KIE

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application claims the benefit of and priority to U.S. Provisional Appl. No. 62/539,932, filed August 1, 2017, the contents of which are incorporated by reference herein in their entireties.

SEQUENCE LISTING

[0002] The instant application contains a Sequence Listing which has been submitted electronically in ASCII format and is hereby incorporated by reference in its entirety. Said ASCII copy, created on February 27, 2018, is named 102590-0619_SL.txt and is 122,588 bytes in size.

TECHNICAL FIELD

[0003] The present technology relates generally to compositions including recombinant KIE bacteriophages, methods for making the same, and uses thereof. The recombinant KIE bacteriophages disclosed herein are useful for the identification and/or antibiotic

susceptibility profiling of specific bacterial strains/species present in a sample.

BACKGROUND

[0004] The following description of the background of the present technology is provided simply as an aid in understanding the present technology and is not admitted to describe or constitute prior art to the present technology.

[0005] Bacterial infections may complicate a patient's existing medical condition, and in some cases, may lead to death. Patients suffering from various bacterial infections often present with similar symptoms, thus making it difficult to accurately identify and characterize the bacterial species or strain responsible for the infection. Accurate identification of the bacteria through conventional lab tests can be challenging and may require incubation periods of up to several days. Additionally, some bacterial strains are not amenable to culturing and in vitro analysis in light of their fastidious nature. In other situations, the observable behavior of some bacterial strains is not readily distinguishable from others. Moreover, individual strains of a particular bacterial species may exhibit resistance to otherwise effective antibiotics. [0006] Early and accurate identification of the bacterial strain(s) responsible for a patient's illness and determining its susceptibility to various antibiotics is an important aspect of the treatment selection decision process.

SUMMARY OF THE PRESENT TECHNOLOGY

[0007] In one aspect, the present disclosure provides a recombinant K1E bacteriophage nucleic acid sequence, wherein the nucleic acid sequence between (a) position 40,788 and 40,789 of SEQ ID NO: 1 is replaced with a heterologous nucleic acid sequence comprising an open reading frame that encodes a reporter protein, wherein the reporter protein is a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any

combination thereof. In another aspect, the present disclosure provides a recombinant K1E bacteriophage nucleic acid sequence comprising a heterologous nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 4, and SEQ ID NO: 5.

[0008] Additionally or alternatively, in some embodiments, the recombinant K1E bacteriophage nucleic acid sequence further comprises an expression control sequence that is capable of directing the expression of the heterologous nucleic acid sequence. The expression control sequence may be an inducible promoter or a constitutive promoter.

[0009] Examples of fluorescent protein include, but are not limited to, TagBFP, Azurite, EBFP2, mKalamal, Sirius, Sapphire, T-Sapphire, ECFP, Cerulean, SCFP3A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, mTFPl, GFP, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, mWasabi, EYFP, Citrine, Venus, SYFP2, TagYFP, Monomeric Kusabira-Orange, mKOK, mK02, mOrange, mOrange2, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, mRuby, mPlum, HcRed-Tandem, mKate2, mNeptune, NirFP, TagRFP657, IFP1.4, iRFP, mKeima Red, LSS-mKatel, LSS-mKate2, PA-GFP, PAmCherry 1, PATagRFP, Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red), PSmOrange, or Dronpa. Examples of chemiluminescent protein include, but are not limited to, β-galactosidase, horseradish peroxidase (HRP), or alkaline phosphatase. Examples of bioluminescent protein include, but are not limited to, Aequorin, firefly luciferase, Renilla luciferase, red luciferase, luxAB, or nanoluciferase. In some

embodiments, the bioluminescent protein is nanoluciferase.

[0010] Also disclosed herein is a recombinant K1E bacteriophage nucleic acid sequence comprising the nucleic acid sequence of SEQ ID NO: 3. [0011] In one aspect, the present disclosure provides a vector comprising any of the recombinant KIE bacteriophage nucleic acid sequences disclosed herein, as well as bacterial host cells comprising the vectors of the present technology. In some embodiments, the bacterial host cell expresses Kl capsule genes. The bacterial host cell may be a natural or non-natural host for KIE bacteriophage.

[0012] In another aspect, the present disclosure provides a recombinant KIE

bacteriophage comprising any of the recombinant KIE bacteriophage nucleic acid sequences of the present technology. Also provided herein are recombinant KIE bacteriophages comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. The recombinant KIE bacteriophage of the present technology specifically infects E. coli strains that express Kl capsule genes. In some embodiments, the E. coli strains that express Kl capsule genes are selected from the group consisting of ATCC #11775 and ATCC #700973.

[0013] In one aspect, the present disclosure provides a bacterial host cell comprising a recombinant KIE bacteriophage disclosed herein. In some embodiments, the bacterial host cell expresses Kl capsule genes. The bacterial host cell may be a natural or non-natural host for KIE bacteriophage.

[0014] In one aspect, the present disclosure provides a method for identifying at least one bacterial strain or species that expresses Kl capsule genes in a test sample obtained from a subject comprising (a) contacting the test sample comprising bacterial cells with a recombinant KIE bacteriophage of the present technology; and (b) detecting the expression of the reporter protein in recombinant KIE bacteriophage-infected bacterial cells, wherein detection of the reporter protein indicates the presence of at least one bacterial strain or species that expresses Kl capsule genes in the test sample. In some embodiments of the method, the expression of the reporter protein is measured in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 minutes after contacting the test sample comprising bacterial cells with the recombinant KIE bacteriophage.

[0015] In another aspect, the present disclosure provides a method for determining the antibiotic susceptibility of a bacterial strain or species in a test sample obtained from a subject comprising (a) contacting a plurality of test samples comprising bacterial cells with a recombinant KIE bacteriophage of the present technology and an antibiotic, wherein the plurality of test samples is derived from the subject; (b) detecting the expression of the reporter protein in recombinant KIE bacteriophage-infected bacterial cells in the plurality of test samples; and (c) determining that the antibiotic is effective in inhibiting the bacterial strain or species in a test sample when the reporter protein expression levels of the recombinant KIE phage-infected bacterial cells in the test sample are reduced relative to that observed in an untreated control sample comprising bacterial cells, wherein the untreated control sample is derived from the subject. In some embodiments, the bacterial strain or species in the test sample expresses Kl capsule genes. The expression of the reporter protein may be measured in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, or 90 minutes after contacting the plurality of test samples comprising bacterial cells with the recombinant KIE bacteriophage.

[0016] Additionally or alternatively, in some embodiments of the methods disclosed herein, the test sample is blood, sputum, mucus, lavage, saliva, or a swab obtained from the subject. In some embodiments, the subject is human.

[0017] In certain embodiments of the method, the antibiotic is selected from the group consisting of rifampicin, tetracycline, levofloxacin, ampicillin, penicillin G, methicillin, oxacillin, amoxicillin, cefadroxil, ceforanid, cefotaxime, ceftriaxone, doxycycline, minocycline, amikacin, gentamicin, levofloxacin, kanamycin, neomycin, streptomycin, tobramycin, azithromycin, clarithromycin, erythromycin, ciprofloxacin, lomefloxacin, norfloxacin, chloramphenicol, clindamycin, cycloserine, isoniazid, rifampin, teicoplanin, quinupristin/dalfopristin, linezolid, pristinamycin, ceftobiprole, ceftaroline, dalbavancin, daptomycin, mupirocin, oritavancin, tedizolid, telavancin, tigecycline, ceftazidime, cefepime, piperacillin, ticarcillin, virginiamycin, netilmicin, paromomycin, spectinomycin,

geldanamycin, herbimycin, rifaximin, loracarbef, ertapenem, doripenem, imipenem/cilastatin, meropenem, cefazolin, cefalotin, cephalexin, cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren, cefoperazone, cefpodoxime, ceftibuten, ceftizoxime, lincomycin, dirithromycin, roxithromycin, troleandomycin, telithromycin, spiramycin, aztreonam, furazolidone, nitrofurantoin, posizolid, radezolid, torezolid, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin V, temocillin, bacitracin, colistin, polymyxin B, enoxacin, gatifloxacin,

gemifloxacin, moxifloxacin, nalidixic acid, ofloxacin, trovafloxacin, grepafloxacin, sparfloxacin, temafloxacin, mafenide, sulfacetamide, sulfadiazine, silver sulfadiazine, sulfadimethoxine, sulfamethizole, sulfamethoxazole, sulfanilimide, sulfasalazine,

sulfisoxazole, trimethoprim-sulfamethoxazole (Co-trimoxazole) (TMP-SMX), sulfonamidochrysoidine, demeclocycline, oxytetracycline, clofazimine, dapsone, capreomycin, ethambutol, ethionamide, pyrazinamide, rifabutin, rifapentine, arsphenamine, fosfomycin, fusidic acid, metronidazole, platensimycin, thiamphenicol, tinidazole, trimethoprim(Bs) and vancomycin.

[0018] In one aspect, the present disclosure provides a method for making a recombinant K1E bacteriophage of the present technology comprising (a) contacting a non-recombinant K1E bacteriophage genome of SEQ ID NO: 1 comprising a single first recognition site with a first restriction enzyme in vitro under conditions where the first restriction enzyme cleaves the first recognition site to produce a cleaved non-recombinant K1E bacteriophage genome; and (b) recombining in vitro the cleaved non-recombinant K1E bacteriophage genome with a heterologous nucleic acid in the presence of a recombination system under conditions to produce a recombinant K1E bacteriophage genome, wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof. In some embodiments of the method, the first restriction enzyme is PflFl .

