BACKGROUND OF THE INVENTION Within cells different types of DNA sequences have been identified along with the numerous molecular processes that repair, replicate, recombine, amplify and transpose these sequences. It is now well understood that somatic genomes are not static but rather are flexible and able to respond to environmental influences. It has also been found that various forms of DNA exist within cells, often within different subcellular compartments.

Of course, the most highly characterised cellular DNA structures are the chromosomal sequences found within in the nucleus.

Extra-chromosomal forms of DNA, however, were identified as early as 1965 (Hotta, Y. and Bassel, A., (1965) Proc. Natl. Acad. Sci. U. S. A., 53,356-362). These DNAs are smaller than chromosomal DNA and are covalently closed circular molecules. In eukaryotes, it appears that covalently closed circular DNAs exist in a manner similar to plasmids which are widely distributed in prokaryotes. These DNAs can arise from many origins ; they may be associated with organelles, such as mitochondria, or they may comprise the genomes or intermediates of viral life cycles. There is a group of extra- chromosomal covalently closed circular DNAs (eccDNAs) that appear to have a chromosomal origin (for a review see Gaubatz, J. W., (1990) Mutation Res., 237,271-292).

This group is not well characterised and the biological functions of these DNAs are not clear.

Some Protozoan parasites contain plastid circular extra-chromosomal DNA (35kb) and appear to contain functional genomes (Kohler et al., (1997) Science, 276,2039-2042; Wilson and Williamson, (1997) Microbiol Mol Biol Rev., 61,1-16). Unlike the circular

DNAs found in many cells, these Protozoan circular DNA found in Leishmania, Trypanosome and Plasmodium are of the same size. Heterogenous sizes of extra- chromosomal circular DNA containing amplified genes are commonly found in cancer cells (Schoenlein et al., (1999) Chromosoma., 108,121-131; Sanchez et al., (1998) Cancer Res., 58,3845-3854). eccDNA levels have been found to increase in response to carcinogen treatment in human and rodent cells (Cohen, S. and Lavi, S., (1996) Mol. Cell. Biol., 16,2002-2014; Cohen, S., et al., (1997) Oncogene, 14,977-985; Sunnerhagen, P., et al., (1989) Somatic Cell.

Mol. Genet., 15,61-70) and have consistently been found to be raised in neoplastic patients, possibly in response to chemotherapeutic agents (Wahl, G. M., (1989) Cancer Res., 49,1333-1340). In addition, elevated amounts of eccDNAs have been observed in the cells of patients suffering from genetic diseases characterised by genomic instability and premature aging, for example Fanconi's anemia (Motejlek, K., et al., (1993) Mutation Res., 293,205-214) and Werner's syndrome (Kunisada, T., et al., (1985) Mech. Ageing Dev., 29,89-99). Another example of eccDNA with an apparent chromosomal origin is the family of relatively small double stranded DNA circles composed of repetitive sequences, often ribosomal DNA, that have been found in invertebrates and implicated as a cause of aging (Sinclair, D. A. and Guarente, L., (1997) Cell, 91,1033-1042; Pont, G., et al., (1987) R Mol. Biol., 195,447-451).

Analysis of cloned eccDNAs has lead to the identification of sequences within these structures. Among those identified to date are satellite DNA, short interspersed and long interspersed repeat families, retrovirus-like elements, transposable elements, low-copy, and single-copy chromosomal sequences. In addition, repetitive sequences appear to be overrepresented in eccDNAs in comparison to their frequency in chromosomal DNA (Sunnerhagen, P., et al., (1986) Nucleic Acids Res., 14,7823-7838).

Despite a great deal of research aimed at elucidating the mechanism of eccDNA generation those proposed remain mostly speculative. One major difficulty is that the primary structures of relatively few eccDNAs are known. The sequences contained within these structures should aid in the identification of their origin and in the manner in which they are created. It does appear, however, that although several mechanisms likely exist,

which generate eccDNAs of various types, the preferred pathway involves homologous intrachromosomal recombination.

The function of eccDNAs is not yet known. One difficulty in assigning functional roles to eccDNAs arises from their diversity in structure and location. Also, although eccDNAs have been known since 1965, the study of circular DNA has been limited due to the lack of convenient techniques of isolation. Thus, there is a need for a general method for detecting and isolating eccDNA from cells and tissues.

It is important to note that since eccDNAs are often found to be elevated in individuals suffering from certain cancers and genetic disorders, they may be particularly useful in medicinal genetics. To date the use of eccDNAs in molecular diagnosis and identification techniques has not been examined. Further, eccDNAs have not yet been tested as potential gene therapy vectors although their structure and natural occurrence should make them good candidates.

This background information is provided for the purpose of making known information believed by the applicant to be of possible relevance to the present invention. No admission is necessarily intended, nor should be construed, that any of the preceding information constitutes prior art against the present invention. Publications referred to throughout the specification are hereby incorporated by reference, in their entireties, in this application.

SUMMARY OF THE INVENTION An object of the present invention is to provide novel circular extra-chromosomal DNA (CED) elements isolated from a wide diversity of organisms. In accordance with one aspect of the present invention there is provided an isolated circular extra-chromosomal DNA element having a size of about 40 kb to about 110 kb, wherein the element is resistant to X exonuclease and contains at least one open reading frame.

In accordance with another aspect of the present invention there is provided a method of isolating a circular extra-chromosomal DNA element having a size of about 40 kb to about

110 kb, wherein the element is resistant to X exonuclease and contains at least one open reading frame, comprising: alkaline extraction of circular DNA from animal tissue; and precipitation of the circular DNA.

In accordance with another aspect of the present invention there is provided fragments of the isolated circular extra-chromosomal DNA element of the present invention.

In accordance with another aspect of the present invention there is provided compositions comprising the isolated extra-chromosomal circular DNA element of the present invention.

In accordance with another aspect of the present invention there is provided a use of a circular extra-chromosomal DNA element as a stable expression element, wherein the element is resistant to X exonuclease and contains at least one open reading frame.

In accordance with another aspect of the present invention there is provided a host cell containing a genetically engineered circular extra-chromosomal DNA element having a size of about 40 kb to about 110 kb, wherein the element is resistant to k exonuclease and contains at least one open reading frame.

BRIEF DESCRIPTION OF THE TABLES AND FIGURES Table 1 provides a list of partial sequences of DNA. The asterisk indicates that two identifiable sequences were obtained using either M13 forward or reverse primers. NA denotes that the strain information is not available.

Figure 1 provides results from an analysis of CED from murine brain. The CED was prepared by an alkaline extraction procedure (Griffin, B. E., et al., (1981) J. Virol., 40,11- 19) and analysed by electrophoresis in an agarose gel (0.7% w/v) counter-stained with ethidium bromide. Lane 1 contains Balb/c CED. Lane 2 shows Balb/c CED digested with the NotI restriction enzyme. Note the increase in the molecular weight of the NotI digested material.

