Field of Invention [0002] The present invention relates to the identification of essential and important genes in Pseudomonas aeruginosa, and the use thereof in screening assays and diagnostic methods to identify, evaluate or design antibacterial agents useful for the treatment of Pseudomonas infections. Such agents are particularly useful in preventing and treating opportunistic infections in immunocompromised individuals and for treating and preventing pulmonary infections in patients having cystic fibrosis disease.

Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.

Background of Invention [0003] Pseudomonas aeruginosa is a versatile Gram-negative bacterium that is able to adapt to and thrive in many ecological niches, from water and soil to plant and animal tissues. The bacterium is capable of utilizing a wide range of organic compounds as food sources, thus giving it an exceptional ability to colonize ecological niches where nutrients are limited, such as soil, marshes and coastal marine habitats.

Hardalo, C. & Edberg, S. C. Pseudomonas aeruginosa : assessment of risk from drinking water. Crit. Rev. Microbiol. 23,47-75 (1997). It also forms biofilms on wet surfaces such as those of rocks and soil. Costerton, J. W. , Stewart, P. S. & Greenberg, E. P. Bacterial biofilms: a common cause of persistent infections. Science 284,1318- 1322 (1999). Ahearn, D. G. , Borazjani, R. N. , Simmons, R. B. & Gabriel, M. M.

Primary adhesion of Pseudomonas aeruginosa to inanimate surfaces including biomaterials. Methods Enzymol. 310,551-557 (1999). Analysis of the P. aeruginosa genome has identified genes involved in locomotion, attachment, transport and utilization of nutrients, antibiotic efflux, and two component and other regulatory systems involved in sensing and responding to environmental changes. Because its natural habitat is the soil, where it exposed to bacilli, actinomycetes and molds, it has developed resistance to a variety of their naturally-occurring antibiotics.

[0004] The emergence of P. aeruginosa as a major opportunistic human pathogen during the past century may be a consequence of its resistance to the antibiotics and disinfectants that eliminate other environmental bacteria. P. aeruginosa is now a significant source of bacteraemia in burn victims, urinary-tract infections in catheterized patients, and hospital-acquired pneumonia in patients on respirators.

Bodey, G. P. , Bolivar, R. , Fainstein, V. & Jadeja, L. Infections caused by Pseudomonas aeruginosa. Rev. Infect. Dis. 5,279-313 (1983). It is also the predominant cause of morbidity and mortality in cystic fibrosis patients, whose abnormal airway epithelia allow long-term colonization of the lungs by P. aeruginosa. Thus, people with cystic fibrosis, burn victims, individuals with cancer and AIDS, and patients requiring extensive stays in intensive care units are particularly at risk of disease resulting from P. aeruginosa infection. P. aeruginosa is also a cause of a variety of different disorders including septicemia, urinary tract infections, pneumonia and chronic lung infections, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis.

[0005] Cystic fibrosis is one of the most common fatal genetic disorders in the United States, affecting about 30,000 individuals. A comparable number of people in Europe also have CF. It is most prevalent in the Caucasian population, occurring in one of every 3,300 live births. The gene involved in cystic fibrosis was identified in 1989 and codes for a protein called the cystic fibrosis transmembrane conductance regulator (CFTR). This protein, normally produced in a number of tissues throughout the body, regulates the movement of salt and water in and out of these cells. One hallmark of CF is the presence of a thick mucus secretion that clogs the bronchial tubes in the lungs and plugs the exit passages from pancreas and intestines, leading to loss of function of these organs and resulting in a predisposition toward chronic bacterial infections.

Pseudomonas aeruginosa, having a propensity to live in warm, wet environments, is a particular problem for CF patients, whose lungs typically become colonized (inhabited long-term) by P. aeruginosa before their lOth birthday. Although antibiotics can decrease the frequency and duration of these attacks, resistant bacteria are quick to develop and the bacteria are never completely eradicated from the lung. More effective antibiotics are necessary for improving lung function and quality of life for CF patients for extended time periods.

[0006] Pseudomonas aeruginosa is notorious for its resistance to antibiotics and is, therefore, a particularly dangerous and dreaded pathogen. Todor, K. 2000 Pseudomonas aeruginosa, University of Wisconsin-Madison, http://www. bact. wisc. edu/microtextbook/disease/ pseudomonas. html, available on April 25,2001. The permeability barrier afforded by its outer membrane LPS also contributes to its natural antibiotic resistance, as do the presence of two antibiotic resistance plasmids, both R-factors and RTFs, which are commonly transferred between cells by the bacterial processes of transduction and conjugation. Only a few antibiotics are effective against Pseudomonas, including tobramyocin (TOBI; Chiron), fluoroquinolone, gentamicin and imipenem, and even these antibiotics are not effective against all strains.

[0007] Pseudomonas aeruginosa disease generally begins with some alteration or circumvention of normal host defenses and may involve several different virulence determinants. Todor, 2000, supra. The ultimate Pseudomonas infection may be seen as composed of three distinct stages: (1) bacterial attachment and colonization; (2) local invasion; (3) disseminated systemic disease. Particular bacterial determinants of virulence mediate each of these stages and are ultimately responsible for the characteristic syndromes that accompany the disease. For instance, Pseudomonas utilize fimbriae or pili to adhere to the epithelial cells, apparently via binding to specific galactose or mannose or sialic acid receptors on epithelial cells. Fimbrial adherence may be an important step in Pseudomonas keratitis and urinary tract infections, as well as infections of the respiratory tract. Mucoid strains, which produce an a exopolysaccharide (alginate) have an additional or alternative adhesin which attaches to the tracheobronchial mucin (N-acetylglucosamine). Therefore, mucoid strains of P. aeruginosa are commonly seen in lung infections.

[0008] The ability of P. aeruginosa to invade tissues depends upon its resistance to phagocytosis and the host immune defenses, and the extracellular enzymes and toxins that break down physical barriers and otherwise contribute to bacterial invasion.

Todor, 2000, supra. For instance, Pseudomonas elastase cleaves collagen, IgG, IgA, and complement, and also lyses fibronectin to expose receptors for bacterial attachment on the mucosa of the lung. Alkaline protease interferes with fibrin formation and lyses fibrin. Together, elastase and alkaline protease destroy the ground substance of the cornea and other supporting structures composed of fibrin and elastin. Elastase and alkaline protease together are also reported to cause the inactivation of gamma Interferon (IFN) and Tumor Necrosis Factor (TNF).

[0009] P. aeruginosa produces three other soluble proteins involved in invasion, including a cytotoxin (MW 25,000) and two hemolysins. Todor, 2000, supra. The cytotoxin is a pore-forming protein originally named leukocidin because of its effect on neutrophils, but it appears to be cytotoxic for most eukaryotic cells. Of the two hemolysins, one is a phospholipase and the other is a lecithinase. They appear to act synergistically to break down lipids and lecithin. The cytotoxin and hemolysins contribute to invasion through their cytotoxic effects on eukaryotic cells.

[0010] Pseudomonas aeruginosa also produces two extracellular protein toxins, Exoenzyme S and Exotoxin A. Exoenzyme S may act to impair the function of phagocytic cells in the bloodstream and internal organs to prepare for invasion by P. aeruginosa, and is typically produced by bacteria growing in burned tissue. Exotoxin A is partially identical to diphtheria toxin, and exhibits a necrotizing activity at the site of bacterial colonization and is thereby thought to contribute to the colonization process. Indirect evidence involving the role of exotoxin A in disease is seen in the increased chance of survival in patients with Pseudomonas septicemia that is correlated with the titer of anti-exotoxin A antibodies in the serum.

[0011] While therapeutic measures aimed at any of the above virulence factors may help to slow the progression of an infection and may be useful in combined therapeutic regimens, given the variety of virulence factors of P. aeruginosa, antibacterial agents that inhibit growing bacteria by interacting with essential genes and essential gene products are necessary. Although, this is not to say that genes encoding virulence factors would not be essential to survival in particular niches or environments, emphasizing the importance of screening for gene essentiality in various pathogenic environments. See, e. g., Coulter et al., 1998, Staphylococcus aureus genetic loci impacting growth and survival in multiple infection environments, Mol. Microbiol.

30 (2): 393-404. However, as P. aeruginosa becomes more and more resistant to existing antibacterial agents, new compounds are required.

[0012] Indeed, reports of bacterial strains resistant to the most powerful known antibiotics are becoming more common, signaling that new antibiotics are needed for all bacteria, not only P. aeruginosa. For instance, the United States Center for Disease Control recently announced that one of the most powerful known antibiotics, vancomycin, was unable to treat an infection of Staphylococcus aureus (staph), an organism commonly found in the environment and responsible for many nosocomial infections. If this trend continues, some have warned that we could return to a time when a common bacterial infection is a life threatening matter. See Zyskind et al. , WO 00/44906, published August 3,2000.

[0013] Historically, however, the identification of new antibacterial drugs has been painstaking and laborious with no guarantee of success. Traditional methods involve blindly and randomly testing potential drug candidate molecules, with the hopes that one might be effective. Today, the average cost to discover and develop a new drug is nearly $500 million, and the average time is 15 years from laboratory to patient. New identification and screening methods that shorten and improve this process are much needed.

[0014] A newly emerging technique for identifying new antibacterial agents is to first identify gene sequences and proteins required for the proliferation of bacteria, or "essential"genes and proteins, and then conduct a biochemical and structural analysis of that target gene or protein in order to derive compounds that interact with the target.

Such methodology employs molecular modeling techniques, combinatorial chemistry and other means to design candidate drugs, and offers a more directed alternative to merely screening random compounds with the hope that one might be suitable for a particular bacterium.

[0015] Nevertheless, even this preferred approach presents obstacles including the identification of essential genes and proteins, and the design of new assays for the genes thus identified in order to efficiently screen candidate compounds. Several groups have proposed systems for the identification of essential genes. For instance, Zyskind and colleagues propose a method of identifying essential genes in Escherichia coli by subcloning a library of E. coli nucleic acid sequences into an inducible expression vector, introducing the vectors into a population of E. coli cells, isolating those vectors that, upon activation and expression, negatively impact the growth of the E. coli cell, and characterizing the nucleic acid sequences and open reading frames contained on the subclones identified. See WO 00/44906, herein incorporated by reference. The disadvantage of this method is that the overexpression of nonessential genes can also negatively impact the cell, particularly the overexpression of membrane proteins and sugar transport proteins that are not necessary for growth where alternative carbon sources exist. Such proteins typically become trapped in membrane export systems when the cell is overloaded, and would be identified by this methodology. See Muller, FEMS Microbiol. Lett. 1999 Jul 1; 176 (1) : 219-27.

[0016] Another group proposes the identification of growth conditional mutants, and more specifically temperature sensitive (ts) mutants, as a means to identify essential genes in Staphylococcus aureus. See Benton et al. , U. S. Patent 6,037, 123, issued March 14,2000, herein incorporated by reference. Each gene is identified by isolating recombinant bacteria derived from growth conditional mutant strains, i. e. , following introduction of a vector containing a library of nucleic acid sequences, which would grow under non-permissive conditions but which were not revertants. These recombinant bacteria were found to contain DNA inserts that encoded wild type gene products that replaced the function of the mutated gene under non-permissive growth conditions. By this method, Benton and colleagues were able to identify 38 loci on the S aureus chromosome, each consisting of at least one essential gene.

[00171 The disadvantages of this method are first, the chemical employed to induce mutagenesis (diethyl sulfate, DES) is capable of causing several mutations in the same cell, thereby complicating interpretation of the results. Second, the method is particularly labor intensive in that one must painstakingly analyze replica plates of individual colonies grown at permissive and non-permissive temperatures, where replica plates include both mutant and non-mutant cells. Thus, employing the appropriate level of mutagen to achieve a balance between minimizing the number of non-mutant colonies one must screen in order to identify one mutant, while at the same time avoiding multiple mutations in the same cell, may be an arduous task.

[0018] Another group has proposed a transposon mutagenesis system for identifying essential genes called"GAMBIT" ("genomic analysis and mapping by in vitro transposition"), and has used the system to identify essential genes first in the gram positive bacteria Haemophilus influenzae and Streptococcuspneumoniae, and more recently in Pseudomonas aeruginosa. See Akerley et al., Systematic identification of essential genes by In vitro mariner mutagenesis, Proc. Natl. Acad. Sci USA 95 (15): 8927-32; Wong and Mekalanos, 2000, Proc. Natl. Acad. Sci. USA 97 (18): 10191-96 ; and Mekalanos et al. , U. S. Patent No. 6,207, 384, issued March 27, 2001, herein incorporated by reference. GAMBIT involves first isolating and purifying specific genomic segments of approximately 10 kilobases using extended-length PCR, and creating a high density transposon insertion map of the isolated region using Himarl transposon mutagenesis. The transposon insertions are then transferred to the chromosome following transformation of the bacteria with the transposon containing vectors, and selection for the antibiotic resistance marker on the transposon. The position of each transposon insertion with respect to a given PCR primer is then determined by genetic footprinting, i. e. , by amplifying sub-PCR products using one of the original PCR primers and a primer that recognizes an internal site in the Himarl transposon. By analyzing the length of PCR fragments thus identified, it is possible to identify regions that are devoid of transposon insertions, thereby signaling regions that might contain essential genes.

[0019] While the GAMBIT method is a good technique for looking at a small region of the genome for essential genes, it would be extremely labor intensive to use this method for analyzing the entire genome. This is particularly true for P. aeruginosa, whose genome (-6 megabases) is about 70% greater in size than the H. influenzae genome (-1. 8 megabases). Furthermore, GAMBIT would not be readily applicable to use in organisms that are less recombinogenic than H. influenzae. Indeed, while the H. influenzae genome contains about 1700 protein coding genes, P. aeruginosa contains about 5570. According to U. S. Patent 6,207, 384, one would need to clone and mutagenize the 6 million base pair genome of P. aeruginosa in 10,000 base pair fragments, isolating and characterizing 400-800 mutants per 10,000 base pair fragment.

Generating 6 X 105 mutants and characterizing them via PCR on gels would require a significant investment of labor, materials and time.

[0020] Another group at Abbott Laboratories has proposed a genome scanning method for identification of putative essential genes in H. influenzae, whereby random transposon insertions are mapped and analyzed to identify open reading frames containing no insertion in order to identify putative essential genes. Reich et al. , 1999, Genome Scanning in Haemophilus influenzae for Identification of Essential Genes, J.

Bacteriol. 181 (16): 4961-68. However, even though transposon insertions were isolated that spanned the whole genome, the authors employed a genomic footprinting technique similar to that used in GAMBIT to map insertions in a short contiguous region of the chromosome. The method further employs the methods of mutation exclusion and zero time analysis in order to monitor the fate of individual insertions after transformation in growing culture, which looks at individual insertions on a case- by-case basis. Again, such techniques would be extremely labor-intensive for the P. aeruginosa genome, which is 70% larger than the genome of H. influenzae.

[0021] Wong and Mekalanos also proposed identifying essential genes in P. aeruginosa by starting with the knowledge of three essential genes in H. influenzae and using genetic footprint analysis to determine if the homologues of these genes are essential in P. aeruginosa. Of three homologues tested, only one was unable to accommodate a transposon insertion. See Wong and Mekalanos, supra. Such results underscore the fact that a gene that is shown to be essential in one species will not necessarily be essential in another, given that some gene products may fulfill different functional roles in different species. Furthermore, given the larger coding capacity of the P. aeruginosa genome relative to that of other bacteria, it would not be surprising for P. aeruginosa to possess an increase in redundant gene functions, thereby decreasing the actual number of essential genes, and making them more difficult to identify.

10022] Another method is entitled Transposon Mediated Differential Hybridisation (TMDH), which is disclosed in WO 01/07651, herein incorporated by reference. This method entails (i) providing a library of transposon mutants of the target organism; (ii) isolating polynucleotide sequences from the library which flank inserted transposons; (iii) hybridising said polynucleotide sequences with a polynucleotide library from said organism; and (iv) identifying a polynucleotide in the polynucleotide library to which said polynucleotide sequences do not hybridise in order to identify an essential gene of the organism. However, the problem with this methodology is that it has a high propensity to lead to false positives, and many essential genes will be missed.

Furthermore, the method does not yield any detailed information regarding the loci disrupted by transposons, or whether they were hit more than once.

[0023] Thus, there is a great need for more efficient methods to identify essential genes, particularly in P. aeruginosa, so that new antibacterial agents may be designed therefrom for use in treatment of P. aeruginosa infections.

Summary of Invention [0024] The present inventors have devised a database of potential essential or otherwise important genes in P. aeruginosa, which may be used to verify essentiality and design antibacterial agents active against the targets thus identified. In particular, the inventors have isolated and mapped a library of at least about 5,000 to at least about 14,000 transposon insertions in the genome of P. aeruginosa, and more preferably a library of at least about 8000 to at least about 14,000 transposon insertions, and even more preferably a library of at least about 10,000 to at least about 14,000 transposon insertions, using the recently published P. aeruginosa gene sequence. The map thus generated was used to form a database of approximately 1500 to 3000 open reading frames, or more preferably about 1500 to 2000 open reading frames, for which no transposon insertions could be obtained, each of which possibly represents an essential gene required for growth and proliferation of P. aeruginosa on rich media, or an important gene, the mutation of which results in an attenuated growth mutant. Also disclosed is a Bayessian statistical model that may be utilized to increase the statistical confidence that any given gene identified using the disclosed methodology is essential.

[0025] Thus, one aspect of the invention is a database of putative essential or otherwise important genes, defined by the absence of transposon insertions in those genes in a High Throughput Transposon Insertion Map (HTTIM) database comprising about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa. Minimally, such a database comprises approximately 1800 open reading frames (ORFs), each of which may be further tested for essentiality using a variety of tests disclosed herein. However, predictions of essentiality or importance may be bolstered based on length of the ORF and predicted function and other statistical factors, thereby providing for more narrow databases of putative essential genes. Thus, the invention also includes databases that are more narrow and comprise only those genes for which essentiality or importance may be predicted with at least an 80% confidence level, and include at least about 850 to about 875 genes. The invention also includes databases assigned a confidence level of about 85% and including at least about 675 to about 700 genes. The invention further includes databases assigned a confidence level of about 90% including at least about 475 to about 500 genes.

Further, the invention includes databases assigned a confidence level of about 95% and including at least about 200 to 250 genes.

[0026] The transposon insertion map and database of putative essential or otherwise important open reading frames (ORFs) obtained may be used to confirm the essentiality or importance of genes, for example by integration knock outs in the presence of chromosomal complementation or by integration and activation of a regulatable promoter. An"essential"gene is one that cannot be"knocked out, "i. e. for which null mutants having complete absence of the gene product are not viable. This does not mean, however, that such genes could not tolerate point mutations or truncations that preserve sufficient gene product function so as to enable cell growth and survival.

Essential genes are to be distinguished from"important"genes, which are also included in the present invention, in that a"knock out"of an important gene does not lead to cell death but rather results in an attenuated growth mutant. Such genes may be included in the database of open reading frames not hit by random transposon mutagenesis as described herein, because attenuated growth colonies may be significantly smaller than the average P. aeruginosa colony and may have been overlooked when transposon insertion mutants were picked to generate the high throughput transposon insertion database (HTTIM).

[0027] Nevertheless, important gene products may interact with or regulate other genes, gene products or cellular processes that are essential, thereby making such gene products appropriate targets for drug design. Moreover, most drugs don't effectively kill all the pathogenic bacteria in the body ; rather, they kill or growth attenuate a portion of the bacteria, empowering the immune system to target the remainder.

Hence, important genes that, when targeted with an antibacterial agent, result in attenuated growth, are also targets for the antibacterial drugs of the present invention.

[0028] The invention also includes a database of attenuated growth mutants identified from the HTTIM transposon database. The genes marked by such mutations are of the same class of importance as the"important"genes identified in the no-hit database of genes, except that the growth attenuated nature of such transposon mutants was discovered at the transposon mutagenesis stage, rather than at the stage where essentiality is tested via targeted knock out. Thus, genes that when mutated confer attenuated growth may be identified from two sources: (1) from the library of open reading frames that did not receive a transposon insertion during HTTIM but were subsequently identified as an important gene when essentiality was tested via knock out and/or promoter swap strategies, and (2) from the HTTIM database itself when in the process of accumulating transposon insertion mutants it was observed that a particular insertion conferred an attenuated growth phenotype.

[0029] Such attenuated mutants grow more slowly than wild type, and may grow more slowly due to reduced expression of an essential gene, i. e. , transposon is in gene that regulates expression of an essential gene, or due to expression of a truncated form of an essential gene, i. e. , transposon is in the essential gene itself and leads to expression of a truncated mRNA. For example, mutants that show a higher drug susceptibility could be the result of insertions in a gene that potentiates resistance, such an efflux pump, or due to reduced expression of essential genes involved in the mechanism of action of the drug. Expression of mutated forms of essential and important genes may make the cell more susceptible to compounds that inhibit that particular gene or gene product, and may allow the identification of antibacterial agents with greater sensitivity. Furthermore, screening in whole cells overcomes the potential problems of uptake and efflux that are sometimes an issue for compounds identified via enzyme-based assays.

[0030] The essential and important genes of the invention may be used to design, screen for and evaluate potential antibacterial agents for the purpose of developing new treatments for P. aeruginosa infection. Antibacterial agents identified according to the invention may have activity against the gene or against the corresponding gene product or metabolic pathways requiring the gene product. For instance, antibacterial agents according to the invention may include antisense nucleic acids or regulatory proteins that bind to open reading frames, to upstream polar sequences or to promoters that drive expression of the genes encoded by such open reading frames. Active agents according to the invention may also include antibodies or proteins that bind to proteins encoded by open reading frames, or to transcriptional or translational regulators of such genes or proteins, or to binding partners of such proteins. Agents may also be chemical compounds designed following molecular modeling of essential gene products according to the invention, or mutant proteins designed therefrom that compete with the essential wild type protein for reactive cell components or for interacting nutrients, as well as agents from random chemical.

[0031] The present invention therefore includes methods and assays for identifying antibacterial agents having specificity for the essential or important open reading frames identified, or to genes and proteins that interact with such open reading frames or the products encoded thereby. Once essential and important open reading frames are identified, antibacterial agents may be identified using the assays and methods described herein, or by any suitable assay. Such assays may vary depending on the function delineated for each essential locus, as would be apparent to those of skill in the art. For instance, enzyme assays may be designed based on the predicted function of essential and important genes in order to define classes of inhibitors to be tested. Also, random chemical libraries may be screened for activity against the isolated genes or gene products. Cell lines may be designed or isolated that demonstrate reduced expression of essential genes, thereby providing a sensitive screening tool for inhibitors that effect the activity of that gene or gene product as it functions in the cell. Such cell lines may be devised from cells having transposon insertions that lead to attenuated growth, or may be constructed by the promoter swap techniques described herein, by using a regulatable promoter that can be used to increase gene expression, allowing for confirmation of target specificity. Here, the minimal inhibitory concentration of the inhibitor is directly related to the expression level of the target gene, such that under low expression, an attenuated growth cell is more susceptible to an inhibitor than the wild type strain, and as you raise the expression level, the minimum inhibitory concentration (MIC) increases. The MIC shift will be consistent when the inhibitor acts on the regulated target.

[0032] Active agents and compounds can be formulated into pharmaceutical compounds and compositions, effective for treating and preventing Pseudomonas infections in accordance with the methods of the invention. Such therapy will be particularly useful in the hospital setting for preventing and treating nosocomial infections, and for administering to cystic fibrosis patients to improve lung function and quality of life. Depending on the activity of the essential or important gene targeted, such agents could also be useful in treating all types of Pseudomonas infections ranging from bacteraemia and septicemia, urinary-tract infections, pneumonia and chronic lung infections, burn infections, cancer, AIDS, endocarditis, dermatitis, osteochondritis, ear and eye infections, bone and joint infections, gastrointestinal infections and skin and soft tissue infections, including wound infections, pyoderma and dermatitis. Further, the invention provides pharmaceutical compositions appropriate for use in methods of treating bacterial infections described above.

Brief Description of the Drawings [0033] Figure 1. Depiction of a single crossover recombination event resulting in integration of a plasmid into the bacterial chromosome. Isolation of such recombinants indicates that the targeted gene is not essential.

[0034] Figure 2. Single crossover and integration of a plasmid resulting in the replacement of a wild type promoter with a regulatable promoter.

[0035] Figure 3. Depiction of the'promoter swap'strategy, using transformation of pBEMlO into P. aeruginosa in order to replace the IpxC promoter with the arabinose araBAD promoter, thereby allowing modulation of its lpxC expression by the use of a simple sugar, arabinose.

[0036] Figure 4. Graph showing the susceptibility or non-susceptibility of various E. coli and P. aeruginosa strains to the inhibitor L161, 240.

[0037] Figure 5. Graph depicting the effect of tetracycline and L161, 240 on the growth of P. aeruginosa strain PA01 with and without polymixin permeabilization.

[0038] Figure 6. Sensitivity of various E. coli and P. aeruginosa strains to inhibitor L161, 240 following promoter swap and transformation with vector expressing E. coli LpxC or P. aeruginosa lpxC. E. coli"swaps"refer to P. aeruginosa containing a vector comprising E. coli lpxC, and"PA swaps"refer to P. aeruginosa containing a vector comprising P. aeruginosa lpxC.

[0039] Figure 7. Graph illustrating ORF coverage by Tn5 achieved in High- Throughput Transposon Insertion Mapping (HTTIM), wherein 30% of the genes in the genome are candidate essential genes where ORF size is not taken into account in predicting essentiality.

[0040] Figure 8. Graph depicting the probability of identifying an essential gene given no transposon insertion, as a function of gene size.

[0041] Figure 9. A circular map of the P. aeruginosa genome showing distribution of transposon insertion sites constituting a HTTIM of the invention, and demonstrating the random nature of the transposon employed. The length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non- overlapping kilobase.

[0042] Figure 10. Histogram depicting the number of ORFs in the P. aeruginosa genome of (a) up to 4000 base pairs and (b) from 4000 up to 16884 base pairs.

[0043] Figure 11. Graph showing likelihood and accumulative likelihood gains.

[0044] Figure 12. Trajectory of the algorithm projected in a subspace spanned by two gene sizes. The x-axis represents genes of sizes 151-160 DNA base-pairs and y-axis represents genes of sizes 171-180 DNA base-pairs. Here n= (2, 1) and M= (7,9). The median gene size of each group is used as the gene size. At iteration number 66, the likelihood gain is maximum in the direction of increasing the number of nonessential genes by one for genes with size 171-180 DNA base-pairs. At iteration number 443, the largest likelihood gain is obtained in the direction of increasing one nonessential genes for genes of sizes 151-160 DNA base pair. At any point, moving backwards has a negative likelihood gain.

[0045] Figure 13. More trajectories of the searching algorithm projected in different subspaces.

[0046] Figure 14. Plot of likelihood for different initial values.

[0047] Figure 15. Trajectories of the algorithm with different starting values projected in the subspace spanned by two gene sizes: 1101-1150 DNA base-pairs for X-axis and 921-930 DNA base-pairs for y-axis.

[0048] Figure 16. Top: (A) The top line is M, number of genes, the bottom line is ñ, the number of genes with at least one observed insertion; the line in the middle is N, the number of estimated nonessential genes. For demonstration purpose, a cubic spline smooth is applied to the data. Bottom: Histogram of resamples of r (B) and (C).

[0049] Figure 17. Plot of RIM,. The doted line is the value of lv ; M ; and the solid line is a moving average smooth.

[0050] The essential and important open reading frames identified in the present invention were originally part of a library of putative nucleic acid sequences generated from P. aeruginosa strains PA01 and PAK. See Table 1. Nevertheless, it is expected that the genes identified will also be essential or important in related P. aeruginosa strains as well as other Pseudomonas species, given the low sequence diversity that exists between P. aeruginosa strains of widely diverse environments and the pronounced structural and functional homology of gene products. See, e. g., Spangenberg et al. , 1998, Structural and functional implications of sequence diversity of Pseudomonas aeruginosa genes oriT, ampC andfliC, Electrophoresis 19 (4): 545-50; Ruimy et al., 2001, Genetic diversity of Pseudomonas aeruginosa strains isolated from ventilated patients with nosocomial pneumonia, cancer patients, bacteremia, and environmental water, Infect. Immun. 69 (1) : 584-8. For instance, comparative sequencing of several P. aeruginosa genes from several environmental and clinical isolates revealed the sequence diversity to be about one order of magnitude lower than in comparable housekeeping genes from Salmonella. See Kiewitz and Tummler, 2000, Sequence diversity of Pseudomonas aeruginosa : impact on population structure and genome evolution, J. Bacteriol. 182 (11): 3125-35. Thus, it is expected that agents identified as antibacterial based on their interaction with genes or gene products of P. aeruginosa PA01 or PAK will be broadly applicable as antibacterial agents against a variety of Pseudomonas species as well as other bacteria including but not limited to Escherichia, Hemophilus, Vibrio, Borrelia, Enterococcus, Heliobacter, Legionella, Mycobacterium, Mycoplasma, Neisseria, Staphylococcus, Streptococcus, etc.

[0051] Thus, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. Even more preferably, the present invention encompasses an isolated nucleic acid molecule comprising a nucleic acid sequence encoding a polypeptide having at least about 90 to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.

[0052] In particular, the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration knock-out coupled with extra-chromosomal complementation. Likewise, the invention encompasses isolated nucleic acid molecules comprising nucleic acid sequences encoding polypeptides having at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.

[0053] In one embodiment, the polynucleotides of the invention are recombinant.

Recombinant polynucleotides of the invention include proteins of genomic, cDNA, semisynthetic, or synthetic origin, which, by virtue of its origin or manipulation (1) is not associated with all or a portion of a polynucleotide with which it is associated in nature; (2) is linked to a polynucleotide other than that to which it is linked in nature; or (3) does not occur in nature.

[0054] Given that the library of nucleic acid sequences encompassed in Table 1 provides an unprecedented tool useful for the identification of essential and otherwise important genes in Pseudonsonas and the construction and isolation of attentuated mutants, the present invention includes a library of nucleic acid sequences consisting essentially of nucleic acid sequences having at least 70% sequence identity, or more preferably at least about 80 to 90 to 95% identity, to a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein said library of nucleic acid sequences is employed to identify essential or otherwise important genes or to construct or isolate attenuated mutants in Pseudomonas.

[0055] Also encompassed in the invention is a map of at least about 10,000 to about 14,000 transposon insertions in the genome of Pseudomonas aeruginosa (High- Throughput Transposon Insertion Database or HTTIM), wherein said map is useful for identifying genes that are essential or important for survival of said Pseudomonas aeruginosa, i. e. , by permitting the generation of a database of open reading frames that do not contain a transposon insertion. Figure 9 contains a circular map of the P. aeruginosa genome depicting 12,000 to 13,000 transposon insertion sites constituting a HTTIM of the invention, and demonstrates the random nature of the transposon employed. The length of the bars radiating outward from the center of the circular map reflect the number of transposon insertions per non-overlapping kilobase. Table 3 contains a list of 13,515 specific Tn5 transposon insertion sites generated in either PAK or PA01, with the 473 mutants 12516-13043 being identified as attenuated for growth.

[0056] Thus, the databases and libraries disclosed herein may be used to formulate useful subsets of these libraries and databases. Accordingly, the invention includes subsets of the databases and libraries disclosed. For instance, mutants 12516-13043 are identified as attenuated for growth and as such, the genes in this subset could be useful drug targets. Accordingly, this group of 473 mutants from the HTTIM database of 13,515 transposon hits provides a useful subset database for comparing homologies with essential genes of other organisms, for computer modeling of potential antibacterial agents, etc. A particularly useful database subset is one containing essential genes from P. aeruginosa that are also identified as essential in other Gram negative or Gram positive bacteria. Indeed, genes that have essential homologs in other bugs are likely to provide useful targets for broad spectrum antibacterial agents, i. e., agents that have broad spectrum activity as an antibacterial agent. Genes in the putative essential or important gene database have already been identified via BLAST or other database analyses, and constitute an exemplary subset database of the present invention. See Table 4.

[0057] Further, the databases and subset databases of the present invention may also be used as comparative tools with other like databases or database subsets to identify broad spectrum. For instance, particularly envisioned is an embodiment wherein the database of putative essential and important genes identified in P. aeruginosa is cross- referenced with a similar database formed from S. aureus, wherein homologues present in both databases signal a potential target for a broad spectrum antibacterial agent.

Cross-referencing between P. åeruginosa and S. aureus in particular will identify antibacterial targets for identifying broad spectrum antibiotics active against both Gram negative and Gram positive bacteria. However, databases derived from any bacteria could be employed in such comparisons, as well as databases formed from yeast, fungi, mycoplasma, and other potential pathogens.

[0058] Also encompassed in the invention is the use of essential and important genes and the corresponding proteins expressed thereto in the design of vaccines for eliciting prophylactic or therapeutic immune responses against Pseudomonas aeruginosa.

[0059] Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or variant thereof encoded by an essential gene. Additionally, such antigens will preferably be a protein expressed on the surface of the bacteria.

[0060] Such vaccines will typically comprise a Pseudomonas aeruginosa protein antigen or fragment or derivative thereof encoded by an essential or important gene.

Preferably, the protein antigen expressed from a recombinant polynucleotide.

[0061] Where the invention is directed to a fragment of a protein encoded by an essential or important gene, said fragment is preferably at least 8 to 12 amino acids long, and even more preferably at least about 20 to 30 amino acids long. Preferably, the fragment comprises either a B cell or a T cell epitope.

[0062] Where the invention is directed to a derivative of a protein encoded by an essential or important gene, said derivative contains one or more amino acid substitutions, additions or deletions. Preferably, the amino acid substitutions are conservative amino acid replacements. Conservative amino acid replacements are those that take place within a family of amino acids that are related in their side chains.

Genetically encoded amino acids are generally divided into four families: (1) acidic = aspartate, glutamate; (2) basic = lysine, arginine, histidine ; (3) non-polar = alanine, valine, leucine, isoleucine, proline, phenylalanine, methionine, tryptophan; and (4) uncharged polar = glycine, asparagine, glutamine, cystine, serine, threonine, tyrosine.

Phenylalanine, tryptophan, and tyrosine are sometimes classified jointly as aromatic amino acids. For example, it is reasonably predictable that an isolated replacement of a leucine with an isoleucine or valine, an asparate with glutamate, a threonine with a serine, or a similar conservative replacement of an amino acid with a structurally related amino acid will not have a major effect on the biological activity. Polypeptide molecules having substantially the same amino acid sequence as the protein by possessing minor amino acid substitutions that do not substantially affect the functional aspects are encompassed with the scope of derivatives of the proteins of the invention.

[0063] The polypeptide fragment or derivative is preferably immunologically identifiable with the polypeptide encoded by the essential or important gene. The polypeptide fragment or derivative is preferably immunogenic and is able to cause a humoral and/or cellular immune response, either alone or when linked to a carrier, in the presence or absence of an adjuvant. The polypeptide fragment or derivative may be fused to or incorporated into another polypeptide sequence. This other polypeptide sequence may include one or more other proteins, fragments or derivatives thereof encoded by an essential or important gene. The other polypeptide sequence may also include a polypeptide sequence which allows for presentation of the polypeptide fragment or derivative.

[0064] Accordingly, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least 80% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. More preferably, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 85 to 90% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1. Even more preferably, the present invention encompasses an isolated polypeptide and fragments and derivatives thereof, wherein said polypeptide has at least about 90% to about 95% sequence identity to a polypeptide encoded by a nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1.

[0065] In particular, the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identity, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential or important nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein the essentiality or importance of said nucleic acid sequence is determined by integration knock-out couple with extra-chromosomal complementation. Likewise, the invention encompasses isolated polypeptides and fragments and derivatives thereof, wherein said polypeptides have at least 80% sequence identify, or more preferably at least about 85 to 90 to 95% identity, to a polypeptide encoded by an essential nucleic acid sequence selected from the group consisting of the Pseudomonas aeruginosa open reading frames (ORFs) listed in Table 1, wherein essentiality or importance of said nucleic acid sequence is determined by integration of a regulatable promoter into the gene, or via any other suitable method.

[0066] Also encompassed in the invention are therapeutic and prophylactic vaccines that comprise ligands that specifically bind antigens encoded by essential or important genes identified according to the invention, for use in, for instance, passive immunization. Preferred ligands are antibodies and antibody fragments that specifically bind the antigen encoded by the essential gene. Such antibodies may be polyclonal or monoclonal. Types of antibodies and antibody fragments include by way of examples murine antibodies, chimeric, antibodies, humanized antibodies, Fab fragments, Fab2 fragments and human antibodies and scFv's. Methods for producing antibodies and antibody fragments by recombinant and non-recombinant methods are well known to those skilled in the art. In some embodiments the antigen used in such passive immunization may be attached to a cytotoxic moiety, e. g. , a radionuclide or other agent that is cytotoxic against the bacteria.

[0067] Further encompassed within the scope of the invention are cells or viral vectors that express on their surface a Pseudomonas aeruginosa essential gene, fragment or variant identified according to the invention.

[0068] In the case of prophylactic vaccines, the vaccine will comprise an immunogenic composition comprising a prophylactically effective amount of an antigen, antibody, cells or vector expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a protective immune response. In the case of therapeutic vaccines, the vaccine will comprise an immunogenic composition comprising a therapeutically effective amount of an antigen, antibody, cells or vectors expressing an antigen encoded by an essential or important gene and will be formulated such that upon administration it elicits a therapeutic immune response. Dosage effective amounts of prophylactic and therapeutic vaccines will be determined by known methods and will typically vary from about 0.00001 g/kg body weight to about 5-10 g/kg body weight.

[0069] The immunogenic compositions of the invention can be administered by known methods, i. e. , mucosally or parenterally.

[0070] Suitable routes of mucosal administration include oral, intranasal (IN), intragastric, pulmonary, intestinal, rectal, ocular, and vaginal routes. Preferably, mucosal administration is oral or intranasal.

[0071] Where mucosal administration is used, the immunogenic composition is preferably adapted for mucosal administration. For instance, where the composition is administered orally, it may be in the form of tablets or capsules (optionally enteric- coated), liquid, transgenic plants, etc. Where the composition is administered intranasally, it may be in the form of a nasal spray, nasal drops, gel or powder. Where the antigen composition is adapted for mucosal administration, it may further be formulated such that the antigen remains stable, for instance by the use of carriers and excipients.

[0072] The immunogenic compositions of the invention can further comprise a mucosal adjuvant. Mucosal adjuvants suitable for use in the invention include (a) E. coli heat-labile enterotoxin ("LT"), or detoxified mutants thereof, such as the K63 or R72 mutants; (B) cholera toxin ("CT"), or detoxified mutants thereof; or (C) microparticles (i. e., aparticle of slOOnm to ~15011m in diameter, more preferably ~200nm to ~3011m in diameter, and most preferably ~500nm to ~1011m in diameter) formed from materials that are biodegradable and non-toxic (e. g. a poly (a-hydroxy acid), a polyhydroxybutyric acid, a polyorthoester, a polyanhydride, a polycaprolactone etc.) ; (D) a polyoxyethylene ether or a polyoxyethylene ester (see International patent application WO 99/52549); (E) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (see International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (see International patent application WO 01/21152) ; (F) chitosan (e. g. International patent application WO 99/27960) and (G) an immunostimulatory oligonucleotide (e. g. a CpG oligonucleotide) and a saponin (see International patent application WO 00/62800). Other mucosal adjuvants are also available (e. g. see chapter 7 of Vaccine design: the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X).

[0073] Mutants of LT are preferred mucosal adjuvants, in particular the"K63"and "R72"mutants (e. g. see International patent application WO 98/18928), as these result in an enhanced immune response.

[0073] Microparticles are also preferred mucosal adjuvants. These are preferably derived from a poly (a-hydroxy acid), in particular, from a poly (lactide) ("PLA"), a copolymer of D, L-lactide and glycolide or glycolic acid, such as a poly (D, L-lactide-co- glycolide) ("PLG"or"PLGA"), or a copolymer of D, L-lactide and caprolactone. The microparticles may be derived from any of various polymeric starting materials which have a variety of molecular weights and, in the case of the copolymers such as PLG, a variety of lactide: glycolide ratios, the selection of which will be largely a matter of choice, depending in part on the coadministered antigen.

[0074] Antigen may be entrapped within the microparticles, or may be adsorbed to them.

[0075] Entrapment within PLG microparticles is preferred. PLG microparticles are discussed in further detail in Morris et al. , (1994), Vaccine, 12: 5-11, in chapter 13 of Mucosal Vaccines, eds. Kiyono et al., Academic Press 1996 (ISBN 012410587), and in chapters 16 & 18 of Vaccine design : the sgbunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X).

[0076] LT mutants may advantageously be used in combination with microparticle- entrapped antigen, resulting in significantly enhanced immune responses.

[0077] Suitable routes of parenteral administration include intramuscular (IM), subcutaneous, intravenous, intraperitoneal, intradermal, transcutaneous, and transdermal (see e. g., International patent application WO 98/20734) routes, as well as delivery to the interstitial space of a tissue.

[0078] The immunogenic compositions of the invention may be adapted for parenteral administration (e. g. , in the form of an injectable, which will typically be sterile and pyrogen-free).

[0079] The immunogenic composition may further comprise a parenteral adjuvant.

Parenteral adjuvants suitable for use in the invention include: (A) aluminum compounds (e. g. aluminum hydroxide, aluminum phosphate, aluminum hydroxyphosphate, oxyhydroxide, orthophosphate, sulfate etc. (e. g. see chapters 8 & 9 of Vaccine design : the subunit and adjuvant aproach, eds. Powell & Newman, Plenum Press 1995 (ISBN 0-306-44867-X) (hereinafter"Yaccine design"), or mixtures of different aluminum compounds, with the compounds taking any suitable form (e. g. gel, crystalline, amorphous etc.), and with adsorption being preferred; (B) MF59 (5% Squalene, 0. 5% Tween 80, and 0. 5% Span 85, formulated into submicron particles using a microfluidizer) (see Chapter 10 of Vaccine design ; see also International patent application WO 90/14837); (C) liposomes (see Chapters 13 and 14 of Vaccine design), (D) ISCOMs (see Chapter 23 of Vaccine design) ; (E) SAF, containing 10% Squalane, 0.4% Tween 80, 5% pluronic-block polymer L121, and thr-MDP, either microfluidized into a submicron emulsion or vortexed to generate a larger particle size emulsion (see Chapter 12 of Vaccine design) ; (F) RibiTM adjuvant system (RAS), (Ribi Immunochem) containing 2% Squalene, 0.2% Tween 80, and one or more bacterial cell wall components from the group consisting of monophosphorylipid A (MPL), trehalose dimycolate (TDM), and cell wall skeleton (CWS), preferably MPL + CWS (DetoxTM) ; (G) saponin adjuvants, such as QuilA or QS21 (see Chapter 22 of Vaccine design), also known as Stimulodrm ; (H) ISCOMs, which may be devoid of additional detergent (International patent application WO 00/07621); (1) complete Freund's adjuvant (CFA) and incomplete Freund's adjuvant (IFA); (J) cytokines, such as interleukins (e. g. IL-1, IL-2, IL-4, IL-5, IL-6, IL-7, IL-12, etc.), interferons (e. g. interferon-y), macrophage colony stimulating factor, tumor necrosis factor, etc. (see Chapters 27 & 28 of Vaccine design) ; (K) microparticles (see above); (L) monophosphoryl lipid A (MPL) or 3-O- deacylated MPL (3dMPL) (e. g. chapter 21 of Vaccine design) ; (M) combinations of 3dMPL with, for example, QS21 and/or oil-in-water emulsions (European patent applications 0835318,0735898 and 0761231); (N) oligonucleotides comprising CpG motifs (see Krieg (2000) Vaccine, 19: 618-622; Krieg (2001) Curr. Opin. Mol. Ther., 2001,3 : 15-24; WO 96/02555, WO 98/16247, WO 98/18810, WO 98/40100, WO 98/55495, WO 98/37919 and WO 98/52581, etc. ) i. e. containing at least one CG dinucleotide, with 5-methylcytosine optionally being used in place of cytosine ; (O) a polyoxyethylene ether or a polyoxyethylene ester (International patent application WO 99/52549); (P) a polyoxyethylene sorbitan ester surfactant in combination with an octoxynol (International patent application WO 01/21207) or a polyoxyethylene alkyl ether or ester surfactant in combination with at least one additional non-ionic surfactant such as an octoxynol (International patent application WO 01/21152) ; (Q) an immunostimulatory oligonucleotide (e. g. a CpG oligonucleotide) and a saponin (International patent application WO 00/62800); (R) an immunostimulant and a particle of metal salt (International patent application WO 00/23105); (S) a saponin and an oil- in-water emulsion (International patent application WO 99/11241); (T) a saponin (e. g.

QS21) + 3dMPL + IL-12 (optionally + a sterol) (International patent application WO 98/57659); and (U) other substances that act as immunostimulating agents to enhance the effectiveness of the composition (e. g. see Chapter 7 of Vaccine design).

[0080] Aluminium compounds and MF59 are preferred adjuvants for parenteral use.

[0081] The immunognic compositions of the invention may be administered in a single dose, or as part of an administration regime. The regime may include priming and boosting doses, which may be administered mucosally, parenterally, or various combinations thereof.

[0082] In some instances the vaccines of the invention may comprise several antigens, fragments or variants encoded by essential genes identified according to the invention. Alternatively, the vaccine may further comprise antigens identified by other methods, or specific to other bacteria, e. g. , in order to provide multivalent vaccines.

[0083] With respect to libraries according to the invention, a library of polynucleotides or a library of transposon insertion sites is a collection of sequence information, which information is provided in either biochemical form (e. g. , as a collection of polynucleotide molecules), or in electronic form (e. g. , as a collection of polynucleotide sequences stored in a computer-readable form, as in a computer system and/or as part of a computer program). The sequence information of the polynucleotides can be used in a variety of ways, for instance as a resource for gene discovery, i. e. , for identifying and verifying essential and important genes in P. aeruginosa, or for identifying essential or important homologues in other genera or species. A polynucleotide sequence in a library can be a polynucleotide that represents an mRNA, polypeptide, or other gene product encoded by the polynucleotide, and accordingly such a polynucleotide library could be used to formulate corresponding RNA or amino acid libraries according to the sequences of the library members.

[0084] The nucleotide sequence information of the library can be embodied in any suitable form, e. g. , electronic or biochemical forms. For example, a library of sequence information embodied in electronic form comprises an accessible computer data file (or, in biochemical form, a collection of nucleic acid molecules) that contains the representative nucleotide sequences of essential and important genes and/or insertion mutants that are differentially expressed (e. g., attenuated growth mutants). Other combinations and comparisons of cells affected by various diseases or stages of disease will be readily apparent to the ordinarily skilled artisan. Biochemical embodiments of the library include a collection of nucleic acids that have the sequences of the genes or transposon insertion sites in the library, where the nucleic acids can correspond to the entire gene in the library or to a fragment thereof, as described in greater detail below.

[0085] The polynucleotide libraries of the subject invention generally comprise sequence information of a plurality of polynucleotide sequences, where at least one of the polynucleotides has a sequence of any of the sequences in Tables 1-3. By plurality is meant at least 2, usually at least 3 and can include up to all of the sequences included in these tables. The length and number of polynucleotides in the library will vary with the nature of the library, e. g., if the library is an oligonucleotide array, a cDNA array, a computer database of the sequence information, etc.

[0086] Where the library is an electronic library, the nucleic acid sequence information can be present in a variety of media. "Media"refers to a manufacture, other than an isolated nucleic acid molecule, that contains the sequence information of the present invention. Such a manufacture provides the genome sequence or a subset thereof in a form that can be examined by means not directly applicable to the sequence as it exists in a nucleic acid. For example, the nucleotide sequence of the present invention, e. g. the nucleic acid sequences of any of the polynucleotides of Tables 1-3, can be recorded on computer readable media, e. g. any medium that can be read and accessed directly by a computer. Such media include, but are not limited to: magnetic storage media, such as a floppy disc, a hard disc storage medium, and a magnetic tape; optical storage media such as CD-ROM; electrical storage media such as RAM and ROM; and hybrids of these categories such as magnetic/optical storage media. One of skill in the art can readily appreciate how any of the presently known computer readable mediums can be used to create a manufacture comprising a recording of the present sequence information. "Recorded"refers to a process for storing information on computer readable medium, using any such methods as known in the art. Any convenient data storage structure can be chosen, based on the means used to access the stored information. A variety of data processor programs and formats can be used for storage, e. g. word processing text file, database format, etc. In addition to the sequence information, electronic versions of the libraries of the invention can be provided in conjunction or connection with other computer-readable information and/or other types of computer-readable files (e. g., searchable files, executable files, etc, including, but not87 limited to, for example, search program software, etc.).

[0087] By providing the nucleotide sequence in computer readable form, the information can be accessed for a variety of purposes. Computer software to access sequence information is publicly available. For example, the gapped BLAST (Altschul et al. Nucleic Acids Res. (1997) 25 : 3389-3402) and BLAZE (Brutlag et al. Comp.

Chem. (1993) 17: 203) search algorithms on a Sybase system can be used to identify open reading frames (ORFs) within the genome that contain homology to ORFs from other organisms.

[0088] As used herein, "a computer-based system"refers to the hardware means, software means, and data storage means used to analyze the nucleotide sequence information of the present invention. The minimum hardware of the computer-based systems of the present invention comprises a central processing unit (CPU), input means, output means, and data storage means. A skilled artisan can readily appreciate that any one of the currently available computer-based system are suitable for use in the present invention. The data storage means can comprise any manufacture comprising a recording of the present sequence information as described above, or a memory access means that can access such a manufacture.

[0089]"Search means"refers to one or more programs implemented on the computer-based system, to compare a target sequence or target structural motif, or expression levels of a polynucleotide in a sample, with the stored sequence information.

Search means can be used to identify fragments or regions of the genome that match a particular target sequence or target motif. A variety of known algorithms are publicly known and commercially available, e. g. MacPattern (EMBL), BLASTN and BLASTX (NCBI). A"target sequence"can be any polynucleotide or amino acid sequence of six or more contiguous nucleotides or two or more amino acids, preferably from about 10 to 100 amino acids or from about 30 to 300 nucleotides. A variety of comparing means can be used to accomplish comparison of sequence information from a sample (e. g., to analyze target sequences, target motifs, or relative expression levels) with the data storage means. A skilled artisan can readily recognize that any one of the publicly available homology search programs can be used as the search means for the computer based systems of the present invention to accomplish comparison of target sequences and motifs. Computer programs to analyze expression levels in a sample and in controls are also known in the art.

[0090] A"target structural motif, "or"target motif, "refers to any rationally selected sequence or combination of sequences in which the sequence (s) are chosen based on a three-dimensional configuration that is formed upon the folding of the target motif, or on consensus sequences of regulatory or active sites. There are a variety of target motifs known in the art. Protein target motifs include, but arc not limited to, enzyme active sites and signal sequences. Nucleic acid target motifs include, but are not limited to, hairpin structures, promoter sequences and other expression elements such as binding sites for transcription factors.

[0091] The present invention encompasses the use of the library of essential and important genes to search for polynucleotide and amino acid sequences in common among the essential and important genes. Such identified sequences can be used to design and develop antibacterial agents and vaccines against Pseudomonas aeruginosa.

[0092] A variety of structural formats for the input and output means can be used to input and output the information in the computer-based systems of the present invention. One format for an output means ranks the relative expression levels of different polynucleotides. Such presentation provides a skilled artisan with a ranking of relative expression levels to determine a gene expression profile.

[0093] As discussed above, the"library"as used herein also encompasses biochemical libraries of the polynucleotides of Tables 1-3, e. g., collections of nucleic acids representing the provided polynucleotides. The biochemical libraries can take a variety of forms, e. g., a solution of cDNAs, a pattern of probe nucleic acids stably associated with a surface of a solid support (i. e., an array) and the like. Of particular interest are nucleic acid arrays in which one or more of the sequences of Tables 1-3 is represented on the array. By"array"is meant a an article of manufacture that has at least a substrate with at least two distinct nucleic acid targets on one of its surfaces, where the number of distinct nucleic acids can be considerably higher, typically being at least 10 nt, usually at least 20 nt and often at least 25 nt. A variety of different array formats have been developed and are known to those of skill in the art. The arrays of the subject invention find use in a variety of applications, including gene expression analysis, drug screening, mutation analysis and the like, as disclosed in the above-listed exemplary patent documents.

[0094] In addition to the above nucleic acid libraries, analogous libraries of polypeptides are also provided, where the polypeptides of the library will represent at least a portion of the polypeptides encoded by a gene corresponding to one or more of the sequences in Tables 1-3.

[0095]"Identity"as it is used in the present invention should be distinguished from "homology"or"homologous. "In the context of the coding sequences and genes of this invention, "homologous"refers to genes whose expression results in expression products which have a combination of amino acid sequence similarity (or base sequence similarity for transcript products) and functional equivalence, and are therefore homologous genes. In general such genes also have a high level of DNA sequence similarity (i. e. , greater than 80% identity when such sequences are identified among members of the same genus, but lower when these similarities are noted across bacterial genera), but are not identical. Relationships across bacterial genera between homologous genes are more easily identified at the polypeptide (i. e. , the gene product) rather than the DNA level. The combination of functional equivalence and sequence similarity means that if one gene is useful, e. g. , as a target for an antibacterial agent, or for screening for such agents, then the homologous gene is probably also useful, but may not react in the same manner or to the same degree to the activity of a specific antibacterial agent.

[0096] Nevertheless, the identification of one such gene serves to identify a homologous gene through the same relationships as indicated above, and can serve as a starting point to determine whether the homologous gene is also essential, whether it responds to the same antibacterial agents, etc. Typically, such homologous genes are found in other bacterial species, especially, but not restricted to, closely related species.

Due to the DNA sequence similarity, homologous genes are often identified by hybridizing with probes from the initially identified gene under hybridizing conditions that allow stable binding under appropriately stringent conditions. For instance, nucleic acids having sequence similarity are detected by hybridization under low stringency conditions, for example, at 50°C and 10XSSC (0.9 M saline/0.09 M sodium citrate) and remain bound when subjected to washing at 55°C in 1XSSC. Sequence identity can be determined by hybridization under stringent conditions, for example, at 50°C or higher and 0. 1XSSC (9 mM saline/0.9 mM sodium citrate). Hybridization methods and conditions are well known in the art, see, e. g., USPN 5,707, 829. Nucleic acids that are substantially identical to the provided polynucleotide sequences, e. g. allelic variants, genetically altered versions of the gene, etc., bind to the provided polynucleotide sequences under stringent hybridization conditions. By using probes, particularly labeled probes of DNA sequences, one can isolate homologous or related or substantially identical genes. The equivalent function of the product is then verified using appropriate biological and/or biochemical assays.

[0097] Using such hybridization technique for the identification of homologous genes, it will be possible to screen other species of bacteria, particularly other genera of gram negative pathogenic bacteria although gram positive bacteria may also be screened, to determine if any essential or important gene identified herein has a homologue in that particular genus of bacteria. If so, such gene could be cloned and isolated for essentiality in the particular genus, and further tested for sensitivity or susceptibility to the antibacterial agents and inhibitors identified herein. Specific genera of bacteria particularly appropriate for hybridization screening for the presence of homologues of essential and important genes include Escherichia, Hemophilus, Vibrio, Borrelia, Enterococcus, Heliobacter, Legionella, Mycobacterium, Mycoplasma, Neisseria, Staphylococcus, Streptococcus, etc.

[0098] "Identity, "on the other hand, is gauged from the starting point of complete homology. Thereafter, identity may be described in terms of percentages according to the number of base changes in the DNA sequence taking into account any gaps. For purposes of the present invention, variants of the invention have a sequence identity greater than at least about 65%, preferably at least about 75%, more preferably at least about 85%, and can be greater than at least about 90% or more as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular). A preferred method of calculating percent identity is the Smith- Waterman algorithm, using the following. Global DNA sequence identity must be greater than 65% as determined by the Smith-Waterman homology search algorithm as implemented in MPSRCH program (Oxford Molecular) using an affine gap search with the following search parameters: gap open penalty, 12; and gap extension penalty, 1.

[0099] Amino acid sequence variants are also included in the invention. Preferably, naturally or non-naturally occurring protein variants have amino acid sequences which are at least 85%, 90%, or 95% identical to the amino acid sequences identified herein, or to a shorter portion of these sequences. More preferably, the molecules are 98% or 99% identical. Percent sequence identity is determined using the Smith-Waterman homology search algorithm using an affine gap search with a gap open penalty of 12 and a gap extension penalty of 2, BLOSUM matrix of 62. The Smith-Watennan homology search algorithm is taught in Smith and Waterman, Adv. Appl. Math. (1981) 2: 482-489.

[0100] Also included in the invention are fragments of the nucleic acid sequences and amino acid sequences identified herein, as well as RNAs and RNA fragments corresponding to the DNA sequences disclosed. Such nucleic acid fragments are at least about 10 nucleotides, more preferably at least about 20 to 25 nucleotides, and more preferably at least about 50 to 100 nucleotides, and can include any fragment or variant of a fragment. Such nucleic acid fragments may be used as probes for identifying similar or substantially identical or identical nucleic acid sequences in other genera, or as tools in constructing nucleic acid vectors for knock out and promoter swap experiments. Such amino acid fragments are at least about four amino acids in length, more preferably at least about 8 to 12 amino acids in length, and more preferably at least about 20 to 30 amino acids in length, and may be used as agonists or antagonists to test binding interactions of the proteins disclosed herein, or alternatively as immunogens to isolate antibodies that recognize and bind to specific epitopes of a target protein.

[0101] Once a gene is identified as being essential or important for Pseudomonas growth on rich media or in any specific environment, the invention also encompasses the identification of antibacterial agents that have specific activity against the essential or important genes or their gene products or the biochemical pathways in which they are involved. In this context, the term"biochemical pathway"refers to a connected series of biochemical reactions normally occurring in a cell, or more broadly a cellular event such as cellular division or DNA replication. Typically, the steps in such a biochemical pathway act in a coordinated fashion to produce a specific product or products or to produce some other particular biochemical action. Such a biochemical pathway requires the expression product of a gene if the absence of that expression product either directly or indirectly prevents the completion of one or more steps in that pathway, thereby preventing or significantly reducing the production of one or more normal products or effects of that pathway.

[0102] Thus, an agent specifically inhibits such a biochemical pathway requiring the expression product of a particular gene if the presence of the agent stops or substantially reduces the completion of the series of steps in that pathway. Such an agent, may, but does not necessarily, act directly on the expression product of that particular gene. An"expression product"of a gene means that, in a bacterial cell of interest, the gene is transcribed to form RNA molecules. For those genes that are transcribed into mRNAs, the mRNA is translated to form polypeptides. More generally, in this context, "expressed"means that a gene product is formed at the biological level that would normally have the relevant biological activity (i. e. , RNA or polypeptide level).

[0103] Thus, the invention includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against an essential or important bacterial gene identified by the methods herein. The invention also includes a method of screening for an antibacterial agent, comprising determining whether a test compound is active against a protein encoded by an essential bacterial gene identified herein, or active to inhibit the biochemical pathway that involves said protein. The term"antibacterial agent"refers to both naturally occurring antibiotics produced by microorganisms to suppress the growth of other microorganisms, and agents synthesized or modified in the laboratory which have either bactericidal or bacteriostatic activity. An"active"agent in this context will inhibit the growth of P. aeruginosa and possibly related species. The term"inhibiting the growth"indicates that the rate of increase in the numbers of a population of a particular bacterium is reduced. Thus, the term includes situations in which the bacterial population increases but at a reduced rate, as well as situations where the growth of the population is stopped, as well as situations where the numbers of the bacteria in the population are reduced or the population even eliminated. If an enzyme activity assay is used to screen for inhibitors, one can make modifications in uptake/efflux, solubility, half life, etc. to compounds in order to correlate enzyme inhibition with growth inhibition.

[0104] Assays may include any suitable method and may be expected to vary on the type of essential gene or protein involved. For instance, one embodiment is a method comprising the steps of : a) contacting said protein or a biologically active fragment thereof with a test compound; and b) determining whether said test compound binds to said essential gene product or protein or fragment of said protein; wherein binding of said test compound to said polypeptide or said fragment is indicative that said test compound is an antibacterial agent. It is quite common in identifying antibacterial agents, to assay for binding of a compound to a particular polypeptide where binding is an indication of a compound which is active to modulate the activity of the polypeptide. Binding may be determined by any means according to the agent tested and techniques known in the art. l0105] Also, agents that inhibit binding of two proteins or polypeptides may also be identified, for instance using a yeast two-hybrid system. Such a system will entail cloning the genes encoding each protein and expressing each in a reporter cell system such that interaction between the two proteins is monitored by observing the expression of a reporter gene. For instance, cDNAs cloned in a yeast two-hybrid expression system (Chien et al. (1991) Proc. Natl. Acad. Sci. (U. S. A. ) 88: 9578; Zervos et al.

(1993) Cell 72: 233) can be used to identify other cDNAs encoding proteins that interact with the protein encoded by the first, thereby produce expression of the GAL4- dependent reporter gene. Thereafter, cells expressing both proteins leading to expression of the reporter gene are used to screen for agents that interact with either protein, or the gene encoding either protein. Such systems are well known in the art and are well within the realm of ordinary skill.

[0106] Another embodiment is a method for evaluating a test agent for inhibition of expression of an essential gene identified according to the methods herein, comprising: a) contacting a cell expressing said essential gene with said agent; and b) determining the amount or level of expression of said essential gene in said sample.

[0107] The exact determination method will be expected to vary depending on the characteristics of the expression product as would be readily apparent to one of ordinary skill in the art. Such methods can include, for example, antibody binding methods, enzymatic activity determinations, and substrate analog binding assays. Such level of expression could be monitored by monitoring the level of the product of the essential gene in the cell, i. e. , by SDS-PAGE, or by colorimetric assays using, for example, a lacZ gene or protein fusion and detection on media using X-Gal or spectrophotometric detection.

[0108] When such fusions are employed, fusions may be designed using the chromosomal gene so long as the fusion does not disrupt the function of the essential gene, i. e. , as with a gene fusion where lacZ is inserted just downstream of the essential gene and is expressed from the same promoter as the essential gene. Alternatively, one could employ an extrachromosomal fusion construct whereby the wild type chromosomal copy of the gene is not disrupted. In this case, one could employ a protein fusion, i. e. , where a portion of lacZ sufficient to be detected with a colorimetric test is fused in frame with the coding region of the essential gene such that a fusion protein is obtained. Other detectable or measurable proteins commonly used in the art may be used as an alternative to lacZ, for instance, phoA, Lux/luciferase, etc.

[0109] Another method of the invention for evaluating an potential antibacterial agent, comprises the steps of : a) providing a bacterial strain comprising a mutant or normal form of the essential or important gene, wherein said mutant form of the gene confers a growth conditional phenotype; b) contacting bacteria of said bacterial strain with a test compound in semi- permissive or permissive growth conditions; and c) determining whether the growth of said bacterial strain comprising said mutant form of a gene is reduced in the presence of said test compound to a greater extent than a comparison bacteria comprising a normal form of said gene.

[0110] In this context, a"mutant form"of a gene is a gene which has been altered, either naturally or artificially, changing the base sequence of the gene, which results in a change in the amino acid sequence of an encoded polypeptide. The change in the base sequence may be of several different types, including changes of one or more bases for different bases, small deletions, and small insertions. Mutations may also include transposon insertions that lead to attenuated activity, i. e. , by resulting in expression of a truncated protein. By contrast, a normal form of a gene is a form commonly found in a natural population of a bacterial strain. Commonly a single form of a gene will predominate in natural populations. In general, such a gene is suitable as a normal form of a gene, however, other forms which provide similar functional characteristics may also be used as a normal gene. In particular, a normal form of a gene does not confer a growth conditional phenotype on the bacterial strain having that gene, while a mutant form of a gene suitable for use in these methods does provide such a growth conditional phenotype.

[0111] As used in the present disclosure, the term"growth conditional phenotype" indicates that a bacterial strain having such a phenotype exhibits a significantly greater difference in growth rates in response to a change in one or more of the culture parameters than an otherwise similar strain not having a growth conditional phenotype.

Typically, a growth conditional phenotype is described with respect to a single growth culture parameter, such as temperature. Thus, a temperature (or heat-sensitive) mutant (i. e. , a bacterial strain having a heat-sensitive phenotype) exhibits significantly reduced growth, and preferably no growth, under non-permissive temperature conditions as compared to growth under permissive conditions. In addition, such mutants preferably also show intermediate growth rates at intermediate, or semi-permissive, temperatures.

Similar responses also result from the appropriate growth changes for other types of growth conditional phenotypes. A growth conditional phenotype can also be conferred by cloning an essential or important gene behind a regulatable promoter, for instance, a promoter that is only active, or only leads to transcription, under particular environmental conditions or in response to a specific environmental stimulus. Such growth conditional promoter mutants may be isolated according to the promoter swap strategies described herein.

[0112]"Semi-permissive conditions"are conditions in which the relevant culture parameter for a particular growth conditional phenotype is intermediate between permissive conditions and non-permissive conditions. Consequently, in semi- permissive conditions the bacteria having a growth conditional phenotype will exhibit growth rates intermediate between those shown in permissive conditions and non- permissive conditions. In general, such intermediate growth rate is due to a mutant cellular component which is partially functional under semi-permissive conditions, essentially fully functional under permissive conditions, and is non-functional or has very low function under non-permissive conditions, where the level of function of that component is related to the growth rate of the bacteria.

[0113] The term"method of screening"means that the method is suitable, and is typically used, for testing for a particular property or effect in a large number of compounds. Therefore, the method requires only a small amount of time for each compound tested; typically more than one compound may be tested simultaneously (as in a 96-well microtiter plate, or in a series of replica plates), and preferably significant portions of the procedure can be automated. "Method of screening"also refers to determining a set of different properties or effects of one compound simultaneously.