[0019] Additionally or alternatively, in some embodiments of the method disclosed herein, the cleaved non-recombinant K1E bacteriophage genome comprises a first cleaved bacteriophage genomic fragment and a second cleaved bacteriophage genomic fragment. In certain embodiments of the methods disclosed herein, the heterologous nucleic acid sequence comprises a 5' flanking region that is homologous to the 3' end of the first cleaved bacteriophage genomic fragment, and a 3' flanking region that is homologous to the 5' end of the second cleaved bacteriophage genomic fragment.

[0020] Additionally or alternatively, in some embodiments, the method further comprises propagating the recombinant K1E bacteriophage genome in a bacterial host. The bacterial host may be a non-natural bacterial host cell or a natural bacterial host cell for K1E bacteriophage.

[0021] Additionally or alternatively, in some embodiments of the method, the

recombination system comprises a 5'-3' exonuclease, a DNA polymerase, and a DNA ligase. In one embodiment, the 5 '-3' exonuclease is T5 exonuclease, the DNA polymerase is Phusion ^® DNA polymerase (Thermo Fisher Scientific, Waltham, MA), and the DNA ligase is Taq ligase. In other embodiments, the recombination system comprises a 3'-5' exonuclease, a DNA polymerase, and a DNA ligase. [0022] Also disclosed herein are kits comprising one or more coded/labeled vials that contain the recombinant KIE bacteriophage of the present technology, instructions for use, and optionally at least one antibiotic.

BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 shows the PflFl restriction enzyme cleavage site within the KIE bacteriophage genome. PflFl cleavage occurs between base pairs 40,788 and 40,789 of the KIE bacteriophage genome. Figure discloses SEQ ID NO: 8.

[0024] Figure 2 shows the heterologous nucleic acid sequence (SEQ ID NO: 2) that was inserted into KIE phage genomic DNA that was cleaved with PflF 1. The underlined sequences represent the homologous 5' and 3' flanking regions of the heterologous nucleic acid sequence.

[0025] Figures 3(A)-3(N) show the complete genome sequence of the recombinant NanoLuc ^® KlE phage (SEQ ID NO: 3).

[0026] Figure 4 shows the junctional and flanking PCR assays that tested for the presence of recombinant KIE bacteriophage.

[0027] Figure 5(A) shows the upstream junction sequence of the nanoluciferase insertion in the recombinant KIE phage genome (SEQ ID NO: 4). Figure also discloses SEQ ID NOS 9, 9, 10, and 9, respectively, in order of appearance. Figure 5(B) shows the downstream junction sequence of the nanoluciferase insertion in the recombinant KIE phage genome (SEQ ID NO: 5). Figure also discloses SEQ ID NOS 11, 12, 11, and 11, respectively, in order of appearance.

[0028] Figure 6 shows the luminescence activity profile and sensitivity of the

recombinant KIE phages of the present technology.

[0029] Figure 7 shows antibiotic susceptibility profiling results using the recombinant KIE phages of the present technology.

[0030] Figure 8 shows the specific host range of the recombinant KIE phages of the present technology.

[0031] Figure 9 shows that the recombinant NanoLuc ^® KIE phages of the present technology successfully infected an E. coli clinical isolate that was incapable of being infected with a recombinant nanoluciferase expressing T7 phage. An E. coli clinical isolate expressing Kl capsule genes was infected with the recombinant NanoLuc KIE phages disclosed herein, and a recombinant NanoLuc ^® T7 phage for 1 hour.

[0032] Figures 10(A)-10(M) show the complete genome sequence of non-recombinant KIE phage (NCBI Reference Sequence: NC_007637; SEQ ID NO: 1).

[0033] Figure 11(A) shows the antibiotic susceptibility profile of an E. coli strain to amikacin using the recombinant KIE phages of the present technology. Figure 11(B) shows the antibiotic susceptibility profile of an E. coli strain to gentamicin using the recombinant KIE phages of the present technology. Figure 11(C) shows the antibiotic susceptibility profile of an E. coli strain to levofloxacin using the recombinant KIE phages of the present technology. Figure 11(D) shows the antibiotic susceptibility profile of an E. coli strain to ceftazidime using the recombinant KIE phages of the present technology.

DETAILED DESCRIPTION

[0034] It is to be appreciated that certain aspects, modes, embodiments, variations and features of the present methods are described below in various levels of detail in order to provide a substantial understanding of the present technology.

[0035] In practicing the present methods, many conventional techniques in molecular biology, protein biochemistry, cell biology, microbiology and recombinant DNA are used. See, e.g., Sambrook and Russell eds. (2001) Molecular Cloning: A Laboratory Manual, 3rd edition; the series Ausubel et al. eds. (2007) Current Protocols in Molecular Biology; the series Methods in Enzymology (Academic Press, Inc., N.Y.); MacPherson et al. (1991) R 1: A Practical Approach (IRL Press at Oxford University Press); MacPherson et al. (1995) PCR 2: A Practical Approach; Harlow and Lane eds. (1999) Antibodies, A Laboratory Manual; Freshney (2005) Culture of Animal Cells: A Manual of Basic Technique, 5th edition; Gait ed. (1984) Oligonucleotide Synthesis; U.S. Patent No. 4,683,195; Hames and Higgins eds. (1984) Nucleic Acid Hybridization; Anderson (1999) Nucleic Acid Hybridization; Hames and Higgins eds. (1984) Transcription and Translation; Immobilized Cells and Enzymes (IRL Press (1986)); Perbal (1984) A Practical Guide to Molecular Cloning; Miller and Calos eds. (1987) Gene Transfer Vectors for Mammalian Cells (Cold Spring Harbor Laboratory);

Makrides ed. (2003) Gene Transfer and Expression in Mammalian Cells; Mayer and Walker eds. (1987) Immunochemical Methods in Cell and Molecular Biology (Academic Press, London); and Herzenberg et al. eds (1996) Weir 's Handbook of Experimental Immunology. Definitions

[0036] Unless defined otherwise, all technical and scientific terms used herein generally have the same meaning as commonly understood by one of ordinary skill in the art to which this technology belongs. As used in this specification and the appended claims, the singular forms "a", "an" and "the" include plural referents unless the content clearly dictates otherwise. For example, reference to "a cell" includes a combination of two or more cells, and the like. Generally, the nomenclature used herein and the laboratory procedures in cell culture, molecular genetics, organic chemistry, analytical chemistry and nucleic acid chemistry and hybridization described below are those well-known and commonly employed in the art.

[0037] As used herein, the term "about" in reference to a number is generally taken to include numbers that fall within a range of 1%, 5%, or 10% in either direction (greater than or less than) of the number unless otherwise stated or otherwise evident from the context (except where such number would be less than 0% or exceed 100% of a possible value).

[0038] As used herein, "bacteriophage" or "phage" refers to a virus that infects bacteria. Bacteriophages are obligate intracellular parasites that multiply inside bacteria by co-opting some or all of the host biosynthetic machinery (i.e., viruses that infect bacteria). Though different bacteriophages may contain different materials, they all contain nucleic acid and protein, and can under certain circumstances be encapsulated in a lipid membrane.

Depending upon the phage, the nucleic acid can be either DNA or RNA (but not both).

[0039] As used herein, a "control" is an alternative sample used in an experiment for comparison purpose. A control can be "positive" or "negative." For example, where the purpose of the experiment is to determine a correlation of the efficacy of a therapeutic agent for the treatment for a particular type of disease or condition, a positive control (a compound or composition known to exhibit the desired therapeutic effect) and a negative control (a subject or a sample that does not receive the therapy or receives a placebo) are typically employed.

[0040] As used herein, "expression" includes one or more of the following: transcription of the gene into precursor mRNA; splicing and other processing of the precursor mRNA to produce mature mRNA; mRNA stability; translation of the mature mRNA into protein (including codon usage and tRNA availability); and glycosylation and/or other modifications of the translation product, if required for proper expression and function. [0041] As used herein, an "expression control sequence" refers to polynucleotide sequences which are necessary to affect the expression of coding sequences to which they are operably linked. Expression control sequences are sequences which control the transcription, post-transcriptional events and translation of nucleic acid sequences. Expression control sequences include appropriate transcription initiation, termination, promoter and enhancer sequences; efficient RNA processing signals such as splicing and polyadenylation signals; sequences that stabilize cytoplasmic mRNA; sequences that enhance translation efficiency (e.g., ribosome binding sites); sequences that enhance protein stability; and when desired, sequences that enhance protein secretion. The nature of such control sequences differs depending upon the host organism; in prokaryotes, such control sequences generally include promoter, ribosomal binding site, and transcription termination sequence. The term "control sequences" is intended to encompass, at a minimum, any component whose presence is essential for expression, and can also encompass an additional component whose presence is advantageous, for example, leader sequences.

[0042] As used herein, a "heterologous nucleic acid sequence" is any sequence placed at a location in the genome where it does not normally occur. A heterologous nucleic acid sequence may comprise a sequence that does not naturally occur in a bacteriophage, or it may comprise only sequences naturally found in the bacteriophage, but placed at a non-normally occurring location in the genome. In some embodiments, the heterologous nucleic acid sequence is not a natural phage sequence. In certain embodiments, the heterologous nucleic acid sequence is a natural phage sequence that is derived from a different phage. In other embodiments, the heterologous nucleic acid sequence is a sequence that occurs naturally in the genome of a wild-type phage but is then relocated to another site where it does not naturally occur, rendering it a heterologous sequence at that new site.