Figure 2 provides results from an examination of CED from various mouse tissues. CED from various mouse tissues were prepared as described and subsequently analysed by electrophoresis in agarose gel (0.4% w/v). (A) Material was counter-stained with ethidium bromide. Lanes 1-4 include CED from Balb/c brain (lane 1), spleen (lane 2), thymus (lane 3), and testis (lane 4). Lanes 5 to 7 include CED from C57B16 brain (lane 5), spleen (lane 6 and whole testis (lane 7). Lanes 8 and 9 show CED from C57/B16 RAG-1-/-liver (lane 6) and brain (lane 9). (B) The agarose gel in (A) was blotted unto nylon filters and probed using 32P NE4 probe derived from Balb/c CED circles. The results from Southern blot shows that the CED found in various tissues react with NE4 probes.

Figure 3 presents a schematic of the NE4 probe, used for Southern blot analysis and in situ hybridisation studies, corresponds to the intra-cisternal A particle (IAP) region of the short incubation mouse prion gene. The prion gene consists of three exons (Inoue et al., (1997) J. Vet. Med. Sci., 59 (3), 175-183), the first two are non-coding and the third exon is translated into proteins that are believed to be the etiological agents of transmissible spongiform encephalopathies. The IAP region, as well as the two non-coding exons, may play an important role in regulating the expression of exon 3.

Figure 4 presents the sequence (SEQ ID NO : 1) of a NotI subclone of CED isolated from Balb/c mouse brain. X represents a, t, g or c.

Figure 5 shows a demonstration of the isolation and characterisation of CED from human tissue. CED was prepared by an alkaline extraction procedure and analysed by electrophoresis in agarose gel (0.4% w/v) and counter-stained with ethidium bromide. (A) Lane 1 and 2 contain DNA extractions of human sperm and leukocytes, respectively.

Lane 2 shows a band of CED. (B) The agarose gel was blotted onto nylon filtered and probed with the NE4 probe derived from Balb/c brain CED.

Figure 6 shows evidence that purified CED generally has a clustered appearance when viewed under the transmission electron microscope (A). The individual strands appeared fibril-like (B) and exhibited resemblance to the scrapie-associated fibrils responsible for

transmission of spongiform encephalopathies (Merz et al., (1983) Nature, 306,474-476; Merz et al., (1987) J Virol., 61,42-49; Prusiner et al., (1983) Cell. 35 (2 Pt 1), 349-358).

Figure 7 demonstrates the subcellular localisation of CED using in situ hybridisation. The NE4 probe, corresponding to a sequence within CED, was used to determine the subcellular localisation of CED. Signal appeared within the nucleus of many cells in grey and white matter, suggesting that CED is ubiquitously distributed in healthy brain cells.

Figure 8 presents results of a study wherein purified CED was digested with proteases, RNases and DNases. To verify that the CED of the present invention, which contains the coding sequence for the short incubation prion gene, consists of DNA without RNA or proteins, CED was digested with RNase, proteinase K and DNase. In this agarose gel (0.5%), the bands corresponding to CED were present after treatment with RNase or proteinase K but absent in DNase treated lanes, strongly suggesting that CED consists of DNA elements. Lane 1 is CED treated with RNase; lane 2 is CED treated with Proteinase K; Lane 3 is CED treated with DNase/Mn buffer; and lane 4 shows CED treated with DNase/Mg buffer.

Figure 9 shows an electrophoresis gel of CED isolated from mice defective in immunological rearrangement. The brain (lanes 1-4) and liver (lanes 5-8) of Balb/c (lanes 1 and 5), RAG1 deficient mice (lanes 2 and 6) and RAG2 deficient mice (lanes 3 and 7) and SCID mice (lanes 4 and 8) were examined for the presence of CED. In each case, electrophoresis of the CED produced a band around 65 kb. This finding indicates that the formation of CED is independent of immunoglobulin or TCR recombination.

Figure 10 demonstrates that CED is present in various organisms. CED appears to be widely distributed in the animal kingdom and extra-chromosomal circular DNA, the size of CED in mice were found in human (lane 1), rat (lane 2), and shark (lane 4) brains, as well as chick liver (lane 3). Lane 5 contained CED from Balb/c mouse brain as a control.

Figure 11 demonstrates homogeneity of CED elements obtained from human peripheral blood leukocytes. The CED from several species was subcloned into sequencing vectors and Cosmid vectors. The analysis of three independent isolates of the human peripheral

blood leukocytes have demonstrated no heterogeneity in restriction digests with several enzymes including NotI, SacII, KpnI and XhoI.

Figure 12 shows a comparison of CED from brain and testis. CED isolated from C57/b6 brain and testis was analysed using EcoRI and HindIII restriction enzymes. This example demonstrates a heterogeneity between the CED elements isolated from the C57/b6 brain and testis.

Figure 13 depicts the results of PCR analysis of prion-like gene in CED. Ten forward and reverse primers corresponding to various regions of the short incubation prion gene were used in the PCR analysis using genomic DNA and linearised CED as templates (CED isolated from Balb/c brain was subcloned into the Supercosmid vector and digested with NotI). Primers 1 forward (1F) and 1 reverse (1R) correspond to approximately 4 kb upstream of exon 1. Primers 2 forward (2F) and 2 reverse (2R) correspond to approximately 0.8 kb upstream of exon 1. Primers 3 forward (3F) and 3 reverse (3R) correspond to approximately I kb downstream of exon 3. Primers 4 forward (4F) and 4 reverse (4R) correspond to the coding sequence of the short incubation prion gene.

Primers 5 forward (5F) and 5 reverse (5R) extend from exon 2 to exon 3 of the gene. The sequences of the primers 1F, 1R, 2F, 2R, 3F and 3R were found in genomic DNA but not in CED. The sequences of primers 4F and 4R was found in both genomic DNA and CED, which indicates that the coding sequence of the prion gene is present in both. The genomic sequence overlapping exons 2 and 3 was not found in genomic DNA, but was present in CED, as evidenced by the fact that the sequences of primers 5F and 5R were found in CED but not in genomic DNA.

Figure 14 shows that CED contains a sequence that corresponds to exon 3 coding sequence of the prion gene. PCR was performed on CED from C57 (lane 2) and Balb/c (lane 3) mouse brain, using primers directed toward the coding sequence of exon 3 and generated a product of approximately 770 bp. Lane M contained marker DNA (1 kb extended ladder) and lane 1 contained the product of the control PCR, which contained no target DNA.

Figure 15 presents the results of X exonuclease digestion of plasmid DNA, CED and mouse genomic DNA.

