The present invention relates to compositions, immunogenic or vaccine compositions and pharmaceutical compositions for the prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of equine mammals, preferably of horses, preferably of chronic allergic pruritus, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse.

RELATED ART

Pruritic conditions and allergic conditions are commonly seen in horses (S. D. White, Equine vet. Educ. (2015) 27 (3) 156-166). Pruritus-mediated itching of the skin will, for example, manifest clinically in a dermatitis phenotype and may be of allergic origin. Allergic dermatitis development is poorly understood. Potential factors involved are numerous. Although the potential cause is an allergen, antihistamines, have little effect and do neither cure nor mitigate pruritus and dermatitis (S. D. White, Equine vet. Educ. (2015) 27 (3) 156-166). An underlying allergic cause can be of environmental origin, such as allergens from trees, grass, pollens, molds, fungi, dust mites, dusts, danders, feed (provender) mites, and insects but also from components in the food. Additionally, genetic predispositions are thought to favor pruritus-induced allergic dermatitis (Fadok, Vet Clin North Am Equine Pract 1995, 1:1-10; Fadok, Vet Clin North Am Equine Pract 2013; Yu and Rosychuk 2013, Equine Dermatology, Veterinary Clincis of North America: Equine Practice).

Chronic pruritus is defined by clinical signs of itching lasting longer than six weeks (Ikoma et ak, Nat Rev Neurosci 2006, 7:535-547; Stander et ah, Acta Derm Venereol 2007, 87:291-294). In horses, chronic pruritus causes self-inflicted trauma, alopecia and secondary skin lesions. These lesions have a considerable impact on the quality of life of those affected individuals and often make horses unsound for work. The treatment of chronic pruritus is a serious challenge and depends on its cause. Numerous different causes may lead to the development of chronic allergic pruritus in horses, however often the causative allergen is not known, making chronic pruritus of unknown origin (CPUO) difficult to treat. Given the challenges of identification of the allergic trigger by the limitations of diagnostics, an allergen- independent treatment option is greatly desirable for equines, in particular horses.

Interleukin-31 (IL-31) is preferentially secreted by activated Th2 CD4+ cells, but also from mast cells and macrophages (Dillon et al. Nat Immunol 2004, 5:752-60). Th2 cells play a key role in type I allergic reactions but also have been recently linked to represent the "missing link" in neuro-immune crosstalk between immune cells and sensory nerves in itch. IL-31 belongs to the pgl30/IL-6 cytokine family and binds to a heterodimeric receptor complex composed of IL-31 receptor A (IL-31RA) and oncostatin M receptor beta (OSMRP) subunits (Dillon et al. Nat Immunol 2004, 5:752-60; Bilsborough et al. J Allergy Clin Immunol. 2006 117(2);418-25). Upon ligand binding IL-31 receptor complex activates Janus kinase-signal transducer and activator of transcription (JAK-STAT), mitogen-activated protein kinase (MAPK), and phosphatidylinositol 3-kinase (PI3K) pathways (Zhang et al., Cytokine Growth Factor Rev 2008, 19:347-356). IL-31 can directly bind on its receptor expressed by a small subset of small-sized nociceptive neurons of dorsal root ganglia (DRG), suggesting that this cytokine may directly activate pruritogenic signals in peripheral nerves (Mizuno et al., Vet Immunol Immunopathol 2009, 131:140-143; Sonkoly et al., J Allergy Clin Immunol 2006, 117:411-417). Moreover, the receptor is found on a variety of other cells, such as keratinocytes, macrophages, and eosinophils (Kasraie et al., Allergy 2011, 66:845-852; Kasraie et al., Allergy 2010, 65:712-721; Zhang et al., Cytokine Growth Factor Rev 2008, 19:347-356).

Transgenic mice overexpressing IL-31 developed severe pruritus, alopecia, and skin lesions accompanied by increased inflammatory cell infiltration into the skin (Dillon et al., 2004). An intradermal injection of IL-31 is known to induce itch (scratching) in murine skin (Zhang et al. Cytokine Growth Factor Rev 2008, 19:347-356; Cevikbas J Clin Allergy 2013). Patients with atopic dermatitis (AD) have skin-homing CD45RO+ memory cutaneous lymphocyte-associated antigen (CLA)-positive T cells expressing IL-31 and Th2 cells were found almost exclusively in the dermis. Approximately 60% of Th2 cells were positive for IL- 31, whereas no IL-31 mRNA was found in other immune or resident skin cells such as keratinocytes, endothelial cells, and fibroblasts. The only other source of IL-31 besides Th2 cells were mature dendritic cells, although they produced significantly lower levels compared to Th2 cells (approximately 100-fold) (Cevikbas, J Clin Allergy 2013). Levels of IL-31 mRNA in skin lesions from AD patients are considerably higher than in lesions of healthy patients (Sonkoly et al. J Allergy Clin Immunol 2006; 117:411-7). An antibody against human IL-31 (Bristol-Myres Squibb) for the treatment of itch in AD human patients entered clinical testing in 2012 (www.ClinicalTrials.gov: NCT01614756) and a monoclonal anti-canine IL-31 antibody for the treatment of AD in dogs recently entered the market (Gonzales et al. Vet Dermatol 2013; 24:48-el2; Michels et al. Vet Dermatol 2016; 27:478-el29).

IL-31 induced pruritus is independent of mast cell or basophil degranulation or proteinase-activated receptor-2 (PAR-2)-mediated itch. It seems, thus, that IL-31 -mediated pruritus is not directly associated with type I mechanisms, however, type I allergic events can further increase pruritus, as IL-4 and IL-13 mRNA expression have been correlated to IL-31 mRNA levels in human and canine AD lesions (Nei et al. J. Allergy Clin. Immunol. 2006; 118, 930-937). In line with that it was suggested that IL-31 might be promoting allergic inflammation (Chattopadhyay et al. J Biol Chem 2007; 282:3014-26; Wai et al. Immunology 2007; 122, 532-541).

The current treatments to address pruritic or allergic conditions and disorders of equine mammals, in particular horses, comprise, for example, glucocorticosteroids or other systemically administered steroids. The same holds true for CPUO the current treatment of which relies on symptomatic treatment using a combination of topical and systemic therapies including antihistamines, essential fatty acids, pentoxifylline, and glucocorticoids (Fadok, Vet Clin North Am Equine Pract 1995, 1:1-10; Nowak and Yeung, Can Fam Physician 2017, 63:918-924). Due to the disadvantages such as toxic side-effects, in particular, of these glucocorticosteroids, in particular in long-term treatments, there is an unmet need for alternative treatment options for said conditions and disorders in equine mammals, and in particular horses.

WO 2016/062720 and WO 2017/042212 describe vaccine compositions, in particular vaccine compositions comprising virus-like particles as core particles, and WO 2018/162577 describes vaccine compositions for the prevention or treatment of a pruritic or an allergic condition of equine mammals, preferably of horses.

SUMMARY OF THE INVENTION

Skin biopsies from horses with chronic pruritic skin lesions have surprisingly shown that equine IL-31 mRNA was expressed in skin lesions from sites with pruritus, whereas it was completely absent in healthy horse skin samples from the same horses. Notably, said horses were affected by long history of chronic allergic pruritus in absence of clinical signs for IBH. This is the first time equine IL-31 was detected in pruritic skin lesions of horses in absence of clinical signs of IBH such as eosinophils present in said lesions, and thus it is the first time suggesting a major role of equine IL-31 in the pathology of chronic allergic pruritus in horses. Moreover, it has been surprisingly found that administration of compositions of the present invention comprising equine Interleukin-31 antigens linked to a core particle, preferably to a virus-like particle, to horses affected by long history of chronic allergic pruritus in absence of clinical signs for IBH leads not only to strong induction of auto-antibodies, but, furthermore, the compositions of the present invention are effective for the prevention and treatment of said chronic allergic pruritus. The latter was evidenced by in-vivo studies conducted with such horses suffering from chronic allergic pruritus, notably all-year round. The effectiveness of the inventive compositions are surprisingly independent of the nature and in particular of the occurrence within the season of a possible allergic trigger causing said pruritus or pruritus- associated dermatitis, and thus being effective against chronic allergic pruritus all year-round and even in winter.

Thus, vaccination of horses affected by chronic pruritus, preferably chronic allergic pruritus with the inventive compositions comprising eIL-31 antigens linked to CMV-VLPs led not only to significant decrease of pruritic behavior determined by the visual analogue scale test but, further led to skin healing as evidenced by photographs of the affected skin before and after treatment with the inventive compositions.

Since many horses are typically not only allergic to one single allergen, but rather react against multiple allergens (also due to cross-reactivities of different allergens), an allergen independent therapy which is further independent from seasonal impacts is highly desired to effectively prevent and treat chronic pruritus, preferably chronic allergic pruritus. Moreover, the inventive compositions can be applied as an allergen-independent treatment option for horses with chronic pruritus, preferably chronic allergic pruritus, and in particular of chronic pruritus of unknown origin (CPUO) overcoming the challenges of identifying the allergic trigger.

Therefore, in a first aspect, the present invention provides for a composition comprising:

(a) a core particle with at least one first attachment site; and (b) at least one antigen with at least one second attachment site, wherein said at least one antigen is an equine Interleukin-31 antigen (eIL-31 antigen), wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l; wherein (a) and

(b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond; for use in a method of prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and wherein preferably an effective amount of said composition is administered to said equine mammal, preferably to said horse.

In a preferred embodiment, said condition or disorder is pruritus, preferably chronic pruritus, of an equine mammal, preferably of a horse. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with allergic dermatitis or pruritus associated with atopic dermatitis. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with allergic dermatitis. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with atopic dermatitis. In a preferred embodiment, said condition or disorder is chronic allergic pruritus, of an equine mammal, preferably of a horse. In a further preferred embodiment, said condition or disorder is chronic pruritus of unknown origin (CPUO).

In a further preferred embodiment, said condition or disorder is pruritus, preferably chronic pruritus, further preferably chronic allergic pruritus, of an equine mammal, preferably of a horse, wherein said pruritus is associated with a pruritic condition or an allergic condition, wherein preferably said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, allergic dermatitis, alopecia, bacterial folliculitis, dermatophytosis, recurrent urticaria, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper-responsiveness, chronic obstruction pulmonary disease, and inflammatory processes resulting from autoimmunity, and wherein further preferably said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, pruritus, allergic dermatitis and recurrent urticaria, and wherein again further preferably an effective amount of said composition is administered to said equine mammal, preferably to said horse. In a preferred embodiment, said pruritus is pruritus associated with allergic dermatitis or pruritus associated with atopic dermatitis.

Thus, in a further aspect, the present invention provides for a composition comprising:

(a) a core particle with at least one first attachment site; and (b) at least one antigen with at least one second attachment site, wherein said at least one antigen is an equine Interleukin-31 antigen (eIL-31 antigen), wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l; wherein (a) and

(b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond; for use in a method of prevention or treatment of a condition or disorder, wherein said condition or disorder is chronic pruritus, preferably chronic allergic pruritus, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and wherein preferably an effective amount of said composition is administered to said equine mammal, preferably to said horse.

In a further aspect, the present invention provides for a composition comprising: (a) a core particle with at least one first attachment site; and (b) at least one antigen with at least one second attachment site, wherein said at least one antigen is an equine Interleukin-31 antigen (eIL-31 antigen), wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond; for use in a method of prevention or treatment of chronic pruritus of unknown origin (CPUO) of an equine mammal, preferably of a horse.

In a further aspect, the present invention provides for a method of prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and wherein said method comprises administering the composition of the invention or the pharmaceutical composition of the invention to an equine mammal, preferably to a horse.

In a further aspect, the present invention provides for a method of prevention or treatment of pruritus, preferably chronic pruritus, further preferably chronic allergic pruritus, of an equine mammal, preferably of a horse, wherein preferably said pruritus is associated with a pruritic condition or an allergic condition, wherein said method comprises administering the composition of the invention or the pharmaceutical composition of the invention to an equine mammal, preferably to a horse.

