This application claims the benefit of U.S. Provisional Application Serial No.62/840,788, filed April 30, 2019, which is incorporated by reference herein. SEQUENCE LISTING

This application contains a Sequence Listing electronically submitted to the United States Patent and Trademark Office via EFS-Web as an ASCII text file entitled“0504-000015WO01.txt” having a size of 4 kilobytes and created on April 29, 2020. Due to the electronic filing of the Sequence Listing, the electronically submitted Sequence Listing serves as both the paper copy required by 37 CFR § 1.821(c) and the CRF required by § 1.821(e). The information contained in the Sequence Listing is incorporated by reference herein. BACKGROUND

Tuberculosis (TB) is an increasingly important worldwide public health concern due to its aerosol transmission and high morbidity and mortality. TB ranks as a leading cause of death worldwide due to a bacterial pathogen. The World Health Organization estimates that there are 10.4 million new cases and 1.7 million deaths due to TB annually worldwide. Mycobacterium tuberculosis (Mtb) is the major etiologic agent of TB, which typically attacks the lungs and can be transmitted through aerosol. Approximately one-third of the world’s population is latently infected with Mtb, representing an enormous reservoir of active TB cases.

The recommended anti-TB regimen is a combination of at least four drugs. The duration of the treatment is at least six months and may be up to two years for drug-resistant TB. The complex and lengthy anti-TB regimens often result in inadequate adherence to treatment, which in turn provides a new opportunity for drug-resistant Mycobacterium tuberculosis (Mtb) strains to multiply.

During the past decade, multidrug-resistant TB (MDR-TB) and extensively drug-resistant TB (XDR-TB) have been increasing in incidence in many areas, not only in developing countries but also in industrialized countries. Additional and more efficacious anti-tuberculosis drugs and simpler drug regimens would, therefore, be desirable to meet therapeutic needs. SUMMARY OF THE INVENTION

This disclosure describes compounds, compositions, and methods for treating or preventing infection or disease including, in some specific embodiments, treating or preventing tuberculosis and/or infection with Mycobacterium tuberculosis (Mtb).

In one aspect, this disclosure describes a compound including an aurone having the structure of Formula I:

wherein X = Cl, Br, or Me.

In another aspect, this disclosure describes a compound comprising an aurone having the structure of Formula II:

,

wherein R = H or an acetyl (Ac) group, and wherein R' = H, a halogen,–OH,–NO ₂ , or an alkyl group. Alternatively, R = H or an acetyl (Ac) group, and R' = a halogen,–OH,–NO2, or an alkyl group. That is, in some embodiments, R' does not include H alone.

In yet another aspect, this disclosure describes a compound including an aurone having the structure of Formula III:

wherein R = H or an acetyl (Ac) group; wherein X = O, NH, or S; and wherein R' = H, a halogen (for example, F, Cl, Br, I, or At),–OH,–COH,–NO ₂ , or an alkyl group (–C _n H _2n+1 , for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group, a hexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, etc.), or a combination thereof.

In additional aspects, this disclosure describes a compound including

(aurone 9504); or

(aurone 9505); or

(aurone 9501); or

(aurone 9510); or

(aurone AA2A).

In a further aspect, this disclosure describes a method for treating or preventing an infection, disease, or condition in a subject. The method includes administering to the subject a composition including an effective amount of an aurone. The aurone includes an aurone having the structure of Formula I, an aurone having the structure of Formula II, an aurone having the structure of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof. In another aspect, this disclosure describes a composition including an aurone selected from an aurone having the structure of Formula I, an aurone having the structure of Formula II, an aurone having the structure of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof.

In yet another aspect, this disclosure describes a kit that includes an active agent comprising an aurone and instructions for use. The aurone includes an aurone of Formula I, an aurone of Formula II, an aurone of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8 or a combination thereof.

As used herein,“alkenyl” refers to an unsubstituted or substituted hydrocarbon chain radical having at least one carbon-carbon double bond and having from about 2 to about 15 carbon atoms; from 2 to about 10 carbon atoms; or from 2 to about 8 carbon atoms. Non-limiting examples of alkenyls include, for example, vinyl, allyl, and butenyl.

As used herein,“alkynyl” "refers to an unsubstituted or substituted hydrocarbon chain radical having at least one carbon-carbon triple bond and having from about 2 up to about 15 carbon atoms; from 2 to about 10 carbon atoms; or from about 2 to about 8 carbon atoms. Non-limiting examples of alkynyls include, for example ethynyl, propynyl, propargyl and butynyl.

As used herein,“aryl” refers to an aromatic, carbocyclic or heterocyclic ring radical. Non- limiting examples of aryls include, for example, phenyl, tolyl, xylyl, cumenyl, naphtyl, biphenyl, thienyl, furyl, pyrrolyl, pyridinyl, pyrazinyl, thiazolyl, pyrimidinyl, quinolinyl, tetrazolyl, benzothiazolyl, benzofuryl, indolyl, and the like. Aryls may be substituted or unsubstituted.

As used herein“alkoxy” refers to an alkyl, alkenyl, or alkynyl group, as defined herein, attached to an oxygen radical. The term "alkoxy" also includes alkyl ether groups, where the term 'alkyl' is defined above, and 'ether' means two alkyl groups with an oxygen atom between them. Non-limiting examples of alkoxy groups include methoxy, ethoxy, n- propoxy, i-propoxy, n-butoxy, s-butoxy, t-butoxy, methoxymethane (also referred to as“dimethyl ether”), and methoxyethane (also referred to as“ethyl methyl ether”).

As used herein,“hydroxyl group” or“hydroxyl” refers to a substituent group of formula ^OH.

As used herein,“halogen” or“halide” refers to fluoride, chloride, bromide or iodide. The terms“fluoro”,“chloro”,“bromo”, and“iodo” may also be used when referring to halogenated substituents, for example,“trifluoromethyl.” As used herein,“amine group” has the general formula -NRR, where each R is independently hydrogen, or a hydrocarbon.

As used herein,“cyano group” or“cyano” refers to a–CN group.

The term“azido group” or“azido”, refers to an -N3 group.

As used herein,“ether group” or“ether” refers to radicals of the general formula -R'-O-R", where R and R" are independently substituted or unsubstituted hydrocarbyl.

As used herein“nitro group” or“nitro” refers to–NO ₂ .

As used herein“ester group” or“ester” refers to a substituent of the general formula -C-O- O-R ¹ where R ¹ may be either aliphatic or aromatic.

The term substituted refers to the moiety (for example, alkyl, alkenyl, cycloalkyl, aryl, etc.) bearing one or more substituents. Non-limiting examples of substituents can include alkyl, alkenyl, alkynyl, hydroxyl, alkoxy, heterocyclic, aryl, heteroaryl, aryloxy, halogen, haloalkyl, cyano, nitro, amino, lower alkylamino, lower dialkylamino, amido, azido, acyl (—C(O)R ₆ ), carboxyl (—

C(O)OH), ester (—C(O)OR6), carbamate (—OC(O)—N(R6)2), wherein R6 is H or lower alkyl, lower alkenyl, lower alkynyl, aryl, heteroaryl, heterocycle, and the like. In the case of an aurone ring structure, the term“substituted” can include the substitution of a heteroatom into the aurone ring structure.

The words“preferred” and“preferably” refer to embodiments of the invention that may afford certain benefits, under certain circumstances. However, other embodiments may also be preferred, under the same or other circumstances. Furthermore, the recitation of one or more preferred embodiments does not imply that other embodiments are not useful and is not intended to exclude other embodiments from the scope of the invention.

The terms“comprises” and variations thereof do not have a limiting meaning where these terms appear in the description and claims.

Unless otherwise specified,“a,”“an,”“the,” and“at least one” are used interchangeably and mean one or more than one.

Also herein, the recitations of numerical ranges by endpoints include all numbers subsumed within that range (for example, 1 to 5 includes 1, 1.5, 2, 2.75, 3, 3.80, 4, 5, etc.).

For any method disclosed herein that includes discrete steps, the steps may be conducted in any feasible order. And, as appropriate, any combination of two or more steps may be conducted simultaneously. The above summary of the present invention is not intended to describe each disclosed embodiment or every implementation of the present invention. The description that follows more particularly exemplifies illustrative embodiments. In several places throughout the application, guidance is provided through lists of examples, which examples can be used in various

combinations. In each instance, the recited list serves only as a representative group and should not be interpreted as an exclusive list.

All headings are for the convenience of the reader and should not be used to limit the meaning of the text that follows the heading, unless so specified.

Reference throughout this specification to“one embodiment,”“an embodiment,”“certain embodiments,” or“some embodiments,” etc., means that a particular feature, configuration, composition, or characteristic described in connection with the embodiment is included in at least one embodiment of the disclosure. Thus, the appearances of such phrases in various places throughout this specification are not necessarily referring to the same embodiment of the disclosure. Furthermore, the particular features, configurations, compositions, or characteristics may be combined in any suitable manner in one or more embodiments.

Unless otherwise indicated, all numbers expressing quantities of components, molecular weights, and so forth used in the specification and claims are to be understood as being modified in all instances by the term“about.” Accordingly, unless otherwise indicated to the contrary, the numerical parameters set forth in the specification and claims are approximations that may vary depending upon the desired properties sought to be obtained by the present invention. At the very least, and not as an attempt to limit the doctrine of equivalents to the scope of the claims, each numerical parameter should at least be construed in light of the number of reported significant digits and by applying ordinary rounding techniques.

Notwithstanding that the numerical ranges and parameters setting forth the broad scope of the invention are approximations, the numerical values set forth in the specific examples are reported as precisely as possible. All numerical values, however, inherently contain a range necessarily resulting from the standard deviation found in their respective testing measurements. BRIEF DESCRIPTION OF THE FIGURES FIG.1A shows the general structure of an aurone. FIG.1B shows the benzofuran-3(2H)-one (3-coumaranone) and benzylidene (styrene) components of an aurone. FIG.2 shows an aurone as depicted in Fig.1A as synthetically derived fragments: a benzofuranone-derived fragment (BDF) and an aldehyde-derived fragment (ADF).

FIG.3 shows a standard aurone substituent ring numbering scheme.

FIG.4A– FIG.4D show aurone AA2A and aurone AA8 inhibit Mtb chorismate synthase activity. FIG.4A. Schematic of assays to measure aurone AA2A and aurone AA8 inhibition of chorismate synthase of Mtb. FIG.4B. SDS-PAGE analysis of recombinant proteins of Rv3227 (left) and Rv2540c (right) extracted from the E. coli Rossetta expressing these two proteins. Lane 1: protein molecular weight marker (PageRuler ^TM Unstained); Lane 2: crude protein extracts from the E. coli strains; Lanes 3-5: samples eluted from Ni-column by 125 mM, 250 mM, and 500 mM imidazole, respectively; Lane 6: the concentrated proteins that were eluted by 500 mM imidazole. FIG.4C. Evaluation of Mtb chorismate synthase activity by measuring phosphate production.

FIG.4D. Evaluation of Mtb chorismate synthase activity by measuring 5-enolpyruvylshikimate-3- phosphate synthase (EPSP) consumption. Data are means of three independent experiments ± standard deviation (S.D.) * P <0.05; ** P <0.01; *** P <0.001.

FIG.5A– FIG.5B show treatment with aurone AA2A or aurone AA8 reduces the bacterial load in lungs of Mtb infected mice. FIG.5A. In vivo imaging System (IVIS) study results of live mice and lungs before (Left) and after (Right) treatment with aurones AA8 and AA2A. Groups of mice were imaged in vivo by the IVIS system with tdTomato optimal excitation and emission wavelengths following the protocol of Kong et al. (PloS One.2016;11(3):e0149972). Lungs of the mice extracted after sacrificing the mice and imaged by IVIS ex vivo. FIG.5B. Colony forming unit (CFU) data of mouse lung tissues from different groups at various time points. ** P<0.01.