Figure 16 shows the PCR products from amplification of cosmid subclones of Balb/c mouse brain CED (WJBB), C57 mouse brain CED (WJCB) and human leukocyte CED (WJHL) using the DF2 primer.

Figure 17 shows the PCR products from amplification of cosmid subclones of Balb/c mouse brain CED (WJBB), C57 mouse brain CED (WJCB) and human leukocyte CED (WJHL) and the PCR product from genomic DNA, all using the DF3 primer.

Figure 18 presents the results of PCR amplification. Lanes 1 to 8 contain PCR products from CED with (+X) and without ("exonuclease pretreatment from amplification using primers specific for the IAP sequence (IAP), the prion gene sequence (PrP) and the DF2 and DF3 primers. Lanes 9 and 10 contain PCR products from a positive control DNA template (mouse testis genomic DNA) known to produce PCR products using the IAP, PrP primers. Lanes 11 and 12 contain PCR products from a positive control DNA template (WJBB cosmid sublone of CED obtained from Balb/c mouse brain) known to produce PCR products using the DF2 and DF3 primers.

Figure 19 presents a direct comparison of PCR products generated using the DF2 and DF3 primers and genomic and CED templates. The CED templates used were isolated CED with (CED +X) and without (CED-exonuclease pretreatment or the WJBB cosmid sublone of CED obtained from Balb/c mouse brain (WJBB).

Figures 20 to 32 present maps of contigs 1 through 10 and 11 through 14 from CED isolated from Balb/c mouse brain.

Figure 33 presents the results from a PCR amplification of WJBB (lane 1), WJCB (lane 2), human native CED (lane 3), WJCT (lane 4), SCID testis CED (lane 5) and Balb/c liver CED (lane 6) using the DF2 primer pair. WJBB, WJCB and WJCT denote cosmid clones made from Balb/c brain, C57 brain and C57 testis CED, respectively.

Figure 34 presents the results from a PCR amplification of WJBB (lane 1), WJCB (lane 2), human native CED (lane 3) and WJCT (lane 4) using the DF3 primer pair. WJBB, WJCB

and WJCT denote cosmid clones made from Balb/c brain, C57 brain and C57 testis CED, respectively.

Figure 35 presents the results from a PCR amplification of X exonuclease-untreated (lanes 1 to 3) and X exonuclease-treated (lanes 4 to 6) CED isolated from CHO (+) cells transfected with the WJBB cosmid clone. The PCR was performed using neomycin- resistance gene specific primers (lanesl and 4), the DF2 primer pair (lane 2 and 5) and the DF3 primer pair (lanes 3 and 6).

Figure 36 presents the nucleotide sequence (SEQ ID NO : 2) of the PCR product generated from mouse brain CED using the DF2 primer pair.

Figure 37 presents the nucleotide sequence (SEQ ID NO : 3) of the PCR product generated from mouse brain CED using the DF3 primer pair.

Figure 38 presents the results of a BLAST comparison of sequences from CED elements derived from Balb/c and C57 mouse brains.

Figure 39 presents the results from PCR amplification of CED elements from brain tissue of a PrP knock-out mouse. One set of CED elements was treated with , exonuclease and compared with the untreated CED elements. PCR was performed using primers specific for IAP, Wrn, PrP exon3 sequences and the DF2 primer pair.

DETAILED DESCRIPTION OF THE INVENTION Definitions and Abbreviations Unless defined otherwise, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art to which this invention belongs. Generally, the nomenclature used herein and the laboratory procedures in spectroscopy, cell culture, molecular genetics, diagnostics, amino acid and nucleic acid chemistry, described below are those well known and commonly employed in the art.

Standard techniques are typically used for recombinant nucleic acid methods,

polynucleotide synthesis, and microbial culture and transformation (e. g., electroporation, lipofection).

The techniques and procedures are generally performed according to conventional methods in the art and various general references (see generally, Sambrook et al.

Molecular Cloning: A Laboratory Manual, 2d ed. (1989) Cold Spring Harbor Laboratory Press, Cold Spring Harbor, N. Y.) which are provided throughout this document. Standard techniques are used for chemical syntheses, chemical analyses, and biological assays.

As employed throughout the disclosure, the following terms, unless otherwise indicated, shall be understood to have the following meanings: "CED"refers to extra-chromosomal, covalently closed circular DNA.

"Protein"refers to include a whole protein, or fragment thereof, such as a protein domain or a binding site for a second messenger, co-factor, ion, etc. It can be a peptide or an amino acid sequence that functions as a signal for another protein in the system, such as a proteolytic cleavage site.

"Isolated polynucleotide"refers a polynucleotide of genomic, cDNA, or synthetic origin or some combination there of, which by virtue of its origin the"isolated polynucleotide" (1) is not associated with the cell in which the"isolated polynucleotide"is found in nature, or (2) is operably linked to a polynucleotide which it is not linked to in nature.

"Polypeptide"as used herein as a generic term to refer to native protein, fragments, or analogs of a polypeptide sequence. Hence, native protein, fragments, and analogs are species of the polypeptide genus.

"Naturally-occurring"as used herein, as applied to an object, refers to the fact that an object can be found in nature. For example, a polypeptide or polynucleotide sequence that is present in an organism (including viruses) that can be isolated from a source in nature and which has not been intentionally modified by man in the laboratory is naturally-occurring.

"Polynucleotide"refers to a polymeric form of nucleotides of at least 10 bases in length, either ribonucleotides or deoxynucleotides or a modified form of either type of nucleotide.

The term includes single and double stranded forms of DNA.

"Corresponds to"refers to a polynucleotide sequence that is homologous to all or a portion of a reference polynucleotide sequence, or to a polypeptide sequence that is homologous to a reference polypeptide sequence. In contradistinction, the term"complementary to"is used herein to mean that the complementary sequence is homologous to all or a portion of the complement of a reference polynucleotide sequence. For illustration, the nucleotide sequence"TATAC"corresponds to a reference sequence"TATAC"and is complementary to a reference sequence"GTATA".

"Prion-like"as used herein refers to sequences that are similar or identical to known prion nucleic acid and protein sequences. Prion-like sequences are understood to include expressible nucleic acids, proteins and peptides which may or may not comprise an infectious form.

Other chemistry terms herein are used according to conventional usage in the art, as exemplified by The McGraw-Hill Dictionary of Chemical Terms (ed. Parker, S., 1985), McGraw-Hill, San Francisco, incorporated herein by reference).

The present invention provides novel DNA elements that have been identified in animal tissues. The novel DNA elements are composed of closed, circular, double-stranded DNA and have been isolated from various tissues. Although these CED elements may contain some sequences that are homologous to mitochondrial DNA sequences, these CED elements are distinct from known mitochondrial DNA.

