ANTIBIOTIC CHEMICAL STRUCTURE OBTAINED FROM THE STRAIN STREPTOMYCES SP. BS46 AND ITS USE AGAINST METHICILLIN-RESISTANT

BACTERIA

Field of the Invention.

[0001] The present invention relates to a new compound that belong to a new family of antibiotic chemical structure (identified hereafter as Ymycine) , to the Streptomyces sp. BS46 producing it, to its preparation process, to the pharmaceutical cosmetic, food or. feed composition and to the biomaterial comprising this compound and its use against microorganisms, such as bacteria , especially against Methicillin resistance bacteria, including Methicillin-resistant Staphylococcus aureus.

Background of the invention

[0002] Despite the availability of a variety of highly effective antibiotics, the search for new antibiotics is a continuing one. The primary reason for the continuing search is the reoccurring development of microorganisms which are resistant to existing antibiotic therapy.

[0003] The Infectious Diseases Society of America (IDSA) believes that is critically needed to save countless lives and to protect national security. Antibiotics simply are not as profitable as drugs that treat chronic conditions that require drug therapy for the rest of a patient's life, and, for this reason, they are not being developed by drug companies. A recent study has found only five new antibiotics in the R&D pipeline out of more than 506 drugs in development among 15 major

pharmaceutical companies with a track record in antibiotic development and seven major biotechnology companies. Since 1998, the Food and Drug Administration has approved very few antibiotics and only a small proportion of these were truly novel; that is, they have a new target of action, with no cross- resistance with other antibiotics. For more than two years, IDSA has investigated the serious decline in new antibiotic R&D (source IDSA. 2005) . [0004] Methicillin-resistant Staphylococcus aureus (MRSA) is the most problematic gram-positive bacterium in public health not only because it is highly prevalent but also because it has become resistant to almost all available antibiotics except vancomycin and teicoplanin. Recently, its susceptibility to vancomycin has decreased, and vancomycin-intermediate and vancomycin-resistant S. aureus have increasingly been found in several countries. Furthermore, a decrease in the susceptibility of MRSA to teicoplanin has also been reported in several hospitals around the world. The evidence of MRSA resistance to vancomycin and teicoplanin, which are antibiotics of last resort, makes the need for alternative antibiotics and chemotherapeutics after vancomycin and teicoplanin treatments have failed particularly urgent .

Aims of the Invention [0005] A first aim of the present invention is to provide compounds which present an antibiotic profile and which do not present the drawbacks of the state of the Art .

[0006] A preferred aim of the present invention is to provide such compounds which are active against various microorganisms such as bacteria, especially against antibiotic resistance bacteria, more preferably Methicillin-resistant bacteria, including Methicillin-resistant Staphylococcus aureus (MRSA) .

[0007] A further aim of the present invention is to provide a method and a cell which is able to produce these compounds .

[0008] A last aim of the present invention is to provide a pharmaceutical cosmetic, food or feed composition and/or a biomaterial comprising these compounds and which are active against various microorganisms such as antibiotic resistant bacteria, especially Methicillin-resistant bacteria, including Methicillin-resistant Staphylococcus aureus (MRSA) .

Summary of the Invention

[0009] A first aspect of the present invention is related to an antibiotic compound (or molecule) having the formula I, formula II or formula III.

Wherein Rl, R2 , R3 , R4 and/or R5 are independently selected from the group consisting of

- Hydrogen atoms (H) ,

- halogen atoms (F, Cl, Br, or I) , - hydroxy1 groups ,

- aryl groups having 5, 6 or 7 carbon atoms and possibly one or more hetero atoms, wherein the carbon atoms are possibly substituted (by an halogen atom) ;

- alkyl groups (preferably ethyl, methyl or C-halogen (CF3) groups) ;

- oxyalkyl, alkenyl , alkynyl, alkyloxy, alkyloxyalkyl , alkylthioalkyl, alkoxycarbonyl , alkythiocarbonyl , alkanoyl , cycloalk ylalkyl, cycloalkylcarbonyl, cycloalkylalkanoyl, cycloalkylthiocarb onyl , cycloakylalkoxycarbonyl , cycloakylalkoxythiocarbonyl , cycloalkylthioalkyl , alkylcarbonyloxyalkyl, cycloalkylcarbonyloxya lkyl, siloloxyalkyl , aralkyl , arylalkenyl, arylcarbonyl , aryloxycarbo nyl, arylthiocarbonyl , aralkoxycarbonyl , arylalkylthiocarbonyl, aryl oxyalky, arylthioalkyl , haloalkyl , hydroxyalkyl , aralkanoyl, aroyl , ar yloxycarbonylalkyl, aryloxyyalkanoyl, carboxyl , alkenylcarbonyl , alk ynylcarbonyl, cyano, aminocarbonyl , aminoalkanoyl, aminoalkyl , hydrox yl or amino groups;

- Wherein R6 and R7 are O-Rl groups, preferably OH;

- Wherein R8 is a COORl group preferably COOH and;

- Wherein Y and Z are 0 or S, prodrugs and suitable salts thereof.

