Login| Sign Up| Help| Contact|

Patent Searching and Data


Title:
VIRAL VECTOR CODING FOR A GLYCOPROTEIN OF THE VIRUS RESPONSIBLE FOR A.I.D.S., VACCINE AND ANTIBODY
Document Type and Number:
WIPO Patent Application WO/1987/006260
Kind Code:
A1
Abstract:
Viral vector characterized in that it comprises at least a portion of the genome of a virus, a gene coding for one of the glycoproteins (gp) of the envelope of the virus responsible for AIDS, as well as the elements providing for the expression of said glycoprotein in cells.

Inventors:
KIENY MARIE-PAULE (FR)
RAUTMANN GUY (FR)
LECOCQ JEAN-PIERRE (FR)
WAIN-HOBSON SIMON (FR)
GIRARD MARC (FR)
MONTAGNIER LUC (FR)
Application Number:
PCT/FR1987/000116
Publication Date:
October 22, 1987
Filing Date:
April 08, 1987
Export Citation:
Click for automatic bibliography generation   Help
Assignee:
TRANSGENE SA (FR)
PASTEUR INSTITUT (FR)
International Classes:
G01N33/569; A61K39/00; A61K39/21; A61K39/395; A61P31/12; A61P31/18; C07K14/00; C07K14/145; C07K14/155; C07K14/16; C07K14/705; C07K16/00; C07K16/10; C12N5/10; C12N7/00; C12N15/00; C12N15/09; C12N15/62; C12P19/34; C12P21/00; C12P21/02; C12P21/08; G01N33/577; A61K38/00; C12R1/91; (IPC1-7): C12N15/00; A61K39/21; C07K15/14; C12N7/00; C12P19/34; C12P21/02; G01N33/569
Foreign References:
Other References:
BIO/TECHNOLOGY, Vol. 4, No. 3, March 1986, H. BIALY, "IL-2 Crystals, TNF Tests and Aids Vaccines", page 166.
SCIENCE, Vol. 227, 1st February 1985, R. SANCHEZ-PESCADOR et al., "Nucleotide Sequence and Expression of an AIDS-Associated Retrovirus (ARV-2)", pages 484-492.
NATURE, Vol. 312, No. 5990, 8 November 1984, M.P. KIENY et al., "Expression of Rabies Virus Glycoprotein from a Recombinant Vaccinia Virus", pages 163-166.
SCIENCE, Vol. 233, 11 July 1986, L.A. LASKY et al., "Neutralization of the AIDS Retrovirus by Antibodies to a Recombinant Envelope Glycoprotein", pages 209-212.
BIO/TECHNOLOGY, Vol. 4, No. 9, September 1986, M.P. KIENY et al., "AIDS Virus env Protein Expressed from a Recombinant Vaccinia Virus", pages 790-795.
NATURE, Vol. 320, 10 April 1986, S. CHAKRABARTI et al., "Expression of the HTLV-III Envelope Gene by a Recombinant Vaccinia Virus", pages 535-537.
NATURE, Vol. 320, 10 April 1986, S.L. HU et al., "Expression of AIDS Virus Envelope Gene in Recombinant Vaccinia Viruses", pages 537-540.
SCIENCE, Vol. 233, 8 August 1986, A.G. FISCHER et al., "Infectious Mutants of HTLV III With Changes in the 3'Region and Markedly Reduced Cytopathic", page 658.
Download PDF:
Claims:
REVENDICATIONS
1. Vecteur viral caractérisé en ce qu'il comporte au moins : une partie du génome d'un virus, un gène codant pour l'une des glycoproteines (gp) de l'enveloppe du virus responsable du SIDA, ainsi que les éléments assurant l'expression de cette glycoprotéine dans des cellules.
2. Vecteur viral selon la revendication 1 , caractérisé en ce que la partie du génome d'un virus est une partie du génome d'un poxvirus.
3. Vecteur viral selon la revendication 2, caractérisé en ce que le poxvirus est la vaccine.
4. Vecteur viral selon les revendications 1 à 3, caractérisé en ce que le gène codant pour l'une des gp de l'enveloppe est le gène codant pour la gp 160.
5. Vecteur viral selon les revendications 1 à 3, caractérisé en ce que le gène codant pour l'une des gp est le gène codant pour la gp 41. 6.
6. Vecteur viral selon les revendications 1 à 3, caractérisé en ce que le gène codant pour l'une des gp est le gène codant pour la gp 120.
7. Vecteur viral selon les revendications 1 à 6, caractérisé en ce que le gène codant pour la gp de l'enve loppe du virus responsable du S.I.D.A. est précédé de la séquence signal S du gène env.
8. Vecteur viral selon les revendications 1 à 7, caractérisé en ce que le gène codant pour la gp de l'enve¬ loppe du virus responsable du S.I.D.A. est suivi de la séquence transmembranaire tm du gène env.
9. Vecteur viral selon les revendications 1 à 8, caractérisé en ce qu'il comporte une séquence signal et/ou une séquence transmembranaire provenant d'un virus hétéro¬ logue.
10. Vecteur viral selon la revendication 9 , caractérisé en ce que la séquence signal et/ou la séquence transmembranaire provenant d'un virus hétérologue provient du virus de la rage.
11. Vecteur viral selon les revendications 1 à 3 et 7 à 10, caractérisé en ce que le gène codant pour l'une des gp est le gène env total comportant depuis l'extrémité 5' : la séquence signal du gène env, la gp 120, la gp 40, la zone transmembranaire (tm) du gène env.
12. Vecteur viral selon la revendication 11, caractérisé en ce que le gène codant pour le gène env total est le gène env du virus LAV.
13. Vecteur viral selon les revendications 7 à 12, caractérisé en ce que la zone tm a été mutée pour remplacer le codon Arg par un codon Ile.
14. Vecteur viral selon les revendications 1 à 13, caractérisé en ce que le gène env a subi une mutation pour supprimer le site de clivage par les protéases entre la gp 120 et la gp 40.
15. Vecteur viral selon l'une des revendications 1 à 14, caractérisé en ce que la séquence d'ADN codant pour la ou les gp est sous la dépendance d'un promoteur d'un gène du proxvirus.
16. Vecteur.viral selon la revendication 15, caractérisé en ce que le promoteur est un promoteur du gène de la vaccine.
17. Vecteur viral selon la revendication 16, caractérisé en ce que la séquence d'ADN codant pour la ou les gp .est sous le contrôle du promoteur du gène de la protéine 7,5 K de la vaccine.
18. Vecteur viral selon l'une des revendications 15 à 17, caractérisé en ce que la séquence codant pour la ou les gp est clonée dans le gène TK de la vaccine.
19. Vecteur viral selon l'une des revendications L à 18 * caractérisé en ce que le gène env a subi au moins deux mutations pour supprimer les sites de clivage par les protéases dans la région de la jonction gpl20 et gp40.
20. Vecteur viral selon la revendication ^ caracté¬ risé en ce que les séquences codant pour les régions excracy toplasmique et intracytoplasmique sont fusionnées en phase, après délétion du peptide hydrophobe Cterminal.
21. Vecteur viral selon l'une des revendications 1 à 18 ' caractérisé en ce que le gène codant pour la gρ40 est dépourvu des séquences codant pour la partie Nterminale hydrophobe de cette gp.
22. Vecteur viral selon l'une des revendications 1 à 1 caractérisé en ce que les régions extracytoplasmique et intracytoplasmique de la gplôO sont fusionnées en phase, après délétion du peptide hydrophobe C ter inal.
23. Vecteur viral selon l'une des revendications précédentes, caractérisé en ce qu'il comporte une séquence codant pour l'une des protéines suivantes : J S gpl20 gp40 (tm) S est un peptide signal. gpl20 est la glycoprotéine 120, J schématise la partie de jonction entre la gpl20 et la gp40 dépourvue de site de clivage par les protéases, gp40 est la glycoprotéine 40, tm est un peptide transmembranaire.
24. Vecteur viral selon la revendication 23 caracté¬ risé en ce que la glycoprotéine 40 est dépourvue de son ex trémité Nterminale hydrophobe.
25. Vecteur viral selon l'une des revendications 19 à 4, caractérisé en ce qu'il comporte une séquence codant pour une protéine de structure : S gp40 tm ou S gpi20 tm dans Laquelle gp40 est la glycoprotéine 40 dépourvue de son extrémité Nterminale hydrophobe, S, tm et gpL20 ayant les signi ications données dans la revendications.
26. Vecteur viral choisi parmi : W.TG. eLAV 1125 (91) W.TG. eLAV 1128, W.TG. eLAV 1130, W.TG. eLAV 1131 , W.TG. eLAV 1132, W.TG. eLAV 1133, W.TG. eLAV 1134.
27. Vecteur viral choisi parmi : W.TG.eLAV1135 . W.TG.eLAV1136 W.TG.eLAV1137 W.TG.eLAV1138 .
28. Vecteur viral choisi parmi : W.TG.eLAV1162 W.TG.eLAV1163 .
29. ADN recombinant correspondant à un vecteur viral selon l'une des revendications 1 à 28.
30. • Culture de cellules de mammifères infectées par un vecteur viral selon l'une des revendications 1 à 28. ou comportant un ADN selon la revendication 29.
31. 31 Procédé de préparation de glycoproteines d'enveloppe de virus responsable du S.I.D.A., caractérisé en ce que l'on cultive des cellules selon la revendication 30 et que l'on récupère les glycoproteines produites.
32. • Glycoproteines d'enveloppe de virus respon¬ sable du S.I.D.A. obtenues par mise en oeuvre du procédé selon la revendication 31.
33. Glycoprotéine selon la revendication 32 caractérisée en ce qu'elle comporte, en outre, une partie de glycoprotéine de la rage.
34. Vaccin caractérisé en ce qu'il est constitué par un vecteur viral selon l'une des revendications 1 à 28 et/ou par les glycoproteines selon l'une des revendications 32ou 33..
35. Vaccin selon la revendication 34, caractérisé e ce qu'il comporte plusieurs vecteurs viraux de structure différente et/ou plusieurs glycoproteines de structure diff rente. 3g. Vaccin selon la revendication 35» caractérisé e ce qu'il comporte en association les virus VV.TG.eLAV1136 e W.TG.eLAVl138 ou les glycoproteines correspondantes. 37 '. Anticorps dressés contre les glycoproteines d'enveloppe du virus responsable du S.I.D.A., caractérisés en ce qu'on inocule un organisme vivant avec un vecteur viral selon l'une des revendications 1 à 28 ou avec les glycoproteines obtenues selon les revendications 32 ou 33 et en ce qu'on récupère les anticorps formés après un temps déterminé.
Description:
Vecteur viral, codant pour une glycoprotéine du virus responsable du S.I.D.A., vaccin et anticorps.