Characterisation of Circular Extra-chromosomal DNA (CED) Elements The size of the naturally occurring CED element of the present invention is relatively homogeneous within each tissue, the range of which can vary from tissue to tissue. In one embodiment the size ranges from about 40 kb to about 110 kb. In another embodiment the size of the CED ranges from about 50 kb to about 100 kb. In a related embodiment the

size of the CED ranges from 60 to 100 kb. One skilled in the art would appreciate that if a naturally occurring CED element is modified, i. e. by deletion, insertion or substitution of sequences, then the size of the modified CED element may be greater than or less than the ranges outlined above.

The CED element of the present invention is capable of autonomous replication, as demonstrated in Example IX.

The CED elements contain at least one open reading frame. In one embodiment, each CED circle comprises one prion gene. The partial sequence of one exemplary CED isolated from mouse brain (see Table 1) demonstrates the presence of genes or gene fragments from different chromosomal locations that are known to be involved in animal development and pathogenesis.

The present invention provides a discrete extra-chromosomal DNA, which is circular and which has electrophoretic migration characteristics that differ from any known extra- chromosomal DNA. Thus, CED elements are discrete in nature and differ from the heterogeneous circles previously reported for TCR in the thymus and BCR rearrangement in the bone marrow and spleen. Furthermore, a survey of the literature reveals that no previous reports have appeared describing DNA circles of this size and homogeneity in normal animal tissues or species. The natural formation of the circular CED of the present invention does not depend on the RAG-1 gene.

In order to demonstrate that CED exists in tissues other than the brain, the alkaline extraction procedure was used to extract circular DNA from liver, spleen, testis and thymus tissues from Balb/c mice. As illustrated in Figure 2, discrete forms of CED exist in various tissues. In one example, the CED isolated from liver migrates with an apparent size of 100 kb while that isolated from testis tissues migrates with an apparent size of 65 kb.

In order to demonstrate the existence of tissue specific molecular forms of CED, the CED of the present invention can be isolated from the tissue of interest, cleaved with restriction enzyme, for example EcoRI, BamHI or Saul, and subcloned into a pBluescript sequencing vector. The sizes of the inserts will vary from 200 bp to 9 kb and may span the entire

CED. These clones can be expanded and partially sequenced. Table 1 shows a partial list of sequences and of the identities of some of the sequences that were identified using this technique on Balb/c mouse brain CED.

In order to demonstrate that the subcloned sequences originate from the CED, Southern blot analysis can performed (for example, see Figure 2B) using a probe specific for a sequence within the original CED. The results shown in Figure 2B demonstrate that the NE4 probe, which was designed to be specific for a sequence that is known to occur in the mouse brain CED, hybridises with the CED from the brain and with the CED from the spleen and testis. Thus, although the size of CED varies among the tissues, the CED from each of the three different tissues tested contained the NE4 sequence subcloned from brain CED.

In order to demonstrate that humans possess the CED, circular DNA preps can be prepared from various tissues, including brain, liver, testis and peripheral blood leukocyte (PBL) cells. Figure 5 demonstrates that CED is present in human PBL cells but it is not detectable in sperm.

Modified Circular Extra-chromosomal DNA Elements One embodiment of the present invention provides modified CED elements that have been modified by the excision of one or more portions from a naturally occurring CED element.

A related embodiment provides CED elements that have been modified by insertion of one or more heterologous polynucleotides into a naturally occurring CED element or a CED element derived from a naturally occurring CED element. Moreover, the present invention encompasses CED elements that include at least one heterologous polynucleotide that contains a regulatory sequence such as a ribosome binding site, polyadenylation site, splice donor or acceptor site, promoter, transcription terminator or enhancer sequence. A heterologous polynucleotide can also be a marker gene or can be used to a express an mRNA, a protein or a peptide of interest.

One embodiment of the present invention provides fragments, analogs and derivatives of CED, wherein the fragments, analogs and derivatives are capable of autonomous replication.

Another embodiment of the present invention provides linearised forms of the naturally occurring or modified CED elements.

Method of Isolating the Circular Extra-chromosomal DNA Elements One embodiment of the present invention provides a method of isolating CED from animal tissue. This method is unbiased toward TCR and BCR rearrangement and is a modification of the method used to isolate circular DNA from Epstein Barr virus (episome) (Griffin, B. E., etal., (1981) J. Virol., 40,11-19). The use of the method to isolate mouse brain CED is summarised in Example I.

In Example I, brain tissues from five healthy adult male Balb/c mice were dissected and circular DNA was extracted using the alkaline extraction method of the present invention.

The DNA preparation was examined by agarose gel electrophoresis. As evidenced in Figure 1, lane 1 the isolated DNA migrated as a discrete molecular species of approximately 50 kb. When the DNA was cleaved with the rare cutting endonuclease Notl (lane 2), the resulting digested material migrated as a discrete band with an approximate molecular size of 65 kb. This change in migration is indicative of the relaxation of super- coiled circular DNA into an extended linear form.

One embodiment of the present invention provides a method of isolating CED, as described above, that additionally includes a step in which the isolated CED preparation is treated with), exonuclease to remove any contaminating linear DNA, such as chromosomal DNA.

Use of the Circular Extra-chromosomal DNA Elements Use of CED Elements in Genetic Testing Mitochondrial DNA sequencing is an alternative to genomic DNA genetic testing that has found widespread use in forensic, archaeological and lineage analysis, in cases where the sample is highly degraded and/or contaminated, such that the genomic DNA is often present in such low quantities or in such poor condition and is useless for reliable genetic

testing. Since CED is circular and relatively small it would also provide an alternative source of genetic material, in a manner similar to the use of mitochondrial, because CED is polymorphic and exhibits reduced susceptibility to denaturation in comparison to genomic DNA. Example VI demonstrates polymorphism between CED sequences from two different mouse strains. This polymorphism can be used to distinguish between the sequences obtained from the two mouse strains.

Use of CED Elements as a Stable Expression Element One embodiment of the present invention provides the use of a CED element, or a fragment thereof, as a means of stably expressing a heterologous polynucleotide. A heterologous polynucleotide encoding a protein, a peptide or mRNA of interest can be inserted into the CED element, or a fragment thereof, using standard molecular biology techniques well known to those skilled in the art. Alternatively, the heterologous polynucleotide can be a marker gene. Following insertion of the heterologous polynucleotide with the appropriate regulatory elements, it can be expressed either following transfection into host cells. Example IX demonstrates the expression of the neomycin resistance gene following its insertion, with appropriate regulatory sequences from the cosmid vector, into a 65 kb fragment of CED.