[0043] "Homology" or "identity" or "similarity" refers to sequence similarity between two peptides or between two nucleic acid molecules. Homology can be determined by comparing a position in each sequence which may be aligned for purposes of comparison. When a position in the compared sequence is occupied by the same nucleobase or amino acid, then the molecules are homologous at that position. A degree of homology between sequences is a function of the number of matching or homologous positions shared by the sequences. A polynucleotide or polynucleotide region (or a polypeptide or polypeptide region) has a certain percentage (for example, at least 60%, 65%, 70%, 75%, 80%, 85%, 90%), 95%), 98%) or 99%) of "sequence identity" to another sequence means that, when aligned, that percentage of bases (or amino acids) are the same in comparing the two sequences. This alignment and the percent homology or sequence identity can be determined using software programs known in the art. In some embodiments, default parameters are used for alignment. One alignment program is BLAST, using default parameters. In particular, programs are BLASTN and BLASTP, using the following default parameters: Genetic code=standard; filter=none; strand=both; cutoff=60; expect=10;

Matrix=BLOSUM62; Descriptions=50 sequences; sort by =HIGH SCORE; Databases=non- redundant, GenBank+EMBL+DDBJ+PDB+GenBank CDS

translations+SwissProtein+SPupdate+PIR. Details of these programs can be found at the National Center for Biotechnology Information. Biologically equivalent polynucleotides are those having the specified percent homology and encoding a polypeptide having the same or similar biological activity. Two sequences are deemed "unrelated" or "non-homologous" if they share less than 40% identity, or less than 25% identity, with each other.

[0044] As used herein, a "host cell" is a bacterial cell that can be infected by a phage to yield progeny phage particles. A host cell can form phage particles from a particular type of phage genomic DNA. In some embodiments, the phage genomic DNA is introduced into the host cell by infecting the host cell with a phage. In some embodiments, the phage genomic DNA is introduced into the host cell using transformation, electroporation, or any other suitable technique. In some embodiments, the phage genomic DNA is substantially pure when introduced into the host cell. In some embodiments, the phage genomic DNA is present in a vector when introduced into the host cell. The definition of host cell can vary from one phage to another. For example, E. coli may be the natural host cell for a particular type of phage, but Klebsiella pneumoniae is not.

[0045] As used herein, the term "isolated" refers to a substance or entity that has been separated from at least some of the components with which it was associated when initially produced (whether in nature or in an experimental setting). Isolated substances and/or entities may be separated from at least about 10%>, about 20%, about 30%>, about 40%, about 50%), about 60%), about 70%, about 80%, about 90%, or more of the other components with which they were initially associated. In some embodiments, isolated substances and/or entities are more than about 80%, about 85%, about 90%, about 91%, about 92%, about 93%, about 94%, about 95%, about 96%, about 97%, about 98%, about 99%, or more than about 99%o pure. As used herein, a substance is "pure" if it is substantially free of other

components. [0046] As used herein, "operably linked" means that expression control sequences are positioned relative to a nucleic acid of interest to initiate, regulate or otherwise control transcription of the nucleic acid of interest.

[0047] As used herein, a "phage genome" or "bacteriophage genome" includes naturally occurring phage genomes and derivatives thereof Generally, the derivatives possess the ability to propagate in the same hosts as the naturally occurring phage. In some

embodiments, the only difference between a naturally occurring phage genome and a derivative phage genome is at least one of a deletion or an addition of nucleotides from at least one end of the phage genome (if the genome is linear) or at least one point in the genome (if the genome is circular).

[0048] As used herein, the term "polynucleotide" or "nucleic acid" means any RNA or DNA, which may be unmodified or modified RNA or DNA. Polynucleotides include, without limitation, single- and double-stranded DNA, DNA that is a mixture of single- and double-stranded regions, single- and double-stranded RNA, RNA that is mixture of single- and double-stranded regions, and hybrid molecules comprising DNA and RNA that may be single-stranded or, more typically, double-stranded or a mixture of single- and double- stranded regions. In addition, polynucleotide refers to triple-stranded regions comprising RNA or DNA or both RNA and DNA. The term polynucleotide also includes DNAs or RNAs containing one or more modified bases and DNAs or RNAs with backbones modified for stability or for other reasons.

[0049] As used herein, the term "recombinant" when used with reference, e.g., to a cell, or nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or the alteration of a native nucleic acid or protein, or that the material is derived from a cell so modified. Thus, for example, recombinant cells express genes that are not found within the native (non- recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under expressed or not expressed at all.

[0050] As used herein, an endogenous nucleic acid sequence in the genome of an organism (or the encoded protein product of that sequence) is deemed "recombinant" herein if a heterologous sequence is placed adjacent to the endogenous nucleic acid sequence, such that the expression of this endogenous nucleic acid sequence is altered. In this context, a heterologous sequence is a sequence that is not naturally adjacent to the endogenous nucleic acid sequence, whether or not the heterologous sequence is itself endogenous to the organism (originating from the same organism or progeny thereof) or exogenous (originating from a different organism or progeny thereof). By way of example, a promoter sequence can be substituted (e.g., by homologous recombination) for the native promoter of a gene in the genome of an organism, such that this gene has an altered expression pattern. This gene would be "recombinant" because it is separated from at least some of the sequences that naturally flank it. A nucleic acid is also considered "recombinant" if it contains any modifications that do not naturally occur in the corresponding nucleic acid in a genome. For instance, an endogenous coding sequence is considered "recombinant" if it contains an insertion, deletion or a point mutation introduced artificially, e.g., by human intervention. A "recombinant nucleic acid" also includes a nucleic acid integrated into a host cell

chromosome at a heterologous site and a nucleic acid construct present as an episome.

[0051] As used herein, a "recombinant bacteriophage genome" is a bacteriophage genome that has been genetically modified by the insertion of a heterologous nucleic acid sequence into the bacteriophage genome. A "recombinant bacteriophage" means a bacteriophage that comprises a recombinant bacteriophage genome. In some embodiments, the bacteriophage genome is modified by recombinant DNA technology to introduce a heterologous nucleic acid sequence into the genome at a defined site. In some embodiments, the heterologous nucleic acid sequence is introduced with no corresponding loss of endogenous phage genomic nucleotides. In other words, if bases Nl and N2 are adjacent in the wild-type bacteriophage genome, the heterologous nucleic acid sequence is inserted between Nl and N2. Thus, in the resulting recombinant bacteriophage genome, the heterologous nucleic acid sequence is flanked by nucleotides Nl and N2. In some embodiments, endogenous phage nucleotides are removed or replaced during the insertion of the heterologous nucleic acid sequence. For example, in some embodiments, the

heterologous nucleic acid sequence is inserted in place of some or all of the endogenous phage sequence which is removed. In some embodiments, endogenous phage sequences are removed from a position in the phage genome distant from the site(s) of insertion of the heterologous nucleic acid sequences.

[0052] As used herein, a "recombinant K1E bacteriophage" or "recombinant K1E phage" means a K1E bacteriophage whose genomic DNA comprises a heterologous nucleic acid sequence that encodes a bioluminescent protein, a fluorescent protein, a chromogenic protein, or any combination thereof. [0053] As used herein, the term "sample" refers to clinical samples obtained from a subject or isolated microorganisms. In certain embodiments, a sample is obtained from a biological source (i.e., a "biological sample"), such as tissue, bodily fluid, or microorganisms collected from a subject. Sample sources include, but are not limited to, mucus, sputum, bronchial alveolar lavage (BAL), bronchial wash (BW), whole blood, bodily fluids, cerebrospinal fluid (CSF), urine, plasma, serum, or tissue.

[0054] As used herein, "a sub-sample" refers to one or more samples containing bacterial cells that are derived from a test sample obtained from a subject. In some embodiments, the sub-sample is void of non-bacterial cells (e.g., human cells). In some embodiments, the sub- sample contains lysed human cells.

[0055] As used herein, "test sample" refers to a sample taken from a subject that is to be assayed for the presence of bacteria and/or for the antibiotic susceptibility of bacteria present in the sample. In some embodiments, the test sample is blood, sputum, mucus, lavage, or saliva. In certain embodiments, the test sample is a swab from a subject.

[0056] As used herein, the terms "subject," "individual," or "patient" are used

interchangeably and refer to an individual organism, a vertebrate, a mammal, or a human. In certain embodiments, the individual, patient or subject is a human.

[0057] As used herein, a "vector" refers to a nucleic acid molecule capable of

transporting another nucleic acid to which it has been linked. One type of vector is a

"plasmid," which generally refers to a circular double stranded DNA loop into which additional DNA segments may be ligated, but also includes linear double- stranded molecules such as those resulting from amplification by the polymerase chain reaction (PCR) or from treatment of a circular plasmid with a restriction enzyme. Other vectors include cosmids, bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC). Another type of vector is a viral vector, wherein additional DNA segments may be ligated into the viral genome (discussed in more detail below). Certain vectors are capable of autonomous replication in a host cell into which they are introduced (e.g., vectors having an origin of replication which functions in the host cell). Other vectors can be integrated into the genome of a host cell upon introduction into the host cell, and are thereby replicated along with the host genome. Moreover, certain vectors are capable of directing the expression of genes to which they are operatively linked. Such vectors are referred to herein as "recombinant expression vectors" (or simply "expression vectors"). Bacteriophage

[0058] Bacteriophage are obligate intracellular parasites that multiply inside bacteria by co-opting some or all of the host biosynthetic machinery. Phages contain nucleic acid and protein, and may be enveloped by a lipid membrane. Depending upon the phage, the nucleic acid genome can be either DNA or RNA but not both, and can exist in either circular or linear forms. The size of the phage genome varies depending upon the phage. The simplest phages have genomes that are only a few thousand nucleotides in size, while the more complex phages may contain more than 100,000 nucleotides in their genome, and in rare instances no more than 500,000 bp. The number and amount of individual types of protein in phage particles will vary depending upon the phage. The proteins function in infection and to protect the nucleic acid genome from environmental nucleases.