[0010] Preferably, the new antibiotic compound (or molecule) according to the invention corresponds the formula I;

- wherein R2 and R4 are alkyl groups, preferably methyl groups;

- wherein Rl, R3 and R5 are H, - wherein R6 and R7 are OH;

- wherein R8 is COOH; and

- wherein Y and Z are 0.

[0011] The present invention includes also suitable portions, prodrugs and salts of these compounds (or molecules) .

[0012] Preferably, the antibiotic compound (or molecule) according to the invention is obtained from the strain Streptomyces sp. BS46 having the deposit number BCCM/LMG. A deposit of this microorganism has been done according to the Budapest treaty, on June 23 ^rd 2006 with the deposit number LMG P- 23725 at the BCCM/LMG Bacteria collection. Universitiet Gent - Laboratorium voor Microbiologie KL. ledeganchstraat 35, B-9000 Gent Belgium [0013] Another aspect of the present invention is related to the cell which is able to produce under suitable conditions the antibiotic compound according to the invention. The suitable conditions are media containing suitable the sources of carbohydrates, nitrogen and phosphorus, submerged under aerobic condition at a temperature comprised between about 20 and about 35 C° and a PH comprised between about 4 and about 10, until antibiotic activity is imported to this media by a production of the antibiotic compound (or molecule) according to the invention. Furthermore, from these media, the antibiotic compound could be recovered by methods well known by the person skilled in the art.

[0014] The culture media can be the Bennett medium, composed of glucose (1%), peptone (0, 2%), Yeast extract (0, 1%) and meat extract (0, 1%) .

[0015] In a preferred embodiment of this invention, the strain is grown in a fermentor under controlled conditions, such as pH control, temperature .control, dissolved oxygen control, etc. already described in the scientific literature.

[0016] After culture for a period between 5-7 days, an antibiotic preparation may be recovered from the extracellular culture medium. The antibiotic compound (or molecule) may be further purified using techniques known in the art, such as silicagel chromatography, sephadex chromatography and HPLC separation.

[0017] A further aspect of the present invention is related to the antibiotic compound (or molecule) or it's producing cell according to the invention for use as a medicament or to a pharmaceutical composition comprising an adequate pharmaceutical carrier or diluent and the antibiotic compound (or molecule) or cell according to the invention. [0018] The pharmaceutical composition according to the invention may also comprise other antibiotic molecules, including Methicillin antibiotic molecules. [0019] The present invention is also related to a cosmetic food or feed composition comprising (or molecule) or cell according to the invention.

[0020] Another preferred aspect of the present invention to a biomaterial having a polymeric structure made of lactic acid, glycolic acid, polyurethane , silicon, polyethylene, polyamide, polypropylene, polyacrylate, and polymetylmetacrylate and having a surface modified by a link with the antibiotic compound (or molecule) or cell according to the invention, preferably a covalent link. The biomaterial according to the invention can be used for the manufacture of artificial tissues, such as bones or cartilages, prostheses, sensors, cardiac stimulators or catheters , to prevent or avoid microorganism (bacterial) infections in treated patients. [0021] A last aspect of the present invention is related to the use of compound or molecule or cell according to the invention the pharmaceutical composition and/or the biomaterial according to the invention for the manufacture of a medicament in the treatment and the prevention of infections induced by microorganisms, (bacteria, mycoplasms, viruses,...) preferably)) bacteria, especially Methicillin-resistant bacteria (enteroccoci, streptococci, staphylococci, E.coli,...), including Methicillin-resistant Staphylococcus aureus (MRSA) .

[0022] The present invention is also related to a method of treatment and prevention of a infection induced by microorganisms preferably bacteria, especially Methicillin- resistant bacteria including Methicillin-resistant Staphylococcus aureus (MRSA) , which comprise the step of administrating of sufficient amount of the antibiotic compound (or molecule) , of the cell, of the composition or of the biomaterial according to the invention to mammal subject including a human patient suffering from this infection. [0023] The invention will be described in further details in the following examples by reference to the enclosed drawings, which are not in any way intended to limit the scope of the invention as claimed.

EXAMPLES

Example 1; Isolation of "Ymycine" molecule producing strain [0024] The Actinomycete strain Streptomyces sp. BS46 was isolated from the rhizospherical soil of the Moroccan endemic plant Bupleurum spinosum using soil extract medium. a) Sampling

[0025] Three samples from the rhizospheric soil were collected from Oukaimeden region of Marrakech (Morocco) , during autumn 1999. Samples were taken with an auger (up to 10cm depth) after removing approximately 3 cm of the soil surface, placed in sterile polyethylene bags and stored in a refrigerator. b) Sample treatment and culture conditions

[0026] Samples of the rhizospheric soil were first mixed, suspended in sterile distilled water (4 g in 36 ml) and shaken on a rotatory shaker (200rev πiin ^'1 ) for 30 min. Then, they were gone under one or more of the following treatments : supply of sodium pyrophosphate (PPNa) at 0,01%, the sonication at 40 pps for 10, 15 and 20 min and