FIG.6 shows schematic of structure activity relationship (SAR) analysis of aurones against Mtb.

FIG.7 shows aurones inhibit intracellular Mtb.25 mM and 50 mM of aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were incubated with the infected cells (MOI=20) after removing extracellular bacteria. Growth ratio of each sample = fluorescence intensity (FI) of each sample at 48 hours / FI of the same sample at 0 hours. Positive controls at their in vitro MICs: AMI 1 mg/mL; ETH 0.5 mg/mL; INH 0.5 mg/mL; and RIF 0.4 mg/mL. Data are means of three independent experiments ± S.D.

FIG.8A– FIG 8F shows the evaluation of efficacy of AA2A, AA8, 9501, and 9504 against Mtb in vivo. CFU in the lungs of infected mice treated with AA2A or AA8 (FIG.8A), or with 9501 or 9504 (FIG.8B). IVIS images of the mouse lungs treated with aurones AA2A or AA8 (FIG.8C), or with 9504 or 9501 (FIG.8D). Quantitative analysis imaging results of the mouse lungs treated with aurones AA2A or AA8 (FIG.8E), or with 9504 or 9501 (FIG.8F). * P<0.05; ** P<0.01; *** P<0.001; and **** P<0.0001.

FIG.9A– FIG.9B shows AA2A and 9504 inhibit Mtb-Cs activity. FIG.9A. Evaluation of AA2A and AA8 inhibitory effects on Mtb-Cs activity. FIG.9B. Evaluation of 9501, 9504, 9505, and 9510 inhibitory effects on Mtb-Cs activity. Data are means of three independent experiments ± S.D. DETAILED DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS

This disclosure describes compounds, compositions, and methods for treating or preventing infection or disease including, in some specific embodiments, treating or preventing tuberculosis (also referred to herein as TB) and/or infection with Mycobacterium tuberculosis (Mtb).

In an exemplary aspect, this disclosure describes aurones including, for example, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8, compositions including aurones, and methods of using aurones for treating or preventing tuberculosis. Aurones

Aurones are a heterocyclic chemical compound that are chemically defined as a

benzofuranone linked to an exocyclic arylidene that is most frequently derived from an aldehyde. (Harborne. The Flavonoids: advances in research since 1980. Chapman and Hall; 1988.) Aurones are flavonoids (from the Latin word flavus meaning yellow), and some aurones are naturally- occurring yellow pigments in vegetables and flowers. Additional non-naturally occurring aurones have been synthesized, with some of the non-naturally occurring aurones built on a scaffold of a naturally occurring aurone.

Previous studies have demonstrated that aurone analogues can act as antiparasistics, antivirals, antibacterials, and antifungals and as anti-cancer agents and anti-inflammatory agents. (Sutton et al. Bioorganic & Medicinal Chemistry Letters.2017;27(4):901-3; Park et al. Int

Immunopharmacol.2017;43:116-28; Alsaif et al. Curr Pharm Biotechnol.2017;18(5):384-90;

Haudecoeur et al. Curr Med Chem.2012;19(18):2861-75; WO 2017/180644.) Aurone derivatives or synthetic aurones have been demonstrated to have anti-bacterial activities, inhibiting, for example, the growth of Gram-positive bacteria and Gram-negative bacteria, including Staphylococcus aureus and Caulobacter crescentus (Pires et al. Journal of Medicinal Chemistry.2001;44(22):3673-81), Streptococcus pneumoniae (Thomas et al. Bioorganic & Medicinal Chemistry Letters. 2003;13(3):423-6), Klebsiella pneumonia (Hadj-esfandiari et al. Bioorganic & Medicinal Chemistry Letters.2007;17(22):6354-63), Bacillus subtilis, E. coli, and Proteus vulgaris (Bandgar et al. Eur J Med Chem.2010;45(7):3223-7). The anti-tuberculosis effect of aurones (for example, against Mtb) was unknown at the time of the invention. Substituted Aurones

Aurones are characterized by a 15-carbon skeleton containing a coumaranone

(benzofuranone) component, or its aza- or thio- counterpart, linked via an exocyclic alkene to an aryl group, for example, another phenyl ring, with the thermodynamically favored Z-geometry about this alkene (FIG.1A, reproduced below).

Representative aurones contain, as a first component, a coumaranone (benzofuranone) component (typically a 3-coumaranone, also known as benzofuran-3(2H)-one, or its aza- or thio- counterpart) and, as a second component, an aryl-containing component, for example a benzylidene (also known as a styrene) component, which contains the exocyclic alkene and an aryl group (FIG. 1B, reproduced below).

3-Coumaranone (benzofuran-3(2H)-one)

Benzylidene (styrene) In some aurones, the second, aryl-containing component includes a 5-membered ring (for example, furyl) instead of a 6-membered ring (phenyl) as shown above.

In the case of aurones with nitrogen or sulfur substitutions in the five-membered ring of the first component, it should be understood that the first component may be an oxindole or a benzothiophenone.

The first component of the substituted aurone (that is, the benzofuranone, oxindole or benzothiophenone) may be substituted or unsubstituted. However, at least one of the first and second components of the substituted aurone is substituted. In some embodiments, an aurone may include a nitrogen or sulfur substitution in the five membered ring. In such embodiments, the coumaranone component may be an oxindole or a benzothiophenone.

In some embodiments, the aryl-containing (for example, benzylidene) component of the aurone, designated herein as the second component of the aurone, is frequently derived from an aldehyde; thus, this second component of the aurone is also referred to herein as an“aldehyde- derived” component or fragment (ADF). The coumaranone (benzofuranone) component (typically a 3-coumaranone, also known as benzofuran-3(2H)-one, or its aza- or thio- counterpart) of the aurone, designated herein as the first component of the aurone, is analogously also referred to herein as the“benzofuranone-derived” component or fragment (BDF) (FIG.2, reproduced below).

A substituted aurone is an aurone that contains one or more substituents positioned at one or more positions on either or both of the first or second components of the 15-carbon skeleton, and/or that includes a ring substitution.

Roussaki et al. have described the numbering scheme for substituent position for aurone derivatives (FIG.3), which is reproduced below to assist in identifying substituent positions (Int. J. Med. Chem. (2012) Article ID 196921).

Compounds

In one aspect, this disclosure describes a compound which may be suitable for inclusion in one or more compositions described herein or for us in one or more methods described herein. Compounds described herein include both newly discovered compounds as well as compounds that may be known to the art, but not heretofore known to possess the activity or activities described herein.

In some embodiments, a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula I:

wherein X = Cl, Br, or Me, or a combination thereof. The aurones of Formula I include a benzylidene with dimethylamino substitutions linked to benzofuranone with chlorine, bromine, and/or methyl substitutions. In some embodiments, more than one carbon of the benzofuranone may include a Cl, Br, and/or Me. Exemplary aurones having the structure of Formula I include aurone 9499, aurone 9501, aurone 9503, aurone 9504, aurone 9505, or aurone 9510 (see Table 1).

In some embodiments, a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula II:

;

wherein R = H or an acetyl (Ac) group; and wherein R' = H, a halogen (for example, F, Cl, Br, I, or At),–OH, - COH,–NO2, or an alkyl group (–C _n H _2n +1, for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group, a hexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, etc.), or a combination thereof.

In some embodiments, the acetylated or non-acetylated azaaurones of Formula II include a benzylidene linked to indolin-3-one. In some embodiments, when R' = a halogen, the halogen preferably includes Cl and/or Br. In some embodiments, the acetylated or non-acetylated azaaurones of Formula II include a bromobenzylidene linked to indolin-3-one. Exemplary aurones having the structure of Formula II include aurone AA2, aurone AA2A aurone AA3, aurone AA3A, aurone AA6, aurone AA7, and aurone AA8 (see Table 1). In some embodiments, R' does not include H alone. When R' does not include H alone, Formula II does not include aurone AA8.

In some embodiments, a representative compound suitable for use in the compositions and methods of the disclosure is a compound comprising an aurone having the structure of Formula III:

wherein R = H or an acetyl (Ac) group; wherein X = O, NH, or S; and wherein R' = H, a halogen (for example, F, Cl, Br, I, or At),–OH,–COH,–NO2, or an alkyl group (–C _n H _2n +1, for example, a methyl group, an ethyl group, a propyl group, an isopropyl group, a pentyl group, a hexyl group, a heptyl group, an octyl group, a nonyl group, a decyl group, etc.), or a combination thereof.

The aurones of Formula III include a heteroaromatic group (for example, a furan, a pyrrolidine, or a thiophene) linked to indolin-3-one. Exemplary aurones having the structure of Formula III include aurone AA4A, aurone AA5, and aurone AA5A, and aurone AA9 (see Table 1).

In some embodiments, a compound includes a compound selected from:

9504,

9505,

9501, 9510, AA2A, and

.

In some embodiments, a compound includes a combination of compounds selected from aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8. In some embodiments, a compound includes a compound or combination of compounds selected from aurone 9504, aurone 9505, aurone 9501, aurone 9510, and aurone AA2A. In some embodiments, a compound includes a combination of compounds selected from an aurone of Formula I, an aurone of Formula II, and/or and an aurone of Formula III. In some embodiments, a compound includes a combination of compounds selected from an aurone of Formula I, an aurone of Formula II, an aurone of Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, and aurone AA8.

As further described in Example 1, an iterative three round strategy was utilized to generate and identify aurones 9504, 9505, 9501, 9510, AA2A and AA8, that could effectively inhibit the growth of Mtb in culture and intracellularly in human cells. Although the structure of the AA8 aurone was previously reported (see, for example, WO 2017/180644), its effect on Mtb was previously unknown. The other 5 aurones discussed in Example 1 (9504, 9505, 9501, 9510, and AA2A) are newly generated, non-naturally occurring aurones.

An assessment of the structures of the most inhibitory aurones from the testing of Example 1 demonstrated some interesting trends in what constitutes the design of aurones that are effective in inhibiting Mtb. In general, the most inhibitory aurones were aurones where benzylidene with dimethylamino substitutions were linked to benzofuranone with chlorine or bromine substitutions and acetylated or non-acetylated azaaurones where benzylidene was linked to indolin-3-one. These aurone scaffolds may provide platforms for the development of future anti-TB compounds.6- chloro, 6-bromo, 7-bromo, and 5,6-dimethyl appeared to be the optimal substitution patterns on the benzofuranone portion while the modification of the dimethylamino group was not well tolerated. Aurone synthesis

Aurones may be synthesized using any suitable method. In some embodiments, aurones may be synthesized using a method described by Varma et al. (Tetrahedron Letters 1992;33(40):5937- 40) or a method described by Hawkins and Handy (Tetrahedron 2013;69(44):9200-4).

Azaaurones may be synthesized using any suitable method. In some embodiments, azaaurones may be synthesized using a modification of the method reported by Carrasco et al. (Chem Med Chem.2016;11(19):2194-204). For example, to a solution of 1-acetylindolin-3-one (for example, 0.5 mmol) in toluene, the appropriate aldehyde (for example, 0.5 mmol) and piperidine may be added. The mixture may be heated to reflux (for example, for 12 hours), cooled to room temperature, and then purified. Purification may be, for example, by flash column chromatography using ethyl acetate/hexanes mixtures.

For deacetylated azaaurones, the acetylated product may be dissolved in methanol and treated with 50% aqueous KOH. The reaction mixture may be acidified and extracted with ethyl acetate and/or concentrated in vacuo. The resulting residue may be purified including, for example, by flash column chromatography using toluene/ethanol mixtures. Compositions

The present disclosure provides a composition that includes the aurone. In some

embodiments, the composition is a pharmaceutical composition that includes, as an active agent, an aurone, and a pharmaceutically acceptable carrier. In exemplary embodiments, the aurone includes an aurone according to Formula I, Formula II, Formula III, 9504, 9505, 9501, 9510, AA2A, or AA8, or a combination thereof. In some embodiments, the aurone preferably exhibits at least 40 percent inhibition of the growth of the tdTomato-labeled Mtb CDC1551 strain. In some

embodiments, the percent inhibition of the growth of the tdTomato-labeled Mtb CDC1551 strain may be measured using 100 mL of the aurone, as described in Example 1.