In a further aspect, the present invention provides for a method of prevention or treatment of chronic pruritus of unknown origin (CPUO) of an equine mammal, preferably of a horse, wherein said method comprises administering the composition of the invention or the pharmaceutical composition of the invention to an equine mammal, preferably to a horse.

In another aspect, the present invention provides for the use of the composition of the invention or the pharmaceutical composition of the invention for the manufacture of a medicament for the prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and wherein typically and preferably an effective amount of said inventive composition or said inventive pharmaceutical composition is administered to an equine mammal, preferably to a horse.

In another aspect, the present invention provides for the use of the inventive composition or said inventive pharmaceutical composition for the manufacture of a medicament for the prevention or treatment of pruritus, preferably chronic pruritus, further preferably chronic allergic pruritus, of an equine mammal, preferably of a horse, wherein preferably said pruritus is associated with a pruritic condition or an allergic condition, wherein typically and preferably an effective amount of said inventive composition or said inventive pharmaceutical composition is administered to an equine mammal, preferably to a horse.

Further aspects and embodiments of the present invention will become apparent as this description continues.

DESCRIPTION OF FIGURES

FIG. 1 : Skin punch biopsies from three different horses affected by CPUO, a pruritic and allergic dermatitis conditions that could not be explained by IBH; two biopsies per horse, one from a lesion with pruritus associated skin lesion, one from a non-lesional healthy skin part. Levels of eIL-31 expression relative to ePactin levels (in % eIL-31 of ePactin) in skin punch biopies from pruritic skin lesions (+) and matched healthy skin (-) of the same horse. No detection in healthy skin (-), n=2. Dashed line shows cutoff value for limit of detection.

FIG. 2A: SDS-PAGE of eIL-31-C-His purification and refolding. Samples from various stages of the inclusion body preparation and purification were applied to a 4-12% Bis-Tris Gel (NuPAGE, Novex, Invitrogen Life Technologies) and run under reducing conditions. Proteins were stained with Coomassie blue. Lane M, Size Marker, lane 1, Lysate, lane 2, soluble fraction, lane 3, solubilized inclusion bodies, lane 4, flow-through (unbound material), lane 5, pooled eIL-31 monomer eluate from Ni-NTA column, lane 6, pooled eIL-31 monomer and dimer after refolding and size exclusion chromatography, lane 7, same as lane 6 run under native conditions, lane 8, eukaryotic e-IL-31-C- Strep. I, eIL-31, m (E.coli); II, eIL-31, d (E.coli); III, eIL-31, m (HEK); IV, eIL-31, d (HEK); x-axis, protein size in kDa.

FIG. 2B: Integrity of refolded recombinant eIL-31-C-His. Far-UV circular dichroism (CD) spectrum of purified eIL-31-C-Tag from E.coli and eukaryotic HEK cells. Grey line, 1, eIL-31 (HEK); Black line, 2, eIL-31-m (E.coli); Light grey line, 3, eIL-31-d (E.coli); x-axis, wavelength; y-axis, (0) _MR w(deg cm ² dmol ¹ ).

FIG. 3 A: Analysis of coupling reaction of eIL-31-C-His-CMVtt830. By SDS-PAGE. Proteins were stained with Coomassie blue: eIL-31 monomer (I), CMVtt830 monomer (II), coupling (III). Lane M, Size Marker, lane 2, TCEP activated eIL-31-C-His, lane 3, CMVtt830- VLP after derivatization with the chemical crosslinker SMPH, lane 4, eIL-3 l-C-His-CMVtt830 coupling reaction, lane 5, eåL-31-C-His-CMVtt830 vaccine post size exclusion chromatography (SEC), lane 6, free eIL-31 removed from eIL-31-C-His-CMVtt830 vaccine during SEC. eåL-31-C-His,CMVtt830, and eåL-31-CMVtt830 were loaded equimolar. X-axis, protein size in kDa.

FIG. 3B: Analysis of coupling reaction of eIL-31-C-His-CMVtt830. By Western-blot. Stained with a-His antibody: eIL-31 monomer (I), eIL-31 dimer (II), coupling (III). Lane M, Size Marker, lane 2, TCEP activated eIL-31-C-His, lane 3, CMVtt830-VLP after derivatization with the chemical crosslinker SMPH, lane 4, eåL-31-C-His-CMVtt830 coupling reaction, lane 5, eåL-31-C-His-CMVtt830 vaccine post size exclusion chromatography (SEC), lane 6, free eIL-31 removed from eIL-31-C-His-CMVtt830 vaccine during SEC. eIL-31-C-His, CMVtt830, and eIL-31-C-His-CMVtt830 were loaded equimolar. X-axis, protein size in kDa.

FIG. 4A: ELISA of Antibody titer in horses from sera. Pre-immune and serum after 2 ^nd vaccination (days 42, 93, and 118) with eIL-3 l-C-His-QP vaccines of one horse was collected. Sera were analyzed for antibodies against eIL-31. Horse has been immunized on days 0 and 19 by eIL-31 -C-His-Qp. Data shows OD50 values for sera subtracted by pre-immune values.

FIG 4B: ELISA of Antibody titer in pruritic horses from sera. Antibody titer of anti- CMVtt830 IgG (open circle) and anti-eIL-31 IgG (filled circle) for horse I. to IV. (see FIG. 5A- 5D) upon vaccination with eIL-31-C-His-CMVtt830 at time point of 1 ^st vaccination (I), post 2 ^nd vaccination (II), at time point of 3 ^rd injection (III) and post 3 ^rd vaccination (IV). All antibody titers are calculated with naive serum subtracted on logarithmic scales, limit of detection are titers < 10. Y-axis shows OD50 anti-IL-31/CMVtt830 IgG antibody titer.

FIG. 5 A: Pruritic skin lesions before and after vaccination, horse I. 1., 3. Skin photographs from day of 1 ^st vaccination. Pruritic skin lesion sites at buttock (1) and neck (3). 2., 4. Skin photographs from five weeks post 2 ^nd vaccination of the same locations at buttock (2) and neck (4).

FIG. 5B: Pruritic skin lesions before and after vaccination, horse II. 1., 3, 5. Skin photographs from day of 1 ^st vaccination. Pruritic sites at neck (1), thigh (3) and cheek (5). 2., 4., 6. Skin photographs from four weeks post 2 ^nd vaccination at neck (2), cheek (4) and thigh (6)·

FIG. 5C: Pruritic skin lesions before and after vaccination, horse III. 1., 4., 7. Skin photographs from day of 1 ^st vaccination at mane (1), tail (4) and back (7). 2., 5. Skin photographs prior 3 ^rd injection at mane (2) and tail (5). 3., 6., 8. Skin photographs post 3 ^rd vaccination at mane (3), tail (6), back (8).

FIG. 5D: Reduction of corticosteroids in horse IV. Oral application of daily oral prednisolone (Prednisolon, Vetoquinol, y-axis, Prednisolon (mg/day)). Vaccinations are indicated by arrows. X-axis: weeks; y-axis: Prednisolon (mg/day).

FIG. 6: Evaluation of pruritus before and after vaccination by horse owners. Pruritic behavior before vaccination (1) and improvement of pruritic behavior after the 3 ^rd vaccination (2) according to visual analogue scale filled out by horse owners. 1, pre vaccination; 2, post vaccination; y-axis: Pruritic Behavior (0-10).

DETAILED DESCRIPTION OF THE INVENTION

Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs.

Virus-like particle (VLP): The term “virus-like particle (VLP)” as used herein, refers to a non-replicative or non-infectious, preferably a non-replicative and non-infectious virus particle, or refers to a non-replicative or non-infectious, preferably a non-replicative and non- infectious structure resembling a virus particle, preferably a capsid of a virus. The term “non- replicative”, as used herein, refers to being incapable of replicating the genome comprised by the VLP. The term “non-infectious”, as used herein, refers to being incapable of entering the host cell. A virus-like particle in accordance with the invention is non-replicative and non- infectious since it lacks all or part of the viral genome or genome function. A virus-like particle in accordance with the invention may contain nucleic acid distinct from their genome. Recombinantly produced virus-like particles typically contain host cell derived RNA. A typical and preferred embodiment of a virus-like particle in accordance with the present invention is a viral capsid composed of polypeptides of the invention. A virus-like particle is typically a macromolecular assembly composed of viral coat protein which typically comprises 60, 120, 180, 240, 300, 360, or more than 360 protein subunits per virus-like particle. Typically and preferably, the interactions of these subunits lead to the formation of viral capsid or viral-capsid like structure with an inherent repetitive organization. One feature of a virus-like particle is its highly ordered and repetitive arrangement of its subunits.

Virus-like particle of an RNA bacteriophage: As used herein, the term “virus-like particle of an RNA bacteriophage” refers to a virus-like particle comprising, or preferably consisting essentially of or consisting of coat proteins, mutants or fragments thereof, of an RNA bacteriophage. In addition, virus-like particle of an RNA bacteriophage resembling the structure of an RNA bacteriophage, being non replicative and/or non-infectious, and lacking at least the gene or genes encoding for the replication machinery of the RNA bacteriophage, and typically also lacking the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. Also included are virus-like particles of RNA bacteriophages, in which the aforementioned gene or genes are still present but inactive, and, therefore, also leading to non-replicative and/or non-infectious virus-like particles of an RNA bacteriophage. Preferred VLPs derived from RNA bacteriophages exhibit icosahedral symmetry and consist of 180 subunits (monomers). Preferred methods to render a virus-like particle of an RNA bacteriophage non replicative and/or non-infectious is by physical, chemical inactivation, such as UV irradiation, formaldehyde treatment, typically and preferably by genetic manipulation.

Virus-like particle of CMV: The terms "virus-like particle of CMV "or CMV VLPs refer to a virus-like particle comprising, or preferably consisting essentially of, or preferably consisting of at least one CMV polypeptide. Preferably, a virus-like particle of CMV comprises said CMV polypeptide as the major, and even more preferably as the sole protein component of the capsid structure. Typically and preferably, virus-like particles of CMV resemble the structure of the capsid of CMV. Virus-like particles of CMV are non-replicative and/or non- infectious, and lack at least the gene or genes encoding for the replication machinery of the CMV, and typically also lack the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. This definition includes also virus-like particles in which the aforementioned gene or genes are still present but inactive. Preferred methods to render a virus-like particle of CMV non replicative and/or non-infectious is by physical or chemical inactivation, such as UV irradiation, formaldehyde treatment. Preferably, VLPs of CMV lack the gene or genes encoding for the replication machinery of the CMV, and also lack the gene or genes encoding the protein or proteins responsible for viral attachment to or entry into the host. Again more preferably, non-replicative and/or non-infectious virus-like particles are obtained by recombinant gene technology. Recombinantly produced virus-like particles of CMV according to the invention typically and preferably do not comprise the viral genome. Vims-like particles comprising more than one species of polypeptides, often referred to as mosaic VLPs are also encompassed by the invention. Thus, in one embodiment, the vims-like particle according to the invention comprises at least two different species of polypeptides, wherein at least one of said species of polypeptides is a CMV polypeptide. Preferably, a VLP of CMV is a macromolecular assembly composed of CMV coat protein which typically comprises 180 coat protein subunits per VLP. Typically and preferably, a VLP of CMV as used herein, comprises, essentially consists of, or alternatively consists of, at least one CMV polypeptide comprising or preferably consisting of (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.