- heating in a water bath shaker at 50 ⁰ C for 10, 15 and 20 min. All treated samples were serially diluted up to 10 ^"6 and spread

(0,1 ml) over the surface of agar plate with sterile L-shaped glass rods . c) Isolation media

[0027] Triplicate plats of the following media: Olson's

(O) (Olson 1968) , Lindenbein modified by Benedict (LB) (Porter et al. 1960), Nakeeb and Lechevalier (NL) (Nakeeb and Lechevalier 1963), Kuster and ulphuri (KW) (Kuster and Williams 1964) , Lingappa and Lockwood (LL) (Lingappa and Lockwood 1962) , M3 medium (Rowbotham and Cross 1977) and Soil Extract agar (SE)

(see below) , were used for actinomycete isolation. All those media were supplemented with cyloheximide (40μg ml ^"1 ) which found to inhibit the growth of fungi (Eack-Hour and Leclerck 1973, Goodfellow and Williams 1983, Saadoμn efc al. 1997) . Plates were incubated at about 28°C and colonies were determined after 21 days. Actinomycete colonies, generally leathery and tough on surface of the agar plate, were characterized morphologically and physiologically following directions given by the International Streptomyces Project (Shirling and Gottlieb 1966) . Morphological characteristics were studied under light microscope after growing the culture on oatmeal agar. d) Soil Extract preparation [0028] Equal volume of the rhizospheric soil of investigated endemic plant and distilled water were overnight macerated and filtered after sterilization at about 12O ⁰ C for aboutl5 min. Agar was added to the collected filtrate and the pH was adjusted to 7.0 before sterilization. To increase the selectivity of this medium one or more of the following compounds were added: glycerol (0,5%), starch (1%), aspargine

(0,02%), KNO ₃ (0,02%), nalidixic acid (10 mg/1) , streptomycin (10 mg/1) and novobiocin (20 mg/1) . In the other hand, and in order to facilitate the recognition of actinomycetes isolates,

different concentrations of agar (10, 15 and 25 g/1) were tested for the soil extract medium prepared and the 25g/l of agar let us to isolate the new strain Streptomyces sp . BS46.

Example 2: Taxonoπiic characterisation of strain Streptomyces sp. BS46

[0029] Taxonomic characterisation of strain Streptomyces sp. BS46 of the invention was carried out according to the recommended method of International Streptomyces Porject, completed by analysis of cell wall components and molecular determination. a) Morphological properties:

[0030] On solid media the strain Streptomyces sp. BS46 gave thin powdery and irregular colonies. Under light microscopy, substrate mycelia are not fragmented and the aerial hyphae are bearing spiral spore chains . Spores are of cylindrical shape of about 0.75 to about 0.95 μm long and about

0.55 to about 0.6 μm in diameter with smooth surfaces (Fig 1) . No synnemata, sclerotia or sporangia were observed. b) Properties in various media:

[0031] The exemplary strain of the invention shows the following properties when incubated at 28 ⁰ C in the following various solid media:

On Yeast Extract-Malt Extract Agar (ISP2) , abundant white-grey growth; yellow-brownish substrate mycelium, no soluble pigment. On Oatmeal Agar (ISP3) , moderate gray growth for both aerial and substrate mycelia, no soluble pigment.

On Inorganic Salt Starch Agar (ISP4) , moderate white aerial growth, brown substrate mycelium, no soluble pigment. On Glycerol-Asparagine Agar (ISP5) , abundant white growth, yellow-brownish substrate mycelium, no soluble pigment .

On Pepton Yeast Extract Iron Agar (ISP6) , thin white growth, creamy vegetative mycelium, no soluble pigment.

OnTyrosine Agar (ISP7) , abundant white-gray growth, creamy substrate mycelium, no soluble pigment.

On Sucrose Nitrate Agar, abundant white growth, white-yellowish substrate mycelium, no soluble pigment. On Sucrose Czapeck Agar, thin white growth for both aerial and substrate mycelia, no soluble pigment.

On Glucose Asparagine Agar, thin creamy growth for both aerial and substrate mycelia, no soluble pigment.

On Olson's medium, abundant white growth, yellow-brownish substrate mycelium, no soluble pigment.

On Bennett's Agar, abundant white-gray aerial mycelium, yellow vegetative mycelium, no soluble pigment.

On Nutrient Agar, moderate yellow growth for both aerial and substrate mycelia, no soluble pigment. c) Physiological properties:

[0032] The strain of the invention was catalase positive oxydase positive and nitrate reductase positive. The optimal growth was obtained for a temperature between 28 to 30 ⁰ C. The strain grew in nutrient agar medium containing 15 g/1 of NaCl and metabolized preferentially D-glucose, sucrose, cellobiose,

L-rhamnose, mannose, maltose, starch, dextrin, salicin, glycerol, sorbitol innositol and citrate.