[0059] Phage genomes come in a variety of sizes and shapes (e.g., linear or circular). Most phages range in size from 24-200 nm in diameter. The capsid is composed of many copies of one or more phage proteins, and acts as a protective envelope around the phage genome. Many phages have tails attached to the phage capsid. The tail is a hollow tube through which the phage nucleic acid passes during infection. The size of the tail can vary and some phages do not even have a tail structure. In the more complex phages, the tail is surrounded by a contractile sheath which contracts during infection of the bacterial host cell. At the end of the tail, phages have a base plate and one or more tail fibers attached to it. The base plate and tail fibers are involved in the binding of the phage to the host cell.

[0060] Lytic or virulent phages are phages which can only multiply in bacteria and lyse the bacterial host cell at the end of the life cycle of the phage. The lifecycle of a lytic phage begins with an eclipse period. During the eclipse phase, no infectious phage particles can be found either inside or outside the host cell. The phage nucleic acid takes over the host biosynthetic machinery and phage specific mRNAs and proteins are produced. Early phage mRNAs code for early proteins that are needed for phage DNA synthesis and for shutting off host DNA, RNA and protein biosynthesis. In some cases, the early proteins actually degrade the host chromosome. After phage DNA is made late mRNAs and late proteins are made. The late proteins are the structural proteins that comprise the phage as well as the proteins needed for lysis of the bacterial cell. In the next phase, the phage nucleic acid and structural proteins are assembled and infectious phage particles accumulate within the cell. The bacteria begin to lyse due to the accumulation of the phage lysis protein, leading to the release of intracellular phage particles. The number of particles released per infected cell can be as high as 1000 or more. Lytic phage may be enumerated by a plaque assay. The assay is performed at a low enough concentration of phage such that each plaque arises from a single infectious phage. The infectious particle that gives rise to a plaque is called a PFU (plaque forming unit).

[0061] Lysogenic phages are those that can either multiply via the lytic cycle or enter a quiescent state in the host cell. In the quiescent state, the phage genome exists as a prophage (i.e., it has the potential to produce phage). In most cases, the phage DNA actually integrates into the host chromosome and is replicated along with the host chromosome and passed on to the daughter cells. The host cell harboring a prophage is not adversely affected by the presence of the prophage and the lysogenic state may persist indefinitely. The lysogenic state can be terminated upon exposure to adverse conditions. Conditions which favor the termination of the lysogenic state include: desiccation, exposure to UV or ionizing radiation, exposure to mutagenic chemicals, etc. Adverse conditions lead to the production of proteases (rec A protein), the expression of the phage genes, reversal of the integration process, and lytic multiplication.

Recombinant K1E Phage Compositions of the Present Technology

[0062] K1E is a 45,251 bp, lytic bacteriophage (NCBI Reference Sequence: NC_007637; see Figures 10(A)-10(M)) that infects numerous E. coli strains that express Kl capsule genes. K1E phage is of the T7 supergroup. The recombinant K1E bacteriophage of the present technology specifically infects E. coli strains that express Kl capsule genes. In some embodiments, t e E. coli strains that express Kl capsule genes are selected from the group consisting of ATCC #11775, and ATCC #700973.

[0063] In one aspect, the present disclosure provides a recombinant K1E bacteriophage nucleic acid sequence, wherein the nucleic acid sequence between position 40,788 and 40,789 of SEQ ID NO: 1 is replaced with a heterologous nucleic acid sequence comprising an open reading frame that encodes a reporter protein, wherein the reporter protein is a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any

combination thereof.

[0064] Also disclosed herein are recombinant K1E bacteriophages that comprise any recombinant K1E bacteriophage nucleic acid sequence disclosed herein. In some

embodiments, the reporter protein(s) encoded by the heterologous nucleic acid sequence produces a detectable signal upon exposure to the appropriate stimuli, and the resulting signal permits detection of bacterial host cells infected by a recombinant K1E phage of the present technology.

[0065] In certain embodiments, the open reading frame encodes a reporter protein that serves as a marker that can be identified by screening bacterial host cells infected by a recombinant K1E phage of the present technology. Examples of such markers include by way of example and without limitation: a fluorescent label, a luminescent label, a

chemiluminescence label, or an enzymatic label. In some embodiments, the heterologous nucleic acid sequence further comprises sequences naturally found in the bacteriophage, but placed at a non-normally occurring location in the genome.

[0066] In some embodiments, the length of the heterologous nucleic acid sequence is at least 100 bases, at least 200 bases, at least 300 bases, at least 400 bases, at least 500 bases, at least 600 bases, at least 700 bases, at least 800 bases, at least 900 bases, at least 1 kilobase (kb), at least 1.1 kb, at least 1.2 kb, at least 1.3 kb, at least 1.4 kb, at least 1.5 kb, at least 1.6 kb, at least 1.7 kb, at least 1.8 kb, at least 1.9 kb, at least 2.0 kb, at least 2.1 kb, at least 2.2 kb, at least 2.3 kb, at least 2.4 kb, at least 2.5 kb, at least 2.6 kb, at least 2.7 kb, at least 2.8 kb, at least 2.9 kb, at least 3.0 kb, at least 3.1 kb, at least 3.2 kb, at least 3.3 kb, at least 3.4 kb, at least 3.5 kb, at least 3.6 kb, at least 3.7 kb, at least 3.8 kb, at least 3.9 kb, at least 4.0 kb, at least 4.5 kb, at least 5.0 kb, at least 5.5 kb, at least 6.0 kb, at least 6.5 kb, at least 7.0 kb, at least 7.5 kb, at least 8.0 kb, at least 8.5 kb, at least 9.0 kb, at least 9.5 kb, at least 10 kb, or more. In certain embodiments, the heterologous nucleic acid sequence comprises a length that is less than or equal to a length selected from the group consisting of 1 kb, 2 kb, 3 kb, 4 kb, 5 kb, 6 kb, 7 kb, 8 kb, 9 kb, and 10 kb. In some embodiments, the heterologous nucleic acid sequence comprises a length that is less than or equal to the maximum length of heterologous nucleic acid sequence that can be packaged into a phage particle comprising the phage genome.

[0067] In some embodiments, the length of the heterologous nucleic acid sequence is from 100 to 500 bases, from 200 to 1,000 bases, from 500 to 1,000 bases, from 500 to 1,500 bases, from 1 kb to 2 kb, from 1.5 kb to 2.5 kb, from 2.0 kb to 3.0 kb, from 2.5 kb to 3.5 kb, from 3.0 kb to 4.0 kb, from 3.5 kb to 4.5 kb, from 4.0 kb to 5.0 kb, from 4.5 kb to 5.5 kb, from 5.0 kb to 6.0 kb, from 5.5 kb to 6.5 kb, from 6.0 kb to 7.0 kb, from 6.5 kb to 7.5 kb, from 7.0 kb to 8.0 kb, from 7.5 kb to 8.5 kb, from 8.0 kb to 9.0 kb, from 8.5 kb to 9.5 kb, or from 9.0 kb to 10.0 kb. [0068] In some embodiments, the heterologous nucleic acid sequence is inserted into the K1E phage genome with no loss of endogenous K1E phage genomic sequence. In some embodiments, the heterologous nucleic acid sequence replaces an endogenous K1E phage genomic sequence. In certain embodiments, the heterologous nucleic acid sequence replaces an endogenous K1E phage genomic sequence that is less than the length of the heterologous nucleic acid sequence. Accordingly, in some embodiments, the length of the recombinant K1E phage genome is longer than the length of the wild-type K1E phage genome.

[0069] In certain embodiments, the open reading frame of the heterologous nucleic acid sequence encodes a reporter protein that confers a phenotype of interest on a host cell infected by a recombinant K1E phage of the present technology. In some embodiments, the phenotype of interest is the expression of the gene product encoded by the open reading frame of the heterologous nucleic acid sequence.

[0070] In certain embodiments, the open reading frame of the heterologous nucleic acid sequence is operably linked to an expression control sequence that is capable of directing expression of the open reading frame, wherein the open reading frame encodes a reporter protein (e.g., a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof). In some embodiments, the expression control sequence is located within the heterologous nucleic acid sequence. In other embodiments, the expression control sequence is located in the endogenous K1E phage genome sequence. For example, the open reading frame may be inserted into the K1E phage genome downstream of or in the place of an endogenous K1E phage open reading frame sequence. In some embodiments, the expression control sequence is an inducible promoter or a constitutive promoter (e.g., sarA promoter or lpp promoter). See e.g., Djordjevic & Klaenhammer, Methods in Cell

Science 20(1): 119-126 (1998). The inducible promoter or constitutive promoter may be an endogenous K1E phage promoter sequence, a phage promoter sequence that is non- endogenous to K1E phage, or a bacterial host promoter sequence. Additionally or alternatively, in some embodiments, the inducible promoter is a pH-sensitive promoter, or a temperature sensitive promoter.

[0071] In some embodiments, the heterologous nucleic acid sequence comprises a first open reading frame and at least one supplemental open reading frame. In certain

embodiments, the first and the at least one supplemental open reading frames are operably linked to the same expression control sequences. In some embodiments, the first and the at least one supplemental open reading frames are operably linked to different expression control sequences.