The active agent may be formulated in a pharmaceutical composition to be administered to a subject in a formulation adapted to the chosen route of administration. The formulation may include one suitable for oral, rectal, vaginal, topical, nasal, ophthalmic, or parenteral (including

subcutaneous, intramuscular, intraperitoneal, and intravenous) administration.

The pharmaceutically acceptable carrier may include, for example, an excipient, a diluent, a solvent, an accessory ingredient, a stabilizer, a protein carrier, or a biological compound. Non- limiting examples of a protein carrier includes keyhole limpet hemocyanin (KLH), bovine serum albumin (BSA), ovalbumin, or the like. Non-limiting examples of a biological compound which may serve as a carrier include a glycosaminoglycan, a proteoglycan, and albumin. The carrier may be a synthetic compound, such as dimethyl sulfoxide or a synthetic polymer, such as a

polyalkyleneglycol. Ovalbumin, human serum albumin, other proteins, polyethylene glycol, or the like may be employed as the carrier. In a some embodiments, the pharmaceutically acceptable carrier preferably includes at least one compound that is not naturally occurring or a product of nature. In a some embodiments, the pharmaceutically acceptable carrier results in a compositions including an aurone that is not naturally occurring or a product of nature.

In some embodiments, the aurone is formulated in combination with one or more additional (for example,“second”) active agent(s). For example, an aurone with anti-Mycobacterium tuberculosis (Mtb) activity may be formulated in combination with another anti-tuberculosis compound. An anti-tuberculosis compound may include for example, one of the most utilized anti- TB drugs, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF). Additional exemplary anti-tuberculosis compounds include Pyrazinamide (PZA), Streptomycin (SM), Levofloxacin, Moxifloxacin, Ethionamide, Prothionamide, Cycloserine, p-aminosalicylic acid, Bedaquiline, Clofazimine, Linezolid, Amoxicillin, clavulanic acid, Imipenem, Cilastatin,

Meropenem, Kanamycin, and Capreomycin.

In some embodiments, such a combination therapy includes at least one compound that is not naturally occurring or a product of nature. In some embodiments, the pharmaceutical composition includes at least one non-naturally occurring therapeutic or prophylactic agent.

The composition may be conveniently presented in unit dosage form and may be prepared by any of the methods well-known in the art of pharmacy. All methods include the step of bringing the active agent into association with a pharmaceutical carrier. In some embodiments, the composition may be prepared by uniformly and intimately bringing the active compound into association with a liquid carrier, a finely divided solid carrier, or both, and then, if necessary, shaping the product into the desired formulations.

A composition including an aurone suitable for oral administration may be presented as discrete units such as tablets, troches, capsules, lozenges, wafers, or cachets, each containing a predetermined amount of the active agent as a powder or granules, as liposomes, or as a solution or suspension in an aqueous liquor or non-aqueous liquid such as a syrup, an elixir, an emulsion, or a draught. The tablets, troches, pills, capsules, and the like may also contain one or more of the following: a binder such as gum tragacanth, acacia, corn starch, or gelatin; an excipient such as dicalcium phosphate; a disintegrating agent such as corn starch, potato starch, alginic acid, and the like; a lubricant such as magnesium stearate; a sweetening agent such as sucrose, fructose, lactose, or aspartame; and a natural or artificial flavoring agent. When the unit dosage form is a capsule, it may further contain a liquid carrier, such as a vegetable oil or a polyethylene glycol. Various other materials may be present as coatings or to otherwise modify the physical form of the solid unit dosage form. For instance, tablets, pills, or capsules may be coated with gelatin, wax, shellac, sugar, and the like. A syrup or elixir may contain one or more of a sweetening agent, a preservative such as methyl- or propylparaben, an agent to retard crystallization of the sugar, an agent to increase the solubility of any other ingredient, such as a polyhydric alcohol, for example glycerol or sorbitol, a dye, and flavoring agent. The material used in preparing any unit dosage form is substantially nontoxic in the amounts employed. The active agent may be incorporated into preparations and devices in formulations that may, or may not, be designed for sustained release or controlled release.

A formulation suitable for parenteral administration may include a sterile aqueous preparation of the active agent, or a dispersion of a sterile powder of the active agent, which is preferably isotonic with the blood of the subject. Parenteral administration of an aurone (for example, through an IV drip) is one form of administration. An isotonic agent may be included in the liquid preparation including, for example, a sugar; a buffer; and/or a salt including, for example, sodium chloride. A solution of the active agent may be prepared in water, optionally mixed with a nontoxic surfactant. A dispersion of the active agent may be prepared in water, ethanol, a polyol (such as glycerol, propylene glycol, liquid polyethylene glycols, and the like), a vegetable oil, or a glycerol ester, or a mixture thereof. The ultimate dosage form may be sterile, fluid, and stable under the conditions of manufacture and storage. The necessary fluidity may be achieved, for example, by using liposomes, by employing the appropriate particle size in the case of dispersions, or by using surfactants. Sterilization of a liquid preparation may be achieved by any convenient method that preserves the bioactivity of the active agent, preferably by filter sterilization. Methods for preparing a powder include vacuum drying and freeze drying of the sterile injectable solutions. Subsequent microbial contamination may be prevented using various antimicrobial agents, for example, antibacterial, antiviral and antifungal agents including parabens, chlorobutanol, phenol, sorbic acid, thimerosal, and the like. Absorption of the active agents over a prolonged period may be achieved by including agents for delaying, for example, aluminum monostearate and gelatin. Nasal spray formulations include purified aqueous solutions of the active agent with a preservative agent and/or an isotonic agents. Such formulations may be adjusted to a pH and isotonic state compatible with the nasal mucous membranes. Formulations for rectal or vaginal administration may be presented as a suppository with a suitable carrier such as cocoa butter, or hydrogenated fats, or hydrogenated fatty carboxylic acids. Ophthalmic formulations are prepared by a similar method to the nasal spray, except that the pH and isotonic factors are preferably adjusted to match that of the eye. Topical formulations include the active agent dissolved or suspended in one or more media such as mineral oil, petroleum, polyhydroxy alcohols, or other bases used for topical pharmaceutical formulations. Topical formulations may be provided in the form of a bandage, wherein the formulation is incorporated into a gauze or other structure and brought into contact with the skin. Methods

In another aspect, this disclosure provides methods of using the compounds and

compositions. In some embodiments, as further described in this section, a method includes administering an aurone to a subject. In some embodiments, the method includes using the compounds and compositions to treat, prevent, inhibit, or control an infection, disease, or condition in a subject. In some embodiments, the infection, disease, or condition includes tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection. Administration

In some embodiments, an aurone (including for example, an aurone having the structure of Formula I, Formula II, Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof), as the active agent, may be administered to a subject alone or in a pharmaceutical composition that includes the active agent and a

pharmaceutically acceptable carrier. The term“administered” encompasses administration of a prophylactically and/or therapeutically effective dose or amount of the active agent to a subject. The active agent may be administered to a subject in an effective amount to produce the desired effect. The term“effective dose” or“effective amount” refers to a dose or amount that produces the effects for which it is administered, especially an intended effect such as an anti-tuberculosis effect.

An aurone may be introduced into the subject systemically or locally, for example at the site of infection or inflammation. The active agent may be administered to the subject in an amount effective to produce the desired effect. An aurone may be administered in a variety of routes, including orally, parenterally, intraperitoneally, intravenously, intraarterially, transdermally, sublingually, intramuscularly, rectally, transbuccally, intranasally, liposomally, via inhalation, vaginally, intraoccularly, via local delivery by catheter or stent, subcutaneously, intraadiposally, intraarticularly, intrathecally, or in a slow release dosage form. Local administration may include topical administration, administration by injection, or perfusion or bathing of an organ or tissue, for example.

A formulation may be administered as a single dose or in multiple doses. In some embodiments, a formulation may be administered once per day or more than once per day including, for example, twice per day, three times per day, or four times per day. Useful dosages of the active agent may be determined by comparing their in vitro activity and the in vivo activity in animal models. Methods for extrapolation of effective dosages in mice, and other animals, to humans are known in the art.

In some embodiments, examples of anti-tuberculosis therapies which can form the basis for determining dosages and dosing regiments for an aurone may be found in the Companion

Handbook to the WHO Guidelines for the Programmatic Management of Drug-Resistant

Tuberculosis (available on the world wide web at www.ncbi.nlm.nih.gov/books/NBK247416/) or on the world wide web at aidsinfo.nih.gov/guidelines/html/4/adult-and-adolescent-oppo rtunistic- infection/356/tb-drug-dosing.

Dosage levels of the active agent in the pharmaceutical compositions may be varied to obtain an amount of the active agent which is effective to achieve the desired therapeutic response for a particular subject, composition, and mode of administration, without being toxic to the subject. The selected dosage level will depend upon a variety of factors including the activity of the particular compound employed, or the ester, salt or amide thereof, the route of administration, the time of administration, the rate of excretion of the particular compound being employed, the duration of the treatment, other drugs, compounds and/or materials used in combination with the aurone, the age, sex, weight, condition, general health and prior medical history of the subject being treated, and like factors well known in the medical arts.

In an exemplary embodiment, an aurone may be administered to a subject in an amount of at least 5 mg, at least 10 mg, at least 20 mg, at least 30 mg, at least 40 mg, at least 50 mg, or at least 5 g. In exemplary embodiment, an aurone may be administered to a subject in an amount of up to 40 mg, up to 50 mg, up to 60 mg, up to 70 mg, up to 80 mg, up to 90 mg, up to 100 mg, or up to 1000 mg. In an exemplary embodiment, an aurone may be administered orally at least once per day including, for example, as a medication, nutritional supplement, or food additive. In a further exemplary embodiment, an aurone may be administered to a subject intravenously or

intramuscularly.

In another exemplary embodiment, an aurone may be administered to a subject in an amount effect to provide a daily dosage of at least 0.01 mg/kg body weight, at last 0.3 mg/kg body weight, at least 0.1 mg/kg body weight, or at least 1 mg/kg body weight. In another exemplary embodiment, an aurone may be administered to a subject in an amount effect to provide a daily dosage of up to 1 mg/kg body weight, up to 5 mg/kg body weight, up to 10 mg/kg body weight, or up to 20 mg/kg body weight.

A physician or veterinarian having ordinary skill in the art may determine and prescribe the effective amount of the pharmaceutical composition required. For example, a physician could start doses of the aurone employed in the pharmaceutical composition at levels lower than that required in order to achieve the desired therapeutic effect and gradually increase the dosage until the desired effect is achieved. Methods to treat or prevent tuberculosis or Mycobacterium tuberculosis (Mtb) infection

In some embodiments, an aurone (including for example, an aurone having the structure of Formula I, Formula II, Formula III, aurone 9504, aurone 9505, aurone 9501, aurone 9510, aurone AA2A, or aurone AA8, or a combination thereof) may be used to treat, prevent, inhibit, or control tuberculosis or Mycobacterium tuberculosis (Mtb) infection.

As further described in Example 1 and Example 2, aurones 9504, 9505, 9501, 9510, AA2A, and AA8 performed as well or better than the four most utilized anti-TB drugs, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF) in preventing, inhibiting, or controlling Mycobacterium tuberculosis (Mtb) infection. Given the myriad of side effects associated with the use of AMI, ETH, INH and RIF in patients, the high selectivity of the top six aurones identified in Example 1, one or more of these aurones could be used as a replacement for one or more of a more toxic anti-TB drugs that is currently in use. Additionally or alternatively, as further described herein, an aurone may be used in combination with another anti-TB drug or drug cocktail.