To gain a better understanding of the invention described herein, the following examples are set forth. It should be understood that these examples are for illustrative purposes only. Therefore, they should not limit the scope of this invention in any way.

EXAMPLES EXAMPLE I: Isolation and Characterization of Circular Extra-chromosomal DNA Elements A technique for isolation of the CED elements of the present invention was developed, which is unbiased toward T cell receptor (TCR) and B cell receptor (BCR) rearrangement, that allows the identification of large double-stranded DNA (dsDNA) circles as by- products of recombination events in adult mammalian tissues, particularly the brain. This technique is a modification of a known protocol for circular DNA isolation from Epstein- Barr virus (episome) infected cells (Griffin, B. E., et aL, (1981) J. Virol., 40,11-19). In

the present example brain tissues from healthy adult male mice were dissected and circular DNA was extracted using this alkaline extraction method.

Briefly, the mice were perfused with phosphate-buffered saline (PBS) through a left ventricular incision through the heart. The organs were harvested and the DNA was immediately extracted by first rinsing the tissue with PBS and placing it in alkaline sodium dodecyl sulphate buffer (50 mM NaCl, 2 mM EDTA, 1 % SDS, pH 12.4). After the tissue was incubated and gently agitated at 37°C for 1 hour, Proteinase K solution (0.05 volumes of 1 M Tris pH 7.0,0.2 volumes of 5 M NaCl, 0.02 volume of 0.5 % solution of Proteinase K) was added and the tissue mixture was incubated for 1 hour with gentle swirling. To the digested tissue, 1/3 volume of buffer-saturated phenol was added and gently mixed. The solution was then centrifuged at 5200 rpm for 20 minutes in a swinging bucket centrifuge at 4 °C. The mixture was placed on ice for 5 minutes to facilitate the recovery of the top aqueous layer. The top layer containing RNA and circular DNA was transferred and 1 volume of choloroform-isoamyl alcohol (24: 1) was added. After gentle mixing, the solution was again centrifuged at 5200 rpm for 20 minutes and placed on ice for 5 minutes. To the collected aqueous phase, 1/10 volume 3 M sodium acetate and 2 volumes of cold 95 % ethanol were added. After gentle mixing, the sample was frozen overnight at-20°C to precipitate the circular DNA. The DNA was collected by centrifuging the sample for 20 minutes at 5200 rpm. Subsequently, the ethanol was removed and the DNA pellet was dried. The DNA was resuspended in Tris-EDTA buffer (TE; pH 7) with RNase (2 ul/100, ul Tris), and left overnight at 37 °C. RNase was removed by phenol/choroform extraction (1: 1) and the CED elements were precipitated using two volumes of ethanol and 1/10 volume of sodium acetate. The mixture was kept at 20 °C for one hour and the CED elements were collected by centrifugation at 11 000 rpm. The ethanol was decanted and the pellet was air dried and resuspended in Tris buffer (pH 7.1).

The DNA preparation was examined by agarose gel electrophoresis. As shown in Figure 1, the CED in lane 1 migrated as a discreet molecular species of approximately 50 kb.

Following cleavage of the DNA with the rare cutting endonuclease, NotI (lane 2), only one distinct molecular species was observed. The resulting digested material migrated as a single band with an approximate molecular size of 65 kb. The digested DNA migrated more slowly than the intact DNA, which is indicative of the relaxation of super-coiled

circular DNA into an extended linear form. This data demonstrates that within the brain there exists a novel discrete extra-chromosomal, circular DNA, which is four to five times larger than the mouse mitochondrial genome (T. A. Brown, (1991) Molecular Biology LABFAX (Academic Press, Oxford)). The CED are distinct in nature and differ from the heterogeneous circles previously reported for TCR in the thymus and BCR rearrangement in the bone marrow and spleen (Fujimoto, S. and Yamagishi, H., (1987) Nature, 327,242- 243; Okazaki, K., et al., (1987) Cell, 49,477-485.; and Okazaki, K., et al., (1988) J.

Immunol., 141,1348-1352).

Subcloning and Sequencing In order to further characterise the circular DNA, the Balb/c CED was isolated, cleaved with NotI, EcoRI, BamHI or Saul and subcloned into a pBluescript sequencing vector.

The CED was subcloned for sequencing as described herein although alternative methods of subcloning may also be used, as would be understood to a worker skilled in the art. The CED was obtained from the brain of Balb/c mice, as described above. The DNA was digested with EcoRI (NE and KE clones) and BamHI (KB clones) and subcloned into the multiple cloning site in pBluescript (following digestion of pBluescript with EcoRI and BamHI and treatment with calf intestinal alkaline phosphatase). The ligated DNA was transformed into E. coli DH10B electro-competent cells using Gene Pulsera54.

Ampicillin-resistant E. coli colonies were selected and the plasmid DNA was extracted.

Clones of the desired sizes of the DNA inserts were automatically sequenced using an M13 forward (5'-GTAAAACGACGGCCAAGT-3' (SEQ ID NO : 4)) or reverse primer (5'- GCGAAACAGCTATGACCATG-3' (SEQ ID NO : 5)).

The sizes of the cloned inserts varied from 200 bp to 9 kb and these libraries likely span the entire brain CED. These clones were expanded and partially sequenced. Table 1 presents a list of exemplary sequences found in the CED, and the identities of some of the sequences. The fragments from the mouse brain CED include genes involved in DNA replication/recombination (Yan, H., et al., (1988) Nat. Genet., 19,375-378; Brosh, Jr., R.

M., et al., (1999) J. Biol. Chem., 274,18341-18350; Harmon, F. G., et al., (1999) Mol.

Cell., 3,611-620; and Liu, Y., etal., (1999) Cell. Mol. Life Sci. 55,1195-1205), circadian rhythm (Sehgal, A., etal., (1999) RecentProg. Horm. Res., 54,61-84; Hastings, M. and Maywood, E. S., (2000) Bioessays, 22,23-31; and Miki, Y., (1998) J. Hum. Genet., 43, 77-84), retrotransposons (Smit, A. F., (1999) Curr. Opin. Genet. Dev., 9,657-663; and

Stewart, H., et al., (1998) Arch. Dis. Child. 78,531-535), development (Parboosingh, J. S., etal., (1999) Arch. Neurol., 56,710-712; Laporte, J., etal., (1996) Nat. Genet., 13,175- 182), apoptosis (Ahmad, M., etal., (1998) CancerRes., 58,5201-5205; Hu, S., etal., (1998) J. Biol. Chem., 273,29648-29653; Chen, T. C., etal., (1998) Lab. Invest., 78,165- 174; and Savickiene, J., et al., (1999) Cell. Death Differ. 6,698-709) and erythroid and lymphocyte function (Chan, A., and Mak, T. W., (1989) CancerDetect. Prev., 14,261- 267; Korman, A. J., et al., (1985) Immunol. Rev., 85, 45-86; Lafuse, W. P., (1991) Crit.