[0072] Fluorescent proteins include, but are not limited to, blue/UV fluorescent proteins (for example, TagBFP, Azurite, EBFP2, mKalamal, Sinus, Sapphire, and T-Sapphire), cyan fluorescent proteins (for example, ECFP, Cerulean, SCFP3 A, mTurquoise, monomeric Midoriishi-Cyan, TagCFP, and mTFPl), green fluorescent proteins (for example, GFP, EGFP, Emerald, Superfolder GFP, Monomeric Azami Green, TagGFP2, mUKG, and mWasabi), yellow fluorescent proteins (for example, EYFP, Citrine, Venus, SYFP2, and TagYFP), orange fluorescent proteins (for example, Monomeric Kusabira-Orange, ιηΚΟκ, mK02, mOrange, and mOrange2), red fluorescent proteins (for example, mRaspberry, mCherry, dsRed, mStrawberry, mTangerine, tdTomato, TagRFP, TagRFP-T, mApple, and mRuby), far-red fluorescent proteins (for example, mPlum, HcRed-Tandem, mKate2, mNeptune, and NirFP), near-IR fluorescent proteins (for example, TagRFP657, IFP1.4, and iRFP), long stokes-shift proteins (for example, mKeima Red, LSS-mKatel, and LSS- mKate2), photoactivatable fluorescent proteins (for example, PA-GFP, PAmCherry 1, and PATagRFP), photoconvertible fluorescent proteins (for example, Kaede (green), Kaede (red), KikGRl (green), KikGRl (red), PS-CFP2, PS-CFP2, mEos2 (green), mEos2 (red),

PSmOrange, and PSmOrange), fluorescein, rhodamine, and photoswitchable fluorescent proteins (for example, Dronpa).

[0073] Examples of bioluminescent proteins are aequorin (derived from the

jellyfish Aequorea victoria) and luciferases (including luciferases derived from firefly and Renilla, nanoluciferase, red luciferase, luxAB, and the like). These proteins have also been genetically separated into two distinct functional domains that will generate light only when the protein domains are closely co-localized. A variety of emission spectrum-shifted mutant derivatives of both of these proteins have been generated over the past decade and have been used for multi-color imaging and co-localization within a living cell.

[0074] Examples of chemiluminescent protein include β-galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase. Peroxidases generate peroxide that oxidizes luminol in a reaction that generates light, whereas alkaline phosphatases remove a phosphate from a substrate molecule, destabilizing it and initiating a cascade that results in the emission of light. [0075] In some embodiments, the open reading frame of the heterologous nucleic acid sequence comprises an epitope that can be detected with an antibody or other binding molecule. For example, an antibody that recognizes the epitope may be directly linked to a signal generating moiety (such as by covalent attachment of a chemiluminescent or fluorescent protein), or can be detected using at least one additional binding reagent such as a secondary antibody, directly linked to a signal generating moiety. In some embodiments, the epitope is absent in wild-type K1E bacteriophage and the bacterial host cell. Accordingly, detection of the epitope in a sample demonstrates the presence of a bacterial host cell infected by a recombinant K1E phage comprising a heterologous nucleic acid sequence, wherein the open reading frame of the heterologous nucleic acid sequence comprises the epitope. In other embodiments, the open reading frame of the heterologous nucleic acid sequence comprises a polypeptide tag sequence, such that the expression product of the open reading frame comprises the tag fused to a polypeptide or protein encoded by the open reading frame (e.g., poly-histidine, FLAG, Glutathione S-transferase (GST) etc.).

[0076] In some embodiments, the open reading frame of the heterologous nucleic acid sequence comprises a biotin binding protein such as avidin, streptavidin, or neutrAvidin that can be detected with a biotin molecule conjugated to an enzyme (e.g., β-galactosidase, horseradish peroxidase (HRP), and alkaline phosphatase) or an antibody. In some

embodiments, the antibody conjugated to a biotin molecule may be directly linked to a signal generating moiety (such as by covalent attachment of a chemiluminescent or fluorescent protein), or can be detected using at least one additional binding reagent such as a secondary antibody, directly linked to a signal generating moiety.

[0077] Also disclosed herein are recombinant K1E bacteriophages comprising any of the recombinant K1E bacteriophage nucleic acid sequences disclosed herein. In some embodiments, the recombinant K1E bacteriophages comprise a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0078] In another aspect, the present disclosure provides a vector comprising any of the recombinant K1E bacteriophage nucleic acid sequences disclosed herein, as well as bacterial host cells comprising the vectors of the present technology. In some embodiments, the bacterial host cell expresses Kl capsule genes. The bacterial host cell may be a natural or non-natural host for K1E bacteriophage. [0079] The present disclosure also provides a bacterial host cell comprising a recombinant KIE bacteriophage disclosed herein. In some embodiments, the bacterial host cell expresses Kl capsule genes. The bacterial host cell may be a natural or non-natural host for KIE bacteriophage.

Methods of Making Recombinant KIE Bacteriophage of the Present Technology

[0080] In one aspect, the present disclosure provides methods for making a recombinant KIE bacteriophage of the present technology comprising (a) contacting a non-recombinant KIE bacteriophage genome of SEQ ID NO: 1 comprising a single first recognition site with a first restriction enzyme in vitro under conditions where the first restriction enzyme cleaves the first recognition site to produce a cleaved non-recombinant KIE bacteriophage genome; and (b) recombining in vitro the cleaved non-recombinant KIE bacteriophage genome with a heterologous nucleic acid in the presence of a recombination system under conditions to produce a recombinant KIE bacteriophage genome, wherein the heterologous nucleic acid sequence comprises an open reading frame that encodes a bioluminescent protein, a fluorescent protein, a chemiluminescent protein, or any combination thereof. The cleaved non-recombinant KIE bacteriophage genome comprises a first cleaved bacteriophage genomic fragment and a second cleaved bacteriophage genomic fragment. In certain embodiments of the methods disclosed herein, the heterologous nucleic acid sequence comprises a 5' flanking region that is homologous to the 3' end of the first cleaved bacteriophage genomic fragment, and a 3' flanking region that is homologous to the 5' end of the second cleaved bacteriophage genomic fragment. In some embodiments, the first restriction enzyme is PflFl .

[0081] In some embodiments of the methods disclosed herein, the homologous 5' flanking region of the heterologous nucleic acid sequence has a length of about 20-30 base pairs (bps), 30-40 bps, 40-50 bps, 50-60 bps, 60-70 bps, 70-80 bps, 80-90 bps, 90-100 bps, 100-110 bps, 110-120 bps, 120-130 bps, 130-140 bps, 140-150 bps, 150-160 bps, 160-170 bps, 170-180 bps, 180-190 bps, 190-200 bps, 200-210 bps, 210-220 bps, 220-230 bps, 230- 240 bps, 240-250 bps, 250-260 bps, 260-270 bps, 270-280 bps, 280-290 bps, 290-300 bps, 300-310 bps, 310-320 bps, 320-330 bps, 330-340 bps, 340-350 bps, 350-360 bps, 360-370 bps, 370-380 bps, 380-390 bps, 390-400 bps, 400-410 bps, 410-420 bps, 420-430 bps, 430- 440 bps, 440-450 bps, 450-460 bps, 460-470 bps, 470-480 bps, 480-490 bps, 490-500 bps, 500-510 bps, 510-520 bps, 520-530 bps, 530-540 bps, 540-550 bps, 550-560 bps, 560-570 bps, 570-580 bps, 580-590 bps, or 590-600 bps. [0082] Additionally or alternatively, in some embodiments of the methods disclosed herein, the homologous 3' flanking region of the heterologous nucleic acid sequence has a length of about 20-30 base pairs (bps), 30-40 bps, 40-50 bps, 50-60 bps, 60-70 bps, 70-80 bps, 80-90 bps, 90-100 bps, 100-110 bps, 110-120 bps, 120-130 bps, 130-140 bps, 140-150 bps, 150-160 bps, 160-170 bps, 170-180 bps, 180-190 bps, 190-200 bps, 200-210 bps, 210- 220 bps, 220-230 bps, 230-240 bps, 240-250 bps, 250-260 bps, 260-270 bps, 270-280 bps, 280-290 bps, 290-300 bps, 300-310 bps, 310-320 bps, 320-330 bps, 330-340 bps, 340-350 bps, 350-360 bps, 360-370 bps, 370-380 bps, 380-390 bps, 390-400 bps, 400-410 bps, 410- 420 bps, 420-430 bps, 430-440 bps, 440-450 bps, 450-460 bps, 460-470 bps, 470-480 bps, 480-490 bps, 490-500 bps, 500-510 bps, 510-520 bps, 520-530 bps, 530-540 bps, 540-550 bps, 550-560 bps, 560-570 bps, 570-580 bps, 580-590 bps, or 590-600 bps.

[0083] Additionally or alternatively, in some embodiments, the methods further comprise propagating the recombinant KIE bacteriophage genome in a bacterial host. For example, the bacterial host may be transformed with the recombinant KIE bacteriophage genome via electroporation. The bacterial host may be a non-natural bacterial host cell or a natural bacterial host cell for KIE bacteriophage.

[0084] Additionally or alternatively, in some embodiments of the methods disclosed herein, the recombination system comprises a 5'-3' exonuclease, a DNA polymerase, and a DNA ligase. In one embodiment, the 5 '-3' exonuclease is T5 exonuclease, the DNA polymerase is Phusion ^® DNA polymerase (Thermo Fisher Scientific, Waltham, MA), and the DNA ligase is Taq ligase. In other embodiments, the recombination system comprises a 3 '-5' exonuclease, a DNA polymerase, and a DNA ligase.