In one embodiment, an aurone is administered in an amount effective to treat or prevent tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection. Administration of the aurone (including, for example, a composition including the aurone) may be performed before, during, or after a subject develops tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or manifests symptoms of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.

Therapeutic treatment is initiated after the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection. Treatment initiated after the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or after manifestation of tuberculosis and/or

Mycobacterium tuberculosis (Mtb) infection, may result in decreasing the severity of a symptom, or completely removing a symptom.

In another embodiment, an aurone may be administered prophylactically in an amount effective to prevent or delay the development of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection in a subject. Treatment that is prophylactic, for instance, may be initiated before a subject develops tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection, or manifests symptoms of tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection. An example of a subject who is at particular risk of developing tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection is a person with a medical condition that weakens the immune system, including, for example a person with an HIV infection; a person who work or reside with a person who is at high risk for TB in a facilities or an institutions such as a hospital, a homeless shelter, a correctional facility, a nursing home, or a residential home for those with HIV; an IV drug user; etc.

Administration of an aurone may occur before, during, and/or after other treatments including, for example, additional active agent(s). In an exemplary embodiments, such combination therapy may involve the administration of an aurone before, during and/or after the use of other anti-tuberculosis agents.

The administration of an aurone may be separated in time from the administration of another active agent by hours, days, or even weeks; alternatively, the other active agent(s) may be administered concurrently, either together in the same composition or in separate compositions. Additionally or alternatively, the administration of an aurone may be combined with another active agent or modality such as, for example, non-drug therapies, such as, but not limited to, radiotherapy, heat therapy, cryotherapy, electrical therapy, massage, and acupuncture.

The activation of macrophages by T cell cytokines are a critical defense mechanism against intracellular bacterial pathogens including Mtb (Jayaswal et al. PLoS pathogens.

2010;6(4):e1000839). However, Mtb has strategies to survive inside macrophages to avoid being eliminated by drugs. Because Mtb primarily stays in the macrophage after infection, new treatments for Mtb will preferably be active against intracellular Mtb. As further described in Example 1, using THP-1 human monocyte cells that were differentiated into macrophage-like cells, aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were found to significantly inhibit intracellular Mtb replication at two different concentrations that had no or minimal cytotoxic effects. These data indicate that these aurones may effectively penetrate into macrophage phagosome to inhibit Mtb replication. Furthermore, as described in the Examples, in vivo studies of 9504, 9501, AA2A and AA8 demonstrated that aurones 9504, 9501, AA2A and AA8 could rapidly reduce the bacterial load in mouse lungs. These results further suggest these aurones may be effect anti-TB drugs.

Multi-drug resistant Mtb (MDR-Mtb) and extensively drug-resistant Mtb (XDR-Mtb) have become life-threaten challenges to TB control. Shorter regimens and new drugs that are effective against drug-resistant TB would make it much more likely for patients to complete therapy and decrease opportunities for the emergence of drug resistance. At the time of the invention, aurones had never been applied to treat TB patients and/or other mycobacterium infections. The results of Example 1 further demonstrated that the AA2A and AA8 aurones are effective at treating an MDR Mtb strain as well as a drug-susceptible Mtb strain.

First-line anti-TB drugs contribute to diverse pathological complications, including hepatotoxicity. Current first-line anti-TB drugs are among the most reported anti-microbial drugs incriminated to be potential causes of drug-induced liver injury (Pugh et al. Clin Liver Dis.

2009;13(2):277-94), and anti-TB drug induced liver injury is one of the most prevalent

hepatotoxicities reported in many countries (Huang et al. J Chin Med Assoc.2014;77(4):169-7). When TB patients take these drugs, liver function must often be followed every two weeks to prevent serious hepatotoxicity. Sometimes drugs must be stopped until liver functions improve. In new drug development, the candidate drugs preferably have low cytotoxicities. As further described in the Examples, aurones 9504, 9505, 9501, 9510, AA2A, and AA8 aurones had lower cytotoxic effects compared to the first-line anti-TB drug Rifampin (RIF). Aurones 9504, 9505 and 9501 had low cytotoxic effects on the human liver cell line HepG-2 and the primate kidney cell Vero. Aurone 9504 exhibited the highest selectivity index on both cells, significantly better than RIF. These results suggest that one or more of these aurones– along or in combination– may be an effective replacement for the more toxic anti-TB drugs that are currently in use. Exemplary treatment populations

This disclosure describes using the compounds of the invention in the treatment, control, or prevention tuberculosis or Mycobacterium tuberculosis (Mtb) infection, in a subject. A subject may include, for example, a mammal including humans and animals. For example, animals may include companion animals, domesticated animals such as farm animals, animals used for research, or animals in the wild. Companion animals include, but are not limited to, dogs, cats, hamsters, gerbils, and guinea pigs. Domesticated animals include, but are not limited to, cattle, horses, pigs, goats, and llamas. Research animals include, but are not limited to, mice, rats, dogs, apes, and monkeys. In one embodiment, the compound is administered to an animal, such as a companion animal or domesticated animal, that has been diagnosed with, or is exhibiting symptoms of, or is at risk of developing, tuberculosis or Mycobacterium tuberculosis (Mtb) infection. In another embodiment, the compound is administered in an animal or animal population that serves, may serve, or is suspected of serving as a tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection reservoir, regardless of the presence of symptoms. Administration may be, for example, part of a small or large scale public health infection control program. The compound may, for example, be added to animal feed as a prophylactic measure for reducing, controlling or eliminating infection in a wild or domestic animal population. The compound may, for example, be

administered as part of routine or specialized veterinary treatment of a companion or domesticated animal or animal population. It should be understood that administration of the compound may be effective to reduce or eliminate tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection or the symptoms associated therewith; to halt or slow the progression of infection or symptoms within a subject; and/or to control, limit or prevent the spread of infection within a population, or movement of infection to another population.

Veterinary uses of the compounds in domestic or domesticated animals (including small animals such as cats, dogs, and other pets, as well as large animals such as cows, horses, pigs, and other livestock), as well as wild animals (for example, animals housed in zoos) to treat or prevent tuberculosis and/or Mycobacterium tuberculosis (Mtb) infection.

A derivative of benzofuran-3[2H]-one reported to inhibit the chorismate synthase (Cs) of S. pneumonia (Thomas et al.2003;13(3):423-6) has a similar chemical structure to aurones 9504, 9505, 9501, 9510, AA2A, and AA8. The Mtb Cs is the key enzyme for the last step of the shikimate pathway. Chorismate, the final product of the shikimate pathway is essential for the synthesis of aromatic amino acids, folate, naphthoquinones, menaquinones and mycobactins (Parish et al. Microbiology.2002;148(Pt 10):3069-77). Because the shikimate pathway of Mtb is essential and is absent from mammals (Parish et al. Microbiology.2002;148(Pt 10):3069-77; Development GAfTD. Handbook of anti-tuberculosis agents. Tuberculosis.2008;88(2):85-169.), Mtb Cs is an attractive drug target since inhibition of Cs is unlikely to have a toxic side effect on the host.

The data from Example 1 demonstrated that AA2A and AA8 aurones may significantly inhibit Mtb Cs. Due to the low cytotoxicity of AA2A and AA8 and their ability to inhibit Mtb Cs, in theory, a high dose of AA2A or AA8 could be used to treat Mtb infection in mammals, which would potentially shorten the period of treatment and reduce risk of drug resistance development. As further described in Example 1, an in vivo study of AA2A and AA8 demonstrated that these two aurones could rapidly reduce the bacterial load in mouse lungs, demonstrating the promise of AA2A and AA8 as new anti-TB drugs in mammals. Moreover, the Examples demonstrate that aurones 9504, 9505, 9501, 9510, AA2A, and AA8 can significantly inhibit Mtb-Cs. Kits

This disclosure further describes a kit that contains at least one compound or composition described herein, together with instructions for use. In some embodiments, the instructions for use provide instructions for use in the treatment or prevention of tuberculosis and/or infection with Mycobacterium tuberculosis (Mtb). Optionally, the kit includes a pharmaceutically acceptable carrier. The carrier may be separately provided, or it may be present in a composition that includes the compound. Optionally, the kit may further include one or more additional active agents which may be co-administered with the aurone. The one or more active agent(s) may have cumulative or complementary activities, as described in more detail elsewhere herein. The present invention is illustrated by the following examples. It is to be understood that the particular examples, materials, amounts, and procedures are to be interpreted broadly in accordance with the scope and spirit of the invention as set forth herein. EXAMPLES All reagents, starting materials, and solvents used in the following examples were purchased from commercial suppliers (such as Sigma-Aldrich Chemical Company, St. Louis, MO) and were used without further purification unless otherwise indicated. EXAMPLE 1

This Example describes screening and optimization of aurones to find compounds that effectively inhibit/eliminate Mycobacterium tuberculosis (Mtb) growth. This Example further describes the determination of the effective concentrations of the aurones identified and the result of using the aurones to treat Mtb infection in vivo.

As further described in this Example, 147 synthesized aurone derivatives were screened using an iterative strategy. Initially, 87 aurones were tested in round one (see Table 2); an additional 44 aurones were tested in round two (see Table 3) based on the results of round one testing; and an additional 16 aurones were tested in round three (see Table 4) based on the results of round two testing for compounds that can effectively inhibit/eliminate Mtb growth. Six aurones that inhibit the growth of Mtb were identified for further testing: 9504, 9505, 9501, 9510, AA2A, and AA8. The aurones inhibited the growth of Mtb with minimal inhibitory concentrations (MICs) of 6.25 PM, 12.5 PM, 25 PM, 25 PM, 25 PM and 50 PM, respectively. All six aurones were equally or more effective at inhibiting the intracellular growth of Mtb than the top four drugs currently used to treat TB, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF). The AA2A and AA8 aurones were further evaluated in vivo, and the bacterial load of Mtb in the lungs of aerosol- infected mice treated with AA2A and AA8 was significantly reduced within 12 days. MATERIALS AND METHODS Aurone synthesis

Aurones were synthesized using either the method described by Varma et al. (Tetrahedron Letters 1992; 33(40):5937-40) (31) or by the method described by Hawkins and Handy

(Tetrahedron 2013; 69(44):9200-4). The azaaurones were synthesized via a modification of the method reported by Carrasco et al. (Chem Med Chem 2016 ;11(19):2194-204). To a solution of 1- acetylindolin-3-one (0.5 mmol) in toluene (3 mL) was added the appropriate aldehyde (0.5 mmol) and 1 drop of piperidine. The mixture was heated to reflux for 12 hours, cooled to room

temperature, and then purified by flash column chromatography using ethyl acetate/hexanes mixtures. For deacetylated azaaurones, the acetylated product was dissolved in methanol (2 mL) and treated with 0.1 mL of 50% aqueous KOH for 45 minutes. The reaction mixture was acidified and extracted with ethyl acetate and concentrated in vacuo. The resulting residue was purified via flash column chromatography using toluene/ethanol mixtures to afford the desired azaaurones.

AA2A: To a solution of 0.5 mmol of 1-acetylindolin-3-one in 1 mL of toluene was added a slight excess (1.2 equivalents) of 2-bromobenzaldehyde and one drop of piperidine. The mixture was heated to 100 °C for 12 hours, then cooled to room temperature and purified via flash column chromatography (20% ethyl acetate/hexanes) to afford the desired compound as a yellow solid (mp = ) in 83% yield. ¹ H NMR (300 MHz, CDCl ₃ ) 8.28 (d, J = 8 Hz, 1H), 7.87 (d, J = 8 Hz, 1H), 7.71-7.63 (m, 2H), 7.46 (dd, J = 1.5, 8 Hz, 1H), 7.42 (s, 1H), 7.35 (t, J = 8 Hz, 1H), 7.32 (d, J = 8 Hz, 1H), 7.24 (t, J = 8 Hz, 1H), 1.81 (s, 3H); ¹³ C NMR (75 MHz, CDCl ₃ ) 185.42, 170.08, 150.27, 136.70, 136.30, 135.75, 133.70, 130.82, 130.26, 128.00, 125.32, 125.14, 124.45, 123.94, 120.76, 117.82, 24.80.