The strain Streptomyces sp. BS46 was sensitive to kanamycin, neomycin, gentamycin, Polymexin B, erythromycin, streptomycin, ulphuric ap, bacitracin, novobiocin, chloramphenicol and sulfamide. The strain was resistant to oxacilline, ampicillin, trimetoprime sulfoxide, cefaltine; pristinamycine. d) Chemotaxonomy:

[0033] The cell wall of strain Streptomyces sp . BS46 contained LL isomer of diaminopimelic acid and the strain was assigned to cell wall chemotype I which characterised the genus of Streptomyces.

e) Molecular taxonomy:

[0034] In addition, the partial sequencing of 16S rRNA of strain Streptomyces sp. BS46 (see above) using the specific primer for the gamma, beta and alpha regions give the following sequences :

- Sequence for gamma region: (SEQ ID N°l)

AAACGNKTGAKCCWCGAKTWCCGAGGCTGCTGGACGAGTAWGCCGGCGCTTCTTCTG ASGGACC GTACCTCTCGCTTCTTCCCTGCTRAAvGGGGTTWaAACCCCRAAGGCCGTAATCCCTAAC GCGG CGTCGCTGMATMAGGCTTTCGCCCATTGTGCAATATTCCCCACTGCTGCCTCCCGTAGGA GTCT GGGCCGTGTCTCAGTCCCAGTGTGGCCGGTCGGCCTCTCAGGCCGGCTACCCGTCGTCGC CTTG GTAGGCCATCACCCCACCAACAAGCTGATAGGCCGCGGGCTCATCCTTCACCGCCGGAGC TTTC CACACACAGACCATGCGGTCGTGTGTCGTATCCGGTATTAGACCCCGTTTCCAGGGCTTG TCCC AGAGTSAAGGGCAGATTGCCCACGTGTTACTCACCCGTTCGcCACTAATCCCCTCCCGCA RGGR GGYTCATCGTTCGACTTGCATGTGTTAAGCACGCCGCCAGCGTTKCGTCCT

- Sequence for beta region: (SEQ IDN ⁰ 2)

CCGTCATTCcTTTGAGTTTAGCcTTGCGGcCGTACTCCCCAGGCGGGGAACTTAATG CGTTAGT GCGGCACGGACGACGTGGAATGTCGCCCACACCTAGTTCCCAACGTTTACGGCGTGGACT ACCA GGGTATCTAATCCTGTTCGCTCCCCACGCTTTCGCTCCTCAGCGTCAGTATCGGCCCAGA GATC CGCCTTCGcCACCGGTGTTCCTcCTGATATCTGCGCATTTCACCGCTACACCAGGAATTC CGAT • CTCCCCTACCGAACTCTAGCCTGCCCGTATCGAATGCAGACCCGGGGTTAAGCCCCGGGC TTTC ACATCCGACGTGACAAGCCGCCTACGAGCTCTTTACGCCCAATAATTCCGGACAACGTTT GCGC CCTACGtATTACCGCGGyTTSYTGGTCGTVACTGGGAAAACCCKSG

- Sequence for alpha region: (SEQ IDN°3)

TCTtGWCGCTNSBCCATGCAGTCCACCTCGCGTTCCTCCACAAGGGTTGGCACcGCT YGGGTGT TACCGMCTTtCGTGACGTGACGGGCGGTGTGTACAAGGCCcSGGAACGTATTCACCSCAG CAAT GCTGATCTGCGATTACTAGCAACTCCGACTTCATGGGGgTCGAGTTGCAGACCCCAATCC SCAC TSAGACCCCYTTTTTGAGATTCGCTCCACCTCGSGGTATCGCAGCTCATTGTACCCCCCA

Example 3 ; Antimicrobial activity of "Ymycine" producing strain [0035] The following strains were used to evaluate the antimicrobial activities of the strain Streptomyces sp BS46 and

its produced antibacterial "Ymycine" : Staphylococcus aureus 209 PC IP53156, Bacillus subtilis ATCC 9524, Streptomyces scabies EF35 (Paradis et al . , 1994), Microccocus luteus ATCC381, Escherichia CoIi ATCC 25922, Candida albicans ATCC 2091, Candida tropicalis R2 CIP203, Saccharomyces cerevisiae ATCC9080, Fusarium oxysporum f. sp. Albedinis, and verticillium dahliae (strains collection of Laboratory of Phytopathology, Faculty of Sciences Semlalia, Marrakech) , 20 clinical isolates of MRSA, and a reference strain of MRSA ATCC33591 kindly provided by Pr. Moha.Jana (Avicenne Military Hospital Marrakech Morocco) .

[0036] The antimicrobial activity was determined by the plate diffusion method (Bauer et al. 199S). Isolates were grown on agar-Bennett medium for 14 days and three discs (10 mm in diameter) were cut and placed on Muller-Hinton agar (for bacteria) and Sabauroud medium (for fungi and yeasts) which were seeded with appropriate test organism. Plates were first kept about 4 ⁰ C for at least 2 h to allow the diffusion of produced antibiotics, then incubated about 30 ⁰ C. Inhibition zones were determined after 24 h for bacteria and yeast and after 48 h for fungi.

[0037] The antimicrobial activities of the new strain Streptmoyces sp. BS46 is shown in the following table.