La présente invention concerne plus particu¬ lièrement un vaccin destiné à la prévention du S.I.D.A..

Le syndrome d 1 im unodéficience acquise (S.I.D.A.) est une affection virale qui présente ain- tenant une importance majeure en Amérique du Nord, en Europe et en Afrique centrale.

Les estimations récentes suggèrent que environ 1 Million d'Américains peuvent avoir été exposés au virus du S.I.D.A. Les individus affectés présentent une immunodépression sévère et la maladie est, en géné¬ ral, fatale.

La transmission de la maladie s'effectue le plus souvent par contact sexuel, bien que les personnes utilisant des stupéfiants par voie intraveineuse repré- sentent également un groupe à haut risque ; d'autre part, un grand nombre d'individus ont été infectés par ce virus après avoir reçu du sang ou des produits san¬ guins contaminés.

L'agent causal de cette affection est un rétro- virus. De nombreuses affections animales ont été attri-.. buées auxrétrovirus, mais c'est seulement récemment que des rétrovirus affectant des hommes ont pu être décrits.

Alors que des rétrovirus des cellules T humaines (HTLV: human T leu emia virus)de types I et II ont été impliqués comme agent causal de certaines leucémies des cellules T chez les adultes, le rétrovirus associé à des lymphadénopathies (virus LAV) , qui est également appelé virus KTLV III ou A.I.D.S.-related virus (ARV), est main¬ tenant couramment accepté comme l'agent responsable du S.I.D.A.

Le génome du rétrovirus LAV a été caractérisé de façon très complète ( ain-Hobson et al., 1985 ; Ratner et al., 1985 ; Muesing et al., 1985 ; Sanchez- Pescador et al., 1985) et des informations sur la sé- quence indiquent une relation étroite avec le groupe des

lentivirus. Les lentivirus, dont le prototype est le virus ovin Visna, sont les agents de maladies à progression très lente et qui présentent typiquement une période d'incubation prolongée. Le LAV et le virus Visna par- tagent de nombreuses similarités, en particulier dans leur tropisme pour le tissu neurai.

Par analogie avec d'autres rétrovirus bien connus, les trois plus importantes parties du génome du LAV ont été désignées par gag, pol et env. La séquence du gène env incluant la séquence de la gp120 et de la gp41 révèle des caractéristiques qui étaient attendues d'une glycoprotéine d'enveloppe transmembranaire et l'identité du précurseur de la protéine env, gp160,constitué par la gpl2θ et la gp41, a été confirmée par un séquençage direct des acides aminés.

Dans ce qui suit, la gp41 sera parfois dénommée gp40 ou gp 42.

Des anticorps dressés contre la protéine env gp160 et ses produits de clivage gp120 et gρ41 , sont communément détectés dans le sérum de patients ayant le S.I.D.A., et la glycoprotéine env représente l'antigène de surface majeur du virus du S.I.D.A.

La protéine env est ainsi le candidat le plus prometteur pour développer une stratégie de vaccination, c'est pourquoi l'attention a été concentrée sur cette protéine et sur sa séquence codante.

Un grand nombre de groupes ont rapporté l'ex¬ pression de la protéine env dans les bactéries. Toute¬ fois, l'absence de glycosylation et de structuration post-traductionnelle peuvent compromettre le pouvoir immunogène des matériaux synthétisés par de tels micro¬ organismes.

C'est pourquoi la présente invention propose d'utiliser comme vecteur d'expression de la protéine env un vecteur viral permettant l'expression de la pro¬ téine dans un environnement qui permettra sa glycosylation et sa restructuration post-traductionnelle.

C'est pourquoi la présente invention concerne un vecteur viral caractérisé en ce qu'il comporte tout ou partie du gène env du virus responsable du S.I.D.A.

Parmi les vecteurs viraux utilisables, il faut citer plus particulièrement les poxvirus, et notamment le virus de la vaccine (W) .

Le virus de la vaccine est un virus à ADN double brin qui a été utilisé très largement dans le monde entier pour contrôler et éradiquer la variole. Des déve- loppements techniques récents ont permis le développement de ce virus comme vecteur de clonage et des virus recom¬ binants vivants ont permis d'exprimer des antigènes étran¬ gers et même d'obtenir des immunisations contre différen¬ tes maladies virales ou parasitaires. Ainsi, plusieurs groupes ont récemment mis en évidence l'utilisation de recombinants de ce type pour exprimer l'antigène de l'Influenza, de l'hépatite B et la glycoprotéine de la rage pour immuniser contre ces maladies (Smith et al., 1983 ; Panicali et al., 1983 ; Kieny et al., 1984) .

L'expression d'une séquence codant pour une protéine étrangère par le virus de la vaccine (W) impli¬ que nécessairement deux étapes :

1 ) la séquence codante doit être alignée avec un promo- teur de W et être insérée dans un segment non essentiel de l'ADN de W, clone dans un plasmide bactérien approprié ;

2) les séquences d'ADN de W situées de part et d'autre de la séquence codante doivent permettre des reco - binaisons homologues in. vivo entre le plasmide et le génome viral ; une double recombinaison réciproque conduit à un transfert de l'insert d'ADN du plasmide dans le génome viral dans lequel il est propagé et exprimé (Panicali et Paoletti, 1982 ; Mackett et al., 1982 ; Smith et al., 1983 ; Panicali et al., 1983) .

Bien entendu, l'utilisation de ce type de vec¬ teur implique souvent une délétion partielle du génome du virus vecteur.

La présente invention concerne plus part--.culiè- rement un vecteur viral caractérisé en ce qu'il comporte au moins :

- une partie du génome d'un virus vecteur,

- un gène codant pour l'une des glycoproteines

(gp) de l'enveloppe du virus responsable du SIDA. - ainsi que les éléments assurant l'expression de cette glycoprotéine dans des cellules. L'invention concerne également les ADN recombinants correspondant auxdits vecteurs viraux.

Il convient de remarquer que les glycoprot ines (gp de l'enveloppe du virus responsable du SIDA sont au nombre de

3, désignées par leur masse en kDA, à savoir la gp160, la gp1 et la gp41 ; la première, gp160, est en fait le précurseur de deux dernières protéines. Ces dénominations ne sont pas encor figées et la gp41 est parfois appelée gp40 ou gp42 mais les différences de masse font que ces 3 glycoproteines sont par falternent identifiables, quelle que soit leur dénomination.

Par virus responsable du SIDA, on entend notam¬ ment désigner le virus LAV, le virus HTLV III ou ARV, de même que d'éventuels mutants ponctuels ou des délé- tions partielles de ces virus, ainsi que les virus apparentés.