AA8A: To a solution of 0.5 mmol of 1-acetylindolin-3-one in 1 mL of toluene was added a slight excess (1.2 equivalents) of benzaldehyde and one drop of piperidine. The mixture was heated to 100 °C for 12 hours, then cooled to room temperature and purified via flash column

chromatography (20% ethyl acetate/hexanes) to afford the desired compound as a yellow oil that was mostly the E isomer (>5:1) in 80% yield. ¹ H NMR (300 MHz, CDCl ₃ ) 8.30 (d, J = 8 Hz, 1H), 7.86 (d, J = 8 Hz, 1H), 7.71-7.62 (m, 1H), 7.55 (d, J = 8 Hz, 2H), 7.45-7.35 (m, 3H), 7.35 (t, J = 8 Hz, 1H), 7.33 (s, 1H), 7.29 (t, J = 8 Hz, 1H), 1.92 (s, 3H); ¹³ C NMR (75 MHz, CDCl3) 186.02, 170.55, 150.36, 136.48, 135.12, 134.12, 130.29 (2C), 129.98, 129.32 (2C), 125.04, 124.24, 123.99, 122.42, 117.94, 25.19.

AA8: To a solution of AA8A in 2 mL of methanol was added 0.4 mL of 50% aqueous KOH. After stirring for 30 minutes, the reaction was neutralized with 1M HCl, extracted with ethyl acetate, and the organic layer dried with sodium sulfate, filtered and concentrated in vacuo. The resulting residue was purified via flash column chromatography (20% ethanol in toluene) to afford the desired compound as an orange solid (mp = 189-191 °C) in 80% yield. ¹ H NMR (300 MHz, CDCl ₃ ): 7.76 (d, J = 8 Hz, 1H), 7.56 (d, J = 8 Hz, 2H), 7.51-7.42 (m, 3H), 7.33 (t, J = 8 Hz, 1H), 7.03-6.98 (m, 2H), 6.88 (s, 1H); ¹³ C NMR (75 MHz, CDCl ₃ ): 186.72, 153.29, 136.37, 135.54, 134.89, 129.63, 128.74, 125.19, 121.88, 120.82, 112.10, 111.67. Mtb strains and culture

The Mtb CDC1551 strain carries a plasmid constitutively expressing a fluorescent protein, tdTomato, under a phage L5 promoter (Kong et al. PLoS One 2016; 11:e0149972). The Mtb CDC1551 strain was grown in 7H9 broth (Difco, Detroit, MI) supplemented with 0.5% glycerol, 10% OADC (oleic acid dextrose complex without catalase) and 0.05% Tween 80 (M-OADC-TW broth), or Middlebrook 7H9 supplemented with 10% OADC and 15 g/L Bacto agar (M-OADC agar, BD DIFCO), or on 7H11 selective agar (Difco). To culture the tdTomato-expressing Mtb CDC1551 strain, media and plates were supplemented with 80 mg/mL hygromycin. Frozen stocks were prepared from strains by growth standing at 37°C until an OD ₆₀₀ = 0.5 and stored in aliquots at -80°C until use. To culture the MDR-Mtb strain (BEI Resources, Manassas, VA; the strain was originally isolated from a South African source), the M-OADC-TW broth was supplemented with 0.1 mg/mL isoniazid (INH) and 0.5 mg/mL rifampicin (RIF). Determining the minimum inhibitory concentrations (MICs) of the aurones to Mtb:

Black 96-well microplates with clear bottom were preloaded with 100 mL of two-fold serial dilutions of aurones (range 200 mM– 3.125 mM). The tdTomato-expressing Mtb at mid-log culture phase was diluted to OD600=0.1 (equivalent to McFarland Standard 0.5), and added 100 mL into each well, three replicates / sample. Both fluorescence intensity (FI) of tdTomato and OD600 were measured daily for three days of incubation by a Multi-Detection Microplate Reader (INFINITE 200 PRO, Tecan Group Ltd., Switzerland). MIC was defined as the concentration of aurone that results in ³ 99% inhibition of growth relative to the untreated Mtb (negative control) measured by FI or OD ₆₀₀ . HepG2 and Vero cytotoxicity assay

Vero cells were maintained in DMEM medium supplemented with 10% heat-inactivated FBS at 37°C with 5% CO ₂ . HepG2 cells were maintained in DMEM medium supplemented with 20% heat-inactivated FBS at 37°C with 5% CO2. Cells were seeded into a 96-well plate. A series of two-fold dilutions of aurones, Isoniazid (INH), or Rifampin (RIF) were added into the cell culture media in microplates to determine the concentration that eliminates 50% of eukaryotic cell growth in a two-day incubation. Cells without drug treatment were incubated with the vehicle buffer and served as negative controls (100% viable). Cells treated with digitonin served as the positive controls (100 mg/mL). At the end time point, 10 mL of 3-(4,5-dimethylthiazol-2-yl)-2,5- diphenyltetrazolium bromide (microculture tetrazolium, MTT) reagent was loaded into each well and incubated for three hours at 37°C. The TACS MTT Cell Proliferation and Viability Assay Kit (R&D Systems, Minneapolis, MN) was used to do this assay.100 mL of the detergent solution provided with the kit was then added into each well and incubate for two hours. Absorbance of each sample in the 96-well plates was measured at 580 nm. Viability of each drug-treated sample was calculated as the absorbance of the sample divided by the absorbance of the untreated sample and multiplied by 100. L6 and THP-1 cytotoxicity assay

L6 rat skeletal myoblasts were maintained in DMEM medium supplemented with 10% heat- inactivated FBS, 45 mg/L glucose and sodium pyruvate, 4 mM L-glutamine, 50 IU/mL penicillin, 50 ug/mL streptomycin (HyClone, Logan, UT) at 37°C with 5% CO2. THP-1 human monocyte cells were maintained in RPMI 1640 medium supplemented with 10% heat-inactivated FBS and 1% penicillin/streptomycin (complete culture medium) at 37°C with 5% CO ₂ . Log phage cells were trypsinized, adjusted in fresh media to deliver 5,000 cells/well in a 96-well tissue culture plate (BD Falcon, Franklin Lakes, New Jersey), treated with 300 mM, 100 mM, 30 mM, 10 mM, 3 mM and 1 mM concentrations of the aurones and incubated for 48 hours. Alamar Blue dye (Invitrogen, Carlsbad, CA) was used to assess the viability of cells according to the manufacturer's instructions and the fluorescent intensity was read on a SpectraMax M2e micro- plate reader (Molecular Devices, LLC, San Jose, CA) using excitation and emission wavelengths of 560 and 590 nm, respectively. Determining the efficacy of aurones against intracellular Mtb infection

The intracellular activity of the aurones were evaluated in human monocyte THP-1 cell line. The cells were seeded at 5 × 10 ⁴ cells per well in 96-well tissue culture black plates with clear bottoms. Phorbol-12-myristate-13-acetate (PMA) was used to induce the monocytes to develop into macrophages for three days before infection. The tdTomato-expressing Mtb was employed for cell infection at MOI=20. After a 3-hour incubation of the Mtb strain with THP-1 cells, extracellular bacteria were removed by washing with the cell culture medium twice.200 mL of cell medium containing either 25 mM or 50 mM aurones was added to each well in triplicate and incubated for 48 hours. The negative controls were the infected cells treated with the vehicle buffer. Amikacin (AMI) (1 mg/mL), Ethambutol (ETH) (0.5 mg/mL), Rifampin (RIF) (0.4 mg/mL) and Isoniazid (INH) (0.5 mg/mL) were used as positive controls. Intracellular Mtb was quantified by measuring tdTomato FI of the infected cells before and after the treatment period using the Multi-Detection Microplate Reader. Growth ratio of each sample = FI of each sample at 48 hours / FI of the same sample at 0 hours. Expression and purification of chorismate synthase and EPSP synthase and from Mtb

Mtb EPSP synthase and Cs were over-expressed in E. coli with a vector pET28a(+) and purified from the soluble components of the lysates by affinity chromatography on a HisTrap column eluted with a series of concentrations of imidazole.

PCR was conducted using the primers Rv2540c-F tatacatatggtgttgcgctggatcacc (SEQ ID NO:1) and Rv2540c-R: tataggatccttaaccggagacccgc (SEQ ID NO:2) to amplify Rv2540c (aroF), which encodes chorismate synthase from genomic DNA of Mtb CDC1551, using the following amplification parameters: denaturation for 5 minutes at 95°C, then 34 cycles consisting of 45 seconds at 95°C, 45 seconds at annealing temperature (56°C), and 3 minutes at 72°C, and then 10 minutes at 72°C for final extension. To amplify Rv3227 (aroA), which encodes 5- Enolpyruvylshikimate-3-phosphate synthase (EPSP) from genomic DNA of Mtb CDC1551, PCR was conducted using the primers Rv3227-F tatacatatggtgaagacatggccagcc (SEQ ID NO:3) and Rv3227-R tataggatccactcgtcgtagtcgccgg (SEQ ID NO:4) using the following amplification parameters: denaturation for 5 minutes at 95°C, then 34 cycles consisting of 45 seconds at 95°C, 45 sec at annealing temperature (62°C), and 3 minutes at 72°C, and then 10 minutes at 72°C for final extension. The PCR-amplified products of Rv2540c and Rv3227 were analyzed on 0.8% agarose gel and purified with DNA clean & concentrator kit (Zymo Research, Irvine, CA). Eluted purified PCR products and expression vector pET-28a(+) were digested with NdeI and BamHI, respectively. The pET-28a(+) vector was also dephosphorylated by phosphatase. After electrophoresis, bands were cut, and then Rv2540c, Rv3227 and pET-28a(+) vector were extracted using Agarose

GelExtract Mini Kit (5-PRIME). The digested fragments of Rv2540c and Rv3227 were mixed with pET-28a(+) vector, respectively, and ligated with T4 DNA ligase. The ligated product was transformed into chemically competent E. coli DH5a cells. The cloned Rv2540c and Rv3227 was further confirmed by sequencing (Eurofins Genomics, Luxembourg). For expression of Rv2540c and Rv3227, the constructed plasmid was isolated and transformed into expression Rosetta (DE3) competent cells (Merck). Positive transformants were screened on LB agar plate containing 25 mg/mL kanamycin and confirmed by sequencing. The E. coli Rosetta (DE3) strain carrying plasmid Mtb-Cs (Rv2540c) or EPSPs (Rv3227) was induced by IPTG over night at 16°C. After lysis of the E. coli Rosetta (DE3), the rRv2540c and rRv3227 expressed as His-tagged fusion proteins were purified from the soluble components of the lysates by affinity chromatography on a HisTrap HP Ni ²⁺ IMAC column and eluted with a series of concentrations of imidazole. The samples were analyzed by SDS-PAGE to confirm the size and purity of the proteins. Mtb EPSP synthase activity assay