Rev. Immunol., 11,167-194; and Kasahara, M. (1997) Hereditas, 127,59-65). These genes are potentially associated with various diseases including spinal muscular dystrophy, thalesemia, Werner syndrome, myotubular myopathy and cystic fibrosis.

Another of the gene fragments identified, is a prion-like sequence containing a nucleic acid sequence homologous to the short-incubation prion gene.

This is the first report of large circular dsDNA in healthy, adult animal cells. The observation that the CEDs are found to be of distinct sizes between different tissues, yet contain similar regions of DNA which originate from multiple chromosomal sites, suggests that they develop in a highly regulated manner yet to be described in biology.

The isolation method for animal-derived circular DNA could have widespread application in studying eccDNA origins and characteristics.

Tissue Distribution The tissue specific distribution of CED was demonstrated by isolation of CED from the liver, spleen, testis and thymus of Balb/c, C57/B16 and C57/RAG1 deficient mice using the alkaline method for circular DNA isolation as described above. To minimise the possibility of isolating endemic viruses, each strain of mouse was purchased from different vendors and the mice were kept in three independent germ-free animal facilities. Discrete forms of CED were found in all of the tissues examined, however, while the molecular weight was consistent within a particular tissue, it varied from one tissue to another (Figure 2A). Undigested CED from the liver migrated with an apparent size of 100 kb while undigested CED from the testis migrated with an apparent molecular size of 65 kb.

Southern blot analysis was performed to demonstrate that the CEDs isolated from the various tissues contained homologous sequences (Figure 2B). 32p probes were prepared by the random priming method. Southern blot was carried out according to Maniatis'

Manual. T. Maniatis, E. F. Fritsch, J. Sambrook, Molecular Cloning A Laboratory Manual (Cold Spring Harbor Laboratory, Cold Spring Harbor, 1984) The NE4 probe obtained from the subcloned CED (Figure 3) hybridised with the CED isolated from the mouse brain, liver, spleen and testis. Thus the CED elements isolated from these tissues all contained the NE4 sequence identified in the mouse brain CED element. Additionally, the CED extracted from the Balb/c and C57B16 mice migrated with a similar molecular size.

The presence of the CED in RAG1-/-indicates that the generation of the CED was not dependent on the same immuno-recombinase system responsible for the TCR or BCR commitment in lymphocytes. The existence of the brain CED in wild-type C57B16 and RAG1-/-mice is demonstrated in Figure 3. It was found that the undigested CED from both wild type and mutant mice migrated with the same homogeneity and apparent size (undigested) of approximately 50 kb in brain and 80 kb in liver.

EXAMPLE II : Sequencing of Balb/c Mouse Brain Circular Extra-chromosomal DNA Elements A cosmid clone, called WJBB, was constructed using 3 u, g ofcosmid vector, Super cosmid 1 (Stratagene), which was digested with XbaI for 1 hour at 37 °C and treated with calf intestine phosphatase for 30 minutes. Subsequently, the cosmid vector was cut with Not I and ligated with a NotI fragment excised from Balb/c mouse brain CED (incubation at 16 °C overnight). The resulting DNA was packaged into bacteriophage using the XL1 in vitro packaging system (Stratagene). XL1 E. coli cells were infected with the phages generated above and plated on ampicillin-LB agar plates for screening of ampicillin-resistant colonies. The isolated cosmid clone was used for sequencing of the NotI insert, which contains at least 75-80 % of the entire Balb/c mouse brain CED.

The complete sequence of the 42.5 kb NotI insert of the Balb/c mouse brain CED element is presented in Figure 4.

EXAMPLE III: Human Circular Extra-chromosomal DNA Elements 3 In order to demonstrate that CED elements exist in human tissues, circular DNA preparations were prepared from human peripheral blood leukocytes (PBL) and sperm using the alkaline extraction protocol as described in Example I. Figure 4A demonstrates that 50 kb (undigested) CED appears to be present in human PBL but was not detectable in sperm under these conditions. This result was supported by the Southern blot analysis using the NE4 probe (Figure 4B). The finding of CED in both mice and humans indicates that these genetic elements exist in other species and that they share at least some of the same sequences.

EXAMPLE IV: Electron Microscopic Characterisation of Circular Extra-chromosomal DNA Elements CED was isolated using the alkaline extraction method outlined above and 5 p. l of the CED solution (1.0 llg/, ul) was placed on a formvar-coated copper grid. The sample was then negatively stained with 2 % aqueous uranyl acetate for five minutes. The grid was then air dried and viewed under the transmission electron microscope (Figure 6).

It was revealed, as shown in Figure 6, that CED has an unusual fibril-like structure. The large structures shown in Figure 6A are aggregates of CED and the smaller structures in Figure 6B are single or small aggregates of CED. Surprisingly, these structures are morphologically similar to those described for the prion infectious agent.

Finally, in order to establish where within the cell CED is localised, a digoxigenin-labelled DNA probe derived from the Balb/c brain CED was synthesised for use in in situ hybridisation. The NE4 clone was grown vigorously (300 rpm) in 2 ml of LB media containing ampicillin (100 pg/ml) overnight. The bacterial cells were mini-preped by alkaline lysis. Then 2 mg of extracted DNA was digested with EcoRI (10U ; Gibco-BRL) for one hour and electrophoresed on an 0.8 % agarose gel. The insert DNA was cut out of the gel and purified by QiaxIITM gel extraction kit (Qiagene). Approximately 300 ng of the purified DNA was denatured by boiling at 100 °C for 10 minutes and quickly chilled on ice. The denatured DNA was immediately used for random labelling by mixing with DIG-high prime (Boerhinger-Mannheim) and incubated in 25 pLI of total volume at 37 °C

overnight. The reaction was stopped by adding 2 pLI of 0.2 M EDTA (pH 8.0) and heating the probe at 65 °C for 10 minutes.

This probe was used to examine, within mouse brain sections, the localisation of CED within cells of the brain. The probe will identify both genomic and CED prion gene sequences. As shown in Figure 7 all the detected signals were localised within the nucleus of the labelled cells which indicates that CED is also localised to the nucleus of the brain cells.

EXAMPLE V: Identification of Prion Nucleic Acid Sequences in Circular Extra-chromosomal DNA Elements Tests were performed to demonstrate whether CED has any of the previously reported enzymatic sensitivities as the infectious agent reported by Prusiner et al. (Prusiner et al., (1981) Proc Natl Acad Sci U S A. 78, 6675-6679) by conducting studies wherein purified CED was incubated with V8 protease. The results are presented in Figure 8, (lane 2), RNase (Lane 3) and DNase (Lane 4). This study demonstrates that CED is not sensitive to either protease or RNase digestion but is sensitive to DNase digestion. Therefore, the CED element does not share the characteristics of circular DNAs previously described for the prion infectious agent and confirms that CED elements consist mostly of DNA materials without RNA or proteins.