Les vecteurs viraux, dans la partie correspondant au génome du virus vecteur (distinct du virus responsable du S.I.D.A.), peuvent être constitués à partir du génome d'un virus d'origine quelconque. Toutefois, on préférera utiliser une partie du génome d'un poxvirus et plus parti¬ culièrement une partie du génome de la vaccine.

Les conditions nécessaires pour l'expression d'une protéine hétérologue dans le virus de la vaccine ont été rappelées précédemment.

De façon générale, le gène en cause, par exemple le gène env, devra, pour pouvoir être exprimé, être sous la dépendance d'un promoteur d'un gène de la vaccine, ce promot sera en général le promoteur de la protéine 7,5K de la vacci

- 5 En outre, la séquence codante devra être clonée dans un gène non essentiel de la vaccine qui pourra éventuellement servir de gène marqueur.Dans la plupart des cas, il s'agira du gène

Parmi les glycoproteines de l'enveloppe que l'on souhaite voir exprimer, il faut citer les trois protéines

10 mentionnées précédemment, à savoir la gp 160, la gp 41 et la gp 120.

De façon générale, on préférera faire exprimer le gène d'enveloppe complète, c'est-à-dire le gène env comportant la séquence signal et la séquence transmembra—

15 naire de ce gène.

Les premiers essais conduits avec un vecteur viral dans lequel a été clone le gène codant pour la protéine env totale a conduit à proposer des modifica¬ tions de ce gène pour améliorer 1'immunogénicité des

20 produits d'expression.

On a constaté un relargage important de la protéine env dans les surnageants de culture (relargage qui se produit, probablement in vivo, dans les liquides circulants) . Ceci peut être dû à un

25 mauvais accrochage de la protéine dans la membrane cellu¬ laire ; on sait en outre que la présentation des anti- •- gènes à la surface des cellules est très importante pour l'induction d'une réponse immunitaire avec le système vaccine. On propose donc de modifier le gène env de façon

30 à améliorer l'ancrage de la glycoprotéine dans la mem-

- brane cellulaire.

Pour ce faire, le gène env pourra être modifié au niveau de sa partie codant pour la zone transmembra- naire afin de remplacer le codon correspondant à une 35 arginine par un codon correspondant à une isoleucine.

Il existe également une possibilité d'améliorer l'ancrage en remplaçant et/ou en ajoutant à la zone transmembranaire de la protéine env la zone transmembra- naire d'un virus hétérologue, par exemple la zone trans- membranaire de la gp du virus de la rage.

De plus, il se pourrait que la protéine ne soit pas bien assemblée à la suite de son expression- En effet, le peptide signal est assez atypique, et pourrait nuire à l'exportation complète de la protéine. C'est pourquoi il est proposé de remplacer et/ou d'ajouter une séquence signal qui provienne d'un virus hétérologue, par exemple la séquence signal de la gp du virus de la rage.

Enfin, il semble que c'est la gp 120, plutôt que la gp 160, qui est relarguée par les cellules. Elle peut, d'une part, fournir un leurre pour le système immu¬ nitaire., d'autre part en accord avec des données récentes, aller se fiicer sur les cellules T4, ce qui pourrait avoir pour effet d'inactiver les cellules T4 ou de les faire apparaître comme étrangères aux autres cellules T. II peut donc être intéressant d'obtenir une protéine env gp 120 qui ne puisse pas être relarguée. Ceci est effectué en modifiant le gène env entre les séquences codantes de la gp 120 et de la gp 41 pour supprimer le≤site≤de clivage par les protéases situé entre la gp 120 et la gp 41 en particulier par la suppressio du site REKR.

Dans les plasmides selon l'invention, on effectue au ixioins une mutation supplémentaire dans un site correspondant à une séquence KRR située 8 aminoacides en aval de la séquen¬ ce REKR. La gp!60 ainsi obtenue n'est plus clivée.

Les vecteurs selon la présente invention comportent également une séquence codant pour la gp4l dépourvue de la séquence correspondant à son peptide N- terminal hydrophobe dont on pense qu' il pourrait être responsable du pouvoir syncitial de la protéine env c'est-à-dire la capacité pour le virus de fusionner les cellules et d'obtenir une cellule géante ou syncitium.

Enfin, la présente invention concerne des vecteurs viraux dans lesquels les régions extracytoplasmique et intra- cytoplasmique de la gpl60 sont fusionnées en phase après délétion du peptide hydrophobe C-terminal ce qui permet d'o b - tenir une sécrétion de la glycoprotéine.

De façon générale, les vecteurs viraux selon l'in¬ vention comportent une séquence codant pour l'une des proté¬ ines suivantes :

J

- S - gpl20 gp40 - (tm) - . S est un peptide signal,

. gpl20 est la glycoprotéine 120,

. J schématise la partie de jonction entre la gpl20 et la gp40 dépourvue de site de clivage par les protéases, . gp40 est la glycoprotéine 40, . tm est un peptide transmembranaire ou bien encore pour une protéine de structure :

- S - gp40 - tm ou

- S- gpl20 - tm

Le peptide signal et la séquence transmembranaire peuvent être ceux du virus responsable du SIDA ou bien être hétérologues, en particulier provenir du virus de la rage ou du V5V ou de tout virus à enveloppe.

La gp40 peut éventuellement être dépourvue de son extrémité N-terminale hydrophobe. La première invention concerne principalement l'utilisation de vecteurs viraux pour l'obtention des glycoproteines codées par le gène env du virus LAV dans des cultures cellulaires. Il s'agit donc dans un premier temps de cellules de mammifères qui ont été infectées par un vecteur viral selon l'invention ou bien qui peuvent con¬ tenir l'ADN recombinant correspondant ; parmi ces cellules, il faut citer plus particulièrement les cellules diploïdes

humaines, des cultures primaires ainsi que les cellules Vero Bien entendu, il est possible de prévoir d'autres types de cellules comme cela ressortira d'ailleurs des exemples ci-ap Les glycoproteines ainsi obtenues peuvent être utilisées après purification pour la réalisation de vaccins.

Il est également possible de prévoir l'utili¬ sation directe des vecteurs viraux selon l'invention afin d'effectuer une vaccination, les glycoproteines étant alors produites in situ et in vivo.

Il est intéressant de prévoir l'utilisation associé de plusieurs agents vaccinants administrés conjointement ou séparément, en particulier les agents vaccinants correspon¬ dant aux vecteurs exprimant séparément la gpl20 et la gp40 ayant subi la modification décrite précédemment. Par exemple il peut être intéressant d'utiliser conjointement les agents vaccinants issus des vecteurs 1136 et 1138qui seront décrits ci-après.

Enfin, la présente invention concerne également les anticorps dressés contre les glycoproteines précé¬ dentes obtenus par infection d'un organisme vivant avec un vecteur viral tel que décrit précédemment et récupé¬ ration des anticorps induits après un temps déterminé.

Les techniques mises en oeuvre pour l'obtention des glycoproteines, les cultures cellulaires et les tech¬ niques de vaccination sont identiques à celles qui sont pratiquées actuellement avec les vaccins connus et ne seront pas décrites en détail.

La présente invention sera mieux comprise à la lecture des méthodes et exemples suivants.

Cinq- figures illustrent les exemples : - la figure 1 représente l'action de l'endo-F sur les protéines synthétisées par les recombinants WTGeLAV9-1 et WTGeLAV1132 et immunoprécipitées grâce à un sérum anti-LAV. Dans cette figure, les poids molé¬ culaires sont donnés en kilodaltons, et on représente par :

P, le culot cellulaire S, le surnageant u, les produits obtenus sans traitement e, les produits obtenus après traitement à l'endo-F. - La figure 2 représente la reconnaissance des protéines du virus LAV par les sérums de souris vacci¬ nées avec le recombinant WTGeLAV9-1. Dans cette figure, T représente les cas où le sérum utilisé est celui d'un malade atteint de SIDA. Les poids moléculaires sont ex¬ primés en kdaltons.

- La figure 3 représente l'immunoprécipitation des protéines synthétisées par les virus de la vaccine recombinants portant le gène env. Dans cette figure, les poids moléculaires sont en kDaltons.

- la figure 4 représente une immunoprécipitation des proté¬ ines synthétisées par les virus recombinants W.TG.eLAV 1135, 1136, 1137 et 1138.

Le virus 1135 synthétise une gplôO qui n' pparait pas dans le surnageant de culture.

En ce qui concerne les virus 1136 et 1138, ils produisent des protéines gpl20 et gp40 respectivement, associées au culot cellulaire.