Table 1 In vitro antimicrobial activities of strains Streptomyces sp . BS46

- Values given are the mean of 3 replicates

Example 4 : Fermentation and ■ isolation of the antibiotic compound or molecule "Ymycine" according to the invention [0038] The fermentation carried out for the production of the exemplary" antibiotic of the invention by using the strain of the invention comprises the steps of cultivating the strain Btreptomyces sp. BS46 in Bennett agar plates and incubated about 72h about 28 ⁰ C. From the well grown ones, a slant culture was inoculated into a 500 ml baffled Erlenmeyer flasks containing 100 ml of the producing liquid medium, which consisted of: glucose (Merck) 10 g/1, peptone (Difco) 2 g/1, yeast extract (Difco) 1 g/1, and meat extract (Difco) 1 g/1. The pH was adjusted about 7.2 before sterilization about 110 ⁰ C about 30 minutes. The culture was incubated on a rotary shaker (200 rpm) about 30 ⁰ C about 48 hours. 2 litres of this culture was used as inoculum for a 20-litre jar fermentor containing 18 litres of the culture medium described above. Starting pH is about 7.2 and

the aeration was 5 litres/minutes with agitation of 120 rpm. The fermentation was carried out about 28 ⁰ C about 5 days.

[0039] The bacterial culture received from the fermentation was filtered over the celite. In order to extract the component, the water phase was extracted three times with acetic ester. The organic phases were collected together and evaporated in vacuum about 4O ⁰ C until they became dry. In this way, 2.4g of crude extract was obtained. This crude extract was first put in methanol and treated with cyclohexane in order to unfatten the sample. Carrying out the plate diffusion tests, only the methanolic phase was active against tested bacteria, fungi and yeast .

The work up and the pathway of the isolation to get the pure compound "Ymycine" is illustrated in figure below:

Crude extract (2.4g)

Methanol/cylcohoxan

Distribution Methanol phase (fcyclohexane phase

Sephadex LH-20, CHCI ₃ /Methanol 6:4 11 fractions (fraction N° 4 is active against tested bacteria)

Silica gel column CHCI3/ methanol (Gradient)

12 fractions (fraction N° 6 is active and shows two spots on the TLC after staining with anisaldehyd/ Dulphuric acid)

Preparative Thin layer chromatography (CHCI3/ methanol 95:5)

"Ymycine" (128 mg) (a colourless compound sparingly soluble in CH2CI2, CHCI3, readily in DMSO, pyridine with an Rf = 0.18 CHCI3/CH2OH 90:10)

[0040] The bioautography and the chemical screening was done for each step of the purification of the molecule or compound ^λV Ymycine" of the invention. The crude extracts for each step were used to do the thin layer ulphuric aphy (TLC) . These were evaluated under day-light, UV-light, after staining with anisaldheyde/ ulphuric acid, Ehrlish' reagent and INPTC (2- (p- Iodophenyl-) -3 (p-nitrophenyl) -5-phenyl-2H-tetrazoliumchlorid) .

[0041] The purity of "Ymycine" molecule or compound was performed by analytical WATTERS high performance liquid chromatography (HPLC) equipped with a RP C18 reverse phase column 7μm (7mm i.d x300 mm). The mobile phase used was water acetonitrile (HPLC grade) , linear gradient from 10% acetonitril to 90% acetonitrile the flow rate for 1 ml/min.

Example 5 ; Structure elucidation of the antibiotic COMPOUMD "Ymycine" according to the invention.

[0042] The structure elucidation of the exemplary antibiotic compound of the invention was derived from a variety of the electroscopy mass spectrum, one-dimensional and two- dimentional NMR spectra ( ¹ H-NMR, ¹³ C-NMR, APT, COSY, HMQC and IR: see figures from 1 to 26) as described in the following procedures :

(+)-ESI: 486 (100%, M - H + 2 Na) , 508 (55, M - 2 H + 3 Na), 949 (40, 2 M - 2 H + 3 Na) (-) -ESI: 440 (100, M - H) EI (70 eV) : 441 (20 %, M), 423 (38, M-H ₂ O), 379 (84, M - H ₂ O, -

CO ₂ ), 273 (100, C17H21O3 by HR), 169 (44, C ₇ H ₇ NO ₄ by HR)

[0043] The loss of CO ₂ by EI ionisation seems to indicate a free carboxylic acid. This is confirmed by the fact, that only multiple sodium adducts were found under (+) -ESI conditions due to formation of sodium carboxylate, but no M + 1 Na adduct.

High resolution of the molecular ion at EI afforded 441.17740 The following suggestions correspond with this mass: (table 2)

TABLE 2

Only one of these possibilities agrees with the C count from the 13C NMR spectrum. The formula is therefore most probably C ₂₄ H ₂₇ NO ₇ .