[0114] Because the essential and important genes identified herein can be readily isolated and the genes cloned into a variety of vectors known in the art, the invention also encompasses vectors comprising the nucleic acid sequences, open reading frames and genes of the invention, as well as host cells containing such vectors. Because the essential genes identified herein can be readily isolated and the encoded gene products expressed by routine methods, the invention also provides the polypeptides encoded by those genes, as well as genes having at least about 50%, or more preferably about 60%, or more preferably about 70%, or more preferably about 80%, or more preferably about 90%, or most preferably about 95% protein sequence identity.

[0115] Thus, by identifying certain essential and/or important genes, this invention provides a method of screening for an antibacterial agent by contacting a polypeptide encoded by one of the identified essential or important genes, or a biologically active fragment of such a polypeptide, with a test compound, and determining whether the test compound binds to the polypeptide or polypeptide fragment. In addition, to simple binding determinations, the invention provides a method for identifying or evaluating an agent active on one of the identified essential genes. The method involves contacting a sample containing an expression product of one of the identified genes with the known or potential agent, and determining the amount or level of activity of the expression product in the sample.

[0116] In particular, antibodies to essential and important gene products are anticipated to be suitable diagnostic binding and antibacterial agents. Thus, antibodies to the proteins encoded by the essential and important genes identified by the methods described herein are also included in the invention. Such antibodies may be isolated according to well known techniques in the art, i. e. , Kohler and Milstein for monoclonal antibodies. Also included are polyclonal antibodies and antibody fragments such as Fv, Fab and Fab2 fragments, as well as chimeric and humanized antibodies, and human antibodies, i. e. , made using a Xeno mouse.

[0117] In a further aspect, this invention provides a method of diagnosing the presence of a bacterial strain having one of the genes identified above, by probing with an oligonucleotide at least 15 nucleotides in length, which specifically hybridizes to a nucleotide sequence which is the same as or complementary to the sequence of one of the bacterial genes identified above. In some cases, it is practical to detect the presence of a particular bacterial strain by direct hybridization of a labeled oligonucleotide to the particular gene. In other cases, it is preferable to first amplify the gene or a portion of the gene before hybridizing labeled oligonucleotides to those amplified copies.

[0118] In a related aspect, this invention provides a method of diagnosing the presence of a bacterial strain by specifically detecting the presence of the transcriptional or translational product of the gene. Typically, a transcriptional (RNA) product is detected by hybridizing a labeled RNA or DNA probe to the transcript.

Detection of a specific translational (protein) product can be performed by a variety of different tests depending on the specific protein product. Examples would be binding of the product by specific labeled antibodies and, in some cases, detection of a specific reaction involving the protein product. Diagnostic assays find particular use in assaying tissue and fluid samples of patients suspect of having a Pseudomonas infection.

[0119] Antibacterial agents identified according to the methods of the invention may be employed in pharmaceutical compositions. Such compositions may be administered to patients in order to treat an infection by or involving P. aeruginosa, either alone or in combination with secondary agents targeted at, for instance virulence factors of P. aeruginosa, or other bacteria that may be present in addition to P. aeruginosa. In this context, the term"administration"or"administering"refers to a method of giving a dosage of an antibacterial pharmaceutical composition to a mammal, where the method is, e. g. , topical, oral, intranasal, inhaled, intravenous, transdermal, intraperitoneal, or intramuscular. The preferred method of administration can vary depending on various factors, e. g. , the components of the pharmaceutical composition, the site of the potential or actual bacterial infection, the bacterium involved, and the severity of an actual bacterial infection.

[0120] As used above and throughout this application, "hybridize"has its usual meaning from molecular biology. It refers to the formation of a base-paired interaction between nucleotide polymers. The presence of base pairing implies that at least an appreciable fraction of the nucleotides in each of two nucleotide sequences are complementary to the other according to the usual base pairing rules. The exact fraction of the nucleotides which must be complementary in order to obtain stable hybridization will vary with a number of factors, including nucleotide sequence, salt concentration of the solution, temperature, and pH.

[0121] The term, "DNA molecule", should be understood to refer to a linear polymer of deoxyribonucleotides, as well as to the linear polymer, base-paired with its complementary strand, forming double-strand DNA (dsDNA). The term is used as equivalent to"DNA chain"or"a DNA"or"DNA polymer"or"DNA sequence", so this description of the term meaning applies to those terms also. The term does not necessarily imply that the specified"DNA molecule"is a discrete entity with no bonding with other entities. The specified DNA molecule may have H-bonding interactions with other DNA molecules, as well as a variety of interactions with other molecules, including RNA molecules. In addition, the specified DNA molecule may be covalently linked in a longer DNA chain at one, or both ends. Any such DNA molecule can be identified in a variety of ways, including, by its particular nucleotide sequence, by its ability to base pair under stringent conditions with another DNA or RNA molecule having a specified sequence, or by a method of isolation which includes hybridization under stringent conditions with another DNA or RNA molecule having a specified sequence.

[0122] References to a"portion"of a DNA or RNA chain mean a linear chain which has a nucleotide sequence which is the same as a sequential subset of the sequence of the chain to which the portion refers. Such a subset may contain all of the sequence of the primary chain or may contain only a shorter sequence. The subset will contain at least 15 bases in a single strand. However, by"same"is meant"substantially the same" ; deletions, additions, or substitutions of specific nucleotides of the sequence, or a combination of these changes, which affect a small percentage of the full sequence will still leave the sequences substantially the same. Preferably this percentage of change will be less than 20%, more preferably less than 10%, and even more preferably less than 3%. "Same"is therefore distinguished from"identical" ; for identical sequences there cannot be any difference in nucleotide sequences.

[0123] As used in reference to nucleotide sequences, "complementary"has its usual meaning from molecular biology. Two nucleotide sequences or strands are complementary if they have sequences that would allow base pairing between the strands according to the usual pairing rules. This does not require that the strands would necessarily base pair at every nucleotide ; two sequences can still be complementary with a low level of base mismatch such as that created by deletion, addition, or substitution of one or a few (up to 5 in a linear chain of 25 bases) nucleotides, or a combination of such changes.

[0124] Other embodiments of the invention will be immediately envisaged by those of skill in the art upon reading the methods and examples to follow. Such examples are merely illustrative of the invention, and should not be construed as limiting the scope of the invention in any way.

Methodology Generation of Transposon Library [0125] Transposon insertions were generated using an improved transposon system for P. aeruginosa that utilizes a mini-Tn5-type transposon on a delivery vector that does not replicate in Pseudomonas. The delivery vector contains a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions. Weinreich et al. , 1994, Evidence that cis preference of the Tn5 transposase is caused by nonproductive multimerization, Genes Dev. 8 (19): 2363-74. The Tn5 transposase was placed under control of a lac promoter and the complete transposable element was minimized to 1.7 kilobases in length, including a tetracycline resistance marker and transcription terminator to prevent read-through into the genome. The transposon vector is delivered to P. aeruginosa via conjugation from a suitable E. coli host (e. g. SM103w). Following conjugation, transposon mutants are selected by resistance to tetracycline conferred by the trasnposable element.

[0126] Libraries were created in both P. aeruginosa PAK and PA01. The average diversity of the libraries created using this strategy is estimated to be-40, 000 to -50, 000 independent mutants per conjugation. Care is taken to minimize passage of each transposon conjugation before plating for mutant selection in an effort to minimize the potential for siblings, i. e. , by stopping the conjugation after sufficient time for a single round of conjugation events.

High-Throughput Transposon Insertion Mapping (HTTIM) [0127] Precise transposon insertion sites were determined by an anchored, semi- random PCR method for amplification of the transposase/genome junction region.

O'Toole and Kolter, 1998, Initiation of biofilm formation in Pseudomonasfluorescens WCS365 proceeds via multiple, convergent signaling pathways: a genetic analysis, Mol. Microbiol. 28 (3): 449-61. The technique, HTTIM, uses both Tn5 specific and semi-random primers with conserved primer tails. A small aliquot of transposon mutant liquid culture is used as a template and amplification of a fragment containing an insertion site is achieved in a two-step process. The PCR product is then sequenced and the insertion site is entered into an Oracle database for analysis. To date, more than 10,000 to 14,000 insertions have been mapped, each insertion representing the disruption of a gene or intergenic region that is not essential for survival on rich media.

[0128] With every insertion added to the map, the regions of the genome containing essential genes, and particularly those containing operons containing essential genes (because of potential polar effects of insertions in upstream genes), begin to become apparent because these regions will not be able to accommodate transposon insertions.

Table 1 shows a listing of the open reading frames identified as existing between transposon insertions, as well as an indication of whether the gene has homologues that have been identified in other bacteria pursuant to BLAST sequence database analysis.

Open reading frames were tentatively assigned names prior to being identified pursuant to HTTIM analysis, as disclosed in the Pseudomonas genome project, and reported in Stover et al., Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen, August 21,2000, Nature 406: 959-964, herein incorporated by reference in its entirety.

[0128] For instance, the predicted ORFs were examined individually for (1) identity with known genes of P. aeruginosa with sequences deposited in GenBank, (2) similarity with well-characterized genes from other bacteria, or (3) presence of known functional motifs (see http://www. pseudomonas. com for complete list). In each case the literature was searched to ensure that the proteins encoded by the homologous genes were functionally characterized to avoid the perpetuation of poorly supported functional assignments. In addition, 61 researchers who were members of the P. aeruginosa research community or had experience in particular aspects of bacterial physiology were enlisted for the Pseudomonas Community Annotation Project (PseudoCAP) to provide expert assistance and confirmatory information in the genome project for the analysis of identified ORFs and assigned functions.

[0129] The genome project was able to assign a functional class to 54.2% of ORFs.

As in other bacterial genomes, a large proportion of the genome (45.8% of ORFs) consists of genes for which no function could be determined or proposed (confidence level 4). Of these, nearly a third (769 ORFs) possess homology to genes of unknown function predicted in other bacterial genomes, and the remainder (32% of ORFs) do not have strong homology with any reported sequence. The 372 ORFs from the entire genome analysis that are known P. aeruginosa genes with demonstrated functions (confidence level 1) are primarily genes encoding lipopolysaccharide biosynthetic enzymes, virulence factors, such as exoenzymes and the systems that secrete them, and proteins involved in motility and adhesion. ORFs with strong homology to genes in other organisms with demonstrated functions (confidence level 2; 1,059 ORFs) include those required for DNA replication, protein synthesis, cell-wall biosynthesis and intermediary metabolism.

[0130] The ORFs that provided the most new information about P. aeruginosa biology via the genome annotation were those that could be assigned a probable function on the basis of similarity to established sequence motifs, but could not be assigned a definite name (confidence level 3; 1,590 ORFs). Most of these genes encode products that are in one of three functional classes: putative enzymes (405 genes), transcriptional regulators (341 genes) or transporters of small molecules (408 genes). In some cases genomic context provided additional information, allowing us to identify loci that appear to encode systems such as metabolic pathways and secretion systems, although the substrates for such systems could not be identified. The system for assigning name and putative function to each essential or important gene was gleaned from the Pseudomonas genome project data already available.

Statistical Analysis of Putative Essential and Important Genes [0131] The open reading frames listed in Table 1 are also presented in Table 2, wherein the ORFs are listed in order of length of base pairs from longest to shortest.

Also listed in Table 2 is the probability of essentiality assigned to each of the open reading frames. Probability correlates with length of the ORF, such that the longer the ORF, the higher the probability of hitting the ORF in a random transposon mutagenesis experiment, and the higher the confidence level that the ORF represents an essential or an important gene given that no transposon insertions therein were isolated. Statistical confidence levels in essentiality or importance can help narrow the focus in the screening of specific genes, thereby shortening the verification process and the subsequent identification of antibacterial agents specific for that gene or gene product.

Thus, one of the benefits of the HTTIM approach is that it is a quantitative approach that lends itself well to statistical analysis.

[0132] The High-Throughput Transposon Insertion Mapping (HTTIM) strategy utilizes a transposon, which is a small, mobile DNA element that randomly inserts into the chromosome. Although HTTIM was performed using a Tn5 transposon, any transposon may be employed so long as its insertion into the chromosome is random, i. e. , devoid of hot spots. Reznikoff, W. S. , 1993, The Tn5 transposon, Annu. Rev.

Microbiol. 47: 945-63. Although the Tn5 derivative employed here contained a modified transposase gene with three amino acid substitutions that have been shown to increase the frequency of Tn5 insertions (see supra), the frequency of insertion is generally quite low. For instance, mutants with even one insertion occur at a rate of only 1 in 105 or 106 bacteria, and must be specifically selected from a background of cells with no insertions. Because the frequency of a single insertion is so low, the frequency of a double insertion is so low as to be insignificant.

[0133] When the transposon insertion disrupts one of the 5570 genes in the Pseudomonas genome, the function of that gene is lost. If the disrupted gene is essential for growth, the transposon insertion mutant dies and cannot be characterized.

If the transposon disrupts a gene that is non-essential, the mutant survives, grows and the transposon insertion site is mapped. By examining the insertion sites of a large number of transposon mutants, all, of the non-essential P. aeruginosa genes can be identified, and by implication, all of the essential genes may be identified as well.

Characterization of over 13,000 transposon insertions revealed insertions in 3890 genes and resulted in an even distribution of insertions across the entire length of the genome.

The remaining 1658 genes, in which a transposon insertion has never been observed, are candidates of essential genes (30%). See Figure 7, showing a graph illustrating ORF coverage by Tn5 achieved in High-Throughput Transposon Insertion Mapping (HTTIM), wherein 30% of the genes in the genome are candidate essential genes where ORF size is not taken into account in predicting essentiality.

[0134] Because insertion of the transposon used here into the chromosome was proposed to be random, it was possible that some of the 1658 genes that did not receive a transposon insertion were simply not hit by random chance. One cannot truly know that a transposon has no hot spots and is entirely random until the data is analyzed, and the data here confirmed that the Tn5 derivative employed underwent random insertion in P. aeruginosa. Thus, the chance that a gene will not be hit by the transposon as a matter of random chance increases as the length of the gene decreases, particularly for very small genes (< 600 base pairs). See Figure 8, Probability of Being an Essential Gene Given No Hit. Thus, by deleting smaller ORFs (< 600 base pairs) in which there is a lower confidence in essentiality, the probability of essentiality goes up while the number of predicted essential genes decreases. Further, the curve in the graph depicted in Figure 8 should level off faster. Thus, in predicting the essentiality of genes from the HTTIM candidate set, the closer one can come to a probability of 1.0 as depicted in Figure 8, the higher the confidence level of essentiality that can be assigned to each gene in the candidate subset. For a representation of the number of ORFs of various lengths in P. aeruginosa, see the histogram in Figure 9.

[0135] A Bayessian statistical model for truncated counting data was applied to the candidate essential gene set, and permitted a determination that 16 to 17 percent of P. aeruginosa genes are essential. Such a model may therefore be utilized to increase the statistical confidence that a given gene in the candidate subset is essential. An exemplary statistical model is provided in Example 1.

Physical Methods for Target Gene Validation [0136] While the above methodology and the database of putative essential and important gene candidates established thereby is believed to be superior to existing methods with regard to the quantity of experimentation required to identify essential and important genes in Pseudomonas aeruginosa and the degree of confidence conferred, it should be understood that the methodology described herein can be incorporated into combined protocols with technology known in the art. For instance, the methods for verifying essentiality disclose in WO 01/07651, herein incorporated by reference in its entirety, would be useful as a secondary method to be utilized in combination with the methods described in this disclosure. Alternatively or additionally, one of several approaches may be used to determine whether a particular gene is essential (absolutely required for survival on rich medium) or important (the absence of which results in attenuated growth) to P. aeruginosa.

Integration Knockouts [0137] This is the simplest and most rapid strategy. PCR is used to amplify a small (200-500 base pairs) portion of the coding sequence, or open reading frame (ORF) of the gene of interest. This gene fragment must be centrally located within the ORF--it cannot include either termini of the gene's coding region. This fragment is cloned into a plasmid vector that can replicate in E. coli, but not in Pseudomonas. The vector used should have a drug resistance marker that is suitable for selection in Pseudomonas, and an origin for conjugal transfer. This feature allows the plasmid to be transferred by conjugation from a suitable E. coli donor strain to a Pseudomonas strain when the two are co-cultured under the appropriate conditions.

[0138] Following conjugation the co-cultured mixture is harvested and plated on media which selects against the E. coli donor and for Pseudomonas which contain the plasmid. Since the plasmid is incapable of extra-chromosomal replication in Pseudomonas, colonies that arise are the result of homologous recombination between the Pseudomonas chromosome and the cloned gene fragment on the plasmid. This is referred to as single-crossover recombination ; a single recombination event takes place between the plasmid and the chromosome. The result is integration of the plasmid into the bacterial chromosome and disruption of the gene from which the fragment was amplified (Fig. 1).

[0139] Variations of this approach are possible. For instance, one could clone out the entire locus and isolate transposon insertion mutants in E coli using known techniques, i. e. , by transposition from the E. coli genome, selecting plasmid insertions by mobilizing the vector into a recipient cell that does not contain the transposon or the antibiotic resistance marker encoded by the transposon, and screening the plasmid for insertions in the cloned gene. Thereafter, a similar assay could be performed by screening for double crossover events in P. aeruginosa that result in recombination of the transposon into the chromosomal locus from a suicide vector.

[0140) Integration of the plasmid or other insertion at the locus can be confirmed by a relatively rapid PCR-based screen of recombinant colonies. The advantage of this strategy, particularly the plasmid single crossover strategy, is that it requires only amplification of a short stretch of DNA followed by a single cloning step before recombination experiments can be performed. The disadvantage is that if the target gene is essential, no recombinants can be obtained. Failure to obtain recombinants as proof of essentiality is pretty thin evidence. However, if a gene is in fact non-essential, this method will demonstrate that quickly.

Integration Knockouts with Extra-chromosomal Complementation [0141] This variation of the above method provides more convincing data when the target gene is essential. It employs the same type of non-replicating integration plasmid described above, but recombinations are performed in strains already carrying a second copy of the target gene on an extra-chromosomal plasmid. This second copy can then supply the essential function when the chromosomal copy is disrupted. If disruptions can only be obtained when a complementing plasmid is present and not when a control plasmid is present, this is rather strong evidence that the target gene is essential. The advantage of this method is that you obtain colonies even when your gene is essential.

The disadvantage is that construction and sequencing of the complementation plasmid takes additional time.

Integration with a Regulatable Promoter (Promoter Swap) [0142] This approach also involves selecting for chromosomal integration of non- replicating plasmids via homologous recombination. However, the design of the integrating plasmid is different. In this case, the N-terminal coding sequence (300-500 base pairs) of the target gene is PCR amplified and cloned into a vector downstream of a regulatable promoter, i. e., a lac promoter, which is inducible in the presence of IPTG, or an arabinose promoter (pABD), inducible in the presence of arabinose. The activity of the promoter can be modulated by the presence of a specific inducer molecule. The plasmid is conjugated into Pseudomonas and integration selected for under conditions where the regulatable promoter is active. The resulting chromosomal integration replaces the target gene's natural promoter with the regulatable promoter from the plasmid (Fig. 2). If the target gene is essential, recombinants can only survive when the inducer molecule is present in their growth media to stimulate gene expression. If the gene is non-essential, the recombinant's growth is independent of the addition of the inducer. The advantage of this strategy is that it requires only amplification of a short stretch of DNA followed by a single cloning step before recombination experiments can be performed.

Examples : Essential Genes Identified Example 1: A Bayessian Statistical Model for Increasing Statistical Confidence of Essentiality [01431 When the Tn5 transposon inserts into the Pseudomonas DNA, one of three things happen: 1) The insertion disrupts a nonessential gene. The cell survives to be characterized and the location of the insertion is determined. 2) The insertion disrupts an essential gene. The cell does not survive and the insertion site is not determined. 3) The insertion is in an intergenic region (between genes) and no information is gained.

Genes with identified insertions are nonessential genes. However, genes without identified insertions could be essential genes or nonessential genes with zero transposon insertion. To determine the number of essential genes, we have developed a multivariate Bayession model for truncated Poisson data and applied it to the Pseudomonas genome data set. A likelihood gain based searching algorithm was developed to obtain maximum likelihood estimates. The property of the algorithm was studied. Different approaches were compared for both multivariate and univariate approaches.

A. Structure of the Data and Preliminary Considerations [0144] A transposon Tn5 insertion mutagenesis library was constructed in Pseudomonas aeruginosa strains PAK and PAO1. Mutants were randomly picked and their genomic insertion site sequence determined through polymerase chain reaction (PCR) and automated DNA sequencing. BLASTN analysis of transposon/genome junction sequences was used to map the location of the insertions relative to the completed strain PAO1 genome sequence. More than 20,000 mutants were analyzed which resulted in 12,219 independent insertions being mapped. In order to identify essential genes, transposon insertion sites were analyzed with respect to the protein- encoding genes in this organism. A data set consists of the ID of genes, their length in DNA base-pairs, and the number of transposon insertions were obtained from experiments. The data set consists of 5570 genes with 881 different sizes ranging from 72 to 16884 DNA base-pairs. The distribution of the gene sizes are extremely skewed to the right with majority of the genes being smaller than 2000 DNA base-pairs as shown in Figure 10.

[0145] A randomly selected subset of the data is shown in Table 4, where 8 is gene size, x is the observed number of transposon insertions. Insertions to essential genes are not observable since the insertion mutants can not survive for characterization when the transposon is inserted into an essential gene. Therefore, a gene with zero observed transposon insertions can either be an essential gene or a nonessential gene with zero transposon insertion. Consequently, the count of transposon insertions x is truncated with the truncation region being a single element {0}.

Table 4: A sample of the gene data set Genes 6 x <BR> <BR> 298 1359 3 4047 618 0 1170 735 1 4953 1044 1 5526 213 0 4624 1707 4 5069 426 3 [0146] Since the insertion into the chromosome of Pseudomonas aeruginosa is random (Reznikoff WS. 1993), and the probability of receiving an insertion for a given gene is proportional to its size measured in DNA base-pairs, the number of transposon insertions into a gene is distributed as truncated Poisson with parameter k6, where S is the size of the gene and k is an unknown parameter, which is independent of gene size.

B. A Bayessian Model [0147] Let R be a measurable subset of the probability space Q such that a random variable X is observable only if X##\R. In this example, no observations can be obtained from essential genes, whereas only nonzero observations can be obtained from nonessential genes, the set R consists of a single element {0}.

1. a. One Gene Size [0148] Assume all genes in a genome have same size, 8, and let N be the number of nonessential genes in this genome. Then the observations Xi, X2,..., XN from the N nonessential genes are i. i. d. Poisson (S b), of which, all observations of value zero are truncated. The product ?,. 8 indicates that the probability of a gene receiving an insertion is proportional to its size.

[0149] Let denote the subset of all nonzero observations. Then this subset composes a random sample of size n from a truncated Poisson distribution whose distribution function can be written as [0150] Let q l-e~Ay denote the probability that an observation from Poisson (###) is not truncated, and let p =1-q=-##. Then, conditional on the parameters n and N, the likelihood function of the joint distribution of {x ;, xi,..., xn} can be written as [0151] Let S=X1*+X2*+###+Xn* (3. 3) denote the sum of all nonzero observations and notice that n follows a binomial distribution B (N, q). The likelihood function of the joint distribution of {n,X1*,X2*,###,Xn*}, conditional on the parameter N, can be obtained as [0152] The Bayesian model consists of the conditional model (2.4) and a prior distribution of the parameter N. Assuming N, the number of nonessential genes, is binomial B (M, y), where M is the total number of genes of size 8, which is known, and y is the portion of nonessential genes which is unknown and is independent of gene size, we can write the likelihood function of the joint distribution of {n,N,X1*,X2*,###,Xn*} as [0153] This is the likelihood function of n nonzero observations from M genes of the same size 8, of which N genes are nonessential. It is easy to see that (3.5) is proportional to the likelihood function of the posterior distribution of N given observations n and S.

2. b. Multiple Gene Sizes [0154] For a given genome consists of genes of different sizes, let #=(#1,#2,###,#g)T denote the vector of g different gene sizes, and let M= (M1,M2,###,Mg)T the vector of known numbers of total genes, # = (N1,N2,###,Ng)T the unknown numbers of nonessential genes, the numbers of nonzero observations from the nonessential genes, and #= (S1,S2,###,Sg)T the sums of nonzero observations, as defined in (3.3).

[0155] The likelihood function of the joint distribution of can be written as where #*# is the L1 norm of a vector, and [0156] Let 3 = ln (L). Then up to an additive constant, the log likelihood function of the joint distribution of {#,#,#} can be written as where (ra, N) are the parameters of interests. The vector # is defined on {ni # Ni # Mi; = 1,2,###,g} and 3 (7, AR) is proportional to the likelihood function of the posterior distribution of N given ñ and s.

[0157] When g is large, say, in the order of hundreds as in the situation we are dealing with in this paper, obtaining the maximum likelihood (ML) estimate of Ñ= (N1,N2,###,Ng)T from (3.7) in such a high dimensional parameter space is a very difficult task both theoretically and computationally. In the next section, we will present a stepwise, maximum likelihood gain based method to obtain the ML estimation.

C. ML ESTIMATION OF PARAMETERS [0158] For any #=(N1,N2,###,Ng)T, it is easy to verify using (3.7) that the ML estimations of the parameters y and k are r=IIÑII/IIMII (4.1) and #=###/(#T##) (4.2) respectively. Substituting (4.1) and (4.2) for y and X in (3.7), we have [0159] For 1#i# g, define <BR> <BR> <BR> <BR> #i#*(#)=#*(#+#i)-##(#) (4.4)<BR> <BR> <BR> <BR> <BR> <BR> for any # # {ni # Ni < Mi, nj # Nj # Mj: i # j}. In equation (4.4), #@ = =(0,###0,1,0,###,0)T with 1 at the i position. For notational purpose, let #(k)=k#ln(k)+(###-k)#in(###-k) (4.5) for 11 ñ ## k ###. Then, (3.4) can be written as [0160] To obtain ML estimation of Ñ, we define an operator, ED, between the observed vector ñ and any integer k with 0 # k ## ##-### as follows: <BR> <BR> <BR> <BR> <BR> <BR> K$0=K,<BR> <BR> <BR> <BR> ##1={#+#i:#$i#*(#)##j#*(#) for all j#i}, and (4.7)<BR> <BR> <BR> <BR> ##k=(##(k-1))#1 for k # 2.

We also define a likelihood-gain function G with G (0) =0 and <BR> <BR> <BR> <BR> <BR> <BR> G (k) = #*(##k)-##(##(k-1)) (4.8)<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> for 1#k####-###.

[0161] Using this likelihood-gain function, we can search the ML estimation for Ñ as follows: 1. Start with the observation ii as the initial estimate of #, and denote it as No.

2. For each gene size 8 ; with n ; < Mus, il 2,..., g, calculate a likelihood difference #i#*(#0)=#*(#0+#i)-#*(#0) by set Ni0 = ni+1 and NJ = nj for all jgi.

3. Update the initial values #0 by setting N° = N° + 1 such that #i#*(#0)=max{#j#*(#0), j=1,2,###,g}. This maximum likelihood difference is the likelihood gain defined in (4.8).

4. Repeat the process until it converges. By convergence we mean that either the estimated number of nonessential genes equals to the number of genes in each size group or when increasing the number of nonessential genes in any size groups will result in a loss of likelihood.

[0162] This algorithm searches the ML estimator in a high dimensional space (881 in our study) along a path such that at each iteration, it moves in a direction (that is, increases the number of nonessential genes in this size group by one) along which the likelihood gain is maximum among all possible directions. Because the searching algorithm prohibits reversal of previous moves at any later iteration, it moves towards the ML estimator along the shortest path with the deepest ascending (maximum likelihood gain) at each step. Table 5 and Figures 11 and 12 show the values of likelihood gains in each iteration. With very few exceptions where the monotonous is violated only at the fourth or fifth decimal places that probably can be attributed to rounding errors, the likelihood gain is a monotonously decreasing function.

Table 5. A Sample of Likelihood Gains at Each Iteration Iteration id 6 M n N (i) G (i) 1 28 210 13 2 3 2. 67559 2 60 306 14 3 4 2.41082 3 44 258 14 5 6 2.34388 4 63 315 15 5 6 2.29243 ... ... ... ... ... ... ...

18 32 222 7 1 2 2.05160 19 81 369 11 2 3 2.05166 ... ... ... ... ... ... ...

774 122 492 12 8 11 0.00692 775 266 924 16 14 15 0.00544 776 85 381 14 3 11 0.00531 The following three theorems show that the estimates obtained through the above algorithm are indeed the maximum likelihood estimates.

THEOREM 1: if then G (1) >0.

Proof : IfG (1) <0, thenby (4.5), #i#*(#)#0 for all 1#i#g, which leads to C (###+1)-#(###)-####in(1+#i/(#T##))+ln(Mi-ni)#0 Using the facts that (1+1/x)x<e, (1+1/x)x+1>e, and (1-1/x)x-1>e-1 for any x>0, we obtain This is contradictory to condition (4.9).

For g=l, (4.9) becomes ln (n) > (X1+X2+###+Xn)/n. Hence, when the mean of the observed transposon insertions is less than the log of the number of nonzero observations, the vector n can not be the ML estimator of Ñ and there must be truncated observations from nonessential genes.

THEOREM 2: foralli&num j (4. 10) Proof : By definition in (4.5), for any 0<x<###. Hence #(###+1)-#(###) is an increase function of ###. Using this result, we have <BR> <BR> <BR> <BR> <BR> <BR> A, #*(#)-#i#*(#-#j)=<BR> <BR> <BR> <BR> <BR> <BR> (#(###+1)-#(###))-(#(###)-#(###-1))<BR> <BR> <BR> <BR> <BR> <BR> -####ln(1_#i/(#T##))+####ln(1+#i/(#T##-#j))<BR> THEOREM 3: Under (4.9), for any 1#j#g and 1#k#K*, with K* = max{k*#0:G(k)#0 for all 0 # k # k*}, <BR> <BR> <BR> <BR> <BR> <BR> if # = ##k -#j#{nj#Nj#Mj}, then<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> 3 (##k)>#*(##k-#j) (4.11) Proof : This is obviously true when k=l. Assume (3.11) is true for integers 1,2,..., k.

For integer k+1, we have <BR> <BR> <BR> <BR> <BR> <BR> #*(##(k+1)-#j)-#*(##k)<BR> <BR> <BR> <BR> <BR> =[#*(##(k+1)-#j)-#*(##k-#j)]+<BR> <BR> <BR> <BR> <BR> <BR> [#8(##k-#j)-#*(##k)] < [3* (Me (k+1)-#j)-#*(##k-#j)] By theorem 2, #(##(k+1)-#j)-#*(##k-#j)<#*(##(k+1))-#(##k) Therefore #*(##(k+1))>#*(##(k+1)-#j) Combining theorems 1-3, we obtain THEOREM 4: If the likelihood function defined in (3.7) has an unique solution, the ML estimator of N is: #=##K* (4.12) [0163] Theorem 3 guarantees that the trajectory of the searching algorithm follows the shortest path in the sense that a reversal of a previous move (that is, removal of a previously added nonessential gene of any gene size) at any later state will result in a loss of likelihood. This property is illustrated in Figure 4 which shows the trajectory of the searching algorithm projected in a subspace spanned by two different gene sizes.

For illustration purpose, genes are grouped into 143 groups by grouping genes with similar sizes together to increase the length of the trajectory. As indicated in the plot, at any state, moving backwards in any direction results in a loss of likelihood. Figure 13 shows more trajectories projected in different subspaces.

[0164] Now we need to demonstrate that the likelihood function (3.7), which is defined in a high dimensional discrete space, has an unique solution. This can be established if the same estimations are obtained from different initial values. Since the initial values can be any value between the observation ñ and the total number of genes M, we need to extend the searching algorithm (4.7) as follows: For any initial value {N'' : nj<Ni°<Mj fori= 1, 2,---, g} and any integer k with <BR> <BR> <BR> <BR> #0#0=#0,<BR> <BR> <BR> <BR> <BR> 0#k####-##0# such that #j0#l={30~#i:#i#*(#0)##f#*(#0) for all j#i}, and (4.13)<BR> <BR> <BR> <BR> <BR> #0#k=(#0#(k-1))#1 for k#2.

The likelihood gain function is extended similarly as G (0) =0 and <BR> <BR> <BR> <BR> <BR> <BR> G (k)=#*(#0#k)-#*(#0#(k-1)) (4.14)<BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> <BR> for 1#k####-##0#.

[0165] Algorithm (4.13) preserves all the properties of algorithm (4.7) and it searches the ML estimator the same way as that of algorithm (4.7) with two exceptions. Unlike algorithm (4.7), which uses ñ as initial values of N and at each iteration, the number of nonessential genes is increased by one in gene groups of size bi to find the maximum likelihood gain, this algorithm uses ? as initial values of N which can be greater than the ML estimator. Therefore, at each iteration, the number of nonessential genes in a group with size ces ; can be either increased or decreased by one such that the likelihood gain is maximum.

[0166] Randomly selected initial values ? were used for data with grouped gene sizes and data with exact gene sizes. The estimations of all parameters are exactly the same and the final likelihood for all initial values ? are exactly the same as indicated in Figure 14, which plots twenty seven different initial values ouf ?. The line in the far left represents the likelihood when Ñ° = n, and the lines in the middle are randomly selected. Figure 15 is the trajectory projected into a subspace spanned by two gene sizes. Each circle represents the projection of a different initial value Ñ°. Regardless of the initial values, the trajectories all converge to the ML estimator.

D. ANALYSIS OF PSEUDOMONAS AERUGINOSA DATA 1. Multivariate Model with Exact Gene Sizes [0167] The data considered here consist of observations from 5570 genes in 881 different sizes, ranging from 72 to 16884 DNA base-pairs. Distribution of gene size is severely skewed to the right as indicated in Figure 10. For many sizes, especially for sizes smaller than 200 or greater than 2000 DNA base-pairs, there is only one gene in a given size and the observation of transposon insertions for small genes are usually truncated. Since all genes are modeled simultaneously in a single model with a prior y enforcing the essentialness of a gene being independent of its size, the sparseness of the data does not impose limitations on the computation. However, as discussed in the next section, the prior may play a dominating role for small genes where data are sparse.

The estimations of y and A, together with the 95 percent BCa confidence intervals are presented in Table 6 and the estimation of Ñ is presented in Figure 16.

Table 6. Parameter Estimation of y and Estimate Bias SE BCa Confidence Intervals y 0. 8434 3. 942x10-3 9. 893x10-3 (0.818, 0.859) 2. 547x10-3-1. 027x10-5 4. 392x10-5 (0.00247, 0.00264) Here the bias and standard error are estimated with bootstrap 2. Multivariate Model With Grouped Gene Sizes [0168] The prior y plays an important role in enforcing the fact that the essentialness of a gene is independent of its size. It also made possible to estimate the number of essential genes where data are very sparse. However, for small genes where data are extremely sparse, the prior y becomes the dominating source of information. In order to moderate the dominance of the prior on small genes with sparse observations, we grouped the genes into 143 groups according to their sizes, using the median size of each group as the gene size. Table 7 is a sample of estimated JV based on grouped and exact gene sizes. In the table, m is the number of unique sizes in each group ; N1 is estimated using grouped data and N2 is estimated using ungrouped data.

Table 7: Estimated N with Grouped and Exact Gene Sizes Gene size m M x N Ni N2 [72,120] 6 7 3 2 6 7 (120,150] 4 7 3 2 6 7 (150,160] 3 7 2 2 6 7 (160,170] 2 8 0 0 7 7 (170,180] 3 9 1 1 8 8 (180,190] 3 9 1 1 8 8 (190,200] 3 12 4 4 11 11 (200,210] 4 27 7 7 23 24 (210,220] 3 19 7 5 16 17 ... ... ... ... ... ... ... ...

[0169] We see that here N2 # N1. However, this is true only for data in the above tabl where the ungrouped data are extremely sparse and most of the data are truncated. The estimated proportion of non-essential genes, y, is actually larger for grouped data which is presented in Table 8. Grouping genes with similar sizes reduces the sparseness of the data and consequently, the dominance of the prior. Another obvious advantage of grouping is dimension reduction of the parameter space, and therefore, drastic reduction of computation time. Of cause, such grouping introduces another source of variation, and the algorithm could be unrobust against different grouping. In our study, however, different grouping resulted only in slight difference in estimates.

3. Conditional Maximum Likelihood Estimates For a given gene size Aj, the likelihood function (3.4) can be written differently as [0170] Here f (. ,. ) is defined in (3.1), and xj,1*,xj,2*,###,xj,nj* are the nj nonzero observations from Nj genes of size 8j. Assume there are g different gene sizes, the likelihood function can be written as with [0171] Assuming the number of observations nj for each gene size 8j being fixed, we can obtain the conditional maximum likelihood estimate of X by maximize L2 as nj<BR> Equation (5.3) reduces to equation (4.2) if we estimate nj by Nj= .<BR> <P> 1-e-##j The proportion of truncated nonessential genes can be calculated as p=P (x=O} nonessential) = F26dF (a). (5. 4) n [0172] Here Q is the set of nonessential genes, which can be approximated by the set of all untruncated genes.

Therefore, # =n/M+ # (5.5) Estimations from the three approaches are very similar as shown in Tabe 8. If the primary interest is to estimate X and y, the conditional MLE approach has the advantage of simplicity. However, in estimating #, this approach omitted information of M, and y is estimated separately after k is estimated. Another obvious limitation of this approach is that it can only estimate ###, the total number of nonessential genes by 11 ñ 11/Y. The estimation of Ñ by jilp is not reasonable because even though y is independent of gene size, we can not assume the proportion of non-essential genes in different sizes being the same as shown in Figure 17.

Table 8. Estimates of y and k with the Three Approaches Estimates Bias SE 95% BCa Confidence intervals Multivariate Model with Y 0.843 3. 942x10-3 9. 893x10-3 Exact Gene Sizes (0. 818,0. 859) X 2. 547x10-3-1. 024xlO-5 4. 320x10-5 (2.473, 2.642) x10-3 Multivariate Model with Grouped Gene Sizes y 0.853 7. 221xlO 8. 051x10-3 (0.835, 0.867) 2. 524x10'3 2. 803x10-6 4. 063x10-5 (2.451, 2.610) x10-3 Conditional Maximum Likelihood Estimates y 0.828-7. 621x10-5 7. 273x10-3 (0.815, 0.843) 2. 539x10-3 9. 713x10-7 4. 058x10-5 (2.455, 2.618) x10-5 E. DISCUSSION OF ONE DIMENTSIONAL CASE [0173] When the model does not depend on gene size, which can happen for example, when we study a subset of genes with a fixed size, or in other settings where the distribution is identical, model (2.6) reduces to (2.5). Blumenthal, Dayhiya, and Gross (1978) studies estimations of complete sample size from an incomplete Poisson sample using conditional, unconditional, and modified maximum likelihood functions.

The modified likelihood estimation weights the likelihood function and maximizes it. This approach is similar to providing priors to ? and N. Table 9 presents four types of estimations of N using data randomly selected from the 143 grouped genes. Here M and n are number of genes and number of genes with at least one observed transposon insertions. Nm-b is a subset of Ni in Table 7, which is estimated using model (2.6) with grouped data; Nb is estimated with model (2.5) ; Nc and Nu are conditional and unconditional estimates of N as described in Blumenthal., Dayhiya, and Gross (1978).

Table 9: Comparison of Estimations with Different Methods Gene size M n Nm-b Nb Nu Ne [72,120] 7 2 6 2 3 2 (400-410] 44 31 40 37 36 36 (430-440] 46 22 38 25 25 26 (470-480] 80 42 66 57 56 57 (500-510] 54 30 45 39 39 39 (610-620] 47 29 39 33 33 34 (640-650] 54 35 45 44 43 43 (710-720] 50 35 42 41 41 41 (750-760] 56 37 46 39 46 40 (770-780] 61 43 51 53 52 52 (910-920] 60 47 52 53 53 52 (980-990] 57 45 49 52 51 51 (1050-1100] 137 107 115 117 115 117 (1200-1250] 129 100 106 106 106 106 (1400-1450] 121 110 111 112 112 112 (2100-2150] 23 20 20 20 20 20 [0174] We see that the estimations from the three univariate models are very similar.

For fairly large genes, estimations from the multivariate model are similar to those of the univariate models. However, for small genes with high truncation rate, estimations from the multivariate model are larger than estimations from the univariate models. In the univariate models, only the information related to a particular gene size is used and the estimations are obtained separately for each gene size. This approach tends to underestimate N for small genes with sparse observations. The multivariate model uses a prior to enforce the fact that the essentialness of a gene is independent of its size and maximizes the likelihood jointly for all genes. Therefore, it alleviates the underestimation of N for small genes with high truncation rate.

Example 2: IpxC [0175] Lipid A constitutes the outer layer of the outer membranes of gram-negative bacteria and is essential for bacterial growth. This makes all the enzymes involved in the biosynthesis of this molecule essential for bacterial growth, and therefore ideal targets for drug design. A series of synthetic molecules was previously identified that inhibited the first committed step in lipid A biosynthesis. Onishi H. R. , B. A. Pelak, L.

S. Gerckens, L. L. Silver, F. M Kahan, M-H Chen, A. A. Patchett, S. M. Galloway, S.

A. Hyland, M. S. Anderson, and C. R. H. Raetz. 1996. Science. 274: 980-982. This step is catalyzed by a unique deacetylase (UDP-3-O-[R-3-hydroxymyristoyl]-GlcNAc deacetylase), LpxC.

[01761 UDP-3-0- [R-3-hydroxymyristoyl]-GlcNAc deacetylase (LpxC) is a deacetylase that catalyzes the first committed step of lipopolysaccharide (LPS) biosynthesis in gram negative bacteria. This is the second step following the first acylation of N-Acetylglucosamine (GlcNAc). This enzyme functions to deacetylate the UDP-3-0-[R-3-hydroxymyristoyl]-GlcNAc. This step was shown to be essential for growth in E. coli wherein a point mutant (envol) expresses an LpxC protein that has reduced activity. Beall B. and J. Lutkenhaus, 1987. Sequence analysis, transcriptional organization, and insertional mutagenesis of the envA gene of Escherichia coli. J.

Bacteriol. 169: 5408-5415. A 30% reduction in the amount of LPS on the cell wall of such mutants results in hypersensitivity to antibiotics. Attempts to create null mutants in lpxC were unsuccessful in a number of pathogenic bacteria, indicating that inhibitors of LpxC would be effective antibiotics for a number of gram negative organisms.

[0177] Previously identified inhibitors are chiral hydroxamic acids that had unique hydrophobic aromatic moieties, and were suspected to bind a metal in the active site of the deacetylase. The most potent inhibitor, L-161,240, displayed a minimal inhibitory concentration of about 1 microgram per milliliter against E. coli, caused three logs of bacterial killing in 4 hours, and cured mice infected with a lethal intraperitoneal dose of E. coli. Considering the very high degree of homology between the E. coli and P. aeruginosa enzymes, it was initially presumed that an inhibitor of the E. coli enzyme might also inhibit the P. aeruginosa enzyme. However, this molecule inhibited LpxC from P. aeruginosa only at very high concentrations, and even then it did so poorly. It had no effect on bacterial growth in this organism. Thus, there was some question as to whether the IpxC homologue had the same function in P. aeruginosa, and whether it was essential to P. aeruginosa given its decreased sensitivity to the L, 161,240 inhibitor.

[0178] Nevertheless, P. aeruginosa IpxC was one nucleic acid identified as being unable to accommodate a transposon insertion in the library depicted in Table 1 (PA4406). To test the essentiality of P. aeruginosa lpxC, we first tested the sensitivity of P. aeruginosa transformants expressing E. coli LpxC following a"promoter swap" integration. Using this technique, we completely shut off expression of the native P. aeruginosa lpxC, while expressing only the E. coli enzyme encoded on a plasmid. This strategy resulted in a P. aeruginosa mutant that was more sensitive to L-161,240. This suggested that the E coli IpxC gene was substituting for the function of the P. aeruginosa gene, and moreover, that there were no duplicate functional homologues in P. aeruginosa that were active in the absence of lpxC.

[01791 Materials. Pseudomonas aeruginosa PAO1 was grown at 37°C in Luria- Bertani (LB) broth (Difco) or plated on sheep blood agar (Remel). Tetracycline at 100 u. g/ml in LB media was used to maintain the selection of the integrated plasmid pBEMlO in PAO1. LB broth or agar with 10 ug/ml of tetracycline was used for <BR> <BR> <BR> <BR> growing E. coli DH5a (Gibco BRL) and E. coli S-17 transformants. Plasmids pPS72 and pBADHisB were from Promega and Invitrogen, respectively. EDTA, bis-tri buffer, sucrose, arabinose, and DMSO were purchased from Sigma as Ultrapure agents. Yeast extract and Tryptone were obtained from Difco. Restriction enzymes, and T4 DNA Ligase, and their reaction buffers were from New England Biolabs. Polymixin B nonapeptide was from Sigma. The antibiotics, tetracycline, ampicillin, carbenicillin, gentamicin, and kanamycin were all purchased from Sigma. DNA and deduced amino acid information were analyzed using a family of programs included in the Dnastar package. BLASTP was used to search for amino acid'similarities among a host of protein databases available on-line through the National Library of Medicine (USA).

Altschul, T. F. , W. Gish, W. Miller, E. W. Myers, and D. J. Lipman. 1990. Basic local alignment tool. J. Mol. Biol. 215: 403-410.

[0180] DNA manipulations. Standard recombinant DNA procedures were used.

Sambrook, J. , E. F. Fritsch, and T. Maniatis. 1989. Molecular cloning : a Laboratory Manual, 2nd Edition. Cold Spring Harbor, NY: Cold Spring Harbor Laboratory.

Primers were designed to the N-and C-terminal regions of the E. coli or P. aeruginosa lpxC gene that encompassed only the coding region and included NdeI and EcoRI restriction sites for subsequent cloning. For the E. coli gene the primers were (5'- GGGAATTCCATATGATCAAACAAAGGACACTTAAACGT-3'and 5'- CCGGAATTCTTATGCCAGTACAGCTGAAGGCGCT-3') and for P. aeruginosa gene they were (5'- GGGAATTCCATATGATGATCAAACAACGCACCTTGAAGAACAT-3'and 5'- CCGGAATTCCTACACTGCCGCCGCCGGGCGCATATAG-3'). These primers were used in a polymerase chain reaction (PCR) containing either P. aeruginosa genomic DNA (10-50 pg) or plasmid pKD6 containing the E. coli lpxc gene (1. 0 ug) as template (Sorensen, P. G. , J. Lutkenhaus, K. Young, S. S. Eveland, M. S. Anderson, and C. R. H. Raetz. 1996. Regulation of UDP-3-O- [R-hydroxymyristoyl]-N- acetylglucosamine deacetylase in Escherichia coli. The second enzymatic step of lipid A biosynthesis. J. Biol. Chem. 271 (42): 25898-25905). The lpxC genes were amplified using Pwo DNA polymerase (Roche) in a 100 p^1 reaction mixture containing 200 uM concentration of each dNTP and 0.5 gM concentration of each primer for 30 cycles (94°C denaturation, 55°C annealing, and 72°C polymerization (according to the manufacturer's instructions). The PCR products were purified with the Qiaquick PCR Purification Kit from Qiagen (according to the manufacturer's instructions) and digested with NdeI and EcoRI restriction enzymes at sites introduced by the primer sequences. Bands of the correct sizes predicted for the LpxC genes were separated by gel electrophoresis, and the excised DNA purified using the Qiaquick Gel Extraction Kit from Qiagen (according to the manufacturer's instructions). The purified DNA was ligated into the T7 expression vector (Studier, F. W. , A. H. Rosenberg, J. J. Dunn, and J.

W. Dubendorff. 1990. Use of T7 RNA polymerase to direct expression of cloned genes.

Methods Enzymol. 185: 60-89) pET21b (Novagen), that had been cut in the multiple cloning site with the same enzymes, transformed into DH5a and plated on LB agar containing ampicillin (250 pg/ml). The resulting clones had their DNA sequenced to confirm the fidelity of the PCR reactions before it could be transferred into the expression strain. Subcloning of these fragments into other vectors was carried out as needed for expression in various backgrounds. These included pEXl 8T (cbR) for allelic exchange mutagenesis in P. aeruginosa (Schweizer, H. P and T. T. Hoang. 1995.

An improved system for gene replacement and xylE fusion analysis in Pseudomonas aeruginosa. Gene 158 (1) : 15-22), pDNl9 (tetR) for low copy number complementation of E. coli JBK-1 (Nunn, D. , S. Bergman, and S. Lory. 1990. Products of three accessory genes, pilB, pilC, andpilD, are required for biogenesis of Pseudomonas aeruginosa pili. J. Bacteriol. 172 (6): 2911-2919), and pUCP30T (gmR) for P. aeruginosa'promoter swap'mutant complementation (Schweizer, H. P. , T. R.

Classen, and T. Hoang. 1996. Improved methods for gene analysis and expression in Pseudomonas. In: Nakazawa, T. , K Furukawa, D. Haas, S. Silver. (Eds. ) Molecular Biology of Pseudomonas. American Society for Microbiology, Washington, DC. pp.

229-237).

[0181] Construction of pBEMlO and'promoter swap'mutagenesis. Plasmid pPW101 was made by ligating oriT, the region that encodes conjugative plasmid transfer, into pSP72 (Promega). oriT had been amplified from plasmid pEXlOOT (Schweizer and Hoang, 1995, supra) with an introduction of an Ndel and an AatII restriction sites. To create the lpxC'promoter swap'vector, pBEMlO, the following different DNA pieces were amplified and sequentially ligated into pPW101. These included the tetracycline resistance marker (tetR) from plasmid pUCP26 (Olsen, R. H., G. DeBusscher and R. R. McCombie. 1982. Development of broad-host-range vectors and gene banks: self-cloning of the Pseudomonas aeruginosa PAO chromosome. J.

Bacteriol. 150: 60-69), the araBAD promoter from the plasmid pBAD HisB (Invitrogen) with an altered ribosome binding site (rbs) (Guzman, L. M. , D. Belin, M.

J. Carson, and J. Beckwith. 1995. Tight regulation, modulation, and high-level expression by vectors containing the arabinose pBAD promoter. J Bacteriol. 177 (14): 4121-4130), the araC gene, also from pBAD HisB (Lee, N. 1980. Molecular aspects of ara regulation. In The Operon. J. H. Miller and W. S. Reznikoff, eds. Cold Spring Harbor, NY. Cold Spring Harbor Laboratory, pp. 389-410 ; and Schleif, R. S.

1992. DNA looping. Ann. Rev. Biochem. 61: 199-223), and the first 340 base pairs of the P. aeruginosa LpxC gene. The tetR marker was amplified using a forward primer that introduced a BglII site (5'-AGATCTCAAGGGTTGGTTTGCGCA-3') and a reverse primer that introduced an EcoRI site (5'- GAATTCTAATTCTCATGTTTGACA-3'). The araBAD promoter and araC gene were amplified as one piece from the pBAD HisB vector. The forward primer introduced an Mol site (5'-CTCGAGGCATGCATAATGTGCCTGTC-3') and the reverse primer introduced a HintII site (5'- AAGCTTCTCCTGTTAGCCCAAAAAAACG-3'). The rbs was altered from its original AGGAG to CTTCT. The following primer set was used to make these changes and introduced an upstream BssHII site (5'- GCGCGCGGACGAAAGTAAACCCAC TGG-3') and a downstream HindJII site (5'- AAGCTTATTCAGAAGGTTAGCCCAAAA AAACGGG-3'). The first 340 bases of PAO1 IpxC were amplified from PAO1 genomic DNA. The forward primer introduced a HindII site (5'-AAGCTTATGATCAAACAACGCACCTT-3') and the reverse primer introduced anXbaI site (5'-TCTAGAAGCGCTGCCATCCATGATCGG-3').

These pieces were then ligated into pPWIOl to form the final product, pBEMlO, which was used for the'promoter swap'mutagenesis of lpxC. The'promoter swap'scheme is a homologous recombination strategy, whereby transformation of pBEMlO into P. aeruginosa removed the native lpxC promoter and placed the tightly regulated araBAD promoter upstream of the chromosomal copy of lpxC, allowing modulation of its expression by the use of a simple sugar, arabinose (Figure 3). In the absence of arabinose the IpxC was effectively shut off, and expression was inducible by addition of arabinose. Such mutants were selected in the presence of arabinose, and if lpxC is essential, these mutants would not be viable in media that is not supplemented with arabinose, but fully capable of growth in the presence of arabinose.

[0182] Growth curves. Bacterial cultures were prepared by diluting stationary phase overnight cultures to an OD600 of 0. 1 in 5 ml of LB. The inhibitor, L-161,240, was resuspended in DMSO to a final concentration of lOmg/ml and added to the bacterial cultures to a final concentration of 50 vug/ml or 10 pLg/ml. In the samples without inhibitor, DMSO was added to keep the final concentration of DMSO equivalent between samples. The cultures were incubated with shaking and 0.8 ml was taken for OD600 readings over the course of the experiment. DH5a, PA01, and PA0200 (Schweizer, H. P. 1998. Intrinsic resistance to inhibitors of fatty acid biosynthesis in Pseudomonas aeruginosa is due to efflux: application of a novel technique for generation of unmarked chromosomal mutations for the study of efflux systems.

Antimicrob. Agents Chemother. 42: 394-398) were all grown at 37°C. In the cases where temperature sensitive JBK strains were being assayed, the cultures were grown at 42° C for both the overnight and the time course cultures.

[0183] Outer membrane permeabilization. Polymixin B nonapeptide (Sigma) was prepared as a suspension in DMSO at 3 mg/ml final concentration. Erythromycin and Tetracycline were resuspended in DMSO to a final concentration of 250 mg/ml and 125 mg/ml, respectively. L-161,240 was prepared as above in DMSO to a final concentration of 1 Omg/ml. These DMSO antibiotic solutions were individually added to LB to the appropriate final concentration and mixed. Polymixin B nonapeptide was then added to the appropriate samples and mixed. DMSO was added to each sample to keep the final concentration of DMSO equivalent between samples. A stationary phase overnight culture of PA01 was added to each sample to bring the final concentration to 0.1 OD600. Samples were removed for OD600 determinations every 1-2 hours for 6.5 hours and the data from these time points were plotted.

[0184] MIC determinations for'promoter swapped'mutants. Single colonies of DHSa, PA01 and each promoter swap strain were picked and grown in LB at 37°C with shaking for approximately 4 hours. Assuming that an OD600 reading of 1.0 is equivalent to 109 cells/ml, dilutions were made of all cultures to 5x105 cells/ml. 200 of each diluted culture was added to each well where a two-fold serial dilution of inhibitor had been placed. The 96-well plates were incubated at 37°C overnight and their OD600 determined using the Spectramax Plus (Molecular Devices) plate reader.

[0185] To confirm the effect of the arabinose-sensitive promoter in regulating the LpxC expression in the swapped mutants, MIC determinations were performed as above, except that arabinose was added to induce expression of the chromosomal locus and override the effects of the plasmid borne lpxC. In this case the stationary-phase overnight bacterial culture was diluted to 5x105 cells/ml in LB containing Arabinose to a final concentration of 0.2% (a 20% stock made up in water).

RESULTS AND DISCUSSION: [0186] Homology between the E. coli and the P. aeruginosa LpxC enzymes. Using protein analysis software, this study and others have compared the deduced amino acid sequence of LpxC from both E. coli and P. aeruginosa (Hyland, S. A. , S. S. Eveland, and M. S. Anderson. 1997. Cloning, expression, and Purification of UDP-3-O-Acyl- GlcNAc Deacetylase from Pseudomonas aeruginosa : a metalloamidase of the lipid A biosynthesis pathway. J. Bacteriol. 179 (6): 2029-2037). This comparison revealed 82% similarity and 57% identity shared between the two sequences. This homology was found over the entire length of the protein sequence (data not shown). Significant homology with other known acetyl-or acyltransferases was not found, suggesting that LpxC is unique among acetyltranferases. The two proteins also share a total of five fully conserved Histidine residues that are presumed to be responsible for the zinc metal cofactor coordination. It was therefore expected that an inhibitor that functions by chelating the metal cofactor away would affect both enzymes similarly.

[0187] LpxC is essential for growth in P. aeruginosa. Since the hydroxamate inhibitor was effective in preventing growth of E. coli, but completely ineffective against P. aeruginosa, there was a possibility that LpxC was not essential in P. aeruginosa This could be as a result of the presence of another enzyme that catalyzed a similar function. If that were the case, elimination of the LpxC function should be possible without inhibiting bacterial growth. A thorough analysis of the P. aeruginosa genome sequence revealed only one LpxC homologue. An attempt to disrupt the function of this LpxC homologue was made by conjugating wild type PAO1 with a suicide vector (pEXl 8T) carrying lpxC whose BamHI-SalI fragment had been replaced with a gentamicin cassette. However, P. aeruginosa null mutants could not be established by this method. In several attempts a few gentamicin resistant trans- conjugants were obtained, but in all these cases allelic replacement of the chromosomal LpxC by the defective copy had not occurred. Instead, a gene duplication had occurred, placing the suicide vector and the disrupted copy next to the wild type allele (data not shown). This could be demonstrated by the carbenicillin resistance and sucrose sensitivity acquired by these trans-conjugants, both of which are encoded on the suicide vector. These data indicated a strong negative selection for the sought after disruption of IpxC suggesting that lpxC is essential for growth. To confirm this, an experiment was carried out whereby the trans-conjugants were transformed with either lpxC on a low copy, replicating vector, or vector alone. In 100% of lpxC transformants, resolution of the gene duplication as demonstrated by the loss of carbenicillin resistance and sucrose sensitivity was observed, as opposed to no such resolution among those transformed with vector alone. These results suggested that the wild type genomic allele could be disrupted if a functional copy was present on the transforming plasmid.

10187] In another attempt at demonstrating essentiality of LpxC in P. aeruginosa, the 'promoter swap'strategy as described in materials and methods was carried out.

'Promoter swapped'pseudomonas mutants were fully capable of growth in the presence of arabinose when the arabinose sensitive lpxC promoter was turned on, but completely incapable of growth in the absence of this inducer. This further confirmed that in P. aeruginosa, just as in E. coli, LpxC is essential for growth.

[0188] E. coli expressing LpxC from P. aeruginosa is more resistant to L-161, 240. The E. coli strain JBK-l/pKD6 contains the chromosomal lpxC gene disrupted with a kan element and a wild type copy of E. coli lpxC on the temperature-sensitive replicon pKD6. The strain was constructed as described by Sorensen et al., 1996. Since lpxC is essential for growth, this strain is not viable at 42° C because the functional copy is on the temperature sensitive replicon. Transforming JBK-l/pKD6 with IpxC from either E. coli or P. aeruginosa on a non-temperature-sensitive replicon (pKD19, TetR) and selecting at 42°C, produced transformants that were viable at 42°C, tetracycline resistant, and kanamycin sensitive. This result indicated that lpxC from P. aeruginosa could be expressed in the E. coli background, and was capable of substituting for the missing chromosomal copy. An unexpected result was that whereas the JBK-1 carrying the LpxC copy from E. coli was still sensitive to killing by a slightly higher concentration of L-161, 240, the JBK-1 carrying the LpxC copy from P. aeruginosa was resistant to up to 50, ug/ml, about 50 times above the MIC of the wild type organisms (data not shown). This suggested that the P. aeruginosa enzyme was uniquely resistant to this inhibitor. It also meant that this resistance was the reason for the failure to inhibit growth of P. aeruginosa, and not reduced permeability, or efflux or modification of drug by the pseudomonal enzymes. This, in turn, suggests that a program designed to search for inhibitors for the pseudomonal enzyme should be based on screening directly on that enzyme, and not the surrogate enzyme from E. coli.

[0189] L-161,240 is a substrate for the major drug efflux pump of P. aeruginosa.

The completed P. aeruginosa genome reveals genes for at least nine homologous, multicomponent, multidrug efflux systems (Stover et al. , 2000, Complete genome sequence of Pseudomonas aeruginosa PAO1, an opportunistic pathogen, Nature 406: 959-64). However the only one that is constitutively expressed to a high degree in the wild type strains is MexAB-OprM (Kohler, T. , M. Michea-Hamzehpour, and U. Henze.

1997. Characterization of MexE-MexF-OprN, a positively regulated multidrug efflux system of Pseudomonas aeruginosa. Mol. Microbiol. 23: 345-354). Therefore, mutants of this efflux system can be used to evaluate the consequences of diminished efflux pump activity. These mutants would be expected to be highly sensitive to a number of antibiotics. Such a mutant, PAO 200, has been isolated (Schweizer, 1998, supra), and whereas it shows a higher level of sensitivity to a number of antibiotics (Westbrock- Wadman, S. D. R. Sherman, M. J. Hickey, S. N. Coulter, Y. Q. Zhu, P. Warrener, L. Y.

Nguyen, R. M. Shawar, K. R. Folger, and C. K. Stover. 1999. Characterization of a Pseudomonas aeruginosa Efflux Pump Contributing to Aminoglycoside Impermeability. Antimicrobial Agents and Chemotherapy. 43 (12): 2975-2983), it was not more sensitive to L-161,240 (Figure 4). This suggests that this drug compound is not a substrate for this efflux system in P. aeruginosa.

[0190] P. aeruginosa is not less permeable to L-161,240. Low permeability of the outer membrane is a major contributing factor to the observed high levels of intrinsic drug resistance in P. aeruginosa (Nikaido, H. 1998. The role of outer membrane and efflux pumps in the resistance of gram-negative bacteria. Can we improve access? Drug Resistance Updates. 1: 93-98). This low permeability is due to the fact that P. aeruginosa lacks the homolog of the relatively efficient, trimeric porins like OmpF. P. aeruginosa has, instead, OprF, the OmpA homolog, which produces channels only when it is folded into a rare conformation, and only a small fraction of these channels occurs in the open conformation. As is usually the case with P. aeruginosa it was assumed that the reason L-161,240 was ineffective against P. aeruginosa was the lack of permeability of the outer membrane to this inhibitor. Polymixin B nonapeptide (PMBN), a derivative of Polymixin B that lacks the fatty acid tail, is capable of binding to the polyanionic LPS molecules and disrupting the bilayer structure, thus increasing the permeability of the outer membrane. PMBN has been used this way to permeabilize the outer membrane of many gram-negative bacteria (Vaara, M. and T. Vaara. 1983.

Sensitization of gram-negative bacteria to antibiotics and complement by a nontoxic oligopeptide. Nature 303: 526-528), including P. aeruginosa (Vilianen, P. and M.

Vaara, 1984. Susceptibility of gram-negative bacteria to polymixin B nonapeptide.

Antimicro Agents Chemother. 25: 701-705) and effectively sensitize them to lipophilic antibiotics. Unlike the acylated polymixin B, PMBN is not cidal. In order to determine the effect of outer membrane exclusion of L-161, 240, we exposed P. aeruginosa to PMBN in combination with L-161,240, and with other lipophilic antibiotics as positive controls. Whereas PMBN lowered the MIC of tetracycline for P. aeruginosa more than 16 fold, the sensitivity towards L-161, 240 remained unchanged (Figure 5). This, together with the E. coli expression data indicated that permeability was not a major factor causing the inability of L-161,240 to inhibit pseudomonal growth.

[0191] P. aeruginosa expressing only E. coli LpxC is more sensitive to L161-240 than wild type. Using the'promoter swap'technique as described in the methods, it was possible to replace expression from the wild type chromosomal copy of P. aeruginosa lpxC, with expression solely from a plasmid borne copy. For this experiment,'promoter swapped'P. aeruginosa was transformed with either vector containing P. aeruginosa lpxC ("PA Swap &num 1"), or vector containing E. coli lpxC ("PA Swap &num 2'). The transformants were then exposed to various concentrations of L- 161,240 for MIC determination. Transformants expressing the E. coli enzyme only were much more sensitive to the inhibitor compared to organisms expressing the P. aeruginosa enzyme (Figure 6). These transformants were sensitive enough to be comparable with the sensitivity seen in E. coli. Since the validity of this observation relied on the un-induced arabinose-sensitive promoter to shut down expression from the chromosomal copy of lpxC, it was necessary to demonstrate how effectively this happens. To do that, MIC determinations were performed as above, except that arabinose was added to induce expression of the chromosomal locus. For this experiment stationary-phase overnight bacterial cultures were diluted to 5x105 cells/ml in LB containing 0.2% arabinose. In this case all the transformants, regardless of what gene the vector contained, were resistant to killing due to the expression of the chromosomal copy of P. aeruginosa IpxC. This confirmed that certain intrinsic properties of the P. aeruginosa enzyme are resistant to inhibition by this hydroxamate inhibitor. It also confirmed that neither reduced uptake, efflux, nor modification of the inhibitor play a significant role in this observed resistance. Considering the very high similarity between the two enzymes, this finding was not expected.