The ability of the aurones to inhibit Mtb Cs was determined using a coupled enzyme reaction. Mtb needs both Mtb EPSP synthase for the biosynthesis of 5-enol-pyruvyl shikimate-3- phosphate (EPSP), which is the substrate for chorismate synthase (Cs), and Mtb-Cs for the formation of chorismate. The EPSP synthesis reaction consisted of shikimate-3-phosphate (S3P), phosphoenolpyruvate (PEP), and EPSP synthase. The equilibrium of the forward reaction was displaced using purine nucleoside phosphorylase (PNP) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG). PNP consumed phosphate released from EPSP synthesis to cleave MESG. The cleaved MESG resulted in a change in absorbance from 330 nm to 360 nm. Thus, EPSP synthesis was monitored by measuring A360 using a spectrophotometer. After EPSP synthesis, the reaction mix was used directly as a source of EPSP for the chorismate synthesis reaction after ultrafiltration using an AMICON Ultra-15 Centrifugal Filter Unit with a 10 kDa cutoff (Millipore Sigma) to remove enzymes. The Mtb-Cs enzyme reaction consisted of Mtb-Cs, EPSP, Flavin mononucleotide (FMN), and reduced nicotinamide adenine dinucleotide (NADH). After a 30- minute incubation at 30qC, the reaction mixture was filtered through an AMICON Ultra-15

Centrifugal Filter Unit with a 10 kDa cutoff (Millipore Sigma) before subjecting it to Liquid chromatography–mass spectrometry (LC/MS) to measure EPSP consumption. The reaction without Mtb-Cs served as the negative control. The consumption of EPSP in the reactions with and without aurones was compared. Alternatively, production of chorismate from the enzymatic reaction was indirectly measured by measuring phosphate production at A ₃₆₀ from the reaction using MESG and PNP. Determination of EPSP with LC/MS

LC/MS assays were performed to detect leftover EPSP in the chorismate synthesis reaction on a Bruker amaZon SL mass spectrometer (ESI) with a Shimadzu Corporation (Kyoto, Japan) HPLC system equipped with a KINETEX 5 mm C18100 Å column (50 × 2.1 mm) (Phenomenex, Torrance, CA). A mixture of methanol/water (75:25, v/v) was employed as the major solvent system. The elution started from 100% water for 0.5 minutes, followed by 75% methanol for 5 minutes before increasing to 100% methanol over 1 minute. The total elution of each injection was 6.5 minutes at a flow rate of 0.3 mL/minute. The mass spectrometry (MS) detector began to record the ion signals at the time point of 0.35 minutes, and both positive and negative ions were collected. It was found that EPSP was eluted out at 1.3 minute retention time and characteristic peak of EPSP was ESI m/z 323.2 [M-1]- under the negative ESI mode. The peak areas (AUC) of EPSP were calculated from extracted ion chromatograms (EIC) of ESI- m/z 323.2 [M-1]-. Determining the potencies of aurones against Mtb infection in mice

(1) Determining the median tolerated dose (MTD): Prior to testing in vivo efficacies of the AA2A and AA8 aurones, the MTDs of the aurones in BALB/c mice was determined using a single dose range-finding study. AA2A and AA8 dissolved in dimethyl sulfoxide (DMSO) as stocks were first 1:1 mixed with Tween 80 to improve aqueous solubility, and then added into phosphate buffer to four final concentrations for delivering 1 mg/kg, 2 mg/kg, 5 mg/kg, or 10 mg/kg into mice. A pilot drug tolerance test was conducted with these four concentrations of aurones that were intraperitoneally (i.p.) injected into 6-week BALB/c female mice daily for seven days. Mice were weighed daily and examined twice daily for any adverse effects. No any adverse effects were identified at all tested doses.5 mg/kg of AA2A and AA8 was determined to be a safe dose for mice and used this dose to treat infected mice thereafter.

(2) Mouse infection and aurone treatment: BALB/c mice were aerosol infected using the Bio-Aerosol Nebulizing Generator in the University of Tennessee Health Science Center Regional Biocontainment Laboratory, with 5X10 ⁵ colony forming units (CFU) per milliliter (CFU/mL) of Mtb in PBS to deliver 20-80 CFU/lung. At day 28 post-infection, mice were randomly grouped into control, AA2A, or AA8 treated group, five mice per group per time point. For the treated groups, 5 mg/kg of AA2A or AA8 was i.p. injected daily. The mice in the control group were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO). In vivo imaging System (IVIS) images were collected in vivo for the live mice and ex vivo for the harvested lungs using tdTomato excitation and emission wavelengths on one day before the treatment started and on day 12 post-treatment. Bacterial CFU counts in lungs of each group of mice were also collected by plating homogenized lungs on 7H11 agar plates at day 1, day 21, day 28, and day 40. IVIS studies

In Vivo Imaging System (IVIS) studies were conducted as described previously (Kong et al. PLoS One 2016; 11:e0149972; Kong et al. Meth. Mol. Biol.2018; 1790:75-8). Briefly, mice were anesthetized with isofluorane and imaged in an IVIS Spectrum (Caliper Life Sciences) with tdTomato filters for fluorescence. Photographic images were directly overlaid with matching fluorescent images for all mice. Wavelength-resolved spectral imaging was carried out to image tdTomato-expressing Mtb infection in live mice. The excitation wavelength was 535 nm and emission was collected in 20 nm increments from 580 nm to 660 nm. Each acquisition was taken with auto exposure with f-stop two and medium binning. Images were analyzed with Living Image Software v4.1 (PerkinElmer, Inc., Waltham, MA) using spectral unmixing algorithms to remove autofluorescence, as described in the manual, with one of the resulting channels locked to fit the emission spectrum of tdTomato. Statistical analysis

Significant difference of means between two groups was examined using t-test. For comparison among three or more groups, ANOVA F-test and Tukey–Kramer method post-hoc pairwise t-test were employed. The estimation of minimum number of animals for the in vivo studies is based on power analysis with a software G*Power 3.1 using conditions based on previous studies with similar methods and literature (35) at a=0.05 and Power=0.8. RESULTS Screening for aurones that inhibit Mtb growth

The tdTomato-labeled Mtb CDC1551 strain was employed to determine the anti-TB efficacies of 148 aurone analogues against actively replicating Mtb. In the initial screening, the multi-copy tdTomato expressing Mtb strain was co-incubated with the aurones at a concentration of 100 mM for three days. The tdTomato specific fluorescence intensity (FI) was measured daily using the same strain without treatment as a control. The inhibitory rate was calculated as: . The 148 aurones that were synthesized and tested in this study are shown in Table 1. The first round of screening used a diverse library of 87 aurones that consisted of a benzylidene, furanylidene, pyrrolylidene or thiophenylidene linked to benzofuranone with various bromine, chlorine, cyano, dimethylamino, fluorine, hydroxyl, iodine, methoxy, methyl, nitro, pyridyl or trifluoromethyl substitutions in benzylidene, furanylidene, pyrrolylidene or thiophenylidene. Some of the aurones also included bromine, hydroxyl, methoxy or methyl substitutions in benzofuranone. These aurones had been screened in previous studies to identify potent antifungal agents (Sutton et al. Bioorganic & Medicinal Chemistry Letters.2017; 27(4):901-3), an immunosuppressant (Park et al. Int Immunopharmacol.2017; 43:116-28) and potential anti-cancer agents (18) (Alsaif et al. Curr Pharm Biotechnol.2017; 18(5):384-90). Table 2 shows the inhibition rates of the first round of aurones that were synthesized at a concentration of 100 PM against Mtb. In general, these aurones were not effective inhibitors of Mtb growth. The four aurones that were the most effective inhibitors of Mtb growth in the first round of screening, 2906, 9067, 9251 and 9087, had inhibitory rates of 44.88%, 44.80%, 41.03% and 35.81%, respectively (see FIG.6).

Table 1. Structure of the aurones used in this study

Table 2. Round 1 aurones inhibition rate of Mtb growth at 100 PM

*Percent inhibition at 100 PM

Inhibitory rate= 100- (fluorescence intensity (F.I.) of treated Mtb at day 3 - F.I. of treated Mtb at day 0) / (F.I. of untreated Mtb at day 3 - F.I. of untreated Mtb at day 0) C 100.

Aurones 9053 and 9087 were highly fluorescent at the wavelength used to detect the tdTomato protein. For these aurones the percent inhibition was determined using cellular absorbance.

The percent inhibition experiments were repeated in triplicate and the average standard deviation was less than 10%.

Data are presented as Mean ± SD. Table 3. Round 2 aurones inhibition rate of Mtb growth at 100 PM

*Percent inhibition at 100 PM

Inhibitory rate= 100- (fluorescence intensity (F.I.) of treated Mtb at day 3 - F.I. of treated Mtb at day 0) / (F.I. of untreated Mtb at day 3 - F.I. of untreated Mtb at day 0) C 100.

Aurones 3012, AA5 and AA5A were highly fluorescent at the wavelength used to detect the tdTomato protein. For these aurones the percent inhibition was determined using cellular absorbance.

The percent inhibition experiments were repeated in triplicate and the average standard deviation was less than 10%.

Data are presented as Mean ± SD. Table 4. Round 3 aurones inhibition rate of Mtb growth at 100 PM

*Percent inhibition at 100 PM

The percent inhibition experiments were repeated in triplicate and the average standard deviation was less than 10%.

Based on the results of the first round of screening, in the second round of screening another 44 aurones were synthesized to investigate additional substitutions of benzylidene in aurones. In these aurones, benzylidene was linked to benzofuranone as well as alternative benzofuranone groups, where the internal single bonded oxygen of benzofuranone, which constitutes an aurone, was replaced with a secondary amine to generate azaaurones, a tertiary acetylated amine to generate acetylated azaarones, a sulfur to generate thioaurones, or a carbonyl group to generate indanediones. Table 3 shows the inhibition rates of the second round of aurones that were synthesized at a concentration of 100 mM against Mtb. The four aurones that were the most effective inhibitors of Mtb growth in the second round of screening, AA2A, AA8, AA4A, and 3012, had inhibitory rates of 85.95%, 71.86%, 71.49%, and 69.28, respectively (see FIG.6).

Based on the results of the second round of screening, in the third round of screening another 16 aurones were synthesized to investigate additional substitutions in benzofuranone in aurones where benzylidene was linked to benzofuranone and the effect of glycosylation. Table 4 shows the inhibition rates of the third round of aurones that were synthesized at a concentration of 100 mM against Mtb. The four aurones that were the most effective inhibitors of Mtb growth in the third round of screening, 9504, 9501, 9505 and 9510, had inhibitory rates of 88.29%, 84.99%, 84.44% and 83.14%, respectively (see FIG.6). Determining the MIC of the top six aurones that inhibited the growth of Mtb

The top six aurones which inhibited Mtb that were identified in the three rounds of testing, aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were selected for further testing. The minimal inhibitory concentration (MIC) of each aurone was determined in 7H9 broth culture. The bacterial fluorescence was measured over the time of treatment and the growth ratios of the samples were calculated as: Fluorescence of the sample at day 3 divided by the fluorescence of the sample at day 0. The MIC of aurones 9504, 9505, 9501, 9510, AA2A, and AA8 were determined to be 6.25 mM, 12.5 mM, 25 mM, 25 mM, 25 mM and 50 mM, respectively.