Antigen: As used herein, the term “antigen” refers to a molecule capable of being bound by an antibody or a T-cell receptor (TCR) if presented by MHC molecules. The term “antigen”, as used herein, also refers to T-cell epitopes. An antigen is additionally capable of being recognized by the immune system and/or being capable of inducing a humoral immune response and/or cellular immune response leading to the activation of B- and/or T-lymphocytes. This may, however, require that, at least in certain cases, the antigen contains or is linked to a Th cell epitope and/or is given in adjuvant. An antigen can have one or more epitopes (B- and T-epitopes). The specific reaction referred to above is meant to indicate that the antigen will preferably react, typically in a highly selective manner, with its corresponding antibody or TCR and not with the multitude of other antibodies or TCRs which may be evoked by other antigens. If not indicated otherwise, the term “antigen” as used herein does not refer to the core particle or virus-like particle contained in the inventive compositions, immunogenic or vaccine compositions and/or pharmaceutical compositions.

Coat protein: The term “coat protein” refers to a viral protein, preferably to a subunit of a natural capsid of a virus, preferably of an RNA bacteriophage or a plant virus, which is capable of being incorporated into a virus capsid or a VLP. The term coat protein encompasses naturally occurring coat protein as well as recombinantly expressed coat protein. Further encompassed are mutants and fragments of coat protein, wherein said mutants and fragments retains the capability of forming a VLP.

Polypeptide: The term “polypeptide” as used herein refers to a polymer composed of amino acid monomers which are linearly linked by peptide bonds (also known as amide bonds). The term polypeptide refers to a consecutive chain of amino acids and does not refer to a specific length of the product. Thus, peptides, and proteins are included within the definition of polypeptide.

Cucumber Mosaic Virus (CMV) polypeptide: The term “cucumber mosaic virus (CMV) polypeptide” as used herein refers to a polypeptide comprising or preferably consisting of: (i) an amino acid sequence of a coat protein of cucumber mosaic virus (CMV), or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated, i.e. said coat protein of CMV, show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%. Typically and preferably, the CMV polypeptide is capable of forming a virus like particle of CMV upon expression by self-assembly.

Coat protein (CP) of cucumber mosaic virus (CMV): The term “coat protein (CP) of cucumber mosaic virus (CMV)”, as used herein, refers to a coat protein of the cucumber mosaic virus which occurs in nature. Due to extremely wide host range of the cucumber mosaic virus, a lot of different strains and isolates of CMV are known and the sequences of the coat proteins of said strains and isolates have been determined and are, thus, known to the skilled person in the art as well. The sequences of said coat proteins (CPs) of CMV are described in and retrievable from the known databases such as Genbank, www.dpyweb.net. or www.ncbi.nlm.nih.gov/protein/. Examples are described in EP Application No. 14189897.3. Further examples of CMV coat proteins are provided in SEQ ID NOs 10-12. It is noteworthy that these strains and isolates have highly similar coat protein sequences at different protein domains, including the N-terminus of the coat protein. In particular, 98.1% of all completely sequenced CMV isolates share more than 85% sequence identity within the first 28 amino acids of their coat protein sequence, and still 79.5% of all completely sequenced CMV isolates share more than 90% sequence identity within the first 28 amino acids of their coat protein sequence. Typically and preferably, the coat protein of CMV used for the present invention is capable of forming a virus-like particle of CMV upon expression by self-assembly. Preferably, the coat protein of CMV used for the present invention is capable of forming a virus-like particle of CMV upon expression by self-assembly mE.coli.

Modified virus-like particle (VLP) of cucumber mosaic virus (CMV): The term “modified virus-like particle (VLP) of cucumber mosaic virus (CMV)” as used herein, refers to a VLP of CMV which is a modified one in such as it comprises, or preferably consists essentially of, or preferably consists of at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, a CMV polypeptide, and a T helper cell epitope. Typically and preferably, said T helper cell epitope (i) is fused to the N- terminus of said CMV polypeptide, (ii) is fused to the C-terminus of said CMV polypeptide, (iii) replaces a region of consecutive amino acids of said CMV polypeptide, wherein the sequence identity between said replaced region of consecutive amino acids of said CMV polypeptide and the T helper cell epitope is at least 15%, preferably at least 20%, or (iv) replaces aN-terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids. Preferably, said T helper cell epitope replaces a N-terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids, preferably of 9 to 14 consecutive amino acids, more preferably of 11 to 13 consecutive amino acids, and most preferably of 11, 12 or 13 consecutive amino acids. Preferably said modified VLP of CMV of the present invention is a recombinant modified VLP of CMV.

Modified CMV polypeptide: The term “modified CMV polypeptide” as used herein refers to a CMV polypeptide modified in such as defined herein, that said modified CMV polypeptide comprises, or preferably consists of, a CMV polypeptide, and a T helper cell epitope. Typically, the modified CMV polypeptide is capable of forming a virus-like particle of CMV upon expression by self-assembly. Preferably, the modified CMV polypeptide is a recombinant modified CMV polypeptide and is capable of forming a virus-like particle of CMV upon expression by self-assembly mE.coli.

N-terminal region of the CMV polypeptide: The term “N-terminal region of the CMV polypeptide” as used herein, refers either to the N-terminus of said CMV polypeptide, and in particular to the N-terminus of a coat protein of CMV, or to the region of the N-terminus of said CMV polypeptide or said coat protein of CMV but starting with the second amino acid of the N-terminus of said CMV polypeptide or said coat protein of CMV if said CMV polypeptide or said coat protein comprises a N-terminal methionine residue. Preferably, in case said CMV polypeptide or said coat protein comprises a N-terminal methionine residue, from a practical point of view, the start-codon encoding methionine will usually be deleted and added to the N- terminus of the Th cell epitope. Further preferably, one, two or three additional amino acids, preferably one amino acid, may be optionally inserted between the stating methionine and the Th cell epitope for cloning purposes. The term “N-terminal region of the mutated amino acid sequence of a CMV polypeptide or a CMV coat protein” as used herein, refers either to the N- terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV, or to the region of the N-terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV but starting with the second amino acid of the N- terminus of said mutated amino acid sequence of said CMV polypeptide or said coat protein of CMV if said mutated amino acid sequence comprises a N-terminal methionine residue. Preferably, in case said CMV polypeptide or said coat protein comprises a N-terminal methionine residue, from a practical point of view, the start-codon encoding methionine will usually be deleted and added to the N-terminus of the Th cell epitope. Further preferably, one, two or three additional amino acids, preferably one amino acid, may be optionally inserted between the stating methionine and the Th cell epitope for cloning purposes.

Recombinant polypeptide: In the context of the invention the term "recombinant polypeptide" refers to a polypeptide which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably, a recombinant polypeptide is produced in a prokaryotic expression system. It is apparent for the artisan that recombinantly produced polypeptides which are expressed in a prokaryotic expression system such as E. coli may comprise an N-terminal methionine residue. The N-terminal methionine residue is typically cleaved off the recombinant polypeptide in the expression host during the maturation of the recombinant polypeptide. However, the cleavage of the N-terminal methionine may be incomplete. Thus, a preparation of a recombinant polypeptide may comprise a mixture of otherwise identical polypeptides with and without an N-terminal methionine residue. Typically and preferably, a preparation of a recombinant polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant polypeptide with an N-terminal methionine residue.

Recombinant CMV polypeptide: The term “recombinant CMV polypeptide” refers to a CMV polypeptide as defined above which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably a preparation of a recombinant CMV polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant CMV polypeptide with an N-terminal methionine residue. Consequently, a recombinant virus-like particle of the invention may comprise otherwise identical recombinant polypeptides with and without an N-terminal methionine residue.

Recombinant modified CMV polypeptide: The term “recombinant modified CMV polypeptide” refers to a modified CMV polypeptide as defined above which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably a preparation of a recombinant modified CMV polypeptide comprises less than 10 %, more preferably less than 5 %, and still more preferably less than 1 % recombinant modified CMV polypeptide with an N-terminal methionine residue. Consequently, a recombinant virus like particle of the invention may comprise otherwise identical recombinant polypeptides with and without an N-terminal methionine residue.

Recombinant virus-like particle: In the context of the invention the term "recombinant virus-like particle" refers to a virus-like particle (VLP) which is obtained by a process which comprises at least one step of recombinant DNA technology. Typically and preferably a recombinant VLP is obtained by expression of a recombinant viral coat protein in host, preferably in a bacterial cell. Typically and preferably, a recombinant virus-like particle comprises at least one recombinant polypeptide, preferably a recombinant CMV polypeptide or recombinant modified CMV polypeptide. Most preferably, a recombinant virus-like particle is composed of or consists of recombinant CMV polypeptides or recombinant modified CMV polypeptides. As a consequence, if in the context of the present invention the definition of inventive recombinant VLPs are effected with reference to specific amino acid sequences comprising a N-terminal methionine residue the scope of these inventive recombinant VLPs encompass the VLPs formed by said specific amino acid sequences without said N-terminal methionine residue but as well, even though typically in a minor amount as indicated herein, the VLPs formed by said specific amino acid sequences with said N-terminal methionine. Furthermore, it is within the scope of the present invention that if the definition of inventive recombinant VLPs are effected with reference to specific amino acid sequences comprising a N-terminal methionine residue VLPs are encompassed comprising both amino acid sequences comprising still said N-terminal methionine residue and amino acid sequences lacking the N- terminal methionine residue.

Mutated amino acid sequence: The term "mutated amino acid sequence" refers to an amino acid sequence which is obtained by introducing a defined set of mutations into an amino acid sequence to be mutated. In the context of the invention, said amino acid sequence to be mutated typically and preferably is an amino acid sequence of a coat protein of CMV. Thus, a mutated amino acid sequence differs from an amino acid sequence of a coat protein of CMV in at least one amino acid residue, wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 90 %. Typically and preferably said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 91 %, 92 %, 93 % 94 %, 95 %, 96 %, 97 %, 98 %, or 99 %. Preferably, said mutated amino acid sequence and said sequence to be mutated differ in at most 11, 10, 9, 8, 7, 6, 4, 3, 2, or 1 amino acid residues, wherein further preferably said difference is selected from insertion, deletion and amino acid exchange. Preferably, the mutated amino acid sequence differs from an amino acid sequence of a coat protein of CMV in least one amino acid, wherein preferably said difference is an amino acid exchange.

Position corresponding to residues...: The position on an amino acid sequence, which is corresponding to given residues of another amino acid sequence can be identified by sequence alignment, typically and preferably by using the BLASTP algorithm, most preferably using the standard settings. Typical and preferred standard settings are: expect threshold: 10; word size: 3; max matches in a query range: 0; matrix: BLOSUM62; gap costs: existence 11, extension 1; compositional adjustments: conditional compositional score matrix adjustment.

Sequence identity: The sequence identity of two given amino acid sequences is determined based on an alignment of both sequences. Algorithms for the determination of sequence identity are available to the artisan. Preferably, the sequence identity of two amino acid sequences is determined using publicly available computer homology programs such as the “BLAST” program (http://blast.ncbi.nlm.nih.gov/Blast.cgi) or the “CLUSTALW” (http://www.genome.ip/tools/clustalw/). and hereby preferably by the “BLAST” program provided on the NCBI homepage at http://blast.ncbi.nlm.nih.gov/Blast.cgi. using the default settings provided therein. Typical and preferred standard settings are: expect threshold: 10; word size: 3; max matches in a query range: 0; matrix: BLOSUM62; gap costs: existence 11, extension 1; compositional adjustments: conditional compositional score matrix adjustment.

Amino acid exchange: The term amino acid exchange refers to the exchange of a given amino acid residue in an amino acid sequence by any other amino acid residue having a different chemical structure, preferably by another proteinogenic amino acid residue. Thus, in contrast to insertion or deletion of an amino acid, the amino acid exchange does not change the total number of amino acids of said amino acid sequence. Very preferred in the context of the invention is the exchange of an amino acid residue of said amino acid sequence to be mutated by a lysine residue or by a cysteine residue.