[0192] But on further examination and analysis of existing data, it was possible to recognize some inherent differences that might explain this finding. Whereas both these enzymes share five conserved Histidine residues, the E. coli enzyme has two more Histidines that have no counterparts in the P. aeruginosa enzyme. This is an important difference because these residues are probably involved in the metal cofactor coordination. It was also observed earlier that whereas the E. coli enzyme is not sensitive to EDTA, the P. aeruginosa enzyme was significantly inhibited by as little as 2 u. M EDTA. Evidence that the E. coli enzyme is also a metalloenzyme is that the envol mutation, which has one of the conserved Histidines (His 19) replaced by a Serine, is sensitive to EDTA. It was because of these observations that these investigators suggested that the E. coli enzyme has a more stably bound metal than that of the EnvAl mutant protein, and thus it is less accessible to EDTA than the wild type P. aeruginosa enzyme. These observations suggest that the Histidine'patch'that is involved in the metal coordination is not similar between the two enzymes. It is conceivable therefore that since the inhibitor works by chelating the metal cofactor away from the enzyme, each'patch'has unique features that result in disparate reactivities towards the inhibitor. It is also important to consider the findings of Wyckoff et al. , 1998. Hydrocarbon rulers in UDP-N-acetylglucosamine acyltransferases. J. Biol. Chem. 273 (49): 32369-32372. These investigators found that LpxA, the first enzyme of lipid A biosynthesis, is very selective for the length of its acyl donor substrates. Whereas E. coli LpxA prefers R-3-hydroxymyristoyl-ACP to R- 3-hydroxydecanoyl-ACP, P. aeruginosa LpxA prefers the opposite. The products of the LpxA reaction therefore differ in the carbon chain length of their lipid moieties between the two bacteria. Since the product of the LpxA reaction is the substrate of the LpxC reaction, this observation suggests that the two LpxCs would have substrate binding pockets of different sizes to accommodate the different size substrate. That would, in turn, suggest that inhibitors that have to occupy that active site would be unique for each enzyme.

Examples 3-7: ispA, ispB, uppS, aroC, aroK, and metK [0193] Several more candidate genes from the HTTIM gene database were tested for essentiality using a single crossover knock-out strategy. The Pseudomonas genes targeted for knocking out were ispA, ispB, uppS, metK, aroC, and aroK. To attempt knock-outs, regions of about 300 bp were cloned into the vector pPW120. These regions were selected so that known active site residues (or highly conserved residues likely to be essential for enzyme function) would be separated after generation of a single-crossover knock-out. The regions were (numbering from the start codon): ispA, 283-594; ispB, 319-610, uppS, 103-402 ; metK, 415-732; aroC, 385-684; aroK, 175- 375.

[0194] The pPW120 vector carries an E. coli origin of replication, but not a Pseudomonas origin of replication, making it a suicide vector. It also carries an origin of conjugal transfer and antibiotic resistance genes for tetracycline and ampicillin. An E. coli donor strain (SM10) carrying the pPW120 knockout constructs was incubated with Pseudomonas strain PAO1 to allow conjugal transfer, and recombinants were selected by plating onto media containing tetracycline at 100 pg/mL and chloramphenicol at 10 j. g/mL. Pseudomonas recombinants will be resistant to this antibiotic mixture while wild-type PAO1 and the E. coli donor strain will be sensitive.

Aromatic amino acid recombinants (aroC and aroK) were then tested for auxotrophy by plating onto minimal media with and without phenylalanine, tryptophan, tyrosine, and folic acid at 100 jug/mL while maintaining tetracycline selection. The genes ispB, uppS and metK did not yield recombinants, demonstrating that they are essential genes in all media conditions, while ispA yielded slow-growing recombinants (suggesting that this gene may nevertheless be an"important"gene according to the invention).

[0195] For ispA, ispB, uppS, and metK, the conjugation procedure was also done in the presence of the complementing plasmid pBAD/HisP. This plasmid has both E. coli and Pseudomonas origins of replication, an antibiotic resistance gene for carbenicillin, and an arabinose-inducible copy of the full-length wild-type gene. In this way, recombinants with the chromosomal copies of ispA, ispB, uppS, and metK knocked out could be isolated since the vector copy would provide complementation.

[0196] The genes ispB, uppS, and metK are novel with regard to P. aeruginosa. The gene ispB (PA4569, ranging from 5116864 to 5117832 in the genome), has 67% similarity/52% identity to IspB in E. coli, and was assigned to the function class concerned with biosynthesis of cofactors, protein groups and carriers, and energy metabolism, with a confidence level of 2. It is thought to be involved in the pathway of ubiquinone biosynthesis.

[0197] The gene uppS (PA3652, ranging from 4091654 to 4090899), coding for undecaprenyl pyrophosphate synthetase, has 69% similarity/57% identity to the uppS gene in E. coli, and was assigned to the function class involved in biosynthesis of cofactors, protein groups and carriers, cell wall and capsule, with a confidence level of 2. It is separated by one gene (casa) from dxr, which is involved in the synthesis of isopentenyl diphosphate, a precursor of undecaprenol phosphate.

[0198] The gene metK (PA0546, ranging from 604896 to 603706) had never been characterized in P. aeruginosa, although it is 82% similar/72% identical to MetK in E. coli. The gene encodes methionine adenosyltransferase (adomet synthetase) which is involved specifically in methionine metabolism, and was originally assigned to a function class of amino acid biosynthesis and metabolism and central intermediate metabolism with a confidence level of 2.