The MICs of AA2A and AA8 against a MDR-Mtb strain originally isolated from a pulmonary TB patient in South Africa was also evaluated. The MICs for AA2A and AA8 against this MDR-Mtb strain in 7H9 broth culture was determined by measuring bacterial optical density (OD) at 600 nm over time of treatment. The growth ratios of samples was calculated as follows: OD600 of the sample at day 3 divided by OD600 of the sample at day 0. 25 mM of aurone AA2A and 12.5 mM of aurone AA8 completely inhibited growth of the MDR-Mtb strain within the 3-day treatment (growth ratio <1). Higher than 50 mM of AA2A killed more than 50% of this MDR-Mtb strain, and 200 mM of AA2A eliminated this strain completely.200 mM of AA8 killed more than 50% of this MDR-Mtb strain. As expected, the growth of this strain was not inhibited by INH or RIF at 200 mM. Evaluation of the cytotoxicities of the top six aurones that inhibited the growth of Mtb in HepG2 and Vero cells

To assess the potential cytotoxicity of the top six aurones that inhibited the growth of Mtb, the half maximal inhibitory concentration (IC ₅₀ ) values were determined in HepG2 human liver cancer cells and Vero African green monkey kidney epithelial cells using the standard 3-(4,5- dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (microculture tetrazolium, MTT) cell proliferation assay. (Schmid et al. Transplantation Proceeding 2005; 37(1):110). As shown in Table 5, four of the six aurones tested, 9501, 9504, 9510 and AA8, had IC ₅₀ values that were 400 mM or greater against both HepG2 and Vero cells. Based on their MIC values against Mtb, the selectivity of 9501, 9504, 9510 and AA8 are 32-fold, 64-fold, 16-fold and 8-fold, respectively, and were identified as excellent candidates for development as therapeutic agents. The top six aurones can significantly inhibit the replication of intracellular Mtb in macrophage- like cells

The intracellular activities of the top six aurones were tested in THP-1 human monocyte cells that were differentiated into macrophage-like cells using both 25 mM and 50 mM

concentrations of the aurones (Table 6). For comparison purposes, the four most prescribed antibiotics for treating Mtb infections, Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF) were also tested at their suggested doses against intracellular Mtb (Table 7). All six of the aurones tested were as effective as AMI, ETH, INH and RIF, and the 9501, 9504 and 9505 aurones clearly outperformed AMI, ETH, INH and RIF. Table 5. IC ₅₀ in PM of aurones 9501, 9504, 9505, 9510, AA2A, and AA8 in mammalian cells

The IC ₅₀ experiments were repeated in triplicate and the average standard deviation was less than 10%. Rifampin (RIF) was included for comparison purposes. Table 6. Intracellular inhibition of Mtb in THP-1 cells by the aurones

The intracellular inhibition experiments were repeated in triplicate and the average standard deviation was less than 10%. Table 7. Intracellular inhibition of Mtb in THP-1 cells by anti-TB drugs

Amikacin (AMI), Ethambutol (ETH), Isoniazid (INH), and Rifampin (RIF) were used at their suggested doses against intracellular Mtb (1 mg/mL, 0.5 mg/mL, 0.5 mg/mL and 0.4 mg/mL, respectively (Development GAfTD. Handbook of anti-tuberculosis agents. Tuberculosis.

2008;88(2):85-169). The intracellular inhibition experiments were repeated in triplicate and the average standard deviation was less than 10%. The AA2A and AA8 aurones inhibit Mtb chorismate synthase.

A derivative of benzofuran-3[2H]-one has been reported to inhibit the chorismate synthase (Cs) of S. pneumonia (Thomas et al. Bioorganic & Medicinal Chemistry Letters.2003; 13(3):423-6) and its chemical structure is very similar to the top six aurones that were isolated in this study. It was hypothesized that aurones 9504, 9505, 9501, 9510, AA2A, and AA8 could inhibit / eliminate Mtb by inhibiting Mtb-Cs.

In Mtb, the shikimate pathway is essential and leads to the biosynthesis of a wide range of primary and secondary metabolites, including aromatic amino acids, folate, naphthoquinones, menaquinones and mycobactins (Parish et al. Microbiology.2002; 148(Pt 10):3069-77) In this pathway, Mtb-Cs converts 5-enol-pyruvyl shikimate-3-phosphate (EPSP) to chorismate via a 1,4- trans elimination of phosphate (Macheroux et al. Planta 1999; 207:325-34). The reaction requires a reduced flavin mononucleotide (FMNred) and NADH (FIG.4A). The Mtb-Cs also functions as a NADH:FMN oxidoreductase in this reaction (Ely et al. BMC Biochem.2008; 9:13). Two plasmids were constructed the first expressing the Mtb EPSP synthase (EPSPs, Rv3227) and the second expressing Mtb Cs (Rv2540c), and Mtb EPSPs and Cs from the soluble components of the lysates of the E. coli strains expressing them were purified by His-Trap Affinity Chromatography. The samples were analyzed by SDS-PAGE, and the results showed that the purified proteins Rv2540c and Rv3227 had molecular masses as predicted (42.9 kD and 46.3 kD) based on their amino acid sequences (FIG.4B). Because the phosphate production in the chorismate synthesis reaction directly reflects the production of chorismate, the inhibitory effect of the two aurones on Mtb-Cs activity was analyzed by comparing phosphate released from the chorismate synthesis reaction (FIG.4C). Initially, the AA2A and AA8 aurones were evaluated. Phosphate production from the reaction of EPSP and Cs co-incubated with the AA2A and AA8 aurones was reduced significantly compared to the untreated control. The effects of the two aurones on the consumption of EPSP, the substrate of Cs, in this reaction using LC/MS was also analyzed (FIG.4D). Mtb Cs treated with AA2A and AA8 consumed much less EPSP than the untreated control.

Aurones AA2A and AA8 significantly reduced both phosphate production and the consumption of ESPS, which are key to Mtb chorismate synthase activity; thus aurones AA2A and AA8 significantly reduced Mtb chorismate synthase activity. Aurones AA2A and AA8 can significantly reduce the bacterial load in lungs of Mtb infected mice The in vivo efficacies of aurones AA2A and AA8 against Mtb in BALB/c mice was determined. First a pilot drug-tolerance-test was conducted before evaluating the efficacies of the aurones in vivo. The aurone AA2A and aurone AA8 stocks in DMSO were first 1:1 mixed with Tween 80 to improve aqueous solubility, and then added to phosphate buffer at four final concentrations for delivering 1 mg/kg, 2 mg/kg, 5 mg/kg, or 10 mg/kg into mice. These four concentrations were intraperitoneally (i.p.) injected into 6-wk BALB/c female mice daily for seven days. Mice were weighed daily and examined twice daily for adverse effects. No weight loss or other adverse effects were identified.5 mg/kg of aurone AA2A and aurone AA8 was determined to be a safe dose for mice, and this dose was used to treat infected mice thereafter.

BALB/c mice were aerosol infected by the tdTomato labeled Mtb CDC1551 strain at a low dose (20 cfu - 80 cfu). At day 28 post-infection, mice were randomly separated into a control group and AA2A or AA8 treatment groups. For the treatment groups, 5 mg/kg of AA2A or AA8 was injected i.p. daily. The mice in the control group were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween80 + 2.5% DMSO). IVIS data were collected for the live mice and ex vivo for the harvested lungs using tdTomato excitation and emission wavelengths at the day before treatment started and on day 12 post-treatment (FIG.5A). The IVIS data showed that the tdTomato specific fluorescence intensity of the two aurone treated groups of mice were significantly lower than the untreated mice after the 12-day treatment. Bacterial cfu counts in the lungs of each group of mice were also collected using homogenized lungs that were cultured on agar plates. Bacterial cfu in the lungs of treated mice reduced 1.45 log (AA2A) and 1.18 log (AA8) cfu/lung compared to untreated mice, respectively (FIG.5B). Demonstrating the safety of aurones as potential therapeutic agents

Pharmaceutically useful antibiotics must be tolerated at doses up to 10 mg/kg. To demonstrate the safety of the aurones in general as pharmaceutic agents, three representative aurones from the first round of screening whose IC50 values were significantly lower than aurones that significantly inhibited Mtb growth (1009, 9051 and 9067) were selected for further testing. Table 8 shows the IC ₅₀ values for these three aurones in L6 rat skeletal myoblast cells and THP-1 human monocyte cells. CD-1 mice received daily 1 mg/kg, 3 mg/kg, or 10 mg/kg doses of the aurones for seven days and then a heart puncture was performed on day eight. Serum was prepared from each sample and a blood chemistry profile was conducted to assess enzyme levels associated with the liver and kidney as well as electrolyte levels. Table 9 shows the codes for the blood chemistry analysis that were performed as well as the expected ranges and Table 10 shows the results. Compared to the controls and vehicles, none of the aurones caused any toxicological problems at any concentration, indicating the potential of the aurones as safe therapeutic agents.

Table 8. IC ₅₀ in mM of the 1009, 9051 and 9067 aurones in mammalian cells

The IC50 experiments were repeated in triplicate and the average standard deviation was less than 10%. Table 9.7-day mouse toxicology study of the aurones 1009, 9051 and 9067. The codes for the blood chemistry tests, the units of measurement as well as the possible ranges in normal serum are listed below.

Table 10. Weight change and clinical chemistry results of the 7 day mouse toxicology study on the aurones 1009, 9051 and 9067

Table 10. (cont.)

EXAMPLE 2

This Example shows further screening of aurones 9504, 9505, 9501, 9510, AA2A and AA8 identified in Example 1. Aurones 9504, 9505, 9501, 9510, AA2A and AA8 inhibited the growth of Mtb with minimal inhibitory concentrations of 6.25 mM, 12.5 mM, 25 mM, 25 mM, 25 mM, and 50 mM, respectively. Aurones 9504, 9501, AA2A, or AA8 significantly reduced the Mtb load in the lungs of infected mice after a 12-day treatment. Three of the aurones (aurones 9504, 9501, and 9510) showed lower cytotoxic effects on human liver cells than rifampicin. Aurones 9504, 9505, 9501, 9510, AA2A and AA8 were determined to inhibit Mtb chorismate synthase, a key enzyme for aromatic acid synthesis using an established assay and mass spectrometry. In conclusion, the results of this Example further demonstrate the promise of these synthetic aurones as novel anti-TB therapeutics. MATERIALS AND METHODS

Aurones were synthesized as disclosed in Example 1. Mtb strains were cultured as described in Example 1. Efficacies of aurones against intracellular Mtb infection were determined as described in Example 1. Minimum Inhibitory Concentrations (MICs) of aurones

A resazurin microtiter assay (REMA) was used to determine MICs of the six aurone leads (aurones AA2A, AA8, 9501, 9504, 9505, and 9510). This assay assesses activity of a compound against Mtb growth by measuring resazurin color change (reduction of resazurin) after adding it into bacterial culture (Zwergel et al. Nat Prod Commun.2012; 7:389-94). Black 96-well microplates were preloaded with 100 mL of 2-fold serial dilutions of aurones (1.56 mM - 100 mM) or RIF (0.0625 - 4 mM) in MOAD-Tw with 3 replicates for each concentration. After adjusting absorbance of bacterial culture to a McFarland tube No.1, the bacteria were diluted 1:20 by the medium, and 100 mL was used as an inoculum to load into each well. The plates were covered, sealed in plastic bags, and incubated at 37°C in the normal atmosphere. After 7 days of incubation, 30 mL of resazurin solution (0.02%) was added to each well, incubated overnight at 37°C, and assessed for color development. A change from blue to pink indicates reduction of resazurin and therefore bacterial growth. All MICs were performed in duplicate on at least two independent cultures. Cytotoxicity assay

Cytotoxicities of aurones were evaluated in Vero cell (ATCC), HepG2 (ATCC), and human lung epithelial cell line A549 (ATCC), using the standard microculture tetrazolium (MTT) cell viability assay. Media used for Vero cells was DMEM supplemented with 10% calf serum; for HepG2 was DMEM supplemented with 20% calf serum; and for A549 cell culture was DME/F12 1:1 with 10% calf serum (HyClone Cosmic Calf, GE Lifesciences). Cells were seeded into a 96- well plate. The Assay was performed as described in the“HepG2 and Vero cytotoxicity assay” section of Example 1. Potencies of aurones against Mtb infection in mice

Five to seven week old female BALB/c mice were obtained from Jackson Laboratories. All animals were housed in UTHSC Regional Biocontainment Laboratory (RBL) in a controlled environment with 12 hour light / 12 hour dark cycle, at a temperature in a range of approximately 18-23°C, and with 40-60% humidity.

Pilot drug-tolerance-test: Prior to testing in vivo efficacies of the aurones, the drug- tolerance of the aurones in BALB/c mice were determined using a single dose range-finding study. AA2A, AA8, 9501, and 9504 stock solutions (40 mg/mL) dissolved in DMSO were mixed 1:1 with Tween 80 to improve aqueous solubility, and then added into phosphate buffer to four final concentrations for delivering 1 mg/kg, 2 mg/kg, 5 mg/kg, or 10 mg/kg into mice. Aurones were intraperitoneally (i.p.) injected into 6-week-old BALB/c female mice daily for seven days. Mice were weighed daily and examined twice per day for adverse effects and were monitored by veterinarians and specialized technicians.