Epitope: The term epitope refers to continuous or discontinuous portions of an antigen, preferably a polypeptide, wherein said portions can be specifically bound by an antibody or by a T-cell receptor within the context of an MHC molecule. With respect to antibodies, specific binding excludes non-specific binding but does not necessarily exclude cross-reactivity. An epitope typically comprise 5-20 amino acids in a spatial conformation which is unique to the antigenic site.

T helper (Th) cell epitope: The term “T helper (Th) cell epitope” as used herein refers to an epitope that is capable of recognition by a helper Th cell. In another preferred embodiment, said T helper cell epitope is a universal T helper cell epitope.

Universal Th cell epitope: The term “universal Th cell epitope” as used herein refers to a Th cell epitope that is capable of binding to at least one, preferably more than one MHC class II molecules. The simplest way to determine whether a peptide sequence is a universal Th cell epitope is to measure the ability of the peptide to bind to individual MHC class II molecules. This may be measured by the ability of the peptide to compete with the binding of a known Th cell epitope peptide to the MHC class II molecule. A representative selection of HLA-DR molecules are described in e.g. Alexander J, et al., Immunity (1994) 1:751-761. Affinities of Th cell epitopes for MHC class II molecules should be at least 10 ⁵ M. An alternative, more tedious but also more relevant way to determine the “universality” of a Th cell epitope is the demonstration that a larger fraction of people (>30%) generate a measurable T cell response upon immunization and boosting one months later with a protein containing the Th cell epitope formulated in IFA. A representative collection of MHC class II molecules present in different individuals is given in Panina-Bordignon P, et al., Eur J Immunol (1989) 19:2237-2242. As a consequence, the term “universal Th cell epitope” as used herein preferably refers to a Th cell epitope that generates a measurable T cell response upon immunization and boosting (one months later with a protein containing the Th cell epitope formulated in IFA) in more than 30% of a selected group of individuals as described in Panina-Bordignon P, et al., Eur J Immunol (1989) 19:2237-2242. Moreover, and again further preferred, the term “universal Th cell epitope” as used herein preferably refers to a Th cell epitope that is capable of binding to at least one, preferably to at least two, and even more preferably to at least three DR alleles selected from of DR1, DR2w2b, DR3, DR4w4, DR4wl4, DR5, DR7, DR52a, DRw53, DR2w2a; and preferably selected from DR1, DR2w2b, DR4w4, DR4wl4, DR5, DR7, DRw53, DR2w2a, with an affinity at least 500nM (as described in Alexander J, et al., Immunity (1994) 1:751-761 and references cited herein); a preferred binding assay to evaluate said affinities is the one described by Sette A, et al., J Immunol (1989) 142:35-40. In an even again more preferable manner, the term “universal Th cell epitope” as used herein refers to a Th cell epitope that is capable of binding to at least one, preferably to at least two, and even more preferably to at least three DR alleles selected from DR1, DR2w2b, DR4w4, DR4wl4, DR5, DR7, DRw53, DR2w2a, with an affinity at least 500nM (as described in Alexander J, et al., Immunity (1994) 1:751-761 and references cited herein); a preferred binding assay to evaluate said affinities is the one described by Sette A, et al., J Immunol (1989) 142:35-40.

Universal Th cell epitopes are described, and known to the skilled person in the art, such as by Alexander J, et al., Immunity (1994) 1:751-761, Panina-Bordignon P, et al., Eur J Immunol (1989) 19:2237-2242, Calvo-Calle JM, et al., J Immunol (1997) 159:1362-1373, and Valmori D, et al., J Immunol (1992) 149:717-721.

Adjuvant: The term "adjuvant" as used herein refers to non-specific stimulators of the immune response or substances that allow generation of a depot in the host which when combined with the vaccine and pharmaceutical composition, respectively, of the present invention may provide for an even more enhanced immune response. Preferred adjuvants are complete and incomplete Freund's adjuvant, aluminum containing adjuvant, preferably aluminum hydroxide, and modified muramyl dipeptide. Further preferred adjuvants are mineral gels such as aluminum hydroxide, surface active substances such as lyso lecithin, pluronic polyols, polyanions, peptides, oil emulsions, keyhole limpet hemocyanins, dinitrophenol, and human adjuvants such as BCG (bacille Calmette Guerin) and Corynebacterium parvum. Such adjuvants are also well known in the art. Further adjuvants that can be administered with the compositions of the invention include, but are not limited to, Monophosphoryl lipid immunomodulator, AdjuVax 100a, QS-21, QS-18, CRL1005, Aluminum salts (Alum), MF-59, OM- 174, OM- 197, OM-294, and Virosomal adjuvant technology. The adjuvants may also comprise mixtures of these substances. Virus-like particles have been generally described as an adjuvant. However, the term "adjuvant", as used within the context of this application, refers to an adjuvant not being the inventive virus-like particle. Rather "adjuvant" relates to an additional, distinct component of the inventive compositions, vaccines or pharmaceutical compositions.

The term "allergic condition" is defined herein as a disorder or disease caused by an interaction between the immune system and a substance foreign to the body. This foreign substance is termed "an allergen". Common allergens include aeroallergens, such as pollens, dust, molds, dust mite proteins, injected saliva from insect bites, etc. Examples of allergic conditions include, but are not limited to, the following: allergic dermatitis, recurrent urticaria, pruritus, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper responsiveness, chronic obstructive pulmonary disease, and inflammatory processes resulting from autoimmunity, such as Irritable bowel syndrome (IBS).

The term "pruritic condition" is defined herein as a disease or disorder characterized by an intense itching sensation that produces the urge to rub or scratch the skin to obtain relief. Examples of pruritic conditions include, but are not limited to the following: atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

The term "pruritus" is known to the person skilled in the art. It is a condition characterised by an unpleasant skin sensation, leading to the desire to scratch. "Pruritus" can be a symptom of many diseases, disease states, or disorders. It may also be present independently of a disease, disease state, or disorder. The term "pruritus" includes itch, or pruritus, wherein the cause of the itch or pruritus is associated with or due to a disorder, disease or disease state, and includes itch or pruritus wherein the cause or origin is not understood.

The term "associated with" includes cases wherein both pruritus and the disease or disorder are present, and a link between them is suspected but not proven.

Chronic pruritus: The term “chronic pruritus”, as used herein, refers to pruritus lasting 6 or more weeks. In a preferred embodiment, chronic pruritus refers typically and preferably to self-inflicted trauma caused by chronic itching of skin and includes recurrent and chronic pruritus, characterized by periodical reoccurrence of pruritic episodes or persistent pruritus for longer than 6 weeks.

Chronic pruritic condition or disorder: The term “chronic pruritic condition or disorder”, as used herein, refers to chronic pruritic conditions associated with typically and preferably atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

Chronic allergic pruritus: The term “chronic allergic pruritus”, as used herein, refers to “chronic pruritus” associated with and potentially of an allergic origin.

Chronic pruritus of unknown origin (CPUO): The term “chronic pruritus of unknown origin (CPUO)”, as used herein, refers to chronic pruritus with no knowledge of the underlying origin. Preferably, the term “chronic pruritus of unknown origin (CPUO)”, as used herein refers to chronic pruritus with no finding of the underlying origin following completion of diagnostic tests (Stander et ah, Acta Derm Venereol 2007, 87:291-294).

Effective amount: As used herein, the term “effective amount” refers to an amount of an active ingredient, typically and preferably a composition in accordance with the present invention, sufficient to effect beneficial or desired results when administered to an equine mammal, preferably to a horse. An effective amount can be administered in one or more administrations, applications or dosages. An effective amount of the composition, or alternatively the pharmaceutical composition, would be the amount that achieves this selected result, and such an amount could be determined as a matter of routine by a person skilled in the art. Preferably, the term “effective amount”, as used herein, refers to an amount that produces an objectively measured change in one or more parameter associated with the prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse. Again further preferably, said one or more parameter associated with the prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition is the level or severity grade of skin lesions or the level of pruritus. Again further preferably, said reduction of said level or severity grade of skin lesions is determined by a symptom lesion scoring test and said reduction of said level of pruritus is determined by a pruritus scoring test. The effective amount can vary depending upon the particular equine mammal, preferably the horse, and condition being treated, the weight and age of the equine mammal, preferably the horse, the severity of the disease condition, the particular composition chosen, the dosing regimen to be followed, timing of administration, the manner of administration and the like, all of which can readily be determined by one of ordinary skill in the art without necessitating undue experimentation.

Treatment: As used herein, the terms “treatment”, “treat”, “treated” or “treating” refer to prophylaxis and/or therapy. In one embodiment, the terms “treatment”, “treat”, “treated” or “treating” refer to a therapeutic treatment. In another embodiment, the terms “treatment”, “treat”, “treated” or “treating” refer to a prophylactic treatment. Typically and preferably, equine mammals, preferably horses, in need of treatment include those already with the disorder as well as those in which the disorder is to be prevented. Thus, preferably, the terms “treatment”, “treat”, “treated” or “treating” of a disease, condition or disorder in accordance with the present invention, includes preventing or protecting against the disease, condition or disorder (that is, causing the symptoms not to develop); inhibiting the disease, condition or disorder (i.e., arresting or suppressing the development of symptoms; and/or relieving the disease, condition or disorder (i.e., causing the regression of symptoms). As will be appreciated, it is not always possible to distinguish between "preventing" and "suppressing" a disease, condition or disorder since the ultimate inductive event or events may be unknown or latent. Accordingly, the term "prophylaxis" will be understood to constitute a type of "treatment" that encompasses both "preventing" and "suppressing." The term "treatment" thus includes "prophylaxis". The term "prophylaxis" as used herein refers to means of preventing or delaying the onset of disease or condition and/or symptoms attributed to the disease or condition.

Attachment Site, First: As used herein, the phrase "first attachment site" refers to an element which is naturally occurring with the virus-like particle or which is artificially added to the virus-like particle, and to which the second attachment site may be linked. The first attachment site preferably is a protein, a polypeptide, an amino acid, a peptide, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof. A preferred embodiment of a chemically reactive group being the first attachment site is the amino group of an amino acid residue, preferably of a lysine residue. The first attachment site is typically located on the surface, and preferably on the outer surface of the VLP. Multiple first attachment sites are present on the surface, preferably on the outer surface of the VLP, typically in a repetitive configuration. In a preferred embodiment the first attachment site is associated with the VLP, through at least one covalent bond, preferably through at least one peptide bond. In a further preferred embodiment the first attachment site is naturally occurring with the VLP. Alternatively, in a preferred embodiment the first attachment site is artificially added to the VLP. In a very preferred embodiment said first attachment site is the amino group of a lysine residue of the amino acid sequence of said VLP polypeptide.

Attachment Site, Second: As used herein, the phrase "second attachment site" refers to an element which is naturally occurring with or which is artificially added to the antigen and to which the first attachment site may be linked. The second attachment site of the antigen preferably is a protein, a polypeptide, a peptide, an amino acid, a sugar, a polynucleotide, a natural or synthetic polymer, a secondary metabolite or compound (biotin, fluorescein, retinol, digoxigenin, metal ions, phenylmethylsulfonylfluoride), or a chemically reactive group such as an amino group, a carboxyl group, a sulfhydryl group, a hydroxyl group, a guanidinyl group, histidinyl group, or a combination thereof. A preferred embodiment of a chemically reactive group being the second attachment site is a sulfhydryl group, preferably the sulfhydryl group of the amino acid cysteine most preferably the sulfhydryl group of a cysteine residue. The term "antigen with at least one second attachment site" refers, therefore, to a construct comprising the antigen and at least one second attachment site. However, in particular for a second attachment site, which is not naturally occurring within the antigen, such a construct typically and preferably further comprises a "linker". In another preferred embodiment the second attachment site is associated with the antigen through at least one covalent bond, preferably through at least one peptide bond. In a further embodiment, the second attachment site is naturally occurring within the antigen. In another further preferred embodiment, the second attachment site is artificially added to the antigen through a linker, wherein said linker comprises or alternatively consists of a cysteine. Preferably, the linker is fused to the antigen by a peptide bond.

