., Mima, J. & Ueda, M. (2006) Systems for the detection and analysis of protein-protein interactions. Appl Microbiol Biotechnol 71, 127- 36.

6. Parrish, J. R., Gulyas, K. D. & Finley, R. L., Jr. (2006) Yeast two-hybrid contributions to interactome mapping. Curr Opin Biotechnol 17, 387-93. 7. Rual, J. F., Venkatesan, K., Hao, T., Hirozane-Kishikawa, T., Dricot, A., Li, N., Berriz, G. F., Gibbons, F. D., Dreze, M., Ayivi-Guedehoussou, N., Klitgord, N., Simon, C, Boxem, M., Milstein, S., Rosenberg, J., Goldberg, D. S., Zhang, L. V., Wong, S. L., Franklin, G., Li, S., Albala, J. S., Lim, J., Fraughton, C, Llamosas, E., Cevik, S., Bex, C, Lamesch, P., Sikorski, R. S., Vandenhaute, J., Zoghbi, H. Y., Smolyar, A., Bosak, S., Sequerra, R., Doucette-Stamm, L.,

Cusick, M. E., Hill, D. E., Roth, F. P. & Vidal, M. (2005) Towards a proteome- scale map of the human protein-protein interaction network. Nature 437,

1173-8.

8. Li, S., Armstrong, C. M., Bertin, N., Ge, H., Milstein, S., Boxem, M., Vidalain, P. O., Han, J. D., Chesneau, A., Hao, T., Goldberg, D. S., Li, N., Martinez, M.,

Rual, J. F., Lamesch, P., Xu, L., Tewari, M., Wong, S. L., Zhang, L. V., Berriz, G. F., Jacotot, L., Vaglio, P., Reboul, J., Hirozane-Kishikawa, T., Li, Q., Gabel, H. W., Elewa, A., Baumgartner, B., Rose, D. J., Yu, H., Bosak, S., Sequerra,

R., Fraser, A., Mango, S. E., Saxton, W. M., Strome, S., Van Den Heuvel, S., Piano, F., Vandenhaute, J., Sardet, C, Gerstein, M., Doucette-Stamm, L., Gunsalus, K. C ₁ Harper, J. W., Cusick, M. E., Roth, F. P., Hill, D. E. & Vidal, M. (2004) A map of the interactome network of the metazoan C. elegans. Science 303, 540-3.

9. Boder, E. T. & Wittrup, K. D. (1997) Yeast surface display for screening combinatorial polypeptide libraries. Nat Biotechnol 15, 553-7.

10. Boder, E. T. & Wittrup, K. D. (2000) Yeast surface display for directed evolution of protein expression, affinity, and stability. Methods Enzymol 328, 430-44.

11. Cho, B. K., Kieke, M. C ₁ Boder, E. T., Wittrup, K. D. & Kranz, D. M. (1998) A yeast surface display system for the discovery of ligands that trigger cell activation. J Immunol Methods 220, 179-88.

12. Huang, D. & Shusta, E. V. (2005) Secretion and surface display of green fluorescent protein using the yeast Saccharomyces cerevisiae. Biotechnol

Prog 21, 349-57.

13. Huang, D. & Shusta, E. V. (2006) A yeast platform for the production of single-chain antibody-green fluorescent protein fusions. Appl Environ Microbiol 72, 7748-59. 14. Murai, T., Ueda, M., Yamamura, M., Atomi, H., Shibasaki, Y., Kamasawa, N., Osumi, M., Amachi, T. & Tanaka, A. (1997) Construction of a starch-utilizing yeast by cell surface engineering. Appl Environ Microbiol 63, 1362-6.

15. Furukawa, H., Shimojyo, R., Ohnishi, N., Fukuda, H. & Kondo, A. (2003) Affinity selection of target cells from cell surface displayed libraries: a novel procedure using thermo-responsive magnetic nanoparticles. Appl Microbiol

Biotechnol 62, 478-83.