Example 8: rrF [0199] The essentiality of the P. aeruginosa rrF (PA3653, ranging from 4092227 to 4091670) gene was tested using the promoter swap methodology disclosed herein. The N-terminus region (position 1-327) of the gene encoding the ribosome recycling factor (frr) was cloned into the plasmid vector pBEM10. A single crossover was constructed as described above for lpxC. Recombinants were unable to grow in the absence of arabinose, confirming the essentiality of this gene. The rrf gene encodes ribosome recycling factor, alternatively known as ribosome releasing factor, assigned to the functional class pertaining to translation, post-translational modification and degradation with a confidence level of 1. Although this gene was previously known in Pseudomonas aeruginosa, confirming the essentiality of known genes using the methods disclosed herein will reveal new utilities for such genes as targets for the identification and design of new antibacterial drugs. _- .", < _ _. w ;,,. , :. s s ! ! t' ' :-. a . fy : ; J'w : . aa'g . . r, r.. . s Y ...,..,.. .. .. d.. t 'Y'r .. Pid. n,.. e., ,' !", : s.. t, w/. y. - : 'PA0001 j 39J 9 tchrompsonjep) icationmiatpr protein ! : _P_A0004 9945822DNA g _rase subunit B, YrB : PA0006 9945824 conserved hypothetica) proteinj ! j/3sD""' 'PAOOOS""'9945826Jg) ycy)-tRNA synthefase beta chain) g) yS''"""""' '650-'9945827 fycyi-tRNAsynthetaseatpha chan ! g) yQ J---'"--"--- iPA0011J 45830 probabte'"'"""'"-.. - ! pA0015 JIMJlX. P° ! lst ! pr, .... L.. L. L'I. L" "J"II 1..--I"" ; PA0022 9945841 conserved hypotheticalNprotein , wyrdC ^ 'PA0026 9945846 hypothetical protein ! PAID033 9945854 hypothetical protein 'PA0035 9949945856 t ptophan synthase alpha chain _ trpA ! PA0038 9945859 hypothetical protein PA039__ T_9_945860 hypothetical protein 9945864 h pothetical protein ! PA0047 9945869 hypothetical pot (Lin (PA0052""'"9945875 hypothetica) protein ! "] LA005L 9945876 hypothetical protein t PA0054 9945877 conserved hypothetica) protein ! yjitJ PA0055 9945878 hypothetical protein H' ; PA0058 9945881 hypothetical protein PA0059 9945882 osmoticaOy inducibfe proteinpsmC ! osmC 1pua0060 9945883 conservpot in 'iPA0061 9945884 hypothetical protein , _. ... .. _. _......., _. __.... _. _.,. .., _. ...... iPA0065 9945889 hypothetical protein _945892 hKpotefii protein JPA0070"9945894 hypothetica ! proteinJ PA0070 9945894 hypothetical protein PA0080 9945905 hypothetical protein PA0082 9945907 hypothetical protein PA0094 9945920 hypothetical protein ip JPA0105 9945932 cytochrome c oxidase, subunit) !'pxB co !""' ! _. _ ; __ 0P994593_ _y9oh- ; 9 45936 h pothetical rotein ; 9945938 h pothetical protein _- , PA0113 9945940 probable cytochrome c oxidase assembly factc Y' . _... __. _. PA011414 9945941 conserved hypothetical protein Pua0115 9945942 conserved hypothetical rotein ; PA01_16 9945944 hypothetical protein i ; 3 PA0119 9945947 probable dicarboxylate transporter, _ 91P.-1. 9945948 j probabie transcriptipna) reguiatorH......... [I......'...... J........ 1111] 124 9945952 hypothetical protein PA0124 yp p m PA0125 9945953 hypothetical protein j PA0128 9945956 conserved hypothetica) protein ! "jphnA, 9945960 hypothetical protein . PA0133 1 9945962 probable transcriptional requlator iPA0135 9945964 hypothetical protein 9945969 alkyl hydroperoxide reductase subunit C'amp 'iPA0143" ; 9945973 prpbabtenudepsidehydrofase...... 11.."""" !". 1-.... 1...-1 ' ! PA0145 9945975'h 'jPA0149"J 9945980 iprobabiesigma-70 factor. ECFbfamity""'""""'J : PA01] 54 9945985'protocatechu3, 4-dioxqenase, aipha subURpcaG'--------............ i PA0159 9945991 ! probabie transcriptionaijregutator"'"","""'"""'"""''" : P_AO_1_67 ; _99_4_5999p_robable transcrip_tionai regula#or.... m, _M... _.. _.... _.........' 'PA0161 9945993 hypothetical protein y_-_. __. . _.a __. _. _. ___. _____.. _ PA0170""19946003 J hypothetical protein""""""""""" :"'------------'.-....--.--. j JPA0171'""'"9946004 J hypotheticai protein'"IL'''1 IjJIII""'""-"---"----i PAO 182 9946016 ! ! probable short-chain dehydrogenase asa . . _.. __.. _... _.. ___. __ : _. _. . _. _.. _____. __. _... _. _____. _. _.. ____. _..... __. _. ___. ___.. ___. _____. __.. __., _. __...... _... _. _. _.. _. _. ___.. _. _........ _...... _......... __... _...... _.... _..... _. _. _.. ___., 99460181 prob _oTponent of ABC trani3 PA0184 able ATP-binLirIQ PA0187 994602lihyp, in _. _. _w : _______. _..... _.. ___. _. _, .. PA0200 9946035 hypothetical protein LPA0202. 99460371 probable amidase PA0203 . °'-. ___.. robable bindin rot __ 9946038 f p g p ein component of ABC tr ; ; PA0204 9946039 probable permease of A_BC transporter f , PA020_5 _ :99946040, probable permease of ABC transporter _ PA0207 ! 9946042 proba. btetranscriptionatregujatpr"""'j''""j PA0209 9946045, conserved hyp thetical prote. in mdcb , PA0211 99460471 malonate decarboxylase beta subunit 1 mdcd PA021_3 __ ; Y999460491 hypothetical protein i, much PA0216 99460521 probable lmadm PA0233 j _ 9946071 probable transcriptional regulator PA0236 bable transcriptional regulator PA0238 1 99460761 hypothetical protein {PA0243"'9946082 J probabie transcriptionai regmator L-*" TL1---II--LIII LIIJ . PA0244'")'9946083 hypothetical protein"''T'J'"'L----I---. J iPA0244 I 9946083i hypothetical protein PA0245 3-dehydroquinate dehydratase aroQ2 laroD2 PA0250 9946090 ! conserved hypothetical PA0258" ! 9946098 jT) ypotheticai protein'"j'") PA0258 1 9946098 hypothetical protein 9946101 hypothetical protein P 264 9946105 hefical-ro-tein PA0273 99461151 probable MFS transporter 1PA0279 9946122 probabie transcriptionai regutatprj l5IIIIIIIIJ IPA0280 9946123 sulfate transport protein ic_ ______. _. _. ____. __..... _ ! PA0284 ; 9946127 hypothetical protein- _ 3 __ j ; PA0309 9946155 ! hypothetica ! protein J"'f , PA0311 9946157 hypothetical protein ! PA0320"T 9946167j conserved hypothetical protein iPA0332"T 9946180 hypotheticat protein] 'IL- PA0332 : w99461801 h othetical protein _ _ E iPA0332---646 ! 8bi hypothetical protein PA0339' (9946187 hypothetica) proJ.. L. II"'J"L--II-.-.-1 PA0341 J 9946190 protipoproteindiacytg ! ycery) transferase Jigt umpA PA0341y 'g946191 thymidylate synthase, _ y_ v PA0342 th A ; PA0350 j 9946200 dihydrofolate reductase olA tmrA __ PA0358 _j 9946208 hypothetical rotein _ __ ____ ___ ___ PA0362 9946213 ferredoxin [4Fe-4S) ifdxl ! PA0363 9946214iphpsphopantetheineadeny) y) trans lE hypothetical protein iPAa370__.. _.-.---9946222'. conserved hypothetical protein---....... . wHH-. __. _. __....... _.. _iyhhF... _. __...... __.. __. _...... __. _.. _.. _. _... _. _.... _. ! ; PA0373 9946225 signal recog nition particle receptor FtsY ftsy E PA0376 9946228 ! jsi'gma factor PA0377 9946229'hypothetical protein PA0380 9946232 ! conserved lpoth ! ical .......... PA0384 _g946237 . . - -_.... _.... _.... _.... _. _. _.. _.. _..... _. ___.... __.. ;'y.... __.. _^__. YPothetical protein __. _. _.. _. ____ _. __... _ __. ___ __. _. _.. ___. _.. PA0402 99462561aspartate carbamoyltransferase pyrb 9946257'transcriptional regulator PyrR pyrr PA04. 10. 4.--......,. !--. 9946258i conserved hypothetical protein iPA0405 i 9946259 ! conserved hypothetical protein IEPA101407 99462621glutathione synthetase lgshb PA0416 9946271 probable transcriptional regulator ichpd PA0416] 9946271 jprobabte franscriptionaf reguiatorL-J. 1-IIItchpD ["-"-"-- PA0422 1 994Q278 conserved hypothetical protein PA0427 9946283 outer membrane protein OprM precursor zou PA0433 9946290 hypothetical PA0442 9946300 hypothetical protein PA0443 1 9946301'probable transporter 46304 probable transposase PA0446 J 9946305 conserved hypothettca) protein ! PA0448'. _. !99946307 probable transcriptioiial _. PA0453 9946312 hypothetical protein PA0456 j 9946316 probabte coid-shock proteint"j r yp. e_n PA0466 i 9946327 hypothetical protein JITT'llj PA0475 9946337 probable transcriptional requlator --AO4-77-- 9946339 probable transcriptional regulator PA0477'9946339 p J j PA0479 9946341 probabie transcriptiqnai regutator L--" PA0488"1 9946351 conserved hypothetical protein Im PA0489] 9946352 probabie phosphoribosyt transferase j PA0490 9946353 hypothetical protein PA0493 1 9946356yi p''quiring _ _ PA049able biotm-retuinng enz me Pari 9946365 8-amino-7-oxon'IIILJJ -A050-2 9946366 probable biotin biosynthesis protein b_ioH bioH PA0503j 9946367 probabie biotin synthesis protein BioCJ [biqC J PA0504 9946368 dethiobiotin synthase _ T ! bioD j PA0505 9946369 hypothetical protein PA0514 9946379 heme d1 biosynthesis protein Girl PA0527 s^946393 transcriptional regulator Dnr __A_ adnr _ ___ __ _ PA0531 j 9946397 probabfe gfutamine amidotransferase. jI j PA0535 9946402 ! probable transcriptional regulator PA0540 j 9946407) hypothetical protein PA0542 ; 9946409 e conserved hypothetical rotein ; _-1 C PA0543 99464101 hypothetical protein------ PA0544 T 9946411h othetical roten I-, _ PA0546 9946414 methionine adenosyitransferase metK PA05SO 9946418 conserved hypotheticai protein ygbM posphoglyycerate kinase pg k 9946422 ! hypothetical protein [PA0555r 9946424'fructose-1, 6-bfsphosph fda . J. .'. cbbA, cfxB s ; PA0559 9946428iconserved hypothetical protein tyhiN, PA0565---"-6946-4341 conserved h pothetical protein PA0565 9946434} conserved hypothetical protein iyqaE PA0570 §-946-4401 hypothetical rotein PA0570''9946440 jhyppthetica) protein"I"'.'.... I "'".----. PA0571-------5 : Z6-4=-4-1-.,'hypothetical protein ', PA0574 ... . _. _. _.. 9946444i hypothetical protein. PA0578 9946449 !, conserved hypothetical protein PA0579""''9946450) 308 ribosoma) protein21"""IPsU"'"' : , PA0580 9946451 jo-siaiogjycoprotein endopeptidase 92EL YSJD.. ; PA0582 9946453 ! dihydroneopterin aldolase fo I B PA0585 99464561. hypothetical protein PA0589 9946461 ! conserved hypothetical protein 9 p PA0591 conserved hypothetical protein PA0593 j 9946465 pyridoxai phosphate biosynthetic protem PdxAjpdxA j PA0594 ; 9946466 peptidyl-prolyl cis-trans isomerase SurA sura PA0595 ! 9946467 organic solvent tolerance protein OstAprecurpstAirnp ! } PA0607 ! 9946481 ribuiose-phosphate 3-epimeraserpe dod ! PA0610 9946484 ttranscriptiona ! reguiator PrtN jprtN ! 1 PA0611"9946485jtranscriptiona) regutator PrtR"fprtR"'''"T PA0613---9946-487 hypothetical protein PA0614 r 9946488 hypothetical protein PA0617 9946492 j probable bacteriophage protein ! PA0626 9946501 j hypothetical protein ! PA0627 9946502 conserved hypothetica) prote ! n... jj PA0617 9946492 probable bacteriophage protteiin I PA0627 ; _- 9946502consehrveld hyp t_ein.-p othetical rotem_ -PA06-30-"'F----§-946-505 rotein PA0632 9946507 hypothetical protein___,- PA0635 9946511 hypothetical protein ! PA0643""1"9946519 hypothetica) proteinJJIIIIIIL j ! PA0644 j'9946520 hypothetica) protein"'j" PA0643 9946519 hypothetical protein _ _ _ _ __ _ PA0644 99465201 hypothetical protein PA0647 99465241 hypothetical protein PA0648 99465251 hypothetical protein IPA0652 9946529 1 transcriptional regulator Vfr 1 vfr ! f PA0653 i _994_6530 conserved hypothetica_I protein ; --_, y fA PA0655-. M. j 9946532 h potheticalrolp tein_--, , .. _ y-. _.. _ , PA0680 9946538 h othetical prote'in ; 'PA0661_ I 9946539 conserved hypothetical protein _ W _, _ _" PA0665 i 9946543 ! cpnserved hypothetica) protein...... YR PA0678 9946558 probabte type)) secretion system protein PA0679'"'9946559 hYpothetica) protein""jhxcP '" PA0680_ s 9946560 p_robable type II secretion system prote ! n hxcV PA0684 ; 99probable type II secretion syterg rqtein hxcz PA0686"'9946566 probable type)) secretion system prote ! n' hxcR 994687 994656i probable type II secretion system protem ; PA06_8 9946570 hypothetical protein y _ PA0697 9946579 hypotheticat protein.. PA0698) 9946580 hpothetical protein s -----_-_-y ' h othet'_p PA0700 9 46582 yp ical rotem f_ JPA0702"J 9946585 j hypothetica) protein"L-JI. JHI'lL- !- 'PA0702 9946585'hypothetical protein . PA0705 9946588 ; probable glycosyl transferas .. __. __ _. . _ 9A PA0708'9946591 probable transcriptiona ! regulator"j'......--.---. ! ! PA0709 9946592 hypothetical protein ! PA0710'"""9946593 iactoyig ! utathione ! yase'','g'o6'" __.... _.. . _.. _.. _..-.. . , _PAO_712'_ 9946595 i hypothetical protein 'PA0714 99465981 hypothetical protein ! PA0716"9946600 hypothetica ! protein'""I"1L-..-'J """---- P _716 _9946600 hypothetic_al protein_ _... ___. ____ _.. __ :.. _. _.. m. "'.. ___. __. _ _.. _. _ !. PA0717"9946601 hypothetica ! protein of bacteriophagePflj"''"' PA0720""9946604 hejixdestabiiizing protein of bacteriophagePf ; PA0728 99466136probable bacteriophage integrase N w 1 _ __. _. _... __ _ 1PA0729 9946614 ! hypothetical protein PA0730 9946615 probable transferase 99466 ip PA0733 9946618 probabtepseudoundyiatesynthasej rsuA PA0734 9946619 hypothetical protein Pua0738 ! 9946624 conserved hypothetica ! protein !' ! FPA-07472-9946628 hypothetical protein j PA0759 ! 9946647 conserved hypothetical protein ----§946-651 anti-sigma factor Muta Pua0767 j 9946655 GTP-binding protein Liera ......... PA0768--6661signal peptidase I __. _. __., __. ei SPASE.. I _. _. _... ______. _... PA0771 9946660IGTP-binding protein Ers liera PA0776 9946665 hypothetical protein YP P. _ PA0778 9946, 667 hypothetical protein........ PA0786 9946676 probable transporter PA0787 9946677 hypothetical protein PA0790 fuzz 9946681 hypothetical rotein PA0802 9946694 hypothetical protein PA0805 99466971 hypothetical protein PA0808 99467011 hypothetical protein PA0815 99467081 probable transcriptional regulator PA0818 in PA0822 99467161 hypothetical protein PA0822 ! 9946716 hypothetica) protein) j i PA0825 othetical protein P, hy., __.... _....,.. __ PA0829 1. 9946723 probable hydrolase PA0837 9946732 peptidyI-prolyl cis-trans isomerase SlyD,,. islyd IPA0850 9946747 hypothetical protein PA0851; 9946748 hypothetical protein PA0853 j 9946750 ! probabieoxidoreductaseT" ' PA0857 j 9946754 j morphogene protein Bols bols I PA0862 _ ; 9946760, hypothetical protein PA0867 1 9946766 hypothetical protein.........-------- PA0868"9946766 conserved hypotheticai protein''"'"""ya&J'""'"""' PA0869 9946767 D-alanyi-D-alanine-endopeptidase rvpbpG i ^_ _T PA0871 9946770Epterin-4-alpha-carbinolamine dehydratase phhB 1 PA0874 9946773 hypothetical protein PA0880 9946779 probable ring-cieaving diqxygenase't ! ! PA0894 99467941 hypothetical protein iPA0900 i 9946801 l hypothetical protein PA0903 9946804 ! alan 1-tRNAsynthetase : alas s : PA0904'9946806iaspartatek ! nase alpha iPA0905 9946807 jcarbon storage regulator .. .'9srA''<'--- PAt) 906 9946808 j probabie transcriptiona ! f7egu ! ato -.-.-.......- g u 1 ; to r iPA0908 9946810 : protein PA0913"'""9946815 ! probable Mg transporter MgtE'"'"""" ? rngtE'.-.-.----..- ; PA 468251 hypothetical protein __. _ __'. f-__. r j __ ; ,.. _. _. : __. ___. __. __.. _______ . ___, ___.. ____.. ; IPAO_927 _ _."., _9946831 D lactate dehydroge_nase__ (fermentatme..""".,-,"_ cldhA w IPA0932- _m 9946836jcysteine synthase B_-, __ H s. jPA0937 ; 9946842iconserved hypothetical protein' 3yaiL [PA0939''""'j9946844 hypothetica ! prote ! r . L . I ! I ! {PA0944, 9849 pjhosphobpsytamHoimid iP [N ! *" ! [PA0945 99465-0'lphosphoribosylaminoimidazole svnthetase ipurm PA0947 i 9946853 conserved hypotheticat protein ! -P-0953 9946859 ! probable thioredoxin PA0954 f 9946860 probab) eacy) phosphatase ! '"J PA0956 i 9946862 ! Lprolyi-tRNA synthetase PA0960 i 9946867 hypothetical protein PA0962 j946869 probable dna-binding stress protein ! ? A0969 9946876 ToQ protein J to) Q''"'J PA0970 46877 ToIR protein tolR 9946878TolA rotem PA0971 _ p'tolA PA0971--9-946-878, TolA protein tola . . J _ .. Pua0973 9946880 outer membrane protein OprL precursor PA0976 j'-9946884 conserved hypothetical protein PA0978 9946886 conserved hypothetical protein PA0979 9946887 jconserved hypothetica) proteinIj. ! IL---' PA0980_ _ 9946888 hypothetical protein ,. _. _... _.. _. __. PA0981 9946889 hypothetical protein PA0983 9946891 conserved hypothetical protein ---946-893 1. p .... ,. .... », JPA0986j 9946894) conserved hypothetical protein conserved hypothetical protein_. __. PA0991 9946900 1 hypothetical protein PA0993 9946902 probabie pi) i assembiy chaperone PA1000 9946909, hypothetical prote_in__ _ ( !'_. __.... _ PA1008 9946918 bacterioferritin comigratory protein loci Pua1010) 9946920 dihydrodipicolinate synthase dapA ; PA1012 1 9946922 conserved hypothetical protein PA1013 9946923 phosphoribosyiaminoimidazote-succjnocarboxurC' ! PA1021 _j 9946932 ; probable enoyl-CoA hydratase/isomerase j PA1021 9946932 probable enoyl-CoA hvdratase/isomerase ! PA1026 9946938, h pothetical protein PA1035 9946948 hypothetical protein PA1039 ! 9946952 conserved hypotheticai proteinL-.-. L' ychJ ! PA1049 9946963 pyridoxine S'-phosphate oxidasepdxHj PA1055 9946969 conserved hypotheticat protein lphac PA1063 ; 99478 hypothetical protein _ y _ _ _ _ __ ! ! PA1068 j 9946983 probabie heat shock protein (hsp9p fami ! y)"'"'J'') 'PA1076) 9946992 hypothetical protein yPA1088 ! 9947004 ; hypothetical protein _. _.. _..... _.. _ _....... s (PA1089 "9947005 jconserved hypothetica) protein ''..'. 1'"1'.''HL ---.--- IPA1095 9947012'hypothetical protein iflis = r_.. . ___ t,"o_com o_nent s_ensor A1098-". 9947015 ;-P _. _ _..... _.....' rPA1_102.. __ 994701 g ____-_. _. _ _. _. fliG _.. __ iPA-1105 . ... __9947022flaellar protein FIiJ _, _. _rv. _ 1 PAl 106 9947023 hypothetical protein PA1107. _, _... _. __9947025 ; conse_rve_d hypothetical protein........ _... _... _......... ____... _M_.. _Y___. _^... _. _. _. _. __.... _. _. __ iPA1114 a__ etical rotein v _ _ : PA1118 9947037 ! hypothetical protein , PA1120 9947039conserved hypothetical protein yfiN__ _, __ PA1122 _w,... _. ____. __ 9947041 amble peptide deformylase _y , . _ .. . _.. . _.. _v f def, pdf, fus PA1125 ! _9947044 ; probable cobalamin biosynthetic protein M', ^ ; cobB__ PAI 129 1 9947049 probable fosfomycin resistance Rrottein PA1134 '9947054 hypothetical protein' _,. _ ;...... __ .. ___. _. __ PA1135 9947055 conserved hypothetical protein PA1138_ I, _ 9947058probable transcriptional reculator _ y _ ! _ PA1145 i 9947066 pro6able transcriptional re ulator i I-i3'A 114-9 9947071 hypothetical protein PA1151 9947073 pyocin S2 immunity protein _. -i5Al-l 9947076 conserved h potheti6al protein, _. PA1155'9947077 ! ribonucleoside reductase, small chain nrdB _ PA1156 _ 9947078ribonucleoside reductase, large chain ; nrdA _ , PA1129 9947049 j probabie fosfomycin resistance protein'j PA1134 ! 9947054) hypotheticaf protein ! PA1135 J 9947055 j conserved hypotheticat protein ! ysdU PA1138 J9947058 probabie transcriptionai reguiator. [ . PA1145'9947066 probabie transcriptionai regutator j F PA1149 f*"994707T hypothetical proteinHL-.-. "- PA1151 T'9947073 pyocin S2 immunity proteintl'ILt'-.-PA1154 1 9947076 conserved hypothetical proteinJ"'PA1155 9947077 ribonudeoside reductase, smat) chainmrdB PA11569947078 ribonucteoside reductase, targe chainJjirdA J PA1157 J 9947080 probabie two-component response regujator ; ! PA1159"'p'9947082 probabie coid-shock protein JlLjI. LJI. T-. ! JLL-. LLLLL ! PA1160 9947083 hypothetical protein VAif-I 9947 inyl-diaminopimelate desucsin PA1164 ! 9947087 conserved hypothetical protein [J... PA1165 r'9947088 hypothetical protein PA1167 j 9947091 hypothetical protein ° PA1167 9947091 hypothetical protein IPA1172 1 9947096 ;, cytochrome c-type protein NapC __napC ' PA1173 _9947097 cytochrome c-type protein NapB precursor, _eapB PA1176 r 9947100 ferredoxin protein NapF spF ! ! ) PA1177 j 9947101 peripiasmic nitrate reductase protein NapE jnapE'JJ . p p.. _ _...... P_ _ _ p _. p .... ___. _.. Pua1183 9947108 C4-dicarboxylate transport i-,--, 0947119 hypothetical protein , PA1203 9947130 hypothetical protein PA1204 ! 9947131 conserved hypothetical protein ^ __ ! yieF' _ _, , I Pua1206 9947133 hypotheticai protein ____ _., __, __. _.. __. _. ____. _.. ___ _. __. _. ___. .. ____. _ PA1213 9947141, hypothetical protein PA1213 9947141 hypothetical protein. JILjIIII IL-JIIIII--L-J PA1215 3 hypothetical rotein PA1216 9947144'hypothetical protein PA1217 9947145 probable 2-isopropylmalate synthase.. __.... _. _'__...... _.. __. _.. _. _i. ___. __.. _.... _.. _... _____. _. __. p 9947147 hypothetical protein IPA1223 (9947152 probable transcriptional reguiator ; PA1224 9947153'probable NAD (P) H dehydrogenase _ ; Pua1228 9947157 hypothetical protein PA1230 1--'947-159'hypothetical protein 9947162 hypothetical protein 9947167 ! probable multidrug resistance efflux pump [PA1250 9947181. ! aikaiineproteinaseinh ! b ! torApri . I... lapr !"' 'PA1261 9947193 t probable transcriptional regulator , PAi269 9947202'Drobable tra t lator 'PA1280'9947214 ! hypothetical protein fi cobC PA1285'9947220 j probabie transcriptionat regulator j"" ;""'"'""" s_ i tional re PAl 298 9947234 ! conserved hypothetical protein 'PA1300 9947236'. probable sigma-70 factor, ECF subfamily _...,........ _. _.. _......... _.. : PA1306. 99472433probable HIT family protein, y S PAl 306 3 j probable HIT family protein 6. 1' 9947243 prpbabje H) T fami ! y protein"JI"'"""""" 947252 li-Al 315 pro bable, transcri ptional requlator ßPA1321'9947259icvtochrome o ubiquinol oxidase protein CyoElcyoE 3PA1323 9947261 {Ihypothetical protein probable transcriptional re uliatior PAl 328 9947267 9947270 conserved hypothetical protein PA1342 9947282 probable binding protein component of ABC tr z PA1348'9947289ihypothetical protein PA1349 9947290 conserved hypothetical protein PA1349 ! 9947290jconserved hypothetica) protein"T''"I-.- ! PA ! 35CL_ 9947291 hypothetical protein PA1352 9947293 conserved hypothetical protein PA1353 9947295 hypothetical protein PA1355 9947297 hypothetical protein 9947300 hypothetical protein IPA1362 t'9947304 hypothetical protein PA1362 9947304 hypothetical protein PA1364 ! 9947306 probable transmembrane sensor _ i --Al 366 9947309 hypothetical protein IP 1369 9947312 hypothetical protein IPA1369 9947312 hvpothetical protein B g PA1371 9947314 hypothetical protein Yp PAl 372 1 9947315 hypothetical protein | PA1372 9947315 1 hypothetical protein _ __ _ _ _ I PA1375 9947319 1 erythronate-4-phosphate dehydrogenase pdxB _ I 9947319jeythronate-4-phosphate dehydrogenase lpdxb IPA1377 9947321 tconserved hypotheticai protein çyhhY iPA1378 9947322'hypothetical protein |PA1379 probabie short-chain dehydrog_ase'Ç __ ___ 99473401 hypothetical protein IPA1397 9947343 tt rmguiator} ç _ X PA1398 J"9947344 hypothetica ! protein J'1'''J PA1398 9947344, h othetcal rotem f s YP p PA1<1 9947344 hypothetical protein t PA1404 9947351 hypothetical protein | PA1404 W_ H _'i'_ ~_ PA1409 ! 9947356 ace Ipol amine aminohydrolase aphA | PA1426 _ 994737_5 hypotheticai protein-_ _. _ , _ i tPA1427 l 99473761hypothetical protein I , PA1426 9947375 ! hypothetical protein iPA1427 1 99473761 hypothetical protein PA1431 99473801 regulatory protein RsaL rsal I PA1442 ! w __ W §oliL ____*__ PA1427)'9947376'hypotheticai protein111--..-J... I JL'j ifs PAl 442 b9473931conserved hypothetical protein PA1454 9947406 flagellar synthesis regulator FieN PA1456 9947408 two-component response regulator CheY PA1461 9947413 probable c emotaxis protein motb PA1462 9947414 probabie. plasmid partitioning protein PA1464 9947417, probable purine-binding chemotaxis protein J cheW iPA1465 99474181 hypothetical protein 'PA1468 9947421 ! hypothetical protein , PA1472 | 9947425iconserveu_ypotnetlcal protein.,'. Y . _.. __.... _ w fRS 994742 heme"exporterprot-------.....--. PAl 476 9947429' ! heme exporter protein CcmB : ccmb tlO ; cycw ; helb bPA1477 9947431 Iheme exporter protein CcmC, ccmC. pfcyt1 cycZ heiC sPA1478. 9947432i, hypothetical protein ; pfcyt2 ccmD cycX helD.' PA 1480 : 9947434 cytochrome C-type biogenesis protein CcmF ; ccmF cycK ; cc ! 1 JL-'9947435 cytochrome C biogenesis protein CcmG ccmG dsbE iPA1482 ; 9947436Jcytochrome C-type biog_nes_prote, n Ccm tccmH _ c12 cycL _ CPA1488 ; 9947442 ! hypothetical protein '. PA1489 9947443. hvDothetical protein fPA1492'--99474471 hypothetical protein sPA1496 t 99tassium channel,, 9~,, _ _ t PA1504 9947460 i probable transcriptional regulator 1 s 9947464l, hypothetical protein S t ical rotem I PA1. 509, 9947465. hypothetlcal proteln PA1. 509 9947465 ! hypothetical protein PA1514 ! 9947471 conserved hypothetica) protein < IybbT w s PA1517 __ 9947474 conserved hypothetical protein PA1518 1 99474753btical protein S PAl 518 9947475 ! conserved hypothetical protein PA1526 1 9947484Sprobable transcriptional regulator. o_ PA1528, 9947486 cell division protein ZipA PA1529 J !'SdZ. DNAiigaseEII dnaL ! jgAJ' PAl 532 9947490 DNA polymerase subunits gamma and tau dnax PA1533 1 9947491', conserved hypothetical protein S _I PA1535, 9947494 probable acyl-CoA dehydrogenase. PA1539 ! _ 9947498, hypothetical protein I, EAI 54Q 9947499 1 conserved hypothetical protein PA1541"r 99475p0robab ! edruge i. IIL-L-- PA1548 9947508 consenced hypothetical protein I'fixS FPAL 5-48 1 9947508 1 conserved hypothetical protein fixs PA1551 j 9947511 probable ferredoxin í nxe PAl 555 9947515 Probable cvtochrome c Ifixp CCOP 9947519 hypothetical protein PAl 558 PAl 559 1 9947520, hypothetical protein PA1560} 9947521 thypothetical protein _'_S PA1564 i 9947526 conserved hypothetical protein PA1568_ ; 9947530 ; conserved hypothetical protein PAl 571 9947533 ! hyp, in i IPA1582 99475451succinate dehydrogenase (D subunit) t_ I, > PA1582 9947545t e (D subunit) sdhd PA1583 9947546isuccinate dehvdroaenase (A subunlt) ssanA I PA1583 9947546Ssuccinatedehydrogenase (A subunit) sdhA"" PA1587 i 9947550. 1ipoamide dehydrogenase-glc llpau, ipaA u-CoA synthetase beta chain suc PA1589 1 9947553 | succinVl-CoA svnthetase alpha chain, sucD PA1591 9947555 ; h othetical rotein -vir= PA1592..... f_.. 9947556_ _othe_tical pro_tein,. _. ____... ___... _ _....... __... _.. _...... _..... __ PA1591 j 99475551 hypothetical protein PA1592 9947556 1 hypothetical protein PA1595 9947559 ii hypothetical protein { m. r | A _ PA1610 9947559 hypothetical protein PA1610 9947576 beta-hydroxydecanoyi-ACP dehy . irise IP A 1 9947584 1 conserved hypothetical protein lybdb PA1619 t 5. 90 j conserved hypothet ! capot : 9947589'probable hydrolase _. _..... _. ____. ____... _... __.-.9_. _______. _. .. ; _.. __.. __.... __. _. __.. _...... _....... _. _....... _..... _.. _- : _.... _... _. _.......... _.......... _..... _. ___..... _.... _. _........ _....... _......... __.. _. ___... : ; PA1624 ^.. _ 9947591 ; hypothetical proten _. _. _.. _. ___. __. _. _... ____... __..... _... 'PA1632 99476005KdpF protein kdpF'. 3PÂ1635 9947603. potassium-transporting ÅTPase C chaln Kdpi_ s, atkC iPA1638 R 9947606Econserved hypothetical protein <, yneH ÆPÂ1641 ; _ 99476104. hypothetical protein __ _ _,'__ _ __ _ I PA1641'. _PA1657947627 ; conserved hypothetical_p_ro_te__in_ _"_, m"^x. _,''" --"-T-. T-.. _____. _.. _. fPA1641 99476101, hypothetical protein V PA1666'99476371 hypothetical protein i, si IPÂ1673 1 9947645Shypothetical protein S , 3PA1674'9947646 GTP cyclohydrolas-e I precursor, folE2 IEA 16 L3 9947645 hypothetical protein PA1675"'9947647 j conserved hypotheticarprotein)'""""j'"""'j PA1676 i 9947648thypothetical protein 3 PA1687, 9947660 spermidine synthase spee PA1690 9947663 transiocation protejn in type 111 secretion pscU IPA1691 1 9947664 translocation protein in type III secretion psct PA1696 3 9947669 trans ocation protein in t e ifl secretion psc0 ; PA1696 9947669 translocation protein in type III secretion PSCO PA1698 3 9947672 outer membrane Protein POPiN pOplN PA1701 9947675 conserv in type III secre ; PA1702 E 9947676 conserved h pothetical protein in type I I I sec j pcr4 -r j l f PA1705 99476791 regulator in type III secretion. pcru | 3 PA1710, 3 99476843exoenzyme S synthesis proteiX exsC PA1711 f 9947685 hypothetical protein PA1718 9947693 type III export protein PscE _ pscE _S _ ____ PA1719 j 9947694 type III export protein PscF pscg PA1720 9947695 type) !) export protein PscG _ pscG v PA1722 9947697 type))) export protein Psc) i. PscL.'... III. PA1732 w 9947708 conserved h othetical rotem YP p _... _. _. _. . _.. _ PA1732 9947708 conserved hypothetical protein _'_ _* PA1743 ! 99477201hypothetical protein 3j PA1743 9947720 1, hypothetical protein PA1745 99477221 hypothetical protein PA1750 9947728 phospho-2-dehydro-3-deheptonate aldotas, -, _rj-- PA1757 W I 99477_354homoserine_k_inase ; thrH i_ PA1757 I 9947735 ! homoserine kinase PA1772 1 9947752 probabfemethyftransferase""menG""''' 3iPA1777 ii 99477571outer membrane protein uprF precursor ioprr | IPA1780 9947760 assimilatory nitrite reductase small subunit inird nase IPA1783 99477641 nitrate transporter lnasa nast PA1787 99477 aconitatehydratase2 . HLJspn B 'j '9947768 t aconitate hydratase 2 _ acnB PA1787 ' 'PA1790 j 994. 7772 Yhypothetical protein _ _ : _ __ 3PA1792, 99477741conserved hypothetical protein [ybbF PA1794 ! 9947776 gtutaminy)-tRNA synthetase'""" ! ghS"f'""""''"" PA1795 i 9947777|cysteinyl-tRNA synthetase cysS t E gena<,, TolD t PA1796 = _9947778C5', 10-methylene-tetrahydrofolate dehydrog_ena f ID Y--_ __ _ PA1803 9947786 Lon protease () on capR deg muc JopA PA1815 9947800 ribonuclease H rnha [E : 1816 9947801, DNA polymerase lll,, epsilon chain dn@Q imutd (PA1817 99478021 hypothetical protein i. PA1820 i 9947805 ! sodium/proton antiporter NhaB : nhaB 3 __... __. _.. _......... _. _....... . PA1825_ 9_ p P_. t ____....... __.. ___ PA1830'9947816i, hyethetical protein PA1835 y uhyp het p :-,--_-"...-. _... __. _.. _. __.. ___. __.. _. _..... .. _.,.. _.. __... __.. _. _.. i hypothetical protein ; PA1837-. Y. __.. 9947823 ; hypoth_etical protein _-'m. _.. _____. _.. , _.... __. _ _ _ _. ; h- othe _.... _. _. _ IPA1842 9947829 ! hypothetical protein iiPA1845 9947832 hypothetical protein _ e. _. _. _ 9947835 ; conserved. hypothetical protein .......... PA1855 1 99478433hvpothetical protein PA1859. 9947848iprobable transcriptional regulator i 1 ---------- PA1867 T 9947857Lypothetical protein 3 tjxphA . _. PA1869 9947859 probable acyl carrier protein PA1872 9947862 hypothetical protein PA1882 9947873 probable transporter ii PA1882' !"'9947873 probable transporter, [. JIIT*') PA1883 : 9947874 (probable NADH-ubiquinone/plastoquinflne oxo " PA1883 PA1884 99478751 probable transcriptional reg lator 'PA1885 1 9947876 conserved hypothetical protein PA1892 1 9947884 hypothetical protein PA1894 9947886 hypothetical protein PA1895 9947887 hypothetical protein PA1896 99478 8 hypothetical protein PA1897 1 hypothetical protein PA1897 ; PA1900 i 9947893 probable phenazine biosynthesis protein i zB2 PA1905 i probable pyridoxamine 5'-phosphate oxldasw ipnzz PA1911 9947904 probable transmembrane sensor PA1912 99479051 probable si ma-70 factor, ECF subfamily PA1914 9947907 ! conserved hypothetical rotein hvn PA1917 t 9947910|hypothetical protein t iJ PA1924 1 9947918 hypothetical protein PA1 92i5 A ~ x t PA1928 zu 9947923Jiribosomal protein alanine acetyltransferase frimJ __ PA1929 1 9947924 hypothetical protein PA1936 9947932 hypothetical protein A1937 9947933 conserved hypothetical. protein PA1938 9947934 conserved hypothetical protein PA1939 9947935 hypothetical protein I PA1951 9947949 hypothetical protein l PA1952 9947950 hypothetical protein PA1955 9947953 hypotheticai rotp ein ; _ 1PA1956 1 9947953 hypothetical protein PA1962"* ! 9947960 conserved hypothetical protein PA1963 9947962 hypothetical protein PA1965 9947964 hypothetical protein PA1967 9947966 hypothetical protein l s PA1968 1 9947967|hypothetical protein _.. _--S A1 9947974ihpthetical rrtem... ___. ____-.. ___= PA1974 9947974'hypothetical protein g "_.. __ PA1980 i 99479801probable two-comDonent response_tor { ; PA1985 ! 9947986 ; pyrroloquinoline quinone biosynthesis protein i, pqqA : ; .. _........ _. _ __... _ _... _.. _... __. ___..,..... __.. _. _., _ PA1986 : 9947987i. pyrroloajuinoline quinone biosynthesis protein tqB' 1PA1988 9947989rroloquinolme quinone biosynthesis protein tqqD si PA1994'_ 9947996 1 hypothetical protein _ __ ç _ i __ _ _ H95 i, 99479971 hypothetical protein A 9 i 9 tÇcis träñs isor i äse C1 ppj ... _ __ _---_+ __S-- '_ ce I CoA acet Itransferase B PA2002 99480041conserved hypothetical protein i iatoE PA2007 99480101 maleylacetoacetate isomerase ; maia iPA20l6 994801 sfpTobabie transcript')-.....--.--... PA2013''9948016tprobable en l-ydratase/isomerase i ; menB PA2013'9948016 probabte enoyJ-CoA hydratase/isomerase ! J"JmenB---- PA2015'9948019 probabte acy !-CoA dehydrogenase'"11111. . ! PA2016 probable transcriptional PA2017"'9948021 hypotheticaf protein"--"--"-''' PA2021'i 9948025 hypothetical protein i PA2026 1 9948031 wls=r ed hz het e n __1 __ yfeH i PA2029 L 9948034 hypothetical protein 9....... PA2031 948036 h pothetical protein PA2034 9948039 hypothetical protein_________ I PA2037 9948043 hypothetical protein PA2042 i 9948048 probable transporter (membrane subunit) yg, jU PA2051 1 9948058 probable transmembrane sensor i ; PA2051 9948058 probable transmemirane sensor PA2052 Jl9948059 cyanate tyasejcynS"' pA2060'999948068 probable permease of ABC transporter PA2062 9948071 probabie pyridoxai-phosphate dependent enzy ; ! PA2066 9948075 hypothetical protein . _. _ __-.. _... _. _. _... ...., _, _.. __ PA2071 9948081 eion aton factor G _ fusA2 PA2073 ! 9948083 probable transporter (membráne subunit) $ ; PA2074 F 9948084 hypothetical protein__ PA28086 hypothetical protem PA2080 1 99480911 hypothetical protein _ _ PA2090 9948102 ! hypothetical protein rter ^. ... . _ ... .... _. . J'.. _. l PA2095 9948108 hypothetical iPA2097 9948110iprobable flavin-binding monooxygenase i l I PA2101 ! 9948114 conserved hypothetica) proteinl ! l....... . i PA2103 9°. 9948117 ; probable mol bdopterin biosynthesis proteinN' -_m-W moe8y . PA2105 bable acetyltransferase 5 99481195 _~_ co__ 99481191 pro P PA21 10 9948124 1hypothetical protein PA211 I 994813_3i06-methylguanine-DNA methyltransferase ada PA2119 a) coho ! dehydrogenase (Zn-dependent) adh PA2120 i 99481351hypothetical protein g L p 99481381 probable transcriptional A2123 lat...... PA2131 {9948147ihypothetical protein _ PA2136 1 994818153 hypothetical protein ; u ( PA2142 9948159 probabte short-chain dehydrogenaseY yhxC T PA2143 1 9948160 1 hypothetical protein T 4 PA2143 9948160 hypothetical protein PA2146 9948164 conserved hypothetical protein _y {Pm7 <9protein __] __ L, _ _____. _--- 99-48175 i hypothetical . _.. j _. _... ! PA2166""""'"9948186 hypotheticai protein J"------- - hypothetical rotein , PA2170'"J.""' 9948190 ! hypotheticat protean"""' ;""'"'"'"""-'-"-"'"-"-" _, pothetical protem °-.. ___.. _. __. __. _. _____ ____... .,. Y. __. _. _... ___.. __. _. _ ___... __. _... __. _..- PA2167'v r. w. 9948187 ; hypotheticalrotein-T-. Y-_. _.... _... .. _... _... _..... _.. __. _ww... _. _.. _. _. _. _.. _.,. _... _ _. _.... _.,... _,., _.. . f-PA2171 99481911 yR2Lhetical protein 9948194 hypothetical . 2PA2167 994Ent glwt PA2170 : 99481<ypothetical protein 217i'94 91ihZp theticalproten PA2174 9948194'hypothetical protein'. tPA2175 PA2174 protein_. _. __.. : P 182 _. : 994 Yp 'p.-.-. _. __... _. __. __ ;-. V _. %. . __. _____. _.. _.. __......... _.. _... __.. _ 'PA2182. 9948203 hypothetical protein iPA2183 9948204 hypothetical protein I proteln PA2185 ; 9948206 hypotheticai protein PA2187 ___-rv9948208 hypothetical protein. _. _... _, . 4 V _ _ PA21'87-9948208 ! hypothetical protein A2190 9948211 conserved hypothetical'protein 9948214 conserved hypothetical.. protein PA2196 j 9948218iprobable transcriptional regulator PA2197 9948218 probable transcriptional regulator PA2205 ì 9948228 jhypothetical protein {_ S PA2207 9948230 hypothetical protein PA2207 9948230 hypothetica) proteinJj PA2211 9948234 conserved hypothetical protein PA2214 9948238 probable MFS transporter PA2219 9948243 membrane protein OpdE opte ! PA2220 probable transcriptional regulator oprm PA2221 j 9948245 conserved hypothetical protein _ _ _ PA2222t 9948247 hypothetical protein JL-.'L. JII""'I'L.--ir'''' ! PA2223 1 9948248 h_.-_. _~wo__~__ XPA2224 9948249 hypothetical protein _. S PA2225- 9948250 hypotheticai pr_otein_ PA2225 99482501 hypothetical protein PA2226 i 99482511hypothetical protein __ ? __, ___ 9948252 probable transcriptional reguliatior PA2228 i 9948253 hypothetical protein _ _ i _I _ FP-A2228 9948253 hypothetical protein PA2234 r 9948259 probabte exopotysaccharide transporter ! ; PA2242 ; 99948268 hypothetical protein ___ _ _ l PA2242 9948268'h othetical protein JPA2251 9948278 hypothetica ! proteinJ j" PA2253 i 9948280 ; iL-asparacinase I lanse _ _ __ f PA2257 j 1_ vcD _, _ PA2258 9948285 [transcriptional regulator PtxR ptxr PA2260 1 99482881 hypothetical protein IPA2280 f 99483091conserved hypothetical protein H _ jlPA2282 $<sça M 5'I PA2282 9948312 h pothetical protein w {",, t., j [, PA2293 1 99483241hypothetical protein. j_ _ _. __'. _ o. _____ ! 1PA2292 9948323 hypothetical protein PA2293 9948324 hypothetical protein PA2295 9948326 probable permease of ABC transporter 1"j' PA2297'"} 9948328 probabteferredoxinT".... LlI'*' IPA2298. 99483291probable oxidoreductase PA2303 99483351h pothetical p ! PA2311 9948344 ! hypothetical protein '. PA2316 f >, robable transcriptional regulator. 2 fPA2329F'9948364, probab ! eATP-bindingcom""T"------"----'' ; PA2329_,. _, _. ____ 83 p b dtng po 'PA2331 9_4836 h1Usthet > DBtY n __ _ , PA2336'. 9948371 : hypothetical protein : t PA2331 9948366 hypothetical protein : _PA2336.. ___.. _........ __994837_1 hypothetical protein '"''... __ _, __u.. _. _... _.. _.... ___ __. . ___-.. ___w.... _. _..,. _ _. _.. __. __.... ____.. _. _ _. _. p __. , PA2338 9948374 i probable binding protein component of A m, mtle PA2347 9948384 ß hypothetical protein : PA2347 9948384 ! hypothetical protein "PA2347""'"'"9948384hypothet) ca) protein-------------j--- PA2349-9948386, conserved hypothetical protein sPA2351. 9948388. probable permease of ABC transporter PA2365, _9948403, conserved hy othetrcai _ rotein . PA2367 9948406lhypothetical protein. | PA2368 l 9948407. hypothetical protein I tPA2370 9948409} hypothetcal protein IPA2372 l 9948411 ! hypothetical proteln _ IPA2375 n 99484141hypothetical protein'| T PA2383 _i_ 9948423 jprobable transcriptional regulator 9948411 hypothetical protein _... __. _.. _.. ^ PA2411"j 9948455 probabte thioesterasei 'J PA2411 __ 9948455 probable thioesterase . w 1 __. ; _, PA2406 t wypothetical protein _ t S PA2411'9948455 probåble thioeste_ase} PA2412, 9948463 ! conserved hypothetical protein _t PA2428 994846 ypothetical protein E PA2422 9948473 hypothetical protein PA2427 t 99484731hypothetical protein PA2428 9948474 hypothetical tPA2429 1 9948475 ! hypothetical protein IPA2434 99484 pothetical protein PA2441 1 99484881h othetical protein PA2441, 9948488 hYpothetical protein PA2446) 9948494 giycine cleavage system protein H2 jgcvH2 j ! PA2451 1 9948499 hypothetical protein |PA2451 <, hypothetical protein _ _ _ Pua2455 ! 9948502 jhypothetical protein _ _ E_. _,. _. _ _. | _ ___ _ _-. PA2456 protein) "''' PA2455 ; 9948504 hYpothetical protein , PA2456 1 9948505 ! hypothetical protein PA2459 9948508, hypothetical protein i _ J tPA2460.,., 3 S lPA2461 9948510jhypothetical protein i'_ 4 SPA2464 9948514 j hypotheticai proteinJl.. JIIjJ PA2467 994851 7 ; probable transmembrane sensor ç __ PA2469 9948519'probable transcriptional regulator 'PA2464 -P 99485171 probable transmembrane sensor yp P _ 9948519 1 probable transcriptional regulator PA2474 1 99485251 hypothetical protein PA2475 1 9948526 probable cytochrome P450 . __. __. _ _. .. _ p. _ p 'jPA2490 t 9948542 ! conserved hypothetical protein X, jydbB 9948539 hypothetical rotein jxPA2492 i'99485441transcriptional regulator MexT,. mexT 0 j PA2496 _ I v _ _. i.....'o_-~--~----5 ; PA 1_.. . 9948554 hypothetical pro_tein_ a r 1_p_o ein = (PA2492--9948544 transcriptional regulator Mex. mexT iPA2501 99485541 hypothetical protein s _____ _,, _,, _,, _ ___ _ _. !...... ___. _. _. _. __. _. __ _.,,, _ _ 9 _ _ _ _ _ __,, _ _x". _~_ _, _...... I''''''''''''''--}- '''"-'__-__ __ _. ____c_a_ _. ___. _ PA2515'9948569 ! cis-1 2-ydroxvcvclohexa-3, 4-dienecarboxylivlL 'PA2517 9948571 itoluate 112-dioxygenase beta subunit, xylY PA2521.. . w 994857_6R_ND_div_a_len_t me_ta_I c_ation_e_fflux mem_br_ane fu, czcB . y---w.-Vyu.. -'".. , PA2536 99 93 S probable phosphatidate cyt y yltransferase __ _, yn i3 _ _ iPA2536 9948593 probable phosphatidate cltriladylyltransfe 5PA2538 9948595t, hypothetical protein ___ _ __ __ __ _ __ _ _ iPA2538 9948595 ! hypothetical protein h PA2544 9948602 E hypothetical protein IPA2549. 9948608conserved hypothetical protein I EygiT jPA2551'7''9948610jprobab) etJIIIIIjI""'""" PA2552 9948611 jprobabte acy !-CoAjjehydrogenase jacdB ! ; PA2551 9948610Eprobable transcriptional ret E I PA2552 ; 9948611 ! proba_e acyi-Co dehydrogenase, 9, _, _,"",,, d _, « ~,,,, ~ acci,,, 3 w, 9"_,, i ìPA2553 9948612*probable acyl-CoAthiolase t PA251 99486101 nscriptional requlator PA2577' ["'9948639 probab) etranscnptiona) regu ! ator-j--. PA95-77 9948639 probable transcriptional regulator PA2584, _ 9948647 CDP-diacylglycerol--glycerol-3-phosphate 3-pi IpgsA E PA2591'. 9948655sprobable transcriptional reguiator _ I I T PA2602'"r"9948667 hypothetica) protein i. IILIIL-ZLi-111-"' H ! I PA2605 $'9948670 w _, ~ E ~, _ yheN _S_ m PA2606 i 9948671 conserveu typotSnetlcal protein EE yheM PA2607 iZ _ 9948672iconserved hypothetical protein _,,,,,,,,,,,,,,,,"","",,,, T,,,,,, _,,,",,, _ __ _ _ _ _ e PA260_7_.. 9948672 ; conserved hypOthetical protein 9948671 ! conserved hypothetical protein serS I PA2612.'9948677 seryt-tRNA synthetase serSj PA2614 T 9948680Zperiplasmic chaperone LOIA JOIA 9948681 cell division protein FtsK ftsK PA2617 . .-. 99486831euc I/phenrlalan I-t-, RNA-proteintransfera_se aat ---w-_. __. .. __ PÁ2619 T 99486851initiation factor Z jnfA i PA2621 1_99486871conservedhypotheticalpr tein __ t_ I_ __ _ PA2626 9948693jtRNAmethy ! transferae ! l [ [ ! l'='........ JItas.) L'Ej,..., J _... _... s... __. . _. _. y , P i _9948696 aden losuccinate I ase _ __ _ PA2638 E 9948706, NADH dehydrogenase I chain B nuoB î _r |jo * PA2641 j"'9948709JNADH dehydrogenase) chain FL-Jl !"°IIIIIlT] PA2645 ! 9948714JNADH dehydrogenase i chain J inu_oJ_ _ _ I PA2646 i 9948715iNADH dehydrogenase I chain K ìnuoK I | kPA2658 (9948_72_8 hypothetica) protein PA2658 1 9948728 hypothetical protein PA266 34 hypothetical protein PA2687 t 9948738tconse ved hypothetical protein __<_ _ PA2688 ì 9948739fhvpothetical protein PA26-ro8 9948739 hypothetical protein iPA2673 99487441 probable type If secretion system protein <". jhptV"j PA2674 j 9948745 probable type 11 secretion system protein ihplu PA2675 9948746|probable typwm_rotein _ t_ _ A, k iPA2678 9948749tprobable permease of ABC-2 transporter J 4 UB2681 _ 9948753jprobable transc ltgulator _., _~~_ » L-o iPA2B83 9948755|probable senne ! threonne de dratasel degrac tdcB _ _ t. Y. .. ___ ___ _ _ _ IPA2-689 _ _ 9948762 1 hypotheticai protein __ _ _ ; _ _'_ _. _. ~ __1 iPA2689 99487621 hypothetical protein IPA2690 9948763 probable transposase j, ioredoxin j e iPA2708 ; 9948780 ; hypothetical proten I ßPA2703} 99487771hypow D) iPA2706 l 9948780ihypothetical protein. t __ t PÄ27i5 lY 9948790 jprobable ferredoxin 0 'PA2719 9948795 ! hypothetical protein 9948796 hypothetical protein ! iPA2721 9948797 ! hvpothetical protein e 22 9948798 h othetical roten PA2723 _y _ical rot_ein ; ,,, _ _----"''""'''"'""'""''"'''""'"'' ? ? PA2726 ? 9948802 ? probable radical activating enzyme _i_ {PA2730 9948807 hypothetical protein ? JPA2722"'9948798 hypotheticat protein """"''.....""'j''"-. ..-.....-.-..-.....-.... A2733 9948810 i ical proten . PA2731 9948808 ? hypothetical protein J _^ _ . 4 ; conserved hypot_het' ; ' .". _....... _. _.... tPA2733 9948810 ?, conserved hypotheticai eroteln _ X _ fi v 994881 1 w ? ? PA2736 9948814 ! hypothetical protein PA2737 99488151 conserved hypothetical protein .......... PA2737 ! 9948815 cqnseryed hypothetica) protein T'I ! PA2738"i 9948816jintegration host factor, a ! pha subumt'*TrnA j.---.--.-..--.-. PA2739,.. __9948817lphenylalanyl-tRNA synthetase, betasubunit__-'pheT v ; F__T..- --.. ____. ____ ..........-- =,'PA2740 _ 9948818 phenylalanyl-tRNA synthetase, alpha-subunit phe_S iPA2741 ; 994_8819 50S ribosomal protein L20 rpIT PA2742 r 9948820 J 503 ribosoma ! protein L35jpmj ! J P PA2743 itiation factor IF-3 infc PA2744 i 99488221threonyl-tRNA svnthetase thrb PA2749 1 99488281DNA-specific endonuclease I endA _. < PA2753 99488 : al protein PA2756 99488. 35 hypothetical protein PA2759 9948839 hypothetical protein EPA2759 3 9948839 hvpothetical protein PA2762 1'9948842 hypothetical protein oo PA2763 9948843 hypothetical protein PA2767 QoARRA7 r) rnbable enovi-CoA hydratase/isomerase PA2768 99488481 hypothetical protein PA2769 9948849 hypothetical protein _2948855 YPO PA2775'1'9948856 hypothetical protein'""""""'"' !---.--.------ PA2780 9948861|hypothetical protein ___ I _____ PA2781 99488621 hypothetical protein 'PA2782 1 9948863 1 hypothetical protein liPA2784 4i 9948866 hypothetical protein PA2785 9948867 conserved hypothetical protein PA2786 9948868 hypothetical protein -PA2792 9948874 hypothetical protein PA2794 1 9948877 hypothetical protein PA2797 ! 9948880 hypothetical protein , PA2799 L 9948882 hypothetical protein ~ PA2800 9948883 conserved hypotheticai protein ! JvacJ J PA2803 t 9948886 hypothetical protein PA2805 9948888 hypothetical protein PA2807 9948891 hypothetical protein {PA2808 i 9948892 ! hypothetical protein _,, yf _ tf PA2808 9948892 hypothetical protein PA2818 9948902 hypothetical-protein PA2819 1 9948903 hypothetical protein PA2827 9948912 conserved hypothetical protein 4 __. yeaA PA2829 9948914 hypothetical protein , PA2831 1 9948917 conservedpothetical protein __ iPA2832'. 99489181thiopurine methyltransferase tpm SpAS839'9948925 ! conserved hypothetical protein'iY9tD.. __ _ X f PA2843 _ 9948930 ; probable aldolase _ {i PA2845 994eSn {PA2851"''9948938itrans) ationefongation'"'"'''""'" ; g'''''"j"-".................. ! PA2852"'""9948939) hypothetica) protein I. . Il.. j"""'""' si PA2852 9948939 i hypotheticai protein sPA2853 _ 9948941.'outer membrane lipoprotein Oprl precursor, oprl {, [PA2859r 9948947 ! transcription elongation factor GreB" ; greB'1"'j PA2859'9948947itranscription elongation factor GreB greB'ij a, PA2863'9948_1I ase modulator p otein'ilipi. __ PA2868 . 99489571 h othetical roten J = _. 99489571hypothetical protein __ _ _ __ _ __ _ _ _ ! tRA2874 _'9948963 I hyp + , 3PA2876 1 9948966, orotidine 5'-phosphate decarboxylase'ipyrF iPA2877 9948967i probable transcriptional requlator IPA2879 i 99489691 probable transcriptional regulator PA2883 T ; 9948973 hypothetical protein - _ _ _ _ _____.. __ PA2894 9948985 hypothetical protein PA2898 9948990 hypothetical protein PA29_01 9948993hypothetical prote_in., _ _ _ PA2901, 9948993, 3hypothetical protein I I PA2915 _a 9949008 hypothetical protein PA2915 i 9949008 hypothetical protein 3j. 1 3 PA2922 9949008 hypothetical protein .. __-. _..-. PA2928-49023 h othetica) rotem E othetical ro#en _ PA29 1 9 9949030 hypothetical protein 9949031 hy othetical protein PA2937 IP P _ _ _ PA2940 probable acyl-CoA thiolase,.. PA2949 9949046 probable lipase PA2949 L<ffl o~-- PA2951 9949048 electron transfer flavoprotein alpha-subuniHiF PA2952 9949049 electron transfer flavoprotein beta-subunit etfb PA2953 L 9949050jelectrontransferflavoprotein-ubiquinoneOxidO. _ PA2960 9949058 type 4 fibrin ! biogenesis protein PiIZ pilZ PA2961 i 9949059iDNA polymerase 111, delta prime subunit IholB PA2962 i 99490601thymidylate kinase _'tmk Ft 9949061 |conserved hvpothëtical protein i'wG li 9 conserved hypothetical protein lyceg PA2966 9949064 acyl carrier protein sPA2967 r 9949065 ; 3-oxoacyl-[acyi-carrier-protein] reductase ifabG PA2968 99490B6 B _ <_ i PA2970 9949069 50S ribosomal protein L32 I rpmf PA2971 f 9949070 ! conserved hypothetica) protein11111111" ! yc' PA2975 1 9949074 ! ribosomal large subunit pseudouridine syntha¢. rluC IyceC PA2977 9949076 UDP-N-acetyipyruYqytgfucosamine reductase murB ! PA :) sine protein phosphatase liptpA Ij gj t PA2979 ì 9949078 tj 3-deoxy-manno-octulosonate cytidylyltransfera kdsB f tjPA2980' 9949079iconserved hypothetical protein W ycaR . __. __. _..-.. _------. * PA2980 erved h pothetical protein ycar PA2982 9949081 conserved hypothetical protein i ij PA2983' 9949082 P probable #oIQ-type transport proten PA2985 tj 99490851hypothetical protein PA 9949085 hypothetical protein PA2986 949086 conserved hypothetical protein , PA2987 9949087 probable ATP-binding'component of ABC tran, 's lycfv ! PA2988', 9949088 i, oon_rW ! PA2989 1 9949089 hypothetical-protein iPA2991 9949091 ;, soluble pyridine nucleotide transhydrogenase Isth,. . p p. . _ :.. ___.. __ ___. ___. ___z 'PA2992 9949092thypothetical protein''. , PA2996'9949096iNa+-translocating NADH : uniquinone oxidoredl, anqrD sPA3001""'9949102 j probabje giyceraidehyde-3-phosphate dehydrc'....-.-.--.--.-.-.- PA3004 PA3004 9949105i probable nudeoside phosphoryfase ['J PA3009y_ u_9949111 hpothetical, pr_ote_m PA3009 9949111'i hypothetical protein iPA3011 9949113 ! DNAtopoisomerase I ítOp ; iR ----------------- protein ! PA3012 9949114 ! h pothetical protein PA3017 99491201, con, served hypothetical protein [PA3022'"9949125 hypotheticatprotein'j J' { PA3021 pothetical protein PA3024 1 9949127, probable carbohydrate kinase,,,",,,, _ _L. _ _ _ _} ____. __. _ __ _ _ _ _. ______. _. r ip 9949127 probable carbohydrate kinase "PA3030 9949134 probable molybdopterin-Quanine dinucleotide b moba PA3033 9949137 hypothefical protein w ; r PA3036 t 9949140ihypothetical protein % -fi PA3040 t 9949145 conserved hypothetical protein_ __ _ yqjD I _ __ .-. _..... PA3041 9949146 ! hypothetical protein --'9949147 hypothetical protein Put3042 PA3049, 9949155 ribosome moduiation factor rmf. _-., _ _ PA______... ---9949157h pothetical protein _... _. ____. _. _.. _........ _.... __. __. _. _. . _. __. ___. . _____.... _. __ '_. _. PA3067 # 9949174iprobable transcriptional regulator PA308_1 _, 9949189 ! conserved hypothetical protein y [ PA3051 9949157 hypothetical protein'I PA3081 1 9949189 ! conserved hypothetical protein _/_.... _ _ _| PA3088 9949197 conserved hypotheticai protein ijYfl§ ! PA3085 9949193 hypothetical protein PA3093, _ 994 0 ypothetical protein _'_ PA3089 1 949198. pothetical protein PA3093 ; 9949202 MebM, _ _ __. ~ __ _ ; PA3095 9949205 general secretion pathway protein M xcpZ PA3096 J 9949206 genera) secretion pathway protein L XCPY PA3100 1 9949210 general secretion pathway protein HxcpUpddB'"''''"'' ! PA3103' ! 9949213 general secretion pathway protein E xcpR PA3103 99492131general secretion pathway protein E L _ 9949221 thypothet __ __ _ _ w _ _ PA3112 1 9949221 hypothetical protein PA3117 1 9949229 aspartate semialdehvde dehvoroqenase asa PA3117 1 994929r se PA3123 ; 9949235 conserved hypothetical protein PA3140 9949254, hypothetical protein PA3140 i 9949254 jhypothetical protein PA3142 9 ___9256 hypothetical protein PA3144 9949258 hypothetical protein PA3145 ! 9949259 glycosyltransferase WbpL lwbpL_ - ; 'PA3146'9949260 ! probable NAD-dependent epimerase/oenyurat3vDpK 1 { tPA3147 í 9949261 probable glycosyl transferase WbpJ LwbpJ l _t PA3148 9949262 probable UDP-N-acetylqlucosamine 2-epimerE twpi PA3149 4 9< o-i i ! PA3150 9949264 LPS biosynthesis protein WbpG IwbpG v PA3151 9949266 ; imidazolegcerol-phosphate synthase, cyclase : hisF2 PA3152"9949267jgiutamine amidotransferase'"ThisH2"' iPA3153 t 994926810-antigen translocase lwzx IwbpF, rfbX PA3154 9949269 B-band 0-antigen poiymerase wzy rfc j PA3155 9949270 probabte aminotransferase WbpEwbpE 9. PA3156 1 s= _pD, wbpD j _J PA3155 9-492-701 probable aminotransferas WbiLE pE PA3157Y 9949272 probabie acetyitransferase . . L-- J"wbpCj ! PA3158'r 9949273 j probabte oxidoreductase WpbS. LUbpB" [..'.. ! , PA3159 99492745probable UD_glucose/GDP-mannose ciehy_re NbpA >_ _ _ _ __., P. __ Y_ __ 'PA3160 9949276iO-antigetth guiator'wzz Scld, rol i'PA3161 : 9949277iintegration hostfactor beta subunit''himD EPA3162 : 9949278i30S ribosomal protein Su rusa PA3163""""""9949279 jcytidyfate kinase"""""""''] cmk"" T----------- . - T. . PA3167, 9949283 ! 3-phosphoserine aminotransferase iserC iPA3168 9949285 ! DNAgyrasesubunitA tgyrA £'. PA317 1 < 9949288 1 3-demethylubiquinone-9 3-methyltransferase, ubiG jPA3178"""'9949296\hypbtheticaj prote ! n"jJ'-"-"--T"'"""""" ; i_.... ___ __ _. _ _. _ ! PA318fj 9949299 2-keto-3-deo -..---,.....---.... ....... j f PA3185 9949303 hypothetical protein. t_ T ? 9949314 glyceralidaehvde 3-phosphate dehydrogenase tgapA ij Y _.. _. __ conserved hypothetical protein PA3203 9949323 hypothetical protein PA3207 9949327 hypothetical protein PA3211 9949331 probable permease of ABC transporter PA3220 F 9949341 probabte transcriptiona) regufator ! """-"--'--"'- } PA3227 ! 9949348 peptidyt-protytcis-transisomeraseAfppiA j cyHIL--."' [PA3230 1 99493521conserved hypothetical protein PA3232 t 9949354 ! probable nuclease PA3237 _'9949359 hypothetical protein'_. _ _ 1 _. _ _ PA3242 9949365 probable lauroyl acyltransferase PA3245 9949368 cell division topological specificity factor MinE minE PA3246 9949369ipseudouridine synthase RIuA rluA {yabO PA3249J 9949372 probabietranscriptipna) JIIIL. 11."1 PA3255 9949379 hypothetical protein PA3260 ! 99493841probable transcriptional regulator PA3266 9949391 'cold acclimation protein B capB csp _ _S PA3273 99493981 hypothetical protein PA3274 1 99493991 hypothetical protein PA3275 9949401 3conserved hypothetical protein 3 IynfA PA3278 99494041 hypothetical protein PA3280 j 9949406) outer membrane porin OprO precursor _opr0 , _ _ PA3281 9949407 h pothetical protein onserved hypothetical protein PA3287 99494141c pezs 94as m I'PA3289 1 9949416 hypothetical PA3291 9949418 hypothetical protein PA3291 9949419 hypothetical protein IPA3298 i 9949426ihypothetical protein I 1 3 PA3298 9949426, hypothetical protein PA3302 99494301 conserved hypothetical protein ) g 9949438 conserved hypothetical protein PA3312 ! 9949441 í probable 3-hydroxyisobutyrate dehYdrogenase ; I' PA3314 ! 9949443lprobable ATP-binding component of ABC tran (; [i, PA3315 9949444 probable permease of ABC transporter PA3317 T 9949447 hypothetica) proteinJ j IPA3318 1 9949448ihypothetical protein'} PA3320 9949450 hypothetical protein PA332G ! 9949457 probable Clp-Pfamily ATP-dependent protease s_-, T ipA3330 i 9949461 ! probable thortwgenase 1 3 PA3332 3 9949463'conserved hypothetical protein S i X 334 j 9949465 probab) eacy) arrierprptejn i. I.... I... f" !. ......"J 3PA3338 1 9949470E. hypothetical protein S i PA333_8 _ 9949473WnEgwegulator >, _. Ws~WW___. _____.-_. _ *WW _ _------------s a PA3341 m_ 99494_73 ! probable transcriptional regulator 'PA3347 9949480 hypothetical rotein JPA3341 ! 9949473 probabie transcriptionairegufator " ;"--- __ _ y..--_. _ __. ntPA3348 9949481ipr babi emotaxisproteinmethyitransferaseN. cheR1 PA3351"'9949484 hypotheticai protein'r I LiT T''". I Jf ! g [. 1""""I" PA3353'""'9949486) hypotheticat protein'J !'""-"--'--'-'--- : 1PA3353 9949486 hypothetical protein ypothetical protein , PA3354 9949487 h iPA3360 9949494 probable secretion prot-,,, n p__A3367 _ H ___ 9949502lhypotheticalproten _. . _ _M, ., . cydcA _.. _... _.......' PA3368 9949503 probable acetyltransferase 9, 67., H__, _9949502 LyS9titet ~ww M _ _w w W*_ www_w tw_ _ ww oeYwC _A_ _ _ w _w _ _s PA3370 994950 rotein _.. _ PA3370'. 9949505 hvpotheticalproteln e s PA3371'9949506 hypothetical protein i t PA3380 Z1-"1 f"3S49506hypothetjcaf protein riLJ"...--.-.. II--........... . I'"J"'-..-----. PA3380 ! 9949515 conserved hypothetica ! protein"" phnG"'J PA3384 ! 9949519 ATP-binding component of ABC phosphonatesphnC _ w_s PA3390 í 9949525'hypothetical protein S PA3390 9949525, hypothetical protein _ _ #.. ,. _ _. r. PA3395 9949531 NosY protein inosy PA3396 1 9949532 NosL protein lnosl PA3397 9949534 ferredoxin--NADP+ reductase _ _ Eev PA3403 i 9949540 hypothetical protein . PA3407 9949545 heme acquisition protein HasAp hast iyebG PA3413 9949551 conserved h othetical rotem. _ PA3414 9949552 hypothetical protein t r PA3416 99495541probable pyruvate dehydrogenase E1 compon PA3432 99495721 hypothetical protein PA3433 f 9949573 probabte transcnptionat regufator {ywb)"''"n . IJ PA3433 W=guiator _wol lYWblwww__ s PA3434 9949574 probable transposase PA3435 9949575 conserved hypothetical protein mioc PA3438 9949578 GTP cyclohydrolase I precursor [folE1.........,,,", f PA3439")''9949579 d-erythro-7. 8-dihydroneopterintriphosphate'''Jfo) X'T J ., probable permease of ABC transporter PA3444 ! 99495850conserved hypothetical protein fi ? ssuD PA3445 9949586 conserved hypothetical protein PA3446 9949587, conserved hypothetical protein IssuE s PA3450 1 9949591 m __ 9fL_H PA3450 ! 9949592 hypothetical protein f I 1 v . ~ PA3460 1 9949602 probableacetyltransferase PA3470 fì 9949614 m PA3472 9949616, hypothetical protein PA3472 9949616 h pothetical protein E PA3477 1 9949621 transcriptional regulator RhIR jrhlR _ PA3482 9949627 metKionyl-tRNA synthetase lmetg PA3488 9949634 hypothetical protein } PA3489'J 9949635 conserved hypotheticai protein ! mfA" ? PA3492, hypotÇi~ __, __.,, ~ irnfD PA3494""9949640 conserved hypothetical protein"J'J') rnfE " ! |W t Fiease 111--r-=~ PA3494 9949640 conserved hypothetical protein rnfe PA3495 y ___ 99496 endonuclease III _. _, ns th __. T_. __, _-_ ____. __ PA3496 9949642 hypothetical protein PA3501 ° 9949647 hypothetical protein iPA3502 hypothetical protein ! PA3505 9949652 hypothetical protein PA3512 j 9949659 probabie permease of ABC transporter PA3519 t _ mypotheticai protein _e : PA3520 ! 9949668jhypothetical PA3523 PA3523 9949671 ; probable RND efflux membrane fusion protein spa3528 9949677, ribonuc-iease T ; rnt EPA3530-9949679 ! conserved hypothetical protein _ ; tifd _A3533 9949682 jconser ed hypo hetical protein _ 4 _, y xnD __..... __... _... _. _, __w _... _... _. : PA3542y-. v. ,. 9949693 ; alinate bios nthesis protein AIg44^ .,. T.. . ."M_r ; alg44"". y_".,..,.. _T.. _.. _. w PA3550 9949702, alginate o-acetyltransferase A gF ____ ga 9r __ _ _,,,, _,, _, _, wo ; tPA3558 9949710ihypothetical protein fi, ; iPA3566 9949719, conserved hypothetica', prote ! n _ _, lycnE ! PA3570" J9949724 methytmabnate-serniatdehydedehYdrpgenasem'---' j-'j 1PA3572 99497261 hypothetical protein ) PA3575 ! 9949729 ihypothetica ! protein, J' J1""I, ! : ; PA3575, 9949729 I hyt_H PA3578""'9949732 conserved hypothetical protein"I...... L.... Li..." J" ! 1"'."''J" ! rPA3588 1_9949744|probable acyl-CoA thiolase ___ , PA3600 ì, 99497561conserve_ hypothetical protein __ i _ __ Irpl36 ~ IPA3600 9949756 ! conserved hypothetical protein rpl36. 1PA3601 9949757 ! conserved hypothetical protein X PA3605. 9949762 l hypothetìcal protein _ Q _ _ _ L_ PA3605 9949762 ; hypothetical protein . ------.-.. . ! PA3605--99497621 hypo ! hefical erot2in _PA3_606_, _ y etical rotem_ _ _ _ PA3609' 9949766 poiYamine transportprotein P ! po" F LIIIL-----I ! r b94976-61 polya mine transport p teinPotC-po PA3611 99497681 hypothetical protein PA3616 1 9949774 conserved hypothetical protein _ _, _____ recX __ __ e-| PA3617 i, 99497751RecA protein irece Hi « ffi PA3627 1 9949785, conserved hypothetical protein _ _ ygbB____ i PA3632 9949791 conserved hypothetical protein _ yedF tPA363_3 j _9949792c_onserved h py othetical prfltein _ _ . . iygbP PA3634 9949793, 1 conserved hypothetical protein g PA3635 99497_94enolase eno _ _ _ _ _ xyp p PA3636_ _.. 99497952_deh dro 3 deo _ hos hooctonate aldolase kd_s_A _ . i PA3637'''9949796 CTP synthase''."'""""pyrG""' !'""""""""1 PA3637 9949796 CTP synthase. pyru PA3638 9949797 conserved hypothetical protein. __ PA3639 I 9949798 acetyl-coenzyme A carboxylase carboxyl transRaccA S r | n v PA3640 99498001 DNA polymerase 111, alpha chain -----LdnaE C -w z W ; PA3644 9949804 B glucosamin yç l pXA,. _ _ PA3645 9949805 (3R)-hydroxymyristoyacyt carrier p sefA IPA3646 i 9949806iUDP-3-0-[3-hydroxylauroyl] glucosamine N-atpxD firA omsA,' ! PA3647 9949807 probable outer membrane protein precursor j''j <' PA3648 9949808 probable. outer membrane protein j iPA3648 i 9949808 probable outer membrane prote n I I = _. v 'PA3650 ! 994981111-deoxy-d-xylulose 5-phosphate reductolsomeaxr * PA3651 j 9949812 phosphatidatecytidy) y) transferasecdsA"j PA3652 9949813 undecaprenyt pyrophosphatesynthetase. uppSyaeS J r PA3653 9949814 ribosomerecyciing factorfrr rrf] PA3654 994981i5liuridylate kinase ipyrH t PA3655 9949816 n factor Ts tsf PA3656""''9949817J30S ribosoma) protein S2"-""'""''"''sB"""'" PA3657 j 9949818 methionine aminopeptidase ! map i j 'PA366_2'9949824 hy othetical protein', v 1PA3662 9949824 hypothetical protein PA3666 9949828 tetrahydrodipicotinate succinytaseJPJD ! _. _... _ jPA3671 l ; 9949833, probab1e permease O _ ! PA3674" ! 9949837 hypotheticai proteinIjmi.'L---LL-- i IPA3678 1 9949841 probable transcriptional regulator m. _.. ___. ____. __....... _... _. _........ _. ___. _.. _.. __. _. ___. _.. . __. __. _.... _____. ______... _... _. _... ___. _...... _.... _. _... _. _. _.. __..... _.... _. _. _.... _.. _.......,. _... :.. _. __.... _... _..,......., __..... _. _... _... _.... _... __......... _.. ) PA3684""1" 9949848 hypothetica) protein LlIl..-.-. II--... IIIIII"... . JlI''"'''"TII"'l ! ; PA3685 9949849iconserved hypothetical protein iPA3685 9949849 ! conserved hypothetical protein 'PA36 : conserved hypothetical proten_, ; _ ide cham release factor 2 fp ; __. JPA3704"'9949868J probable chemotaxis sensor/effector fusion PA3704 99 49885 h othe_tical rotei_n _ _ 9949885 hypothetical protein ; PA3725 _ 9949891 ; single-stranded-DNA-sp_ecific_exon_uc_le_ase ReaecJ u Pua3719 Yp'p' P_A3730 : 994989 1h othetical roten __ _ : PA3731. ; . 