Linked: The terms "linked" or "linkage" as used herein, refer to all possible ways, preferably chemical interactions, by which the at least one first attachment site and the at least one second attachment site are joined together. Chemical interactions include covalent and non- covalent interactions. Typical examples for non-covalent interactions are ionic interactions, hydrophobic interactions or hydrogen bonds, whereas covalent interactions are based, by way of example, on covalent bonds such as ester, ether, phosphoester, carbon-phosphorus bonds, carbon-sulfur bonds such as thioether, or imide bonds. In certain preferred embodiments the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one non-peptide bond, and even more preferably through exclusively non-peptide bond(s). The term "linked" as used herein, however, shall not only refer to a direct linkage of the at least one first attachment site and the at least one second attachment site but also, alternatively and preferably, an indirect linkage of the at least one first attachment site and the at least one second attachment site through intermediate molecule(s), and hereby typically and preferably by using at least one, preferably one, heterobifunctional cross-linker. In other preferred embodiments the first attachment site and the second attachment site are linked through at least one covalent bond, preferably through at least one peptide bond, and even more preferably through exclusively peptide bond(s).

Linker: A "linker", as used herein, either associates the second attachment site with the antigen or already comprises, essentially consists of, or consists of the second attachment site. Preferably, a "linker", as used herein, already comprises the second attachment site, typically and preferably - but not necessarily - as one amino acid residue, preferably as a cysteine residue. A preferred linkers are an amino acid linkers, i.e. linkers containing at least one amino acid residue. The term amino acid linker does not imply that such a linker consists exclusively of amino acid residues. However, a linker consisting exclusively of amino acid residues is a preferred embodiment of the invention. The amino acid residues of the linker are, preferably, composed of naturally occurring amino acids or unnatural amino acids known in the art, all-L or all-D or mixtures thereof. Further preferred embodiments of a linker in accordance with this invention are molecules comprising a sulfhydryl group or a cysteine residue and such molecules are, therefore, also encompassed within this invention. Association of the linker with the antigen is preferably by way of at least one covalent bond, more preferably by way of at least one peptide bond.

Equine mammal: An "equine mammal", as used herein, is a mammal included in the family Equidae including horses, ponys, asses (donkeys), and zebras. Preferably, the term "equine mammal", as used herein, refers to a horse, a pony, an ass (a donkey), and a zebra. Again more preferably, the term "equine mammal", as used herein, refers to a horse.

Several aspects of the present invention are disclosed herein; the embodiments and preferred embodiments, respectively, mentioned further herein are applicable for each and any aspect of the present invention disclosed herein, even though not explicitly mentioned.

We have now surprisingly found in skin biopsies from horses with chronic pruritic skin lesions that equine IL-31 mRNA was expressed in skin lesions from sites with pruritus, whereas it was completely absent in healthy horse skin samples. Thus, the compositions of the present invention which induce strong auto-antibody titers are effective for the prevention and treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and in particular, are effective for the prevention and treatment of chronic pruritus, preferably chronic allergic pruritus or chronic pruritus-associated dermatitis. The effectiveness of the inventive compositions are independent of the specific allergic trigger be it allergens or components in the food. Moreover, the inventive compositions are effective in the prevention and treatment of chronic pruritus of unknown origin (CPUO).

Thus, vaccination of horses affected by chronic pruritus or chronic allergic pruritus such as chronic pruritus-associated dermatitis with inventive compositions comprising eIL-31 antigens linked to CMV-VLPs led not only to significant healing of skin lesion but, in particular, led to a very strong decrease in mean pruritus as determined before and after treatment with the inventive compositions, in particular and preferably as evidenced by the test described in Example 4 herein.

Thus, in a first aspect, the present invention provides for a composition comprising: (a) a core particle with at least one first attachment site; and (b) at least one antigen with at least one second attachment site, wherein said at least one antigen is an equine Interleukin-31 antigen (eIL-31 antigen), wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond; for use in a method of prevention or treatment of a condition or disorder selected from a pruritic condition or an allergic condition, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, wherein preferably an effective amount of said composition is administered to said equine mammal, preferably to said horse. In a preferred embodiment, said condition or disorder is a chronic pruritic condition of an equine mammal, preferably of a horse. In a preferred embodiment, said condition or disorder is a chronic allergic condition, of an equine mammal, preferably of a horse. In a preferred embodiment, said condition or disorder is a chronic pruritic allergic condition of an equine mammal, preferably of a horse. In a preferred embodiment, said condition or disorder is pruritus, preferably chronic pruritus of an equine mammal, preferably of a horse. In a further preferred embodiment, said condition or disorder is chronic allergic pruritus. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with allergic dermatitis or pruritus associated with atopic dermatitis. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with allergic dermatitis. In a further preferred embodiment, said pruritus, preferably said chronic pruritus, is pruritus associated with atopic dermatitis. In a further preferred embodiment, said condition or disorder is chronic pruritus of unknown origin (CPUO).

The present invention, thus, provides for inventive compositions for use in all pruritic conditions or all allergic conditions independent of the allergic trigger.

In a further aspect, the present invention provides for a composition comprising: (a) a core particle with at least one first attachment site; and (b) at least one antigen with at least one second attachment site, wherein said at least one antigen is an equine Interleukin-31 antigen (eIL-31 antigen), wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l; wherein (a) and (b) are linked through said at least one first and said at least one second attachment site via at least one non-peptide covalent bond; for use in a method of prevention or treatment of a condition or disorder, wherein said condition or disorder is chronic pruritus, preferably chronic allergic pruritus, of an equine mammal, preferably of a horse, wherein said condition or disorder is not the prevention or treatment of insect bite hypersensitivity (IBH) of an equine mammal, preferably of a horse, and wherein preferably an effective amount of said composition is administered to said equine mammal, preferably to said horse.

In a preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO: 1, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO: 5. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l and SEQ ID NO:2. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:3. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:4. In a further preferred embodiment, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:5.

In a further preferred embodiment, said core particle is a virus-like particle (VLP), preferably a recombinant VLP. In again a further preferred embodiment, said VLP is derived from a plant virus or a bacteriophage, and wherein preferably said bacteriophage is a RNA bacteriophage.

Thus, in a further preferred embodiment, said core particle is a virus-like particle (VLP), and wherein said VLP is derived from a RNA bacteriophage.

Further preferred is a recombinant VLP of an RNA bacteriophage as core particle of the present invention. In a further preferred embodiment, said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins of an RNA bacteriophage, and wherein preferably said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins of RNA bacteriophage QP or of RNA bacteriophage AP205, and wherein further preferably said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins of RNA bacteriophage QP.

In a further preferred embodiment, said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins comprising or preferably consisting of an amino acid sequence selected from (a) SEQ ID NO: 18; (b) a mixture of SEQ ID NO: 18 and SEQ ID NO: 19; or (c) SEQ ID NO:20. In a very further preferred embodiment, said VLP is a VLP of RNA bacteriophage Ob. In a further preferred embodiment, said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins of RNA bacteriophage QP. Again in a further preferred embodiment, said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins comprising or preferably consisting of SEQ ID NO: 18.

In another preferred embodiment, said core particle is a virus-like particle (VLP) wherein said VLP is a VLP of RNA bacteriophage QP, and said VLP comprises, consists essentially of, or alternatively consists of, recombinant coat proteins of RNA bacteriophage QP, and wherein said recombinant coat proteins comprising or preferably consisting of SEQ ID NO: 18.

In one embodiment, said VLP is not a VLP of an RNA bacteriophage, preferably said VLP is not a recombinant VLP of an RNA bacteriophage. In one embodiment, said virus-like particle is not a virus-like particle of an RNA-bacteriophage QP.

In a further preferred embodiment, said core particle is a virus-like particle (VLP), and wherein said VLP is derived from a plant virus. In another preferred embodiment, said VLP is a recombinant VLP, and wherein preferably said recombinant VLP is derived from a plant virus. In another preferred embodiment, said VLP is a VLP of cucumber mosaic virus (CMV).

In a preferred embodiment, said VLP is a modified VLP comprising, essentially consisting of, or alternatively consisting of, at least one modified VLP polypeptide, wherein said modified VLP polypeptide comprises, or preferably consists of, (a) a VLP polypeptide, and (b) a T helper cell epitope, wherein said VLP polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of a virus, preferably an amino acid sequence of a coat protein of a plant virus; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of said coat protein of a virus, and wherein said mutated amino acid sequence and said coat protein of a virus show a sequence identity of at least 90%, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.

In a preferred embodiment, said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of, (a) a CMV polypeptide, and (b) a T helper cell epitope; and wherein said CMV polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90%, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%.

In a preferred embodiment, said CMV polypeptide comprises, preferably consists of, an amino acid sequence of a coat protein of CMV. In another preferred embodiment, said CMV polypeptide comprises, preferably consists of a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90%, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%. Typically and preferably, said mutated amino acid sequence and said amino acid sequence to be mutated differ in least one and in at most 11, 10, 9, 8, 7, 6, 5, 4, 3, or 2 amino acid residues, and wherein preferably these differences are selected from (i) insertion, (ii) deletion, (iii) amino acid exchange, and (iv) any combination of (i) to (iii).

In another preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: 10 or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO: 10; or (ii) a mutated amino acid sequence, wherein said amino acid sequence to be mutated is said amino acid sequence as defined in (i) of this claim, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 95%, preferably of at least 98%, and more preferably of at least 99%.

In another preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: 10 or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO:10. In another preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises SEQ ID NO:21, or (b) an amino acid sequence of a coat protein of CMV comprising an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90%, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% with SEQ ID NO:21; or (ii) a mutated amino acid sequence, wherein said amino acid sequence to be mutated is said amino acid sequence as defined in (i) of this claim, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 95%, preferably of at least 98%, and more preferably of at least 99%.

In a further preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises SEQ ID NO:21, or (b) an amino acid sequence of a coat protein of CMV comprising an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90%, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% with SEQ ID NO:21.

In another preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (i) (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: 10 or (b) an amino acid sequence having a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% of SEQ ID NO: 10; and wherein said amino sequence as defined in (a) or (b) comprises SEQ ID NO:21; or wherein said amino sequence as defined in (a) or (b) comprises an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 75%, preferably of at least 80%, more preferably of at least 85%, again further preferably of at least 90 %, again more preferably of at least 95%, still further preferably of at least 98% and still again further more preferably of at least 99% with SEQ ID NO:21; or (ii) a mutated amino acid sequence, wherein said amino acid sequence to be mutated is said amino acid sequence as defined in (i) of this claim, and wherein said mutated amino acid sequence and said amino acid sequence to be mutated show a sequence identity of at least 98% preferably of at least 99%.

In another preferred embodiment, said CMV polypeptide comprises, or preferably consists of, (a) an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: 10 or (b) an amino acid sequence having a sequence identity of at least 90 % of SEQ ID NO: 10; and wherein said amino sequence as defined in (a) or (b) in this claim comprises SEQ ID NO:21 ; or wherein said amino sequence as defined in (a) or (b) in this claim comprises an amino acid sequence region, wherein said amino acid sequence region has a sequence identity of at least 90% with SEQ ID NO:21.

In another preferred embodiment, said T helper cell epitope replaces aN-terminal region of said CMV polypeptide. In another preferred embodiment the number of amino acids of said N-terminal region replaced is equal to or lower than the number of amino acids of which said T helper cell epitope consists.

In a further very preferred embodiment, said T helper cell epitope replaces a N-terminal region of said CMV polypeptide, and wherein the number of amino acids of said N-terminal region replaced is equal to or lower than the number of amino acids of which said T helper cell epitope consists. Typically and preferably, said replaced N-terminal region of said CMV polypeptide consists of 5 to 15 consecutive amino acids, preferably of 9 to 14 consecutive amino acids, more preferably of 11 to 13 consecutive amino acids.