The analysis of ¹³ C NMR, APT and HMQC spectra in DMSO (blocks 0 1,2) and pyridine (block 3) gave the following signal assignments: (table3)

TABLE 3

Compound of BS -46 *Methylation product 5 Acid in Pyridine

Interpretation of NMR data of part 1; Measurements in DMSO:

[0044] The two doublets in the IH NMR spectrum at δ 7.55 and 6.38 with J = 9.7 Hz are due to an ortho coupling of two aromatic protons . The shifts indicate the neighbourhood of each an electron donating and electron withdrawing substituent. In the HMBC spectrum, the signal at δ 7.55 shows a coupling with one of the two ester/acid CO groups at δ!72 and with the signals

at 158.9 and 158.5. It is likely that these signals correspond to phenolic carbon atoms, resulting in 2, 4-dihydroxybenzoic acid which is substituted in position 3. The couplings of δ 6.38 are supporting this assumption. (see fig 2 A and B) values in [brackets] are calculated; some values of the methyl derivative were taken from the 2D spectra and may differ if compared with the 13C spectrum.

[0045] In the H NMR spectrum, at least 3 acidic protons are visible, however, only the signal at δ 9.00 shows HMBC couplings, i.e. on the signals no. 2 or 3 of the acid CO, and on the phenolic carbon no 4 at 158.9. The oxygen ortho to the acid/ester is obviously a free and chelated OH: It gives a sharp singlet as expected, however, at rather high field. [0046] The EI mass spectrum shows two fragments, and their partial formulae sum up to give the formula of the complete molecule (+ 1 extra H) . It is likely therefore that both parts are connected by a single bond, and that the smaller part corresponds to the benzoic acid. In this case, an additional nitrogen atom must be inserted due to the fragment mass. Although all previous arguments indicate that N is at position R, also the isomer (OH at R and N as carboxamide) must be discussed. In the latter case, the methylation derivative would be a dimethyl ether. As it was possible, to methylate one phenol OH and the acid, the chelated OH leaving untouched, the free COOH group was confirmed. The second part of the molecule cannot be connected as an ester, but must be attached via the nitrogen as an amide or amine. As no cross correlations from outside on the aromatic C-3 are visible, an amide is more likely but cannot be excluded so far. 3-Amino-2, 4-dihydroxybenzoic acid is new in natural products. (Figure 3)

Interpretation of NMR data of part 2 (measurements in DMSO) : [0047] Part of the molecule fragment 2 (C ₁₇ H ₂₁ O ₃ ) are (due to shifts and the ATP spectrum): 2 CO, 2 CH3 , 1 CH=CH, 3 CH, and 1 C _q (at 86) . As 10 hydrogens are missing for C17H21O3 (= MS fragment -H) , 5 CH2 groups must be present . It follows in the same way that 2 additional C _g s must be expected. This agrees with the shift table. According to the formula of fragment 2 and of the complete molecule, 7 double bond equivalents must be present. As there are 3 used for 2 CO and 1 C=C, part 2 must have a tetracyclic ring system.

[0048] The second pair of protons at deep field in the IH NMR spectrum shows a coupling constant of 10 Hz, pointing to a cis orientation of the double bond. As there are HMBC correlations with a carbonyl group at δ202.7, an ,β unsaturated keton (not an ester etc.) must exist. As no further signal splitting (IH NMR) or cross signals (COSY) of the olefinic protons are visible, next to the double bond a quaternary C should be positioned. Both olefin protons show HMBC couplings with carbon(s) at δ 45. There are, however, several signals overlapping in this region, and no clear decision is possible.

[0049] The methyl singlet at δl.16 couples as well with a carbon at 45, and additionally with the keton signal (HMBC) . This methyl group must be connected with a quaternary carbon next to the CO therefore . The methyl group couples additionally with a methylen group at δ 30. A partial structure is represented in figure 4.

[0050] The olefin signal at 6.65 shows a weak coupling with a methylene singlet at 54.2; this methylene group obviously does not have hydrogen in the neighbourhood. On the same methylene group there is a coupling from the second methyl group at 1.38, which additionally couples with the Cq-O fragment at 86.3. Several other couplings are visibles, however, it was not easy to deduce a final structure .

[0051] There are 2 CO signals visible for part 2 of the molecule: One is due to the unsaturated keton, the other must be due to the shifts an ester or amide. The third oxygen must therefore form an ether or ester bond or an OH group. In case of an ester or alcohol, the presence of two C signals at deep field

(86.3 and 75.5) could not be explained. It follows therefore that part 2 contains an ether linkage, and Part 1 and Part 2 are connected via an amide bond.

Measurements in Pyridine:

[0052] A second measurement in pyridine-d ₅ delivered a much better resolved spectrum. Again the olefinic protons showed only the cis coupling (see COSY spectrum 1) indicating that there is only a 2 H spin system. The unsaturated methyl-ketone (substructure above) was confirmed by the long range (->) and H, H couplings (<->) as shown in the figure 5

According to the H, H COSY, the olefin is confirmed (a, %) , and again the downfield proton couples with the carbonyl (HMBC c 3) . As this CO couples with the methyl at 1.15 (c 4), this Me must be β to CO and - as it is a singlet - attached to a quaternary C. The same methyl shows two further long range couplings, one at d 46 (c/d 5) , the other at d 31 or 32 (c/d 6) . The latter two signals correspond two CH2 groups which (see COSY) show only the geminal and vicinal couplings to each other and are forming a closed spin system. One (or both of these CH2 groups gives a coupling with a CO group at 174 (c 7) which must be due to the amide group.