Bacterial Identification and Antibiotic Susceptibility Profiling Methods of the Present Technology

[0085] Accurate identification of bacterial species within a biological sample informs the selection of suitable therapies for treating bacterial infections. The recombinant KIE bacteriophages disclosed herein may be used to identify bacteria present within a biological sample {e.g., whole blood, plasma, serum). Such methods entail contacting the biological sample with a recombinant KIE bacteriophage disclosed herein, and detecting the presence of bacterial host cells infected by the recombinant KIE phage, wherein the recombinant KIE phage comprises a heterologous nucleic acid sequence that encodes a detectable gene product, thereby leading to the identification of bacteria present within the biological sample. [0086] Additionally or alternatively, the recombinant KIE bacteriophages disclosed herein, may be used in methods for profiling antibiotic susceptibility of bacteria present within a biological sample (e.g., whole blood, plasma, serum). These methods include (a) contacting the biological sample with an antibiotic and a recombinant KIE bacteriophage disclosed herein, (b) detecting the presence of bacterial host cells infected by the recombinant KIE phage, wherein the recombinant KIE phage comprises a heterologous nucleic acid sequence that encodes a detectable gene product, and (c) determining that the antibiotic is effective in inhibiting the bacteria present in the biological sample when the levels of recombinant KIE phage infected bacterial host cells are reduced relative to that observed in an untreated control sample.

[0087] In one aspect, the present disclosure provides a method for identifying at least one bacterial strain or species in a test sample obtained from a subject comprising (a) separating bacterial cells isolated from the test sample into one or more sub-samples, (b) contacting each sub-sample with at least one recombinant KIE bacteriophage disclosed herein, wherein each recombinant KIE bacteriophage comprises a heterologous nucleic acid sequence encoding one or more reporter genes, and (c) identifying at least one bacterial strain or species in the test sample by detecting the expression of the one or more reporter genes in recombinant KIE bacteriophage-infected bacterial cells. In certain embodiments, the at least one KIE bacteriophage comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5. In certain embodiments, the method for identifying at least one bacterial strain or species in a test sample does not require the culturing of bacterial cells from the test sample or a sub-sample.

[0088] In some embodiments, identification of at least one bacterial strain or species includes detecting the expression of the one or more reporter genes in recombinant KIE bacteriophage-infected bacterial cells, e.g., detectable expression of green fluorescence indicates the presence of bacterial species A in a test sample or sub-sample. In some embodiments, the absence of at least one bacterial strain or species is identified by the lack of detectable expression of the one or more reporter genes in recombinant KIE bacteriophage- infected bacterial cells, e.g., undetectable expression of green fluorescence indicates the lack of bacterial species A in a test sample or sub-sample.

[0089] In some embodiments, the at least one recombinant KIE bacteriophage infects a single species of bacteria. In certain embodiments, the at least one recombinant KIE bacteriophage infects two or more species of bacteria. By way of example, but not by way of limitation, in some embodiments, the species of bacteria that are infected include Kl capsule gene expressing E. coli strains, such as ATCC #11775, and ATCC #700973.

[0090] In some embodiments, detection of the expression of the reporter gene is detection of the gene product itself, e.g., a fluorescent protein. In some embodiments, detection of the expression of the reporter gene is detection of an enzymatic reaction requiring the expression of the reporter gene, e.g., expression of luciferase to catalyze luciferin to produce light.

[0091] In some embodiments, the expression of the one or more reporter genes is detected in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 120 minutes or any time between any two of the preceding values after contacting a sub-sample with the at least one recombinant K1E bacteriophage disclosed herein.

[0092] The present disclosure also provides a method for identifying at least one bacterial strain or species that expresses Kl capsule genes in a test sample obtained from a subject comprising (a) contacting the test sample comprising bacterial cells with a recombinant K1E bacteriophage of the present technology; and (b) detecting the expression of the reporter protein in recombinant K1E bacteriophage-infected bacterial cells, wherein detection of the reporter protein indicates the presence of at least one bacterial strain or species that expresses Kl capsule genes in the test sample. In some embodiments of the method, the expression of the reporter protein is measured in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90 or 120 minutes after contacting the test sample comprising bacterial cells with the recombinant K1E bacteriophage.

[0093] Additionally or alternatively, in some embodiments of the methods disclosed herein, the test sample is blood, sputum, mucus, lavage, saliva, or a swab obtained from the subject. In some embodiments, the subject is human.

[0094] In another aspect, the present disclosure provides a method for determining the antibiotic susceptibility of a bacterial strain or species in a test sample obtained from a subject comprising (a) separating bacterial cells isolated from the test sample into a plurality of sub-samples, (b) contacting the plurality of sub-samples with a recombinant K1E bacteriophage disclosed herein and at least one antibiotic, wherein the recombinant K1E bacteriophage comprises a heterologous nucleic acid sequence encoding a reporter gene, and (c) detecting the expression of the reporter gene in recombinant K1E bacteriophage-infected bacterial cells in the presence of each antibiotic. In some embodiments, the method further comprises determining that the bacterial strain or species in the test sample is susceptible to an antibiotic if the reporter gene expression in the recombinant K1E bacteriophage-infected bacterial cells in the antibiotic treated sub-sample is decreased relative to that observed in a control sub-sample that is not treated with the antibiotic. In other embodiments, the method further comprises determining that the bacterial strain or species in the test sample is resistant to an antibiotic if the reporter gene expression in the recombinant K IE bacteriophage- infected bacterial cells in the antibiotic treated sub-sample is comparable to that observed in a control sub-sample that is not treated with the antibiotic. In certain embodiments, the method for determining the antibiotic susceptibility of a bacterial strain or species in a test sample does not require the culturing of bacterial cells from a test sample or a sub-sample.

[0095] Additionally or alternatively, in some embodiments of the recombinant K1E bacteriophages of the present technology, the reporter gene is nanoluciferase. In certain embodiments, recombinant K1E bacteriophage comprises a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[0096] Examples of antibiotics include one or more of rifampicin, tetracycline, levofloxacin, ampicillin, penicillin G, methicillin, oxacillin, amoxicillin, cefadroxil, ceforanid, cefotaxime, ceftriaxone, doxycycline, minocycline, amikacin, gentamicin, levofloxacin, kanamycin, neomycin, streptomycin, tobramycin, azithromycin, clarithromycin, erythromycin, ciprofloxacin, lomefloxacin, norfloxacin, chloramphenicol, clindamycin, cycloserine, isoniazid, rifampin, teicoplanin, quinupristin/dalfopristin, linezolid,

pristinamycin, ceftobiprole, ceftaroline, dalbavancin, daptomycin, mupirocin, oritavancin, tedizolid, telavancin, tigecycline, ceftazidime, cefepime, piperacillin, ticarcillin,

virginiamycin, netilmicin, paromomycin, spectinomycin, geldanamycin, herbimycin, rifaximin, loracarbef, ertapenem, doripenem, imipenem/cilastatin, meropenem, cefazolin, cefalotin, cephalexin, cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren, cefoperazone, cefpodoxime, ceftibuten, ceftizoxime, lincomycin, dirithromycin, roxithromycin, troleandomycin, telithromycin, spiramycin, aztreonam, furazolidone, nitrofurantoin, posizolid, radezolid, torezolid, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin V, temocillin, bacitracin, colistin, polymyxin B, enoxacin, gatifloxacin, gemifloxacin, moxifloxacin, nalidixic acid, ofloxacin, trovafloxacin, grepafloxacin, sparfloxacin, temafloxacin, mafenide, sulfacetamide, sulfadiazine, silver sulfadiazine, sulfadimethoxine, sulfamethizole, sulfamethoxazole, sulfanilimide, sulfasalazine, sulfisoxazole, trimethoprim-sulfamethoxazole (Co-trimoxazole) (TMP-SMX), sulfonamidochrysoidine, demeclocycline, oxytetracycline, clofazimine, dapsone, capreomycin, ethambutol, ethionamide, pyrazinamide, rifabutin, rifapentine, arsphenamine, fosfomycin, fusidic acid, metronidazole, platensimycin, thiamphenicol, tinidazole, trimethoprim(Bs) and vancomycin.

[0097] In some embodiments of the method, the differences in the reporter gene expression in the recombinant K1E bacteriophage-infected bacterial cells observed in the antibiotic treated sub-sample and the untreated control sub-sample is defined as μ.

[0098] Additionally or alternatively, in some embodiments of the method, the expression of the reporter gene is detected in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, 120 minutes or any time between any two of the preceding values after contacting a sub-sample with a recombinant K1E bacteriophage disclosed herein.

[0099] In some embodiments, two or more sub-samples are tested for antibiotic susceptibility in series. In some embodiments, two or more sub-samples are tested for antibiotic susceptibility in parallel. In some embodiments, one or more sub-samples are tested for antibiotic susceptibility in a running assay (where resistance or sensitivity to one antibiotic is determined and the resistance or sensitivity to a second, third, fourth, fifth, etc., antibiotic is being assayed).

[00100] In some embodiments of the methods disclosed herein, isolating bacterial cells from a test sample includes incubating the test sample with distilled water to form a mixture, centrifuging the mixture to form a pellet that includes bacterial cells, and re-suspending the pellet to form a bacterial suspension comprising isolated bacterial cells after discarding the supernatant. The pellet may be re-suspended in a phosphate buffer. In some embodiments, the bacterial suspension is divided into one or more sub-samples.