In a further very preferred embodiment, said N-terminal region of said CMV polypeptide corresponds to amino acids 2-12 of SEQ ID NO: 10.

In another very preferred embodiment, said T helper cell epitope is a universal T helper cell epitope. In another preferred embodiment, said T helper cell epitope consists of at most 20 amino acids.

In a very preferred embodiment, said Th cell epitope is a PADRE sequence. In a further very referred embodiment, said Th cell epitope comprises, preferably consists of, the amino acid sequence of SEQ ID NO: 14. In another very preferred embodiment, said Th cell epitope is a PADRE sequence, and wherein said Th cell epitope comprises, preferably consists of, the amino acid sequence of SEQ ID NO: 14.

In another preferred embodiment, said T helper cell epitope is derived from a human vaccine. In a very preferred embodiment, said Th cell epitope is derived from tetanus toxin. In a further very referred embodiment, said Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO: 13. In another very preferred embodiment, said Th cell epitope is derived from tetanus toxin, and wherein said Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO: 13.

In a very preferred embodiment, said Th cell epitope is a PADRE sequence, and wherein said Th cell epitope comprises, preferably consists of, the amino acid sequence of SEQ ID NO: 14; or wherein said Th cell epitope is derived from tetanus toxin, and wherein said Th cell epitope has, preferably consists of, the amino acid sequence of SEQ ID NO: 13.

In a very preferred embodiment, said CMV polypeptide comprises, or preferably consists of, an amino acid sequence of a coat protein of CMV, wherein said amino acid sequence comprises, or preferably consists of, SEQ ID NO: 10 or an amino acid sequence having a sequence identity of at least 95 % of SEQ ID NO: 10; and wherein said amino sequence comprises SEQ ID NO:21, and wherein said T helper cell epitope replaces the N-terminal region of said CMV polypeptide, and wherein said replaced N-terminal region of said CMV polypeptide consists of 11 to 13 consecutive amino acids, preferably of 11 consecutive amino acids, and wherein further preferably said N-terminal region of said CMV polypeptide corresponds to amino acids 2-12 of SEQ ID NO: 10.

In another very preferred embodiment, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15. In another very preferred embodiment, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 16.

In a very preferred embodiment, said first attachment site and said second attachment site are linked via at least one covalent non-peptide-bond. In another very preferred embodiment, said first attachment site comprises, or preferably is, an amino group, preferably an amino group of a lysine. In a further very preferred embodiment, said second attachment site comprises, or preferably is, a sulfhydryl group, preferably a sulfhydryl group of a cysteine.

In a very preferred embodiment, the at least one first attachment site is an amino group, preferably an amino group of a lysine residue and the at least one second attachment site is a sulfhydryl group, preferably a sulfhydryl group of a cysteine residue or a sufhydryl group that has been chemically attached to the at least one antigen of the invention. In a further preferred embodiment only one of said second attachment sites associates with said first attachment site through at least one non-peptide covalent bond leading to a single and uniform type of binding of said antigen to said modified virus-like particle, wherein said only one second attachment site that associates with said first attachment site is a sulfhydryl group, and wherein said antigen and said modified virus-like particle interact through said association to form an ordered and repetitive antigen array.

In one preferred embodiment of the invention, the antigen is linked to the modified VLP by way of chemical cross-linking, typically and preferably by using a heterobifunctional cross linker. In preferred embodiments, the hetero-bifunctional cross-linker contains a functional group which can react with the preferred first attachment sites, preferably with the amino group, more preferably with the amino groups of lysine residue(s) of the modified VLP, and a further functional group which can react with the preferred second attachment site, i.e. a sulfhydryl group, preferably of cysteine(s) residue inherent of, or artificially added to the antigen, and optionally also made available for reaction by reduction. Several hetero-bifunctional cross linkers are known to the art. These include the preferred cross-linkers SMPH (Pierce), Sulfo- MBS, Sulfo-EMCS, Sulfo-GMBS, Sulfo-SIAB, Sulfo-SMPB, Sulfo-SMCC, Sulfo-KMUS SVSB, SIA, and other cross-linkers available for example from the Pierce Chemical Company, and having one functional group reactive towards amino groups and one functional group reactive towards sulfhydryl groups. The above mentioned cross-linkers all lead to formation of an amide bond after reaction with the amino group and a thioether linkage with the sulfhydryl groups. Another class of cross-linkers suitable in the practice of the invention is characterized by the introduction of a disulfide linkage between the antigen and the modified VLP upon coupling. Preferred cross-linkers belonging to this class include, for example, SPDP and Sulfo- LC-SPDP (Pierce).

Linking of the antigen to the modified VLP by using a hetero-bifunctional cross-linker according to the preferred methods described above, allows coupling of the antigen to the modified VLP in an oriented fashion. Other methods of linking the antigen to the modified VLP include methods wherein the antigen is cross-linked to the modified VLP, using the carbodiimide EDC, and NHS. The antigen may also be first thiolated through reaction, for example with SATA, SATP or iminothiolane. The antigen, after deprotection if required, may then be coupled to the modified VLP as follows. After separation of the excess thiolation reagent, the antigen is reacted with the modified VLP, previously activated with a hetero bifunctional cross-linker comprising a cysteine reactive moiety, and therefore displaying at least one or several functional groups reactive towards cysteine residues, to which the thiolated antigen can react, such as described above. Optionally, low amounts of a reducing agent are included in the reaction mixture. In further methods, the antigen is attached to the modified VLP, using a homo-bifunctional cross-linker such as glutaraldehyde, DSG, BM[PEO]4, BS3, (Pierce) or other known homo-bifunctional cross- linkers with functional groups reactive towards amine groups or carboxyl groups of the modified VLP.

In very preferred embodiments of the invention, the antigen is linked via a cysteine residue, having been added to either the N-terminus or the C-terminus of, or a natural cysteine residue within the antigen, to lysine residues of the modified virus-like particle. In a preferred embodiment, the composition of the invention further comprises a linker, wherein said linker associates said antigen with said second attachment site, and wherein preferably said linker comprises or alternatively consists of said second attachment site.

In a further very preferred embodiment of the invention, said core particle is a virus-like particle (VLP), preferably a recombinant VLP and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO: 1 or a protein with an amino acid sequence of at least 95%, and preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, protein with the amino sequence selected from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO: 1, and SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2.

In a further very preferred embodiment of the invention, said core particle is a modified VLP, preferably a recombinant modified VLP, in accordance with the present invention and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 95%, and preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l and SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:3. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:4. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO: 5.

In a further very preferred embodiment of the invention, said core particle is a VLP, preferably a recombinant VLP, wherein said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, wherein said modified CMV polypeptide comprises, or preferably consists of (a) a CMV polypeptide, and (b) a T helper cell epitope; and wherein said CMV polypeptide comprises, or preferably consists of, (i) an amino acid sequence of a coat protein of CMV; or (ii) a mutated amino acid sequence, wherein the amino acid sequence to be mutated is an amino acid sequence of a coat protein of CMV, and wherein said mutated amino acid sequence and said coat protein of CMV show a sequence identity of at least 90 %, preferably of at least 95%, further preferably of at least 98% and again more preferably of at least 99%, and wherein said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 95%, and preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO: 1 and SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:3. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:4. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:5. In a further very preferred embodiment of the invention, said core particle is a VLP, preferably a recombinant VLP, wherein said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, and wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 95%, and preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l, SEQ ID NO:2, SEQ ID NO:3, SEQ ID NO:4, SEQ ID NO:5. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l and SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:3. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:4. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO: 5.

In a further very preferred embodiment of the invention, said core particle is a VLP, preferably a recombinant VLP, wherein said VLP is a modified VLP of cucumber mosaic virus (CMV), wherein said modified VLP of CMV comprises, essentially consists of, or alternatively consists of, at least one modified CMV polypeptide, and wherein said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 16 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l or a protein with an amino acid sequence of at least 90%, preferably of at least 92 %, further preferably of at least 95%, and again further preferably of at least 98% amino acid sequence identity with SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 16 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence selected from SEQ ID NO:l and SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 16 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:l. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 16 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:2. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:3. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO:4. In again a very preferred embodiment of the invention, said modified CMV polypeptide comprises, preferably consists of, an amino acid sequence of SEQ ID NO: 15 and said eIL-31 antigen comprises, or preferably is, a protein with the amino sequence of SEQ ID NO: 5.

In a preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, recurrent urticaria, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper-responsiveness, chronic obstruction pulmonary disease, and inflammatory processes resulting from autoimmunity.

In a further preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria, pruritus, preferably chronic pruritus, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper-responsiveness, chronic obstruction pulmonary disease, and inflammatory processes resulting from autoimmunity.

In again a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, recurrent urticaria, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper-responsiveness, chronic obstruction pulmonary disease, and inflammatory processes resulting from autoimmunity.

In again a further preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria, pruritus, preferably chronic pruritus, heaves, inflammatory airway disease, recurrent airway obstruction, airway hyper-responsiveness, chronic obstruction pulmonary disease, and inflammatory processes resulting from autoimmunity.

In again a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

In again a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, and recurrent urticaria.

In a preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria and pruritus, preferably chronic pruritus.

In a preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria and pruritus, preferably chronic pruritus.

In a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

In a further preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, psoriasis, scleroderma, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria and pruritus, preferably chronic pruritus.

In a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

In a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, eczema, pruritus, preferably chronic pruritus, allergic dermatitis and recurrent urticaria.

In a further preferred embodiment, said pruritic condition is selected from atopic dermatitis, eczema, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria; and wherein said allergic condition is selected from allergic dermatitis, recurrent urticaria and pruritus, preferably chronic pruritus.

In a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, pruritus, preferably chronic pruritus, allergic dermatitis, bacterial folliculitis, dermatophytosis, and recurrent urticaria.

In a further preferred embodiment, said pruritic condition or said allergic condition is selected from atopic dermatitis, pruritus, preferably chronic pruritus, allergic dermatitis and recurrent urticaria.

In a further preferred embodiment, said condition or disorder is chronic pruritus of unknown origin (CPUO).

In a further preferred embodiment, said administration of said composition reduces at least one parameter or symptom associated with said pruritic condition or said allergic condition as compared to said at least one parameter or symptom associated with said pruritic condition or said allergic condition before said administration, and wherein preferably said at least one parameter or symptom associated with said pruritic condition or said allergic condition is the level or severity grade of skin lesions or the level of pruritus, and wherein further preferably said reduction of said level or severity grade of skin lesions is determined by a symptom lesion scoring test and said reduction of said level of pruritus is determined by a pruritus scoring test, wherein further preferably said reduction of said level of pruritus is determined by the reduction of scratching at least one location of the body of said equine mammal, preferably of said horse, and wherein typically and preferably said symptom lesion scoring test and said pruritus scoring test is effected as described in example 7 and example 8 of WO 2018/162577.

In again a further preferred embodiment, said administration of said composition reduces at least one parameter or symptom associated with said pruritic condition or said allergic condition as compared to said at least one parameter or symptom associated with said pruritic condition or said allergic condition before said administration, and wherein preferably said at least one parameter or symptom associated with said pruritic condition or said allergic condition is the level of pruritus, and wherein further preferably said reduction of said level of pruritus is determined by a pruritus scoring test, and wherein typically and preferably said pruritus scoring test is effected by visual analogue scale as described in Example 4.

In a further preferred embodiment, said administration of said composition reduces at least one parameter or symptom associated with said pruritic condition or said allergic condition as compared to said at least one parameter or symptom associated with said pruritic condition or said allergic condition before said administration, wherein said at least one parameter or symptom associated with said pruritic condition or said allergic condition is the level or severity grade of skin lesions and the level of pruritus, and wherein preferably said reduction of said level or severity grade of skin lesions is determined by photographic comparison of skin lesions before and after vaccination and said reduction of said level of pruritus is determined by a pruritus scoring test by a visual analogue scale, wherein further preferably said reduction of said level of pruritus is determined by the reduction of scratching at least one location of the body of said equine mammal, preferably of said horse, and wherein typically and preferably said pruritus scoring test is effected as described in Example 4.