Le virus 1137 produit une protéine légèrement plus petite que le virus 1135, avec un PM en accord avec celui atten¬ du.

- la figure 5 représente la structure des protéines env syn¬ thétisées par les virus recombinants»

S : peptide signal

Il : zone hydrophobe interne

TM : zone d'ancrage transmembranaire t : site de clivage gpl20/gp40 w : séquence provenant de la glycoprotéine rabique

METHODES Clonages : Maniatis et al., 1982. Enzymes : utilisées selon les prescriptions du fournisseur, Mutagénèse localisée : méthode dérivée de Zoller and Smith, 1983.

Transfert dans la vaccine : Kieny et al., 1984. Seule différence : les cellules humaines 143B remplacent les cellules LMTK~. Préparation du stock de virus

Les cellules primaires de poulet "ger free" sont infectées à 0,01 pfu/cellule pendant 4 jours à une température de "37 β C (milieu MEM + 5 % NCS) . Purification du virus On effectue une centrifugation du stock de virus ci-dessus pendant 15 minutes à 2 500 tours (Rotor GSA Sorvall) . Le surnageant est mis de côté. On reprend le culot dans un tampon RSB (Tris HCl 10 M pH 7,4, KC1 10 mM, MgCl- 1 mM) pendant 15 minutes à 4°C. On effectue un broyage au potter, puis une centrifugation pendant 15 minutes à 2 500 tours. Le surnageant est ajouté au précédent puis on effectue un deuxième broyage de la même façon.

Tous les surnageants sont déposés sur 10 ml de coussin de saccharose 36 % (p/v) (Tris 10 mM pH 8). On effectue une centrifugation pendant 2 heures à 14 000 tours (Rotor S 28, Beckman) .

Le culot est repris, dissocié et remis sur un deuxième coussin identique. Le 2ème culot est repris

dans 5 ml PBS et chargé sur un gradient 20-40 % de Saccharose (Tris 10 mM pK 8) (même rotor). On effectue une centrifugation pendant 45 minutes à 12 000 tours. On récupère la bande de virus - Elle est culottée par centrifugation pendant 1 heure à

20 000 tours. Le culot est repris dans du Tris 10 mM pH 8.

Immunoprécipitations

On effectue une infection de cellules BHK-21 (boîtes de 3 cm de diamètre, 10 cellules par boîte, cultivées en G-MEM + 10 % FCS) à 0,2 pfu/cellule pen¬ dant 18 heures. Le milieu est décanté et remplacé par 1 ml de milieu sans méthionine et 10 μl de méthionine S (Amersham) par boîte. On ajoute un excès de méthionine non radio¬ active après 2 heures.

A la fin du marquage, on effectue un grattage des cellules infectées, une centrifugation pendant 1 minute dans une centrifugeuse Eppendorf, une sépara- tion des fractions surnageant et culot, un lavage du culot une fois en tampon PBS, puis une immunoprécipita- tion et un gel d'électrophorèse (selon Lathe et al., 1980). Traitement endo-F

Après immunoprécipitation des protéines marquées par un sérum de malade atteint du SIDA, la fraction protéine- sepharose est reprise dans :

0,2 M phosphate de Na, pH 6,1 0,05 % SDS 0,1 % Nonidet P40 0,1 % Beta-mercaptoéthanol

0,1 % EDTA pH 8 et bouillie pendant 5 minutes pour dénaturer les protéines On effectue une incubation pendant 20 heures à 37°C, avec 4 unités d r Endo-F par ml, puis une précipita- tion pendant 2 minutes dans la glace avec 1/5 de volume de TCA 100 %. On lave le culot 3 fois à l'acétone 80 %,

on ajoute le tampon d'échantillon et on charge sur gel SDS.

Dosage des anticorps par test ELIΞA - LAV 5 Utilisation du test ELAVIA (Pasteur-Diagnostic) avec un deuxième anticorps mouton-antisouris lié à la peroxydase.

Vaccine Des plaques 96 trous (NUNC) à fond plat sont rcr incubées pendant 18 heures à 37°C avec 1O 7 pfu de virus de la vaccine type sauvage en tampon carbonate. Les plaques sont ensuite saturées avec de la gélatine 0,01 %. Les sérums de souris sont alors adsorbés sur les plaques et on effectue le reste du protocole comme pour l'Elisa 15 LAV.

Lectures à 492 nM.

* EXEMPLE 1 Construction des plas ides hybrides Les tailles combinées des différents éléments 20 nécessaires pour letransfert de la séquence codant pour le gène env dans le génome de W et son expression sub¬ séquente sont de l'ordre de plusieurs Kb. Il a donc été jugé nécessaire de minimiser la taille du plasmide de réplication dans E. coli utilisé pour le travail de 25 construction de façon à faciliter les manipulations nécessaires.

Le fragment EindIII (Hin-J) du génome de W contient le gène complet de la thymidine kinase (TK) qui a déjà été utilisé précédemment pour permettre l'échange 30 et la recombinaison de 1'ADN inséré dans le génome de W (Mackett et al., 1982). Il est important de noter que le transfert d'un insert dans le gène TK du génome de W crée un virus TK déficient qui peut être sélec¬ tionné. Il a tout d'abord été nécessaire de produire 35 un plasmide de petite taille portant un site unique

HindIII utilisable pour l'intégration du fragment Hin-J VV. En outre, il était nécessaire d'éliminer les séquen¬ ces de restriction non nécessaires du plasmide de façon à permettre les manipulations suivantes. La construction a été amorcée à partir du plas¬ mide pML2 (Lusky et Botchan, 1981) qui est un vecteur dérivé du plasmide pBR322 par délétion spontanée dans lequel le segment entre les nucléotides 1089 et 2491 a été perdu. D'abord la séquence de PstI a été éliminée par insertion du fragment AhalII-AhalII de pUC8 (Vieira et Messing, 1982) entre deux sites AhalII de pML2 en éliminant 19 paires de bases. On a utilisé la méthode du "linker-tailing" (Lathe et al., 1984) pour insérer un linker HindIII entre lessites NruI et EcoRI traité par S1 de ce plasmide, en éliminant le site BamHI. Ceci conduit à un plasmide de 2049 paires de bases portant le gène bêta-lactamase fonctionnel (conférant la résistance à l'ampicilline) et comportant en outre une origine de réplication active dans E. coli et un site de restriction unique HindIII.

Cette construction a été appelée pTG1H.

Le fragment Hin-J de l'ADN de W portant le gène TK a préalablement été clone dans un vecteur pro¬ venant de ρBR327 (Drillien et Spehner, 1983). Ce frag- ment de 4,6 Kb a été recloné dans le site HindIII de pTG1H. Un clone a été sélectionné dans lequel le gène TK est situé distalement par rapport au gène codant pour la résistance à l'ampicilline.

Cette construction pTG1H-TK a été utilisée comme vecteur dans l'expérience suivante.

L'étape suivante a été d'isoler un promoteur de W utilisable pour commander l'expression de la séquence codant pour le gène à exprimer. Le promoteur d'un gène précoce codant pour une protéine de 7500 daltons (7,5 K) a déjà été utilisé avec succès dans un but

identique (Smith et al., 1983) et on a donc procédé à l'isolement de ce segment.

Le gène 7,5 K est situé sur l'un des plus petits fragments Sali (fragment Sal-S) du génome de W type WR (Venkatasan et al., 1981). Comme les petits fragments sont clones de façon préférentielle, une grande propor¬ tion des clones obtenus par clonage direct de l'ADN de W type WR coupé par Sali dans le plasmide pBR322 porte le fragment Sal-S. Ce fragment est transféré sur le bactériophage vecteur M13mp701 (voir Kieny et al., 1983), par digestion Sali et religation, en conduisant ainsi au phage Ml3TGSal-S.

Dans ce clone, un site Seal se trouve immédia¬ tement à proximité de l'ATG d'initiation du gène 7,5 K. En aval du gène 7,5 K se trouvent situés des sites uniques BamHI et EcoRI- provenant du vecteur. Les sites BamHI et Seal sont fusionnés par l'intermédiaire d'un linker BglII 5' -CAGATCTG-3' après avoir complété les extrémités générées par digestion BamHI avec le fragment Klenow de la polymérase de E. coli. Ce procédé élimine le site Seal mais reconstitue le site BamHI et déplace le site unique EcoRI en aval. En même temps, le site Sali (AccI) en aval est éliminé, le site Sal I en amont devient donc unique. Cette construction est appelée M13TG 7,5 K.

A l'intérieur du fragment Hind-J de l'ADN de W se trouvent situés des sites Clal et EcoRI qui sont séparés par environ 30 paires de bases (Weir et Moss, 1983). Le fragment promoteur de 7,5 K présent dans M13TG7, 5K est excisé par AccI et EcoRI et clone entre les sites Clal et EcoRI de pTG1H-TK pour générer pTG1H-TK-P7,5K.