994989_8 ; c_onserved hypothetical protein, _. WW. _. _V_. _. _.. . _. f PA3733 T... _.. ___... _.. ___9949900hypothetical proteini _, H ; -.. __. _^____.. _... _____. i Pua3731 PA3742 910 50S ribosomal protein L19 rpIS PA3743 ; tRNA (guanine--methyltransferase trmD. ' 9949911 N1) PA3744 ! 9949912 16S rRNA processing protein rimM PA3745 1 99499l3i3OS ribosomal protein S16 PA3746 (9949914 signat recognition partide protein FfhffhJ" PA3752 9949921 hypothetical protein PA3754 1 9949923 hypothetical protein PA3756 1 9949925 1 hypothetical protein yIfK PA3759 9949928 probable aminotransferase PA3765 ; 9949935 hypothetical protein ___ _ PA3767 9949937 conserved hypothetical protein PA3769 9949940 GMP synthase iQuaA PA3773 1 99499441 hypothetical protein PA3776 j 99499471 probabie transcriptiona ! reguiatqr !' PA3777" 9949948 exodeoxyribonuctease Vi) iarge subunit"*3eA PA3782" 9949954 probable transcriptionai regulatori--.---------.-. -. -...- PA3784499599i hypothetical protein __ I _ PA3785 99499571 conserved hypothetical protein PA3787 ; y ical rotein '. PA3788 99499601 hypothetical hypothetical protein PA3796 99499691 PA3803 (9949976, conserved hypothetical protein gcpE IPA3803 1 99499761 conserved hypothetical protein PA3805 i 9949978 t e 4 fimbnal bio enesis rotem PiIF i iIF PA3806 ; 9949979 conserved hypoth_etic_al protein 3 y B PA3806 9949979 conserved hypothetical protein PA3808 9949989 2conserved hypothetical protein-. ""_ _ ; ___'yfhJ PA3809 9949983ferredoxin [2Fe-2S] y fdx_2 _ y ^- _PA3810 I 9949984 heat shock rotein HscA _ I hscA_ _ PA3811 9949985 heat shock protein HscB' ; hsc_l3 , y, PA3812 9949986 probable iron-binding protein iscA."IIIJ'scA"J PA3813 9949987 probable iron-binding protein loci issu PA3816) 9949989 conserved hypothetical protein A3821 J 9949995 secretion protein Secs used ! PA3822 9949996 conserved hypothetical protein ; PA3827 ; 9950_002 conserved hypothetical protein .""____T.... _..... r_lgQ .... __--__ ilPA3827 i 9950002,, conserved hypothetical protein ; PA3828 ! conserved hypothetical__, p ! PA3829 pothetical protein iPA3834 99500û9. valyl-tRNA synthetase, valS PA3834 9950009. valyltRNP, snthetase ,. w m_. _. ___. _.. _. _.. _, aa (S.. _.... _ 1PA3843 9950019 hypothetical protein PA3840 : 9950016 conserved hypothetical protein. IybiN ßPA3843 9950019. hypothetical protein. {' PA_ . hypothetical _, 9950028 ! hypothetical protein I PA3854'9950031 5 hypothetical protein PA3856' ! 9950033ihypothetica [protein'1.'". !"'*' PA3857""T''"9950034Jconservedhypotheticarprot"]"'"""'""""''" " PA3857v. ;. .. 9950034 ; conserved ^M PA3859', 9950037'probable carboxylesterase PA3867 {9950046X, probable DNA invertase | PA3868'9950047 1 hypothetical protein % W cal rotem ; _. _. f......... _... __9950048-Ip----__p.-. _. ___.. _...-__. _. _..... ___. __.. ___r_.. PA3869_ _ h othetical rotem _ _ _ _. __ ! PA3876'j''9950056 nitrite extrusion protein 2jnarK2 1. TIII'I'' PA3884 r 995JOwP t PA3884")'9950064 hypothetica) protein _ _ . .' PA3884 1 9960064 hypothetical protein 9950066 hypothetical protein PA3888 9950069 probable permease of ABC transporter PA3890 9950071 probabie permease of ABC transpprter ! L.--I PA3891''9950072 probabie ATP-binding componentpf ABC tran1 9950073, conserved hypothetical p PA3905 j 9950088 hypothetica) protein ! j PA3905 l 9950088 hypothetical protein _ _ ! PA3905 _i, _ 9950088|hypothetical protein ____ _ l _ _. PA3906 : 9950089, hypothetical protein ì PA3906 9950089 ! 1 hypothetical protein A3911 9950094 ! conserved hypothetical protein PA3916 9950100) mo ! ybdopterin converting factor, large subunitiao PA3917 9950101 molybdopterin convertinq factor small subunitlmoaD PA3918 9950102 molybdopterin biosynthetic protein C ImoaC __ _-J PA3936 j 99501221probable permease of ABC taurine transporter, tauC . PA3960 r 9950149') hypothetica) protein ! -M t m hyp iPA3962' 9950151 hypothetical protein PA3965 9950154 probable transcriptional regulator PA, 3, 9-, 6, 7, 9950156 hypothetical protein PA3969 9950158 conserved hypothetical protein PA3973 9950163 probable transcriptional regulator I ! iaior 9. Y.. . _ pothefical protein oX ! PA3981 9950172 conserved hypothetical protein wi ybeZ PA3982 995017 served hypothetical protein PA3984 j 9950175 ! app) ipoprotein N-acy) transferaseiint cutE (' 8wI 99'0177 B et __ ___ PA3987, 9950178 jieucyl-tRNA synthetase, ileuS PA3987 99501781leucyl-tRNA synthetase PA3988) 9950179 j hypothetical protein ! j' JPA3989'f"9950180 JDNA poiymerase iii, delta subunit''"''ihoiA'"'. .. 1. 1I. J PA3990* r 9950182 conserved hypothetical protein : J PA3993 9950185 probable transposase PA3996 9950188 fipoatesynthasesfipAj) p ! PA3998 9950190 1 conserved hypothetical protein ybed -'' rodA mrdB PA4002 9 9950194 rod shape-determining protein [PA4005"j 9950197jconserved hypothetica) protein jybeBJ lPA4006 1 9950198, hypothetical protein _ __ w ; PA4008 9950201 iprobable hydrolase,... _......... ...... _........ _.... _...... __.. _. __. _....... __..... _. ___... ... __..... _.. _ _.... __. __. _. _.. __. _ _ _. ___. _____. 5 ; h othetical PA401 8. 9950211 hy, pothetical protein 5 PA4012 9960205'hypothetical protein PA4019 9950212'probable aromatic acid xylose _ S PM028 9950222. hypothetical protein sPA4029_ 9950224 ; conserved hypothetical proten _ : __ FdedA _ aPA4031 9950226 inorganic pyrophosphatase _ _ppa _ _tp_ __, _, _,,, _, ! PA4033 9950228'hypothetical protein IPA4037 9950232 probable AT- nding 1-K4-043 9950239 i geranyltranstransferase 1 ispa F. T. t PA4047'9950243iGTP cyclohydrolase 11, ribA L I PA4043 9950240 ; 1 deoxyxylulorse 5 phos __ i is A F PA4047_ _,'99502_43GT_P cyclohydrolase II V. w. ... _. _____ _=rib T_ PA4050 H _i-_H _99502461phosphatidrlgl cerophosphatase_A _ _pg_pA _ PA4051 9950247 thiamine monophosphate kinasefthiLL--I-L-- p {PM051''_ 9950247 CEPase IthiL t ____ _ PA4052''9950248 NusB protein'nusBssyB"' PA4052 9950248 NusB protein inusb ssyb PA4053 4 9950249 6, 7-dimethyl-8-ribityllumazine _y hase 0 ribE _ ribH PA4055 4 ; 9950252. riboflavin s nthase alpha chain V_ nbC _ y ribB ~ 0f77w777777_o777977 _777 PA4056 9950253 ribof ! avin-specificdeaminase/reductase ribD ribGj PA4056 9950253 riboflavin-specific deaminase/reductase ribg p 9950254 conserved hypothetical protein ybaD PA4059 950256 hypothetical protein ; PA4060 | _ 9950257 j hypothetical protein _. PA4063 r 9950260ihvpothetical protein v PA4064'9950261 j probable ATP-binding component of ABC tran, oH PM068 1. 9950266iprobableepimerase 1 F { PA4076 PA4076 y ; -9950274 j hypothet_ical, protein--,---_.. ___ PA4076 99502741 hypothetical protein PA4077 r 9950275 Jprobabte transcriptionai reguiator ! 11111 ! PA4083 9950282 probable pili assembly chaperone __ PA4097 9950298 probable alcohol dehydrogenase (Z_-depende _"."""*.. Y, d. L,,, _, » _ »., _.,,,,,,"__ 4 PA4099 9950300 hypothetical protein PA4104 1 9950305 conserved hypothetical protein PA4107 9950309 hypothetical protein PA4114 9950317 spermidine acetyitransferase.'. jb ! tD j iPA4121 t 9 0324jcon_er ed-yEgt-rotein _~ PA4122 1 E PA4122) 9950325 conserved hypotheticat protein j J ! PA4125 I 9950329 5-carboxymethyl-2-hydroxymuconate isomera ;p; hpcD PA4134 9950339, _hypothetical rotem PA4141 99503461 hypothetical protein PA4149 9950355, conserved hypothetical protein'acoX PA4151 J 9950357 acetoincataboiism protein AcoBjacoB ! PA4157 L 9950364 probable transcriptional regulator IPA4164 1 99503721hvDothetical Drotein,, I ,'jPA4167 i 9950375, probable oxidoreductase __~ yafB _____', PA4169 ! 9950377 conserved hyp ! in I w w}'--'~ PA4170 9950378 hypothetical protein iPA4171 probable protease PA4174't 9950383 probab ! e transcriptiona) reguiator. 11 PA4176 j 9950385 eptidyi-proiyi cis-trans isomerase C2, ppiC2 PA4181 1 9950390, hypothetical protein PA4182 9950391 !, hypothetical protein PA4183 i 9950392 ii hypothetical protein 'PA4190, 9950400, probable FAD-dependentmonooxYgenase, X, E Qerase ___. _. _. __.. __..... m.. __... ___. _. _. __. _____.. ____. _______. _.. ____. _. __.. _. _.... _. ___... ___... _. _... : PA42l6' 7 9950423jprobab ! ephenazmeb ! osynthesfsp""'"""' PA4211 9950424'. probable phenazine bios nthesis protein , PA4212 9950425iphenazine biosynthesis protein PhzC 'PA4215 able phenazine biosynthesis protein t tphzF1 _.... _ _ ;.. _-. _. _ i PA4216 99504301 probable ridoxamine 5'-phosphate oxidase I s 7 p ìPM230 : 9950446isalicylate biosynthesis protein PchB jpchB jPA4232'9950448'j singie-stranded DNA-binding protein jssb s'-.-.--- IPA4239 9950456130S ribosomal protein S4 ìPA4238, 99504551DNA-directed RNA polvmerase alpha chain rpoA W PA4240 9950457130S ribosomal protein S4 rpsD t { lpA4240 9950457t, 30S ribosomal protein S11"''7'\JrpsK''"i'"""""*" ! _...... _..,. _. _________-_. __. ... , _____. lPA4242. 9950459150S ribosomal Drotein L36 rpmJ S PA4243 ! 9950460 secretion protein SecYsecYpr ! A""' ! ° __. __ PA4244 9950461150S ribosomal protein L15 __ _ _trplO PA4245"T 9950462 50S ribosomai protein L30" rpmD''"1'F'T'-"ZL IPA4246 , 9950463130S ribosomal protein S5 rpsE t PA4246 9950463130S ribosomal protein S5 rpse PA4247. 995046150S ribosomal protein Ll 8 rpIR PA4248"j"9950465 50S ribosoma ! protein L6 7piF !-- j PA4250 9950466 30S ribosomal protein S14 rpsN PA4250 9950467 30S ribosomal protein Sl. 4 rpsn PA4251 l 9950468|50S ribosomal protein L5 rpiE j J PA4251 PA4253" !"9950470 50S ribosomai protein L14 rplN PA4254 j 9950471 30S ribosomal protein L14 pl ! PA4254 9950471 30S ribosomal protein S17 rpsq PA4255 l 9950472 50S ribosomal protein L29 rpmC PA4256 9950473 5 S ribosomal protein L16 _ rpiP _ _ __............. PA4257 _ii 9950474 30S ribosomal protein S3 rpsC _PA4258 E 9950475 50S ribosomal protein L22 rplV-1 . c.-_ PA4259 I, 9950476 30S ribosomal protein S19 rpsS __ ; PA4260 1 9950477 50S ribosomal protein L2 rplB _.. l. __. __. . _ PA4259 ! 9950476 30S ribosomai protein S19 rpsS j PA4261 9950478 50S ribosomal protein L23 I rplw or PA4263 1 9950480 50S ribosomal protein L3 1p C __ tPA4264 i 9950482 j30S ribosomal protein S10 2rPsJ..... 1,,-2 pA4267 9950485 30S r p PA4267 l 9950485130S ribosomal protein S7 IrpsG 2 Q PA4268 f 9950486 30S ribosomal protein S12 _jrpsL L PA4269 i 995048is DNA-directed RNA polymerase beta* chain irpoC IPA4270, i 9950488jDNA-directedRNApolymerasebetachain jrpoB---L--- PA4271 44E 9950490i50S ribosomal Drotein L7/L12 IrplL PA4 9950490 50S ribosomal protein L7/L12 rpil iPA4273 1 9950492|50S ribosomal protein L1 lirplA PA4272--9950491 50S ribosomat protein L11 _ _ M. ^. rplK_ _ rA4275 i 9950494Xtranscriptionantjterminationprotein NusG 2nusG] 'PA4276 i 9950495 secretion protein SecEsecE prJG ! PA4276 1 99504951 secretion protein 2 ; IPA4279 1 99504981 hypothetical protein PA4296 9950518 probable two-component response reguiator' l PA4298 2 9950520 i hYPotggt _ 2 w 'PA4299 l 9950521 Ihypothetical protein-2 2 2pA4305 1 9950527 ! hypothetical protein : {,, _ ' ; PA4305 hypothetical protein PA4 06 995052 h ot e cã r te ñ 'PA4314'9950538 fo ywofolatedeformylase purU1_ '_PA4314 T » _995_0538_eformyltetrahydrofolate d_ef_ormylase,,. m .. _ : purU1".,. ^. » _ w wy." »., ".,. y.,",.. x_. _.. hypothetical protein i PA4324. 9950548 i hypothetical protein 'PA4324 m 9950548 hypothetical protein ip PA4329 995055zt ; pyruvate kinase 11 1 pyka pyk-11 iPA4330 i 9950555iprobable enoyl-CoA hy ? dratase/isomerase t', 'PA4341.. 9950567.'probable transcriptional regulator __. __ _ _ ePM345 9950572ihypothetical protein ? - PA4348 9950575) conserved hYpothetica ! protein i [pA4349""9950576 ! hYpothetica ! protein'IIL1-ILj lLjL--I'-I 11111- ! 'PA4345 JPA4354 ; 9950581 conserved hypothetica ! protein i." ! PA4357) 9950584 conserved hypothetica ! protein "JyhgG''J ! .... ___ _ _. _.. .. _ ___ _. _.. __... ___... PA4359'J 9950586) conserved hypotheticat proteinTjfeoA ! =PA4366 j 9950594'superoxide dismutase . sodB , V v ; IPA4350 PA4373) 9950602 hypothetical protein JJ PA4359 9950586 1 conserved hypothetical protein ifeoa tPA4373 __ 9950602 hypotheuca protein _ __ __ i______, _ PA4383 j 9950613 conserved hypotheticalJcrcB ! PA4383 !"5"F i'1F __ _. ___W r_Mrr PA4377 I 9950607 ! h othetical protein PA4388. 9950616 GroES protein'"groES jinoRB"I ! ß--- w- PA4388 99506181 hypothetical protein PA4389 9950619 probabie short-chain dehydrogenase' ! ! PA4392 9950623 ! conserved hypothetical protein PA4395 9950626 conserved hypothetical protein PA4403"r 9950635 secretion protein SecA ! secA ! PA4405 9950637ih pothetical protein PA4406 3 9950638|UDP-3-0-acyl-N-acetylglucosamine dea_ylaiipxC _ 3envA asmB_ r.. Ir. 7 _ PA4407 J 9950639 jcell divislon proteln FtsZ ltSL WA4408 T 9950640Scell division protein FtsA < _ _ --- PA4408 99506401 cell division protein FtsQ jftsQ PA44p9 9950641 jceit division protein FtsQ ftsQTJ {PA4411 9950643 JUDP-N-acetyimuramate-aianineiigase murCjj PA4411' JPA4412 9950644} UDP-N-acetyigiucosamine--N-acetytmurarny1- ! j , PA4411 murc PA4413 f 9950645tcell division protein FtsW {ffsW PA4414 ! 9950646 UDP-N-acet Imuramo lalanine--D-lutamate I murD . _" -__.... _... ___. _y Y 9 __ __. s ! pA4415 9950647 phospho-N-acetytmuramoy)-pentapeptide4ranra} ORFY . _. _. __.... ____ _____.. . tY Y Y 9 y _ g 'H".. _,. .... s... _. _ PA4416 9950648 UDP-N-ace Imuramo lalan I-D-lutam _I 2 murF"_ j __,-". _,... __ ; PM417 _ UDP-N : acetylmuramoylalanyl gMmapE T. s PA4418 9950650 penicillin-bindin protein 3 ftsl pbpB ! PA4418, 9950650 penicillin-binding protein 3 ipb-pB 'PA4419 9950651'cell division protein FtsL _ ftsL _ _ _ _. _ tPA4420 __ 9950652$conserved hypotheticai protein _ w m W yabC ylxA __ ; | PA4421 T m---yabB___ _4 PA4424 f 9950657tconserved hvpothetical protein I yraN YPO Imraw yab ! pA44249950657jqnserved hypotheticai proteint yraNj 4425*""') 9950658 prpbabie phosphoheptoseisomerase yraOj . g _,... ....., j., . __ _, » ».. (PA4427 w_. _. 9950660 ; strin en_t starvation proten_B sspB _. PA4428 9950661 Istringent starvation protein A _ sspA _ _ ssp pog_ {PA4430'99506631probable cvtochrome b PA4432 9950665 30S ribosomal protein S9 _ irpsl .. _----.- PA4433 9950666 SOS ribosqmai protein L13'irpiM PA4436 1 9950670t. probable transcriptional regulator (PA4438"9950672 conserved hypotheticai protein ! ; PA4439M : _ 9950673=tryptophanyl-tRNA synthetase . __M_ ; trpS IPA4439 _ ! 9950673'Etryptophanyl-tRNA synthetase_ _ m _ t__ ___ PA444b 74 ! hypothetical protein , PA4450"''J''''99'50685] UDPacetyu'""" : PA4450 ^ _"9_95_0685°UDP-N-ace Iglucosamine 1-carboxymnyltransmurA ___r, w PA4452'9950687 ! conserved hvpothetical protein. $ 9950687 ! conserved hypothetical protein . PA4453 9950688'conserved hypothetical protein .......... tPA4455 9950690 probable permease of ABC transporter,'VrbE fPA4457'99506931conserved hypothetical proteinL-1J1 jyrbHkpsF""""""""" [PA4459. 9950695 iconserved hypothetica) protein j'jyrbK' iPA4459. 9950695iconserved hypothetical protein E, yrbK ; _. _ _ _ _.... _.... _. _... _ _..... .. ___l_. _.. _..... _. _ 1PA4461 9950697 l probable ATP-bindinp, 2omponent of ABC tran'3 lyhbg } pA4462' j"'9950698 jRNApoiymerase sigma-54 factor ! lE° ! iJl !. l [J"""" PA4462 i X w v f rpoN 3 ntrA PA4463'99506991conserved hypothetical protein-Y lbH RA4464 9950700 j nitrogen regufatory HA protein jjtsN'"''J'--- --'950-700"nitrogen regulatoEK il [A protein ptsn iPA4466, 9950702lDrobable phosphorvl carrier proteln f fS PA4471 L 9950707 hypothetical protein f fa'gA p'reC i I PA4471 9950707 1 hypothetical protein a I (P-g protem M m_r PA4480 9950718 rod shape-determining protein MreC mreC--j PA4482 9950720 Glu-tRNA (Gln) amidotransferase subunit C _ gavu ? tPA4483 9950721 G u-tRNA (Gln) amidotransferase subunit A gatA _ ~_5 __ PA4482 JPA4484'9950722 JG) u-tRNA (Gin) amidotransferase subunit B i gata _PA4_485. 9950723iconserved hypothetical protein PA4492 X 9950730|conserved hypothetical protein _ _ _L PA4499 9 9950738 probable transcriptiona) regulator ; PA4507 9950747"hypothetical protein PA4524 9950766'nicotinate-nucleotide pyrophosphorylase naau J PA4525 1 99507673type 4 fimbrial precursor PiiA ~ p A__,,, _~ o__K,. _-g to_ o _ * r PA4526 3 99507683tvpe 4 flmbrial biogKeMB Pl PA4527 i 9950770 stillframeshlft yHftlt p C_ _s_. _t PA4529 _ 9950772 conserved h othetical rotein i _ , YP P PA4530 99507701 ty PA4537 1 9950780|hypothetical protein __L 3 PA4537 9950780 hypothetical protein IPA4544. 9950788 pseudouridine synthase 1 riud yfil jPM547_ i 9950791thvo-componentres oBegulatorPilR __3pllR_ _3 PA4552'""''9950797Jty pe 4 fimbriaibiogenes protein Pi) W iPA4552 9950797'type 4 fimbrial biogenesis protein PilX tpllA g 3 ? W <~3~29--sl 3 PA4657< 9950802 j LytB protein ! IvtB _ < 3PA4559 3 9950804fprolig ? oprotein signal peptidase 3. 151> 3 s PA4560 3 99508051isoleucyl-tRNA synthetase liles PA4561'9950806 {ribof) avi ribFij PA4563, 9950809130S ribosomal protein S20 rpsT IPA4564 ç 9950810iconserved hypothetic, al protein I ÇscreA Ç3 PM565'j 99508111glutamate5-kinåse __ leror _ I _. ooi PA4565-_ 9950811 _lutamate 5 Wnase , _roB. T.,.. j IPA4567 9950812 ! GTP-binding protein Obg''tobg"jU. I' 99508131505 ribosomal protein L27 rIlmA i PA4567 ; PA4568. j.. _. 99508_14 50 S ribosomal protein L21_ PA4569 9950815 joctaprenyi-diphosphatejsyntnasepB ! ce) tPA4574 ? 3 9950821 Xconserved hypothetical protein ___, _ __ _yL < PA4575'9950822 hypothetica) protein j"'" !' PA4577 9950824 hypothetical protein 1' 4m} 99508241 hypothetical protein j'.'LJ'l-------I IPA4586 t 99508341hvDothetical Drotein i I ? PA4577 9950824 hypothetical protein r rPA4603 t 9950853 ! hypothetical protein JPA4610 j995086Thypotheticaiprotein'.... IL...... i. J"---- i PA461 1 9950862i hypothetical protein tPA4617 9950868. . conserved hypothetical protein ì íygjo PA4630 9950883 j hypothetical protein 'hypothetical pro in . PA4637 9950891.'hypothetical protein'. iPA4638 9950892'i hypothetical protein , PA4638 9950892 X hvpothetical protein i PA4642 9950895 S hypothetical protein . ___... g950895 ical protein ". _.. ___.. _. 'iPA4642 9950895i hypothetical protein PA4646'9950ituracil phosphoribosyltransferase lup. p PA4649 hypothetical protein PA4649 PA4655 ; 9950909iferrochelatase _ -hemH rv s f _ : _. _____. _.. _... _ _.. __.. __ _. _ PA4662 ! 9950917 g ! utamate racemase mur)..--.----- PA4663,'9950918 molybdopterin biosynthesis MoeB prot, iln moeb chIN f PA4665 9950920 E peptide chain release factor 1 f prfA rf1 PA4666 1 9950921, giutamyl tRNA reductase _ XhemA hem1 ; glUtR_ 9 PA4669 99509241isopenten I mono hosphate kinase ipk ychB PA4669 9950924 ! isopentenyl monophosphate kinase ipk PA4670 §1 99509251ribose-phosphate pyrophosphokinase prs prsA PA4671 9950927 probabie ribosoma) protein L25 IP ! Y.. ! P p -y,,. PA4672 9950928 peptidy-tRNA hydrolase _ {pth PA4672-9950928 peptidyi-tRNA hydrol6se pth PA4674 j 9950930 conserved hypothetical protein PA4676 able carbonic y PA4679 1 9950935 hypothetical protein f PA4679 9950935 hypothetical protein __ .. _.. _. ... . __. PA4693 9950950 phosphatidytserine synthase pssA j : PA4696 9950953 acetoiactate synthase targe subunitHM''''"i PA4697"9950955 hypotheticai protein"'j j PA4698"1'"'9950956fhypotheticat protein''"'------Y-----------yqcCj''"'"""'"'""""""J PA4699 j 9950957) hypotheticai protein L---JLJIL----- PM699 S 99509571hypothetical protein _ S PA4702 1 9950960 hypothetical protein =,- PA4 69 8 995095, 61 hypothetical protein PA4711 1 9950970 hy omcalprotein I _ _ H' PA4699 9950957 hypothetical protein IPA4728 I 9950988 2-amino-4-hydroxy-6-hydroxymethyldihydroptefolK PA4711 1 99509701 hypothetical protein li5A4728 i 9950988 2-amino-4-hydroxy-6-hydroxymethyldihydroptdfolK tPA4731 t__ 9950992 aspartate 1-ciecarboxylase precursor e~_ PA4732 j 9950993 g) ucose-6-phosphate isomerase pg) ! PA4737 i 9950998 hypotheticai protein T' ! PA4737 9950998 i hypothetical protein PA4739 9950999 conserved hypothetical protein yjbj PA4740 99 9951002 [polyribonucleotide nucleotidyltransferase pnp PA4741 9951003 9951003ì30S ribosomal protein S15'rpsu S PA4744 J 995106 transtation initiation factor) F-2" f) nfB"'"'J] iPA4745 r 99S1007 N utiiization substance protein A (nusA''""""" j PAA745 9951007 N utilization substance protein A PA4746 9951008 conserved hypothetical protein _y PA4747 j 9951009 secretion protein SecG tPA4748 1. 99510101triosephosphate isomerase ItpiA _ Itpi _~, _ PA4749 9951011 phosphogiucosamine mutase gimtVi yhbF, mrsA j PA4750 ! 9951012 dihydropteroate synthase"'Ifoip dhpS"J [PA4752'995105 ceii division protein FtsJ'ftsJ S sPA4753 t 9951016>conserved hypothetical protein S _tyhbY,,,", __,,,,",,",",,"_, _. _. _u PA4757. 9951020'conserved h othetical protein '_PA4759_^. _... _, __. 9951022dihydrodipico_linat_e_reductase. T _..,.... . _........ <dapB... _,....-. _........ _. _.... _. heat shock roten Gr E E rot in fur ,, p g. . _.. _...... _.' ___ ___. __, ______ , PA4765 9951029iouter membrane lipoprotein OmIAN_. _. _. _.. _. _. __. mom_IA, T_ . _ ! °PrX_. __... __... ___.. _... _.. _. ___.. _ PA4767'9951031) conserved hypothetical protein iPA4773 9951038 hypothetical protein JPA4776 9951041] probab) etwo-componentresponse regutator L. . ! !'MZs" Jstor I '. m." ! yH.'l'1""11" protein S PA4782 _'9951047,'hypotheticai protein X f ___ , A4788 v-r IPA4789 9951055, conserved hypothetical protein v f PA4790 ! 9951056 conserved hypothetical protein f smtA PA4792 9951058 conserved hypothetical protein PA4797 99510641 probable transposese PA4802 {9951069 hypothetical protein', _ jPA4809l""r""9951077 FdhE protein. U'Hr III'IIIIIIII). fdhI"II"tH IIIIIIir"IIIIIII'. IPA4809, 9951077iFdhE protein ffdhE PA4823 1 _9951 0911 hypothetical protein PA4813 | 9951080flipase LipC _ e9_ PA4823 1 9951091 hypothetical protein _ PA4826 9951095 hypothetical protein PA4828 9951097 conserved hypothe'ti'c'in Z PA4831 9951100 probable transcriptional regulator PA4841 9951111 conserved hypothetical protein PA4847 i 9951 118 biotin carboxyl carrier protein (BCCP) $accB fabE , PA4848 1 99511191biotin carboxylase _ {, accC _ L IPA4850, 9951121 tribosomal protein L11 methvltransferase IprmA 9951121 ribosomal protein L11 methyltransferase rprmA PA4853m. 9951124jDNA-binding protein Fis _____ fis __Hw_ } PA4861 j 99511 33 I probable ATP-binding component of ABC tranS _ t . _. _. ___. Pua4864 PA4864 9951137iurease accessory protein lurpr) PA4866't 99511391conserved hypothetical protein s I _ ______ __ _' ; ureC PA4868 9951141 grease alpha subumt a_..,. _. ; p 9951141 urease alpha subunit-- !-Gre-C PA4874 9951148 conserved hypotheticai proteinj jpsjF PA4871 9951144 ! hypothetical protein T » 874 JmiF _ PA4875 PA4878 i 99511521 probable transcriptional regulator i PA4885 $ 9951159itwo-componentresponse_TiriiR TPA4887 r 9951161 {probable MFS transporter T PA4890 9951165 conserved hypothetical protein lyljc m i 99511671urease accessory protein UreF PA4894 9951169 hypothetical protein iPA4895 1 99511701probable transmembrane sensor g} * 99511701 probable transme IPA4906 9951182 probable transcriptional rilalatol iPA49-08 9951185 hypothetical PA4916.-..... ____. g951_-. 193 i hypothetical protein iPA4920 1 9951198 ! NH3-dependent NÄD synthetase ;'nadE A4923 9951201 conserved hypothetical protein a 1PA4925 9951203 conserved hypothetical protein : PA4926 9951204 conserved hypothetical protein ! pA4931"* ! 9951210 repticative DNA helicase jPA4934"j"9951213 30S ribosomai protein S18''"JrpsR'j.-1-J'I ! 'PA4935 g 9951214t30S ribosoma'l protein S6'rpsF} nbosomal proten SB.. _.-.- ! PM938, 9951218iadenylosuccinate synthetase ipurA ripa4940 PA4940 r 9951220jconserved hypotheticat protein' ylsT L----j-. 'PA4944': 9951224iconserved hypothetical protein'hfq PA4945 9951225 J delta 2-isopenter) ! yipyrophosphate transferase miaA"" !--.--- PA4948 9951228, conserved hypothetical protein PM952. 9951233 jconserved hypothetical protein _, yjeQ PM956 9951237, thiosulfate sulfurtransferase _ _, rnc A _ __, ___"_., _______ PA4961 9951243ihypothetical protein PA4962 9951244 conserved hypothetical protein LyJIIILJII PA4964 9951246 topoisomerase) Vsubunit A JB-.'" PA4964 99512461topoisomerase IV subunit A _PA_4_ _99512471 hypothetical protein. r I i ____ __i___. S. __, # __ _. ___,. A : PM966 i 9951248lhypothetical protein PA4966 i 9951248 hypothetical protein PA4967 9951249 topoisomerase IV subunit B 1'parE IPA4969 9951252 conserved hypothetical PA4972 99512551 hypothetical protein jPA4980''9951263jprobabte enoyt-CoA hydratase/fsomerase !'''' PA4988 ! 9E : =sonic-acid (KDu tranwaaA {kdtA PA4990 i 9951275lSMR multidrug efflux transporter _ H ___ -S tv s PA4991 t 9951276 hypothetical protein 1PA4992 hypothetical protein PM992 9951277 hypothetical protein'_, _1 _ _"__-__ __. _ _. i'A4998 - 9951283conserved hypothetical protein ; __..... _ PA5006 S 9951292) hypothetica) protein'*") J PA5007 i 99512922hypothetical protein _ PA5007 i wapQ InaA __ PA5008 i 9951294, hypothetical protein __ s watwaaX PA5008 1PA5009 9951295ilipopolysaccharide core biosynthesis protein aaP rfap PA50 10, 9951296 J ; UDP-glucose : (heptosyi) _LPS< waaG _ rfaG PA5011 9951297tjheptosyltransferase i twaas a p Y ^' m ___... _ _.. lpA5012 1 9951298 heptosvltransferase 11 iwaaF rfaF L PA5028 9951317 conserved hypo ri --A5032 robable transcriptional reguliatior---T-- PA5033 99513221 hypothetical protein JPA5034 j 9951323 uroporphyrinogendecarboxyiase smj... j. [PA5039r'9951329) shikimatekinase''''TaroK''" ! i PA5044 i, 99513341type 4 fimbrial biogenesis protein PilM'jpilM},,, _ PA5050 J'995134Tprimosomat protein N'JpnA' ! PA5051'"T"9951342 arginyt-tRNA synthetase""argS"""""""""""i PA5052 : 9951343 hypothetical protein _ ru-A j 9951353 conserved hypotheticai proteinj phajmH ! PA5063 1 99513551ubiquinone biosynthesis methyltransferase UD] UDlt J PA5064 1) rotein PA5065 9951357jconserved hypotheticat protein' ! lTI) aarFytgRi PA5067 j 9951360 ! phosphoribosyATPpyrophosphphydro L----IL- ! PA5068 i 9951361 translocation protein TatA....... "jmttAyigT....] 5PA5071 7 995_4iconserved hypothetical protein t _ _ PA5072 9951365 probabte chemotaxis transducer J PA5081 i 9951375 hypotheticat protein ! PA5085 j 9951379 probabte transcriptiona) regufator 1 e7PA5072 7 9951365|probablechemotaxis transducer PA5072 9951365 probable chemotaxis transducer 7PAS081 7 995-375 jhypothetical protein PA5085 99513791 probable transcriptional regulator iPA5110 _ ! 9951406 ! fructose-1, 6-bisetgt __ __bp _ Icrr r iPA511j9'J9951417jgjutamireynthetase"'igtnA "''T. ! IPA5116 i 99514131probab, etranscriptio ~ _ ~ iPA511g. .'. 9951417 ; glutaminssynthetase __ _.. w.. _^.. 3.. gInA _. _-,. ,. __. . ... . -... _. _. _. _. ___. _. __. _.... ___. __......... _.... ___...... _____.. __..... _ _.... _ __. _.. _.,...., il_A5128 _ 9951427 ìsecretion protein SecB, secB ; PA5129...... _ _995_1428Mlutaredoxin____ _ ........ _. 9 ! W. _ _.. _. _... _.... _.... _.... _.. _.. _ _. _., a 'PA5130. 9951429i. conservedMttrotein'"e. _ 'PA5 3i t 9 51430'p osphogdycer mutase, P9. m,,, _. _ Y !, b,. 0 9951429 ! conserved hypothetical protein ! PA511'9951430) phosphog) yceratemutase pgm' ; yib0 fA51-3'-2'** ^. __.. _..,. ... 9951431 fhpothetical rotem _, __.. __.... __ _... _.. _. _ _.. _. ___.. N_ PA5142 :'9951442'gjutamine amidotransferase ... I'lHI--r--"-Y- ; PA5144 9951444 ; hypothetical protein _ _ __ ' JPA5148"9951448iconser hypotheticai proteir),...... yggX'" _ __4 _9514... _. ____.. _. ; PA5144 9951444 ! hypothetical protein PA5161 9951463 dTDP-D-glucose 4, 6-dehydratase ! rm B rfbb PA5162 {9951464 dTDP-4-dehydrorhamnose reductase, rmlD irfbD PA5163, 9951465iglucose-1-phosphate thyMlyyitra_sferase lrrnlA'rfbA _ PA5164"I"'''9951466 dTDP-4-dehydrorhamnose 3, 5-epim''" PA5173"r 9951476 carbamate kinase) arcC"") PA5176 _. _.. _ __ econserved h othetical rotein yrfE {PA5178 1 9951481. conserved hypothetical protein tPA5182 1 9951486rhypothetical protein PA5187 9951491, 1 probable acyl-oA dehydrognase PA5190 9951495 probable nitroreductase IPA5195 9951500 probable heat shock. rotein rfrh PA5221-"---F-'"--9951529 probable FAD-depe6dent monooxy enase ivisc PA5222 ; 9951530 hypothetical protein PA5224 9951532. aminopeptidase P lpepp PA5225 9951533 hypothetical protein PA5227 y95 _9951535 conserved hypothetical protein_y_V ; --w.. _. _. _. _ygfE W_ _. _. _. _. _.. ___. ___. __. _. __ PA5229, 9951537 conserved hypothetical protein i, 9951537 conserved hypothetical protein _P_A_5_239'9951548 transcri tion termination factor Rho r_ho .. _. i__. ____ .. p _ __. _.. PA5240 1 9951549 thioredoxin i trxa PA5246 j 9951556 conserved hypotheticai protein iyigj) PA5247 1 9951557|conserved hypothetical protein yail PA5259, 9951570 uroporphyrinogen-lll synthetase _ _ _4hemD _ ____. __, __ _ PA5260 = gen deaminase _, hemC HopE___ PA5276 9951589 jtipopeptideLppL precursor) tppLJJ 'PA5276 j 9951589Semg eE iiPPL_ 2 PA5276, 9951589 lip, , pP p, _p PA5278 vgwldiaminopimelate epimerase HpF S............... ! Y. gB ig M w--r PA5296 ; 9951611 IATP-dependent DNA helicase Rep rep IPA5300 j 9951616icytochrome c5 _, icycB, _. ___. _. __,. _ {PA5303 1 9951619. conserved hvpothetical protein fiPA5316, Mm M PA5316 9951633, 0 ribosomal protein L28 'r mB , I PA5319 9951636 DNA repair protein RadC _ r adC PA5319j 9951636 DNA repair protein RadC"'] 7adC' J PA5319 9951636, DNA repair protein RadC lradc tPA5321 1 9951638 jdeoxyuridine 5'-triphosphate nucleotidohy olEdut _ _ i _ _I Y p p Y _ 4 __ ; PA5325 9951643 hypothetical protein wl 9951646|probable cytochrome c (mono-heme type) PA533 9961648 hypothetical protein v g i r PA5331 1 9951649lorotate phosDhoribosvltransferase ìpyrE I _i PA53339951652iConserved hypotheticai protein"i ' ! I- P A-99516531ribonuclease PH rp------- h. othetical iPA5347 9951667 ! hypothetical protein iPA5339 99516581conserved hyEothetical protein iPA5350 9951670 i rubredoxin JPA5350""9951670 kubredoxin""""" J"J""'-------" ! PA5351""""''995167l1rubredoxin"J 11111111'''L Umn'-""- iPA5358 9951678) 4-hyd roxybenzoate-octaprenynransferase J'ubiA , PA5351 : 9951671 rubredoxin ! PA5364 9951685) probable two-component responseregutator J""""""" PA5381 9951704ihypotefical protein IPA5385 9517091 hypothetical protein PA5381 9951704 ; hypothetical protein.'i i ; PA5385 : 9951709ifMbe X _ __ 'iPA5390 99517141 able peptidic bond hydrolase i'iPA5396, 9951721 ihypothetical protein if_'A 03 ; 99517291 probable transcnptional regulator.,., . _., _",.. _". _.. -T. __. _. __. ___. _. _..... _.. _... _.... _. _. _ PA5404 1 9951730i, hypothetical protein ___ ;, __ ì_. _.,,, _ _,,,.,, _ iPA5406 i 9951732 hvpothetical protein f --------------------- 1PA5406. _- :--995173 : hpothefical protein JPA5406"""9951732 hypothetical protein'"'"') ILL-I11-"1- PA5417 I PA5417 9951744) sarcosineoxidase delta subunit (soxD j PA5408 9951734 ! hypothetical protein PA5460 | 99517921hypothetical protein. 1 _, PA5417 1-788 1h pothetical protein PA5457 PA5469 ! conserved hypothetical protem f PA5470, f 9951802, jprobable peptide chåin release factor, Sprrt PA5480 1 9951813fhypothetical protein _ _ PA5482 9951816, l hypothetical protein PA5482 9951816 hypothetical protein PA5503 f 9951839 probabieATP-binding'component of ABCt' !"..... ! PA5526 9951864 ypothetical proten i < PA5529, 9951867probable sodnm/roton anti orter _ __. __, _... _.. _ PA5529 . _, __m. _.. _ ; 9951871 hypothetical '9951873 hypothetical protein PA5534 __ PA5543-T951-882 hypothetical protein PA5549 ! __9951889jglucosamine--fructose-6-phosphate aminotrarigl_mS 9 PA5552 1 9951892 1 glucosamine-1-phosphate acetyltransferase/'Imu ca PA5553 1 9951893, (ATP synthase epsilonchain u G PA5554 j 9951894 ATP synthase beta chain atpd uncd papb PA5555 ! 9951895ATP synthase gamma chain atpGuncGpapC... J PA5556'T 9951896 JATP synthase alpha chain--"'-'''''- atpA"uncApapA"j r. i I x b J PA5557 9951897 ATP s nthase delta chain atpH ncH papE PA5558 9951898 ; ATP synthase B chain atpF fflF papF PA5559 J 9951899 atp synthase C chain atpE uncEpapH J PA5560 i ? 99519001ATP synthase A chain _ _, ~ un pK sPA5561 1 9951901 IATP svnthase protein I ? axpl ? uncl i iPA5562 ! 9951903 chromosome partitioning protein SppOJ ! spoOJ J jPA5566 f 9951907lhypothetical protein, f IPA5566 1 99519071 hypothetical prot ! iln IP 9951909 ! conserved hypothetical protein id 1PA5569--9519101ribonuclease P protein component I rnpa 1 9951911150S ribosomal protein L34 IP@e V DNA replication, recombination, modifica 483 2027 DNA replication, recombination, modificat 4275; 6695 Hypothetical, unclassified, unknown 833 7803 : Translationl post-translational modificatiofn 124i 10434. Translation, post-translational modificatioi 12488 ; 10434 Translation, post-translational modificatioh 13435j_12488. Cell wall/LPS/cap§ule 14235ii 15122 : Hypothetical, unciassified, unknown 7217 1 S900j Hypothetical, unclassified, unknown 24001 Hypothetical, unclassified, unknown 27646j 28632 Hypothetical unclassified, unknown 36270 5 35905 Amino acid biosynthesis and_metabolism l _ __ _378_93--37087 i I__.. _... . __. .. ; Hypothetical, unclassifiedl unknown _ ! 40190j_ 404054. Hypothetical, unclassified, unknown 40190 40405i Hypothetical, unclassified, unknown 40589 40816i Hypothetical, unclassified, unknown 56546 56941 ; Hypothetical, unclassified, unknown 61879 62388J Hypothetical, unclassified, unknown 68616 681881 ! Hypothfetical, unclassifiedl unknown _ 69272i 695261 Hypothetical, unclassified, unknown 70091 C43 s f Hypothetical, unclassified, unknown 70636 70130 Hypothetical, unclassified, unknown 72880 73384 :. Adaptation, protection 73468 73923 t Hypothetical, unclassified, unknown 74034 74267 Hypothetical, unc ! assified, unknown 74715 74279 ! Hypothetical, unclassified, unknown 78097 77432 ' Hypothetical, unclassified, unknown 80752f 81027i Hypothetical, unclassified, unknown 811161 821741 Hypothetical, unclassified, unknown 83318 82404- Hypothetical, unclassified, unknown 98218 97754. Hypothetical, unclassified, unknown I 100124 101158i Hypothetical, unclassified, unknown 115045 1146111 Hypothetical, unclassified, unknown 1201641 Hypothetical, unclassified, unknown 121346 1222661, Energy metabolism 127378 1285021 Hypothetical, unclassified, unknown 131792 13158 Hypothetical, unclassified, unknown132577 33155j Energy metabolism 134319i 135233i Hypothetical, unclassified, unknown 1352591 135894j Hypothetical, unclassified, unknown 136386 135934 Hypothetical, unclassified, unknown i 136518gf 136991 Transport of small molecules 138818 140167 Transcriptional regulators 140218 140902f iHypothetical, unclassified unknown | 143848 143567a H pothetical, unclassified, unknown 1 4072 143845 Hypothetical, unclassified, unknown 145542--1-458-831 Hypothetical, unclassified, unknown 1 1494251 149138, Transcriptional regulators E 150906 151823 ; Hypothetical, unclassified, unknown 153696 153836 Adaptation, protection 158199158762 Nucleotide biosynthesis and metabolism iL 164415 ; Hypothetical unclassified, unknown 165737i 165219i , Transcriptional regulators r 16936iL i69906 zCarbon compound catabolism'1755D33 176108 ; Transcriptional regulators, 1827681 183706 www4 ~ Hypotheticall unclassified, unknown_. _ 184287 184439' Transcriptional regulators'J 191697 192362 H pothetical, unclassified, unknown 1 194179i 193799 HYpothetical unciassified, unknown, 19474831 194206' Putative enzymes)"207071 207823 Carbon compound catabolism ! 209533 j 207923 i transport of sma ! ! motecuiesj 210460J 209621 Hypothetical, unclassified, unknown j 2 214634 Hypothetical, unclassified, unknown, HãF 215512' Hypothetical unclassified unknown i 229738 229526, Putative enzymes, 232000 2305433 Transport of small molecules j 233100 232066'. Transport of small molecules j 233932 2331231 Transport of small molecules 1 234849, 2339293 Transcriptional regulators 236218 2371111 Hypothetical, unclassified, unknown 238896 239777 j Carbon compound catabolism 240071 240934 Hypothetical, unclassified, unknown 241753 2424455 Transport of small molecules 243841 244605i Transcriptional regulators 262557 263498 Transcriptional regulators 266616 267395 Hypothetical, unclassified, unknown 268704 2695191 Transcri regulators. 275772 276440 Hypothetical, unclassified, unknown 277334 276480 Amino acid biosynthesis and metabolism 277777 277331 i Hypothetical, unclassified, unknown 282757 282323 Hypothetical unclassified unknown 283553 282912 ! H othetical, unclassified, unknown-i 289390 2892051 v i Hypothetical, unclassified, unknown !, 293304 291154 Hypothetical, unclassified, unknown 293798 293301) Hypothetical, unclassified, unknown 299497 299081' Transport of small molecules 309092 307878' Transcriptional regulators 313227 3139251 Transport of small molecules 31 49Z71 313938' Hypothetical, unclassified, unknown 318148 317966 ! i 31814a 3179661 Hypothetical, unclassified, unknown 350841 350089 ! Hypothetical, unclassified, unknown 352164 351610 Hypothetical, unclassified, unknown 359982 360332J Enerqy metabolism i 371833 3711621 Hypothetical, unclassified, unknown 373725 3741921 Hypothetical, unclassified, unknown 378096 378575 Hypotheticat. uncfassified, unknown 382792 382037 ìFattY acid and phosPhöiiPid métaboiism 383727 3w w S Nucleotide biosynthesis and metabolism 384733 385527 Biosynthesis of cofactors, prosthetic grou 393308 393814 Hypothetical, unclassified, unknown 402020 402598 Energy metabolism 406498 406247' S s Central intermediary metabolism 407098 ! Hypothetical, unclassified, unknown 413654 SHYpotheticall unclassified, unknown ! 414529i 413933, -F Protein secretion/export 4175271 418894 ! Transcriptiona) reguiators'420683J 421537J Hypothetical, unclassified, unknown i 422207 : IHYpothetical unclassified, unknown, 423460J 423660 ', Hypothetical, unclassifiedl unknown 1 4271201 426863 i Hypothetical, unc ! ass ! fied, unknown 439991 ! 440395 ; ! Nucleotide biosynthesis and metabolism 445691 ! 444687j iTranscriptiona) reg uiators"446227 j 445715j . _. _ 9 t ~ Hypothetical, unclassified, unknown"446773 ! 446339 j , Hypothetical, unclassified, unknown i 4473421 446773 ; Biosynthesis of cofactors, prosthetic grou 449384 448431) Motility & Attachment 453239 4541141 Transcriptional regulators 463079 463873 ; Hypothetical, unclassified, unknown 470081 470650 Transport of small molecules 1 476333 4777904 Hypothetical, unclassified, unknown 484404 4848381, Hypothetical, unclassified, unknown i 496478 496362J Transport of small molecules 496871 498361 ; Related to phage ; transposon, or plasmid 501120 5001041 Hypothetical, unclassified, unknown 502599 501376 Transcriptional regulators.'~ 504121 505029, H othetical, unclassified, unknown 510499 509825 t Adaptation, protection 514775WiX Hypothetical, unclassified, unknown {526877 527179 J Hypothetical, unclassified, unknown 535085 535489 ! Transcriptional requlators 535539 5361081 -4 Transcriptional regulators 539143 538217i Transcriptional regulators ! 540735 539785 Hypothetical, unclassified, unknown ! 549614 549294 Putative enzymes 5503811 Hypothetical, unclassified, unknown 550813 550520 Putative enzymes, 552746 5529941 Hypothetical, unclassified, unknown 558361 557354 Biosynthesis of cofactors, prosthetic grou 560808 562013 Biosynthesis of cofactors, prosthetic grou 562006 562728 ! Biosynthesis of cofactors, prosthetic grou 562721 563545 Biosynthesis of cofactors, prosthetic grou 563549 564235 Hypothetical unclassified, unknown 564344 564574 Biosynthesis of cofactors, prosthetic grou 576040 575516 Transcriptional regulators ! 586663 585980 Putativeenzvmes {590105 590821 S 0 w Transcriptional regulators 594580 595134 Hypothetical, unclassified, unknown 598608 598994i Hypothetical, unclassified, unknown 600176 599757i Hypothetical, unclassified, unknown J 600426 601394 Hypothetical, unclassified, unknown Central intermediary metabolism 604896 603706i Hypothetical, unclassified, unknown 609999 609202 Energy metabolism 611281 612444i jpothetica), unciassified, unknown J61M Carbon compound cataboiism ! 613338 614402 j Hypotheticat. unciassified, unknown J 617549 616371J j Hypothetical, unclassified, unknown" ! 620488T 620135t Hypothetical, unclassified, unknown 621695 622033i Hypothetical, unclassified, unknown J 622726 622884J Hypothetical, unclassified, unknown f, 624199', 6238524 w f Hypothetical ! unclassified, unknown S 624803 624189 l Hypothetical, unclassified, unknown 1 629884 628763i , Hypothetical, unclassified, unknown 638830 6383811 Translation, post-trånslational modificatiogl 639115J 638900' Translation, post-translational modificatioh 639316'640341 i Biosynthesis of cofactors, prosthetic grou ! 641073 641426i Hypothetical, unclassified, unknown 643714 643208J Hypothetical, unclassified, unknown 649263 648931 l Hypothetical, unclassified, unknown 650538 650158 Biosynthesis of cofactors, prosthetic grou 652483 651497 I w- Chaperones & heat shock proteins 653772 652480 Adaptation, protection 656527 653753 Energy metabolism 669415 670089 Transcriptional regulators l 673091 672777} Transcriptional regulators 673961 673191 Hypothetical, unclassified, unknown 674667 675026r' Hypothetical, unclassified, unknown 675390 675839 Related to phage, transposon, or plasmid 677083 677409 Hypothetical, unclassified, unknown 685846 6867. 183 Hypothetical, unclassified, unknown 686693 686899 Related to phage, transposon, or plasmid 688605 668967' s Related to phage, transposon, or plasmid 689236 689466 Related to phage, transposon, or plasmid 690420 690674f Hypothetical unclassified, unknown 693596 6943661 Hypothetical, unclassified, unknown 1 698932 699720i Hypothetical, unclassified, unknown 1 699744 7008351 ! h Related to phage, transposon, or plasmid 700835 701170i Hypothetical, unclassified, unknown 701477 7025291 Related to phage, transposon, or plasmid ; 702529 702831 ; Related to phage, transposon, or plasmid 702828 7030588; Transcriptiona (regu (ators 706672 706028 ; 0 0 Hypothetical, unclassified, unknown 706944 707366 Hypothetical unclassified unknown 1 709182 708535 Hypothetical, unclassified, unknown 714247 713279J P l Hypothetical, unclassified, unknown 714686 714264 j Hypothetical, unclassified, unknown 1 717231 175'81 Proteinsecretion/export apparatus 737530 737081 Hypothetical unclassified unknown 737677 738108= Protein secretion/export apparatus 738485 738111 j Protein secretion/export apparatus 741335 741928 Protein secretion/export apparatus* 744333 745742 Protein secretion/export apparatus 745742 746956 Hypothetical, unclassified, unknown 748662 749774 Hypothetical, unclassified, unknown 770156 770818 Hypothetical, unclassified, unknown"770847 771326 ! Hypothetical, unclassified, unknown 772275 772700 j 'Hypothetical, unciassified, unknown 775321 774416J . ; , Putative enzymes 1 778181 1 7767871 Putative 779208s... _... _ 778309 ; 'Transcriptionaf regutators 782113 781259j X, unclassified, unknown w 782525 ; Central intermediary metabolism'S 782570g 782965i Hvpothetical, unclassified, unknown l 7838331 783576 ! Hypothetical, unclassified, unknown i 784698j 785174J Hypothetical, unclassified, unknown 785969) 786925! Hypothetical, unclassified, unknown f 786928 788253J Related to phage, transposon, or ptasmidj 7j39144 789356J Related to phage, transposon, or plasmicf, 7901661 9060011 Related to phage, transposon, or plasmid'795793 796776} Hypothetical, unclassified, unknown 797251 797598' Putative enzymes"")'"798827 797925 Transcription, RNA processing and decirF 801967 8012751 Hypothetical, unclassified, unknown ! 802239 801967J Hypothetical, unclassified, unknown 805228 805473l Hypothetical, unclassified, unknown 1 809882 8095743 Hypothetical unclassified, unknown 828344 827400 Secreted Factors (toxins, enzymes, algin 831914 832498 Protein secretionlexport apparatus 835523 837322 8 3 Protein secretion/export apparatus 837328 838182 Translation, post-translational modificatio 839407 840324 j Hypothetical, unclassified, unknown ! 844295 843723 Hypothetical, unclassified, unknown ! 845682 845278 Transport of small molecules 858646 858951 Hypothetical, unclassified, unknown 859007 8601701 Hypothetical, unclassified, unknown (866451 865636 Hypothetical, unclassified, unknown 881077 881400 Hypothetical, unclassified, unknown 883216 882989 4 Hypothetical, unclassified, unknown 885635 886108 Transcriptional regulators 893041 893994 Hypothetical, unclassified, unknown J 895668, 8953961 Hypothetical, unclassified, unknown 896416, 897228i Hypothetical, unclassified, unknown 898886i 8984400 e wl Hypothetical, unclassified, unknown 900165 8998301 Hypothetical, unclassified, unknown 901046-9004081 Putative enzymes ; 903692 904633i Chaperones & heat shock proteins 913086 9135fit Hypothetical, unclassified, unknown 929084 929503 Hypothetical, unclassified, unknown Putative enzymes 932725 932102 Ce) t division935989 936294 Hypothetical, unclassified, unknown, 9426481 9434301 , Hypothetical, unclassified, unknown 948776 9491591 Hypothetical, unclassified, unknown 949280 949693 Cell wall/LPS/capsule 1 9506481 9497161 Amino acid biosynthesis and metabolism 952514 952158 Hypothetical, unclassified, unknown 955722 955456 Putative enzymes 9625451 962925 __... __. Hypothetical, unclassified, unknown 9777431 9774201 ! , Hypothetical, unclassified, unknown ì 9842451 984535, Translation, post-translational modification-986818 989442J Amino acid biosynthesis and metabolism, 989590.'990828 gTranscriptional requlators 991013 : 991198 jTranscriptional regulators', _ 992543= 991830 : {Hypotheticat, undassified, unknown F'993409993783j 993409-993783 Hypothetical, unclassified, unknown. 993776j 994051. Transport of small molecules'996038r 9974861 Hypothetical, unclassified, unknown J1007548 {10072341 Carbon compound catabolism ! 1012972i 1011983 : Amino acid biosynthesis and metabollsm ; 1020708'j 1021607'- Hypothetical, unclassified, unknown i 1027445i 1027984. j l 2 Hypothetical, unclassified, unknown 1030151 1029825i Nucleotide biosynthesis and metabolism 1032763j'1032095' Nucleotide biosynthesis and metabolism 1033824 10327631 jHypothetical, unclassified, unknown 1 1035277'1035981 i Putative enzymes 1039968 1040432i Putative enzymes 1040432 1040707 ! Translation, post-translational modificatio 1 1043404 1041689. Hypothetical, unclassified, unknown 1046462 104667 Adaptation, protection"1048019"10475491 S sl Transport of small molecules 1053848 10545431 Transport of small molecules 1054566 1 05S006 j Transport of small molecules 1055009 1056052i Transport of small molecules 1056049 1 0573474j Transport of small molecules 1 1057400 10579061 i Hypothetical, unclassified, unknown 1059622 1060296i Hypothetical, unclassified, unknown 1062034 1061207i Hypothetical, unclassified, unknown 1062369 106206 Hypothetical, : unclassified, unknown 1062601 10628851 . w.... ______ Hypothetical unclassified unknown'1062921 10635441 1062921 1063544 ! Hypothetical, unclassified, unknown 1065138 10654251 Secreted Factors (toxins, enzymes, algina 1067817 1066321 -l r fo Hypothetical, unclassified unknown ! 1068193 1068456, Hypothetical, unclassified, unknown, 1071877 10712391 Hypothetical unclassified, unknown i 1072462 1072839, Chaperones & heat shock proteins 1073960 10746731. Hypothetical, unclassified unknown 0 1082949 1083854, Hypothetical, unclassified, unknown 1090606 109085741 Adaptation, protection 1092498 Amino acid biosynthesis and metabolism 10932511 1094129' Hypothetical, unclassified, unknown t 10952761 10960341 Nucleotide biosynthesis and metabotism J 1096063 1096773j t Putative enzymes 1 110700_0 1107761 Hypothetical, unclassified, unknown _i 1113050 1112574 ; i Hypothetical, unclassified, unknown 1123850 11233'561 Hypothetical unclassified, unknown 1125865 1125548J Hypothetical, unclassified, unknown 1126338 1125865 j Biosynthesis of cofactors, prosthetic grou 1136388 1137035j Hypothetical, unclassified. unknown 1144862 11452001 Hypothetical, unclassified, unknown 1150470 1150721 ; Chaperones & heat shock proteins 1153637 1155547) Hypothetical, unclassified, unknown 1 1163660 1164022 ; Hypothetical, unclassified, unknown, 1175614t 1176375tt ! Hypothetical, unclassified, unknown 1176380, 1176982 Hypothetical, unclassified, unknown 1176958 1177620' Hypothetical, unclassified, unknown Two-component regutatory systems 1*189172 1190380 j Motility&Attachment i, 1194207'1 1195223i Motili & Attachment 11973901 1197833'. Hypothetical, unclassified, un 11985511 1197838i Hypothetical, unclassified, unknown 1 1199946 1198750 HYPothetiCal, unclassified, unknown 1 1207875 1207540 Hypothetical, unclassified, unknown 1212571 12118881 l-i Hypothetical, unclassified, unknown 1214502 1213195if Translation post-translational modification 1215284 1215727i t-P Biosynthesis of cofactors, prosthetic group 1218181 1218933J Antibiotic resistance and susceptibility 1 1221691 | 1222098, Hypothetical, unclassified, unknown 1226278 1225757 Hypothetical, unclassified ; unknown 1227302 1226427' Transcrintional requlators 1229344 12302 1 9, Transcriptional regulators 1 1236644 1237546i Hypothetical, unclassified, unknown 1243118 1242750 Adaptation, protection 1245665 1245928 Hypothetical, unclassified, unknown 1249552 1249019 Nucleotide biosynthesis and metabolism 1251154 1249907 Nucleotide biosynthesis and metabolism 1254309 1251418t Two-component regulatory systems'1255042 1255752' Adaptation, protection 1257772| 12579811 Hypothetica !, unciassified, unknown 1258470 1258087 ; Amino acid biosynthesis and metabolism. 1260442 92 Hypothetical, unclassified, unknown 1263378 1264190 Hypothetical, unclassified, unknown 1264919 12641911 Hypothetical, unclassified, unknown 1266111 1266782 Hypothetical unclassified unknown 1267282 12676021 l l C Energy metabolism ! 1272796 12722001 Energy metabolism 12728071, Energy metabolism 1276608 w Energy metabolism 1276784 Transport of small molecules 1284513 12858231 Hypothetical, unclassified, 1294138 1294809, Hypothetical unclassified, unknown 1303457 1303864 Hypothetical, unclassified, unknown 1303892 1304449 ; Hypothetical, unclassified, unknown 1305583 1306056i Hypothetical, unclassified, unknown-1 Hypothetical, unclassified, unknown 1317202 1315916 Hypothetical, unclassified, unknown 1 1318150 1317404l Amino acid biosynthesis and metabolism, 1319514 1318147i Hypothetical, unclassified, unknown 1321000 13203861, Transcriptionai regulators 1 1326939 326046 Putative enzymes 1327024 1327803 ,'Hypothetical, unclassified, unknown 1 1330467 1330117 . Hypothetical, unclassified, unknown 1331517 1331714 HHpothetical, unclassified, unknown _ 1334671 1334928i Antibiotic resistance and susceptibiiity f 1339082 1337931J , ISecreted Factors (toxins, enzymes algina 1'573'7 1357712, in, a 13573171 1357712 ! i I Transcriptional reg Transcriptional regulators __i_ 1370092j 1369418i tTranscrlptiotulators i3 1379168 1378500' Hypothetical, unclassified, unknown 1 1391277 ! 1391861 Transcriptional_gulators i 1396731 1397180 Hypotheticai, undassified, unknown j OS4S9'1406752] .. I_. _1406752 Hypothetical, unclassified, unknown j 1408999 1409274J Transcriptional regulators 1 14099491 1410476 ; -a f Putative enzymes 1417500 j 1417961) 3Hypothetical, unclassified, unknown í 14179651 1418738'; Transcriptional regulators 14257545411425140 Energy metabolism 14320373 14329271 Hypothetical, unclassified, unknown 1435493 1435825 Transcriptional reguiators1441547 1440639 Hypothetical, unclassified, unknown 1444451 1442904 ! Transport of small molecules 1456723 14558151 Hypothetical, unclassified, unknown 1462696 14634031 Hypothetical, unclassified, unknown 1463586 1463936 Hypothetical, unclassified, unknown 1464111 1464860 Hypothetical, unclassified, unknown 1467320 1466109 Hypothetical, unclassified, unknown 1467901 1467488 Hypothetical, unclassified, unknown 1468510 1468890 Hypothetical, unclassified, unknown ! 1470978 1470580 Hypothetical, unclassified, unknown 1474391 1474714i Transcriptional regulators 147546 Hypothetical, unclassified, unknown 1479791 14790211 Hypothetical, unclassified unknown 1483123 1483875 Hypothetical, unclassified, unknown Hypothetical, unclassified, unknown 1486967 1486266 Hypothetical, unclassified, unknown 148909 Biosynthesis of cofactors, prosthetic groul 1491913 149305543 i Hypothetical, unclassified, unknown 1494959 14954921 : Hypothetical, unclassified, unknown 1495635 1495997 t l Putative enzymes _ ! 1496920 14960871 Hypothetical, unclassified, 1516433 1516687i s Two-component regulatory systems 1 1518914 15195463 Hypothetical unclassified, unknown i 1519627 1519968 Hypothetical, unclassified, unknown 1526657 1526430 f f Carbon compound catabolism 1533238 1534278in Hypothetical, unclassified, unknown) 1552641 1552997 ! Hypothetical, unclassified, unknown 1553112 1553675 ! Transcriptional reaulators ß 1559122 1558880i Adaptation, protection 1559254 1559859 ! t Hypothetical unclassified, unknown 1572023 1572544' Motility & Attachment 1575290 15755591 E lWo l 1575559 i Motility & Attachment 1583956 15847981 J w Two-component regulatory systems 1585640 1586014 Chemotaxis 1591286 15921761 Cell division i 1592271 1593059i Chemotaxis i 15940871 1594566' Hypothetical, unclassified, unknown 1 15945971 1595004 Hypothetical, unclassified, unknown 15968891 15973051 Hypothetical, unclassified, unknown 1 1599982 1599428' Transport of small molecules Transport of small molecules 16028771 ! 1603548 Transport of small molecules, 16036711 16044292 Hypothetical, unclassified, unknown i. 1604426i 1604602' « E gy metabolism l 1605088i 1607061' Energ metabolism 1607065i 1607607'i Energy metabolism. 1607604 ! 1608071, u Ls lHypothetical, unclassified, unknown, 1615908. 1614670i Hypothetical, unclassified, unknown''1617085 ! 1615895 F Hypothetical, unclassified, unknown1619907) 1620263 Transport of small molecules 1 1624715', 1623864l Transcriptiona ! regutators j"'1634492"1633842 j Hypothetical, unclassified, unknown i 1638639t 1638379 ! Hypothetical, unclassified, unknown 1639794 1638652 Hypothetical, unclassified, unknown j 1647046 1646537 j Hypothetical, unclassified, unknown 1649555 1648629 e Hypothetical, unclassified, unknown 1649928 1650308 Transcriptional regulators 16607271 1661386 s m Cell division 1665065 1665934 DNA replication, recombination, modifica 1666025 1668409 DNA replication, recombination, modifica 1669989 1672034 Hypothetical, unclassified unknown 1672080 1672406 Putative enzymes 1673204 1674352 Hypothetical, unclassified, unknown 1677559 1678407 Hypothetical, unclassified, unknown 1678590 1678261 Transport of small molecules 1678952 1678584 Hypothetical, unclassified, unknown 1684962 1684753 Energy metabolism 1689339 1687924 w 0 Energy metabolism 16940451 16931191 Hypothetical, unclassified, unknown 1696467 1697099 Hypothetical, unclassified, unknown 1697188 1697919 Hypothetical, unclassified, unknown _ 1697916 1698344 Hypothetical, unclassified, unknown 1704522 1704761t Hypothetical unclassified, unknown i 1709765 1709412i S m Hypothetical, unclassified, unknown 1 1712698 17125191 mo w m Energy metabolism 1 1720744 17211300 w _ w Energy metabolism'1721124"1721492 Energy metabolism 1721496 17232, 68 Energy metabolism 1723280 1723987 Energy metabolism 1728416, 1729852 Energy metabolism 17301811 1731347 Energy metabolism 1 31347 1732234 Hypothetical, unclassified, unknown 1734004 1734768 w Hypothetical, unclassified, unknown 1735063 1734827i Hypotheticai, unclassified, unknown j 173S236, 17357091 Hypothetical, unclassified, unknown 1735706 1736152) Hypothetical, unclassified, unknown 1736189 17374181 Fatty acid and phospholipid metabolism 1753418 1752903i Hypothetical, unclassified, unknown 1762433 17628701 iTranscriptional regulators i 1762928i 1763752t Putative enzymes 17653451 1766205i (pothetical,, unclassified, unknown""-.. ,.,.-,-. 1766285i. 1788947 ; IHYpotheticall unclassified, unknown 17669561'1767762 Transcriptiona ! regujatorsJ 1773682 1774548 j Transport of small molecules. p ; _1775945 ; 177 0 Transport of small molecules i 1779877 ! 1780428 ! Hypothetical, unclassified, unknown, 1784108§ 1785016. Hypothetical, unclassified, unknown i 17868881 17871661 Hypothetical undassified, unknowni 1790879 j 1790472 Hypothetical, unclassified, unknown 1805218 1805724 Hypothetical, unclassified, unknown i 1814995 1815135, Hypothetical, unclassified, unknown 1816352 1816858 Hypothetical, unclassified, unknown'1824969 1825430 Biosynthesis of cofactors, prosthetic grou 1826040 1825495' Hypothetical, unclassified, unknown 1826675 1826118i Hypothetical, unclassified, unknown 1827052 18267325 # l 5 Amino acid biosynthesis and metabolism 1836367 1837227 Protein secretion/export apparatus 18415171 18404681* w Protein secretion/export apparatus 1842302 1841514 J - Protein secretion/export apparatus i-1846717 18452411 Protein secretion/export apparatus 1 1847227 1848093 Hypothetical, unclassified, unknown 184. 8707 18490720 Hypothetical, unclassified, unknown 1849077 1849406 Protein secretion/export apparatus 1851982 1852278 Protein secretion/export apparatus 1855862 1856299 Hypothetical, unclassified, unknown 1856308 1856553 Protein secretion/export apparatus 1862558 1862761. Protein secretion/export apparatus 1 1862764 1863021 Protein secretion/export apparatus 1 1863024 1863371 Protein secretion/export apparatus 1863799 1864137 Hypothetical unclassified, unknown 1874967 1875767 Hypothetical, unclassified, unknown 1875849 1876580 Hypothetical, unclassified, unknown 1887297 1887058 Hypothetical, unclassified, unknown 1888186 1887698 Hypothetical, unclassified, unknown 1889173 1888985 Amino acid biosynthesis and metabolisml 1891815 1890739 Amino acid biosynthesis and metabolism 1896630 1897247 Hypothetical, Unclassified, unknown 1912756 1912217 s w Biosynthesis of cofactors, prosthetic grou 1917599 1918087 Transport of small molecules 1921174 1922226 Central intermediary metabolism 1926123 1925797 Transport of small molecules ! 1931775 1930564 Hypothetical, unclassified, unknown i 1933632 1933054 Energy metabolism 1937644 1935035 t Hypothetical unclassified, unknown 1939583| 1940206 s Hvpothetical, unclassified, unknown 19424421 1941720 Translation, post-transtationa ! modification 1943067 1944737 Transition, post-transtationat modification 1944747 1946129 ! Biosynthesis of cofactors, prosthetic grou 1947041 1946187 i Translation, post-translational modificatioh 19562271 1958623i DNA replication, recombination, modifica 1972959 1973405 ; Nucleotide biosynthesis and metabolism 1 1973470 1974210 ; E f unclassified, unknown 1974627 9742 small molecules 1979941, 1978439 rs r Hypothetical, 1984389 19850331 tHypotheticalz unclassified, unknown s 19894233 1989109 Hypothetical, unclassified, unknown 1993898 1993461i Hypothetical, unclassified, unknown 1 1995164, 1994667' Hypothetical, unclassified, unknown X 1998587 ! 1998949 Hypothetical, unclassified, unknown Y 199 1999512 j Hypothetical, undassified, unknown ! 2004892J 2004374 ! Hypothetical, unclassified, unknown _ j 2007665i 2008249 i Hypothetical, unclassified, unknown rv-Lrv2012530 y2012255 Hypothetical, unclassified, unknown j 2015136i 2014915i Transcriptional regulators 2019690 20188031 Transport of small molecules 2022398i 2021712' Hypothetical, unclassified, unknown 2028454 2028981 ! -|s s Fatty acid and phospholipid metabolism 2031466 2031705 Hypothetical, unclassified, unknown 2034857 2034066 Transport of small molecules 2052941 2053264i En Energy metabolism 2053277 205367 Transcriptional regulators 2054223 2053672 Hypothetical, unclassified, unknown 2054309 2054842 Hypothetical unclassified, unknown 2062401 2061664 Hypothetical, unclassified, unknown 2065545 2064853 Hypothetical unclassified, unknown 2066767 2065493 Hypothetical, unclassified, unknown 2067955 2066786 Hypothetical, unclassified, unknown 2068728 2067961 Secreted Factors (toxins, enzymes, algma 2q70685 2071 3 Secreted Factors (toxins, enzymes, algn 2071209 2071697j Secreted Factors (toxins, enzymes, algin : 2076311 207 5 Transcriptional regulators 1 2085426 2084476 Transcriptional regulators t 2085929 20854B1 Hypothetical, unclassified, unknown 2088034 2086808 Hypothetical, unclassified, unknown 209183 209149 Hypothetical unclassified, unknown 2103294 2103770 ! HYDothetical unclassified unknown 2103770 2104096 j Translation, post-translational modificatio i 2109511 2108942 n 2109511 Hypothetical, unclassified, unknown 2109854 2109558i l Hypothetical, unclassified, unknown 2117897 211809 ! Hypothetical, unclassified, unknown 2118585 211889 ! Hypothetical, unclassified, unknown 2118926 2119747 Hypothetical, unclassified, unknown 2122222 2120225 Hypothetical, unclassified, unknown,'I 2137785 2136520t Hypothetical, unclassified, unknown 2138598 2137846j Hypothetical, unclassified, unknown 2141002 2140433 a Hypothetical, unclassified, unknown 2141487 21409991 Hypothetical, unclassified, unknown 2145894 21465021 Hypothetical, unclassified, unknown 2146609 2146875gt Hypothetical, unclassified, unknown 2148854 2149189 P w Hypothetical, unclassified, unknown 2150364 2149864 Hypothetical, unclassified, unknown 2150524 2150781 i Hypothetical, unclassified, unknown 2157968 21'59167 ; Transcriptional regu tators"2164548 2163883J Two-component regulatory systems 2165876"2166553 Biosynthesis of cofactors, prosthetic grou 2171865 _, 2171936= Biosynthesis of cofactors, prosthetic grouj"2171989 ! 2172903i ; Biosynthesis of cofactors, prosthetic grouj'"217362j 2173940 fHypothetical, unclassified, unknown í 2181744'2181181' iHypothetical, unclassified, unknown'. 21820971 2181741 Chaperones&heatshockproteins'_21823941 21821168 'fatty acid and phospholipid metabolism 1 21870651 2188246 ; Hypothetical, unclassified, unknown 2188459 21898831 Carbon compound catabq ! jsm ! 2196132 2195494 : Transcriptiona ! regutatorsY 2198891 2199694 j Putative enzymes i 2203446 2202649i Ho Fatty acid and phospholipid metabolism 2206353 1 2205190 t # o- Transcriptional regulators 2206806 1 2206402 i Hpothetical, unclassified, unknown 2206999 2207928 v z w Hypothetical, unclassified, unknown 2213539 2213315 Hypothetical, unclassified, unknown 2219099 2218098J Hypothetical, unclassified, unknown 2220275 2220574J Hypothetical, unclassified, unknown 2221157 2220903 ; Hypothetical, unclassified, unknown 2223804 2224478 Hypothetical, unclassified, unknown 2227541 2229001 Transport of small molecules. 