Mouse infection and aurone treatment: BALB/c mice were aerosol infected using the Bio- Aerosol Nebulizing Generator in UTHSC RBL, with 5 X 10 ⁵ cfu/mL of Mtb in PBS to deliver approximately 10-20 cfu/lung. At day 28 post-infection, mice were randomly grouped into the vehicle treated, AA2A-, or AA8-, or 9501, or 9504 treated groups, six mice per group per time point. For the treated groups, 5 mg/kg of AA2A, AA8, 9504, or 9501 was i.p. injected daily. The control group of mice were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO). IVIS Spectrum in vivo imaging system (PerkinElmer, Inc., Waltham, MA) was used to collect ex vivo images for the harvested lungs one day before the treatment started and on day 12 post-treatment, following the protocol described previously with tdTomato excitation and emission wavelengths (Kong et al. PLoS One 2016; 11:e0149972.). Mice were euthanized by inhalation of an overdose of isoflurane (>5%) followed by cervical dislocation at the designed time points or when significant illness was observed to prevent undue suffering. Bacterial CFU counts in lungs of each group of mice were also collected by plating homogenized lungs on 7H11 agar plates at day 1, day 21, day 28, and day 40. Mtb chorismate synthase activity assay

An aurone’s inhibition of Mtb chorismate synthase (Mtb-Cs) was determined using a coupled enzyme reaction. The reaction uses Mtb EPSP synthase (EPSPs) for biosynthesis of 5-enol- pyruvyl shikimate-3-phosphate (EPSP), the substrate forchorismate synthase, and Mtb-Cs for the formation of chorismate. The methods for making purified recombinant Mtb EPSPs and Cs are described in Example 1.

EPSP synthesis: The synthesis of EPSP was carried out in a vial containing EPSPs (0.7U), shikimate (9.6 mM), and phosphoenolpyruvate (PEP; 3 mM) at 25 °C for 30 minutes. The equilibrium of the forward reaction was displaced using purine nucleoside phosphorylase (PNP, 2U) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG, 0.4 mM), which consumes Pi, increasing the final concentration of EPSP in the reaction mixture. The cleaved MESG changed absorbance from 330 nm to 360 nm. Thus, EPSP synthesis was monitored by measuring A ₃₆₀ using a spectrophotometer. The enzymes were removed by ultrafiltration (3 kD cut-off Centricon).

Measure Mtb-Cs activity: After EPSP synthesis, the reaction mix was directly used as a source of EPSP for chorismate synthesis reaction after ultrafiltration using a centricon 3 kDa cutoff to remove enzymes. The reaction of converting EPSP to chorismate and Pi by Cs comprised Mtb- Cs, EPSP (15 uL), FMN (0.04 mM), and NADH (0.3 mM). The production of chorismate from the enzymatic reaction was determined by measuring Pi production using MESG (0.2 mM) and PNP (1 U). To assess aurone effect on Cs, Cs was incubated with various concentrations of the aurone leads in a vial preloaded with EPSP and FMN. After adding NADH into the vial, samples were added into a 96-well plate mixed with MESG and PNP. The production of chorismate from the enzymatic reaction was indirectly measured by measuring Pi production at A ₃₆₀ from the reaction using MESG and PNP. The untreated sample was added the aurone dilution buffer containing the same concentration of DMSO as those of the aurone-treated samples and was set as a positive control (activity 100%). The negative control was consisted of the same components as the positive control except that Mtb Cs was replaced with the buffer. The absorbance signal of negative control was subtracted from the signal of other samples in data analysis. The effects of aurones on PNP was determined by incubating Pi standards, aurones, PNP, and MESG, and measuring A360. RESULTS Minimum inhibitory concentrations (MICs) and cytotoxicity

The standard resazurin microtiter assay (REMA) was conduced. The MIC was defined as the lowest drug concentration that prevented the color change of resazurin from blue to pink. The 9504, 9505, 9501, 9510, AA2A and AA8 aurones inhibited the growth of Mtb with MICs of 6.25, 12.5, 25, 25, 25, and 50 mM, respectively. Results are shown in Table 11.

The cytotoxic effects of aurones to the human liver cell line HepG2 and primate kidney Vero cell were evaluated after a 2-day incubation using the microculture tetrazolium (MTT) cell viability assay. Concentration gradients of the selected aurones and RIF (as a control) were incubated with the two cell lines. Half maximal inhibitory concentration (IC50) of aurones on these two cell lines were calculated. Combining MICs with IC50, the selectivity index (SI) for each lead was calculated as SI=MIC/IC ₅₀ . Aurone 9504 has a SI higher than that of RIF on both cell lines. Aurones 9501 and 9510 have SIs > 10 on HepG2 and Vero cells, which are comparable to the SI of RIF on these two cell lines. Results are shown in Table 11.

Table 11. Inhibition rates, MICs, IC50s, and SIs of aurones AA2A, AA8, 9501, 9504, 9505, and 9510, and RIF

Inhibited replication of intracellular Mtb.

The intracellular activities of aurones AA2A, AA8, 9501, 9504, 9505, and 9510 were evaluated in the human macrophage THP-1 cell line. Amikacin, ethambutol, INH, and RIF were employed as positive controls at their in vitro MICs against intracellular Mtb (Brennan et al. Tuberculosis 88:85-170). At 25 mM and 50 mM, the six aurones completely inhibited intracellular Mtb replication after 48 hours of treatment (FIG.7). At 48 hours, the CFUs of intracellular Mtb treated by the six aurones were all significantly lower than the untreated control (P<0.0001). At 50 mM, aurone 9505 had higher activity against intracellular Mtb than ETH or INH, and it reduced intracellular CFU compared to the initially infected intracellular bacterial number (Ctrl 0-h). At 25 mM and 50 mM, aurone 9505 had a higher activity than RIF (Table 12). Table 12. Comparison of potencies against intracellular Mtb between aurone leads and the recommended anti-TB drugs

Aurones AA2A, AA8, 9501, and 9504 can significantly reduce bacterial load in the lungs of Mtb- infected mice.

Mouse models have been widely used to evaluate efficacy of anti-TB drugs (Vandamme. J Pharm Bioallied Sci 2014; 6:2-9). Mouse strains with different genotypes vary in susceptibility to virulent Mtb (Medina et al..1998. Immunology 93:270-4). BALB/c mice are more susceptible to Mtb infection than other mice with increasing bacterial load and shorter survival time post-infection (Franzblau et al. Tuberculosis (Edinb) 2012; 92:453-88)(18). Aerosol infection of Mtb is a widely accepted route of infection in the evaluation of candidate anti-TB drugs in mice (Orme, Am Rev Respir Dis 1988; 137:716-8). In vivo efficacies of AA2A, AA8, 9501, and 9504 against Mtb were determined in aerosol-infected BALB/c mice. Prior to the evaluation of the aurones’ efficacies in vivo, a pilot drug-tolerance-test with four concentrations (1, 2, 5, 10 mg/kg/day) of aurones was conducted. No acute toxic effects were identified at all tested doses for all the four aurones over the 7-day test. Because 5 mg/kg/day of the tested aurones appeared to be a safe dose for mice, this dose was used to treat infected mice thereafter. BALB/c mice were aerosol-infected by the tdTomato- expressing Mtb strain. At day 28 post-infection, mice were randomly grouped into the vehicle-, AA2A-, AA8-, 9501-, or 9504-treated groups. The vehicle-treated group of mice were injected with the vehicle buffer (10 mM phosphate buffer + 2.5% Tween 80 + 2.5% DMSO). IVIS Spectrum in vivo imaging system (PerkinElmer, Inc., Waltham, MA) was used to collected ex vivo images for the harvested lungs one day before the treatment started and on day 12 post-treatment, following the protocol described previously (Kong et al. PLoS One 2016; 11:e0149972) (FIG.8C & FIG.8D). The quantitative IVIS imaging data showed that tdTomato specific FI of the treated groups of mice were significantly lower than that of the untreated mice (FIG.8E & FIG.8F). Bacterial CFU counts in the lungs for each group of mice were also collected by plating homogenized lungs on agar plates. Compared to the untreated mice, bacterial load of aurone-treated mice reduced 1.04-1.65 log (1.65-log for 9504, 1.44-log for AA2A, 1.10-log for AA8, and 1.04-log for 9501) (FIG.8A & FIG. 8B). Inhibition of Mtb chorismate synthase (Cs).

A derivative of benzofuran-3[2H]-one has been reported to inhibit the Cs of S. pneumonia (Thomas et al. Bioorg Med Chem Lett 2003; 13:423-6). The derivative has a similar chemical structure to aurones AA2A, AA8, 9501, 9504, 9505, and 9510. In Mtb, the shikimate pathway is essential (Parish et al. Microbiology 2002; 148:3069-77), in which Mtb-Cs converts 5-enol-pyruvyl shikimate-3-phosphate (EPSP) to chorismate via a 1,4-trans elimination of phosphate (Macheroux et al. Planta 1999; 207:325-34). The reaction requires a reduced flavin mononucleotide (FMNred) and NADH (FIG.4A). The Mtb-Cs serves as a NADH:FMN oxidoreductase in this reaction (Ely et al. BMC Biochem 2008; 9:13). Two expressing the Mtb-EPSP synthase (EPSPs, Rv3227) and Mtb- Cs (Rv2540c), respectively, were constructed. Mtb-EPSPs and -Cs were extracted from the soluble components of the lysates of the E. coli strains expressing them by affinity chromatography on a HisTrap HP Ni2+ IMAC column eluted with concentration gradient of imidazole. The samples were analyzed by SDS-PAGE, and the results showed that rRv2540c and rRv3227 had molecular masses as predicted (42.9 kD and 46.3 kD) based on their amino acid sequences (FIG.4B). The inhibitory effects of the aurone leads on Mtb-Cs activity was analyzed by comparing Pi released from the chorismate synthesis reaction between samples treated with and without aurones. The production of chorismate from the enzymatic reaction was determined by measuring Pi production using the purine nucleoside phosphorylase (PNP) and 2-amino-6-mercapto-7-methylpurine ribonucleoside (MESG). The free Pi from the sample without Cs but was measured as a background signal and subtracted from the signals of the aurone-treated and untreated samples. The untreated sample was added the aurone dilution buffer containing the same concentration of DMSO as those of the aurone-treated samples and was set as a positive control (activity 100%). The samples co-incubated with the aurone leads showed significant Pi reduction compared to the untreated control with a dose-response effect, indicating that the aurone leads can inhibit Mtb-Cs activity (FIG.9A & FIG. 9B). half maximal inhibitory concentration (IC50; mM) of aurones on Mtb-Cs activity was calculated as follows: 9501 (5.36 ± 1.65); 9504 (17.131.07); 9505 (24.47 ± 9.44); 9510 (15.12 ± 1.68); AA2A (24.09 ± 0.55); and AA8 (50.3 ± 8.61). As the chorismate synthesis reaction involves another enzyme, PNP, the possibility of the observed Pi reduction of aurone-treated samples were not derived from the inhibitory effects of the aurone leads on PNP was also ruled out.

The complete disclosure of all patents, patent applications, and publications, and electronically available material cited herein are incorporated by reference. In the event that any inconsistency exists between the disclosure of the present application and the disclosure(s) of any document incorporated herein by reference, the disclosure of the present application shall govern. The foregoing detailed description and examples have been given for clarity of understanding only. No unnecessary limitations are to be understood therefrom. The invention is not limited to the exact details shown and described, for variations obvious to one skilled in the art will be included within the invention defined by the claims.