Cette construction conduit au transfert des sites BamHI et EcoRI uniques du vecteur M13 i média- te ent en aval de la séquence du promoteur 7,5K.

Ces sites uniques BamHI et EcoRI sont utilisés dans la construction suivante.

Le segment polylinker du bactériophage M13TG131 (Kieny et al., 1983) est excisé par EcoRI et Bgl II et inséré entre les sites EcoRI et BamHI du plasmide pTG1H-TK-P7,5K, générant pTG186-poly. Dans cette construction, 10 sites de restriction sont disponibles pour le clonage d'un gène étranger sous le contrôle de P7,5K.

EXEMPLE 2

Construction du plasmide portant la séquence env. Afin d'obtenir une séquence codante pour env, on effectue tout d'abord l'assemblage des deux seg- ments proviraux clon s dans les plasmides PJ19-6 et PJ19-13

De façon à assurer une traduction adéquate du mARN de env, la séquence de nucléotides autour du site d'initiation de la traduction présumée du gène env a été modifiée pour s'adapter à la séquence consensus des gènes eucaryotes et ceci par une muta- génèse dirigée avec un oligonucléotide au voisinage de la position 5767.

Les plasmides PJ19-13 et PJ 19-6 con¬ tiennent des fragments HindIIIdu génome proviral de LAV comprenant les nucléotides 1258 à 1698 et 1698 à 9173 respectivement.

Un fragment EcoRI-Kpn1 de PJ19-13 (contenant l'ATG d'initiation de env) a été inséré dans le phage M13TG130 et on a effectué une mutagénèse dirigée avec un oligonucléotide (séquence 5'CTCTCATTGTCACTGCAGTCTGCTCTTTC) ,

pour introduire un site PstI en amont du codon d'ini¬ tiation de la traduction de env (position 5767) et afin de substituer le G à la position -3 par un A. Le frag¬ ment muté a été introduit ensuite entre les sites EcoRI et Kpnl du plasmide pTG1-P0LY (qui est un mini plasmide de 2,1 kb similaire à pTG1H mais qui contient un segment polylinker de M13TG131.

Le fragment Kpni-HindIII provenant de PJ 19-13 a été ensuite clone dans le même plasmide (entre Kpnl et HindIII) , suivi par un fragment HindIII-Xhol de PJ 19-6 (entre HindIII et Sali) pour générer une séquence codante env complète flanquée par deux sites PstI (plasmide pTG1124).

L'introduction de ces deux sites de restriction PstI permet une manipulation plus aisée de l'ADN du gène env dans la suite de la construction. Comme cela a été indiqué précédemment, l'expression d'une protéine hété¬ rologue dans le virus de la vaccine nécessite que la séquence codante soit alignée avec une séquence de pro- moteur de la vaccine et soit insérée dans un segment non essentiel de l'ADN de la vaccine. Cet ADN situé de part et d'autre permet la recombinaison avec le génome de la vaccine in vivo par une double recombinaison réciproque, qui transfère la séquence codante et le promoteur accom- pagnant dans le génome de la vaccine.

Pour ce faire, le fragment Pstl-PstI mentionné précédemment a été clone dans le site PstI de pTG186-POLY. On obtient ainsi un plasmide dénommé pTG1125.

Le plasmide pTG186-POLY peut être généré à partir du plasmide pTG188 digéré par PstI et religué par la ligase T4.

Le plasmide ρTG188 a été déposé le 20 juin 1985 à la Collection Nationale de Cultures de Microόrganismes de l'Institut Pasteur - 28, rue du Docteur Roux - 75015 PARIS sous le numéro suivant :

E. Coli 5KpTG188 = n° I 458.

Le transfert de la séquence codante du gène env et du promoteur accompagnant dans le génome de la vaccine est effectué comme suit.

EXEMPLE 3 - Clonage dans le virus de la vaccine pour générer W.TG.e LAV 9-1 La stratégie décrite par Smith et coll. (1983) repose sur l'échange in vivo entre un plasmide portant un insert dans le gène W TK et le génome viral de type o sauvage de façon à inactiver le gène TK porté par le virus. Les virus TK peuvent être sélectionnés par éta¬ lement sur une lignée cellulaire (TK-négative) en présence de 5-bromodéoxyuridine (5BUDR) (Mackett et coll., 1982). La thymidine kinase phosphoryle le 5BUDR 5 en 5'-monophosphate, qui est ensuite converti en tri-

* ~> phosphate. Ce composé est un analogue de dTTP et son incorporation dans l'ADN bloque le développement correct du virus. Un virus TK~ peut néanmoins répliquer son ADN normalement et il conduit à des plages virales visibles 0 dans une lignée cellulaire également TK .

Le virus de la vaccine se propage dans le cytoplasme des cellules infectées plutôt que dans leur noyau. C'est pourquoi il n'est pas possible de tirer avantage de la machinerie de réplication et de trans- 5 criptiσn de l'ADN de l'hôte et il est nécessaire que le virion possède les composants pour l'expression de son génome. L'ADN de W purifié est non infectieux.

Afin de générer les recombinants, il est néces¬ saire d'effectuer simultanément l'infection cellulaire 0 avec du virion W et une transfection avec le segment d'ADN clone qui présente de l'intérêt. Toutefois, la génération des recombinants est limitée à la petite proportion des cellules qui sont compétentes pour la transfection par l'ADN. C'est pour cette raison qu'il

a été nécessaire de mettre en oeuvre une stratégie de "congruence" indirecte pour réduire le bruit de fond des virus parentaux non-recombinants. Ceci a été effec¬ tué en utilisant comme virus infectieux vivant un mutant thermosensible (ts) de la vaccine qui n'est pas capable de se propager à une température non permissive de 39,5°C (Drillien et Spehner, 1983). Lorsque les cellules sont infectées par un mutant ts dans des conditions non permissives et transfectées avec l'ADN d'un virus de type sauvage, la multiplication virale interviendra seulement dans les cellules qui sont compétentes pour la transfection et dans lesquelles une recombinaison entre l'ADN viral sauvage et le génome du virus ts aura eu lieu ; aucun virus ne se multipliera dans les autres cellules, en dépit du fait qu'elles ont été infectées. Si un plasmide recombinant contenant un fragment de l'ADN de vaccine tel que pTG11-25 est inclus dans le mélange de transfection, à la concentration appropriée, avec l'ADN du type sauvage, il est également possible d'obtenir qu'il participe à la recombinaison homologue avec l'ADN de la vaccine dans les cellules compétentes.

Des monocouches de cellules primaires de fibro- blastes d'embryons de poulets (CEF) sont infectées à

33°C avec W-Copenhague ts7 (0,1 pfu/cellule) et trans- fectées avec un coprécipité au phosphate de calcium de g l'ADN du virus de type sauvage W-Copenhague (50 ng/10 cellules) et le plasmide recombinant (50 ng/10 cellules). Après incubation pendant 2 heures à une tempéra¬ ture qui ne permet pas le développement du virus ts (39,5°C), les cellules sont incubées de nouveau pendant 48 heures à 39,5 β C. Des dilutions de virus ts sont utilisées pour réinfecter une monocouche de cellules humaines 143 B à 37 β C qui sont ensuite incubées en présence de 5BUDR (150 μg/ml) . Différentes plaques de virus TK~ sont obtenues à partir de ces cellules qui ont reçu le plasmide recombinant, tandis que les cultures contrôles

sans plasmide ne montrent pas de plaques visibles. Les virus TK sont ensuite sous-clonés par une deuxième sélection en présence de 5BUDR.

Une double recombinaison réciproque correcte entre le plasmide hybride pTG1125 et le génome de W aboutit à l'échange du gène TK portant l'insert avec le gène TK du virus, les recombinants devenant ainsi TK~.

Les ADN purifiés à partir des différents virus recombinants TK sont digérés par HindIIIet soumis à une électrophorèse sur gel d'agarose. Les fragments d'ADN sont transférés sur un filtre de nitrocellulose selon la technique décrite par Southern (1975). Le filtre est ensuite hybride avec le plasmide pTG1125 nick- translaté au 32P. Après lavage du filtre, ce dernier est fluorographié et des bandes de 3.85, 2.9, 0.8 Kb sont visibles sur l'autcradiographie quand le virus vaccine a incorporé le gène env du LAV. L'un de ces recombinants W.TG. eLAV 9-1 a été sélectionné pour les études sui¬ vantes.