2234080 2235309f Transcriptional regulators 2244995 2245948i Central intermediary metabolism 2246456 2245986 Transport of small molecules 2256704 2257720 Putative enzymes 2259478 2260659i Hypothetical, unclassified, unknown 2265764 22651261 Translation, post-translational modificatio 2272460 2274568 Transport of small molecules 2277552 2278982 S s Hypothetical, unclassified, unknown 2278982. 2279794 Hypothetical, unclassified, unknown 2281578 2279917 Hypothetical, unclassified, unknown 2290335 2289085 Hypothetical, unclassified, unknown 2297072 2297920 Hypothetical, unclassified, unknown 1 2300676 2301755f Transport of small molecules 2303022 2304215 HvDothetical unclassified, unknown 1 23066271 2305782i t v Carbon compound catabolism 2307957 2309432 Hypothetical, unclassified, unknown 2312899 2313789 Biosynthesis of cofactors, prosthetic grou 2314512 2315690 Putative enzymes2316708 2317403 Hypothetical, unclassified, unknown 2318624 2318226 0 Hypothetical, unclassified, unknown 2322071 2321130 DNA replication, recombination, modificai, 2329348 2330424 Putative enzymes2332059 2330959J iHypothetical, unclassified, unknown 2332820 2332392, Transcriptional regulators 1 2335172f 23361041 Hypothetical, unclassified unknown""2339987 2339352 ! Hypothetical, unclassified, unknown 2346477 2347838 Hypothetical, unclassified, unknown 1 2352430i 2351906 Putative enzymes 1 23567131 23575731 HYpotheticat, unciassified, unknown2358024 2358311) 'Hypothetical, unclassified, unknown I 2361706j 2361873i L ! Hypothetical, unclassified, unknown 2364816 2365058 ! IHym hetical, unclassified, unknown j 237747 2376538i Hypothetical, unclassified, unknown 23817781 23814732 Hypothetical, unclassified, unknqwn 2390255 2390620j Hypothetical, unclassified, unknown"2390949 2392046J Hypothetical unclassified, unknown 2393424 ! 2393633a Hypothetical, unclassified, unknown 23937081 23941781 Hypothetical, unclassified, unknown i 23962521 2395944' ------------1------- Hypothetical, unclassified, unknown Hypothetical, unclassified, unknown"12404655 ! 2404386 j Hvpothetical unclassified unknown, 2405233. 24049495 Hypothetical, unclassified, unknown 2405739 2405230 ; Hypothetical, unclassified, unknown i 24. 05993 2406877' Hypothetical, unclassified, unknown 2406961 24071311, Hypothetical, unclassified, unknown 2407236 24076611, Hypothetical, unclassified, unknown 2409837 2410181, Hypothetical, unclassified unknown 2411709 2412122 l Transcriptional regulators 24 Hypothetical, unclassified unknown 2416376 241741 31 Hypothetical, unclassified, unknown 2424400 2423924j Hypothetical, unclassified, unknown 2427017 2425497 j Hypothetical, unclassified, unknown 2430170 2431129 Transport of small molecules. 2433748 2435070 Transport of small molecules 2441555 2440347 Transcriptional regulators 2441771 2442691 X -ffi Hypothetical, unclassified, unknown 2443161 2444366 Hypothetical, unclassified, unknown 2445533 2444886 b r Hypothetical, unclassified, unknown 2446564 2445545 Hypothetical, unclassified, unknown 2447325 24465971 Hypothetical, unclassified, unknown 2447989 2447573 Hypothetical, unclassified, unknown 2448533 2448533, 2448033 Transcriptional regutatorsj 2449545) 2448568 Hypothetical, unclassified, unknown 2450765 24495541 Hypothetical, unclassified, unknown 2451707 2452426i Transport of small molecules | 24575101 2458280, HYPothetiCal unclassified unknown 1 2468032|. 24690991 Hypothetical, unclassified, unknown 2472104 2472409 Hypothetical, unclassified, unknown 2479130 2478312 Amino acid biosynthesis and metabolism 2480844 2481830 Secreted Factors (toxins, enzymes, aigina 2485471 2486118 I Transcriptional regulators 1 2487293 24863551 Hypothetical, unclassified, unknown 1 2488950 2489732 Hypothetical, unclassified, unknown 2508775 2509467 Hypothetical unclassified, unknown 2510622 2511050 Hypothetical, unclassified, unknown 2512511"2513182J t i Y Hypothetical, unclassified, unknown 2523239 2522958 Hypothetical, unclassified, unknown 2524201 2523236 Transport of small molecules 1 25250521 2524198' Transport of small molecules 2525846 2525049i Energy metabolism i 25276571 2527412t Putative enzymes 2529467 25277431 IHypothetical, unclassified, unknown 1 2540082'2539063ri r J ~vt Hypothetical, unclassified unknown ! 2549748| 2549906. Transcript onal regulators 25539651 25548581 itransport of small molecules 1 2571691 2570855 ; Hypothetical'unclassified, unknown 25733651 2572805) , Hypothetical, unclassified, unknown, 25795421 2580882 {Transport of small molecules ~. ~ 2582097'2583407 3Carbon compound catabolism 1 2587906 2589414i [iJiypothetical, unciassified, unknöwn f 25933301 25945471 i Hypothetical, unclassified, unknown s 2595985i 25967795 Transport of small molecules i 2597869 i 2598522 f Hypothetical unclassified, unknown 1 2614893 2615438 Hypothetical, unclassified, unknown 2617019 2617516 i Hypothetical unclassified, unknown (2617529 31 Hypothetical, unclassified, unknown 2619695-26207-1-11 Hypothetical, unclassified, unknown 2623284 26238561 Hypothetical, unclassified, unknown 2627175 2626780 s t l Transcriptional regulators 2635971 2635051 ? Transport of small molecules 2645303 2646727 j Hypothetical, unclassified, unknown, 2689240 2689569} Hypothetical ; unclassified, unknown 268956895690126 0 w E Putative enzymes 2694544 2693780 Hypothetical, unclassified, unknown 2694763 2694545 Hypothetical, unclassified, unknown 2701205 2702065 Hypothetical unclassified unknown. 2705772 27060861 Hypothetical, unclassified, unknown 2723221 2722754J Hypothetical, unclassified, unknown 2724222 2723308 Hypothetical, unclassified, unknown _ 2724484 2724729 Hypothetical, unclassified, unknown l 2730520j 27299750 Hypothetical, unclassified, unknown 2732965 2732531 Hypothetical, unclassified, unknown 2738840 2739715 Amino acid biosynthesis and metabolism 2740882 2739761ii Amino acid biosynthesis and metabolism 2747072 2746689 ; Hypothetical, unclassified, unknown 2753464 2752865J Hypothetical, unclassified, unknown 275. 4601 2754822 j Hypothetical, unclassified, unknown, 2755724 27562511 Hypothetical, unclassified, unknown 2756308 2756649' Hypothetical, unclassified, unknown 2760086 2759481J Hypothetical, unclassified unknown 3 2760618 2760322 Hypothetical, unclassified, unknown 2761350 27608711. Hypothetical, unclassified, unknown 2781450 2780926 Tfanscriptionaireguiatorsi 2786355 2785369 Transcriptional regulators 2787885 2786971 Central intermediarg metabolism i 2791219} 2791863 Hypothetical, unclassified, unknown j 2791905 2792816 Putative enzymes 1 2794132} 27927981 o Hypothetical, unclassified, unknown t 2803344j 2803622i Hypothetical unclassified, unknown} 28041311 2803859' Hypothetical, unclassified, unknown j 2805916 280629Q ! Putative enzymes I 2807368 28063491 Transcriptional regulators i 28074681 2808511 Hypothetical, unclassified, 2814766i 2815281 Transport of small moiecu ! es 2817448 2818674J Hypothetical, unclassified, unknown''2818885 2818718 ! Hypothetical, unclassified, unknown'. 2822321L 2821704 ! Carbon cornpound catabolism 1 28255903 28246589 Carbon compound cataboiism 2833129 ; 2832368 Carbon compound catabolism, 2H Transport of small molecules _ __ 1 28419651 2840511, Fatty acid and phospholipid metabolism 2865104 28641691 ; Hypothetical, unclassified, unknown Hypothetical, unclassified, unknown 2867505 2866192 Hypothetical, unclassified unknown | 2876409} 2875696' Hvpothetical unclassified unknown i 2880519i 28815621 Transcriptional regulators Putative enzymes 2885332 2884205 Putative enzymes Putative enzymes,'2888551 2885361 Putative enzvmes 2887336 2886569l _.,.. _Y _-. »-- Transcriptional requlators Fatty acid and phospholipid metabolism 2923926 2923366i Transcriptional regulators'2934387 2933581 Hypothetical, unclassified, unknown 2945263 2945868 Hypothetical unclassified, unknown 2948581 2948976 Hypothetical, unclassified, unknown 2948973 2949332 Hypothetical, unclassified, unknown 1 2949332 2949637 HYPothetiCal unclassified, unknown 2949634 2949969 z Translation, post-translational modificatio 2954695 2953415 Chaperones & heat shock proteins 2956778 2956152 S-m > Cell division 2959239 2956804 Translation, post-translational modificatio 1 2û6û455 2961135i Translation, post-translational modificatioh 2962002 2962220 Hypothetical, unclassified, unknown ! 2964842 2964606 w Transcription, RNA processing and degra 2969986 2971113 Nucleotide biosynthesis and metabolism j 2972698 2974068 Energy metabolism2983204 2983881 Z E Energy metabolism 2986242 29875881, Energy metabolism 1 29920010 2992501' Energy metaboiism2992547 2992855' Hypothetical, unclassified, unknown 1 3008323 3008009 j Hypothetical, unclassified, unknown 3012536 3012279 Biosynthesis ofcofactors, prosthetic grou 3015581 3015937 Hypothetical, unclassified, unknown 3016245 3016598 Hypothetical, unclassified, unknown 3016883 3016674 Protein secretion/export apparatus 3020928 3020503 < Protein secretion/export apparatus 3021338 30209 8 S-l Protein secretion/export apparatus 3021741 3021307 Transport of small molecules 3025507 3024704 Transcriptional regulators ^ t 30280741 30290031 Amino acid biosynthesis and metabolism 3031397 3030435} Hypothetical, unclassified, unknown 3042501 3043415 Related to phage, transposon, or ptasmic 3044765 3043749 Energy metabolism 3047969 3047643 Hypothetical, unclassified, unknown 3050611 30 Hypothetical, unclassified, unknown 3057375 3057, 608. ypo e ica, unclassified, unknown 3060659"060264 Energy metaboiismj 3070365 3070703 3070365 ypothetical, unclassified, unknown 1 30737311 3074417'. rHypothetical, unclassified, unknown ! 3075217 ! 3074579 j Hypothetical, unclassified, unknown 30754101. 30758892 ! ; Hypothetical, unclassified, unknown 3075921 i 3076313' : 'Hypothetical, unclassified, unknown 1 3076343i 30766211 : Central intermediarv metabolism I 3079196 3079834'. 'Hypothetical, unclassified, unknown 1 3089612'3088659 ; Hypothetical, unclassified, unknown , Hypothetical, unclassified, unknown 3094184f 3093657 Hypothetical, unclassified, unknown 3096051 j 3094756 Hypothetical, unclassified unknown 1 30989781 3098625 Hypothetical, unclassified, unknown 30997291 3099472i DNA replication, recombination, modifica 310011111 3099809 i Translation, post-trans) at ! qna) modificatiop 3102493 3100115 : Translation, post-translational modificatio 1 3103544 3102528, Translation, post-translational modificatio 3103998 3103642 Transtation, post-transiationatmodificatiol 3104216 3104022 Translation, post-translational modificatio 3104829 3104278 Translation post-translational modificatio 3106751 3104829 DNA replication, recombination, mod ! fica 3110900 3111613 Hypothetical, unclassified, unknown 3114818 3115192' Hypothetical, unclassified, unknown 3117610 3117176@, Hypothetical, unclassified, unknown 3119707 3119393 j Hypothetical, unclassified, unknown 3122264 3121920J Hypothetical, unclassified, unknown 31. 22585 3122376'. Putative enzymes 3126251 31272191 0 t 9 Hypothetical, unclassified, unknown 3127225 3127707 r Hypothetical, unclassified unknown 3128269 3127859. Hypothetical, unclassified, unknown _ 3132815 313. 2228 Hypothetical, unclassified, unknown 31332571 3132820t Hypothetical, unclassified, unknown 1 31378491 3138193j Hypothetical, unclassified, unknown 3138190 3138531 Hypothetical, unclassified, unknown 3139010 3139669) Hypothetical, unclassified, unknown 3141718 3142275i Hypothetical, unclassified, unknown 3142284 3142502' z Hypothetical, unclassified, unknown 3142617 314308 ?, Hypothetical, unclassified, unknown 3149318 3148722j Hypothetical unclassified, unknown 3152201 3150885 i Hypothetical, unclassified, unknown 3155074 3154592 Hypothetical, unclassified, unknown 3156502 3156801 Hypothetical, unclassified, unknown 1 31575631 3156859 ! Hypothetical, unclassified unknown 3158925 3159668 Hypothetical, unclassified, unknown 1 3160320 31605831 Hypothetical, unclassified, unknown 3162215 31615981 Hypothetical, unclassified, unknown 3162578 Transport of small molecules 3166641 3164762 ; Hypothetical, unclassified, unknown 3173174 3171597J Hypothetical, unclassified, unknown 3173243 3173722 Hypothetical, unclassified, unknown 3180951 31805531 Hypothetical, unclassified, unknown 3182399 3182851 ! Hypothetical, unclassified, unknown 3184001 3185128 ; Adaptation, protection 3185816 3185160 ! Hypothetical, unclassified, runknown 3192748 3193518 ; tative 3197641 a . 3198987 ì Hr S 'Hypothetical, unclassified, unknown 32005521 3200319 ! iTranslation, post-translational modification 3205079i 3204513i Hypothetical, unclassified, unknown 32062521 3205122 ; Membrane proteins 3207165 ! Hypothetical, _un_classified, unknown- _ _ 3208260 3207289 =Transcription, RNA processing and degrã 3212524. 32130301 Secreted Factors (toxi ns, enzymes, a ! g ina 3215422T 3216288 Hypothetical, unclassified, unknown 32212051 3221564i s HYpotheticäl unciassified unknöwn A227383 t Nucleotide biosynthesis and metabolism 32301811 3229483 1 Transcriptiona ! reguiatorsJ 3231171 3230278' Transcriptional regulators Hypothetical, unclassified, unknown 3235793 32359600 Hypothetical, unclassified, unknown 3249630 3249208 . Hypothetical, unclassified, unknown 3253679, 32533111 Hypothetical, unclassified, unknown 3255765 3255406 Hypothetical unclassified, unknown'32652101 3264641 v-S Hypothetical, unclassified, unknown 3271692 3270826 Hypothetical unclassified, unknown 32724051 3271812s Putative enzymes 3277408 3278577 Hypothetical, unclassified, unknown 3284597 3283374 Hypothetical, unclassified, unknown 3291172 3290693 Hypothetical, unclassified, unknown 3291282 3291863 Hypothetical, unclassified, unknown 3291959 3292267 Putative enzymes 32971117 3295978 Putative enzymes 3308390 3309337 Energy metabolism 33117201. 3310791 Enegy metabolism 3312469 3311720 Energy metabolism 3312790 3314445 Motility & Attachment 3320029 3319673 r DNA replication, recombination, modificat 3321049 3320063 Nucleotide biosynthesis and metabolism ! ism3321674 3321042 Hypothetical, unclassified, unknown ß 3322752 3321703 Fatty acid and phospholipid metabolism 3325182 3324946 Fatty acid and phosphoiipid metabotism 3326121 33253781 ; Fatty acid and phosphoiipidmetabotism 3327082 3326144 Translation, post-translational modificatio 3328384 3328202 Hypothetical, unclassified, unknown | 3328934 3328398 r s Transcription, RNA processing and degr'3332303 3331347 Cell wall/LPS/capsule 1 3337230 {333621 1 Translation, post-transtationa ! modificatioh 3337691 3337227 Cell wa ! !/LPS/capsule.''J 3338455 3337691 I Hypothetical, unclassified, unknown _. L 33386401 3338455 Cell wall/LPS/capsule 3339676 3338678 Hypotheticat, undassified, unknown 3340116 3339676 Transport of small molecules 3340748 3340113 Hypothetical, unclassified, unknown 3343177 3343710 Hypothetical, unclassified, unknown 33450991 33437981 Transport of. small molecules _"3345795fi 33451121 Hypotiietica), undassified, unknown j 3347038 3345788 ! H) Lpothefical, unclassified, unknown 334 ___. __________. __. _ J _. ~__ ucieotide biosynthesis and metabolism,'3350231, 3348B37 ; Hypothetical, unclassified, unknown,'33508371, 3350410' Energy metabotismJ''3354171 j 3353497J Putative enzymes ______. 33606531 3359268, INucleotide biosynthesis and metabotism 3365743 336500 33657431 3365006'i (Hypothetical, unclassified, unknown f 3369268 3369035 lDNA repiication, rec. ombination, modificai 3372705i 333370099i Hypothetical, unclassified, unknown 33731701 3372796'' Hypothetical, unclassified, unknown 3378511t 3378948 { Hypothetical, unclassified, unknown'3383947 3384333J Hypothetical, unclassified, unknown, 3385183 3384377 ; Putative enzymes 33878 3386269i 28 Biosynthesis of cofactors, prosthetic grou 3394087 3394683j Hypothetical, unclassified, unknown 3397373 3397095, Hypothetical, unclassified, unknown 3398716 3399648' m--W 3404i40i Hypothetical, unclassified, unknown 3403811 3404140 ! Hypothetical, unclassified, unknown 3404144 34045241 Hypothetical, unclassified, unknown 3404538 3404861 Hypothetical, unclassified, unknown 3409952 3409608 Transtation, post-tfansfationat modification 3414400 34146121 Hypothetical, un_classified, unknown '3416066 3415785. Transcriptional regutators3436429 3435986J Hypothetical, unclassified, unknown 3457909 34566421 Hypothetical, unclassified, unknown 3464151 3463888, Hypothetical, unclassified, unknown 3466959 3466072 Hypothetical, unclassified, unknown 3467084 34680491 Hypothetical, unclassified, unknown 3473017 3474135 z Protein secretion/export apparatus j 3476479 3475955 Protein secretion/export apparatus I Protein secretion/export apparatus, 34802381 34797201 Protein secretion/export apparatus {3483421 3481913 j Hypothetical, unclassified, unknown _ 3491410 3490751'. Fatty acid and phospholipid metabolism 3493572 34927001 H H Amino acid biosynthesis and metabolism 3500597 3499485i Hypothetical, unclassified, unknown 3506241 3505864i Hypothetical, unclassified, unknown 3524489 3524160} Hypothetical, unclassified, unknown 1 3527733 35274281 Hypothetical, unclassified, unknown 3528349 3528230 Cell wall/LPS/capsule 3529446 3528427 Cell wall/LPS/capsule 3530457 3529507 Cell wall/LPS/capsule,, 1 3531707 3530466 Ce) f wat)/LPS/capsu) e) 3532814 3531750 Cell wall/LPS/capsule ! 3533932 3532811 í _ < ve Cell wall/LPS/capsule 3535080 35339471- Amino acid biosynthesis and metabolism-3535970 3535215l Amino acid biosynthesis and metabolism 3536578 3535970 Cell wall/LPS/capsule 3537810 3536575 Cell wall/LPS/capsuie 3539123 35378071 'Cell wall I LPS/capsule ___ _ _ 3540206 35391271 jCe) twa !)/LPS/capsu) e i 3540784 3540209 J cell wall/LPS/capsule 35426701'35407811 1Cell wail/LPS/capsule 3543689 3542739 Ce) i wa ! i/LPS'/capsule"""""""""'"""" ?"3545073 3543763 ! Cell wall/LPS/capsule t 3546926 0 3545880 í DNA replication, recombination, modificaj ; 3547972 i 3547688J Translation, post-translational modificatioh 3549788 3548109 Nucleotide biosynthesis and metabolism 3550745 3550056 Biosynthesis of cofactors, prosthetic grou 3556338 3555253J DNA replication, recombination, modificai 3559197 556426= Biosynthesis of cofactors, prosthetic grou 35621M 3562803 j Hypothetical, unclassified, unknown 3569012 3568635j Carbon compound catabolism 35716021, 3570940 Hypothetical, unclassified, unknown 3575696.-35748451, Carbon compound cataboJism j 3587432r'3588436' ! Hypothetical, unclassified, unknown 3593732 35940311 Hypothetical, unclassified, unknown {35942070 3594569 Hypothetical, unclassified, unknown --... I. 35973181 35977974 : Transport of small molecules f i 36004531'3601598 Transcriptional regu ! ators J"3609075 3609839, Chaperones & heat shock proteins 3614303 614866 Hypothetical, unclassified, unknown. 3618466 3617342 Putative enzymes 3619618 3618992 Hypothetical, unclassified, unknown 3624836} 3625057 Cell wall/LPS/capsule 3630604 3629666 Cell division3632429 3632683J Transcription, RNA processing and degree 3632787 3633422J Transcriptionatregujators 3636256 3635540J Hypothetical, unclassified, unknown ; 3641232 3641810 Transcriptional reguiators'3648065 3647754 Adaptation, protection 3653666 3653875 j 3653666 Hypothetical, unclassified, unknown _ 36685_2 3667923 Hypothetical, unclassified, unknown 3668473 3668760 Hypothetical, unclassified, unknown 3669168 3668839 Hypothetical, unclassified, unknown 36710571 36707584 Transport of small molecules 3674323 3673007t Hypothetical, unclassified, unknown 3675159 3674569I v-S Hypothetical, unclassified, unknown 3679945 3680460 Hypothetical, unclassified, unknown 3680967 3680464 Hypothetical, unclassified, unknown 1 3681047 3681460 Hypothetical, unclassified, unknown 3684716 3684162 Hypothetical, unclassified, unknown 3685761 3684904 Hypothetical, unclassified, unknown 3695480 3695178 Hypothetical, unclassified, unknown 3700315 3700785 . Hypothetical, unclassified, unknown g 37102241 3710679' x Putative enzymes} 3715804 3714914J Transport of small molecules 3716807 3717610' Transport of small molecules 3717604 , Hypothetical, unclassified, unknown 1 3719328, 3720056, Hypothetical, unclassified, unknown 3720122 3720622 Hypothetical, unclassified, unknown 3723444 3722989 Translation, post-transtationaimodificatiol 3730075 3729470 j Putative enzymes 3740104 3741018J Hypothetical, unclassified, unknown j 3742264j 3742689. Fatty acid and phospholipid metabolism j 3743699 3743938 : Hypotheticaf, undassified, unknown f 3747455 ? 3747165 Transcriptional regulators 37520431 ! Hypothetical, unclassified, unknown 3 59680 37593 5 Chemotaxis 3760819 3759995 HYpöthëticalX unclassified, unknown T 3762803 3763126 j Hypothetical, undassified, unknown 3763680 3764471 Hypothetical, unclassified, unknown ; 765086 ; 3764475' Secreted Factors (toxins, enzymes, a) gin 3772560 3771502 Hypothetical, unclassified, unknown 3778265J 3778603 . Putative enzymes 37787031 37793681 Hypotheticai, undassified. unknown j 3779929 3780075J Hypothetical, unclassified, unknown 3780127 _3780312i Hypothetical, unclassified, unknown 3787478 3787020 Transport of small molecules 3 1790985 37901491 Hypothetical, unclassified, unknown 3794116 3793814 Energy metabolism 3801103 3801930 Energy metabolism 3801947 3802483 ! i ffi w i- Energy metabolism 3803342 3802566, Jr. hs 9S _ _ Hypothetical, unclassified, unknown 1 3808802 3808317 Transport of small molecules 3814574 3813957 Hypothetical, unclassified, unknown 3820005 3820271 Hypothetical, unclassified, unknown 3820307 38208911 Energy metabolism 3823515 38225141, Hypothetical, unclassified, unknown 3840747 3840358 Transcriptiona) regutators 3840843 3841736J Related phage, transposon, or plasmid 3843289 1 w l f Hypothetical, unclassified, unknown 3844104 3843652J Biosynthesis of cofactors, prosthetic grou, _ 3845774 3846334_ Biosynthesis of cofactors, prosthetic grou 3846336 3846707 ; Transport of small molecules 3849582 3848794i Hypothetical, unclassified, unknown 3850751 3849603 -l X Hypothetical, unclassified, unknown 3851800 38508_291 Hypothetical, unclassified, unknown 3852512 3851919 ww Adaptation, prptectiqn, 3856130 3855492 j Hypothetical, unclassified, unknown 3856336 w Putative enzymes _ _ _ 3867706 38694631 Hypothetical, unclassified unknown 3882979 3883437 s Hypothetical, unclassified, unknown 3885710 3886306 Transcriptional regulators 3890649 3889924 ! Translation, post-translational modificatio 3895323 38973564 Hypothetical, unclassified, unknown 3906390 3907088 Hypothetical unclassified, unknown 7851 t Hypothetical, unclassified, unknown 39107381 39117721 Hypothetical, unclassified, unknown 3912409 3913131 DNA replication, recombination, modifica 3913128 39137661 Hyp. othetical, unclassified, unknown 3913875 39140541 Hypothetical, unclassified, unknown 3918468 3918250 Hypothetical, unclassified, unknown 3918787 3918470 Hypothetical, unclassified, unknown 3922072 3921269 Transport of small molecules 3928333 3927557 Hypothetical, unclassified, unknown 3936836 3935799 Hypothetical, unclassified, unknown 1 39374311 3937237i ; Transport of small molecules 3943806 39426491 Transcription, RNA processing and degr"'"3948137 !'3948811J Hypothetical, unclassified, unknown 55 39498521 3950073 3040852 3960073 ; Hypothetical, unclassified, unknown 3952386 3952060s Secreted Factors (toxins, enzymes, alt 3965841 3967010' Secreted Factors (toxins, enzymes, aigina 3977183 3977833J Hypothetical, unclassified, unknown 3986879, i 3987292' Hypothetical, unclassified, unknown ! 3997821 3998114 Carbon compound cataboiism'''4003600"4002107 Hypothetical, unclassified, unknown ; 4004782 4004958 Hypothetical, unclassified, unknown ! 4007506 4008036 Hypothetical unclassified, unknown 1 4010326 40095411 Carbon compound catabolism 4023176 4021 9715 _ t7 t Hypothetical, unclassified, unknown 40357557 4035605, Hypothetical, unclassified, unknown 4036020 40357577 Hypothetical, unclassified, unknown 4039173 4040099 Hypothetical, unclassified, unknown 4040819 4040103 t | Transport of small molecules 4043060 404383041 Hypothetical, unclassified unknown 4045159 4045569 5. S Hypothetical, unclassified unknown 1 4045588 4045809 H othetical, unclassified, unknown 4051557 4051096j. DNA replication, recombination, modifiât 4052603 4051563 w < Hypothetical, unclassified, unknown 4062898 4062425 Hypothetical, unclassified, unknown 40672941 4067542 Hypothetical, unclassified, unknown-,- z f 7 Hypothetical, unclassified, unknown 4068611 40683271 Carbon compound catabolism 4069965 4068676i Cell wall/LPS/capsule 4070856 407001 1 Nucleotide biosynthesis and metabolism 4072487 4070859= Hypothetical, unclassified, unknown 4073986 4072658 s Fatty acid and phospholipid metabolism 40750061 4074056 DNA replication recombination, modificat 4078677 4075156a Cell wall/LPS/capsule 4082180 4081044 Cell wall/LPS/capsule 1 40829605 40821841 Fatty acid and phospholipid metabolism 4083397 4082957 ; Cell wat)/LPS/capsutej 4084504 4083443 Transport of small molecules 40845041 4085010 Transport of small molecules 4087454 40850611 ? Biosynthesis ofcofactors, prosthetic grou ! 4090093 4088903J 40889031 Fatty acid and phospholipid metabolism 1 4090905 40900901 Cell waft/LPS/capsufe'4091654 4090899) Translation, post-translational modificatio 4092227 4091670 Nucleotide biosynthesis and metabolism 1 4092967 ITranslation, post-translational modificatioh 40940351 40931661 Trans ! ation, post-transtationa) modificatiop 4094906 4094166 Translation, post-translational modificatioh 4095171 4095956 Hypothetical, unclassified, unknown 4102767 4103060 Hypothetical, unclassified, unknown 4103731 4104078 Cell wall/LPS/capsule 4104744 4105778 Transport o small molecules 41110801 4110346 ( Hypothetical, unclassified, unknown 411493 1 41153301 Transcriptional regulators H pothetical, unclassified, unknown i 41239551 4123260 pothetical, unclassified, unknown Hypotheticat, undassified, unknown ! 4126843} 4126163j lhypothetical, unclassified, unknown 4130598'41309425Z Hypothetical, unclassified. unknown ! 4135972 f 4135451', Translation, post-translational modification 4143664j 4142569 i Chemotaxis I 4148251 ; 4145942 Hypothetical, unclassified, unknown 4165879i 4165718 ; DNA replication recombination modifica 4172484 4170769 ! Hvpothetica, unclassified, unknown 4173067 172528,,' lhypothetical, unclassified, unknown 4182018 4181377'' lhypothetical, unclassified, unknown 4182769 4182074 Hypothetical, unclassified, unknown 4183709 4184938f Translation, post-translational modificatio i 4195357 4195007j Transcription, RNA processing. and degr 4196157 41953994 Transcription, RNA processing and degr 4196691 41961641 Trans ! ation, post-transtationaf modificatio i 4196958 4196707 j Protein secretion/export apparatus 4198541 4197168 D < Hypothetical, unclassified, unknown 4204736 42045421 m Hypothetical unclassified, unknown 4205906 4205295 4205906 Hypothetical, unclassified, unknown 4206664 4207164i. Putative enzymes4209255 4210277 Hypothetical, unclassified, unknown 4221796 4221212 Hypothetical, unclassified, unknown 4224115 4223567 w e Nucleotide biosynthesis and metabolism 42272361 4225659 ! Hypothetical, unclassified, unknown 4231070 4232227 Transcriptional regulators 4234274 4235182 1 DNA replication, recombination_odifica _ 4235219 4236598 Transcriptionai regulators 4242294 4241341 Hypothetical, unclassified, unknown 4243651 Hypothetical, unclassified, unknown 4244184 4243708 Hypothetical, unclassified, unknown 4244875 4245723 Hypothetical, unclassified, unknown i 42458091 42462041 Hypothetical unclassified unknown 4255323 4254736. Hypothetical, unclassified, unknown 4260396 4259254 Hypothetical, unclassified, unknown 4263492 4262377 Motili ity& Attachment4265287 4264529 Hypothetical, unclassified, unknown 4266444 4265305 Nucleotide biosynthesis and metabolism L 4266900 4266469 Hypothetical, undassified, unknown 4267344 4267144 Energy metabolism 1 42677090 4267371' l Chaperones & heat shock proteins 4269575 4267716 Chaperones & heat shock proteins4270139 4269618 ; Biosynthesis of cofactors, prosthetic grou 4270470 4270147 Biosynthesis of cofactors, prosthetic grou 4270884 1 Hypothetical, unclassified, unknown 4272655 4272164 Protein secretion/export apparatus 4278946 4277084 Hypothetical, unclassified, unknown 4279344 4279006 Hypothetical, unclassified, unknown 4285483 42844161 Hypothetical, unclassified, unknown 4286594 4285476 ; unclassified, unknown 4287709 4286786 ; tHypothetaf. undassifiedu j 4290866r4291234J Translation, post-translational modificatio 4291355i4294207' al, unclassified, unknown j 604 4294254 ! lhypothetical, unclassified, unknown ! 4302040 4303050il w Hypothetical, unclassified, unknown"j4305063 4305425 j Hypothetical, unclassified, unknown T 4311861 4310950'. Hypothetical, unclassified, unknown 4312702 43119501. Hypothetical, unclassified, unknown 4314794 4314480) Hypothetical, unclassified, unknown 4316037 4315555 l j 4 Hypothetical, unclassified, unknown 4316824 4316108 Putative enzymes 4318258 4318905 DNA replication, recombination, modifical4330320 4330895; Hypothetical, unclassified, unknown 4331451 4332461j f Hypothetical, unclassified, unknown 43326521 43330351 Transport of small molecules 4343527 Hypothetical, unclassified, unknown 4350352 43507381 Hypothetical, unclassified, unknown 4351594 4352493 Transport of small molecules 4354543 43552651 Transport of small molecules 4356200 4356862 Transport of small molecules 4356875 4358038 Hypothetical, unclassified, unknown 4359074 4358166r Hypothetical, unclassified, unknown 4373937 4374332 Hypothetical, unclassified, unknown 4374329 4374856 Hypothetical, unclassified, unknown 4374849 43752321 Hypothetical, unclassified, unknown 4382015 4381500i Biosynthesis of cofactors, prosthetic grou 4386351 4385899 Biosynthesis of cofactors, prosthetic grou 4386607 4386356 Biosynthesis of cofactors, prosthetic grou 4387086 4386604 Transport of small molecules 4414949 44141311 DNA replication, recombination, modifica 4418302 4418583t Hypothetical, unclassified, unknown 4439376 44397831 Hypothetical, unclassified, unknown 4442452 44428681 Transcriptional regulators 4444977 4445486 ; Hypothetical, unclassified, unknown 4445998 4446390 Hypotheticat, undassified, unknown 4447132 4448217 Transcriptional regulators 4453182 4452535 Biosynthesis of cofactors, prosthetic grou 4457361 4458644 Hypothetical, unclassified, unknown 4459749 4459417 Hypothetical, unclassified, unknown 4461387 4462409 Hypothetical, unclassified, unknown 4462399 4462881 j Translation, post-trans ! ationa ! modification 4463903 4465438 Hypothetical, unclassified, unknown L 4466753-4466322 Translation, post-transtationa ! modification 4466924 4469545 ! Hypothetical, unclassified, unknown 4469612 4470235 DNA replication, recombination, modificat 4470273} 44713108 Hypothetical, unclassified, unknown 4471402 4471554J Related to phage, transposon, or plasmic 4473622 4474638 Biosynthesis of cofactors, prosthetic grou 4477976 4476993 Hypothetical, unclassified, unknown 4478907 4478626 Cell wall/LPS/capsule 4483363 4482260 Hypothetical, unclassified, unknown j 4486179 4485823 Hypothetical, unclassified, unknown 4486846 4486202 Putative enzymes 4488409 4489632 jSecreted Factors (toxins, enzymes, algina3 4713795i 4714283, ! Secreted Factors (toxins, enzymes'aigin », 4714313'4714801 ! t oP secreted Factors (toxins, enzymes, algin-47148-4716042 : Secreted Factors (toxins, enzymes'a Zna< 4719sQZ Secreted Factors (toxins, enzymes'algin, 9 4719418 4720062i Hypothetical, unclassified, unknown j 4724034 4722850 : Transport of small molecules 47448181 4745123 ; DNA repficatior), recombination, modificat 4747136 4746639J Translation, post-translational m. odificatioh 47543781 4753989T Transcription, RNA processing and degr ; +j Translation, post-translational modification 4756066, 1 4755446" T nslation, post-translational modificatio 4756472 47560831, |Translation, post-translational modificatioh 4756847 4756491 i Translation, ost-translationaf modificatioi 4757094 47569781 Protein secretion/export apparatus 4758451 47571231 Translation, post-translational modificatiol _4758888 04758452, Translation, post-translational modificatio 4759066 4758890 { Translation, post-translational modificatio 4759569 47590691 Translation, post-translational modificatio 4759923 4759573T Translation, post-translational modificatio 1 4760467 4759934 Translation, post-translational modificatio 4760871 4760479 Translation, post-translational modificatio 4761366 4761061 Translation, post-translational modificatio 4761919 4761380 Translation, post-translational modificatio 4762253 4761939 Translation, post-translational modificatio 4762634 4762266 ; , 4762634 4762266 ! Translation, post-translational modificatio 4762924, 47626581 Translation, post-translational modificatio 4763118 4762927 ; Transtation, post-trans) ationaimodifjcatioi 4763531 4763118 Translation, post-trans) ationat modificatio i 4764229 4763543 w w-z Translation, post-translational modificatio i 4764574 4764242 Translation, post-translational modificatio 4764862 4764587 Translation, post-translational modificatio i 4765700 4764879 Translation, post-transtationa ! modificatio i 4766011 4765712 Translation, post-transtationa ! modificatfoi 4766610 4766008 Translation, post-translational modificatio 4767259 47666241 Translation, post-translational modificatio i 4767653 4767342 Translation, post-transtationa) modificatio 1 4771655 4771185 l w- Translation, post-translational modification 4772126 4771755 Transcription, RNA processing and degree 4776477 4772278 Transcription, RNA processing and degr 4780616 4776543 j Translation, post-translational modificatio 1 Xtwl Translation, post-translational modificatio 4781785 4781285 ! Translation, post-translational modificatio 1 4782679 4781984i J Translation, post-translational modificatioi 4783110 4782679 ! Transcription, RNA processing and de 4783760 4783227 Protein secretion/export apparatus 4784138 4783770) Hypothetical, unclassified, unknown 4787479 47867331 Hypothetical, unclassified, unknown 4819927 4820409 Two-component regulatory systems 4 4820531 4821358i Hypothetical, unclassified, unknown _s _4823363 48230794 Hypothetical, unclassified, unknown S 4824123 4823386 I Hypothetical, unclassified, unknown L 4830553 Lv642 ! Hypothetical unclassified, unknown 4830963 4831181j Nudeotide biosynthesis and metabolism 4843551 48427001 ; Hypothetical, unclassified, unknown 4851309 4852316j Hypothetical, unclassified, unknown 4854008 48536491, Carbon compound catabolism 4856959 4858410i Putative enzymes4859262 4858489j g Transcriptiona) regujators) 4870327 ! 4869557 j Hypothetical, unclassified, unknown")"'4875244 4874654 j Hypothetical, unclassified, unknown 4877605 48768201 H othetical, unclassified, unknown 4878586 487769_ 487- Hypothetical, unclassified, unknown 4878789 9544l Hypothetical, unclassified, unknown 4882052 4882354j Hypothetical, unclassified, unknown 4884960 4884718 Hypothetical, unclassified, unknown 4887505 4887278J Adaptation, protection4893696 4894277J Hypothetical, unclassified, unknown 4902201 4903295 Hypothetical, unclassified, unknown 4909403 4909161 Hypothetical, unclassified, unknown 4914509 4914126 Chaperones & heat shock proteins 4917123 4915480 0 Chaperones & heat shock proteins 4917467 4917174 Hypothetical, unclassified, unknown 4918932 4918198 Putative enzymes 4919041 4919799 Hypothetical, unclassified, unknown 4921980 4922363 Hypothetical, unclassified unknown 4925794 4925315 : l v Protein secretion/export apparatus 1 4936615 4933865 Hypothetical, unclassified, unknown 4937819 4938214 Cell wall/LPS/capsule 4939186 4938275 Cell division 4940483 4939299 Cell division 4941787 4940534t Celt division 4942672 4941809 Cell wall/LPS/capsule 4945074 4943632i Cell wall/LPS/capsule _ 4946140 4945067 w Cell division 4946130 L Cell wall/LPS/caPsule I 4948675 49473291 Cell wall/LPS/capsule 4949771 4§4868911 v Cell _,, +__ _9J Cell wall/LPS/caDsule I 49526031 4951140ii Cell wall/LPS/capsule 4954342 4952C) 0311 Cell division 4954632 4954339 Hypothetical, unclassified, unknown ! 495557J 4954629 j Hypothetical, unclassified, unknown 4956028 4955573J ne Hypothetical, unclassified, unknown 4959519 4959896 Putative enzymes 4959925 4960518 Adaptation, protection 4961557 4961150 Adaptation, protection 4962186 4961569 Energy metabolism 4964265 Translation, post-translational modificatio 4965500 4965108 Translation, post-translational modificatio 4965943 4966515 -jv Transcriptiona) regutators 4968711 4969610 Hypothetical, unclassified, unknown 4971890 49707961 Translation, post-translational modification 49733311 49719851 tHypothetical, unclassified, unknown 4974, 028 49733991 Cell wall/LPS/capsule 4985469, 1 49842, 04i FHypothetìcal, unclassified, unknown | 49861541 4985846' Hypothetical, unclassified, unknown i 49867981 4986151 Hypothetical, unclassified, unknown 0 49872831 4986810 Transport of small molecules 1 4988081'4987284} Hypothetical, unclassified, unknown 4989304 4990284- Hypothetical, unclassified unknown i'4990832 4991404- Hypothetical,-un. clas'sified, unknown 4991391 4991918 Transport of small molecules 4991918 49926431 Transcriptional regulators 4992869 49943621 Hypothetical, unclassified, unknown 4994440 4994748 Transport of small molecules _ 4994762 4995226i Transport of sma)) mofecutes4996118"996390J Hypothetical, unclassified, unknown 5000303 4999908 Cell. division 5012313 50113211 Cell division 5013430 5012393 Translation, post-translational modificatio 5013670 5013960 Translation, post-transtationai modificatjoi 5013973 50154271 Translation, post-translational modificatio 5015534 5016979 Hypothetical, unclassified, unknown 5017039 5017416 Hypothetical, unclassified, unknown 5028230 5027421 Transcriptions) regulators5036244 5036807 Hypothetical, unclassified, unknown 5046663 50460311 Biosynthesis of cofactors, prosthetic grou 5068031 5068879 Motili & Attachment5069530 5069081 Motility & Attachment 5069762 5071462 M S x Motility & Attachment5071566 5072690 Hypothetical, unclassified, unknown 5073563 5074174 5074171 0-74 Hypothetica, unclassified, unknown 5074171 50743710 . Hypothetical, unclassified, unknown 5077535 5077705 ; Transcription, RNA processing and deers 5091814 5090852 Two-component regulatory systems 5094984 5096321 Motility & Attachment 5099262 5100086 Motility & Attachment 5100083 51006703 Adaptation, protection 51059290 5104985' Translation, post-translationa_I modificatio 5 5106957 5106448s Translation, post-translation-1 5109781 51069501 Biosynthesis of cofactors, prosthetic grou 5110743 5109805 Translation, post-translational modificatio 1 5112662 61129371 Hypothetical, unclassified, unknown 5113468 5113004 Amino acid biosynthesis and metabolism 5114598 5113480 Adaptation, protection 5115889 5114669 Translation, post-translational modification 5116288 5116031 Tra nsiation, post-translational modification 5116623 5116312 Biosynthesis of cofactors, prosthetic grou 5116864 5117832 Hypothetical, unclassified, unknown 5122386 5121898 Hypothetical, unclassified, unknown 5122901"5122560 Hypothetical, unclassified, unknown 5125930 5125604 Hypothetical, unclassified, unknown 5135815 5136192 Transcriptiona ! regutators 5155560 5156123 ! Hypothetical unclassified, unknown 5162448 5162068 H pothetical, unclassified, unknown ! 5168754 5169188 ; j Hypothetica). undassified, unknown 5169504T 5169250 2thet Hypothetical, unclassified, unknown 51749791 5176103 Hypothetical, unclassified, unknown 5197880 5198323 Hypöthetical, unc, assified, unknown g 52049271 5206087. Hypothetical, unclassified, unknown 1 5206486'S 5206208. Hypothetical, unclassified, unknown !'52070061'5206719 Hypothetica), undassified, unknown J 5210995) 5210705 Hypothetical, unclassified, unknown) 5212104j 5211631 Nucleotide biosynthesis and metabolism 52128321 5213470 ; Hypothetical, unclassified, unknown 5215669 52162021 f Chaperones & heat shock proteins 5216763 5217551 ---223-561 5222539i Biosynthesis of cofactors, prosthetic grou Get ! wa))/LPS/capsu ! e5230910" 5230113 ! Biosynthesis of cofactors, prosthetic grou 5231658 5230900 Translation, post-translational modificatio 5233566 5232484 ! Translation, post-translational modificatioi 5234852 52335841 l Cell wall I LPS/capsule 5236773 52373901 9 Biosynthesis of cofactors, prosthetic grou 5237392 5238240 e Nucleotide biosynthesis and metabolism 5238407 5239348 S Transtation, post-transfaiiona) modificatiol 5239465 5240079 Translation, post-translational modificatiofi 5240121 5240705 Hypothetical, unclassified, unknown 5242558 5242253 Putative enzymes 5246122 52454751 Hypothetical, unclassified, unknown 5248771 52480701 Hypothetical, unclassified, unknown 5250617 52495998 Fatty acid and phospholipid metabolism 5272299 5271484i Amino acid biosynthesis and metabolism 5275731 5274007 Hypothetical, unclassified, unknown 5276282 5276734J Hypothetical, unclassified, unknown"5277171 5276842 Hypothetical, unclassified, unknown 5277950 5277171 i Hypothetical, unclassified, unknown 5282158 52825051 Transport of small molecules 5286034 5285267 j Hypothetical, unclassified, unknown 5291613, 5291960 Hypothetical, unclassified, unknown 5297482 52970061 Biosynthesis of cofactors, prosthetic grou 5310725 5311213 Biosynthesis of cofactors, prosthetic grou 5311463 53122631 Biosynthesis of cofactors, prosthetic grou 5313205 5313585 Energy metabolism 5313675 5315339i Hypothetical, unclassified, unknown 5322234 5322449 Hypothetical, unclassified, unknown j 5322706 5322509 | Hypothetical, unclassified unknown 5323100 5322756 Transcription, RNA processing and degri 5325478 53233731 i < Transtation. post-transfationat modificatiol 5325921 5325652 Transtation, post-transiationa) modificat ! oi 5329948 5327426 Transcription, RNA processing and deara 53314571 5329976t t Hypothetical, unclassified, unknown 5331960 53315021 Protein secretion/export apparatus5332742 5332353) Energy metabolism-5333500 5332745 Cell wa))/LPS/capsu) e 5334903 5333566 Biosynthesis of cofactors, prosthetic grou 5335771 5334920 j Ce) t division5338522 5337899 Hypothetical unclassified, unknown 5338617 5338931 pothetical, unclassified, unknown'ì 5343754 i 5343104 i Amino acid biosYnthesis and metabofism S 5345891} 53450851 'Chaperones & heat shock proteins ; 5349760 j 53492001 Transcriptiona, _gu_tors_ 1 5352078i 5351674. jTransportofsmall molecu, es T 5352176'5352706t Hypothetical unclassified, unknown 53535061 5353072 ! Hypothetical, unclassified, unknown T"5361585 5362067 Two-component regulatory systems 5364070 5364735.' Transcriptional ret _62561 5366654 Hypothetical, unclassified, unknown 53707201 5370475 Hypothetical, unclassified, unknown 53768511 5377708' Hypothetical, unclassified, unknown 5377790 5378095. _ Hypothetical, unclassified, unknown 53780924 53788411 Hypothetical, unclassified, unknown 53804471 5379512 w Related to phage, transposon, or ptasmic 5383811 5382795 Hypothetical, unclassified, unknown 5386999 5387721 Energy metabolism 5396858 53959291 Fatty acid and phospholiPid metabolism 54029441 54020153 Hypothetical, unclassified, unknown 5414487 5414278l s Hypothetical, unclassified, unknown 5418568 5418350 Hypothetical, unclassified,. unknown-. 5419862 5420317 Transcriptional regulators 1 5422505 54230651 Hypothetical, unclassified, unknown 5434651 5434115j Fatty acid and phospholipid metabolism 5442303 5442773 Fatty acid and phospholipid metabolism-5442791 5444140c, Translation, post-transfationa ! modificatto i 5445198 5446082 i Transcription, RNA processing and deers 5448642 5448965 w o Transport of small molecules 5460525 5461382 Central intermediary metabolism _ _ 5462762 5463604 Hypothetical, unclassified, unknown 5463917 5464435 Central intermediary metabolism 5464820 5466520 Hypothetical, unclassified, unknown 5468282 5468016 . Hypothetical, unclassified, unknown 5468408 5469022 Hypothetical, unclassified, unknown 5472041 5471625 Hypothetical, unclassified, unknown 5472438 5472734 w=S--5472438 H Transcriptional regulators 5473765 5474577 Two-component regutatory systems"5480401 5481090 Transport of small molecules 1 54837671 54824511 Hypothetical, unclassified, unknown 5486355 5486984 Biosynthesis of cofactors, prosthetic grou 5487714 5488385 Hypothetical, unclassified, unknown 5489040 5489612 Transcriptional regulators 5490651 548962911 Transcriptional regulators 1 55057831 55050704 Hypothetical, undassified, unknown 5507897 5506965J Hypothetica), unctassified, unknown""""5517093 5516398) Biosynthesis of cofactors, prosthetic grou 5519710 55205371 Hypothetical, unclassified, unknown 5522385 5522972 S Hypothetical, unclassified, unknown 5524718 5523867 H othetical, unclassified, unknown 5525904 5524969 ; DNA replication, recombination, modificat 5535555 553 iTrans, ation, post-translational modificatioh 5537288aj 5537058t {Translation, post-trans. ationa. modificatioh ç 5537318 Nucleotide biosynthesis and metabolism 55433641 55420729* Hypothetical, unclassified, unknown Hypothetical, unclassified, unknown 5548644 5548396 i m X 5549721 5548750 0 Hypothetical, unclassified, unknown j"5553583) 5553116) Hypothetical, unclassified, unknown 55569341 5557953 Central intermediary metabolism jHypotheticai, undassified, unknown 5569089 5570627J Hypothetical, unclassified, unknown, 5570624j 55711602 DNA replication, recombination, modificat 5574485 Hypothetica"unclassified, unknown X 55750171 55744931 Hypothetica), undassified, unknown j 5576027 5575014, 11 DNA replication, recombination, modificat 5577916 5576027 ; Hypothetical, unclassified, unknown _L_ 6579498 5578680 Hypothetical, unclassified, unknown j 55809611 5581707 Putative enzymes 5593423 5592632 Cell wall/LPS/capsule 303820 Antibiotic resistance and susceptibility 5606102 5606434 Hypothetical, unclassified, unknown 5606495 5607670i Hypothetical, unclassified, unknown'S607667 5608479 Transport of small molecules 5615543 5613732 Hypothetical, unclassified, unknown j 561565T 5616301 Hypothetical, unclassified, unknown 5626378 5624900 Hypothetical, unclassified, unknown 5627133 5626375 Hypothetical, unclassified, unknown 5627864 5627130 Cell wa/LPS/capsule 5628670 5627864 j Ce wall/LPS/capsule 5629788 56286671 Cell wall/LPS/5630852 5629785 Cell wall/LPS/capsule 5631886 5630849 Hypothetical, unclassified, unknown 5659184 5658417 Transcriptional regulators 56627411 5663814 Hypothetical, unclassified, unknown 5663888 ! 5664868 j Biosynthesis of cofactors, prosthetic gro 5666056 56649891 Amino acid biosynthesis and metabolism 5675701 567-51831 Motility & Attachment 5680712 5679648 DNA rep. ication, recombination, modificat 56874Wi 56897i41 Translation, post-translational modification 5689963 5691726i Hypothetical, unclassified, unknown 5691761 Hypothetical, unclassified, unknown 5702113 5701697 Biosynthesis of cofactors, prosthetic groul 57026681 57034381 Hypothetical, unclassified, unknown 5703453 5704079 Hypothetical, unclassified, unknown 5704076 5705677 Amino acid biosynthesis and metabolism 5706190 5706525 Protein secretion/export apparatus") 5706551 5706799 . Hypothetical, unclassified, unknown 5708035 5708742, Chemotaxis 5708954 5710897 Hypothetical, unclassified, unknown 5720468 5720944 Transcriptional regulators 57235811 57245371 Carbon compound catabolism 5752463 Central intermediary metabolism 5754143 5753613 fTranscriptiona. requ. ators-r mbWi Amino acid biosynthesis and metabolism 57, 66483 57678921 , Protein secretion/exDort apDaratus i 5777096i 5776605 ! Nucleotide biosynthesis and metabolism 57773871 5777133 Hypothetical unclassified, unknown _ ; _ t _ ___ p, 5777808j 5777389 ; Carbon compound catabotismj 5778133 5779680 Hypothetical, unclassified, unknown 57799941 57808121 Amino acid biosynthesis and metabolism 5791085'5790444s Hypothetical, unclassified, unknown's 5791836 5792234J Hypothetical, unclassified, unknown !'5797064J 5797336 ! Transport of small molecule 128-. 5802823 Cell wall/LPS/capsule 5810280 5581131338; . m em ! Cell wa) t/LPS/capsule5811335 5812243} Cell wall/LPS/5812240 58131211 Cell wall I capsule 5813121 5813666 Amino acid biosynthesis and metabolism 5824786 5825718 Hypothetical, unclassified, unknown 58294691 5828903 Hypothetical, unclassified unknown 5830749 5830312 Hypothetical, unclassified, unknown 5835481 5835894 Putative enzymes 5840894 5839104 Putative enzymes 5843799 584 9 Chaperones & heat shock proteins 5848366 5847971' Putative enzymes 5 5879970 5878753 Hypothetical, unclassified, unknown 58804811 58799991 Trans) ation, post-trans) ationa) mod) ficatioh 5883012 5881678 Hypothetical, unclassified, unknown 1 58835760 58830225 Hypothetical, unclassified, unknown j 5883971 5884285 m v Hypothetical, unclassified, unknown 5885485 5885943 Hypothetical, unclassified, unknown 5896726 589526011 Transcription, RNA processing and degri 5900123 5898864 Energy metabolism 1 5900694 5900368 Hypothetical, unclassified, unknown 5907389J 5907862 Hypothetical, unclassified, unknown 5908329 5907847 Biosynthesis of cofactors, prosthetic grou 5921496 5920741 s Biosynthesis of cofactors, prosthetic grou 5922434 5921493 e H othetical, unclassified, unknown 5941081 5940746 Cell wa/LPS/capsule 5941335 5941475t Amino acid biosynthesis and metabolism 5942744 5943574 Putative enzymes5945234 5945932 Central intermedia metabolism 5952820 5952482 DNA replication, recombination, modifica 5962715 5964724 Energy metabolism 1 5969764 59693541 Hypothetical, unclassified, unknown. r-5972202 5971849 Transtation, post-transiationatmodificatiol 5986118 5985882 DNAreplication, recombination modificat 5989319 5988645 DNA replication, recombination, modifica 5989459 5990667 4- Nucleotide biosynthesis and metabolism 5990675 5991130t Hypothetical, unclassified, unknown 5996035 5996985 Energy metabolism 6000142 5999753 Hypothetical, unclassified, unknown 6001377 6000760 Nucleotide biosynthesis and metabolism 1 6002039 6001398 Hypothetical, unclassified, unknown 6003329 6002958J Transcription, RNA processing and degree 6004095 60033761 unclassified, unkno i Hypothetical, unclassified, _known J _8004276 60051 39ì Nucleotide biosynthesis and metabolism 6005198 6005809i ! Hypothetical, unclassified, unknown 6008397 6008777 Hypothetical, unclassified, unknown 6017013 601662_1 Carbon compound catabolism t 60189961 6018829' Carbon compound catabotism 6019347"6019180 Biosynthesis of cofactors, prosthetic groul 6025304 ! 6026194 Two-component regutatory systems 6032267 6031365 Hypothetical, unclassified, unknown Hypothetical, unclassified, unknown'"'6063831 ! 6063352 j Putative enzymes, 6069098 6067944i #s Hypothetical, unclassified, unknown'6074229 6075206 Transcriptional regulators. ~ 6082866 6083072 i Hypothetical, unclassified, unknown 60831041 6083508 f P. l . Hypothetical, unclassified, unknown 6083752 6084084 Hypothetical, unclassified, unknown 60845441 60843681 Carbon compound catabolism 6096706 6097026 Hypothetical, unclassified, unknown 6148318 6149181 j Hypothetical, unclassified, unknown 6151313 6151525 Hypothetical, unclassified, unknown l 6155202 61547831 Hypothetical, unclassified, unknown 6158178 6158942 Translation, post-translational modificatio 6159562 6158948 v 6171732 1 Hypothetical, unclassified, unknown 6171732 6171926 Hypothetical, unclassified, unknown 6172872 6172711 1 Hypothetical, unclassified, unknown 6188854 6188165 Transport of small molecules 6195308-6196315 Hypothetical, unclassified, unknown 6219068 6218856 Transport of small molecules 6221100 Transport of small molecules 6225924 6224896 . Hypothetical, unclassified, unknown 6227081 62274491 Hypothetical, unclassified unknown 6228243 6227602 Hypothetical, unclassified, unknown 6236228 62358301 Central intermediary metabolism 6244945 6243110 Cell wa))/LPS/capsuje !' 6247689 6246325 Energy metabolism. I 6248235 6247810 Energy metabolism 6249653 62482771 Energy metabolism 6250544 6249684 Energy metabolism 6252139 62505951 Energy metabolism 6252694 6252158 Energy metabolism 6253176 62527061 Energy metabolism 6253491 6253234 _. _-.. Energy metabolism 62544101 6253541 Energy metabolism 6254807 6254427 Cell division 6255843 6254971 Hypothetical, unclassified, unknown ___ __ 6260053 6259670 Hypothetical, unclassified, unknown 6263563 6261827 Transtation, post-transtationaf modificatio i 6264211 6263804 Transiation, post-transiationai modificatio i 6264360 6264226 4269 4200 0. 9999719 . 4270'4074 i 0. 9999719, rpoB 3640 3522 0. 9999058 : _11_56 _ 2892 995D54 ; nrdA 3834 2853 0. 9994519 vals 4560 2832 0. 999420 osta 595 2775 0. 999327 3168 2772 0. 9993217 i gyrA 1t__sqq_qq_ 4403 2751 0. 9992831 I secA a 0. 9990012 alas 3987 2622 s 0 3987 i 2622 5 0. 9989933 5 leuS i 1787 T"2610'0. 998961 i acnB. I toA 3011 i 2607 | 0. 9989528 5 4744 B 2523 0. 9986937 2436 0. 9983575 ftsk o__q qqe a_s 4"2421 0. 9982914"gyrB'j L- ! 3 ! 2397"0. 99818 | lon _j 3648 2394 0. 9981655 1529 1 2385 0. 9981216"Jig ! s 2739 2379 0. 9980917 pheT 5 3704 1 2310 0. 9977116 . 4964 2265 0. 9974239 parC 5050'2220 0. 9971 priA 260 ! 2151 0. 9965225 21-36 0. 9963824 1372 5 2136 0. 9963824 5 2071 1 2109 0. 996116 fusA2 0. 9960852 n 4740 2106 p P--i 8 2055 0. 9955228 giyS -3 qq--q 2046 0. 9954155 5 dnaX 1532 3482 j 2034 0. 9952684 5 metG 55 5296 2010 0. 9949599 ! rep 1939 1998 0. 9947981 1480 1974 0. 9944589 ccmF 5072 i 1944 0. 9940037 2744 1923 0. 9936629 thrS 1068 1911 0. 9934596 1596 1905 0. 9933555 htpG 3157 1890 0. 9930879 4967 !"1890'0. 9930879 parE 4044 i 1884 0 9929779 i dxs 5 1 1370 1 1866 0. 9926372 3821 i 1863 5 0. 9925788 secD 5 al-PM 3810"1860 0. 99252 j hscA 3821 1810 1848 099228 5549 1 1836 0. 992032------qlm-s 4gg7 _ 1812 0. 9915127 msbAV _ 5 4997 1812 0. 9915127 I msbA 767 i 1800 0. 9912404 1. epA 5187 1791 0. 9910304 1583 i 1773 t 0. 9905952 i sdhA r S _ __. _ L _ __. _. _,, _,, _, 1764 0, 9903698 arqs 0. 9902165 740,. . M 0. 98974B1 B. M.. _.. _ m. _. _.. ftsl.. ^. y . 1758 0. 9902165 ! 4418 1740 : 0. 9897418 ; i fts. . 5568. 1737. 0. 9896605 2298 i 1725 0. 9893287 ; j _4696 _. _ L_ t__ _____ ___ i ; 3725'1716 0. 9893287 956 1716 0. 9890729 4868 , 170'1 ; 0. 9886329 l ureC !""4526""'i'7oi'""""0. 9886329" """p ! ! B"""" 3162 1 1680 1 0. 9879869 ; rpsA 3162 1680 0. 9879869 r-psa ! t 1794 1671 0. 987699 gins 2075 i 1662 0. 9874041 2953 1656 : 0. 9872036 in i 4385 1644 ! 0. 986793 i groEL 2953 1 1656 0. 9872036 3637 1629 i 0. 9862612'i pyrG 1251 1 1626 0. 9861522 ; j 1629 0. 9862612 ; ; 183 ; 1611 i 0. 9855946 1 atsA 183 1611 0. 9855946 atsa 5065 1602 0. 9852493 3769 1578 0. 9842875 jguaA ! 2818'""1578"1"0. 9842875"'j'"i i 3024 1560 i 0. 9835251 f 5131 ! 1548 10. 9829965pgm M 1331 i 1548 0. 9829965 r 555611545) 0. 9828617)"'atpA 5556 1545 0. 9828617 atpa 3984 r'1536 j 0. 9825889 _ 1536 _ t Int 3984 i 1536 ! 0. 9824509 l Int 2207 Si 1521 i 0. 9817442 fj _. __ i mtlY 2343 ! 1509 0. 9811584 3103 ii 1509 1 0. 9811584 I xcpR 3103 1509 0. 9811584 xcp I b2u 1503 0. 9808585 ! 985 1497'j"0. 9805538T"'"'j r 3570 1494 0. 9803997 ; mmsA 4462 1494 ; 0. 9803997' rpoN ( l s 443 ii 1491 0. 9802443 "'4745'"" ! 1482'" !'0. 9797707 T'nusA"""" 5006 1 1479 i 0. 9796104 2097 ! 1476 ! 0. 9794487 ! ! 5237 j 1467 ! 0. 9789561 0. 9787893 4417 1464 iure 2037 1461 A 0. 9786211 2037 1461 0. 9786211 202 8 1458 ! 0. 9784516 { om 202 14bb 0. 9784516 1 1458 1 0. 9784516 --1455 1 0. 9782808 CZCB 4483 j 1455 v 0. 97. 82808 gatA 4329 1452) 0. 9781087 pykA 913 1449 j 0. 9779351 nTgtE 4484'1446 J 0, 9777602'gatB 1443 0, 9775839 murc 1587 1 1437 0. 9772271 1 lpdg LZ3.- !"11"''. 0. 9768646' T""" ! z 2073 i 1431', 0. 9768646 1 ! 1425 0. 9764964 2391 1425 0. 9764964 1416 0. 975933 .'"""'5119" :"1410"""09755499"f'g) nA ..... _., _ __. __ _ _. ; _ _. _ _ ___ __. _ _ __. ___ _4__ _ _ _ _-__-_ 4 686, 1410 _ 3876 1407 0. 9753561 i narK2 704,, 5 _... . ... __ 139 974565 E I 1395 , i 704 1395 0. 9745653 1395-0. 9745653...... .'""4931r""1395 ;"" 0. 9745653""IdnaB 1386 0. 9739556 1795 1383 0. 9737491 cys 3-8-0 0, 973541 xsea S 4416 1377 0. 9733313 | murF 1377 0. 9733313 3746 1 1374'0. 9731199 f ffh * * ; 9 2629 1371 ¢ 0. 9729068 f ; purB f 3746 374 0. 9731199 ffh !'1217 j1368,'0. 972692 1j 3081 1368 0. 972692 I ß 3081 1368 t 0. 972692 lu 2131 1362 0. 9722573 0. 9713671 l- 119 1350'. 0. 9713671 0. 9713671 accc z e z '. 4439 j 1347 0. 9711402 1 trpS 4414 1347lIV 0. 9711402_W murD I 2641 _ 1347, 0. 9711402 i nuoF f l >o 2843 1347 ! 0. 9711402 f 2336 1341 ! 0. 9706808 0. 9704484 ----l 4-9 1338 0. 9704484 gimm '5224) 1335' ! 0. 9702141 pep ?) 2475 1335 0. 9702141 r'3638 ! 1329""""' :"0. 96974"" J 4243 1329 v 0. 96974 J secY w oM-M-^ 716 1326 0. 9695001 2214 1323 0. 9692583 2794 0. 968769 1 | 4887 1317 ! 0. 968769 ! 3280 1317 1 0. 968769 opro e yyw y 3154 1317'. 0. 968769 wzy r--53-9 1314 0. 968521 3159 1311 0. 9682719 ___ybpA 2338 1-311 0. 9682719.......... 1183 ft 1311. 0. 9682719 I dctA f _........ _... _.. _........ F 1120'1308'0. 9680204 1 f ? t 4099, 1305'0. 9677669 w 2986 1302 i 0. 9675113 ? {972 1299 # 0. 9672538 tolB I i 2734 S 1296 i 0. 9669942 __pura I 4938 1293. 0. 9667326 L sura 3f335 1290 0. 9667326 i surA ? 3635'1290 : 0. 9664688 ? eno .......... __. _hemL -- '3977. 1284 0. 9659351 I hemL 2612 1281 0. 9656651 sers 4988 1278 0. 9653929 ... E 1895 1 1275 0. 9651185, __ 1373 1269 0. 9645633 fabF2 4666 1269 0. 9645633 j hemA 4450 1266 0. 9642824 mura 1951 1266 0. 9642824 5239 1260 0. 9637139 rho 0. 9631363 ftsa 4408 1254 2080 1 1251'0. 9628441 _... _i__ t 1155 i 1248 0. 9625495 nrdB ii 3147'1242 i 0. 9619534 wbpJ 3147 1242 0. 9619534 wbpj 1488 1239 0. 9616518 F 904 4 1239 0. 9616518 fgsC 3153 1236 0. 9613478 wzx 3733 1230 0. 9607326 i jl 1595 i 1230 0. 9607326 2042 1230 0. 9607326 1914 1227 0. 9604213 2500 1227 0. 9604213 z H 446, 1224'0. 9601075 446 1224 0. 9601075 4008 1 1224 1 0. 9601075 ! 4566 1221 0. 9597913 obg" 4566'i 1221'0. 9597913 obg f bo-: j 5221 1218, 0. 9594726 .. ____2347 '1218- V,. "0. 9594726"' 2347 1218 0. 9594726 4212 1218 0, 9594726 687 1215 0. 9591513 1215 0. 9591513 'i352 1212 i 0. 9588275 1783 1212 0. 9588275 nasA tf 4430 1212 0. 9588275 j - 2228 1212 1 0. 9588275 1 5320 1209 i'0, 9585011 dfP 5320 1209 0. 9585011 dfp is 2219 1209. 0. 9585011 opdE 1 1098 i 1209 {0. 9585011'fleS i 3589 1 1206 i 0. 9581721 ! 501 t""'12060. 9581721" bioF'1 501 1206 0. 9581721 0. 9581721 1 4413 il 1200 i 0. 9575063 | ftsW J Ji 1974 i 1200 i 0. 9575063 i 4190 i 1197 i 0. 9571695 ii iiC 4190 1197 0. 9571695 i 1107 i 1197 i 0. 9571695 2092 1194 0. 9568299 2553 1191 0. 9564877f 1489 1191, 0. 9564877 j , 3650 i 1191 : 0. 9564877'i dxr 1-546 1 ; 1191 ; 0. 9564877 i metK i 4407 1185 4407 1185 0. 9557951 ftsz 4219 1185 0. 9557951 2062 1182 0. 9554447 2001 S 1182. 0. 9554447'atoB 2103'1179 0. 9550915 559 1179 0. 9550915 3542 T'1170 :'0. 954015 jI". I 4991 1. 1176 0. 9547355 i i _.. . __. _. _. 1896 117'0 0. 954015 2922'1170 $. 0. 954015 3 1588 1167. 0. 9536505 i'SUCC W 787 I 1164 s 0. 953283 s 15-88 1167 0. 9536505 1164 0. 953283 i 2015 ; 1164 0. 953283 2015 1164 0. 953283 1164 0. 953283 '4636 1161 i 0. 9529127 3773 1158 0. 9525394 3523 1158 0. 9525394 1 3 5390 1 1155 5 0. 9521632 L 1237 1152 0. 951784 1162 1152 i 0. 951784 I dapE 3444 0. 9514018 1535 g 1149 1 0. 9514018 1 3096 1149 1 0. 9514018 i xcpY 3 3211 1146 0. 9510165 0. 9506282 3800""1143 T 0. 9506282 1 3800 14 3-' ! 0. 9506282 2940 1140, 0. 9502368 3 3806', 1140 m 0. 9502368 1 0. 9498423 3150 3 1134 ì 0. 9494447 wbpG 852 1131T 0. 949044 2626 1 0. 94864 t 2552 ! 1128 0. 94864 3 2831 1128. 0. 94864 3 4617 1125 5 0. 9482329 5 4527 1125 5 0. 9482329 5 pilC l ; 105 112_5 0. 9482329 coxB 105 12 5"i 0. 9482329 COXB 3230 1125 0. 9482329 4-056 1122 0. 9478225 5 rib 3 3149-+-.--1122 0. 9478225 wbpH 2442 i 1122 0. 9478225 gcvT2 1122 0. 9478225 catB 1 P10 j 1122 !'0. 9478225 jwaaG 574 5 1122 _ _ 0. 9478225 4565 1119 ! 0. 9474089 proB 3828 1119 i 0. 9474089 119 0. 9474089 j 3803 . _1116 Y _ 0. 946992 1113 0. 946571 r31'l7"'1J ! 13 i 0. 9465718'asd 3117 1113 ' ; rfldA = ---. j g-------- .------.--Q gggy-y----------j 2119 1101, 0. 9448574 146 1 1098'0. 9444202 2167 1098. 0. 9444202'' 3701 1096 ! 0. 9441269 ; 4373 k 1095 0. 9439796 i. i 4438'1095. 0. 9439796 643 1092. 0. 9435355 3969 1086 0. 9426368 3167 1086 0. 9426368 4665 1083 1 0. 9421821 prfa f 4415 Zi 1083 i 0. 9421821 I mraY 090 1080 0. 9417237 Z 3155 Z 1080 1 0. 9417237 wbpE 1 3155 1080 0. 9412617 1750 1 1077 0. 9412617 0. 9412617 ada 32 I 1074 ; 0. 9407961' 5032 1074 0. 9407961 , _ T ~. __t j 5034 T 1068 j 0. 9398537 hemE t-. z 1 2242 L 1068 t 0. 9398537 3 5011 1068'0. 9398537 waaC 3 3827 1068 i 0. 9398537. Z E 0. 9398537 555 1065 0. 9393769 fda 3827 1068 0. 9398537 5044 1065 0. 9393769 pilM -Sf 3148 1065 0. 9393769 945 1062 0. 9388964 3646'1062' ! 0. 9388964 ! IpxD 1004 1059 0. 938412 nadA' 3360 1059 1 0. 938412 3360 1059 69 1059 Z 0 938412 69 1059 i 0. 938412 1 5161 1059 0. 938412 | rmlB f Aw ol 1777 1053 i 0. 938412 r-mlb 3_646 1053 ? 0. 9374317 ZZ 2963 ! 1050'j 0. 9369357 646 1053 0. 9374317 1 1050 0. 9369357 pscU L2963 3160 1047 i 0. 9364357 wz _ _. _. ___ ___ __x 971 1044 e 0. 9359319 tolA t-w-1 1044 ! 0. 9359319 I tolA 2492 1044 s 0. 9359319 f mexT 3 2492-TO44-0. 9359319 3 1409 1041 0. 935424 + ap-ha 4149 1041 0. 935424 3617 1041'T 0. 935424 T"recA 5012 in38 0. 9349121 I waaF 1 3519 3 1038 0. 9349121 1 2197 1038 0. 9349121 4481 1038'j 0. 9349121 3 reb 98 1038 0. 934912 3989 1038 0. 9349121 holà 36_6_6 1035 0. 9343961, _ dapD_ j203 1035 ! 0. 9343961 ! J ! 21035 !'0. 9343961 ! j Zi 82 3 1035 Z 0. 9343961 _.. 5531 1029 0. 9333519 tonb 580 T _ 1026 0. 9328235 _gcp 4655 0. 932291 hemh 3981 1023 0. 932291 3759 1023 0. 932291 4895 1023 0. 932291 4895' 1023 0. 932291 _ E 2977'1020. 0. 9317542 H murBYW f l 4681, 102'0'0. 9317542 j 5 1020 0. 9317542 acob 4151 "4952 !'1020 j 0. 9317542 r' Zw Z 2491 Z 1020 Z ; 0. 9317542 3 2303 1 1020 0. 9317542 '3145''"""1020''"J'0. 9317542'""wbpL"""'1 i 2223 1 1020 3 0. 9317542 3 , ... --434--,'- 1017 0. 9312132 -flig-'I 102 1017 0. 9312132 Jr. ZZ 2370 Z 1017 Z 0. 9312132 iZ Z 2370 I 1017 ; 0. 