EXAMPLES

Preferred core particle used in the present invention are virus-like particles (VLPs), in particular recombinant VLPs. In one preferred embodiment, the VLP is VLP of RNA bacteriophage z)b, wherein VLP of RNA bacteriophage z)b comprises, preferably consists of, recombinant coat proteins comprising, preferably consisting of, SEQ ID NO: 18. Such preferred virus-like particles of RNA bacteriophages, in particular of RNA bacteriophage Ob, are disclosed in WO 02/056905, the disclosure of which is herewith incorporated by reference in its entirety. In particular Example 18 of WO 02/056905 contains a detailed description of the preparation of VLP particles of RNA bacteriophage Ob. For the present specific examples, VLPs of RNA bacteriophage Ob consisting of recombinant coat proteins of SEQ ID NO: 18 have been used. In another preferred embodiment, the VLP is a VLP of cucumber mosaic virus (CMV), in particular, a modified VLP of CMV, wherein T helper cell epitopes replace N- terminal regions of the CMV polypeptide. In a very preferred embodiment, the VLP is CMVtt830 comprising modified CMV polypeptides of SEQ ID NO: 15 or CMV-Npadr comprising modified CMV polypeptides of SEQ ID NO: 16, preferably CMVtt830 comprising modified CMV polypeptides of SEQ ID NO: 15, as described herein and as disclosed in WO 2016/062720. In particular Examples 1 to 6 of WO 2016/062720 contain a detailed description of the preparation of VLP particles of modified CMV polypeptides of SEQ ID NO: 15 and SEQ ID NO:16.

EXAMPLE 1

Sampling of skin punch biopsies from horses with pruritic skin lesions and healthy skin,

RNA isolation and eIL-31 specific qPCR

A. Sampling of skin punch biopsies from horses of pruritus affected skin lesions and healthy skin

Two mm punch biopsies were taken from healthy non-lesional/non-pruritic parts and from pruritic skin parts of horses affected by CPUO, a pruritic and allergic dermatitis conditions that could not be explained by IBH. Three CPUO horses with chronic allergic or hypersensitivity induced pruritus and without clinical signs compatible with IBH (i.e. pruritus and alopecia, papulocrusting and scaling dermatitis and excoriations affecting the base of the mane, tail, ears, intermandibular space, axillae, ventral midline and groin with a seasonality reflecting the insect season) were included for biopsy collection during their symptomatic period, which was autumn to winter. Biopsies of affected lesional skin (fresh lesion) and healthy non-lesional skin were collected at the same timepoint for each horse: horse A with chronic pruritus due to exposure to bird mites from co-housed chicken (confirmed by exclusion procedure), biopsy collected in December 2019, pruritus since February 2017; horse B with suspected drug induced (penicillin, in August 2018) pruritus, which persisted over six weeks after drug withdrawal, biopsy collected in October 2018; horse C (=horse III, Example 3), biopsy collected in December 2018, pruritus since autumn 2013 and severe pruritus from winter 2014/2015.

B. RNA isolation and cDNA transcription of skin biopsies

Skin biopsies were stored in RNA/a/er® solution (Qiagen) at 4°C and total RNA was isolated using RNAqueous®-Micro Kit (Invitrogen) including DNase I treatment and inactivation. RNA was transcribed into cDNA using Reverse Transcription System (Promega) and eIL-31 mRNA level and housekeeping Pactin gene were amplified by PCR and quantified by qPCR.

C. Equine IL-31 & pactin qPCR

Amplification of eIL-31 ePactin in skin biopsies using the gene-specific primers for elL- 31 (forward primer: AACAAAGAGAAGGGAGTGC - SEQ ID NO:6; reverse primer: GCTGAGCTGTTGATGTTGC - SEQ ID NO:7) and ePactin (forward primer: CCAGCACGATGAAGATCAAG - SEQ ID NO:8; reverse primer: GT GG AC A AT G AGGC C AG A AT - SEQ ID NO: 9). The PCR was done using FastStart Universal SYBR Green Master (Roche).

Expression of equine IL-31 mRNA in relation to housekeeping gene Pactin from skin biopsies showed that only the samples extracted from itchy skin lesions did express equine IL- 31 mRNA (FIG. 1, +, pruritic skin lesion, n=3), whereas eIL-31 was not detectable in matched healthy horse skin samples of the same horses (FIG. 1, -, healthy skin of the same horses, n=3). This showed that eIL-31 was selectively expressed in pruritic skin, but absent in healthy skin.

EXAMPLE 2

Cloning, expression and purification of equine IL-31 (eIL-31)

A Cloning of eIL-31-C-His and expression as inclusion bodies in E. coli

The DNA sequence encoding for mature eIL-31 (SEQ ID: NO.1) were generated by gene- synthesis as described in example 3 of WO 2018/162577, which is incorporated by way of reference. Hereto, and as described in example 3 of WO 2018/162577, a linker (GGC) was added C-terminally. This insert was flanked by 5’ Ndel and 3’ Xhol and was integratd into pET 42b (+), containing a hexa His-tag (to facilitate purification) and stop codon in frame. The construct was termed pET42b-eIL-31 (SEQ ID NO: 17). Fidelity of the cloning procedure was confirmed by DNA sequencing. The construct pET42b-eIL-31 was transformed into E.coli strain BL21-DE3. The recombinant protein expressed in E. coli is termed eIL-31-C-His (SEQ ID NO:2).

B. Purification and refolding of eIL-31-C-His

The protein was purified via the His-tag by Ni-NTA resin (Ni-NTA Sepharose 6 Fast Flow, Amersham, CatNo 17-5318-01 or Ni-NTA Sepharose SUperflow, Quiagen, CatNo 1018142) column with solubilization buffer as binding buffer A and elution by buffer B (6 M GdmCl, 100 mM NaFhPCE, 10 mM TrisHCl, pH 4.5) (50 mΐ sample for gel analysis: sample D=flow thru NiNTA; 50 mΐ, sample E=peak NiNTA 50 mΐ). Purification was analyzed by SDS- PAGE. The fractions from the elution step containing eIL-31-C-His were pooled and dialyzed against 6 M GdmCl, 100 mM NaHiPCri, 10 mM Tris, pH 8.0 for 2 h at room temperature using a 8 kDa cut-off membrane.

Insoluble eIL-31-C-His was extracted from detergent washed inclusion bodies with 6M guanidine hydrochloride. Different washing steps were analyzed by SDS-PAGE (FIG. 2A): lysate (FIG. 2 A, lane 1), soluble fraction (FIG. 2 A, lane 2), solubilized inclusion bodies (FIG. 2A, lane 3). The solubilized protein was purified by metal chelate affinity chromatography and analyzed by SDS-PAGE (FIG 2A, lane 4, flow through unbound material and FIG. 2A, lane 5, pooled fractions eIL-31 monomer eluate from column). Recombinant eIL-31-C-His was found to be highly enriched by this procedure. The denatured eluate protein was subjected to a refolding procedure as described below and optionally further purified by size exclusion chromatography.

In order to refold eIL-31-C-His, the protein was dialyzed sequentially by the following buffers: buffer 1 (2 M Urea, 50 mM NaHiPCri, 5 mM Glutathione reduced, 0.5 mM Gluthatione oxidized, 0.5 M Arginine, 10 % Glycerol), buffer 2 (50 mM NaH2P04, 5 mM Glutathione reduced, 0.5 mM Gluthatione oxidized, 0.5 M Arginine, 10 % Glycerol), buffer 3a (50 mM NaHiPCri, 0.5 M Arginine, 10 % Glycerol), buffer 3b (50 mM NaHiPCri, 10 % Glycerol), buffer 4 (PBS). Optionally refolded protein was concentrated by Centrifugal Filters (Amicon, Ultrafree-15 Millipore, 10 kDa cut-off) and purified on a HiLoad 26/600 Superdex 75 prep grade (GE Healthcare, CatNo 28-9893-34) with PBS buffer. Eluted fractions were pooled and analyzed by a non-reducing SDS-PAGE (with SDS, no DTT, no heating of samples). Protein concentration was measured by UV-VIS or Bradford assay.

The ability of purified recombinant eIL-31-C-His to form dimers after refolding was assessed by SDS-PAGE comparing reducing conditions (FIG. 2A, lane 6) and non-reducing conditions (FIG.2A, lane 7). As judged by the molecular mass of approximately 33 kDa, elL- 31-C-His was demonstrated to partially exist in dimeric structure. Moreover, eukaryotic HEK cell expressed eIL-31-C- Strep was loaded under native conditions and also showed monomeric and dimeric bands, however highly glycosylated (FIG. 2A, lane 8). Furthermore, integrity of purified and refolded eIL-31-C-His was confirmed by comparing far-UV circular dichroism (CD) spectroscopies of eukaryotic HEK expressed eIL-31-C-Strep (grey line) and prokaryotic E.coli expressed eIL-31-C-His monomer (black line) and dimer (light grey line). Both showed comparable pattern with expected and indicated minima at 208 and 222 nm, representing mostly a-helical secondary structure (FIG. 2B).

C. Biological activity of recombinant refolded equine eIL-31-C-His

The biological activity of recombinant refolded equine eIL-31-C-His was confirmed as described in example 3 of WO 2018/162577, which is incorporated by way of reference.

EXAMPLE 3

Coupling of eIL-31 antigen to VLP, immunization of horses and demonstration of efficacy in horses with chronic pruritus

A Coupling equine IL-31-C-His to VLP of OB

The coupling of equine IL-31-C-His to VLP of OB was effected as described in example 5 of WO 2018/162577, which is incorporated by way of reference. Hereto, Ob VLP comprising coat proteins of SEQ ID NO: 18 were produced as described therein.

B Coupling of eIL31-C-His to CMVtt830 VLP

CMVtt830 VLP were produced as described above and were reacted with a 10 fold molar excess of the heterobifunctional cross-linker succinimidyl-6( -maleimidopropionamido)- hexanoate (SMPH) (Pierce). Unreacted crosslinker was removed by passage over a PD- 10 desalting column (GE Healthcare). The recombinant, purified and refolded eIL-31-C-His was reduced for lh with an equimolar excess amount of tri(2-carboxyethyl)phosphine hydrochloride (TCEP) in 20 mM Na ₂ PC> ₄ /2 mM EDTA, pH 7.5 to reduce the cysteine residue contained in the linker. The reduced eIL-31-C-His was then mixed with the derivatized CMVtt830 VLPs at a molar ratio of VLP monomer to eIL-31-C-His protein of 1:1 and co-incubated for 4 hours at 22°C to allow cross-linking. The reaction was dialysed 12 hours against 20 mM Na ₂ PC> ₄ /2 mM EDTA, pH 7.5 using a 300 kDa cut-off dialysis membrane or free uncoupled eIL-31-C-His was removed by either size exclusion chromatography or tangential flow filtration using 100 kDa MWCO. Analysis: Coomassie staining of SDS-PAGE (FIG. 3 A): eIL-31-C-His, CMVtt830, and eIL31-C-His-CMVtt830 VLP were separated by SDS-PAGE. Subsequently gel was stained with Coomassie-Blue (0.025% Coomassie Brilliant BlueR-250, 40% methanol, 10% acetic acid) and de-stained with destainer (40% methanol, 10% acetic acid).