EXEMPLE 4

Protéine env synthétisée à partir d'un virus recombinant vaccine-LAV

Pour mettre en évidence l'expression du gène env du LAV à partir du virus vaccine hybride, on infecte des cellules de rongeur, BHK21 , qui sont cultivées dans un milieu G-MEM + 10 % de sérum de veau foetal avec ledit recombinant W.TG. eLAV 9-1.

Une monocouche semi-confluente fraîche g (10 cellules) est infectée avec 0,2 pfu/cellule et incubée pendant 18 heures.

Le milieu est ensuite éliminé et on ajoute un milieu à faible teneur en méthionine (1 ml pour 10 cel- Iules) supplémenté avec 10 μl/ml de méthionine 35S.

Les cellules sont incubées à 37°C et les protéines

marquées sont collectées par centrifugation. Après sépa¬ ration en culot et surnageant, les protéines sont incubées avec un sérum appartenant à un patient atteint de SIDA. Les protéines réagissant avec le sérum sont récupérées par adsorptiûn sur une résine protéine A-sépharose et étalées par électrophorèse sur un gel de polyacrylamide SDS et autoradiographiées selon une technique décrite par Lathe et al., 1980. Les autoradiographies montrent que le sérum du patient atteint du SIDA lie spécifiquement trois protéines des extraits cellulaires infectés (le résultat est identique ou similaire à celui obtenu avec d'autres sérums de patients) . Les poids moléculaires apparents de 160, 120 et 41 Kd suggèrent l'équivalence avec les bandes gp 160, gp 120 et gp 41 identifiées par des sérums de malades atteints du SIDA, dans une préparation de glyco¬ protéine env. authentique et dans des extraits de cel¬ lules infectées par le virus LAV. Cette observation que* trois protéines sont exprimées à partir du vecteur recom¬ binant portant seulement la séquence codant pour le gène env du LAV supporte l'hypothèse que la gp 120 et gp 41 sont générées par clivage protéolytique du produit de traduction primaire gp 160.

La séquence codant pour env conduit à un produit de traduction primaire d'environ 90 kDA alors que le précurseur de env obtenu par le procédé précédent pré¬ sente un poids moléculaire apparent d'environ 160 kDA. Cette différence est attribuée à une glycosylation très importante. Par digestion avec l'endoglycosydase F qui élimine les groupes glycosyl, on a pu mettre en évidence une bonne corrélation entre les produits obtenus par la présente invention et les produits prévus (figure 1).

EXEMPLE 5

Mise en évidence des anticorps anti- env chez des souris vaccinées avec le virus W.TG.e LAV 9-1 Des souris Balb/c mâles de 5 semaines sont

- vaccinées par injection sous-cutanée de 5.10 pfu de virus W.TG.e LAV 9-1 par animal. Elles reçoivent une injection de rappel avec la même dose après 2 semaines, et subissent une prise de sang 1 , 2 et 4 semaines après le rappel. La présence d'anticorps dirigés contre des déterminants du virus LAV et du virus de la vaccine dans leurs sérums est recherchée.

Tous les animaux vaccinés donnent des sérums capables de réagir avec le virus de la vaccine dans un test ELISA. Par contre, la réponse en test ELISA contre le virus LAV est faible et peu reproductible. Pour amé¬ liorer la sensibilité des tests, une technique de

*

"Western blot" a été utilisée. Cette méthode permet de mettre en évidence les anticorps capables de réagir avec les protéines du virus LAV après que celles-ci aient été dénaturées au SDS dans un gel d'électrophorèse et trans¬ férées sur une membrane de nitrocellulose. Dans cette expérience, les membranes de nitrocellulose employées sont celles du kit LAV-BLOT vendu par Diagnostic Pasteur et sur lesquelles les protéines du virus LAV sont déjà fixées. Ces membranes sont découpées en bandes, et chaque bande est incubée avec le sérum des souris vaccinées (dilution au 1/20). Un deuxième anticorps (mouton anti¬ souris) lié à la peroxydase permet de visualiser les protéines du virus LAV qui ont fixé des anticorps de souris.

Plusieurs sérums (12/27) donnent une réaction spécifique avec une protéine de poids moléculaire autour de 160 kDA, correspondant à la gp 160 de env (figure 2) . Dans un certain nombre de sérums, on observe également

une réaction avec la protéine gp 41. Il faut noter que les sérums de quelques souris produisent en Western blot des signaux correspondant à des protéines non-identifiées de la préparation de virus LAV fixée sur les membranes.

EXEMPLE 6

Construction de pTG1128 Ce plasmide pTG1128 est identique au plasmide 1125 à ceci près que la séquence codant pour la zone transmembranaire a été mutée pour remplacer l'arginine par une isoleucine, ceci afin d'améliorer l'accrochage de la protéine dans la membrane cellulaire.

Le fragment HindIII-BamHI de pTG1124 contenant la zone transmembranaire de env décrit à l'exemple 2 est inséré dans le phage M13 TG131 après une digestion HindIII- BamHI. On obtient ainsi un phage M13 TG154.

On effectue ensuite sur ce phage M13 TG154 une mutagénèse localisée destinée à remplacer le codon codant pour l'arginine par un codon codant pour l'iso¬ leucine. On utilise pour ce faire 1Oligonucléotide suivant :

5' GGTTTAATAATAGTTTT 3* . On obtient ainsi le phage M13 TG155, les séquen¬ ces ayant été modifiées comme suit :

Gly Leu Arg Ile Val Séquence originale : GGT TTA AGA ATA GTT

Séquence mutée : GGT TTA ATA ATA GTT

Ile Le fragment BamHI-HindlII ainsi muté est trans¬ féré de M13 TG155 dans le plasmide pTG1124 dans des sites équivalents pour donner le plasmide pTG1127 qui reconstitue le gène env comme précédemment sauf que le codon de l'arginine a été remplacé par un codon isoleucine.

Comme cela a été décrit dans l'exemple 1, le fragment Pstl-PstI de pTG1127 est clone dans le site PstI du plasmide pTG186-POLY pour donner le plasmide pTG1128.

EXEMPLE 7 Construction du plasmide pTG1130 Dans ce plasmide, la séquence codant pour la zone transmembranaire de la glycoprotéine rabique est fusionnée avec le début de la séquence codant pour la partie hydrophobe de la glycoprotéine env.

La zone transmembranaire de la glycoprotéine rabique provient d'un fragment BamHI-PstI du phage M13 TGRG151. Ce fragment est clone dans le phage M13 TG154 entre les sites BamHI et PstI (voir exemple précédent) . On obtient ainsi le phage M13 TG156.

On effectue ensuite une mutagénèse localisée sur M13 TG156 pour fusionner en phase les séquences env et rage avec un oligonucléotide en formant une boucle 5' GCTGTGGTATATAAAATATGTATTACTGAGTG 3'

Tyr Leu Lys Ile Phe Gly Lys Tyr Val

TAT ATÂ AAA ATA TTC GGG AAG TAT GTA tm env ^ jψ tm rage

On obtient ainsi le phage M13 TG157.

La zone transmembranaire (tm) de la glycopro¬ téine rabique qui vient d'être fusionnée avec le gène env est ensuite transférée dans le plasmide pTG1124. Pour ce faire, on clone le fragment HindlII- BglII de M13 TG157 dans pTG1124 dont on a effectué une restriction HindlII-BamHI (ceci détruit les sites BamHI et BglII) .

Le site BglII de M13 TG157 provient du fragment 9P rage :

BamHI BglII

t.m. PstI

On obtient ainsi le plasmide pTG1126.

Comme précédemment le fragment Pstl-PstI de pTG1126 est clone dans le site PstI de pTG 186-POLY pour donner le plasmide pTG1130.

EXEMPLE 8 Construction de pTG1T31 L'objectif de la construction de ce plasmide est de fusionner la séquence signal du gène env et la séquence signal de la glycoprotéine rabique.

La séquence signal de la glycoprotéine de la rage est prélevée à partir du plasmi -~de pTG155 PRO sous forme d'un fragment BglII-HindlII qui est clone dans les sites Pstl-HindIII de M13 TG130 grâce à un adaptateur simple brin ayant la séquence suivante :

5' GATCTGCA 3

On obtient ainsi le phage M13 TG158.

Le transfert du peptide signal de env dans M13 TG158 est ensuite réalisé afin de fusionner ce der¬ nier avec le gène codant pour le peptide signal de la glycoprotéine rabique.

On effectue pour ce faire le clonage du fragment PstI traité à la nucléase S1 puis à la Klenow et Kpnl dans M13 TG158 coupé par HindIII traité à la Klenow-Kpnl :

EcoRI Kpnl Pst°/HindIII° Pst /Bglll '

M13 TG130 -\ — ~~ 7777 _L - //////

signal signal env rage

On obtient ainsi le plasmide M13 TG159. On transfère le bloc Kpnl-Pstl de M13 TG159 dans M13 TG131 pour obtenir le plasmide M13 TG160.