PCR Studies CED elements from various mouse and human tissues were purified as described in Example I. PCR was performed using the isolated CEDs in order to demonstrate that components of the prion gene are present in the CED. Primers were prepared based on the sequence of exon 3 of the prion gene, which encodes the prion protein, and on the sequence of the promoter. Within the chromosomal prion gene these regions are separated by 38 kb.

Figure 13 depicts the results of PCR analysis of the prion-like sequence in the CED elements. Ten forward and reverse primers corresponding to various regions of the short incubation prion gene were used in the PCR analysis using genomic DNA and linearised CED as templates (CED isolated from Balb/c brain were subcloned into the Supercosmid

vector and digested with NotI). Primers 1F and 1R correspond to approximately 4 kb upstream of exon 1: forward (1F), GGACACGCATGGATACACAC (SEQ ID NO : 6); and reverse (1R), TGACCAGGCAACTCTTGTG (SEQ ID NO : 7). Primers 2F and 2R correspond to approximately 0.8 kb upstream of exon 1: forward (2F), GTCAGCCTTGAACTTGAGAG (SEQ ID NO : 8); and reverse (2R), GACTGATCCAGTACCCAATG (SEQ ID NO : 9). Primers 3F and 3R correspond to approximately 1 kb downstream of exon 3: forward (3F), GGTTTTTGTCCTGAATCCAG (SEQ ID NO : 10); and reverse (3R), GCAAAATCTGAGCTATGAGG (SEQ ID NO : 11). Primers 4F and 4R correspond to the coding sequence of the short incubation prion gene: forward (4F), TCAGTCATCATGGCGAACCT (SEQ ID NO : 12); and reverse (4R), CACGATCAGGAAGATGAGGA (SEQ ID NO : 13). Primers 5F and 5R extend from exon 2 to exon 3 of the gene: forward (5F), ACTGAACCATTTCAACCGAG (SEQ ID NO : 14); and reverse (5R), TGGTTGTGTACTGATCCAC (SEQ ID NO : 15). The use primers 1F, 1R, 2F, 2R, 3F and 3R were found to produce PCR products from genomic DNA templates but not from PCR using CED as a template. The use of primers 4F and 4R resulted in the production of PCR products from both genomic DNA and CED templates, which indicates that the coding sequence of the prion gene is present in both.

The prion gene sequence overlapping exons 2 and 3 was not found in genomic DNA, but was present in CED, as evidenced by the fact that the use of primers 5F and 5R resulted in the production of PCR products from CED but not from genomic DNA.

Figure 14 shows that CED contains a sequence that corresponds to exon 3 coding sequence of the prion gene. PCR was performed on CED from C57 (lane 2) and Balb/c (lane 3) mouse brain, using primers directed toward the coding sequence of exon 3 and generated a product of approximately 770 bp. Lane M contained marker DNA (1 kb extended ladder) and lane 1 contained the product of the control PCR, which contained no target DNA. Together with the previous observation of the presence of the IAP gene within intron 3, this data indicates at least a portion of the complete prion gene is contained within the mouse brain CED.

EXAMPLE VI: Demonstration of Polymorphism Between Different Mouse Strains Two sequences obtained from CED isolated from brains of Balb/c and C57 mice were compared using BLAST. The results presented below demonstrate that although there is a high percentage identity between the two DNA circles they are polymorphic within species and between strains. The results of the BLAST analysis are presented in Figure 38.

The following list summarises the parameters of the BLAST analysis: -The statistics (bitscore and expect value) was calculated based on the size of nr database.

-Gapped -Matrix : blastn matrix: 1-2 -Gap Penalties: Existence: 5, Extension: 2 -Number of Hits to DB: 2 -Number of Sequences: 0 -Number of extensions: 2 -Number of successful extensions: 2 -Number of sequences better than 10.0: 1 -length of query: 584 -length of database: 706,884,452 -effective HSP length: 23 -effective length of query: 561 -effective length of database: 679044838 -effective search space: 380944154118 -effective search space used: 380944154118 -T : 0 -A : 0 -XI : 6 (11.5 bits) -X2 : 26 (50.0 bits) - S 1 : 12 (23.8 bits) -S2 : 18 (35.3 bits)

EXAMPLE VII: Further Characterisation of Circular Extra-chromosomal DNA Elements In order to demonstrate that the CED element is circular, samples of isolated CED were treated with k exonuclease. This exonuclease specifically cleaves linear DNAs, such as genomic DNA, and, therefore, even nicked or gapped circular DNA will not be digested with by k exonuclease. Approximately equal amounts of each DNA were incubated with 1 unit/pl of X exonuclease at 37 °C for 24 hours. The resulting mixture was electrophoresed on a 1% agarose gel. The results shown in Figure 15 demonstrate that some portion of the circular DNA preparations (plasmid and CED) remains intact while the genomic DNA is completely digested.

The fact that a portion of the CED preparation used in this study was digested by exonuclease suggests that the preparation contained contaminating genomic DNA. These results confirm that the CED of the present invention is circular and demonstrate that the k exonuclease treatment can be used to remove linear DNA from the CED element preparations.

Figures 16 and 17, demonstrate that the 7t DNA population isolated from the brains of two different mouse strains, Balb/c (WJBB) and C57 (WJCB) is homogeneous. The isolated CEDs from each mouse strain were used as templates for PCR amplification with two Balb/c specific primer pairs: DF2 Forward: CCTTGGGATAGCCTTCTTGTTA (SEQ ID NO : 16) DF2 Reverse: CCAGGGTGCTTTGCTATCATTA (SEQ ID NO : 17) DF3 Forward: GCTTGCATTATTGGATCTCTGA (SEQ ID NO : 18) DF3 Reverse: CGATCACCACTTGACTTCTCAA (SEQ ID NO : 19) The sequences for the DF2 and DF3 primers were designed from the sequencing data of Balb/c brain cosmid circular DNA (WJBB). The results indicate that at least these two CED elements from mouse brains share common sequences. The CED isolated from human leucocytes (WJHL) also generated products from PCR using the DF2 and DF3 primers, although they are different in size from those generated from the mouse CEDs.

The data presented in Figures 33 and 34 further demonstrates that all the subclones (WJBB, WJCB, and WJCT) contain DF2 and DF3-specific sequences. This indicates that

CED contains common genetic elements regardless of its source. This data also demonstrates that the human CED generated PCR products with the DF2 and DF3 primers, thus indicating that the DF2 and DF3 sequences are found in the human CED.