The carbon β to the keton CO d -46 can be a Cg (46.7 or 46.2) or one of two CHs (d 46.6, 45.1) . As there is clearly a coupling of d 2.43 with the methyl at 24.4 (d 8), the methylen groups at 31/32 (d 9) and with the CO at 203 (c 10) , the corresponding carbon must be the CH at 46.6.

[0053] Couplings of a CH2 group at 55 with the olefinic CH at 153.9 fix this group in β position to the double bond (C13,14) . As there is a coupling between H at 2.43 and C 55.0 (c 15) and oppositely (c IS), the C to the double and C 46.6 are to be connected. As the CH2 group at 55.0 does not show any other 3J couplings (COSY) , it must be in the middle of two quaternary C atoms, one of them is that in position to the double bond. Only three bonds are open in this substructure. [0054] The remaining fragments can be easily assembled from COSY and HMBC spectra: it is an ether moiety, a CH2-CH-CH2 fragment, and a methyl group. All atoms have been assigned therefore (figure 6) .

As the methyl group must be attached to a quaternary C, it can be connected with the ether moiety or with C-4 of the cyclohexenone. There is, however, no coupling of this Me with the olefinic CH at 153.9/6.38, and not with CH at 46.6/2.43. The methyl at 23.2 must be therefore at Cq at 86.8. Somewhat disturbing is the strong 2J coupling between Cq and Me (d 20) , however, a the 2D cutting level of the spectra was very deep, also small signals came out strongly; the other possibility is much worse. The methyl group couples also with the CH2 at 55 (d 21); the opposite coupling of the methylene at 1.72/1.48 with C at 23.2 is not visible. As this CH2 shows no other H, H couplings, this group must be connected with Cq at 86.8. If we try to connect Cq (86.8) with e.g. C-4 of the cyclohexenone, a 4J coupling would result. As there is no further Cq available, C at 55.0 would to be connected with a CH or CH2 group which is not possible due to the missing H, H coupling of H2 at 1.7/1.48 (see COSY) As there is a strong signal between H at 2.20 and Me at 23.2

(c24) , the C ₃ fragment must be attached with CH at Cq (86.8) .

[0055] There is a strong signal between H at 2.20 and a C at -46 (c25) : One of the open CH2 groups is therefore connected with CH at d 46.6 or with C-4 of the cyclohexenon, if this value

is also at ~46. As all open carbon bonds are "protonated" , a ring closure with C at 46.6 must result in a H, H coupling of H at 2.43. This coupling is small as the signal appears as a broad singlet. As not both protons of a CH2 group can be orthogonal to H at 2.40, at least one coupling should be visible if a CH2 group is connected. The only way therefore is to connect CH 75.5 and CH 46.6, and indeed a weak H, H coupling (c 26) is visible. This connection is much clearer in the spectra in DMSO (figure 7) [0056] As there are only 4 open ends to be connected and the structure with a cyclopropane can be excluded due to the missing high-field shift, only two structures can be drawn which differ only in the shift assignment of the CH2 groups. There is, however, a week COSY coupling of H at 4.5 with CH2 at 1.90/1.80. The final structure is therefore: represented in figure 8 and 9. [0057] As in "Ymycine" there are 6 stereocenters, various stereostructures are possible. Thus, some further minor correlations are drawn in figure 10 and 11. The antibiotic molecule or compound of the invention is a colourless compound sparingly soluble in CH2C12, CHC13 , readily in DMSO, pyridine and it has a molecular formula C ₂₄ H ₂₇ NO ₇ . [0058] This compound is novel in two respects: The acid component has not been found in nature so far, and also the skeleton of the other part has never been found before.

Example 6 : Test for antibacterial activity of "Ymycine" [0059] Comparison of the MICs of Ymycine molecule and vancomycin was conducted by the standard microdilution method described by the National Committee for Clinical Laboratory Standards (1997) with Mueller-Hinton (CAMHB) broth medium (Difco Laboratories) . The final volume of CAMHB broth medium containing Ymycine or vancomycin was 100 μl per well, to give a starting inoculum density of 5 x 10 ^B cells/ml.

The results of a typical experiment are shown in the following table 4.

TABLE 4

Comparative antibacterial activities of " Ymycine" produced by new strain of Streptomyces sp.BS46 and vancomycin Bacterial strain

Ymycine vancomycin MRSA ATCC 33591 0.060 2 *Clinic MRSAl 0.070 1 *Clinic MRSA2 0.070 2 *Clinic MRSA3 0.060 1 *Clinic MRSA4 0.070 1.2 *Clinic MRSA5 0.060 0.25 *Clinic MRSA6 0.070 1.5 *Clinic MRSA7 0.060 1 *Clinic MRSA8 0.070 1 *Clinic MRSA9 0.060 2 *Clinic MRSAlO 0.060 2 *Clinic MRSA12 0.060 1 *Clinic MRSA13 0.070 1.5 *Clinic MRSA14 0.070 1.3 *Clinic MRSA15 0.060 1 *Clinic MRSAl6 0.060 1.2 *Clinic MRSA17 0.070 1.5