Pst /BglII Hind /pst «

Kpnl EcoRI

M13 TG131- V///////// ZZZZZZ signal signal rage env

Une mutagénèse localisée sur M13 TG160 permet de fusionner en phase les séquences env et glycoprotéine rabique (en formant une boucle). Ceci grâce à l'oligo¬ nucléotide

5' GACCCACAATTTTTCTGTAATAGGGAATTTCCCAAA 3'

Signal rage env Cys Phë~[ Gly Lys Phe Pro Ile Tyr Thr Gin Lys Le TGT TTT GGG AAA TTC CCT ATT TAC .- ACA GAA AAA TT

_•*

On obtient ainsi le phage M13 TG161.

Le fragment PvuII-Kpnl de M13 TG161 est alors clone dans pTG1126 coupé par EcoRI traité à la Klenow-Kpnl (le site PvuII de M13 TG161 provient de M13 dans la région

située en amont du polylinker) . Ceci conduit au plasmide pTG1129.

Par clonage du fragment Pstl-PstI de pTG1129 dans le plasmide pTG186-POLY coupé par PstI, on obtient le plasmide pTG1131.

EXEMPLE 9 Préparation du plasmide pTG1132 Par clonage du fragment Pstl-PstI de pTG1128 dans le site PstI de M13 TG131, on obtient le plasmide Ml3 TG162.

On effectue ensuite une mutagénèse localisée grâce à 1Oligonucléotide

5' ATTCCCACTGCTTAGTATTCATTCTGCACCACTC 3'

Ceci permet de placer un codon stop à la fin de la gp120. Les séquences obtenues sont les suivantes Ï

R E K R I Séquence originale : CAG AGA GAA AAA AGA T GCA GTG

site de clivage présumé de la gp120

N E Y xxx

Séquence mutée : CAG AAT GAA TAC TAA GCA GTG

On obtient ainsi le phage M13 TG168. Par reclonage du fragment PstI de M13 TG168 dans le site de PstI de pTGl86-POLY, on obtient le plas- mide pTG1132.

EXEMPLE 10 Construction du plasmide pTG1133 Par mutagénèse localisée sur M13 TG162 grâce à 1'oligonucléotide suivant :

5' ATTCCCACTGCTTGGTGTTCATTCTGCACCACTC 3'

pn obtient un bactériophage dans lequel un site potentiel d e de clivage séparant gp 120 et gp 40 a été détruit.

Les séquences modifiées sont les suivantes :

séquence originale : CAG

site de clivage

séquence mutée : CAG AAT GAA CAC CAA GCA

N E H Q

On obtient ainsi le phage M13TG165. Par reclonage du fragment Pstl-PstI de M13 TG165 dans pTG186-POLY au site PstI, on obtient le plasmide pTG1133.

EXEMPLE 11

Construction du plasmide pTG1134 Par clonage du fragment Pstl-PstI de pTG1131 dans le site PstI de M13 TG131, on obtient le phage M13 TG163.

On effectue une mutagénèse localisée sur M13 TG163 afin de détruire le même site de clivage de la gp120 que précédemment. Pour ce faire, on utilise un oligonucléotide :

5' ATTCCCACTGCTTGATGTTCATTCTGCACCACTC 3'

Ceci permet de modifier les séquences de la façon suivante :

R E K R Séquence originale : CAG AGA GAA AAA AGA fGCA GTG

Séquence mntée : CAG AAT GAA CAT CAA GCA

N E H Q

On obtient dans ces conditions le phage M13 TG166.

Par reclonage du fragment Pstl-PstI de ce phage M13 TG166 dans le site PstI de pTGl86-POLY, on obtient le plasmide pTG1134.

EXEMPLE 12 Immunόprécipitation des protéines synthétisées par les virus recombi- nants W.TG. eLAV.

En opérant comme cela a été décrit précédemment pour le plasmide pTG1125, on obtient les vecteurs vaccine hybrides correspondant aux différents plasmides préparés précédemment.

Ces vecteurs viraux seront appelés respectivement

W.TG. eLAV 1128

W.TG. eLAV 1130

W.TG. eLAV 1131

W.TG. eLAV 1132 W.TG. eLAV 1133

W.TG. eLAV 1134.

Les protéines obtenues comme cela a été décrit précédemment sont testées par immuno-précipitation (figure 3) .

L'ensemble des i muno-précipités fait apparaître pour le virus 9-1 , une ira uno-précipitation correspondant à la gp160, la gp120 et la gp41.

Il en va de même pour le virus 1128. Le virus 1130 montre également une gp160 et une gp120.

La protéine correspondant à la gp41 a un poids légèrement inférieur dû à la modification de son extré¬ mité C-terminale. Le virus 1131 présente un spectre sensiblement identique à celui obtenu pour le virus 1130.

Le virus 1132 ne présente pas bien entendu de protéine correspondant à la gp41. La protéine de 105 kDA présente dans les culots est une isoforme de la gp120 (glycosylation différente).

En ce qui concerne le virus 1133, celui-ci présente bien des protéines 160, 120 et 41 mais les bandes correspondant aux protéines 120 et 41 sont plus faibles que dans les autres spectres. II en va de même pour le virus 1134 avec lequel la gp41 présente également un poids moléculaire plus faible mais pour lequel il est clair que le clivage s'est fait avec une cinétique plus lente que celle des virus

W.TG.1125 (9-1) à 1131. Exemple 1.3 Construction du plasmide pTG1135 .

Les cinétiques de relargage ef fectuées sur le virus W. TG . eLAV1133 et 1134 montrent que , bien que la cinétique d coupure entre la gpl20 et la gp40 soit plus lente, le clivag a encore lieu . L' examen de la séquence d' ADN du gène env révèle un autre s ite potentiel de clivage (KRR), 8 acides aminés aval du premier site de clivage.il peut donc paraître impor t an t de muter ce deuxième site afin d ' obtenir un virus de la vaccine recombinant qui n' exprime que de la gpl60.

Par mutagénèse localisée sur H13TG166 grâce à l' oli¬ gonucléotide suivant :

5 'ATTCTGCACCACGTGATTCTGTGCCTTGGTGGGT 3 '

on obtient un phage dans lequel le deuxième site de clivage est modifié. Les séquences modifiées sont les suivantes :

séquence originale : GCA AAG AGA AGA GTG A K R R V

+ site de clivage potentiel

séquence mutée : GCA CAG AAT CAC GTG A Q N H V

Le fragment Pstl-PstI du phage obtenu (M13TG181) est clone dans pTG186POLY au site PstI pour générer le plasmide PTG1135.

Exemple 14 Construction du plasmide pTG1139.

La partie C-terminale du gène env synthétisée par le vecteur de la vaccine recombinant W.TG.eLAV1135 est une séquence dérivant de la glycoprotéine rabique. Il peut donc paraître utile de disposer également d * un autre recorabinant où cette partie C-terminale serait remplacée par la partie C- terminale du gène env du virus LAV.

Pour ce faire, on effectue sur le phage M13TG165 la même mutagénèse que celle effectuée (voir exemple ! ) sur le phage M13TG166, pour générer le phage M13TG184.

Le fragment Pstl-PstI de M13TG184 est ensuite reclo- né dans le plasmide pTG186POLY pour générer le plasmide PTG1139.

'

Exemple 15 Construction du plasmide pTGL136.

On voudrait encore disposer d'un virus de la vaccine recombinant exprimant la gpl20 seule. Cette gpl20 sera, con- trairement au cas obtenu avec le virus .TG. eLAVI132, munie d'une zone d'ancrage C-terminale.

Pour ce faire, on élimine par mutagénèse localisée les séquences correspondant à la gp40 dans le phage M13TG181 à l'aide de l'oligonucléotide suivant :

5' GCACTCAGTAATACATACACGTGATTCTGTGCCTT 3 '

Cet oligonucléotide permet de fusionner en phase les séquences gpl20 (avec les 2 sites de clivage modifiés) et les séquences de la zone transmembranaire de la glycoprotéine rabique

K N H V

AAG GCA CAG AAT CAC GTG GTG -|— TTC TAT GTA TTA CTG

gpl20 TM rage

On obtient ainsi le phage M13TG182. Le fragment Pstl-PstI de M13TG182 est ensuite inséré au site PstI de pTG186POLY pour générer le plasmide pTG1136.

Exemple 16 Construction du plasmide pTG1137.