9312132 2690 Zl 1017 1 0. 9312132 3993 1 1017 1 0. 9312132 445 1017 Z 0. 9312132 445 1017 0. 9312132 2740 ! 1017 j 0. 9312132"pheS 2060 1017 0. 9312132 ll 3 > ! 4966 j 1014 j 0. 930668 3868 1011 0. 9301183 5110 1011 ZZ 0. 9301183 3 fbp 3840 j 1011 Z 0. 9301183 008 L 0. 9295644 _. r_____. . _.. ___ ______. _.... _____. ____Mf 4322 1 1008', 0. 9295644 4209 1005 0. 929006 498 1008 Z 0. 929006 I 4209 3 1005 {0. 929006 402 1005 1 0. 929006 pyrB iZ 3195 í 1005 ZZ 0. 929006 I gapA '_. . 9 I 2026 3 1002 Z 0. 9284432 4238 1002 0. 9284432 ^-rpoA ; 3416 3 1002 1 0. 9284432 2981 999 0. 927876 | '4480 i 993'0. 9267279 mreC t 927 990 0. 9261471 ldha s 280 i 9900. 9261471 j cysA 143 3 990 1 0. 9261471 593 987 0. 9255616 ! pdxA 3 1 2467 j'987 i 0. 9255616 1 2961 5 987 |'0. 9255616 i holB f'2253"'r"""987'"t'0. 9255616"ansA"""' ) 26) 987) 0. 9255616 728 984 0. 9249716 3996 984 0. 9249716 {lipA 5033 f 981") 0. 9243768) _ 981 0. 9243768 J 5396 i 978'0. 9237773 __ _ _-__-m_ __-X_I i 2227 1 978 0. 9237773 3 5 3445 s 972 0922564 . 922564 2854 972 0. 922564 4945, 972 0. 922564 C miaA 4569 i 969'0. 9219502't ispB _... _ 969 9219502 660 969 0. 9219502 2767 ;'969 ! 0. 9219502' 2767 969 0. 9219502 thil 2293 s 966 0. 8213315 j ' 4051 969 0. 9219502 5 3089 í 966'0. 9213315 T ; 2293 f. 966 i 0. 9213315 3 3089 966 0. 9213315 2293 966 0. 9207078 i 5, 4544 963 1 0. 9207078 rluD 2683 1 963 0. 9207078 2211 í 960. 0. 9200793 2211 i 960 0. 9200793 1213 i 960 1 0. 9200793 _9 5 957 0. 9194457 T rluC 2975 957 0. 9194457 riuc S m 715. 957 1 0. 9194457 2051 954 0. 9188071 3 e j5 2874 i 954 R 0. 9188071 815 954 i 0. 9188071 ------ 407 954 0. 9188071 5 273_0 = _ 954 ; 0. 9188071 407 i 954 i 0. 9188071 gshB 2730 5 954 i 0. 9188071 L 9 54 0. 9188071 5 954 0. 9188071 3639 951, 0. 9181635 5 accA 954 1 0. 9188071 B- 479 5 951 i 0. 9181635 5 T 5'l 0. 9181635 a c 0. 9181635 3158 951 i 0. 9181635 wbpB 0. 9181635 wbpb 1911 5 951 ! 0. 9181635 5325 i 951'0. 9181635 J i 5325 951 0. 9181635 9 948 0. 9175148 557 945 0. 9175148 s 4557'"945) 0. 9168609 i IytB 759 1 945 0. 9168609 829 942 i 0. 9162018 5'. 829-942 0. 9162018 942 0. 9162018 prs 2110 j 0. 9162018J t H o t 4420 942 0. 9162018 L-S260'942) 09162018 1"hemC ! 233'942 ! 0. 9162018 i 3242 939 0. 9155375 2258 i 939 1 0. 9155375 ptxR J59IT'"i39 T"0. 9155375"' ! 2157 939 0. 9155375 1 2968)'939'"'0. 9155375 z fabD 3i 4561 3 939 1 0. 9155375 ribs 936 0. 914868 936 0. 914868 i 2536 j 936 J 0. 914868 3036 933 0. 9141931 ili 5173 ! 933 i 0. 9141931 ! arcC 5173 0. 9141931 1 arcc : 4170 i 933 i 0. 9141931 -2551'933 i 0. 9141931'' '2507. 933'0. 9141931. catA . 869''""933 ; 0. 9141931" T pbpG j 4170 933 0. 9141931 ' 2123 ! 933 i 0. 9141931 2551 933 0. 9141931 869 933 0. 9141931 123 i : 933 0. 9141931 _.. _ i 2681 i 930 i 0. 9135129 2681 930 0. 9135129 930 0. 9135129 etfa 4809 930 0. 9135129 ! fdhE 2017'930 0. 9135129 !, __.. ¢. ^ _....... _ _. _. 1 1517 927 0. 912827 --fO-3f7 _R2 7 0. 9128273 3 r r t 0. I 4037 ! 927.. : . 9128273 Jr~i.-. _ i 4037 ! 927 i 0. 9128273 ii 1555 5i 927 ì 0. 9128273 477 I M g27 _. _ 3829 924 0. 9121363 1 5 4174 924 1 0. 9121363 S ~ 205 1 921 i 0. 9114397 100 | 921 i 0. 9114397 f 2220 j 921 0. 9114397 É 2383 j 921 3 0. 9114397 133 918 ii 0. 9107377 771 918 = 0. 9107377 t era _ _... _.... __..... 2469 . 915 0. 9100301 t 1986 915 0. 9100301'"pqqB j 198r6- 113 915 i 0. 91. 00301 2689 915 ! 0. 9100301 ii ., F. _..., _ 9100301 3 70 915 0. 9100301 3330, 915 ! 2428 j 915 0. 9100301 J 2428 915 0. 9100301 3850 912 0. 9093169 '4305 912 ; 0. 9093169 ii 2474 912 0. 9093169 4305 912 09093169 4 6 _.. _.. ..... 912 _... 0. 9093169_. __... ..... _pXC_.. _ 3776. 909 0. 908598 1 448 909 0. 908598 ; 1. 1638 i 909 0. 908598 ! 1342 909 0. 908598 5162 909 0. 908598 3 rmlD 3892 5 909 i 0. 908598 ! 1328 J 909 ! 0. 908598 LZ02JI--T 0. 9078734 906 i 0. 9078734- 3 1000 ! 906 1 0. 9078734 _ 3 ! 1145 ! 903 i 0. 9071431 J j 730 1 903 0. 9071431 5364 903 _ 0. 9071431 __ 5364 903 0. 9071431 4436 | 900. 0. 906407 _i436 900 0. 906407 _ ; ___... ; 932 900 0. 906407 cvsm 900 0. 906407 705 i 9oo : 0, 906407 i i .......... 894 0. 9049173 1223 894'0. 9049173 t . 2316 : 894 5 0. 9049173 2877 894 i 0. 9049173 ""'207F'"894' !'0. 9049173i 207 894 i 0. 9049173 Z s l 3433'894 0. 9049173 i 5 1321 891 0. 9041635 Z cyoE '3312 : 891 : 0. 9041635 >,"_, _., _, ___ _ L _____. ______ _-__... --.---.---- ! 891 0. 9041635 5358 X 891'O 9041635 ! ubiA 0. 9041635 2101 i 11'888 0. 9034038 1589 888 0. 9034038 1589 1 888'0. 9034038 j' ; 3088 888 0. 9034038 1 4043 1 888 i 0. 9034038 ! ispA 2185 885 0. 9026381 4850 ! 885"0. 9026381 j prmA J 5163 882, 0. 9018663 | rmlA 209 882 Z 0 9018663 5 188 882 0. 9018663 0. 9010883 dapa 5 !'2830 ! 876 0. 9003042 htpX ---- 83-0 876 0. 9003042 Z 412 t 876 1 0. 9003042 pilK 876 0. 9003042 2 1135 876 0. 9003042 r 1135 876 0. 9003042 2441 876 0. 9003042 5562 873 0. 8995139 SPOOJ 0. 89951 626 873 39 3112 873 0. 8995139 ; ac_cD I 1 3655 870 0. 8987173 tsf 1528'"870"""-"''Q. 8987173' r''zipA'"" ! i 5560" ! 870 0. 8987173) atpB 1698 867 0. 8979144 popn 2863 j 867'0. 8979144 ! lipH 6 867 0. 8979144 867 0. 8979144 1630 867 0. 8979'1, 4, + 1 5335 864 0. 8971052 5457 864 0. 8971052 A A-n a . _. 211 864 1 0. 8971052 Z mdcD Z He 1622 i 861 0. 8962895 3 1622 '861. 0. 8962895 1 241 g .. ........ _. __ _-. 8962895 --.. . ___. _ 2418 861 i 0. 8962895 i Zi 2142 861"0. 8962895] 1687 861 0. 8962895 spew 4861 858 0. 8954674 j 4788 858 0. 8954674 3292 858 : _0. 8954674 i 2294 855 0. 8946387 244 1 855 0. 8946387 1 0. 8946387 0. 8946387 fold 376" !'"855" ! 0. 8946387 r'""rpoH z E ; 852 0. 8938035 l- 768 i 855 i ; 0. 8946387 i lepB {, '. 3185-.. g52-. _...... s. 8938035'.', < 3185 852 i 0. 8938035 ! 4314 852. 0. 8938035 purul 4750 85Z 0. 8938035"j foP 4925 852 0. 8938035 1496 852 0. 8938035 '4669'" 849) 0. 8929616 1 1539, 849 i 0. 8929616 2088 3 849 A 0 8929616 3 2088 849 0. 8929616 '1' !'S49'"r''O. S929616""" nadC"1 3787 3 849 0. 8929616 2095 i$i 846 i 0. 892113 3636 846 0. 8921131 kdsA 1364 843 0. 8912579 3 4864 843 Ij 0. 8912579 ureD 1454 0. 8912579 184 840 0. 8903958 4215 5 837 i 0. 889527 --''-------1 - 3384 837 ! 0. 889527 phnC 2329 j 837 j 0. 889527 837 0. 889527 3315 J 834 I 0. 8886512 ij 1379 i 834 0. 8886512 3 5278 831 0. 8877685 dapf f i 4296 828 0. 8868789 "978)'28) 0. 8868789 ! 978 5 828 ii 0. 8868789 3 828 0. 8868789 978 828 0. 8868789 nosY 92 503 825 1 0. 8859821 3 1619'"825 J 0. 8859821 4552 825 ! 0. 8859821 pilW 5 j 3348 !"825 ! 0. 8859821f"J 1938 822 0. 8850783 426-0 4260 822 0. 8850783 r IB 819 0. 8841673 4167 819 s 0. 8841673 I 4167 i 819 ! 0. 8841673 3936 ! 819'0. 8841673 4969 ! 819 i 0. 8841673 936 5132 i 819 0. 8841673 -n -§ 238 1 816'i 0. 883249 3651 816 i 0. 883249 I cdsA 5, -38-816 1 0. 883249 _ 4956 j 816 i 0. 883249 j rhdA 187 816 0. 883249 1164 813 j 0. 8823235 ! 790 816 0. 883249 1164 813 0. 8823235 . _.,.. _r. _. _ 'j 2074 i 813'0. 8823235 ij 4992 i 813. 0. 8823235 3 813 0. 8823235 810 0... __.. 204.... _.. __... __ __ 2591'F 807'""f 0. 8804504 ; J 204 810 0. 8813907 2591 807 0. 8804504 1624 1 807 0. 8804504 .-4759 807 i-0. 8804504 dapb 'i 3022 807 0. 8804504 5009 807 0. 8804504 j ? 35 807 0. 8804504 trpa - | Z 35 ; 807'; 0. 8804504 3 trpA 5 ''3505,'804 i 0. 8795027 ! 3505 804 0. 8795027 2678 5 804 i 0. 8795027 , H f 2010 i 804 i 0. 8795027 801 1 0. 8785475 w 341 1 801 0. 8785475 ig j 4729 801 5 0. 8785475 ; pans 4662 J798 (0. 8775847 j J'I'u [jL-. 550 ! 798 S 0. 8775847'f J ! 4455 i 798 j 0. 8775847 2295 798 0. 8775847 .-2013) 798J 0. 8775847 j -416 0. 8766143 342'795 ; 0. 8766143 thyA i L 342 795 0. 8766143 H 1872 3_ 792 _ 5 0. 8756362 --35-3 7 9'2 0. 8756362 4980 792 0. 8756362 1691 789 0. 8746503 | pscT 642 789 0. 8746503 4651 789 0. 8746503 4157 789 0. 8746503 1462 789 1 0. 8746503 t 3443 789 5 0. 8746503 3578 5 786 a 3657 786'j 0. 8736566 map as 0. 8736566 4348 786 1 2260 783 L 0. 8726551 862 783 ! ; 0. 8726551 __,.. _...,..,- 236 780 0. 8716456 2811 780 0. 8716456 t 1224 1 780 1 0. 8716456 4122 780 0. 8716456 5 4699'780 5 0. 8716456 '7'7'7 3397 7 0. 8706281 IpxA 3512 777 0. 8706281 1307 774 0. 8696025 4330 774 0. 8696025 H | f { 3609 771 0. 8685688 P, I 5063 771 ; 0. 8685688 ubiE 1366 771 0. 8685688 1 771 0. 8685688 5 _ pro 0. 8685688 4341'771 i 0. 8685688 i,. 4341 77_1 2839 0. 8685688 2234 771 0. 8685688 4706 768 0. 8675269 . ____ 4706 768 0. 8675269 2554 768 0. 8675269 5028 768 0. 8675269 2979T J765 0. 8664768 J""kdsB'.' 765 0. 8664768 5469 5 765 s ; 08664768 3220 i"'765 T"0. 8664768"T'1 3220 765 0. 8664768 1 1591 i 765. 0. 8664768 ! 3 '_ 0. 8664768w i . _ __ ; 2989 765'0. 8664768 1088. 762 5 0. 8654183 3 ;-lt 2989 765 0. 8654183"f""1 __. _1021 __ . _. _. 762 _. . I, _ p. 8654183-'. x. _.. _ ; 4663 ; 759 í 0. 8643515 i moeB 4389 759 1 0. 8643515 O-t a 4389 1 759 5 0. 8643515' 4389 759 0. 8643515 1012 759 0. 8643515 1 0. 8643515 ccmc li 5007 759 3 0. 8643515 3743 j 759 1 0. 8643515 trmD 1< 759 ; 0. 8643515 pilF 3151'"756'j JL8632761 !'jT ! sF2 j 4350 756 3 0. 8632761 4748 756 ! 0. 8632761 5 tpiA ! ; 5259]"756'T"0. 8632761 _hemD -25-9 756 i 0. 8632761 hemd 339 j 756 j 0. 8632761 jj 1125 753 ; 0. 8621923 I ( 3851 753 ! 0. 8621923 3851 753 0. 8621923 1952 j 753 ! 0. 8621923 1369 753 0. 8621923 753 0. 8621923 1 D5> 753 182 ; 753 ; 0. 8621923 ; 3 19,, 2 309 753 0. 8621923 2952 750 0. 8610999 etfb 4790 3 750 3 0. 8610999 | 1350 0. 8610999 4049 747 0. 8599988 .......... 4972 747 0. 8599988 L 4972 747 0. 8599988 0. 8599988 744 0. 8588889 2803 744 0. 8588889 544 744 ; 0. 8588889, 4083 741 j 0. 8577703 ! 1816 741 j 0. 8577703 dnaQ 0. 8577703 0. 8566428 4299 738 i -i8-92-f- 0. 8566428 i j 3004. _. _.. i_. ___.. __38.......... _..... . ... .. _0. 8566428.... _. _. __.. Y......... _... _......... 3654 ; 738. 0. 8566428'pyr ;'; !, 4388. ___ 735----0. 8555064 I .......... 4388-735 0. 8555064 ; __. 0. -w : 1559 | 732. 0. 854361 1'. - ^ 1559 I _ 732 0. 8543'61 ( 1733 732 0. 854361 1165. 729 5 0. 8532064 2224 729 0. 8532064 3317 729 0. 8532064 t 3477 j 726 ; 0. 8520428 rhlR 489, 726 j 0. 8520428 1 j 4461 726 0. f"-g----'""73---j---Q ggQgggg--j 723 0. 8508699T ! Al 3494 723 ; 0. 8508699 t < ot 4802 723 0. 8508699 1 502 ; ; 723 Jl 0. 8508699 ;'3888 3 723 ì 0. 8508699 0. 8496877 4181 1 720 0. 8496877 2229 720 i j 5334 720 0. 8496877 rph ! _.. _. _ ___. _.. w--- : 531 717 0. 8484961 i 3857 717 ! 0. 8484961 e 3249 ; % 717 3 0. 8484961 t > 3606 717 08484961 906 0. 8472951 906 ; 3 714'; 0. 8472951 _ ; -749-1 714 0. 8472951 J L 0. 8472951 v 2544"714 0. 8472951 J 1106 714'""'0. 8472951--'------ 106 ) 993 714 0. 8472951 1157 711 0. 8460846 1013 711 ! 0. 8460846 B purC 1584 708 0. 8448644 sdhB 3 w% S 1348 g 708 j 0. 8448644 A, o 5071 708 r 0. 8448644 1 3 58 705 i 0. 8436346 705 0. 8436346 ....... ..........-'-yQ"'0. 8436346 j 3633 705 0. 8436346 l 3633'; 705'0. 8436346 ) 2800 705 0. 8436346 4064 705 j 0. 8436346 j 1475"702 j0. 8423951"'ccmA"j 1371 702 i 0. 8423951 4679 702 1 0. 8423951 279 _ ". _699. _. __. _. _. _.. __0. 841145_7_ j __ _ .. 4679 rod 0. 8423951 j 3 3171"t"699"' !""0. 8411457""""""ubiG"""j 279 ! 699 i 0. 8411457 t 3171 699 i 0. 8411457 pyrF 699 3 699 ! d. 8411457 ___ ___. 3 2876 ;'i 699 | 0. 8411457 3 pyrF 3488'i 699 ! 0. 8411457 i 3681 1 696 1 0. 8398864 3 t 4273 j 696 r 0. 8398864 rptA'j ! 3731 3731 696 0. 8398864 5154 1 696 t 0. 8398 .......... 2105 E 0. 8398864 '2105 T"696'10. 8398864 J j 5052 696 0. 8398864 \69'"'696 ! 0. 8398864. ; totQ I .. 1894 693 0. 8386172 2280 1 693 3 0. 8386172 2280 693. 8386172 213 ! 693 3 0. 8386172 733'< M3 ! 0. 8386172 f ! 733-693 i 0, 8386172 733 693 0. 8386172 ; 690'0. 8373379 t 5496 i 690 0. 8373379 i 4885 3 690 3 0. 8373379 ! irlR 4885 1 . __ 271 g. ___. _. _... _... _ 687_.... _.... _.. i..... _ 0. 8360484 _. __#. ___. ____. __. 2719 3 687 ii 0. 8360484 120 687 0. 8360484 120 33 687 0. 8360484 ! 3 504 1 687''0. 8360484 ! bioD 1862 687 0. 8360484 modB 7 . 527 684 3 0. 8347487 dnr_j ! 1118") 684 0. 8347487 n i | 2987 684 3 0. 8347487 3 2617 681 0. 8334387 aat 3685 681 3 0. 8334387 i t ? 2638 678 33 0. 8321183 j nuoB 3 1980 ! 678, 0. 8321183 2638 678 0. 8321183 1 nuob 20343 675- 0. 8307875 1261 t 675 3 0. 8307875 _ 1261 0. 8307875 i 2996 1 675-0. 8307875 jj nqrD 3528 675 0. 8307875 ! 3528 675 ! 0. 8307875 J rnt j 9713 675 0. 8307875 453 1 675 1 0. 8307875 3 3 g76 3 675 ! 0. 8307875 5319 0 675'0. 8307875 radC 607 33 675''0. 8307875 rpe 284 672 0. 8294461 1167 672 ! 0. 8294461 1476 672 0. 8294461 ccmB 1193 1 672 0. 8294461 1 4892 ì 672 ! 0. 8294461 ure 330 0. 8294461 rpia 944 1 669 j 0. 8280941 purN i 1269 669'0. 8280941 _ 243 669 0. 8280941 67 666 0. 8267314 B5 i 666. 0. 8267314 <. 0. 6267314 f < S ; __.... _.. ,.. __ 1978-_ 666 0. 8287314 4029 666 0. 8267314 !''4776 j 666''"j"0. 8267314} 1823 i 663 0. 8253578 e B ~ 666 0. 8267314 1623 663 0. 8253578 3890 3, 663 ! 0, 8253578 S 3181 663 0. 8253578 11090 i 663 0. 8253578 697-663 0. 8253578 "6 J 660 r OJ34''1 ''2782 :""660""""0. 8239734". . IT'' r 3110"'660') 0. 8239734 f"4055 660 j'0. 8239734 ! : ribC"" 2782 660 0. 8239734 -660 0. 8239734 ribC . ____. __ 660 0. 8239734 ribc 4121 ; 660, 0. 8239734 T 0 _y2832 .. _... ___ 657. _...... _.. _ _--, 82257g T... _.... ;.-Y t m 499§ 651 i 0. 8197539 f 3 4998 651 0. 8197539 tz 1504 651 0. 819753L__ 4757 651 j 0. 8197539 3 t 1504 651 ! 0, 8197539 655 648 0. 818325 3 655 i 648 0. 818325 3 T 3859 648 0. 818325 _ 648 3 3859 i 648 4 0. 818325 3 e M 3 6 648 0. 818325 0. 818325 3973 3 648 T 0. 818325 1 4676 648 1 0. 818325 4216 645 0. 4453 j''648 ! 1905 i 648 ! 0. 818325 v 2473 6-4 5-,, 0. 8168848 3 4006 645 ! 0. 8168848 2473 i 645 ; 0. 8168848 2473 645 1 0. 8168848 < MS 1825 ! 8168848 ifr 652 3 645 j 0. 8168848 vfr 5331 642 0. 8154332 251 642 1 0. 8154332 3 5331 642 ! 0. 8154332 hishl 5142 642 3 0. 8154332 642 5534 642 0. 8154332 3730 642 3 0. 8154332 T -- 2007 639 i 0. 8139701 maiA T A * l 2726 3 639 0. 8139701 w r 2720 r 639 ! 0. 8139701 4646 ! 639 T 0. 8139701 upp 826 639 0. 8139701 3495 639 0. 8139701 nth 1 3678 639 0. 8139701 3450 639 i 0. 8139701 '2066 639 ; 0. 8139701 990 f 639 0. 8139701j 2066 4182 639 i 0. 8139701 4182 2983 636 1 0. 8124954 3246 636 í 0. 8124954 rluA 114 T 636 3j 0. 8124954, 3 ) 114) 636) 0. 8124954 2126 636 1 0. 8124954 2126 | 636 ! 0, 8124954 T l 4507 6330. 811009 j _ _ 1558 t 633 3 0. 811009 ; J 1558 r"633"'0. 811009 2g62 1 633. 0. 811009 633 0. 81 4890 ! 630, 0. 8095108 3-}------l 3 629 t 630 ; 0, 8095108 t i T 4019 8095108 4440'_ 630_, 0. 8095108 3232 627 0. 8080008 ""2614' !"'627"'0. 8080008) JoiA) 5064 627 0. 8080008 ... _..... .. _...... 624 853 624 0. 8064788 3665 624 0. 8064788 a 1790 624 0. 8064788 1 '4752 624, 0. 8064788 t ; ftsJ 3 3 981, 624 0. 8064788 3988"3 624'j 0. 8064788 5341 621 0. 8049447 3 4239 X 621 0. 8049447'rpsD 1--1757--. i.--_.... _... _. __61 g _. _____ _.. _... _0. 8033984 thrH ! 1757 i 618'0. 8033984 thrH 3j 1757 i 618 0. 8033984 fh-rk 2504 618 0. 8033984 4668 618 0. 8033984 4428 618 0. 8033984 ----33-0-66 1-8 0. 8033984 1 4047 3 618 j 0. 8033984 ribA '.. 0. 8033984 2807 618 3407 618 3 0. 8033984. hasAp . __ 1315 615 ; 0. 8018399. 5470 615 ! 0. 8018399 x s 4671 33 615 i 0. 8018399 1219 615 0. 8018399 571 615 3 0, 8018399 s 4871 615 i 0. 8018399 3754 612 0. 800289 4871 615 0. 8018399 3354 612 __ 3 0. 800269 3754 612 0. 800269 5_ (609 0. $986 57 hi H2 3152 3 609'0. 7986857 hisH2 3 I b62 0. 7986857 1962 609 3 0. 7970898 154 606 0. 7970898 pcag i 1962 609 i 0. 7986857 i"2459 606" ! 0. 7970898 f 154 J 606 j 0. 7970898 ! pcaG 154 1 608 0. 7970898 2602'606 0. 7970898 '2602 i 606 3t 0. 7970898 w 806 T<79 ìasi 1432 606 0. 7970898 lasl 32 (.- 606 0. 7970898 377 606 0. 7970898 v rplD 4262 603 0. 7954813 rpid 1089 603 0. 7954813 5190 603 f 0. 7954813'' t 3273 600 !'0. 7938601 r 2451 J 600 ! 0. 7938601"'' rdZrm597 J"0. 7922259""1 3472 597_ 0. 7922259 3 3 3472 597 0. 7922259 3030 597 0. 7922259 j 2792 597 0. 7922259 ! 1172 597 j 0. 7922259 napc 34 594 0. 7905789 4012 594 0. 790578v S 2916 ! 594 i'I ! '4425 3 594 {o. 7905789 3 ; 4425 594 684 594 : 0. 7905789 ! 4345 i 591 i 0. 7889187 1 3 4063 591 0. 7889187 3281 591 0. 7889187 4 3796 D 588 0. 7872454 l 2774 4 588 U 0. 7872454 i 3 2774 588 ! 0. 7872454 ; pilX 4923 588 0. 7872454 923'"588""" ; 0. 7872454"T"''j 763 585 0. 785558. 9- 2196 585 0. 7855589 jl 3765 i 585 i 0. 7855589 i l 3765 585 0. 7855589 1947 585 0. 7855589 . 3 ; 3489 3 585 ! 0. 7855589 3414 I _585 ! 0. 78555$9 3414 3 585 ! 0. 7855589 1 t-4672 ; 585 i 0. 7855589 3t 1280 i3 585 3 0. 7855589 i3 1280 1 585 0. 7855589 1 4366""T''582'I'"0. 7838589'sodB J 2936'i 582'0. 7838589 ! _ 3 3255 ! 579 i 0. 7821455 2936 582 0. 783858 9'0. 7821455 111 579. 0. 7821455 _ 0. 7821455 3867 576 1 0. 7804185 3156 576'0. 7804185 wbpD 776 573 0. 7786779 in 3784 _ 573 ! 0. 7786779 í 7-84--573'0. 7786779 o-o <s 3 4459 573 X 0. 7786779 2372 573 i 0. 7786779 f 2910 570 i 0. 7769234 1928 570 3 0. 7769234 ! rimJ t 1928 570 1955 3 570 i 0. 7769234 3 1955 570 0. 7769234 422 570 ! 0. 7769234 3 405 5 570 0. 7769234 l 2851 3 567 i 0. 775155 ! efp 5176 t ;, 567 3 0. 775155 3 t 1994 564 1 0. 7733726 3 -0fi 564 0. 7733726 --600- 0. 7733726 nfxb 56 4 4171 3 564 1 0. 7733726 4171 564 1 0. 773372 139 564 0. 7733726 ahpC <f 3227 564 0. 7733726 1427 564 0. 7733726 1427 564 3 0. 7733726 ! ii ii 2331 1 561 i 0. 7715761 2406 i 561 3 0. 7715761 2406 561 0. 7715761 3438 561 0. 7715761 ' 4831 561 J 0. 7715761 j) 3 4762 3 561 i 0. 7715761 i3 JeL 2584 561 r OJ715761'pgsA ! H s-r ~s j 1204 I 558 0. 7897653 ! 55'8-0. 7697653 i 558 ;. : 0. 7697653 22 3 558 ii 0. 7697653'3 2784 558 0. 7697653 555 0. 7679402 r"5225'T'"""555'""10. 7679402'"" :"''I'lj L 535 f555 ! 0. 7679402 1472 555 0. 7679402 555 0. 7679402 2743 552 0. 7661006 . _. _. _ 2743.. _m __.. __ 552 '. _. _ 0. 7661006 i infC, 3 16-35 0. 76folOO6 kdpc 1884_ 552 0. 7661006 3 54 ~33-549 T o 7 54 549 0. 7642464 j j 0. 7642464 1543 549 i 0. 7642464 apt I 2365 546 i 0. 7623775 __. 4,. _. ____. _ _ # _ _ _" 2434 546 tj 0. 7623775 3 149 S 0. 7623775 3 149 1674 546 j 0. 7623775 folE2 171 543 0. 7604938 1481"'543"f 0. 7604938'ccmG 3726 j 540 j 0. 7585952 l 4251 540 0. 7585952 rplE 3 w 1768 540 3 0. 7585952 937 540 0. 7585952 537 0. 7566815 5557 537 0. 7566815 atph 3396 537 3 0. 7566815 nosL 2971 j 537 0. 7566815 2971 537 0, 7566815 3 2971 537 ! 0. 7566815 l l 4962 537 0. 7566815 j 4248 j 534 0. 7547527 rp ! F' 248 534 [1377 J 534''0. 7547527 j" 1885 534 0. 7547527 4275 534 0. 7547527 nusG 46419 534 0. 7547527 2985 534 1 0. 7547527 v l < ! 1154 j534 0. 7547527 r"5TlFiT"531 0. 7528085 gioA3 1 4765 531 0. 7528085 omIA 3575 531 0. 752808 5 4031 528 0. 750849 ppa j 13-oo-528 0. 750849 # _2733 528 0. 750849 ? 4460 ! 528 1 0. 750849 3905 528 0. 750849 _ v f 528 ID. 750849 1867 528 0. 750849 4 5-5--528 0. 750849 4--525 0. 748873 nirl 4965 525 O7488739 2464 525 0. 7488739 -.-. $ 3095 : 525 i 0. 7488739 ii xCpz 3095 525 0. 7488739 _ _ 1134 ii 522'0. 7468831 1 b62 i 522 0. 7468831 ii '1442 522 ; 0. 7468831 $i ! 3693522'0. 7468831 : i 3693 _--$31 3811 1 522 0. 7468831 t hscB' 3811 522 0. 7468831 hscb 145 519 0. 7448766 1845 7448766 __ f i 3100 519 z 0. 7448766 ? xcpU ? 3100 519 0. 7448766 XCPU 4866 ? 519 0. 7448766 5039 $ 519'0. 7448766 3 aroK ___2496 _--,.- 516_-- ; _ 0. 7448766 arok 3911 516 i 0. 7428542 x I 4050 516 1 0. 7428542 516 PA 11 6Vl 0-+-5 16 1 0. 7428542 faba 3287 516 0. 7428542 403 i 513 3 0. 7408157 PYrR L s -. 1--- 1514 510 0. 7387611 114-510 0. 7387611 IspA 4559 510 0. 7387611 47 ? 510 $i 0. 7387611 4104 510 i 0. 7387611 510 0. 7387611 3965 510'0. 7387611 3965 510 i 07387611 __. __.. 61 2184 51 0 0. 7366902 3 1657 507 3 0. 7366902 f 1666 507 ii 0. 7366902 ii 1-6-66 50-7 0. 7366902 i3 55 1 507 1 0. 7366902 3647 507 3 0. 7366902 t 3647 507 0. 7366902 973 507 3 0. 7366902 585 3 507 Æ 0. 7366902 2859 j_-507 -= 0. 7366902 greB --wl --f 8 5-9 1 507 1 0. 7366902 _gLeB ----'--t -350 1, 507 1 0. 7366902 fola 3288 504 0. 7346029 1967 501 0. 732499 4272 501 0. 732499 f rplJ 4246 501 0. 732499 rpsE 3318 501 0. 732499 ;-, : i$j 3756 501 3 2226 1 501 3 0. 732499 $ 3 501 0. 732499 nuoj 0. 7303785 1837 498 0. 7303785 4232 498 0. 7303785 ? 1035 495 0. 7303785 ssb t. 1 1035 495 ; 0. 7282411 y a 4 3815 492 0. 7260868 )"1173 492 0. 7260868 j napB 'i 173 3 492 i 0. 7260868 i napB 492 0. 7260868 napb ! JIZ" !"489 0. 7239154)" ! , M 4211 489 0. 7239154 489 0, 7239154 1899 489 0. 7239154 1745 489 0. 7239154 1956 489 0. 7239154 4210'489'0. 7239154 s 4574. 489 0. 7239154 2517 489 0. 7239154 i xyiY . 4728... _. _.. ___. _. _. 48g... _. __.. _.-. 7239154 l. .... __.. fol_.. _. w. _.. E _3403 ; 486 : 0. 7217268 (-_..--. j 837 486 0. 7217268 ,-". w,. . _.. _... _ ; 1 0. 7195209 4295 483 0. 7195209 ""3856 j'""""4S3'"""'0. 7195209'""""" ! 4295') 483 0. 7195209 4295 i 483'0. 7195209 _1 3918 483 0. 7195209 f 3982 !"483 0. 7195209"""'J I 4773_ 1 483 ; 0. 7195209 ! 5247 f"483'0. 7195209J 5222 483 0. 7195209 $ 5222} 483 f, 0. 7195209 3 4052 j 480 0. 7172975 3 4052 480 0. 7172975 nusB i 3 363 480 3 0. 7172975 coaD 2935-4-8b 0. 7172975 2461 480 1 0. 7172975 ! 2721 j 480 0. 7172975 2721 480 0. 7172975 _ _ I 0. 7172975__ _.. ___... _. ; 698 _ 336 480 0. 7172975 4395 480 0. 717297 > x j 3207-480 0. 7172975 3-H k 1464 3 480 i 0. 7172975 1026 477 0. 7150564 -477 0. 7150564 L 3 si 2205 477 0. 7150564 4_053 (... 477 _.. r_, ^iw, _, 0. 7150564., ,-,-ribE...,.,.,., 3 4053 1 477, 3 0. 7150564 ribE 0. 7150564 5081 1 3785 477 0. 7150564 1696 477 0. 7150564 pscO 477 0. 7150564 4718 477 0. 7150564 808 474 1 0. 7127976 3$ < û. 7127976 _ 3 1593 3 474 1 0. 7127976 1593 1 474 0. 7127976 6 0. 7127976 __+ __o~3 3 4454 1 474'0. 7127976 ? t-| t w3 1008 474 i 0. 7127976 bcp 474 03b-474 0. 7127976 116 474 0. 7127976 116 $ 474, û. 7127976_ _ 1206 ! 474 i 0. 7127976 3 3627 474 0. 7127976 3302 471 0. 7105208 S 332 r r---0-7105208 ____f :...... _5558... _. 4267 ! 471 0. 7105208'S 2052 s 471 : 0. 7105208 i cynS i 4847 T 471' 0, 7105208. j accB} . 962 471 0. 7105208 3 _ '2171 471 0. 7105208 '4948 468 0. 7082261 3 4107 _ ; 468 0. 7082261 s ____i 332'468 0 ; 7082261 '4107'468'0. 7082261 i 1482 468. 0. 7082261 ! 4183'468 0. 7082261 i i 2427 ! 468 0. 7082261. 2786 b 468 ! 0. 7082261 {- 953 s 465 ; 0. 7059131'T 4564 ; 465 0. 7059131 1 4564 465'. 0. 7059131 953 465 0. 7059131 _ ; 2731 465 0. 7059131 --------- 80 3 465 0. 7059131 4057 465 ; 0. 7059131 : . _ 2978 1 465 T 0. 7059131 05-7 465 0. 7059131 1306 1 462 IT 0. 7035818. 3616 462 0. 7035818 3616 462 T 0. 7035818 _ 1673 i 462 T 0. 7035818 l 462 0, 7035818 462 0. 7035818 3380 459 0. 701232 4746"T 459 j 0. 701232 ' 3380 4-59 5229 3j 459 ! 0. 701232 5229 459 0. 701232 -3 2 0-456 0. 698863 ? 2499 _ 456, 0. 6988636 3309 J'456"j 0. 6988636 .......... 30 456 0. 6988636 9 0. 6988636 4828 456 5321 456 i 0. 6988636 dut , 4421 I 456 0 6988636 4421 ? 456'. 0. 6988636 T f 4697 5 453 e 06964764 4697 453 0. 6964764 2538 I 453 0. 6964764 2829 453. 0. 6964764 3916 453 < 0. 6964764 moaE tH 3435'453 ! 0. 6964764 lT 115 T 453_', 0. 6964764 f 1 3435 453 0. 6964764 678 450 M 0. 6940703 I 4525 (450 s 0. 6940703 pila 1285 450 0. 6940703 4-450 0. 694, 0703 822 447 0. 6916451 245 447 ! 0. 6916451 aroQ2 3 1815 1 447 1 0. 6916451 $ rnhA, 1594 0. 6916451 07 T 1122 ? 444 0. 68920 O e e 1122 444 0. 6892007 . _w_.. __.... 1105 444 0. 6892007 flii 970 3 441 0. 6867369 ; tolR rt 70 2982""'"441"J"0. 6867369)'j 3645 441"' ! 0. 6867369 3 fabZ """61.. -jQ gg536'"""j" ! 61 i 438 $i 0. 6842536 _ 645 441 0. 6867369 i fabz 1835, 438 ! 0. 6842536 i 1618 438 = 0. 6842536 3 _.. _ 5178 438 0. 6842536 1 i6l 8' 438 0. 6842536 -5-7-1------ 0. 6842536 3017 438 0. 6842536 438 0. 6842536 i 1710 438 i 0. 6842536 ! exsC 3341 435'i 0. 6817506 ! 1710 438 0. 6842536 1 exsc 94 j 435 ; 0. 6817506 2436 435 0. 6817506 4244 435 0. 6817506 756 435 0. 6817506 404 435'0. 6817506 u 250'435 0. 6817506 4610 435 0. 6817506 433) 435 0. 6817506. f 4767 435 3j 0. 6817506. f = 433 435 T 0. 6817506 S-E 2675 435 0. 6817506 i-- 720 435 $j 0. 6817506 679 432 i 0. 6792278 ? 3807 3 432 3 0. 6792278 ndk 4274 432 0. 6792278 rplK 4274 432 0. 6792278 rpIK 3986 432 0. 6792278 52 429 0. 6766849 4433 429 0. 6766849 T rplM ij 1560 429 0. 6766849 ! i 2282 429 l 0. 6766849 ? T 2282 429 0. 6766849 2120 429. T 0. 6766849 429. 0. 6766849 5116 426 ! 0. 6741219 T ii 4169 429 0. 6766849 2368 426'3 0. 6741219 2368 2-0. 6741219 , 1.---.. 2673 426 i 0. 6741219 700 i 426 i 0. 6741219 $ 5553 426 0. 6741219 atp 5553 3, 426 t 0. 6741219 ? atpC 2187 426 i 0. 6741219 ; _ 3332 426''0. 6741219 4518 426 j 0. 6741219 $ T fi 2894 423 ? 0. 6715386 1 2894 423 0. 6715386 1653 423 0. 6715386 1 i 661 $ 423 ! 0. 6715386 542 420 i 0. 6689348 5130 420 1 0. 6689348 0. 6689348 1 $ 5465 420 4935 T 420 3 s L rpsF 4935 420 0. 6689348 850 420 0. 6689348 2225_ 417 _ 0. 6663104 4874 1 417'i 0. 6663104 . _. _______. . _... _____.. _ _.. . _.... __. __.. _ ______. _. . _., D663104 417 _ 264 417 0. 6663104 3962 417 0. 6663104 5182 414 0. 6636651 1353- _414 0. 6636651 1353 414 0. 6636651 868 414 $ 0. 6636651 28 0. 6636651 1 '1353 414'. 0. 6636651 T 3 2192 414 J 6 16t1 3 3289 414'0. 6636651 3 T $ 4256 i 414 X 0. 6636651 ! rplP 3558 3 414 0. 6636651 4256 414 0. 6609989 J 3558 4 0. 6636651 ? 67 1----0. 6609989 1 ) 5300'411"0. 6609989''cycB') 276 411 0. 6609989 3960 _ _408 ; 0. 6583116 1203 408 0. 6583116 5569 ! 408""j 0. 6583116 rnpA 4427 408 T 0. 6583116 sspB 1129 408 3 0. 6583116 --w t 0. 6583116 1645 i 408 ; 0. 6583116 1645 33 408 3 0 6583116 1659 f 408 0. 6583116 1645-ZO 8-,,'0. 6583116 4764 405'0. 6556029 fur -4764-0. 6556029 fur 778 405 ? 0. 6556029 3 474 405 j 0. 6556029 474 405 0. 6556029 5404 3 405. 3 0. 6556029 398 ! 405 r 0. 6556029 2016 $ 405 3 0. 6556029 3 | 2016 405 0. 650121 1 -99 0. 650121 5144 399 0. 650121 1 _ 3 2827 399 j 0. 650121 i ! 5543399 0. 650121r"-- 1 ---399 3674 399'0. 650121 399 0. 650121 3674 399 T 0. 650121 3674 399 0. 650121 1358.. V 399Tw_.. _. _i_. _ 0. 650121 .'. . .-.. ____. . _ r 396 ; 0. 6473475 1358 1 399} 0. 650121 2706 i 396 1 0. 6473475 ! 1250 1 396 1 0. 6473475 1 aprl $ 710 l 396 4 0. 6473475 I gloA2 3788 396 ! 0. 6473475 apri 710 396 0. 6473475 ! ? 2375 396 j 0. 6473475 5195 3 396 ; 0. 6473475 33 l--4405 1 396 1 0. 6473475 2605 i 396 j 0. 6473475 446-396 0. 6473475 l 3904 $ 396, 0. 6473475 2605 396 0. 6473475 3 5347 T 393 i 0. 6445519 3-=2 4 393 0. 8445519 rpsH 4249 393 0. 6445519 i rpsl T 4125 3967 _393_ _ 0. 6445519'_ _ __, 2722 393'O6445519 5328 ? 390 i 0. 6417342 -4240 f 390 0 6417342 i rpsK 3967 393 0. 6445519 f 2722 F 393 ; 0. 6445519' i'i 2722 393 0. 6417342'secG .......... 1817 ì 390 0. 6417342 > . _. ___. __ _ .. _v.. 4237 _t _ 0. 6417342 _ _ rplQ T----0. 6417342 secg 1817 390 0. 6417342 432 390 0. 6417342 _, __',",. --0. 6388941 1581 387 0. 6388941 ? sdhC ! 3813,'387 0. 6388941 !"''iscU""j 1581 387 0. 6388941 sdhC | 3021 387 i 0. 6388941 1 $ 4383 T 384 $ 0. 6360315 T 4392 i 384'0. 6360315 T 3021 387 ; 0. 6388941 Y i 4383 i 384 0. 6360315 ; I 4392 384 0. 6360315 2446 J384 J 0. 6360315 3906 M 867 384 ! 0. 6360315 e 3869 384 0. 636031 Ei 2i 16-0-384 0. 6331462 i 3041 381 i 0. 6360315 v t t 867") 384 ! 0. 6331462 3 4731 381 3 0. 6331462 i panD _ 1355 381 1 0. 6331462 3041 381 0. 6331462 . _.... _. _ . _ 5339 381 i 0. 6331462 880 381 0. 6331462 591 381 i 0. 6331462 T J 1095 381 0. 6331462 T $ (_. _ 591V__ _. _381_.. _.... ___E ___. 6331462 i-_. _... 1518 38 1 0. 6331462 170 381 i 0. 6331462 170 381 0. 6331462 3123 378 0. 6302381 4424 378 0. 6302381 378 0. 6302381 3_17_8 378 ; 0. 6302381 #.. _....... _.. ___...... _...... _... 991 378 X 0. 6302381 4059 H-, s Z- 4059 378 ; 0. 6302381 I . 5381 378 i 0. 6302381 908 375 T 0. 6273069 908 375 g 0. 6273069 0 0. 6273069 2490 375 0. 6273069 $ 680 375 0. 6273069 ! i j 2753 ! 375 0. 6273069 j J 1456'"'375'"0. 6273069'" cheY"" 3012 12-375 0. 6273069 4076 375 0. 6273069 t 4315 375 i, 0. 6273069 mvaT 3439 372 0. 6243525 folX 4268 372 0. 6243525 í rpsL ? 5333 372 0. 6243525 369 ;. 369 0. 621374 1 ; 5533 369. 0. 6213746 ! _ _ _ __' 5533 369 0. 6213746 1541 T6 9 0. 62137416 '4253"'"369 i 0. 6213746 ! rp) N' 3833 i 369 0. 6213746 '"1149"'--ggg---r"'Q. 6213746""1 1149 369 0. 6213746 4271 1 3159 0. 6213746 4276 t 369 ! 0. 6213746 w sec,- 1582 J 369'0. 6213746 I sdhD 4276 369 0. 6213746 sece 166 366 0. 6183732 33'"366' ! 0. 6183732 f i 1842 T 363 i 0. 6153479 t,-i 378 t 363 0. 61 53n9 T t 3203 363 a 0. 6153479 1842 1 0. 6153479 3203 363 0. 6153479 1076 363 j 0. 6153479 J vvv oP-2s 630 1 363 i 0. 6153479 ["613'360 0. 6122987 360 0. 6122987 2901 360 0. 6122987 2606 360 ; 0. 6122987 l q N 4324 360 ! 0. 6122987 4324-360 1492 357 0. 6092253 1492 357 0. 6092253"" vvw. 2741 357 i 0. 6092253 rplT 2666 357) 0. 6092253 -n Jv-vv 1-426 357, 0. 6092253 4241 357 1 0. 6092253 ! rpsM . .. ___ _ 2960 357'0. 6092253 pilZ 871 357 0. 6092253 phhb 2 *. 2 vvvvvvvvvvvi 1995 357 0. 6092253 2667 354 T 0. 6061275 0. 6061275 354 0. 6061275 582 354 1 0. 6061275 folB 1568 ! 354 $i 0. 6061275 582 354 0. 6061275 folb 2736 j 354 i 0. 6061275 wT 39 0 SO51275 2736 0. 6061275 r 1349 1351 j 0. 6030052 351 0. 6030052 665 T 351 ! 0. 6030052 4247'""351"'10. 6030052' rp) R 3 320 i 351 ! 0 6030052 0. 6030052 rpIR 0. 6030052 I rplS 3835 351 0. 6031DO52 3835 351 0. 6030052 1228 rv __ g5'_ ______0. 6030052 yA-___. _____. _ $ 1228 $ 351. 0. 6030052 T _ _ _3 1228 351 0. 6030052 729 348 ; 0. 5998581 729 348 0. 5998581 570 348 0. 5998581 1720'"348 0. 5998581"'pscG t t 4711 348 0. 5998581 i 3684 J 348 0. 5998581 4702 1 348 0. 5998581 348 0. 5998581 1917 348 0. 5998581 2190 345 0. 5966861 -. : Z62-. l"- 345"'0. 5966861 J ! 3688 345 0. 5966861 2780 345 0. 5966861 3046 345 0. 5966861 4739 345 0. 5966861 ! 4739 j 345, 0. 5966861 $ 1398 342 0. 5934889 t 128 342. 0. 5934889 r_ o__.. __ 4575 342 0. 5934889 2456 342 0. 5934889 _... ; __. __.... _.. __ 342_.. __.. _. _.. i _. __... ____. 27 342 0. 5934889 339 0. 5902664 -L s i 5288 339 0. 5902664 glnK 5902664 fdx2 3809 _ ~~''4- __ __ __, ¢ ! 3809 339 j 0. 5902664 T _, _' 3809 1055 339 0. 5902664 J055J339 1722 339 0. 5902664 pscl 3367 339 0. 5902664 565. _... ___ 339.. _.. ___. _ 0. 5902664 2608 1 336 0. 5870183 'i 2608 336. 0. 5870183 T 1965 T 336 i 0. 5870183 644 336 0. 5870183, 825 336. 0. 5870183 ow 1114 336 ! 0. 5870183 i -- 5275'i 336 1 0. 5870183 5067 336 0. 5870183 hisE 333 0. 5837445 -9 t '4258 333 + 0. 5837445 rplV 4990 333 0. 5837445 io s 1323 1 333 i'0. 5837445 5406 333 0. 5837445 7 3979 ti 333 0. 5837445 .......... 3140 330 i 0. 5804447 5804447 3275 330 0. 5804447 1540 330 i 0. 5804447 3275 330'0. 5804447 - 4698 1 330 0. 5804447 _ 1702, 330 0. 5804447 {3040 330] 0. 5804447 t 939, 327 _0. 5771188 j 939 327 0. 5771188 1925 T 327, 0. 5771188 19251""327'0. 5771188 1 _a 4577 _-.. _.. _327. _. ___. _... _. _0. 5771188 _. __... _ w.... _. ____ 4577 1 327'. 0. 5771188 3533 327 0. 5771188 .......... 2694 327 0. 5771188 327 0. 5771188 trxa 617 327 0. 5771188 1533 1 327 0. 5771188 4164 T 327 0. 5771188 $ 4164 327 0. 5771188 z . __. __________.... __. ___. _. 3351 _. __ 32_4 _ ; 0. 5737665 894 324 0. 5737665 I. _ ;,. - _. __, 1362 324 0. 5737665 [802'324' ! 0. 5737665 j' 802 324 0. 5737665 = 4853 i 324 0. 5737665 fis 38, Ci 324 0. 5737665 1123 321 0. 570387" 1 1123 321 0, 5703877 -6 7-6 321 0. 5703877 3502) 318 i 0. 566982 j ! 1038 18 i 0. 566982' 15 318 0. 566982 2422-315------0. 5635494 3854 315 0. 5635494 6 610 315 ; 0. 5635494 prtN 4252 315 0. 5635494 PIX 2658"315''0. 5635494 1830 315 j 0. 5635494 1 315 0. 5635494 922 315 0. 5635494 ! J 2759 315 0. 5635494 2759 315 ; t 5227 315'" ! 0. 5635494 4264 312 (0. 5600895 risk 3260 312 1 0. 5600895 4568"312''j0. 5600895' !"'rp ! U"""1 742 309 0. 5566022 _ 2937 309 ! 0. 5566022 2646 309 1 0. 5566022 nuoK 979 309 0. 5566022 i 4463 309 0. 5566022 4452 309 0. 5566022 2174 309 0. 5566022 309 0. 5566022 786 306 0. 5530873 3142 306 0. 5530873 4674 306 0. 5530873 3347 306 1 0. 5530873 -2161 306 0. 5530873 4230 j306 ! 0. 5530873 I pchB 2245 306 0. 5530873 7-8 9-306 0. 5530873 4250 306 0. 5530873 857 306 0. 5530873 857 306 0. 5530873 bola 3390 303 j 0. 5495445 ! 33=90 303 0. 5495445 j'32M, L303r 0495445J" 2738 303 0. 5495445 hima . 5459736 r IW. 3278 300 0. 5459736 I 2029 ; ____.. ___.... 4261, 300. 0. 5459736 rplW'. 2029 l ; 300 0. 5459736 _' 2029 300 0. 5459736 i 9 s. S 4141 ! 300 0. 5459736 3202 oo 0. 5459736 2799 300 0. 5459736 1 ,'2460, 297 0. 5423744 i s , 1929 i 297 0. 5423744" j 709 J 2970. 5423744) 297 0. 5423744 3662 # 294 i 0. 5387467 4419 294 0. 5387467 1 X 4419 294 1 0. 5387467 1 AsL X 4386 _ 2'4 05oS7467 < 1295 294 ; 0. 5387467 _ __ _ _ 1295 294 1 0. 5387467 w n w_ 490 294 1 0. 5387467 900 _ 291 1 _ 0. 5350903 f 1295 294 0. 5387467 369 291 ; 0. 5350903 369 1 291 t 0. 5350903 4642 291 0. 5350903 4642 291 0. 5350903 3338 291 ! 0. 5350903 4638 288 0. 5314048 o__ o a 2143 288 ; 0. 5314048 H r _ 983 288 | 0. 5314048 ~ o< o _ E 131 288 St 0. 5314048 980 285 0. 5276901 3634 285 ! 0. 5276901 ! 3161 285 0. 5276901 1_ himD _ i 4298 285 ; 0. 5276901 " 2183 285 T'0. 5276901 3998 282 ! 0. 523946 3998 282 0. 523946 3051 282 _ 1 0. 523946__ 124 282 r 0. 523946 e 2292 < 2292 282 0. 52394. f6 2292 282 0. 523946 ! 3940 282 0. 523946 4176 j 282 0. 523946} t'... W # A _ { 1E41 279 1 0. 5201722 3033 279 i_0. 5201722 ; 1 3033 j 279, 0. 5201722 1, m < 1988 279 0. 5201722. _. _Rqql Dup i 2485 1 279'0. 5201722 1 X 1 4060 i 279 0. 5201722 j, 4060 279 ; 0. 5201722 2723 279 1 0. 5201722 L 05201722 1 4018 1 276 1 0. 5163685 x _ : 'if 276 0. 5163685 ç 0. 51i 909 276_. __. _.. __w__ . 51G3685. ___.. ___. ______ __ _. __. O _, _ _^. e ; w 4259 276 0. 5163685 rpss 68 276 0. 5163685 954 276, 0. 5163685 1852 ^ 276 í 0. 5163685 _1298. : 1298. 276. 0 5163685 1298 1 5148 1 273't 0. 5125346 734 273 i 0. 5125346 4466 273 ; 0. 5125346 2487 273 4 0. 5125346 2487 273 0. 5125346 818 * 273 i 0. 5125346 wi 270 50857DQ _< 2182 270 0. 5086704 1447 i 270 0. 5086704 4033 270 4741 f 270 i 0. 5086704 ß rpsO __-, 0. 5047755 4870 267 3413 i 267 i, 0. 5047755 4254 ii 267 i 0. 5047755 rpsQ 874 267 0. 5047755 1963 267 i 0. 5047755 2805 264 ; 0. 5008497 2805 264 > 0. 5008497 L -3601 264 0. 5008497 3085 264 0. 5008497 986 264 0. 5008497 1__il 264 0. 5008497 1508 261 0. 4968928 712 258 ; 0. 4929045 1968 1 258 ! 0. 4929045 i 2663 1 258 <9i s 2663 ! 258 J 0. 4929045 j 1719 258 1 0. 4929045 pscF ir 5559 258 ! 0. 4929045 atpE 1233 258 0. 4929045 S JAO 384 i 258. 0. 4929045 4567 258 0. 4929045 rpmA 2737 J 258 i 0. 4929045 S 635 1 255 i 0. 4888847 S 5129 255 l 0. 4888847 grx 1394 255 E 0. 4888847 I 1394 r 255 i 0. 4888847 4611 255 0. 4888847 53 255 0. 4888847 i 2031 255 .. . 0. 4888847_ 2031 255 0. 488884 3245 j 255 0. 4888847 min__ 3917 252 0. 4848329 moad 1063 3---252 0~4848329 t 1063 252 0. 4848329 -F -3745 252....... 0. 4848329 rp. sft 362 252 i 0. 4848329 i3 fdx1 1006 252 0. 4848329 4944 49 0. 4807491 j 493 0. 4807491 5068 5068"249'j'"0. 4807491 jatAJ 3632 249 0. 4807491 4782 246 0. 4766328 2429 246 0. 4766328 3 1711'246 0. 4766328' t 2297, 246. 0. 4766328 ! 2297 246 0. 4766328 ¢ 738 246 0. 4766328 243 246 0. 4766328 4377 243. 0. 472484 ! 1431 J 243 ! 0. 472484 ; rsaL 1431 243 0. 472484 rsal i 4357 i 243 0. 472484 ; i 2149 243 ; 0. 472484 i 4357 243 0. 472484 0. 472484 i--T849-,,', 243 0. 472484-' 1869 240 3 0. 4683022. ---.- 1564 Z 240, 0. 4683022 i (3334 (. 240 E 0. 4683022 3334 j3_ 240 i 0. 4683022 1 1743 240 0. 4683022 2621 237 l 0. 4640873 i, 1592 237 0. 4640873 5316 237 0. 4640873 rpmb '2966 J 237i 0. 4640873 1 acpP 2845 234 0. 459839 t, 234 i 60 234 0. 459839 60 234 0. 459839. -2703 234 0. 459839 2703 234'i3 0. 459839 | 505 231', 0. 455557 w 648 f 231 i 0. 455557 I rpsR . 455557 _ 648 231 3 0. 455557 t _ 3 231 h 0. 455557"T -2.. 3.. l,.-. 0. 45555. 7. 11.-.- ! 1404 228, ... : 0. 451241 J , o___, f 4 228 1 0. 451241 125 228. 0. 451241 39 j 228 ; 0. 451241 _. .. T 2992 228 0. 451241 4359 228 0. 451241 2021 2 5-0. 4468909 3530 i 222 i 0. 4425063 t 2453 i 222 0. 4425063 3j 0. 4425063 i 1 1855 222 0. 4425063 3612 i 222 4 0. 4425063 0, 4425063 t 222 t 0. 4425063 t- 3b3i 222 0. 4425063 3237 ! 222 0. 4425063 ! j 2785 j 219 0. 4380869 I 222 0. 4425063 3501 i 219 i, 0. 4380869 219 0. 438086§---F- 2412 219) 0. 4380869 j" 2619 ! 219"J 0. 4380869 j infra 219 0. 4380869 i 4306 219 ! 0. 4380869 X 4826 219 E 0. 4380869 38 216 ; 0. 4336324 j j 38 1 216} o 4336324 t 1 4737 3 216, 0. 4380869 4737 216 1 0. 4336324 579 i 216 ii 0 4336324 I rpsU 579 1-216 0. 4336324 717 213 0. 4291427 3049 213 0. 4291427 rmf i 5526 3 213 i 0 4291427 1 ! _ _ 460 213 0. 4291427 200 213 0. 4291427 ! 2763. . __ 210 0. 4246174 1548 210 0. 4246174 2170 210 0. 4246174 456. _ 210 0. 4246_17_4_ W _ 4823 _ 210 0 4246174 456 ?"210 ; 0. 4246174 1 1 2668.. ^__ 210 ! 0. 4246174 109 I""210 f 0. 4246174 j'""960 f"""''"210''0. 4246174"""T'"'""""] 1159 210 0. 4246174 [. 1159'"J"'210 ! 0. 4246174' ! 3266' : 210" ! 0. 4246174"T"capB"" ! 627 i207 0. 4200562 ! ! 5403) 207) 0. 4200562 4077 j, 207__i 0. 4200562 _ yA .. 1718 204 0. 4154588 psce 20 0. 410825J 380 1 0. 410825 ! 553 201 0. 410825 3808 1 201 1936 201 0. 410825 4738 198 0. 4061544 1230 198 0. 4061544 ! 3520 195 0. 4014469 52 195 0. 4014469 5480 1 195 0. 4014469 2-742-1 195 0. 4014469 2808 192 a. _ p. 396702 ; 4255 i 192 i 0. 396702 rm 1747 ! 189 ! 0. 3919195 f 90 5 186 0. 3870991 3371 ! 18E . = 0. 38709 1 258 ; _186. F 0. 3870991 2 186 0. 3870§) l i 0. 3870991 284 183 0. 3822405 2970'183 0. 3822405 rpmF 1 0. 3773433J 180 0. 3724074 1478 j 177 ; 0. 3724074_. _ 5408'177 ; 0. 3724074 ; 3572'_177 : 0. 3724074 424 177 0. 3724074 2186 171 0. 3624'178 4537 i 171 i 0. 3624178 J 2501 1 168 j 0. 3573635} j 2883 168 0. 3573635 j 1177 1 168 1 0. 3573635 pue ["5351 168 T 0. 3573635 5350 168 0. 3573635 168 0. 3573635 _.. _.. _ 3719 162 0. 3471344 5482 162 0. 3471344 311 159 0. 341959 _ 161 ! 2311 ; 159 0. 341959. S t 567 ; 159 ; 0. 341959 i i , _ 161 _ 153 0. 3314847, ___ _i 161 153 0. 3314847 3990 153 0. 3314847 i 3990 153 0. 3314847 3370 147 0. 3208437 1 135 141 0. 3100333 5276 141 0. 3100333 1664 1 141 0. 3100333 _.. . 5570. 135 0. 2990509 i rpmH 3144 1 120 0. 2708239 '"3144" !'''"120"""J0. 2708239'"'"'" ! 442 ! 117 0. 2650435 4242 2 117 i 0. 2650435 rpmJ 1632 90 0. 210914 kdpf 1985 i 72 i 0. 1726306 I pqqA R [A polymere beta* cai _"F.,. _ .. : Y-, c, e..... t> >xr""C,, i" :'. g °, t,. t.., ..."''.. t.. r,. a>,........ : .. . r : =,.... Z > , S u DNA_-d_irec_ted_IRNA pol merase beta"chan> ,'DNA-directed RNA polymerase beta chain ! DNA polymerase III, alpha chain ribonucleoside s, large chanM ; valyl-tRNA synthetase ; organic solvent_t_oIe_rance protein OstA, precursor, , m... _. _. _.,. _. _..... _. _..... _ __. : DNA yrase subunit A_ _,-. _. _.. _.. _ _. __,. _____... _. _, _. _. __ secretion protein Sec_A DN rase sub _^ ___ _ _ __ _ _. _ ; tfe'ucyl-tRNA synthetase . _-.. _.. _, ... _. ___.., . _. _. _.. . _ < cA___ ~__-_ g e nv'i NA 511'bdi <-_ _ wow wwR~_w_. w__w _w ___tw_ £aconitate h dratase 2 {DNA topoisomerase I translation initiation factor IF-2 'cell division protein FtsK _ _. _. T_. _,. _ _ : .. iLonprotease ; a . robable outerelembrane protein F-P J DNA ligase phenylalanyl-tRNA synthetase, beta subunit probable chemotaxis sensorleffector fusion protein topoisomerase IV subunit A primosomal protein N' _. __.. _ __ __ _ __ _w_ _ _ v. ____ __w ___ __ ___ _ hypotheticaf protein hypothetical protein , elongation factor G lelongation factor G pojyrtbonucieotide nucieotidyitransferase . . . . .-.- ! glycyl-tRNA synthetase beta chain DNA polymerase subunits gamma and tau methionyt-tRNA synthetase J ATP-dependent DNA helicase Rep hypothetical protein jcytochromeC-type biogenesis prpteinC ! tmwS_rOtein CcmF probabtechemqtaxist ! besut tHNA sEthetcse probable heat shock protein (hsp90 family)... _.. ! heat shock Drotein HtpG _ E iprobable acetyltransferase itopoisomerase) V subunit B j t a r _w. _w _} % _ ______w_____fl_ P__ __9_ww~__~_ _ _ _ hypothetica) prqte) n j secretion protein SecD heat shock protein HscA robable binding rotein compon_ent of ABC transporter __ rhate aminotransferase *__ transport protein MsbA _ ' GTP-binding protein LepA probable acyl-CoA dehydrogena_s_e _ _ _ _ arginyt-tRNA synthetase.'- ! _arginyl-tRNA_synthetase _ probable acetyltransferase ; p_enic''_.. g. ! conserved hypothetical protein ! probable oxidoreductase , _. iacetolactate synthase larqe subunit isingte-stranded-DNA-specific exonuciease RecJ . prolyl-tRNA synthetase iprolyl-tRNA synthetase urease alpha subunit ttyEria mesis pro ñ i il ~~~ 30S ribosomal protein S1 ! 130S ribosomal protein Sl Igluco_se_-6-phospha_te. isomerase--.. _... ____. _.. _.... _.. _. _. __.. _-__... _... ___. __.. _. __.. _.... _... _. _.... , __. _... _. _. __.. _....-_.... w__.. __. __. ___. ___... __. __.... __... _.. _.... _.. __. _.. _..... ______... __.. ___.. ... _. _.. __ glucose-6-phosphate isomerase hypothetical protein GroËL protein CTP synthas_e _ __ _ _ Cbabsynchemotaxie arylsulfatase conservedjhypothet) cajjp j i . gap hypothetical protein probable carbohydrate kinase phosphoglycerate mutase conserved hypothetical protein chromosoma ! repfication initiator protein DnaA J ATP synthase alpha chain hypothetical protein H g. _ _ S H apolipoprotein N-acyltransferase - hypothetical protein xytuiose kinase ! general secretion pathway protein E ^ M v_ __ _*w__ sodium/proton antiporter NhaB _ _ _ _ _ _ i probable colicin-like toxin probabtecojicin-iike toxin') methyinDaJonate-semiaidehyde dehydrogenase. 1""""""" wmerase sigma-54 factor probable transporter N utilization substance protein A hypothetical protein probable flavin-binding monooxygenase conserved hypotheticål protein hypothetical protein h pothetical rotein probabie amidase"] outer membrane protein OprM precursor probable amidase RND divalent metal cation efflux membrane fusion protein precursor _ § Glu-tRNA (Gln) amidotransferase subunit A pyruvate kinase 11 probable Mg transporter MgtE Glu-tRNA (Gln) amidotransferase subunit B UDP-N-acet ly muramate_--a_lan_ine ligase w -. ^-.. __ I lli, ooamide dehydroqenase-glc probable transporter (membrane subunit) conserved hypothetical protein robable outer ; probab) e ferredoxin -.-....-.--....-.-.........-..... EglutamT y ; ine senthetase ___... ___ =nitrile extrusion protein 2 ! Probable amidase '9 Pi"-I ! i° !.' ?"shydrpgenase *""' soluble pyridine nucleotide transhydrogenase probabfegjycerafdehyde-S-phospha"'.--- cysteinyf-tRNAsYnthetase "'-- jexodeoxyribonuctease VJ ! targe subunit'"----.-..-.... UDP-N-acety) muramoy) atanyD-gfutamy2, 6-djam'""""" ATP synthase beta chais signal recognition particle rotem Ffh adenylosuccinate lyase _ _ _ signat recognitiqn partide rec" ! {probabte 2-is 'probable 2-isopropylmaiate s nthase , . _, conse_rved hypothetical protein''"""''-- protein . h othetical rotein probable dicarboxylate transporter biotin carboxylase"" ; tryptophanyl-tRNA synthetase UDP-N-acety) muramoy ! atanine-D-g ! utamate ! igase , NADH dehydrogenase I chain F" probable aldolase I hypothetica ! protejn''"""" two-component response reg_ulator PiIR _ phosphoglucosamine mutas aminopeptidase P probable cytochrome P450 secretion protein SecY hypothetical protein hypothetica) ! probable MFS transporter hypothetical protein jprobabte MFS transporter porin 0 precursor 3 B-bandO-antigenpoiymerase"j conserved hypothetical protein probabte UDP-gjucose/GDP-mannose dehydrogenase WbpA *'" probabte binding protein component of ABC maltose/mannitol transporter C4-dicarboxylate transport protein 'conserved hypothetical protein conserved hypothetical protein A, TflIB roteW _ _ _ _ _ _ conserved hypothetical protein jTotB protein"''' (hypotheticat protein -----j ; adenytosuccinate synthetase '""""""*'''"'' ! peptidyi-prolyi cis-trans isomerase SurA ., _. ___. _.... _... _........ __. _........ _.. _. _......... _.. _... _.. _. _. _.. _. __.... _.... __... __.. __........ hvpothetical Drotein Y _ glutamate-1-semialdeh de 2 1 Vamnom. utase........ _.. _, ____. _.... _... hypothetical protein glutamate-l-semialdehvde 2, 1-aminomutase h otheticalrotein -... _.. _. _.. _..... _.-_... _.. _. __... __... _.. _.. _... ___.. _. _.. _........-. _.... _.... _...-... _........ _.. _...... . _. __.... e......... __. __. _. _.. _.. _... _. _... _... ____r.. __.... ; -.. Yp p : 3-oxoacyl-ac i cy _arrier protein synthase I I ''------------------_---___.... _ hypothetical protein ; glutamyl-tRNA reductase "" ""°°--------. __. __.. _........ _. _.... ___., , 3-oxoacvl-acvl carrier protein synthase 11 me 1 carbox vin Itransferase, glutamyl-tRNA reductase 'UDP-N-acetylglucosamine 1-carboxyvinyltransferase hypothetical protein 'hypqtheticai protein-.---...-.-....- ; transcription termination factor Rho Ecell division protein FtsA ihypothetical protein __ _ __. _.. __.-_. ___....... _. _. __.. _. _. ___...... _.. _....... _... WH. Hy- i_conserved hypotheticai protein _ _-- ---3 ''conserved hypotheticaf protein II. L. 1I'.. I-"'"""'' ! nbonucieoside reductase, small chain probable glycosy ! transferase WbpJ, hypothetical protein laspartate kinase alpha and beta chain O-antiaen translocåse 0-anti en translocase hypothetical protein i . hypothetical protein probable transporter (membrane subunit) probable transporter Cr-jr-i : Er-n-e's-ubunit)""'*"""-'--"'--'"",--"-"",-,--"-"-",",""-,-* "",---"""----,--", *----,--,------"---"-, fconserved hypothetica) protein j probable MFS transporter conserved hypothetical protein ! probabie hyd ro ! ase ! hypothetical protein GTP-binding protein Obg . probable FAD-dependent monooxygenase J - p. p p--.. __ -M _.. _ hypothetical prOteln _ _rwrwrrrr~~~~'~rr__________ _S hypothetical protein phenazine biosynthesis protein PhzC probable type 11 secretion system protein probable MFS transporter conserved hvpothetical Drotein ~ _ ____"________ _ _> _r_ __^____ ___~__ probable cytochrome b probable cytochrome b hypal protein--- probable cytochrome b hypothetical protein DNA/pantothenate meta bolis membrane protein OpdE membrane protein OpdE two-component sensor probable acyl-CoA thiolase - M 7thase amno 7 oxononanoate s nthase lconserved hvpothetical Drotein ! conserved hypothetical protein cei) division protein FtsW hypothetjca) protein ! probabte FAD-dependent monooxygenase conserved hypothetical protein probable MFS transporter probable acyl-CoA thiolase _ypothetical ypothetical protein 11-deox--lulose 5-phosphate reductoisomerase methionine adenosyltransferase t-cell division protein FtsZ __. ¢_ypothetical protein _ prpbabje pyndoxai-phqsp enzyme"""'"' acetyl-CoA acetyltransferase ) probable mdybdqpterin biosynthesis protein MoeB------ hypothetical protein (hypothetica) protein----. ! hypothetical protein Yp p : _. _ 'h othetical rotein __. __... __.. ___. _... __.. _.... . v. _^. .. _. _. _. ^......... _.. ___. ___. _.......... _..... _.... _... _. __.. _. _... _. __....... _. . _. _. _... __.. _..... __.. ! fsuccmy-Asyntheta""'""'" Y Y _ , probable hydrolase lhypothetical protein probable al-CoA dehydrogenase .......... phosphoglycerate kinase _ hypothetica ! protein hypothetica ! protein"" hypothetical hypothetical protein probable petidic bond hydrolase__y phosphoglycerate kinase hypothetical protein probable precursor probable peptidic bond hydrolase probable multidrug resistanc conserved hypothetical protein probable acyl-CoA dehydrogenase x general secretion pathway protein L probable permease of ABC transporter erythronate-4-phosphate dehyÇse rV w P Y 9 conserved hypothetical hypothetical protein probable acyl-CoA thiolase conserved hypothetica) protein'"""J lipid A-disaccharide synthase , LPS biosynthesis protein WbpG hypothetical protein probable methyltransferase 2robable acyl-CoA dh conserved hypothetical protein conserved hypotheticai protein conserved hypqtheticai prqtei n still tochrome c oxidase, subunit II v cytochrome c oxidase, subunit 11 conserved hypothetical protein riboflavin-specific deaminase/reductase probable giycosyttransferaseWbpH-- . gtycinecjeavageystem protein T2 muconate cycloisomerase I , glycine cleavage system protein T2 .. ----. _ ___ hypothetical protein ___ _ glutamate 5-kinase conserved hypothetical protein hypothetical protein 'conserved hypothetical protein , hypothetical protein I'hypothetical protein conserved hypothetical protein ,--. .. _. __. rod sha e determmm rote n g , _co oi dehy ge ase Zn-d pe dent) _ _ _ _ __ _ conserved hypothetica ! protein-.--.-.-..----.-...... -.. . . , hypothetica) protein"'''""'"--"--""--""-"- : _hypoth_etical protein _.... _... _... _ _. __ 'chain release factor 2 r., hypothetical protein conserved hypothetical protein thypotheticai protein _ _ _ ____ __ conserved r) ypotheHcaj protein--...-.-. -.... hypothetical protein conserved hypothetical protein 3 pho õserin an iñotran fera é ~ ~ ~ ~ ~ ~ ~-~~~~~~~ ~6 , peptide chain release factor 1 phospho-N-acetylmuramoyl-pentapeptide-transferase i thypothetical protein iprobable aminotransferase WbpE ~~~~ ~ ~ ~ ~~ ~~ ~ -~ ~~~~~~ hypothetical protein phospho-2-dehydro-3-deoxyheptonate alll o ase O methyiguanine-DNA methyltransferase .' probable transcriptional regulator ! phospho-2-dehydro-3-deoxyheptonate aidoiase ; f UDP-N-acety glucosamine--N-acetylmuramvl-(pentapeptide) pyrophosphoryl-undecaprenol N-ac_y giucosamine tr were , uroporphyrinogen decarboxylase ; hypothetical protein _ jhypothetK ; a) protein' he tos rltransferase I conserved hypothetical protein fructose-1, 6-bisphosphate aldolase type 4 fimbrial biogenesis protein PilM probable UDP-N-acetylglucosamine 2-epimerase Wbpl- phosphoribosylaminoimidazole synthetase UDP-3-0-r3 ~ 1ucosamine N-acvitransferase yL iquinolinate synthetase A probable alcohol dehydrogenase (Zn.. dependent) . _ conserved hypothetical protein. conserved hypothetical protein _ g dTDP-D-glucose 4, 6-dehydratase out-er membrane protein OprF precurso hypothetical protein lconserved hypothetical protein jtransjocation protein jntype"'"j T_ _. __ To) __. _.. _.. _... rTolA protein __~ p __ conserved hypothetical protein acetyipodyamine ãmiiiohydroïase conserved hypothetical protein conserved hypothetical protein t ; RecA _. ..... _-_... _.. _..... __. _ theptosyltransferase 11 ____ ls P=--- conserved hypothetical protein t ng protein MreB _ __ _ g rod shape-determining protein MreB hypothetical protein hypothetical protein Ste ydrodipicolinate succinyiase _ ____ __ ___ +_. _ w... __. _. __ _ tMat omponent of ABC transpo ter _ ___ tetrahyd rod ipico linate succin) Lase., __. jDNA potymerase i)), deita subunit'"II'IITIIZ'" hetrahydrpdipiconate su"""'"*'" iprobab ! e binding protein cqmppnent of ABC transporter ! hypotheticat protein'j Sconserved hypothetical protein lprobable binding protein component of ABC transporter _ n p tei _ _ _ _ _ _ 'O-sialolycorotein endopeptidase y. T.... ... . _ .,..,. ^.. _ _. _. ... w_,-_ ... ...... ,, , ferrochelatase-.. ; conserved hypothetical , iconserve hypotheMcaprotejn"""" ; probable aminotransferase tprobable transmembrane sensor jUDP-N-acetylpyruvoylgiucosamine reductase ,'hypothetical protein' iacetoin catabolism protein AcoB conserved hypothetical protein probable oxidoreductase Nw, ,., , W "''''-"'' hypothetical (giycosyltransferase WbpL _ hypothetical protein probable transposase flagella motor switch protein Fui6 hypothetical protein probable transposase P P probable transposase probably robable trans osase phenylalanyl-tRNA synthetase, alpha-subunit _ _ probable permease of ABC transporter hypothetical protein hypothetical protein fructose-1, 6-bisphosphatase conserved hypothetical protein ___ probable ATP-binding component of ABC transporter conserved hypothetical protein hypotheticat protein""''"''"'''""j probable 0-methyltransferase partate carbamoyltransferase jg) ycera) dehyde 3-phosphate dehydrogenase'" jconserved hypothetical protein D directed RNA polymerase alpha chain _"rv. probable pyruvate dehydrogenase E1 component, beta chain tetraacyldisaccharide 4-kinase rod shape-determining protein MreC D-lactate dehydrogenase (fermentative) sulfate transport protein CysA ' " pyridoxal phosphate biosynthetic protein PdxA probable transmembrane sensor =DNA polymerase lil, deita prime subunit' L-aspa iginase I hypothetical protein probable bacteriophage integrate tipoate synthase J hypothetical protein (y othetical protein _ p ion nscriptional conserved .. __. _.-otheticaj...... protei_...... _.... ___.. __...... _.. _...... _....... __. _. _........ _... ___.. _... _.. ____.. _..... _........ __... _.. _. _... ___. ___.. _. __........ __. __... _. _. _...... _. _. _......... __. _.. _. _.. __... ___.. __... _... __ . hyp p t n _ . conserved hvpothetical protein 'pctaprenyt-diphosphatesynthase *"" j hypotheticat protein ; hypothetical protein' hypothet'. thase Shpothetical proten-__ hypothetical protein . conserved hypothetical protein hypothetical protein __ ___ probable enoyl-CoA hydratase/is_erase_ ____ _ _ _ 'thiamine monophosphate kinase hypothetica) protein" ical roten ; , hypothetical rotein hypothetical protein hypothetical protein , hvpothetical protein 'p probable serine/threonine dehydratase, degradative 1 seudouridine synthase conserved hypothetical protein hypothetical protein MLee . ribosomal larae subunit pseudouridine synthase C ,,. _, « ___ _____ ____ ~ . h pothetical rotein Ty -, hvpothetical Drotein probable transmembrane sensor probable transmembrane sensor hypothetical protein probabietransmembrane sensor'" p = probable transcriptional regulator nypuUI=cH pTto n _ _ _ _ _ _ _ glutathione synthetase hypothetical protein probabie adhesion protein acetyi-coenzyme A carboxytase carboxyt transferase (a) pha subunit) probabie transcriptiona) regutator probable transcriptional regulator probable NAD-dependent epimerase/dehydratase WbpK probable NAD-dependentepimerase/dehydrataseW" ! probable oxidoreductase WpbB probable transmembrane sensor hypothetical protein hypothetical protein gtycyl-tRNA synthetase alpha chain,, ro ; p bable h ase l-Lyt_-B protein [conserved hypothetical protein probable hydrolase _ - p Y p _. _.. _. _. _. __. ribose-phosphate pyrophosphokinase hypothetical protein conserved hypothetica) protein porphobiiinogen deaminase ! probabte transcriptiona) regutator" ! probable transcriptional reaulator probable lauroyl acyltransferase transcriptional regulator PtxR probable transcriptional regulator probable transcriptional regulator hypothetical protein ____ __ __. _ _---> malonyl-CoA- [acyl-carrier-protein] transacylase maionyt-CoA- [acyi-carrier-protejn] transacyiase"j riboflavin kinase/FAD synthase, conserved hypothetica) protein j conserved hypothetical protein ; probable phosphatidate cytiltransferase '''..-. _. _. _______... _. ___-- hypothetical protein carbamate kinase hypotheticai protein ____ probable transcriptional regulator catechol 1, 2-dioxygenase D-alanyl-D-alanine-endopeptidase ! probable transcriptional regulator l hypothetical protein probabie epimerase.""""""" ; _lipase Lip_C.. w' probable epimerase ranscnptional reguiator __ electron transfer flavoprotein alpha-subunit FdhE protein jFdhE protein hy othetical rotem __TT hyEthetical protein conserved hypothetical protein probable ATP-binding component of ABC transporter .. tprobable cytochrome c _ __ __ zg u I ato r _ _ __ _ _ probable permease of ABC transporter j probable cytochrome c probable transcriptional regulator hypotheticat protein' probabte transcriptiona) reguiator' probable permease of ABC transporter hypothetical protein p obable transcriptional regulator probable transcriptional regulator probabte transcriptiona ! regutator GTP-bindinprotein Era_"Vw---.-_. _. ... . . . ..-_. __. __... _. _. ___. ... ____.. _ hvpothetical protein GTP-binding protein Era pyrroloquinoline quinone biosynthesis protein B probab ! e cytochrome c oxidaseassembjy factor' hypotheticat protein"""'"''"""""'----"------.-..--. hypothetical protein probable short chain dehydrogenase hypothetical protein hypothetical protein hypothetical protein hypothetical protein UDP-3-O-acyt-N-acetyfgtucosamine deacetyiase probabte probable transcriptional regulator _ probable hypothetical protein conserved hypothetical protein probable binding protein component of ABC transporter' Mv dTDP-4-dehydrorhamnose reductase"'--------.---. ... _ _ __ _....... J conserved hypothetical protein probable transcriptional regulator hypothetical protein""" hypothetical protein probable transcriptional regulator probable transferase i _ S probable two-component response regulator p bable transcriptional regulator i _. } probable transcriptional reoulator L hvpothetical Drotein ? cys eine syn hase 8.. _'... .. _. _.., _ ,.... ...... ...... _.-... _.. .. M,. _,.. __. _., _. __ cystine synthase B probable glycosyl transferase fh. __thetica_r - ; prokable_transcriptional regulator, -. 'W----.. __. _. _. _. _ _. ... _... __.. _. . ____.. _. __... _.. _. ...... pra_bable transcrip_tional reg_ulato_r ---------.--m-. __-_., pro iprcbabte transcriptionai reguiator"' : '. probabte transcriptionai regutator"' yprobabie transcriptional regulator _ _ : cytochrome o ubiqui. nqioxidase protein CyoE'"' probable transcriptional regulator ; probable transcriptional regulator 4-hydroxybenzoate-octapreny ! transferase *' p _s_ rotem. _. _, _. . _. ........ , . . _.. _ lprobable ch motaxis protein cons__. _..... _ probable 2-OH-lauroyltransferase probable transcriptional regulator succnyl CoA synthetase alpha chaW conserved hypothetical protein geranyitranstransferase __w____... _... .. __ _. __ . _.. __ hypothetical protein ribosome protein L11 methyltransferase' r glucose-1-phosphate thymidylyltransferase conserved hypothetical rotem _ hypothetical protein dihydrodipicolinate synthase ; meth Itransferase PiIK , _."" M, _ methyttransferase PitK . "'''" ! probable transcriptional regulator conserved hypothetical protein hypothetical protein chromosome partitioning protein P p g rotein S o0J _ _ _ ; hypothetical protein acety !-CoA carboxylase beta subunit élongation factor Ts cell dmsion roten zi A ATP s nthase A chain outer membrane protein Pope lipase modulator protein hypothetical protein probable transcriptional regulator ; conserved hypothetical protein cell division protein Fis mafonate decarboxyfase beta subunit _ ATP synthase gamm . LJI'IHIIHI ! probabie hydrolase h pothetical rotein probabie short-chain dehydrogenase' ! probable ATP-binding component of ABC transporter spermidine synthase h pothetical protein __ _ ' . 2robable ATP-binding component of ABC transporter pro_'I rotein _ _. othetical protein probabie transcriptionat reguiator' !' IIL---"---'- 5, 10-methyiene-tetrahydrofo) ate dehydrogenase/cyc ! ohydro ! ase-...-.--- _qrolase s signal peptidase)---- isignal eptidase I ! hypothetical protein Idihydropteroate synthase conserved hypothet) capoteir) *""t probable potassium channel isopentenyt monophosphate kinase""'I hypothetica) protein"'"' hypothetical protein tncotmate-nucleotide pyrophosphorylase, w nicotinate-nucleotide p rophosphorylase hypotheticai protein--- 2-dehydro-3-deoxyphosphooctonate aldolase-_,. _,-" , Y. w u. _. _.. _. __. _________. __. .. probable transmembrane censor, urease accessory protejn flagellar synthesis regulator FIeN _ l probable ATP-binding component of ABC transporter"""" probable phenazine biosynthesis protein ATP-binding component of ABC phosphonate transporter probable ATP-binding component of ABC transporter probable permease of ABC transporter probable short-chain dehydrogenase diaminopimelate epimerase _ , . .e _. I conserved hypothetica) protein JinI NH3-dependent NAD synthase probable biotin synthesis protein BioC probab ! e transcriptionai reguiator j type4 fimbria) biogenesis prqteinPiJW"""j probable chemotaxis protein methyltransferase conserved hypothetical protein 50S ribosomal protein *" probable oxidoreductase _ j probable permease of ABC taurine transporter __ conserved hypothetical protein hypothetical protein _ hypothetical protein ; phosphatidate cytidylyltrans_ferase bhosphatidyiserine synthase""--.---.--j _. _ h pothetical protem . _. ____. _. i thiosulfate suifurtransferase hypothetical protein conserved hypothetical protein protein protein hYpothetical proteW---_.. _. _. ____.. _.... __ ____.. _... _ .. _. j hypothetica) protein P ! ? ! 'P3i''egu) atqr"*-------. . _ robable".. _.. mese of ABC p pe a tr n porter : conserved hypothetical _ ___ sprobable transcriptional regulator_. .. _. _. ___. , _v.... . v_. _.. _w... _. Wprobable transcriptionai reguiator i hypothetical protein. ___.. _. . ___. _ Lqypo ! e al tein 5, tydrodipicolinate reductase j dihydrodipicoiinate reductase'"""""""""'""" ) hypothetical erotein ______ _ lhypothetical protein ; tryptophan synthas_e a_Ipha chain __-T-- __. _... _. _. __ _. _.. _. _. ______. __. ______. _. _. _.. ___. ____.. . __ 3tryptophan synthase alpha chain probable ATP-bindinq component of ABC transporter çprotein hypothetical protein_ probable permease of ABC-2 transporter iprobable transcriptional regulator conserved hypothetical protein acylglyceryl transferase | 3-methyl-2-oxobutanoate hydroxymethy, transferase glutamate racemase igiutamate racemase probable hypothetical protein probable permease of ABC transporter _ probabieperrnease of ABC transporter probable enoyl-CoA hydratase/isomerase probable transcriptional regulator conserved hypothetical protein thymidylate synthase hypothetica) protein'j l, hypothetical protein probable enoyl-CoA hydratase/isomerase translocation protein in type III secretion M _ hypothetical protein probable pili assembly chaperone robable ili ass _, lprobable transcriptional regulator probable plasmid partitioning protein probable permease of ABC transporter conserYed hypothetica ! protei'""'' conse vo tas t conserved hyppthetica) protein ihypothetical protein hypothetical protein probable transcriptional regulator ! probable permease of ABC-2 transporter tprobable NAD (P) H dehydrogenase lconservedpothetical ihypotheticat protein j fUDPacetytgiucpsam"J . ife_rredoxin--NAD_P+ reductas_e __ _ conserved hypothetical protein fflo. heI z j probabie enoyi-CoA hydratase/isomerase""' lconserved hypothetical protein Iferredoxin--NADP+ reductase potyamine transport protein PotC ubiquinone biosynthesis methyttransferase UbiE--- _.