16. Fukuda, N., Ishii, J., Shibasaki, S., Ueda, M., Fukuda, H. & Kondo, A. (2007) High-efficiency recovery of target cells using improved yeast display system for detection of protein-protein interactions. Appl Microbiol Biotechnol 76, 151- 8.

17. Yeung, Y. A. & Wittrup, K. D. (2002) Quantitative screening of yeast surface- displayed polypeptide libraries by magnetic bead capture. Biotechnol Prog 18, 212-20.

18. Wentzel, A., Christmann, A., Kratzner, R. & Kolmar, H. (1999) Sequence requirements of the GPNG beta-turn of the Ecballium elaterium trypsin inhibitor Il explored by combinatorial library screening. J Biol Chem 274, 21037-43. 19. Christmann, A., Walter, K., Wentzel, A., Kratzner, R. & Kolmar, H. (1999) The cystine knot of a squash-type protease inhibitor as a structural scaffold for Escherichia coli cell surface display of conformational^ constrained peptides. Protein Eng W, 797-806.

20. Shibasaki, S., Ueda, M., lizuka, T., Hirayama, M., Ikeda, Y., Kamasawa, N., Osumi, M. & Tanaka, A. (2001) Quantitative evaluation of the enhanced green fluorescent protein displayed on the cell surface of Saccharomyces cerevisiae by fluorometric and confocal laser scanning microscopic analyses. Appl Microbiol Biotechnol 55, 471-5.

21. Chen, J., Zhou, J., Bae, W., Sanders, C. K., Nolan, J. P. & Cai, H. (2008) A yEGFP-based reporter system for high-throughput yeast two-hybrid assay by flow cytometry. Cytometry A 73, 312-20.

22. Soellick, T. R. & Uhrig, J. F. (2001) Development of an optimized interaction- mating protocol for large-scale yeast two-hybrid analyses. Genome Biol 2, RESEARCH 0052. 23. Tarunina, M. & Jenkins, J. R. (1993) Human p53 binds DNA as a protein homodimer but monomeric variants retain full transcription transactivation activity. Oncogene 8, 3165-73.

24. Conte, N., Delaval, B., Ginestier, C, Ferrand, A., Isnardon, D., Larroque, C, Prigent, C, Seraphin, B., Jacquemier, J. & Birnbaum, D. (2003) TACC1- chTOG-Aurora A protein complex in breast cancer. Oncogene 22, 8102-16.

25. Schneider, L., Essmann, F., Kletke, A., Rio, P., Hanenberg, H., Wetzel, W., Schulze-Osthoff, K., Nurnberg, B. & Piekorz, R. P. (2007) The transforming acidic coiled coil 3 protein is essential for spindle-dependent chromosome alignment and mitotic survival. J Biol Chem 282, 29273-83. 26. Ulisse, S., Baldini, E., Toller, M., Delcros, J. G., Gueho, A., Curcio, F., De Antoni, E., Giacomelli, L., Ambesi-lmpiombato, F. S., Bocchini, S., D'Armiento, M. & Arlot-Bonnemains, Y. (2007) Transforming acidic coiled-coil

3 and Aurora-A interact in human thyrocytes and their expression is deregulated in thyroid cancer tissues. Endocr Relat Cancer λA, 827-37.

27. Young, S. M., Bologa, C ₁ Prossnitz, E. R., Oprea, T. I., Sklar, L. A. & Edwards, B. S. (2005) High-throughput screening with HyperCyt flow cytometry to detect small molecule formylpeptide receptor ligands. J Biomol

Screen 10, 374-82.

28. Edwards, B. S., Bologa, C, Young, S. M., Balakin, K. V., Prossnitz, E. R., Savchuck, N. P., Sklar, L. A. & Oprea, T. I. (2005) Integration of virtual screening with high-throughput flow cytometry to identify novel small molecule formylpeptide receptor antagonists. MoI Pharmacol 68, 1301-10.