MIC ( g/ml) Bacterial strain

Ymyσine vancomycin

*Clinic MRSA18 0.060 0.25 *Clinic MRSA19 0.060 2 *Clinic MRSA20 0.070 2

*Clinic Staphylococcus aureus MRSA were isolated from various sample of hospitalized sick patients in Marrakech's Military Hospital and their resistance confirmed. [0060] "Ymycine" compound showed antibacterial activity against gram positive tested bacteria and its MICs are lower than that of vancomycin. The MICs of "Ymycine" for clinic MSSA and MRSA ATCC33ξ91, were ranged from 0.060 to 0.070μg/m; whereas the MICs of vancomycin were ranged between 0.25 and 2 μg/ml . For all tested MRSA, the "Ymycine"compound showed antiMRSA activities at least four fold higher than that of vancomycin.

BELGIAN COORDINATED COLLECTIONS OF MICROORGANISMS - BCCM/ LMG COLLECTION

Page 1 of Form BCCM/LMG/BP/4/ 06-222 Receipt in the case of an original deposit

Budapest Treaty on the International Recognition of the Deposit of Microoganisms for the

Purposes of Patent Procedure

Receipt in the case of an original deposit issued pursuant to Rule 7.1 by the International Depositary Authority BCCM/LMG identified at the bottom of next page

International Form BCCM/LMG/BP/4/.... 06-222

o: Name of the depositor Microbiology Laboratory

Address Faculty of Sciences Semlalia Cadi Ayyad University P.B. S-15, Marrakech MOROCCO

Identification of the microorganism:

1:1 Identification reference given by the depositor:

Strβptαmyces sp BS46

1.2 Accession number given by the International Depositary Authority:

BELGIAN COORDINATED COLLECTIONS OF MICROORGANISMS - BCCM/

LMG COLLECTION

Page 2 of Form BCCM/LMG/BP/4/ 06-222 Receipt in the case of an original deposit

II. Scientific description an/or proposed taxonomlc designation

The microorganism Identified under I above was accompanied by :

(mark with a cross the applicable box(es))

D a scientific description

ISi a proposed taxonomic designation

III. Receipt and acceptance

This International Depositary Authority accepts the microorganism Identified under 1 above, which was received by it on (date of original deposit):

June 23, 2006

IV. international Depositary Authority

Belgian Coordinated Collections of Microorganisms (BCCM)

Laboratorium voor Microbiologie - Bacterienverzameling (LMG)

Universltelt Gent

K.L. Ledeganckstraat 35

B-9000 Gent, Belgium

Signature(s) of person(s) having the power to represent the International Depositary Authority or of authorized official(s) ;

Dr. S. Van Trappen, Curator Patent Deposits collection Date: August 08, 2006

BELGIAN COORDINATED COLLECTIONS OF MICROORGANISMS - BCCM/ LMG COLLECTION

Page 1 of Form BCCM/LMG/BP/9/ 06-222 Viability statement

Budapest Treaty on the International Recognition of the Deposit of Microoganisms for the

Purposes of Patent Procedure

Viability statement issued pursuant to Rule 10.2 by the International Depositary Authority BCCM/LMG Identified on the following page

International Form BCCM/LMG/BP/9/... 06-222

To: Party to whom the viability statement is issued

Name ; Dr. Y. Ouhdouch

Address : Cadi Ayyad University Faculty of Sciences Semlalia Microbiology Laboratory P.B. S-15, Marrakech MOROCCO

Depositor

1.1 Name : Microbiology Laboratory

I.2 Address : Faculty of Sciences Semlalia Cadi Ayyad University P.B. S-15, Marrakech MOROCCO

IL identification of the microorganism

11.1 Accession number given by the International Depositary Authority:

1I.2 Date of the original deposit (or where a new deposit or a transfer has been made, the most recent relevant date):

June 23, 2006 III. Viability statement

The viability of the microorganism identified under Il above was tested on:

(Give date. In the cases referred to in Rule 10.2(a)(Ii) and (iii), refer to the most recent viability test).

June 26, 2006 On that date, the said microorganism was : (mark the applicable box with a cross)

E) viable

□ no longer viable

BELGIAN COORDINATED COLLECTIONS OF MICROORGANISMS - BCCM/

LMG COLLECTION

Page 2 of Form BCCM/LMG/BP/9/ 06-222 Viability statement

IV, Conditions under which the viability test has been performed:

(Fill In if the Information has been requested and if the results of the test were negative).

V. International Depositary Authority

Belgian Coordinated Collections of Microorganisms (BCCM)

Laboratorium voor Microbiologic - Bacterteπverzameling (LMG)

Universiteit Gent

K.L. Ledeganckstraat 35

B-9000 Gent, Belgium

Signature(s) of person(s) having the power to represent the International Depositary Authority or of authorized official(s) :

Dr. S. Van Trappen, Curator Patent Deposits collection

Date: August 08, 2006