[00101] In certain embodiments of the methods disclosed herein, mixing the test sample with distilled water will lead to the lysis of cells that lack cell walls {e.g., mammalian cells and red blood cells) while leaving cells with cell walls {e.g., bacteria) intact. Without wishing to be bound by theory, in some embodiments, the removal of cells that lack cell walls enhances the detection of reporter gene expression in bacterial cells infected with a recombinant K1E bacteriophage, as intact non-bacterial cells {e.g., red blood cells) may quench reporter gene expression. In some embodiments of the methods of the present technology, the mixture is about 90% distilled water and 10% test sample, about 80% distilled water and 20% test sample, about 70% distilled water and 30% test sample, about 60% distilled water and 40% test sample, about 50% distilled water and 50% test sample, about 40% distilled water and 60% test sample, about 30% distilled water and 70% test sample, about 20% distilled water and 80% sample, or about 10% distilled water and 90% test sample. In some embodiments of the methods disclosed herein, the mixture is incubated for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 minutes, or any time between two of the previously listed time points. Additionally or alternatively, in certain embodiments of the methods disclosed herein, the mixture is centrifuged for 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, or 15 minutes, or any time between two of the previously listed time points.

[00102] Additionally or alternatively, in certain embodiments of the methods disclosed herein, each of the one or more sub-samples comprise between about 5 to 500, about 10 to 400, about 20 to 300, about 30 to 300, about 40 to 200 or about 50 to 100 bacterial cells. In some embodiments of the methods disclosed herein, each of the one or more sub-samples comprises between about 100 to 10,000, about 200 to 9,000, about 300 to 8,000, about 400 to 7,000, about 500 to 6,000, about 600 to 5,000, about 700 to 4,000, about 800 to 3,000, about 900 to 2,000, or about 1,000 to 1,500 bacterial cells.

[00103] In another aspect, the present disclosure provides a method for determining the antibiotic susceptibility of a bacterial strain or species in a test sample obtained from a subject comprising (a) contacting a plurality of test samples comprising bacterial cells with a recombinant KIE bacteriophage of the present technology and an antibiotic, wherein the plurality of test samples is derived from the subject; (b) detecting the expression of the reporter protein in recombinant KIE bacteriophage-infected bacterial cells in the plurality of test samples; and (c) determining that the antibiotic is effective in inhibiting the bacterial strain or species in a test sample when the reporter protein expression levels in recombinant KIE phage-infected bacterial cells in the test sample are reduced relative to that observed in an untreated control sample comprising bacterial cells, wherein the untreated control sample is derived from the subject. In some embodiments, the bacterial strain or species in the test sample expresses Kl capsule genes. The expression of the reporter protein may be measured in about 5, 10, 15, 20, 25, 30, 35, 40, 45, 50, 55, 60, 65, 70, 75, 80, 85, 90, or 120 minutes after contacting the plurality of test samples comprising bacterial cells with the recombinant KIE bacteriophage. In other embodiments, the method further comprises determining that the bacterial strain or species in the test sample is resistant to the antibiotic when the reporter protein expression levels of the recombinant KIE bacteriophage-infected bacterial cells in the test sample are comparable to that observed in an untreated control sample comprising bacterial cells, wherein the untreated control sample is derived from the subject.

[00104] In any of the above embodiments of the methods of the present technology, the test sample is blood, sputum, mucus, lavage, saliva, or a swab obtained from the subject. In some embodiments of the methods disclosed herein, the test sample is obtained from a mammalian subject, including, for example, farm animals, such as sheep, pigs, cows, and horses; pet animals, such as dogs and cats; and laboratory animals, such as rats, mice and rabbits. In one embodiment, the mammal subject is a human.

Kits

[00105] The present technology provides kits including the recombinant KIE

bacteriophages disclosed herein for bacteria identification and antibiotic susceptibility profiling.

[00106] In one aspect, the kits of the present technology comprise one or more

coded/labeled vials that contain a plurality of the recombinant KIE bacteriophages disclosed herein, and instructions for use. In some embodiments, each coded/labeled vial corresponds to a different recombinant KIE bacteriophage. In other embodiments, each coded/labeled vial corresponds to the same recombinant KIE bacteriophage. In some embodiments, the kits of the present technology comprise one or more coded/labeled vials that contain at least one recombinant KIE bacteriophage comprising a nucleic acid sequence selected from the group consisting of SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, and SEQ ID NO: 5.

[00107] In some embodiments, each phage vial is assigned a unique code that identifies the bacteriophage in the phage vial, or the types of bacteria that the bacteriophage strain infects. The unique code can be encoded by a machine discernible pattern, such as a bar code, a QR code, an alphanumeric string, or any other pattern that can be discerned by a reader. Each unique code may be shown as, for example, a bar code sticker on a vial or container storing a corresponding phage sample. In some embodiments, the kit is stored under conditions that permit the preservation of the bacteriophage genomes for extended periods, such as under bacteriophage-specific, controlled temperature, moisture, and pH conditions.

[00108] Additionally or alternatively, in some embodiments, the kits further comprise vials containing natural or non-natural bacterial host cells. In some embodiments, the bacterial host cells are E. coli. In certain embodiments, the bacterial host cells are E. coli strain DH10B.

[00109] The kits may also comprise instructions for use, software for automated analysis, containers, packages such as packaging intended for commercial sale and the like.

[00110] The kit may further comprise one or more of: wash buffers and/or reagents, hybridization buffers and/or reagents, labeling buffers and/or reagents, and detection means. The buffers and/or reagents are usually optimized for the particular detection technique for which the kit is intended. Protocols for using these buffers and reagents for performing different steps of the procedure may also be included in the kit. Further optional components of the kits may include expression media for gene products encoded by the heterologous nucleic acids of the recombinant K IE bacteriophages disclosed herein, such as a medium containing nutrients and cofactors for bioluminescence, devices such as a lamp configured to illuminate at specific wavelengths of light to detect biofluorescence, and devices for measuring the extent of heterologous nucleic acid expression, such as a photometer or photodetector.

[00111] Additionally or alternatively, the kits disclosed herein may also include coded and labeled vials that contain a plurality of antibiotics. In some embodiments, the plurality of antibiotics comprises one or more of rifampicin, tetracycline, levofloxacin, and ampicillin. Other examples of antibiotics include penicillin G, methicillin, oxacillin, amoxicillin, cefadroxil, ceforanid, cefotaxime, ceftriaxone, doxycycline, minocycline, amikacin, gentamicin, levofloxacin, kanamycin, neomycin, streptomycin, tobramycin, azithromycin, clarithromycin, erythromycin, ciprofloxacin, lomefloxacin, norfloxacin, chloramphenicol, clindamycin, cycloserine, isoniazid, rifampin, teicoplanin, quinupristin/dalfopristin, linezolid, pristinamycin, ceftobiprole, ceftaroline, dalbavancin, daptomycin, mupirocin, oritavancin, tedizolid, telavancin, tigecycline, ceftazidime, cefepime, piperacillin, ticarcillin,

virginiamycin, netilmicin, paromomycin, spectinomycin, geldanamycin, herbimycin, rifaximin, loracarbef, ertapenem, doripenem, imipenem/cilastatin, meropenem, cefazolin, cefalotin, cephalexin, cefaclor, cefamandole, cefoxitin, cefprozil, cefuroxime, cefixime, cefdinir, cefditoren, cefoperazone, cefpodoxime, ceftibuten, ceftizoxime, lincomycin, dirithromycin, roxithromycin, troleandomycin, telithromycin, spiramycin, aztreonam, furazolidone, nitrofurantoin, posizolid, radezolid, torezolid, azlocillin, carbenicillin, cloxacillin, dicloxacillin, flucloxacillin, mezlocillin, nafcillin, penicillin V, temocillin, bacitracin, colistin, polymyxin B, enoxacin, gatifloxacin, gemifloxacin, moxifloxacin, nalidixic acid, ofloxacin, trovafloxacin, grepafloxacin, sparfloxacin, temafloxacin, mafenide, sulfacetamide, sulfadiazine, silver sulfadiazine, sulfadimethoxine, sulfamethizole, sulfamethoxazole, sulfanilimide, sulfasalazine, sulfisoxazole, trimethoprim-sulfamethoxazole (Co-trimoxazole) (TMP-SMX), sulfonamidochrysoidine, demeclocycline, oxytetracycline, clofazimine, dapsone, capreomycin, ethambutol, ethionamide, pyrazinamide, rifabutin, rifapentine, arsphenamine, fosfomycin, fusidic acid, metronidazole, platensimycin, thiamphenicol, tinidazole, trimethoprim(Bs) and vancomycin.

[00112] The kits of the present technology may optionally comprise a recombination system that includes a 5 '-3' exonuclease, a DNA polymerase, and a DNA ligase. For example, in one embodiment, the 5 '-3' exonuclease is T5 exonuclease, the DNA polymerase is Phusion® DNA polymerase (Thermo Fisher Scientific, Waltham, MA), and the DNA ligase is Taq ligase. In other embodiments, the kits comprise a non-endogenous

recombination system that includes a 3 '-5' exonuclease, a DNA polymerase, and a DNA ligase.

EXAMPLES

Example 1: Design and Methods for Generating the Recombinant K1E Bacteriophages of the Present Technology

[00113] This Example demonstrates that the methods of the present technology are useful for producing the recombinant K1E bacteriophages disclosed herein.

[00114] K1E bacteriophage DNA was extracted from a clarified lysate using the Zymo ZR Viral DNA kit (Cat. No. D3015) (Zymo Research, Irvine, CA). 150 ng of K1E bacteriophage DNA was digested with the restriction enzyme PflFl (New England Biolabs, Ipswich, MA) according to the manufacturer's specifications. As shown in Figure 1, the PflFl restriction enzyme cleavage site is located between gene 42 and gene 43 of the K1E bacteriophage genome.