Western blot staining with anti-His antibody (FIG. 3B): eIL-31-C-His, CMVtt830, and eIL31-C-His-CMVtt830 VLP were separated by SDS-PAGE and electroblotted onto a nitrocellulose membrane. The membrane was blocked for lh with 5% (w/v) BSA powder in PBST, then incubated with 10 ml of 1 : 1000 diluted anti-His antibody (monoclonal anti-His Tag antibody HRPO conjugate, Novagen CatNo. 71840) in 1% BSA (w/v) powder in PBST. The membrane was washed with PBST for 15 minutes and then developed with ECL (Amersham Pharmacia, Sweden) and exposed to Photographic film.

The covalent chemical coupling of eIL31-C-His to CMVtt830 VLP was assessed by SDS- PAGE and Western blot analyses. Coomassie blue stained gels of the coupling reaction demonstrated the appearance of bands with molecular weights corresponding to those predicted for equine IL31-C-His covalently linked to CMV-tt830, respectively (FIG. 3 A). Furthermore, Western blot analyses showed co-localization of these bands when stained with anti-His antibody (FIG. 3B).

C. Immunization protocol

Horses with eIL-31 -C-His-OB vaccination. In order to generate self-reactive antibodies to equine IL-31, horse was injected subcutaneously on day 0 and 19 with 300 pg of eIL-31-C- His-Q vaccine in l’OOO mΐ of PBS. Horse was bled prior to immunization and on day 42 or on day 93 and 118. Sera were analyzed by ELISA (FIG. 4A).

Horses with eIL-31-C-His-CMVtt830 vaccinations. In order to generate self-reactive antibodies to equine IL-31, horses were injected subcutaneously on weeks 0, 4, 15+/-1 week with 300 pg of eIL-31 -C-His-CMVtt830 in a total of 1 Ό00 pi of 20 mM Na ₂ P0 ₄ /2 mM EDTA, pH 7.5. Horses were bled prior to immunization (day 0) and at least two to four weeks post 2 ^nd vaccination, the day of 3 ^rd vaccination and two to four weeks post 3 ^rd vaccination. Sera are analyzed by ELISA (FIG. 4B).

D. Sera analysis by ELISA:

Horses with eIL-31-C-His- VLP vaccination: Maxisorp 96 well ELISA plates (Nunc) were coated over night with 50 mΐ purified eIL-31-C-His (5 pg/ml). Plates were washed 3 times with PBST blocked with 5% BSA/PBST (Thermo Scientific) for 2 hour at room temperature. Then plates were washed 3 times with PBST and three-fold dilutions of horse sera was added in Superblock and incubated at room temperature for 2 h. The plates were subsequently washed 3 times with PBST and incubated with anti-equine IgG conjugated with HRP (dilution 1 :2000) at room temperature for 30 min. The plates were again washed 4 times with PBS and 50 mΐ/well developing solution (TMB) was added. After approximately 2 minutes of reaction at room temperature the ELISA was stopped with 25 mΐ per well 5% H ₂ SO ₄ . Absorbance was measured at 450 nm on a Tecan M200 spectrophotometer or Tecan Spark (Tecan, Austria).

Horses with eIL-31 -C-His-OB vaccination. Preimmune sera and sera post immunization on days 42, 93 and 118 from a horse vaccinated with eIL-31-C-His-CMVtt830 was collected and analyzed by ELISA. Horse sera was blotted as delta OD50 (AOD o) values, which were calculated from OD450 values for each dilution subtracted by corresponding naive serum dilution. The result of vaccination in a horse shows that immunological tolerance towards the self-antigens IL-31 was overcome (FIG. 4A). Half maximal titer at peak of response were above El’OOO.

Horses with eIL-31-C-His-CMVtt830 vaccinations. Preimmune sera (FIG. 4B, I), sera post 2 ^nd immunization (FIG. 4B, II), sera on the day of 3 ^rd immunization (FIG. 4B, III) and sera post 3 ^rd immunization (FIG. 4B, IV) from horses (horse T, horse II., horse III. and horse IV.) vaccinated with eIL-31-C-His-CMVtt830 were collected and analyzed by ELISA. Horse sera were blotted as delta OD50 (AOD o) values. The result of vaccination in horses shows that immunological tolerance towards the self-antigens IL-31 was overcome (FIG. 4B). Half maximal titer at peak of response were above 1 : 1 Ό00.

E In vivo Efficacy:

Horse I: Thoroughbred gelding (* 2006) with chronic pruritus and alopecia since 2015 (or earlier) had been examined by several veterinarians but treatment attempts yielded limited success, thus pruritus persisted during all seasons. In 2015, the horse had episodes of focal inflammatory alopecia at head and neck but initially without pruritus, and was treated with topical disinfectant Dexavetaderm. In early summer 2016 the horse developed lesions at head and neck with marked pruritus. Alopecia was multifocal, rather annular with little crusts mainly at forehead, mandible, neck, below mane (here also with seborrhoea sicca) and the hairs were easily epilated. Fur and skin was otherwise without abnormalities. The horse received two injections of dermatophyte vaccine (Insol® Dermatophyton, Boehringer Ingelheim), but the pruritus progressed. Due to severe pruritus and impairment of general attitude, the horse was administered corticosteroids (unknown concentration and duration, Dexamedium, MSD) and a mild improvement was noticed short term, whereafter deterioration to severe pruritus affecting head and neck region was again recorded. Skin biopsies from head and neck were taken and were compatible with allergic dermatitis with mainly perivascular infiltration of lymphocytes and eosinophils. In addition, perifollicular fibrosis was noticed, possibly due to an earlier dermatophytosis. The horse was regularly dewormed. Although annular lesions initially non pruritic and later pruritic may suggest for bacterial folliculitis, fungal elements or onchocerca infection, nevertheless could be excluded upon histological exam. Other co-housed horses were not affected. The horse was considered allergic based on exclusion of ectoparasitoses and cutaneous infections. Causative allergic agents could not be identified by the previous examinations and exclusion procedures.

Upon two vaccinations with eIL-3 l-C-His-CMVtt830. lesions at the buttock (FIG. 5A, 1) and neck (FIG. 5A, 3) disappeared (FIG. 5A, 2 & 4), indicating less pruritus-mediated self- inflicted trauma.

Horse II: Shetland pony mare (* 2003) with chronic pruritus and alopecia since 2014. Extensive examination by several veterinarians followed. Pituary Pars Intermedia Dysfunction (PPID) was diagnosed in October 2014 after onset of pruritus and the horse received 0.25 mg pergolide/day per os (Prascend, Boehringer Ingelheim). In addition, the horse had reduced appetite, lost weight and had a colic episode. Subsequently, the horse was dewormed (0.2 mg/kg Ivermectin, Eraquell, Virbac) and received omeprazole (2 mg/kg, GastroGard, Biokema) after having found three small gastric ulcers during endoscopic examination. The pruritus persisted, reduced appetite and weight loss resolved. Allergen-specific IgE serology testing and subsequent desensitization against pollen (IMOVET EAC) was performed for 15 months without any improvement of pruritus and self-induced alopecia. Further search for offending allergens by clinical and dermatological evaluations such as food and bedding exclusions procedures were unrewarding. As such it was not clear whether the origin of the pruritus was allergic in this horse, nevertheless the horse met criteria of CPUO.

Lesions prior to vaccination at the neck (FIG. 5B, 1), cheek (FIG 5B, 3) and thigh (FIG 5B, 5) healed upon two vaccinations with eIL-31-C-His-CMVtt830 and hair grew back at all body parts, i.e. neck (FIG. 5B, 2), cheek (FIG. 5B, 4), and thigh (FIG. 5B, 6).

Horse III: Swiss Warmblood mare (* 2005) with chronic, non-seasonal pruritus, self- induced alopecia and excoriations. Initially in 2012, the horse was a bit itchy during winter months, but no lesions were visible. The horse moved with the same owner end of 2013 to a new stable, however, there was no change in feeding, bedding and housing, the horse always had an open box and any time accessible paddock outside. In winter 2014/2015 the pruritus suddenly worsened dramatically with severe wounds on the skin and developed pruritic urticaria twice. The horse was treated with corticosteroids for a couple of weeks (unknown exact duration and concentration). Thereafter, exclusion procedures for feeding, bedding and topical products was performed. Blankets of horses were only washed without laundry detergent. Pruritus did though persist. Interestingly, after initial pruritus was limited to winter months only, the horses became all year round pruritic with lesions on trunk and tail during winter months and lesions mainly on head, base of mane and neck during summer months. IgE serology testing and subsequent desensitization against D. farinae and D. pteronyssinus (IDEXX Diavet) was performed for six months without any improvement of pruritus and skin lesions. Of note, presence of ectoparasites were tested negative. Although several veterinarians examined this horse, the cause of pruritus remained unidentified and reflects how challenging and frustrating the identification can be. The horse was diagnosed as allergic based on exclusion of other diagnoses. Offending allergens were not identified by exclusion procedures and the pruritus was unresponsive to treatments tried. Two biopsies of lesional and non-lesional skin were taken in December and showed IL-31 expression solely in lesional skin (Horse C, Figure 1) thus being compatible with allergic pruritus.

This horse was vaccinated three times with eIL-31-C-His-CMVtt830 and photographs of lesions were taken at the time point of first injection, i.e. mane (FIG. 5C, 1), and prior to or at the time point of third booster injection, i.e. mane (FIG. 5C, 2), tail (FIG. 5C, 4) and back (FIG. 5C, 7). Photographs post three vaccinations with eIL-31-C-His-CMVtt830 show healing of the lesions, i.e. mane at ten days post third vaccination (FIG. 5C, 3), tail at ten days (FIG. 5C, 5) and sixteen weeks (FIG. 5C, 6) post third injection, and back at eight weeks post third injection (FIG. 5C, 8) compared to the time point of first injection photographs of back (FIG. 5C, 7).

Horse IV: Icelandic horse gelding (* 2007) bom in Iceland and exported in April 2017 showed chronic pruritus and alopecia since arrival in Switzerland, unchanged during summer and winter time. Subsequently, he was put on prednisolone 750 mg/day per os (Prednisolone, Vetoquinol). The owner previously tried to reduce the cortisone dose several times, however, had to increase the dose immediately due to severe pruritus upon reduction. The horse was dewormed regularly, received common prophylactic vaccinations and also vaccination against dematophytosis (Insol® Dermatophyton, Boehringer Ingelheim) without influencing the need for corticosteroids.

At the time point of first vaccination (week 0) we slightly reduced prednisolone treatment to 500 mg/day per os, in order to facilitate a proper immune response towards our vaccine. Following the second, third and fourth vaccination (weeks 4, 18, and 35) we continuously decreased the daily amount of prednisolone, i.e. to 375 mg/day (P.O.) four weeks post second vaccination, to 250 mg/day (P.O.) three weeks post third vaccination, to 125 mg/day (P.O.) eight and a half weeks post third vaccination, to 62.5 mg/day (P.O.) eighteen and a half weeks post third vaccination, and to zero mg/day (P.O.) seven weeks post fourth vaccination, respectively (FIG. 5D).

Reduced pruritic behavior upon eIL-31-CuMVTT vaccination, Horse II-IV. Owners’ evaluation by pruritus scoring test (described in Example 4) on the pruritic behavior of their horses, before vaccination and after the 3 ^rd vaccination (FIG. 6), showed that pruritic behavior was reduced upon vaccination with eIL-31-C-His-CMVtt830 (mean improvement by 76.4%). In addition, all horses improved pruritic behavior thus showing a 100% responder rate.

EXAMPLE 4

Pruritus scoring test by visual analogue scale

For pruritus symptom scoring, owners of horses recorded the intensity of pruritus before and after vaccination, using an analogue visual scale from 0: no itch symptoms to 10: most severe symptoms, where 0, 5, and 10 are visual on the scale and the pointer can be moved in 1 point steps to the left and to the right. Additionally, owners rate the frequency and duration of pruritus of their horses in a tabular manner divided in days, weeks and months plotted to the four seasons and all-year option. Moreover, the location of the pruritus of the horses has to be determined by free text by the horse owner.