Le rôle de la zone hydrophobe située à la partie N- terminale de la gp40 est peu connu. Cette zone de la protéine env pourrait être responsable du pouvoir d'induction de formation des syncitia. II semble donc intéressant de produire une gρl60 qui ne contiendrait pas cette séquence.

Pour ce faire, on fusionne en phase les séquences en amont et en aval de La partie codant pour ce peptide hydro- phobe dans le phage M13TG181 grâce à 1Oligonucléotide sui¬ vant :

5'CAATAATTGTCTGGCCTGCACGTGATTCTGTGCCTT '

Ceci permet d'obtenir le phage M13TG183 en réalisant la fusi¬ on :

AAG GCA CAG AAT CAC GTG GTG -J— GTA CAG GCC AGA CAA

K N H V Q A R Q

gpl20 partie hydrophile de la gp40

Le fragment Pstl-PstI de M13TG183 est recloné dans le site PstI de pTG186POLY pour générer le plasmide pTG1137.

Exemple 17 Construction du plasmide pTG1138.

En plus de virus recombinants exprimant la gplβO ou la gpl20, il peut être utile de générer un virus de la vacci » ne recombinant exprimant la gρ40 seule.

Pour ce faire, on fusionne les séquences codant pour le peptide signal avec les séquences codantes de la gp40 sur le phage M13TG163grâce à 1*oligonucléotide suivant :

5 'CAATAATTGTCTGGCCTGAATAGGGAATTTCCCAAA 3 '

Ceci permet de générer le phage M13TG180, qui comporte la fusion :

TGT TTT GGG AAA TTC CAG GCC AGA CAA

K

signal gp40 (partie de La hydrophile) gp rabique

Le fragment Pstl-PstI de M13TG180 est inséré au site PstI de pTG186POLY pour donner le plasmide pTG1138.

Exemple 18 Construction du plasmide pTG1162.

Comme dans le cas de la gpl60 (plasmide pTG1139), il peut être important de disposer également d'un virus recombi¬ nant exprimant une gp40 dans laquelle la zone d'ancrage et la zone intracytoplasmique soient les séquences du gène env du virus LAV plutôt que les séquences correspondantes de la glycoprotéine rabique.

Pour obtenir ceci, on remplace le fragment HindlII- Bgll de M13TG180 par le fragment HindIII-BglI de M13TG165, en générant le phage M13TG190.

Le plasmide pTG1162 est obtenu par clonage du frag¬ ment Pstl-PstI du phage M13TG190 dans le site PstI du plasmi¬ de pTG186POLY.

Exemple 19 Construction du plasmide pTG1163.

Il semble aussi important d'obtenir un virus de la vaccine recombinant qui synthétise une gp!60 non clivée et

sécrétée dans Le milieu. En effet, cette protéine pourrait ê t re utilisée comme vaccin tué, en association avec des adju¬ vants, ou incluse dans des liposomes ou des ISCOMS ( orein et al., Nature (19S< 3 8, 5958 p 57-60). On construit pour cela le bactériophage M13TG194, d ans lequel les séquences codant pour Les régions extracyto- plasmique et intracytoplasmique sont fusionnées en phase, dans le bactériophage M13TG184 grâce à 1'oligonucléotide suivant :

5'TCCCTGCCTAACTCTATTTTTTATATACCACAGCCA 3*

Le fragment Pstl-PstI de M13TG194 est ensuite clone au site PstI de pTG186POLY pour donner pTG1163.

Les protéines recombinantes ainsi obtenues, et en particulier la gp l60 non clivable, peuvent être utilisées dans des kits de diagnostic pour détecter les anticorps potentiels présents dans le sang des malades ayant été en contact avec le virus. Ces tests peuvent être mis en oeuvre selon des processus connus de l'homme de l'art, par exemple par ELISA, RIPA, " esthern Blot" (Immuno-empreinte).

Ces protéines peuvent également être utilisées pour la réalisation d'hybridomes et d'anticorps monocionaux destinés à détecter la présence de virus dans des échantillons.

Les différents plasmides et phages M13 sont décrits notamment dans les demandes de brevet suivants :

M13 TG131 Kieny et al. , 1983 M13 TGRG151 WO 83/04052 pTG155 PRO FR 84 06499 M13 TG130 Kieny et al. , 1983. Les plasmides suivants ont été déposés le 16 novembre 1984 à la Collection Nationale de Cultures de Microorganismes de l'Institut Pasteur et sont décrits dans le brevet GB-A-84 29099 : PJ 19-6 : CNCM N° 366-1 PJ 19-13 : CNCM N β 367-1.

Le plasmide pTG1125 a été déposé le 6 juin 1986 dans la même collection, sous forme de bactérie transformée : E. coli 1106/pTG1125, sous le n° 1-557.

REFERENCES

1. - Drillien, R. , Spehner, D. (1983) Virology 131, 385-393.

2. - Kieny, M.P., Lathe, R. and Lecocq, J.P. 1983. New versatile cloning and sequencing vectors based on bactériophage M13. Gène 2jL : 91-99.

3. - Kieny, M.P., Lathe, R. , Drillien, R. , Spehner, D. , Skory, S., Schmitt, D., Wiktor, T., Koprowski, H. and Lecocq, J.P. 1984. Expression of rabies virus glycoprotein from a recombinant vaccinia virus. Nature 312 : 163-166.

4. - Lathe, R. , Hirth, P., Dewilde, M.-, Harford, N. and Lecocq, J.P. 1980. Cell-free synthesis of biolo- gically active heat-stable enterotoxin of Escherichia coli from a cloned gène, nature 284 : 473-474.

5. - Lathe, R. , Kieny, M.P., Schmitt, D., Curtis, P., Lecocq, J.P. (1984) J. Mol. Appl. Genêt., vol. 2, 331-342.

6. - Lathe, R., Kieny, M.P., Skory, S. and Lecocq, J.P. (1984) DNA, vol. 3, 173-182.

7. - Lusky, M., Botchan, M. (1981) Nature 293, 79-81.

8. - Mackett, M., Smith, G.L. and Moss, B. 1982. Vaccinia virus : a selectable eukaryotic cloning and expression vector. Proc. Natl. Acad. Sci. USA. 19. '• 7415- 7419.

9. - Maniatis, T., Fritsch, E.F. , Sa brook, J. 1982. Molecular cloning : a laboratory anual. Cold Spring Harbor Lab, N.Y. 10. - Muesing, M.A. , Smith, D.H., Cabradilla, CD.,

Benton, C.V., Lasky, L.A. and Capon, D.J. 1985. Nucleic acid structure and expression of the human AIDS/ lymphadenopathy rétrovirus. Nature 313 : 450-458.

11. - Messing et Vieras, Gène 19, 1982, p. 269-276

38

12. - Panicali, D. and Paoletti, E. 1982. Construction of poxviruses as cloning vectors : Insertion of the thymidine kinase gène from herpès simplex virus into the DNA of infectious vaccinia virus. Proc. Natl. Acad. Sci. USA. 19_ : 4927-4931.

13. - Panicali, D., Davis, S.W., Weinberg, R.L., Paoletti, E. (1983) Proc. Natl. Acad. Soi. USA 8J3, 5364- 5368.

14. - Ratner, L., Haseltine, W. , Patarca, R. , Livak, K.J., Starcich, B., Josephs, S.F. , Doran, E.R.,

Rafalski, J.A. , Whitehorn, E.A., Baumeister, K. , Ivanoff, L., Petterway Jr. , S.R., Pearson, M.L. , Lautenberger, J.A. , Papas, T.S., Ghrayeb, J., Chang, N.T., Gallo, R.C. and Wong-Staal, F. Complète nucleotide séquence of the AIDS virus, HTLV-III. 1985. Nature ~ V$_ : 277-284.

15. - Sanchez-Pescador et al., 1985. Science 227 : 484-492.

16. - Smith, G.L., Mackett, M., Moss, V. (1983) Nature 302, 490-495. 17. - Smith, G.L., Murphy, B.R., Moss, B.

(1983) Proc. Natl. Acad. Sci. USA £, 7155-7159.

18- - Venkatesan, S., Earoudy, B.M., Moss, B. (1981) Cell 125, 805-813.

19. - Wain-Hobson, S., Sonigo, P., Danos, O. , Cole, S. and Alizon, M. Nucleotide Séquence of the AIDS virus, LAV. 1985. Cell _4 : 9-17.

20. - Weir, J.P., Moss, B. (1983) J. Virol. 4_6_, 530

21. - Zoller, M.J. and Smith, M. 1983. Oligonucleotide-directed mutagenesis of DNA fragments cloned into M13 vectors. In : Methods in Enzymology (Wu, Grossman, Moldave, eds.) 100 : 468-500.