[00115] A gBlock (synthesized by Integrated DNA Technologies, Coralville, IA) containing the NanoLuc ^® gene flanked on each side by 25 bp of homology (see Figure 2; SEQ ID NO: 2) to the viral genome was inserted into the PfLfl cleavage site using the NEBuilder® (New England Biolabs, Ipswich, MA) kit according to the manufacturer's specifications. Figures 3(A)-3(N) show the complete nucleic acid sequence of the recombinant K1E bacteriophage. [00116] 2 μΐ of the assembly reaction was transformed into electrocompetent ΝΕΒΙΟβ cells (NEB C3030K) (New England Biolabs, Ipswich, MA). Cells were recovered in 450 μΐ of SOC medium and incubated for 1 hour at 37 °C. After incubation, 250 μΐ of the transformation mixture was added to 3 ml of log-phase E. coli Kl cells (ATCC® 700973). The mixture was further incubated at 37 °C for an hour. After incubation, 1ml of the culture was centrifuged at 10,000 x g for 10 minutes and 100 μΐ of the supernatant was mixed with 100 μΐ of E. coli Kl cells and plated on LB agar with 3ml 0.65% soft agar overlay. After incubation at 37 °C overnight, isolated plaques were selected and screened for

NanoLuc® insertion by PCR using primers that flanked the NanoLuc ^® insertion site.

[00117] Genotypic analysis: Primers flanking the PflFl cleavage site were designed so as to assess the insertion of the NanoLuc ^® gene via PCR screening: Forward primer - CTTAAGAAGAAAGATCATCCTATCAAC (SEQ ID NO: 6) and Reverse primer - GTTCTTAGCACCTCCCACAT (SEQ ID NO: 7). Recombinant KIE phage with the proper NanoLuc ^® insertion yielded a 912 bp amplicon, whereas the wild type amplicon was 383 bp. See Figure 4. The left and right junctions of the PCR products were sequenced in both forward and reverse directions to ensure the proper insertion of the nanoluciferase payload (see Figure 5(A) and Figure 5(B)).

[00118] Phenotypic analysis: NanoLuc ^® production was also evaluated by infecting E. coli Kl (ATCC ^® 700973) bacterial host cells with the recombinant KIE phage for 1 hour at 37 °C and measuring luminescence using the Nano-Glo ^® Luciferase Assay System (Promega Corp., Madison WI). Briefly, mutated and wild-type plaques were picked and used to infect host Kl E. coli cells for 1 hour. The Kl E. coli cells were assayed for NanoLuc ^® production with the Nano-Glo Luciferase Assay System (Promega Corp., Madison WI). See Figure 6.

[00119] These results demonstrate that the methods of the present technology are useful for making the recombinant KIE bacteriophages disclosed herein. Accordingly, the methods disclosed herein are useful for generating recombinant KIE bacteriophages that can be used in the identification and/or antibiotic susceptibility profiling of specific bacterial

strains/species {e.g., bacterial strains/species that express Kl capsule gene) present in a sample. Example 2: Functional Activity of the Recombinant KIE Bacteriophages of the Present Technology

[00120] This Example demonstrates that the recombinant KIE bacteriophages of the present technology are useful for the identification and/or antibiotic susceptibility profiling of specific bacterial strains/species {e.g., bacterial strains/species that express Kl capsule gene) present in a sample.

[00121] NanoLuc ^® signal production and sensitivity were evaluated by infecting E. coli Kl cells with the purified recombinant KIE lumiphage and measuring luminescence at 20, 40, 60 minutes. Briefly, bacterial cells were grown to mid log-phase growth in LB medium and serially diluted in log steps in a microtiter plate to obtain concentrations of 10 ⁴ bacteria/ΙΟΟμΙ down to 1 bacterial cell/ΙΟΟμΙ. KIE detector phage was added to each well at a constant concentration of 10 ⁶ phage/well. For each time point, luminescence was measured using the Nano-Glo ^® Luciferase Assay System (Promega Corp., Madison WI). Figure 6 shows the luminescence activity profile and sensitivity of the recombinant KIE bacteriophage of the present technology. As shown in Figure 6, the luminescence activity of the recombinant KIE bacteriophage-infected Kl bacterial host cells increased in both a host cell-dependent and time-dependent manner.

[00122] Plaques containing the recombinant KIE bacteriophages disclosed herein were used to infect a host population of Kl, K5 and K2 capsule producing E. coli strains. Figure 8 demonstrates that the KIE bacteriophage of the present technology specifically infects Kl capsule producing E. coli strains. The infected Kl bacterial host cells exhibited

luminescence that was at least three orders of magnitude above the background level. See Figure 8.

[00123] As shown in Figure 9, the recombinant NanoLuc ^® KlE phages of the present technology successfully infected a Kl capsule expressing E. coli isolate that was incapable of being infected with a recombinant nanoluciferase expressing T7 phage. Only Kl capsule expressing E. coli cells infected with the recombinant NanoLuc ^® KIE phages of the present technology exhibited an increase in relative luminescence units (RLU) during active infection (1 hour).

[00124] Figure 7 demonstrates that the recombinant KIE phages of the present technology are useful in identifying and profiling the antibiotic susceptibility of a bacterial strain that expresses Kl capsule genes in a test sample. For example, Figure 7 demonstrates that the Kl capsule expressing E. coli in the test sample was sensitive to treatment with 100 μg/ml rifampicin and 20 μg/ml tetracycline.

[00125] These results demonstrate that the recombinant KIE bacteriophages of the present technology are useful for detecting target bacterial strains/species present in a sample.

Accordingly, the recombinant KIE bacteriophages disclosed herein are useful for the identification and/or antibiotic susceptibility profiling of specific bacterial strains/species {e.g., bacterial strains/species that express Kl capsule gene) present in a sample.

Example 3: Antibiotic Susceptibility Profiling Using the Recombinant KIE Bacteriophages of the Present Technology

[00126] Antibiotics were prepared by performing eleven 2-fold serial dilutions in Mueller Hinton Broth (Sigma, St. Louis, MO) in 96 well microtiter plates at a final volume of 100 μΐ. One column contained broth only and served as a no drug control.

[00127] Cells from an overnight growth blood culture in 25% human blood and 75% Tryptic Soy Broth TSB were diluted 1 : 10 in Mueller Hinton Broth. From this dilution, 5 μΐ of cells was added to each well of the antibiotic plate. Cells were pretreated with antibiotics (Ceftazidime, Gentamicin, Amikacin, and Levofloxacin) for 120 minutes at 37 °C. After the 120 minute pretreatment, 10 μΐ of phage suspension comprising the recombinant KIE phage of the present technology (1E6 pfu/reaction well) was added to each well and incubated at 37 °C for 45 minutes. After infection with the phage, 50 μΐ of the reaction was added to 50 μΐ Nano Glo Luciferase Substrate (Promega, Madison, WI) in a luminescent plate and read in a luminometer. The minimal inhibitory concentration (MIC) of each sample was determined using the ETEST ^® method (Biomerieux, St. Louis, MO) according to the manufacturer's instructions. The differences in the reporter gene expression of the recombinant KIE bacteriophage observed in the antibiotic treated samples and the untreated control samples is defined as μ.

[00128] Figures 11(A)-11(D) demonstrate that the recombinant KIE bacteriophages of the present technology were effective in determining the antibiotic susceptibility profile of two different E. coli strains SS11 DL21 and SS3 DL05.

[00129] These results demonstrate that the recombinant KIE bacteriophages of the present technology are useful for determining the antibiotic susceptibility of a bacterial strain or species in a test sample. Accordingly, the recombinant KIE bacteriophages disclosed herein are useful for the identification and/or antibiotic susceptibility profiling of specific bacterial strains/species (e.g., bacterial strains/species that express Kl capsule genes) present in a sample.

EQUIVALENTS

[00130] The present technology is not to be limited in terms of the particular embodiments described in this application, which are intended as single illustrations of individual aspects of the present technology. Many modifications and variations of this present technology can be made without departing from its spirit and scope, as will be apparent to those skilled in the art. Functionally equivalent methods and apparatuses within the scope of the present technology, in addition to those enumerated herein, will be apparent to those skilled in the art from the foregoing descriptions. Such modifications and variations are intended to fall within the scope of the present technology. It is to be understood that this present technology is not limited to particular methods, reagents, compounds compositions or biological systems, which can, of course, vary. It is also to be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended to be limiting.

[00131] In addition, where features or aspects of the disclosure are described in terms of Markush groups, those skilled in the art will recognize that the disclosure is also thereby described in terms of any individual member or subgroup of members of the Markush group.

[00132] As will be understood by one skilled in the art, for any and all purposes, particularly in terms of providing a written description, all ranges disclosed herein also encompass any and all possible subranges and combinations of subranges thereof. Any listed range can be easily recognized as sufficiently describing and enabling the same range being broken down into at least equal halves, thirds, quarters, fifths, tenths, etc. As a non-limiting example, each range discussed herein can be readily broken down into a lower third, middle third and upper third, etc. As will also be understood by one skilled in the art all language such as "up to," "at least," "greater than," "less than," and the like, include the number recited and refer to ranges which can be subsequently broken down into subranges as discussed above. Finally, as will be understood by one skilled in the art, a range includes each individual member. Thus, for example, a group having 1-3 cells refers to groups having 1, 2, or 3 cells. Similarly, a group having 1-5 cells refers to groups having 1, 2, 3, 4, or 5 cells, and so forth. [00133] All patents, patent applications, provisional applications, and publications referred to or cited herein are incorporated by reference in their entirety, including all figures and tables, to the extent they are not inconsistent with the explicit teachings of this specification.