The results presented in Figure 18, confirms that the intact circular DNA that remains following the k exonuclease treatment is the CED. PCR was performed using primers specific for IAP and PrP exon 3 sequence, as well as the DF2, and DF3 primers identified from WJBB. The intact DNA above generated PCR products with the expected size for all the tested primers. This indicates that X exonuclease resistant DNA is the z DNA. This is further demonstrated in Figure 19, where the PCR products obtained using genomic DNA as the template are directly compared with those produced using CED as the template.

The CED produced PCR products of the expected size regardless of k exonuclease treatment, and without any significant reduction in the band intensity, while genomic DNA did not generate the same PCR products even without k exonuclese treatment.

EXAMPLE VIII: Identification of Sequences WJBB DNA was subjected to sequential digestion with exonuclease III and was sequenced. Initially 14 contigs were generated with some gaps between the contigs. To join them, PCR was exploited based on the sequences obtained from these contigs.

The sequence from each contig was directly used for BLAST search in order to identify homologous sequences. Contig 7 and 9 contain part of hemoglobin alpha chain exon 3 and yeast zinc finger protein respectively with several repeats of the sequences. Contig 1 contains sequences with homology to i) the cystic fibrosis transmembrane conductance regulator gene which is associated cystic fibrosis, and ii) Smarcall, chromatin regulator.

Contig 3 contains two interesting sequences with homology to retrotransposon and prostate susceptibility gene (HPC2). Retrotransposon is a critical genetic element in evolution. Contig 4 contains a sequence homologous to a transcription factor, an insulator gene, and a replication protein implying this segment has some regulatory functions.

Contig 5 has a sequence homologous to a partial sequence of EBNA1, which facilitates autonomous replication of Epstein Barr virus. Furthermore, contig 7 contains a sequence homologous to a topoisomerse gene.

In addition, many contigs exhibited partial homologies to mitochondrial genes or to nuclear genes encoding mitochodrial proteins and to sequences in reverse transcriptase.

EXAMPLE IX: Stable Expression of Neomycin Resistance using a Circular Extra-chromosomal DNA Element Subclone Chinese Hamster Ovary Cells (CHO) were transfected with WJBB. 2 x 106 CHO cells were seeded one day before transfection; the cells reached approximately 70 % confluence. The cells were transfected with 3 u. g of the WJBB construct using lipofectamine (Gibco-BRL). Forty-eight hours after transfection, the cells were subjected to selection with neomycin (G418,700 llg/ml). Subsequently the G418-resistant cells went through approximately 40 cell division cycles and were frozen at-130 °C for 6 months. After 6 months the cells were thawed and allowed to go through another 10 cell division cycles. CED was extracted from the cells and used in PCR (Figure 35).

The results shown in Figure 35 indicate that WJBB can replicate autonomously inside CHO cells and provide stable expression of the heterologous neomycin resistance gene.

EXAMPLE X: Isolation of Circular Extra-chromosomal DNA Elements from PrP Knock-out Mice PrP knock-out mice were prepared by insertion of the neomycin resistance gene into exon 3 of the PrP gene. CED elements were isolated from the PrP knock-out mice according to the protocol described above. Following isolation the CED elements were analysed by PCR to demonstrate the presence of the neomycin resistance gene in the prion-like sequence. The results shown in Figure 39 indicate that the CED elements do contain the neomycin resistance gene because the PCR products from the PCR performed using primers directed toward exon 3 of the PrP gene sequence were larger from CED elements isolated from the PrP knock-out mice than from the wild-type mice. The larger products are indicative of the presence of the heterologous neomycin resistance gene in the CED elements of these mice.

The invention being thus described, it will be obvious that the same may be varied in many ways. Such variations are not to be regarded as a departure from the spirit and scope of the invention, and all such modifications as would be obvious to one skilled in the art are intended to be included within the scope of the following claims.

Table 1 v Y . a 5:, aCATE . L kr Y Intracistemal-A particle (IAP) of 95% NE4 1. 2kb 1.2 kb short incubation CH2". Prion diseases prion protein gene MMB2 repeat NE12 2.0kb 1.3 Kb region ofMFiC CH17 90% (NA) ne complex II Response locus 3'UTRCystine NE18 2. 0kb 1.3 Kb caspase 14 gene Unknown 100% (NA) protease- caspase 14 gene Apoptosis L1MM repeat region of neuronal 96% Phosphatase/ NE25 2. Okb 1.4 kb apoptosis CH13 (129/sv Strain) Spl muscular inhibitory atrophy (SMA) protein (NAIP)- rs 3 gene LlMd-1 repeat KE32 5. 5kb 1.3 kb rgion of ji-Cg 99% Hemoglobin globin complex (Balb/C) DNA Helicase; . Replication/ of Wm gene CH8 98% (NA) Recombination; KE33* 2. Okb 1.3 kb and Werner syndrome Reverse Urinown 98% (NA) DNA transcriptase recombination 87% OsteomodulinBone forming Unknown (C57 BU KE36* 4.5kb 1.3 kb Stmin) T-cell receptor CH14 98% (NA) T-cell antigen a-locus receptor a-locus receptor KE37 3. Okb 1.5 kb T-cell receptor 99% (NA) T-cell antigen a-locus KE39 0. 7kb 0.7 kb g5% (NA) L1MM repeat 95°/ region of NAIP-CH13 (129/sv Strain) ° (129/sv Stram) rs3 Gene Line 1 repeat KB3* 0.8kb 0.8 kb region of protein kinase A X 93% (NA) Apoptosis/Cell catalyticsubunit dfferentiation Cx (Pseudogene) , f A V. f i n LI-MM repeat region of X 93% (NA) Myotubular myotubularin-Myopathy KB25* 1. 8kb 1.4 kb Mtml gene LI-MM repeat 95% region of CH13 (129/sv Strain) SMA rs3 gene KB27 4.5kb 1.4kb 45S/28S 18S CH12/15/16/18 99% (NA) rRNA gene Cysticfibrosis KB28 3. Okb 1.3 kb transmembrane CH6 87% (NA) Cystic fibrosis conductance regulatorgene MouseL1M1 KB33 0.7kb 0. 7 kb d L1M2 CHS 90% (NA) Retrotransposon repeating DNA sequence KB35/3L1 MMrepeat 95O/Transcription 6 4. 0kb 1.3 kb region of clock CH5 (129/sv Strain) factor/Circadian gene rhythm ORR1A3 repeat region of 85% KB43 4.5kb 1.4 kb long/short CH2 (NZWorI/Ln Prion disease incubation prion Strain) protein gene * indicates that two identifiable sequences were obtained using either M13 forward or reverse primers. NA denotes that the strain information is not available.