-- h. ypothetical protein __ __ v... _. ,.... .. _.. ____. M__. _. _ _r... _ llubiquinone biosynthesis methyitra_sfe ase UbiE _ ____ __ ___<3 tXyÇp otein _ __ transcriptional regulator PrtR_ ! transcriptional r ator PRLR 0 ein j probable transcriptiona ! regulator''"""------ p na eg ator __ , conserved hypothetical protein kprobable exopolysaccharide transporter_-. -'"- Y ". .-. _.. _.. _ _ PI°J '"9--29TP°I ! f' °f. BC transporter' jhypothetical protein probable short-chain dehydrogenase conserved hypothetical protein [3-deoxymanno-octu) osonate cytidytyttransferase"'"" jprobabfe transporter H. JI-1"""""" conserved hypo__ p prothetical rotein _ probable thioesterase" , hypothetical rotein hypotheticat protein ; hypothetical protein cis-1, 2-dihydroxycyclohexa-3, 4-diene carbox late deh dro enase p robab ! e enoyt-CoA hyd ratase/iso m erase"-.-.....--j molybdopterin biosynthesis MoeB protein jprobabfe short-chain dehydrpg'j conserved hypothetica) protein" heme exporter protein CcmC hypothetical protein tRNA (guanine-N1)-methyltransferase yw, 3 type 4 fimbrial biogenesis protein Pilaf imidazoleglycerol-phosphate synthase, cyclase subunit conserved hypothetical protein triosephosphate isomerase j uroporphyrinogen-))) synthetase i i undeca renyrophosphanthetase hypotheticat protein j ) probab) e cobaiamin biosynthetic protein _ _ YP P.. _ hypothetical protein hypothetical protein probable short-chain dehydrogenase" h pothetical protein électron transfer flavoprotein beta-subunit conserved hypothetica ! protein hypothetical protein _ hypothetical protein hypothetical protein hvpothetical protein hypothetical protein 3^oxoacyl- [acyl-carrier-protein] reductase,. _. __.. _.. ___.. _. ___...... _.. 3 hypothetical proteW __ _ hypothetical protein hypothetical protein i DNA polymerase III, epsilon chain ' ! DNA polymerase III, epsilon chain , h othetcal roteW ! hypothetica) protein, probab) ernjdeoseosphoryfase j 'uridylate kinase _ _ __ __ j hypothetica ! p rote ! n"-.-...-.-- , h pothetical rotein ..... i hypothetica ! prptejn''"'""""""""""'" j hypothetical protein---.--......--......... : hypo_theticai pro_tein kinase hell conserved hypothet_p '- __.. _.. _ r. ^ Y.'______.. ____. _. __. . _.. _v. _..... .. _. _. _. ical roten ! conserved h pothetical protein hypothetical protein _ypothetical protein _ _ _ _ ____ _ _ _ m __. ____ _. *. _. ~. _ _<_w~ _ ~ m_ n _ _ _ _-- i transcriptional regulator RHIR £prob_ab_le p_hosphoribosyl transfer_a_se_ __ _ 'fprobab ! e ATPndingcomppnentpf ABC transporter'"-------- Shypothetical protein rconserve^ d hyipotheticai protem w. -'. _.... _.. ___ _... _. _ _ _.. _......... M. . ^. ^T-m V. _. _... . __,. _. _ ____. ? _ypothetical Protein LIansCLD 0 K h R ^ ^ iconserved hypothetical protein prpbabiebotin biosynthesis protein bioH probabje permease of ABC transporter' hypotheticat protein 7conserved hypothetical protein ribonudeasePH,"" probabfe gfutamine amidotransferase-..-..--.-... Nhypothetical protein probable b » <_teín bioH = ! conserved hypothetical protein (robabie transcri tional regulator . . V. __-_.... __.,.. . ^. .. _. _ ___ f bdb e g utam ne ar amrsferase _ _ __ __ _ _______< j DNA-specific endonuc ! ease t *'"*"""" E obable transcriW conserved hypothetical protein (hypothetical prote_in. V. ___.. __ _ . _.. __. _. _.. __.. _. _ ___. ___.. _____.... ______. _. ; hypothetical protein thypothetical protein probable pili assembly chaperone , probable two-component response regulator ! phosphonbosy) aminoimidazoie-succinocarboxamide synthase""" h pothet_ical isuccinate hypothetical protein hypothetical protein conserYed hyp'*"""*"*' ! hyppthetjcat protein conserved hypothetical protein"' conserved hypothetical protein ypothetical protein su serveN e : Ch theme exporter component of ABC fan-sporter heme exporter protein CcmA hypothetical protein hypothetical protein hypothetical protein t5Y _. __. _ _. w_ _ ___. _. _,. v, + We__ {~ Xo R w v----___s__E^___ __________v_e lprobable hydrolase -.----___. __ V nsne-9 w methyltrans se _ _ __ __ = , orotidine 5'-phosphate decarboxylase '" ! probable hydrolase hypothetical protein hypotheticaj protein'----. ; 50S ribosomai protein L1 __ __o _ = w"~. _ M..,,,, «,,, _, w, _~~~_o_~__ _ 'hypothetical protein , probable permease of ABC transporter hypothetica) protein'-.--.--............................................. ......................... protein : hypothetical prole-i : ToiQ-protein __..... .. w_. _. w-__, _. .... _. ____, _w.. _-.. _-__. ___.... _____ __________. _. : TdQ pjrotein"'""""""""'' YP P _ _ _ _ hypothetical protein. p _'"""wm-.. _. _. .. __ . . __w. _ Y.. ,. . __. ___... _. ____ _.. _ conserved hypothetical protein d late s nthase c tid late knase _ '... . _... _.o__ _..a... _ 'hypothetica ! protein----- jprobabie pseudouridyfate synthase'"' jcytidyfatekinase '''"''" ihypothetica ! protein""'" : [. 9°ni6° ! UE° [ ! -. '"'i SOSribosomai protein S3......'."*""i hypothetical protein jprobabie transcriptionat regutator" dethiobiotin synthase'"'" molybdenum transport protein Mod_B y ' transcriptional regulator Dnr hypothetical protein fprobabietp-bindin probable ATP-binding component of ABC transporter conserved hypothetica) protein'' NADH dehydrogenase) chain B probabie two-component response regujator P P P 9 hypothetical protein proba_ble transcriptional regulator Na+-translocating NADH : uniquinone oxidoreductase subunit Nqr4 Iribonuclease T ''. ' hypothetical protein conserved hypothetical protein DNA repair protein Rads ribulose-phosphate 3-epimerase hypothetical protein. lhypothetical protein ; heme expg j ihYpothetical protein urease accesso p (ribose 5-hos ha e isoemerase P P _... _ phosphoribosylaminoimidazole synthetase probable transcriptional regu_lato_r probabtetranscriptionaf regulator'""i probable transcriptional regulator hypotheticai protein hypothetical protein iconserved hypo probabfe transcriptiona) reguiator"'" lprobable two-component response regulator 'conserved hypothetica) proteinIIIL---"I'''"'"" , conserved hypothetical protein hypothetical protein -, hypothetica) protein"* i hypothetical protein ... _____w. _. ______w ____.l__. _____ yp cal p e ypothet ! caiproteHT"''""-"""-- conserved hypothetical. protein S conserved hypothetica) protein" f_.-.. _. _.... _. ___ : thi permease of ABC transporte _ _ ; atginate o-acetyitransferase A) gF'' conserved hypothetica) protein""""'"''" ! conserved hypothetical protein probable transcriptional regulator ! pyridoxine 5'-phosphate oxidase Yp p h othetical rotein h othetical rotem probable carboxylesterase pyoverdine biosynthesis protin Pvc-D probable transcriptional ; robabve carbonic anhydraseW ; conserved hypgtheticafpr conserved hypothetical protein probable pyridoxamine 5'phosphate oxidase----------------------- probable glutathione S-transferase, hypo hetical protein- h pothetical protein probable glutathione S-transferase transcriptionat regutator Vfr------- s transcriptional regulator Vfr giutamineami dptra n sfe ra s e"" ! .......... b pothetical protein maleylacetoacetate isomerase probabfe radicaf activating enzyme Ih) Lpothetical erot (Lin uracil phosphoribosyltransferase hypothetical protein endonuclease III . probable trantcn tional re u a. hypothetical protein conserved hypothetical protein hypothetical protein probable tolQ-type transport protein pseudouridine synthase R) uA'' conserved hypothetical protein 50S ribosoma_ .rotein _. conserved hypothetical protein_ hypothetical protein _ hypothetical protein probable two-component response regulator thyMIq conserved hypothetica) ? 1'*. II""""""III] Econserved hypotheticalprotein ' L ^' If , conserved hypothetical protein Iprobabie aromatic acid decat-boxylase --'""''. _"w"'-=.. _.. _.. ... _... ___. ru ! probabfe nuctease . ."""'"" iperiplasmic chaperone LOIA 'ihypothetical protein L__. _____ iprobable oxidoreductase jhypothetical protein ; hypothetical protein hypothetical protein fhypothetica ! protein '"'""""''""" ! hypothetica) protein"""" [hypotheticat protejr) ! j30S ribosomai protein S4 *''"' homoserine hypothetical protein "robable li o rotem localization rotem LoiB P P P P hypothetica t protein"""'"'j GTP c cloh drolase II hypothetical protein probable transcriptional regulator _ probable peptide chain release factor probable ribosomal protein L25 hypothetical protein hypothetical protein hypothetical protein hypothetical protein conserved hypothetical protem guanylate kinase glutamine amidotransferase conserved hvpothetical protein hypothetical protein protocatechuate 3, 4-diox genase, alpha subunit hypothetical protein probable Clp-family ATP-dependent protease _ _ lhypothetical protein hypothetica) protein 503 ribosomai protein L4' conserved hypothetical protein , hypothetical protein hypothetical protein hypothetical protein hypptheticai protei n .) probable malybdopterin-, guanine dinucleotide biosynttesi ! prgtei MobA hypotheticai protein _''-"" hypothetical protein , conserved h othetical proten _. _.... _ conserved hypothetical protein ihypothetical protein I hypothetical protein iprobable hosphoheptose isomerase E ; p type I e etion sys#em protein ; hypothetical protein.,............... ...""' ; hypothetical protein _ __. _ ____. _. _.. _.... _ Fin hypothetical protein i'hypothetical protein type 4 fimbrial biogenesis "YJ2ZEi9'r-. ' antStgmafatqrjuc "' prpbabietranscriptionat regu ! ator''"'""" ; , I hypothetical protein conserved hypotheticai protem" conserved h ypothetical rotein hypothetical protein hypotheticat protein superoxide dismutase, hypothetica) protein ! hypothetical protein' hypothetical protein hypotheticai protein''hypotheticai protein probabie DNA invertase. . . i probable DNA invertase probable. acetyltransferase _. _. _. hypothetical protein hypothetical protein hypothetical protein conserved hypothetica) protem J hypothetical protein conserved hypothetical protein ri osomal protein alanine acetyltransferase ; probable transcriptional regulator jhpothetical protein------... _...... onserve. j conserve hypotheticai protein j conserved hypothetical protein conserved hypothetical protein ; hypothetical protein. _. __ [conserved hypothetical protein probabie protease robable protease g_. x... ____. _.. _-. . tt __.. __. ___... _... _.. _ aikyi hydrpperpxide reductase subu ! probable protease fhYpothetical protein . _... ". __. _. .. _ hypotheticai protein'"" Lhothetical protein hypothetical protein P -probable transcriptional regulator , heat shock rotein Gr E.. _ CDP-diacylgl cerol--gcerol-3-phosph, ate 3-hosphatidyltransferase, __4W iCDP-diacyJgtycero1'IIIIIT conserved hypotheticai prptein nserved hypothetical protein ribosomerecyding factor ome ecyc ng facto i hypothetical protein"'""''""""""'"' : hypothetical protein : __.. ; hypothetical protein. ___.. ... _. _.. . _.... . . _. _..... _. _. -. .... . _.,. ,..... _. _...... . _, _... ...... _,... __... __. ___.,.. _. _. . ; h pothetical protein : ribosome recyclinq factor ! conserved hypothetical protein ! _hypothetical protein rra I t o mrtration factor iF 3 _ _ ein itranslation initiation factor IF-3 rconseryedjiypothettcapro"'""' , probable transcriptional regulator {conserved hypothetica ! protein *---- iadenine phosphonbosyttransferase"''"--- conserved hypothetica) protein"'"'* dTDP-4-dehydrorhamnose 3, 5-epimej'ase""'' tprobable_si ma 70 factor, ECF subfamii probabte sigma-70 factprE * ! GTP cyclohydrolase I precursor 2othetical protein . qu 50S ribosomal protein L5 hypothetical protein conserved hypothetical protein conserved hypothetical protein ATP synthase delta chais NosL protein conserved hypothetical protein conserved hypotheticai protein. j conserved hypothetica_I protein ; 50S ribosomap _rotein L6 _. conserved hypothetrcal rotem, : conserved hypothet) ca) prptejn conseryed "" ! conserved hypothetical protein hypptheticat prptetn hypptheticaf protein""" conserved hypothetica) protein' jtactoyigtutathione tyase J hypothetical protein r Ypothe_. __... _. h othetrcal protem -----..... ____. _.. _. _. __. _. _. ___. __. _ ____. ___. inorganic pyrophosphatase ! probable sigma-70 factor, ECF_subfamily probable sigma-70 factor, ECF subfamily___, conserved h pothetical protein - othetical conserved hyp p hypothetica) prptetn-----j roteW^M hypothetica ! protein l hypothetrcal protem __ h pothetical protein _., __. _ hyothetical protein _.----__.. _.... _. ____. __. ____ __. _. ___. _,-. _. _ ____.. __. _. _ r_... ___.. _, _.... _.. 'genera ! secretion pathway protein M.-..-..-.....-...-.......-...-............-.. hypothetica) prptein"""" P __ w__, _ ihypothetical e ; conserved hypothetica ! protein"'..---.-.............. ,.. _____.. _... .......... __... __. _. _. _..... _. _. _.. _..... _.. __.... __...... _....... __...... _.. _. _..... _....... _.... _. __.......... _........ _..... _...... _. __..... __..... _. _... _... _. _.. _. _. _....... __... __... _. _. __... _....... __.. _..-..... _. _... __..... _..... ; conserved hypothetical protein _ _ ; conserved hypothetical protein heat shock protein HscB conserve_d_hypothetical protein ' -'"'". hypothetical protein' genera ! secretion pathway prpteinH"'" !. __. ... r__.. _ shikimatekinase *"-.--, h pothetical protein _ : conserved h othetical rotein phosphatidylglycerophosphatase A beta-hydroxydecanoyl-ACP dehydrase conserved hypothetical protein transcriptional re conserved hypotheticaf protein """""< conserved hypothetical protein spermidine acetyltransferase prolipoprotein signal eptidase hypothetical protein conserved hypothetical protein probable transcriptional regulator _ _ - conserved hypothetical protein probable sima-70 factor, ECF subfamy"j conserved hypothetical protein hypothetical protein hypothetical protein probable outer membrane protein precursor probabie outer membrane protein hypothetical protein transcription elo, g dih drofolate reductase hypothetical protein hypothetical protein 50S nbosomal protein L_10 30S ribosomal protein S5 hypothetical protein hypothetical protein hypothetical protein ADH dehydrogenase I chain J hypothetica) protein hypothetical protein hypotheticat protein"''"''""""'"""""'"""""'"""""j lhypothetical protein hypothetical protein thypothetical protein hypothetical protein conserved h p j^ ypothetical rotein _ __ _ ferredoxm protein NapF _. _........ , ... ...., .. .. _. W _ p phenazine bios nthesis proten _ ' : probabie phenazine bipsynt-..-..-*""'-- : probable phenazine biosynthesis protein ---..-.-..-...-.-.....--.-..-......... ° YP p i_.. __ ; hypothetical proten _ _ j probable phenazine biosynthesis protein 'conserved hypothetical protein 'tofuate 1, 2-dioxygenase beta subunit"' 2-amino-4-hydroxy-6-hydrox methyldihydropteridine p rophos hokinase hypotheticat protein""'"""' _.. _. _. Y.... Y P lhypothetical protein lpeptidyi-prolyl cis-trans iso mrase hypothetica ! protein'" h pothetical protein , hypothetical protein hypothetical protein molybdopterYpbiosynthetic protein C conserved hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein F NusB protein _______ _ phosphopantetheine adenylyltransferase hypothetica) protein : phosphopantetheine adenylyltransferase hypothetical protein hypothetical protein_ hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein roba mdi jprobabte purine-binding chemotaxis protein hypothetical protein hypothetical protein jjiypothettcajproteLJL-1111111111111111"] 6, 7-dimethyl-8-ribityllumazine synthase.""_ hypotheticai protein. ."""'"---'-----...---j co"nserved h othetical protein translocation protein in type III secretion M, _ w translocation protein in type III secretion hypothetical protein hypothetical protein lhypothetical protein YP'_p Jconserved hypotheticai protein"""j conserved hypothetical protein bacteno {bacterioferrittncomigratory protein''"'} conserved hypothetical protein hypothetical protein . Yp ical rotein conserved hypothet p sconserved h pothetical protem yhase 8 h i , 30S ribosoml_grgt ir S cyanate Jyase""""""''""" biotin carboxyl carrier protein (BCCP) probable dna-binding stress protein . conserved hypothetical protein - ghypothetical protein . h othetical rotein _ _ _ ihypothetical-protein' ,, cytochrome C-pe biiogenesis protein CcmH hypothetical protein hypothetica ! protein ! lhypothetical protein t lprobable thioredoxin hypothetical protein _ _-- ; nitrogen regulatory IIA protein conserved hypothetical protein phosphotyrosine protein phosphatase probable HIT famil protein conserved hypothetical protein lhypothetical protein hypothetical protein ___, conserved hypothetical protein conserved hypothetical protein _ _ _ _'--" conserved hypothetical protein hypothetical protem hypothetical proteW_. _ . . conserved hypothetical protein conserved hypothetica) protein j psmoticaj) yir) ducib) e protein smC' deox uridine 5'-triphosphate conserved hypothetical protein hypothetical protein hypothetical protein moiybdopterir) converting facto '"''"' conserved hypothetical protein conserved hypothetical protein_ conserved hypothetical protein_ probable type)) secretion system protein jtype 4 fimbria) precursor PijA ! lprobable transcript_ional regulator __ "' hypothetica) protein J II. I 11'"""'".,"'"i hypothetical protein 3-dehydroquinate dehydratase ribonuclease H ____ ____... . _. _.. _ hypothetical protein j probabte peptide defprmyiase'j probable peptide deformylase ; ToIR pfo etem .. _.. __. _ _.... _. _ _. __,.. __.... _ _.. , w -_. __.. __... _. _. __... _. __ __. _. __. _. ____. ___. : conserved hypothetical protein _ ; ToiR protein"''""""""" iconserved hypotheticai protein"""'"""""' ' (3R)-hydroxymyristqy [M protein] dehydratase""""" ; _hrpothetical protein ihyppthetica) protein" conserved hypothetical protein i conserved hypotheticai protein---- ' : probabtetranscripM. "-111''' 9 f {hypothettcai protein" I_exoenzyme S synthesis protein C precursor iprobable transcriptional regulator _. hypothetical protein hypothetical protein -50S ribosomal protein Let hypothetical protein conserved hypothetical protein hypotheticai protein hypothetical protein conserved hypothetical protein hypotheticat protein""" ! probable type 11 secretion system protein helix destabilizing_ protein of bacteriopag, PL hypothetical protein nucleoside diphosphate kinase 50S ribosomal protein Lu I hypothetical protein hypotheticaf protein-.--..- 50S ribosomal rotem L13 n , hypothetical protein hypothetical protein conserved hypothetical protein probabfe transcriptional reguiator _ hypothetical protein probable. tT e ! I secrefion system __... _... ___. _.. _ hypothetical protein ATP synthase epsilon chain hypothetical protein conserved hypothetical proten ; hypothetical protein hypothetical protein conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein conserved hypothetical protein hypothetical protein J i 30S ribosomal protein S6 hypothetical protein , hypothetical protein jconsejyedjhypotheticap""'""f _erved hypothetical protem -o-tei-n h_.. othetical ppotem, p.. ! hypothetical protein hypothetical protein 'hypotheticat protein.---.-..-......-....-..-..,-...-. jhypothecaj protein""" f"hYpothetical protein. .. _. _. __. __.. __. _. w. j hypotheticai protein"" conserved hypothetical protein h othetical protein ; p' p wy o p ihypotheticai protein ! hypothetical protein hypothet cal protein '"''-w° . ihypothetical protein hyhypothetical protein _. V... _. ___.. ___... ___ »,.... _ ribonucjeasep protein component.' stringent starvation protein B probable fosfom cin resistance protein hypothetical hypothetical rotem hypothetical protein hypothetical protein ferric uptake regulation protein hypothetical protein hypothetical protein hypothetical protein probable transcription l reLulator jprobabte transcriptiona) reguiator probabteNADH-ubiquinone/p ! ) hypothetica) protein) nserved hypothetica) protein""" ! hypothetical rotem hypothetirotein ; E hypothetica) protein"'' proba bfe transcription at regulator yp theti p .. _....... _......... __....... _..... _.......... _..... _......... _. _. _... _. _. _,.. _. _......... _..... _..... _... _... _. _....... __... _....... _. __.. _. _. __.. ____.. _.. _.. _... _____.. ____. _. l aikaiine proteinase inhibitqr Aprt iactoyigiutathione Jyase . . jhypotheticai protein... I-.. l. . .. 11""' '""''"'''--'-"'''-"'''"-j h o'cal rotem hypothetical protein lalka. line proteinase inhibitor Ap-rl lacto I lutathione lyase hypothetical prote _ !, hypothetical protein hypothetical protein , conserved hypothetical protein hypotheticat protein j hypothetical protein 130S ribosomal protein S8 t ; hpothet p ; ical rotein . N ! 5-carboxymethyt-2-hydroxym) jcqftejsornerase'"" : -30S ribosomal protein Su 'hypothetical protein _ __ __ __ __ _ _ 'hypotheticai protem_ ! hypothetical protein t 30S ribosoma p_tein S 1 pr bable cytochrome c (mono-heme type) 30S ribosomal protein Sl l hl2_ _-_-_ ___ _ « _ _ _ __ _ _ _ __ _ _ _ __< j_yEhe ribosimal rotei lsecretion protein SecG 'hypothetical p, rotein hypothetical hypothetica ! protein'"''"" probabiejron-binding protem iscU'"""") IhEot rot in.............................................. _ _ Lypothetical protein ___ al protein conserved hypothetical, protein conserved hypothetical protein glycine cleavage system protein H2 ___ _ __ __ _ _ _ _ypothetical protein _ _ __ _ YP __ P - my hypothetical protein hypothetical protein hypotheticat protein--- YP P hypothetical protein _ __ _ _ t hypothetical prote, in.. aspartate 1-decarboxylase precursor hypothetical protein .. _ f hypothetical protein hypothetical. protein....... pr bable rinq-cleaving xygenase w... ___ __ _s hypothetical protein ATP synthase protein I conserved hypothetical protein conserved hypothetical protein hypothetical protein,,. conserved hypothetical protein conserved hypotheticai protein"*'"'" hypothetical protein, YP P __, _ _.--- p hypothetical protein, hypothetical protein hypothetical protein hypothetical protein conserved hypothetica) protein probabie type)) secretipn system protein j 1 consenred hypothetical protein _ . , _"" .. ", _, _....- , probable type II secretion system protenw .. . ",. . , ___Mw", "_, yothetical protein- _ _ : two-component response regulator CheY _ __ _ _ _ _ _ ß hypothetical protein _ _ _ hypothetical protein transcriptional regulator MvaT, P16 subunit d-ervthro-7, 8-dihvdroneopterin triphosphate epimeras_ _ _ _ __ _ __ 30S ribosomal protein Sl. 2 in :. _.. _. _. _ _ pr__' Yt r hY. potheticalp ____. _.. ___........ ___. _.... ___. _.. _. __... _.... _.... _. _..,.. _. _ ____ __.. ________. . ____. _. _. ! probable drug efflux trans orter _50S ribosomal prot_ein L14 hypothetica } hypotheticai protein'" o ribosomal protein L7 Ll 2 s secretion protein Secte ! succinate dehydeo e inate dehydrogenase (D, hypothetical protein., hyppthetica ! proteinL-. J. IL.'' conserved hypothetical protein in type III secretion hy_pothetical. proten__ hypothetical protein hypothetical. protein hypothetical rotein hypothetical protem YP hypothetical protein hypothetical protein _ a hypothetical protein hypothetical rotem. _ _PP conserved hypothetical protein , _ m _ hypothetical protein. hypothetica ! protein. i hypothetical protein conserved hypothetica) protein *" 50S ribosomal protein L20 probable 6-pyruvoyl tetrahydrobiopterin synthase , , m, ""_', hypothetical protein_^ __^w__ 30S ribosomal protein S13 t_. _ type 4 fimbrial biogenesis protein Pilez pterin-4-alpha-carbinolamine dehydratase hypothetical protein conserved hypothetical rotein- Yp P ihydroneopterin aldolase , conserved hypothetical protein YP P. _ ical rotein conserved hypothetical protein conserved hypothetical rotein conserved,. hypothetical protein 50S ribosomal protein L1_8 hypothetical protein hypothetical hypothetical protein hypothetical.. protein hypothetical protein, _ I [hypothe'p tem __ _ Yp tical rorotein pothetical protein, ____... _....,. .... ".-... .. _. hypothetical protein zu =,hypothetical protein h thetical protein 'conserved hypotheticat protein *'"''" ;, conserved hypothetical protein iconserved hypqthetica) qtein ."''""' ; hypothet ; conserved hypothetical protein. conserved hypothetical protein ; hypothetical protem . h pothetical protein nserved hypothet ! cajprotejn"------ hypotheticat protein hypothetical protein hYpothetical protein _.-. . _. _.. _.... __........ __. _.... __. __.. __. _. _.. __.. _.. _.. ,.. ...., _. _,. _. . : hypothetical protein probable ferredoxin ! nitrogen regulatory protein P-II 2 - _ ferredoxin [2Fe-2S] conserved hypothetical protein conserved h pothetical protein conserved h pothetical protein - conserved_h pothetical protein hypothetical protein _ _ _ __"__ hypothetical protein hypothetical protein h pothetical protein conserved hypothetical protein ___ _'""- phosphoribosyf-ATP pyrophosphohydrotase I""I11 conserved hypo_t_he_tic_al protein conserved hypothetical protein iSMR multidrug efflux transporter ; , hypothetical protein' h othetical protein hypothetical protein '-"' , hypothetical protein (hypothetica) protein t fhypotheticat protein j ; hypothetical protein, iconserved hypothetical protein ,, hypothetical protein h potheticalrotei_n _ "-II''"'4'"-' ) hypothetica) protein ! conserved hypothetical protein ssimiiatory nitrite reductase smat) subunit ! hypothetical protein Jconserved hypothetical protein, '"*'*'] probabte thioredoxin J thioredqxtn. ! ! prqbabie bacteriophage protein t 'conserved hypotheticat protein . . ! s hypotheticai protein j Iconserved hypothetical protein 'conserved hypothetical protein ; £hYpothetical protein [hypothetical protein __ _ __ hypothetical protein .. _.. _..... __ _. _. _... ___, __ . --. -y ^s W. __... -mr W.. __.. ihypothetical protem _, oh hypotheti p ^_. __... _-. _.. _.. _.. . _.... _. _ __ _.. ___. ______. __.. ____... Jprobable iron-bndmg protem IscA. ! hypothetical protein =DNA-binding protein _,.. ., _. __ __.. ___... ___... _.. ___ jhypotheticaj protein----. fDNA-binding protein Fis'"""*"" ., hypothetical protein' conserved h pothetical protein hypothetical protein hypotheticai protein."""" : h othetical protein sarcosine qxidase deita subunit"'""''""---, hypotheticai protein------ hypothetical protein hypothetical protein hypothetical protein h, pothetical protein transcriptional regulator PrtN -OS ribosomalprtein Lq4 hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein conserved hypothetic"" 30S ribosomaiprpte) nS1p"------------- probable transcriptional regulator 50S ribosoma_I pro_tem L21 hypothetical protein hypothetical protein NADH dehydrogenase I chain K conserved hypothetical protein conserved h pothetical pr_o_te_in conserved hypothetical protein hypothetical protein ' '""""-'"'_"- conserved hypothetical protein , probable transporter i ! hypothetica) protein""-" hypothetical protein conserved hypothetical protein hypothetical protein ; salicylate biosynthesis protein PchB"""""" , hypothetical protein conserved hypothetical protein -os ribosom conserved hypothetical protein 'morphogene protein BoIA _ _ _ _ _ ; hypothetica ! protein'"'' hypothetical protein ypothetical protem ! hypothetical protein __. _ _.... f Snit_ __ _ ______ __ _ _ _ Iconserved hypoíhetical protein_ rc_al rotem. r50S ribosomal protein thypothetical protein 3 hypothetical protein lhpothetical protein fhypothetica) protein"""'" hypothetical _ . _ein hy hy_p_othetical protein ""°""' hypothetical protein . __g. _. : __y hypothetica) protejn" ! regutator inype) ! i secretion,. . ."'""'"j hypothetical protein 3hypothetical protein ___w_-__ _____o _ _ j3 ; cell division protein FtsL (GroES protein _ _ conserved hypothetical conserved hvDothetical protein conserved hypothetical tconserved hypotheticalerot in hypothetical protein hypothetical protein 3 G ! u-tRNA (Gln) amidotransferase subunit C . hypothetical protein hypothetical protein hypothetica) protein hypothetical protein , _., Y. ...... w. ^..... _.. w. ___..... __. w__.. _... _. _.. _.. __. __. ___. __y_... _ hypothetical protein hypothetical protein conserved hypothetical protein hypthetrcal rtern hypothetical protein hypothetical protein __~_w ww _ E conserved hypothetical protein j hypothetica) protein""J h othetical protein integration host factor beta subunit hypothetical protein conserved hypothetica ! protem' h othettcai roten @t rotein_ __ _ _ .. I hypothetical protein _ _ _ _ _ __ __ hypothetical Drotein probabie DNA binding protein j probable DNA binding protein peptidyl-prolyl cis-trans isomerase C2 hypothetical protein hypothetical protein hypothetical protein _pyrroloquinoli_ne quinone biosy_nthesis protein D e fid I rol I''e C1L hypothetica) protein h othetical rotem = jhypotheticaf protein j h othetical rotern _ jhypotheticaprotein j sS.... _ _............. t Lhypothetical pro ein _ __ __ _ _ _ _ _ ___ ___4 hypothetical protein } 30S ribogttK S20 , 30S ribosomal protein S19 mal rotem S19 ... _.. _____.... _. _. __... ____. __.... _ _ _ __ probable acylphosphatase : hYpothet p hypothetical protein conserved hypothetical proteln yp.. _. __. _... _. _.. __. _ . ____... _... _.. ____ _. _... _ conserved hypothetical protein ; Conserved hypothetical protein ihypothetical proteln . conserved hypothetical protein : conserved hypothetical protein ! _ f W hypothetica-otein ' ; hypothetical protein ".. _. __..... _. _.. __....... _... _.. _... _.. __ _... __.. ___.. _.. _ _ Eflagellar biosynthetic protein FliQ hypothetical protein ; ffagellar biosynthetic protein FiiQ W. ypthetical protein ww wwwwwww____ _.... _....... _. 30S ribosomal conserved hypothetical protein Iconserved hypothetical protein S ribosomal protein S17 ihypotheticai protean ! 'hvDothetical protein v _. __w_wwww_ww_ __ w___ww _ _ s __wwwwmwww_ __* w_ wwww__ l hypothetical protein lhypothetical protein _. conserved hypothetical protein hypothetical protein conserved hypothetical protein pyocin S2 immunity protein pyocin S2 immunity protein___ _ _ _ __ _ _ _ _ _í hypotheticai protein _ _.. __ _. _. _..... ..,., _, _ ~ _,. t..... __. __. _,. .. _ _. _. _. _. _ _ ___ __ « j hypothetical protein hypothetical protein p.. _. _ hypothetical proteln type III export protein PscF atp synthase C chain j hypothetical protein hypothetical protein 50S ribosomal protein L27 hypothetical protein o_ hypothetical protein 50S ribosomal protein L27 hypothetical protein klutaredoxin. hypothetical hypothetical proteln h othetical rotem -----.---.. __. _ ___.. .. .. glutaredoxin thypothetical protein thvpothetical protein 'hypothetical protein tein hypothetical protein cetf division topobgica J motybdopterin converting factor, smaf) subunit t molybdopterin converting factor, small subunit molybdoDterin convertinq factor, small subunit major outer membrane lipoprotein precursor hypothetical protein 4 Yp P _ 30S ribosomal protein ferredoxin [4Fe-4S] , j _. ____. __. _. ___.. _. __.. _. ___. __. _. __.. _. ... _. _. _. __ _ ferredox_m _4Fe 4S conserved hypothetical protein conserved hypothetical protein _} probable biotin-requiring enzyme translocation protein TatA conserved hypothetical protein . .. .. _ . _.. _.. ___. __.. w. ____ _.. _ _. 'hypothetical protein p p. _. _..... _ ; hypothetical, Eein _ __ _, _o : rp cal rot m wY., : __. __ i probable ferredoxin'-'--"-""--- ; _pr_obable ferredoxin _.. ____.,. _.. __, __.... 'nypothetica) protein --.-.-...-......... .......... ihYpothetical protein hypothetical {conserved hypothetica ! protein" regulatory prot_n_saL _ __ _ _ _ __ \ conserved hypothe_tical protein "'"''""'"'w° . conserved hypothetical protein lhypothetical protein probable acyl carrier protein __ ____ _ _ lprobable acyl carrier protein # conserved hypothetical protein probable acyl carrier protein . hypothetical protein conserved hypothetical protein hypothetical protein _ 60S nbosoma ! protein L28ZIIII'*'""J 50S ribosomal protein L28 acyl carrier protein hypothetical rotein hypothet ! ca) protein' hyDpjthecai protein j conserved hypothetical protein hypothetical protein hypothetical protein 30S ribosomal protein S18 hypotheticat protein l. i.-J -.-.-Lj hypothetical protein hypothetical protein hypothetical protein yap p hypothetical protein hypothetica ! protein t hypothetica) protein) conserved hypothetica ! protein' hypothetical protein ! conserved_hypothetical protein hypothetical protein , conserved hypothetical protein , conserved hypothetical protein ypothetical protein) h"ypothetical protein hypothetical protein conserved hypothetica) protein'"'' hypotheticat protein hypothetical protein , conserved hypothetical protein wshe p initiation factor Yp'p h othetical rotem . __ _ p.. __, hypothetical protein ihypothetical protein _ hypothetical protein p __.. _. _. __. _ _ _ __ _.. 30S ribosomal protein S21 '! tofbacteriop age Pf1 _ _ _ _ _ __ _ r bnssme o1 : acbr ribosome modulation factor_ W ribosome modulation factor .......... protein O hypothetical protein i hypothetica) prgtein . "" ! hypothetical protein conserved hypothetical protein 3hypothetical protein 'probable cold-shock protein j hypotheticat protein."*"" 3, hypothetical protein 3hypothetical protein ih othetical protein ypothetical protein hypothetical protein probable tra_ns_criptionai regulator probable transcriptional regulator cold acclimation protein B rt protein PscE conserved hypothetical protein'' wgulator probable transcriptional regulator leonserved hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein conserved hypothetical protein hypothetical protein hypothetical protein hwgMgn_ hvDothetical Drotein hypothetical protein hypothetical protein hypotheticai protein : 50S ribosomal protein L35 hypothetical proteln 50S ribosomal protein L29 hypothetical protein carbon storage regulator hypothetical Protein hypothetical protein h othetical Iprotein __" conserved hypothetical protein hvpothetical protein wiz hypothetical s hypothetical protein hypothetical protein hypotheticai protein hypothetical protein hvpothetical protein hypothetical protein hypothetical protein 50S nbosomal protein L30 50S ribosomal protein L30 hypothetical protein hypothetical protein hypothetical protein hypothetical protein periplasmic nitrate reductase 3 rubredoxin f-conserved hypothetical hypotheticai protein . , h othet 'hypothetical protein i conserved hypotheticaj protein..,.,...,..,.........,. hypotheticai protein iconserved h othetical rotein _., . _. __. _. _. __ P ___. _. __p _.. _. ____.. _. __... __...... _.. __..... _. _.. _. __... __. _.. _........ _... _... _......... __ qat hypothetical. ,, conserved hypothetical protein : hypothetical protein----------- hypothetica, protein................... ih othetical rotein _, _.. __ jiipopeptide precursor S hypothetical protein_, _____- 50S ribosomal protein L34 hypothetical. protein......... hypotheticai protein 50S ribosomal protein L36 k KdpF protein pyrrobquirolnj . i Y-& 'F,'4... f Y S, Vr fV'1 h : 'M ta tylar'e g rltserr, i, r, . kPnt, "ho'tt !'i ., 001 A01 1 3254036 ; PAK 001A03 1 42145261 ; PAK 001A04 800208ji PAK'. OOlAO4 PAK 001A05 3627210. ; PAK 001A06 | 4931913j PAK 001A07. 1034469 ; i PAK 001A08 ij 6144940 PAK 001AO9 ì 4102307í ; PAK 001A11 1515737ji PAK 1244688 l l 001B02 5924618 001B03 3267350 PAK 001B04 3302119"PAK" 001 B05 3108121 PAK _ _j 001 B06 j 3987545 PAK 001 B07 5585518 PAK ; i e 6 001B09 4682141 PAK 001B10"5041902 PAK _.... _. __ 001B11 3187871 PAK ! 001 C01 5924618 PAK 001 C02 2871514 PAK 001C03 001 C03 4746191 PAK 001 C04 515693 PAK r 001C04 5156931 PAK Si 001 C05 61557441 PAK 001C06 _ 5741543j PAK 001C08 5945561 PAK i 001 CO9 23707631 PAK 001 C10 4186878 PAK . 001 C12'5610441) PAK t PAK s 001D01 6193619 PAK 001 D03 60780341 PAK 001 D04 61398781 PAK _ 1 5225311 PAK ) 001 D06 i 3567982 PAK j 001 D08 3998726ij PAK 001DO9 21402511 PAK 13011691 PAK OOlDlO i ' 001D11 34235191 PAK 6701 001D12 3472 PAK 8009361 PAK I f"001E03'4246525""PAK1 o w i j 001 E04477959 PAK ; 001 E05 li 4779591 PAK ! 001E06 5939777 PAK ; 001 E07 5471284 PAK __ !'001 E08"5582311 PAK 001 EO9 1 442285i PAK ; i 001E10 ; 1 45148791 PAK r 001 E11'4514879 ! PAK'"' i001 E12 5064081T PAK J i. _. __.-. 001 F01.-.. _______. _... _.. _... _.. 903376 ! pat 001 F02-'PAK 001 F02 i 18895811 PAK i ; 001 F03 i 123081 3i PAK '''''Lf J1230813 !"PAK'" : 001F04 j 5755640 ! PAK' ) 001 F05" !'" 5355403)""PAK" 001 F06 ; ; 4493238i PAK ; 001F07'850016 _ PAK_ j'j 001F08'j 5286479ii PAK 001 FO9 3035834 PAK 001 F10 isi 270414 PAK 001F11 4300290 PAK 00IF12 3471740 PAK 001 G01 5431778 PAK 001 G06 5064081 PAK j 001 G07 353196 PAK 001 G08, 4881356 PAK 001 G094684466 PAK i 001G10 1340542 PAK -e 001G11 2659761 PAK 001 G 12 4553600 PAK _ ; 001 G12 4553600 PAK ji 001G01 5431778 PAK 001 G02 627197 PAK i 001G03 30056161 PAK 001GO5 2300131 PAK 5064081 001 G07 353195 PAK m a 001G08 48813561 PAK 'j 001 G08 4881356 PAK 001GO9 4684465 PAK 001 H01 ii 4600925jj PAK 001H02 4465691 PAK 001 H03435295 PAK 001 H04 i 558396T PAK 001 H06 5823734 PAK 001 H08 3880466 PAK 001 H09 271720 PAK j 001H10 433381 PAK 001H11 395319 PAK 002A01 3652524 PAK 002A02 3987593 PAK I 002A03 530429 PAK g 002A04 6232877 PAK 002A05 1543845 PAK 002A06 619210i PAK 002A07 4795351 PAK 002AO9 1152202 PAK 002A09 1 11522021 PAK 002A11 449470i PAK 002B01 5643797 PAK 002B02 3423910 PAK" 002B03 1 36169161 PAK 002B04 1511758 PAK 002B05 3809953 PAK ! PAK 002B06 L PAK' 002B07 i 1277942i PAK _, 002BO8 54367601 PAK PAK 002B09 ; _ _1030806 ; PAK _ r 002B10 1030806J PAK"'" 002B11 3355560j PAK --7 '002B12'3935624J PAK 003A01'. 2016406, PAK 003AOI i'"003A02'4987284 PAK"' 003AO 17138321 PAK OQ3A04"T 1859681 ! PAK 1 |--e Fi 003A05 ! 4333811 PAK PAK 003AO6 62412601 003A08 102621 3j PAK 003AO9 48224261 PAK 003A10 1 513656 PAK 003A11 T""5050248 ! PAK'1 003B04 ! 3377875 PAK 003BO4 003B06 19693051 PAK 003B07 433381'PAK ! 003B08"'"'1034469 PAK 003BO9 i 590741'PAK.' a W 003B10 1 4192241 PAK 003B11 ! 4192241 PAK 003C01 ^. 1 5713913 PAK ! 003C02 2609592 PAK 003C03 2095164 PAK v-r 003C04 5369447 . P 003C05 799610 PAK 003C07 2410828 PAK 003C08 1576887 PAK < i 003CO9 I 3998623 PAK 003C10 3771149 PAK. 003C11 1408282 PAK 003C12 -IPAK 003D01 433382 ! PAK 003D02 259586j PAK 003D03 1700770 PAK v 003D04433381 PAK j 003D05 4893664 PAK 003D07 810409 PAK 3 003D08 433381 PAK 003DO9 5970386 PAK 003D12 2049456l PAK ii 003E01 _1 18194281 PAK r 003E03 C 2555440j PAK 0003E06 5 5415888 PAK 003E07 5929820 PAK 003E08'5414529 PAK i , 003EO9'zL PAK 003E09 835119 P_AK 003ElO 48553681 PAK [003E12 5159655 !' PAK ; -..... ..... ......... ........... ggj--p- ; 003F01 ii 6832743 PAK L'003F02"T 1428758 PAK'- 003F04 j 4638260t PAK 003F05 i 2695523i PAK 003F07 _ i 36079691 PAK 003F08. 1082510 ; PAK 003FO9, i, 1031737, PAK 003F10 7 4333a11 PAK 34222891 H f 003F12 2922974 PAK 29229741 PAK 003G01 4707158j PAK 003GOI 47071581 PAK j 003G02 j 5428282 PAK". 003G04 5649040 PAK 003G05 4333811 PAK 003G06 2581798 PAK 003GO6 2581798 PAK 003G07 648767 PAK 003G 10 _ 5758975 PAK . 3 003G11 6015681 PAK 003G126139731""PAK ! 003H01 3445197 PAK ! 003H02 1525921 PAK 003H03 _5315736 PAK =t v 003H04 i 1291849 PAK 003H05 30684 PAK 003H06 3266054 PAK 003H07 20494561 PAK 003H08433381 PAK 003HO9 _ 879532 PAK 004A01 j 1566541 PAK 1566541 PAK mE 004A04 45765 PAK i 004A05 1 5735233 PAK W 50757161 PAK OOM07 H1B7PFT o m 004A08 34717401 PAK R 004AO9 i 2271949 PAK 004A10 1 2796245 PAK 004A11 i 4454450i PAK 004B01 59512381 PAK 004B02 1 1351 731 PAK 004B04 433381 PAK 004B05 ; 2s4sss7í PAK'. 004806 7323791 PAK 004B07 4316856J PAK i 004BO8 4550848) PAK'1 'D04B09 5223972j PAIC 004B12 4544326 {PAK 004C01 j'329317T PAK 004C03 1_ 18355201 PAK 004C04 i 21883431 PAK 004C05 1 30473741 PAK 004C06 1 531 5858i PAK 004C09 1 1460144s PAK 004C10, 2049699 ! PAK 004C11, 5988345j PAK 004C12 is 11045794 PAK 004D01 ; 751552 ! PAK ,. _ st 004D02 t 3944498'j PAK 004D03 1 18837541 PAK 004D04''910624, PAK 004D05 i 5437535i PAK ) 6--, r---50971891 PAK 004D06 50971 89i PAK 004DO7 5397511 PAK 41937331 PAK } 004D08 j 4193733 PAK 004D09 3400490s PAK 004D10 53082841 PAK 004D11 5859357'j PAK {'004D124364415 PAK' 004D12 4364415i PAK 004E01 3312704j PAK 004E04 1566516@ PAK t 004E05, 5799481 PAK t 004EO6 8977811 PAK j 004E08''"11660541 PAK"1 5865140 004E09 5865140j PAK Æ so 004E10 2471733 PAK 004E11 5956163i PAK 004E12 1653588i PAK ' 004F01 58651451 PAK 004F06 1122958 PAK H 004F07 1884758 PAK 004F08 1 1561871 PAK ! 004P093723875 PAK 004F11 1 1034468, PAK 004F12 i 3047374 PAK 004G02 6100910 PAK . 004G03 3885608 PAK 004G06 5004165 PAK 004G07 629956i PAK .-2231219t PAK'. v 004G11 5772930 PAK 004G12 ij 392997'j PAK 004H02 1 595508i PAK 004H03 1595 8 PAK s 004H04 36354031 PAK 004H05 5988173 PAK 004H06 1621975 PAK E 004H08 5150834 PAK 004HO9 422703 PAK 004H10 5511104 PAK ----l 004H11 395319 PAK PAK 005A01 6121 145 PAK 005A02 4637976 PAK 005A03 1 52516561 PAK 005A04 1358579i PAK __.. _. ____ _. _.,' 005AO5 2826665i PAK 005A06 351028J PAK" 005A08 2009564 PAK"" 005A09'1779817 ! JPAK 005A08'20095643 PAK 005AO9'1779817j PAK 005A11 4 2636229i PAK 005A12'3726006j PAK 005B03 ; 4797603'j PAK 005B05 s 14235781 PAK '005B06 i 1 086897Si PAK 005B07''3463110 ! PAK 005B08 i 1490094 PAK 005B08 PAK 005B10 681527i PAK OO5BlO PAK 005B11 i 2537467 PAK 005B12 j 6223150 PAK HDb2 1445969 PAK'i 005C03 1 6112259i PAK 005C04 i 41 04568i PAK = si 005C07 j 260868 PAK 005CO7 260868 PAK 005C08 1 165991 5j PAK 005C09 697833 PAK 005C10'36426691 PAK 005C11 543492 PAK 005Cl2 543492 PAK ' 005D01 1739361 PAK 005D02 4375879 PAK e 005D03 i 2854969 PAK 005D04 3183786 PAK 1 005D05""'"3715903 PAK'""' ii 005D06 i 4549325j PAK 005D08 j'806743S PAK : j OQ5D105054137j PAK : --- 005D11 5218315i PAK 005D12 49814891 PAK-. 005E03 747595 PAK 005E04 1991244 PAK 005E05 747595i PAK 005E06 1 59459 PAK 005E06 I 5945978 PAK ; 005EO9 1868247 PAK 005E09 1868247 PAK 005Ell 3306428 PAK 005E12 947510j PAK 005F01 32258561 PAK 005F03 1309650 PAK 005F04 3709087 PAK 005F05 50778811 PAK 005F08'i 16808651 PAK 005F10 __ 2185333 PAK , 005F11 4299947 PAK 005F12 1 1130487 PAK 005G02 501 8107 PAK 005G03 i 4422899L PAK :.... _... __.. ____ _, 4517577' 005G07 _ 5059743 : PAK 005G08 i 1843340 ! PAK 005G09 i 6107697, PAK 005G 10'w PAK 4364428 4026064 ; 005G12'1099396, PAK 005H03 62142748 PAK 21445201 PAK 005H05'1 807286j PAK . 005H06 i 1807286'PAK 45i PAK 005HO8 36996 005H10 1 1515737 PAK 005H11 i'3953191 PAK 006A01 6231371s PAK DEMZ 34023031 PAK 006A04 2079699 PAK 006A05 2008375 PAK 006AO6 433381 PAK 006A08 35921391 PAK 006AO9 3453875j PÅK ii 006A10 794950 PAK 006AO9 3 006A11 5819801 PAK j PAK 006A12 3468427 PAK 006B01 1966899 PAK 006B02 31601 10 PAK f 006B03 2955666j PAK oU n 006B04 j 3511738 PAK j 006B06 247151 5j PAK 006B06 2471515j PAK ! 006B07 2048265) PAK ! !"006B08 ! 2469575) PAK 006BO9 6964921 AK 006B11 166848 PAK 006BlO 006BIl 166848 PAK 006B12 _ 47J 41112_ PAK _ 006C01 433381 PAK 006C02 _ 4064994 PAK '006C03 1280374 PAK J w 12Bos 006C04 35964401 PAK 006C05 1442814 ! PAK 006cl7 5774971 PAK 006CO9 1784068 PAK 006ClO 2240534 PAK 006C12 j 4047002 PAK 006D01 v 4070007 PAK 006D02 6085314 PAK 006D03 1150463 PAK 006D05 3610871 PAK i 006D06 5310625 PAK 006D07 517361 PAK i 006D08 2892863) PAK ! PAK 006D10 1 2229992 PAK ! 006D11""'1'1878712 ! p-- ! 006012 !"" 3916203'PAK _. 006E01 147621 S PAK 006E02 3 147622j PAK 006EO2 1476221 PAK 006EO3 6881081 PAK il 006E04'j 688115i PAK j'006E06"-----5023473 j pAK'" 006E06 _ 006E11 4844174, PAK 006F03 6230087 PAK 006F06 6257292 PAK 006F07""3086149J PAK i 006fiv 3020409 PAK 006F11 5211588 PAK 006F12 5211588 PAK PAK 006HO3 22645761 006H05 5597985l PAK l 006HO6 006H10_ 433382s PAK íj "007A01 5912381 PAK 007A02 4996527 PAK 007AO3 2506689 PAK 007A04 5047557 PAK 007AO5 356486 PAK 007A06 51 1912C PAK 007AO8 5119129 PAK 007A09 1 1241181 PAK'i 007A10 1116321 PAK 007A11 5531202 PAK'"" 007B03 381725 PAK 007B04 5202438 PAK 007B07 | 10883801 PAK 007B08 * 761021 PAK'"'" 007B12 319136 PAK 007C01 4999394 PAK 007C03 5925605 PAK 007C04 X 3147742 PAK 007C05 r 1296405 T s M| 007C06 6009818 PAK 007C07 1 4964806t PAK 007C08 j 1820366} PAK 007C12 L 5906710 PAK 007D01 981051 (PAK 007DO1 9810511 PAK 007duo2 1 5864257j PAK w7cw 2R27>- 007D05 2610279 PAK'i 007D06518876 PAK 007D06 518876 PAK 007D11 v HK 007DO9 6104097 PAK , 5998366 007D12 1 59067101 PAK 007E01 59067 1 PAK 007E03 ! 3039779 ! PAK 007E04 ! 2817098j PAK 007EO6 33642201 ! PAK 007E06 i 33642201 PAK r"-'007EQ7------T-----2Q73712J'pAK"" ! 007E08''''5437249 ; PAK 007E08'5437249j PAK 007E09 7<R i, 007E12 í 20072731 PAK _. ____. _. _. 007FOI 59329751 PAR" 007FO2 25693091 PAK 007F02 J2690178 PAK ; Hx 007F03 i 26901783 PAK 007FO6 2818631 PAK 007F07 1 21452751 PAK 007F09 1 5736865 PAK 007F10. 12162393 PAK 007Fll 2268589 PAK 007G01 i 2597565 PAK _ ! ____ PAK st} 007G03 433381 PAK 007G05''5802881 PAK' 007G08 49760581 PAK 007GO9 5862511 PAK 007G12 5053880 PAK 007H01 1138641 PAK 007H06 i 3395040 PAK 6160185 PAK 007H 09 1472036 PAK W7<7 PAK 007H11 395319 PAK X 008A02 3 1401775, PAK 008A02 11401775 PAK ! 008Ao3 5533650 PAK 008A03 5533650 PAK 008A06 1220616 PAK 008A09-.. y- 5177910j PAK 1427316i PAK 008A11 i 5391551 PAK e 006A12 3266259 PAK 008B02 3196439 PAK 008B03 5908754 PAK 008B04 1306276 PAK 008B05 2293871 PAK 008B07 302152 PAK'. 008B08 21 26711 x4 008B09 1506280} PAK !. 006B10 w PAK 11 PAK 008B12 5052784) PAK'"i 008COl 1445520 ! PAK) 008C02 1530109 PAK ! 008C04 5760742 PAK"1 008C05 4119860 (PAK 008CO6 59845801 PAK su8cwT tH PAK 008C07 L 3521 EL PAK 008C08 i 331 6846i PAK 008CO9 54145291 PAK 316347711 PAK 008CIO 008C11 31966821 PAK '"Il°8C09 T 5414529) PAK'' 008C12 ; 1 340468 ! i PAK PPSdjL 3196682) PAK QOg ;- 1340468""--- 008D02 ! 4004133 PAK PAK 008D03 jj 19500361 PAK 008D04''15852281 PAK 008D05 Xi 2700127ii PAK 008D06 57837531 PAK 008DO7 3758033 PAK 008D09 1 20940951 PAK r"008010'""'"j'""""'1540459)"PAK 008D12 1 38997741 PAK 008E01 1 1262833 PAK'. 008EO2 2020234 PAK 008E02 2020234 PAK 008E03 31579553 ; PAK 0008E05 61413931 PAK 008E06 1904921 PAK 008E08 5262133j PAK w t 008E10 2843945 PAK 008E. 11 6067378 PAK 008E12 5838321 PAK 008F01 [_ 2509916s_ PAK..,. 008F02 2951706 PAK 008F03 59661383 PAK 008F04 56674621i PAK 008F06 1010280 PAK 008F07 4170604 PAK ) a 878841 PAK 008F08 878841 PAK 008F10 5170483 PAK m 008F11 1 19252181 PAK 008GO1 4364130 PAK 008G01 43641 30j PAK 008G02 1233542j PAK 008G03 38312943 ; PAK s 008G06 2375310 PAK 008G07 5236287j ; PAK 008G08 7032191 ; PAK 008GO9 34273821 PAK 008G11 3471740 PAK 1 3'i 008G12 5928996 PAK 008H01 5158949 PAK Lo 008H02'4505522'PAK 008H03 3202850 PAK j 008H04'""6026655 PAK" ! 008H055044220 PAK t 008H06 j 54261611 PAK 008H071513042 PAK' 008H08 3194944 PAK 008H09 6228340 PAK 008H10 2423594 PAK ! 008H11 395319 PAK' OO9A01 46182141 PAK OO9A02 5247824. PAK OO9A03'42737933 PAK ____. __. __ OO9A05 í 5793024j PAK 009A06 12356031 PAK 3 OO9A07 i 56839513 PAK 009A08 179152'PAK 59447651 PAK 009au9 ; 009A10 179152'PAK 009A12 755224 PAK S"009B01''3727745'"'PAK 1 OO9B02 17050853. PAK 009B03 F 212212 ( PAK j t. _ 009B02 i 009B04 r-1 100801 PAK 009B05 1 100801\ PAK i ! t !'009B06"'931243 PAK ! 009B07 2902526 PAK" ! 009B10 2903004 PAK o 009B11 i6036075 PAK j 009B12)'4839325JPAK" 009C02 4849653 PAK 009C04 61928501 PAK 009C05 4865184 ! PAK OO9C06 51888673 PAK 009C07 3 5950052i PAK 009C10 861532 PAK j o 009C11 1002811 PAK ! OO9C12 4839325 PAK | OQ9D021896144 PAK 10011591 PAK 009D05 5398428 ; PAK OO9D06 3 5831979i PAK OO9D07 5359312 ! PAK 009D08 3014940 PAK OO9D08 3014940 PAK OO9DO9 2839554 PAK 009DlO 3462293 PAK 009D11 4907028 PAK 009E012492946 PAK OO9E08-16475681 PAK 009Ell 324834611 PAK e H t OO9E12 5712210 PAK 009F02 109260 PAK OO9F03 5700966L PAK 009F06 5370056 (PAK 009F07 3885693 PAK 009F08 ! 1034469 PAK 009F10 2728956 PAK 009F12 5935938984 PAK 009G02 5289936 PAK 1130281 PAK 009GO4 37976501 PAK 009G07 6002903° PAK ---r-ro0029031 OO9G07 6002903 ! PAK 009GlO 37220091 PAK 009Gll 51201952 PAK 009H01 ! 4079716j PAK 1 009H02 4079717 ; PAK 009H04 2696078i _P_AK § _J OO9H02 i 40797173, PAK OO9H04 2696078, PAK OO9H05 807759, PAK OO9H06 1 902991 PAK 009H08 J 3835217 ! PAK j 009HO9 30198131 PAK 009H10'""""T4591512' PAK""] 010A01 5515754f PAK 01 OA01 55157541 PAK j 010A021123336 ; PAK j 5 l 3 010A03 113028 PAK 010A04 3 5391549 PAK p 010A05 3671325J'PAK'J 010A07 113028 PAK 010A08 j 343533J PAK J 010AO9 353366j PAK 010A10113028 PAK 01 OA11 4004274 PAK 01OB02 113028 PAK 679285 010B03"1679285 PAK" ! 01 OB04 3109769 PAK 010B05 2132942 PAK 01 OB07 5743385 PAK 3 010B09 3 5391551, PAK X 010B10 3 1612404 PAK 01OB11 5391551, PAK 010B12 2801075i PAK 010C01 V 1034469 ! PAK ; 4 010C03 4229262 PAK 010C04 5670267 PAK j v 01 OC05 i 5003539 PAK _ ; __ '-010C07 914343 PAK F 010C08 PAK 010C09 1365470 PAK ; 010C12 3969922 PAK 010D02 3567982"'"PAK 010D03 1097715j PAK E 13 010D04 58216921 PAK 010D05 2058204 PAK 010D06 1853936 PAK 010D071853936 PAK ! 3 ! 010D091395857 PAK 3 010D10 1 37767551 PAK il j 4 01OD12 2913045 PAK w 3 2913045 PAK v ; M j 010E02 5391551 ! PAK"1 ! _,...., _, 010E04 s ! 5391551i PAK s 01 OEO9 7 53915513 PAK 7 01 OE10 1 468921 3i PAK i s 010E12 s 6127828i PAK 01 OF02 1 38407853f PAK 6086307 ! PAK 3 01 OF03 60863071 PAK 7s 01 OF04 1 5865699j PAK 01OF05 23402811 PAK rn oioFo7''""'"r'"'"4373594 pAK ' 01 OF07 1 4873594 PAK 01OF09 11701981 010F11 _ 113028 ; _ PAK 01OF12 PAK 010F12 53915513 PAK t010G02'"'""'"113028) PAK'"" ! 01 OG02 113028 j7 PAK s j 010G03) 3603752J PAK J 010G04 7 2326169s PAK 010G05 3 5391551 PAK Ss _..., 010G06 55443731 PAK 010G07 5097690f PAK ; o w m 01 0G08 2880371 j PAK 010G10 409856 PAK ! 010G11 5391551"PAK''J 010G12 44155907 PAK 01 OH01 6180761 PAK 7s 01OH02 113028 PAK 010H03 2324609 PAK 3_ e J 01OH04 5391551j PAK e 01QH05 5391551) PAK" 010H06) 4111582 PAK 01 OH08 3569426i PAK 01OH10 4158204 PAK 011A01 i 53915511 PAK -l z 011A02 L 2898386f$ PAK s ! 011A03"5391551 PAK 011A05 f 1431229 PAK 7 011A06 15875813 PAK 3f3 011A07 3974570 PAK .. _. ___.. 011 A08---... __. ____ 2319023 PAI< '_. _... a 011 A08 231 9023 PAK 3 OlIA09 4706922-A K-' r 011A10 5391551 PAK 011B02807830 ! PAK) 011803 5803345 PAK 011B04 5391551 PAK f 011B05'5823675 PAKj -719 5SZM75 HAS _ 011B06 i 53915513j PAK 3 ! 011B07'5391551 PAK f-3 j011 BOS 1404440 PAK ! 011B11113028 PAK j 011B12 5391551 PAK 011C02 53915511 PAK 011C03 j-H3028J'PAK J ! 011C04 ! 4884564 PAK" ! 3 011C05 L 5197600i PAK L. _____ __. _. _ _____ 011 C07 5391551 a PAK 011C07 5391551s PAK 011 CO9, 5391551 S PAK !'"011C09"'""'5391551"PAK" 011 C11 sj 113028$ PAK oiicio 5391551 PAK f 011 D01 11 88885S PAK 0 11 DO 11888851 PAK s 011D02., 1629363s PAK 011 D05 1 5391551 PAK -"' 011D06-.-"-5391551"pAK"''. s 011 DO9 48988401 PAK OIIDII 1130281 PAK 011 E01'647899 ; PAK 011E01 j 647899 PAK. 011E02'""1961215 PAK'1 s 011 E03 5391551 PAK s 011 E05 5391551 PAK s 011 E07 5391551 PAK 011E08 !'1397790'PAK 011E095391551J pAK"" i m 011E103484613 PAK 011 E11 1703765 PAK 011 E12 5391550 PAK 011F015391551 PAK 5391550 PAK, 720447 PAK 011 F03 011 F04 5391551 PAK 011F051095136 PAK s 011F06 660912 ! PAK 011 F07 5391551 PAK'f 2696404 PAK , V 011 F08 t 011 FO9 709465 ; f PAK ts wos 01 1F11 5391551 PAK t 011F12 5391551 PAK _ _ __-, 011G03 ; 4699702 PAK j 011G0521978 PAK 01 05 011G07113028 PAK H | 011G08 5391550 PAK 011G09"''721418 PAK") 011G11 5391551J PAK j s 011G12 5391551 PAK 011H015391551 PAK 011H03 5391551 PAK 011 H04 5391551 PAK 011H05 53915511 PAK 011 H06. 113028 PAfC __ ; so bis 011 H07 1'4585053S PAK f 011H09 1 53915511 PAK ) 011H10 5391551 PAK ! 01 2A04 s 53195031 PAK 012AO5 731 012AO6 8211341 PAK ---4394536 AK 012AO7 012A12 i 20128841 PAK 01 2B01 369021 9i PAK 012B05 t 3885693i ! PAK 012B06 ! 49789741 PAK 012BO5 3885 012BO6 4978974i PAK 012BO7 36934351 PAK """"""012B08 !'915061"'"PAK'"""" ; 01 2BO9 s3 2488381 ! PAK 012B1Q J 4444Q32 PAK 1 012B1 1 ì 59693501 PAK s 012B12 s 44440321 PAK 012C05 3 3676968j PAK f r 01 2C06 fi 5076344 PAK s 012C07") 5275801 j PAK ! 012C08'"716532 ! PAK'""1 01 2C10 5532453 PAK 01 2C12 5856125 PAK 012DO2 2605217 PAPAS 012D03 6219887 PAK 1 012DO3 012DO5 3676968 PAK zJ 0012D06 5076344 PAK r 012W7 5275S01 PAK 012DOB 716532 ; 012D10 5532453 PAK s 01 2D10 i mK-! f 012D11 5280104 PAK 012E04 4 5290122 PAK 012E08 5204468 PAK 012E10 526706 PAK 012E11 5868065 PAK 012Ell PAK 012E12 167550 PAK 012F07 1597750j PAK ''012F07""1597750 PAK ! 012F08 5139506 PAK 01 2F11 542500 PAK., 012Fl2 5796929 PAK 012G02 1621935 PAK 012G03 3216742 PAK 53712771 012GO8 TA K 012GO9 362164 PAK 3 ! 012G10602919 PAK s 012G11"'1078985 PAK 01 2G12 533509j PAK 012HOl 4542767 PAK '012H02 1110594 PAK 012H03 1878963 PAK } 012H03 1 1878963 PAK_fj L 012H06 r 5978919 PAK 012HO6 012H07 i 5369447j PAK Si v § r _rrrrr-S r 012H08 6098130 !'PAK 7475821 PAK I 012HO9 j 012H10954479 PAK 012Hll 59025081 PAK 01 3A01 3 800844t PAK 013AO2 59089611 PAK , PAK 01 3A03 3_ 62055171 PAK ------------ 01 3A04 T 441 9033r PAK '_ 013A05 m 6084970 ;-PAKA fish 01 3au4 5162666 ; PAK ', 01 3A06'f 852272e PAK 013A07 t 5 _ < 013A08 ! 2870523"PAK'i 013A09 ; 3187469 ; PAK 01 3A10.. 60240275 PAK f 013A11 38799651 PAK 013A11 3879965) PAK'' 013A12"'"'""4447098'"pAK"""" 013BOI 53694481 PAK 013B02} 614648 ! PAK, 013B04 1893982 ! PAK : 013B05 1 5471374t PAK 013B06 4036534J PAK ! 013B07'S242983'PAK 'i 01 3B10 5609996 PAK f 01 3B11 _5 5523251 PAK 013C01 5436102 PAK 01 3C02 5932975i PAK _ 013C04 2559803i PAK 013C05 1163038) PAK 1 01 3C06 ! 273331 ! PAK 01 3C07 f 48766441 PAK 01 3C08 3994085 ! PAK 01 3CO9 60815711 PAK X 01 3C10 5948078l PAK 01 3C11 i 2505785 PAK <iL 013C12 1 32192352 PAK 013D01 1 1581831 PAK 013D02 4571208t PAK 013D03 4163619, P_AK_ 013D04 L 5195351 PAK .. __. _ 013D05 5804720 ! PAK ! 013D06 4545468 ! PAK i 013D07 479428s PAK 013D08 5748672'i PAK 01 3DO9 PAK 145978p'PAK-. w 01 3D10 6090276, PAK 01 3D11 15550861 PAK', 013D12 6210466i PAK 01 3E01 2216724 PAK 01 3E02 5997074f PAK ; 013E04 5005930 PAK 1 01 3E07 2519548 PAK t-01 3E08 2365956 PAK 013EO9 1136241 PAK 013E10 645265 PAK 01 3E11 3672743 ! PAK'i 013F02 60921471 PAK 013F04 ff 916B70 ! PAK 5 01 3F05 4276230i PAK 013F06 974863 ! PAK') 01 3F08 _ 1 2900554fi PAK 013FO9 i 2016407'i PAK 3 01 3F10 342351 9j PAK 01 3G03 1 661 997i PAK 3231365 PAK, 013G04 01 3G05 1 4869306i PAK 01 3G06 ! 21058673 PAK 3617181i PAK 013GO7 i i _.. _.. __.. __ 13G08_. ___ i 3186074 pAK-. 013G10 1 76731 PAK an-tS 013G11 3 5858905 PAK 3735863 PAK 013H02 4789971 PAK,. s 013H03 1 3216741 PAK 01 3H05 419757 PAK 3 01 3H07 j 4078724 PAK i' 013H09 j"381467 PAK) P 013H11 2051342 PAK 013H12 3953191 PAK 014A02)"4854459 PAK 014A05 3715912j PAK l i 01 4A06 1 50450943 PAK t 014A08 | 1674912 PAK 014A10 1 1311742 PAK 014A12 4208 PAK 014B01 5968741ii PAK i 014B02 l 1819429j PAK ; 014B03 75214i PAK 014BO3 752141 PAK 014B05 1086960 PAK 01 4B06 4444809 PAK f 014B07 1235195i PAK 014B08 _ _ 4174090j PAK 01 4BO9 i 2492651 fi PAK f 014B10 j 2290579 ! PAK 014B11 45401401 PAK 014B12 2877350 PAK 01 4C02 30149823 PAK if 014C04 5999079, PAK 014C05285020 PAK L 014C06 ! 1138274 PAK 014C08 4208719 PAK 014C08 4208719 PAK 014C09 6137118 PAK 014CO9 61371181 PAK 014C11 1383921 PAK 014C12 734720 PAK ___ ___ ___-_--'f 014D02 2542978 PAK 014D03 3147545) PAK f ff 014D05 57856061 PAK 014D06603462 PAK 014D07 3606734 PAK 014D08 1877722'PAK J ! 014D09 1395225 PAK'j j 014D10 3465130 PAK J 014D12 2924666t PAK _m 014D11 1761895i PAK 014D12 t 2924666i PAK 014E01, 3498508ì PAK 014E02 j 5818308$ PAK } 014E04 i 4711093 ! PAK : PAK 014EO9 i 644912 ! PAK -59778194 PAK 014E11 ! 812886J PAK : 014E12 f 178912j PAK 014F01 C 4396106j PAK 014F02 i 4044701i PAK !"014F03 J'4369528) PAK" 014F04 Ri 1100801t PAK 014F05 3 3040618j PAK'. 014FO5 014F06 i 11163563 PAK 014F09""5319457 ! PAK"1 014F11 1 986202j PAK 014F12 f 1167213j PAK ii 014G01 4979503 ; PAK ! 014G02 1916999 PAK 3 014G04 560993 PAK _ 014G06 59612601 PAK 014G07 3 19616 ! PAK 3 014G09 3 1272235 PAK if 014G10 1 3323089 PAK f f 014G11 T5979829 PAK 1 014G12 1 1224072i PAK 3 014H03 46237061 PAK 014HO3 014H04 23175273 PAK 014H05 3 34074321 PAK 014H06 ! 2417526j PAK L 014H07 1 4408092 ! PAK 014H10 4623706j PAK 014H11 4596084 PAK m 015A01 5522165 PAK b 015A05 5918131 PAK ! 01 5A06 5004735f PAK 015AO7 01 5A07 2327789if PAK n 015A10 6170456. PAK 015A10 6170456 ;. PAK 015A11 14601441 PAK 01 5B01 5938984j PAK 015B02 2996734 PAK 015B04 711795J PAK j 015B05 5178911 PAK"') q 01 5BO9 5292137 PAK 015BlO PAK 015B11 4115981 PAK ; 01 5B12 1010781 PAK', 01 5C01 i 58354651 PAK 015C02 17891021 PAK 3 01 5C03 4875596i PAK 015C04 51714111 PAK 015C05'_ 2271694i PAK 015CO7 14979684 PAK 01 5C08 j 2429830 PAK 015CO9 f 14601443 PAK : : 015C10 3 62123201 PAK 015C12 i 56575493 PAK 015D01 _ s _ 5835465f PAK 015D02 6213520 59061551 PAK r 01 5D04 i 4180794 PAK 3 015D05 ! 22716943 PAK 015D06'5031841 PAK 1 015D07 j 1497968| PAK 015D08 2429830 PAK 015D10 6212320 PAK 9 015D11 1 320315 ! PAK 015D12 i 2007273j PAK 3 H J 01 5E01 3 2200575 PAK 01 5E02 514461 PAK ---9 01 5E03 4898840 PAK H S 015E04 6023617 PAK z f 015E07, 1132845 PAK ; 015ElO 592214 PAK ; 015E12. 350892PAK 015FOl 5304135 PAK 015F033573515 PAK 015F06 01 5F07 3 2656739j PAK f 015F10 f 2180374, PAK 015F11 6168996 PAK f 01 5F12 1 1010607 PAK 015G01 | 6487543 PAK 01 5G03 5146352 PAK S 01 5G04'57894353 PAK ff 015G06 56831721 PAK 015GlO 5005509 PAK B 01 5G10 5005509i PAK 01 5G12 5005509 PAK r 4 fi 01 5H04 469200 PAK 015H07 1623332 PAK f 935687 PAK - 015H10 58865511 PAK i, ) 016A02 794261 PAK j r"016A03''"1173402 PAKJ j 016A04 1034469 PAK 016AO5 2325018 PAK i I 016A06 1460144 PAK ; '016Afl7 _ 5064891 PAK ;. _..... _... _ : 3 016A08 Le 5362271 PAK 016B01 i 1460143j PAK 016B02 3 ftL PAK 016B02 636345J PAK t 017B01 4136702 ! PAK 017B02 ! 5066149 ! PAK' 017B03 if 46246123 PAK ; 017B08. F. _. ___. ___ 565077,.. _. PAK.. __.. , 17B09 . '... _. ___.... i_.. ___. __... _... __. _ 5379478 ! PAK 017B08 ! 565077JPAK'" 017B09'r""""""5379478 !"''pAK'""' 017B10 j 55379551 PAK 017B12 Sl 5586757i PAK 017Bl2 55867571 PAK r 017C01, i 1034473 PAK 1034473 PAK 01 7C02, 4519101 PAK 01 7C03 6021646 PAK e e 017C03 J'6021646 PAK _ e ee 01 7C05 i 1750668 PAK r 017C08 3274923 PAK 0 017C10 2891663 PAK f-'e ee e 017C11, i 564914 PAK E 01 7C12 L 3139771 PAK . _.... ___ ___. 017D01 fS 4106825 PAK 017D02 1 8351141 PAK 017D03) 3124696J PAK 1 017DO4 4244318 PAK 01 7D05 5958291 PAK 017D06 1156076 PAK 017D07) 5369448 PAK 017D08 571222 PAK f 017D10 2483755 PAK e eiee e ___ 017D11 1964084 PAK 017D12 2568161 PAK 01 7E02 465565 I PAK 01 7E04 61 61205 PAK 01 7E05 ; 5735984, PAK 01 7E06 3596336 PAK'. t 017E07 58971 ! PAK 017EO§------970805 PAK e_e e e f 01 7E10 3626396 PAK 017E11 3874111PAK' i. 017E11 3874111 PAK f 017E113874111 PAK 017F01 1991658 PAK f 017FOI 91658i PAK 01 7F02 13287701 PAK 017F03 3440887 PAK e e- 017F04 5315430 PAK fj 01 7F05 i 40533 ; PA 017F06 4348188 PAK . e e f _^S u i i rut) 017FO7 44952831 PAK f 017G02 i 5313098'f PAK 017G04 5347122 PAK 017G06 3578962 PAK L. I 017G07 3578962 PAK _ 017G08 3240059 PAK 017GO9 5354422 PAK 017G12 j852272'"PAK' : , j 017H03 2997910 ; PAK 017H04 5188419t PAK ; 017HO6 2940676i PAK L'0''7H08 !""'2548132 ; PAK" 017HO9 1796309 PAK 017HIl 41600451 PAK f""018C01'""1"5969351J'PAK"'"' (018C03" !. 1991658 ; PAK i 018C04'', 3689170i PAK' 018C04 í 3689170aa PAK ,, 01 8C05 j 20102631 PAK 018C07... _i. _.. _.. _ 202189 __. PAK,-^. . . 018C07 ff 12021891 PAK 01 8C10'60707741 PAK 098C11 i 5878669 PAK < ~ 01 9A04'5290540 PAK f 01 9A05 ! 368352 PAK 019AO5 3683521 PAK 019AO8 659142 PAK 019A09 j 4014611 PAK L E 01 9A10 2016407 PAK f 019A11"f'5371154'PAK 019All 1477010 PAK 01 9B01 6092460 PAK 019BOI 6092460 PAK 019BO2 6092460 PAK 019B03 884055 PAK bt 019B04 38041 PAK 01 9B05 ! 366569212 PAK 019B06 a359y PAK 019B07 13088281 PAK 01 9B08 5938984 PAK 019BO9 s j019B10 J 503484 PAK 01 9B11 1 3940297'PAK 019C02 3792100 PAK 019C03 940225 PAK 01 9C04 5244238 PAK 01 9G05 ! 4337422 PAK 019C05 4337422 PAK 019C06 3033131i PAK 019C09 T5163695 PAK 01 9C11'1 368996 PAK 019C12 5938984 ! PAK f s 01 9D02 4248315 PAK 019C12 5938984 PAK , 019D03 5938984 ! PAK !-. _ 01 9D05 2789814 PAK 019D06 3225681 PAK zu 1679524 PAK 019D07 16795241 PAK 019D10' _i , w. 01 9D11 1 5980181 | PAK 019D12682403 PAK 019E01 4396977 PAK 019E02 1914294 PAK 019EO3 4645221 PAK 01 9E04 f 4455438 ! PAK 01 9E05 1 3379083f PAK 019EO5 33790831 PAK 01 9EO9 i 5392754S ; PAK _ _ 019E09 ". . 019E11 ! 5938984 ! PAK'"' 984 ; 019F01'4396977f'PAK 019F02 ! 1747643i PAK 01 9F03 i 6029230ii PAK ; 019F04 1'4444027 ! PAK -01 9F04 1 4444027i PAK 019F04 4444027 ! z PAK 019FO7 3174550'PAK !""""'019F08 5418654J PAK"' 019F09 5938984 PAK 5938984 PAK 019F10 019Fll 544 PAK _. _. ___.. . _- 019Fl2 13077591 PAK 01 9G03 7012971 PAK 019G04 40037791 PAK 019G05 4360435 PAK J 019G06 59389831 PAK 019G07 5938984i PAK Hi 019G08 5938984 PAK 019G09 (5887396 PAK, 938984 019G11 1 5938984 PAK 019G12 i 1307759 PAK 01 9H01 5938983 PAK 1275418-PAK 019H03 PAK 019H04 5938984 PAK 019H05 1145752 PAK f d w 019H06 1 5938984 PAK 01 9H08 i ; 5938983 PAK 019H10 42820001 PAK | t 021A02 30716001 PAK 021 A03 _ 2950202 ; PAK _' 021A05'579496 PAK'1 41489251 PAK 4-0 021A07 1446923 PAK j b F 021A08 1878971 PAK j 021 AO9 14017751 PAK 021A11 5593801 ; PAK 021A12 6000256 PAK ! 021 B01 t ; 603281 ! PAK 021 B02 4927535 !""" PAK 021 B03 39675851 PAK'; 021 B04 968147i PAK Lw o o ji 021 B05 5994281 B ; PAK __ __ _______ 021B06 4611237i PAK 021 BO9 5653202 PAK 021 B10 596083 PAK 02lBlO 596083 PAK 021 B11 i 4306140 PAK 3808062 PAK ! 021 C01 1760212 PAK j 021CO2 37539881 PAK , : !""021C64"3598518PAK ! , f_. _. ____. _.... 021C05 ! 4388018i PAK . 021 COg....... _.. ;. ... _... _.,. . . 5169602,.. -PAK. w. r'021C08'"""5169602''PAK L 021C09 3390625 PAK ,. __. __ 021C11 .. °. __. _____ 2608842_. ____ PAK <. 021C08 i 51696021 PAK 021 CO9 j 3390625j PAK 021C11 2608842i PAK !"'021C11"2608842 !"""PAK 021 D04 ? 9200431 PAK 021 D05'6146637i PAK ? 021 D06 j 248536i PAK f F 021D08 ! 4431627i PAK 021D10 j 310215f PAK ""021 D11 ! 2470939) PAK 021 D11'2470939i PAK 2470939'PAK Z 021E02 4997801i PAK 021 E03 57547291 PAK 021 E05 ! 14573701 PAK 021 E06 m 4628283 (PAKv 021 EO 1847010 PAK 021E07 v 1847010 ? PAK 021 E082489769 PAK "021E10392789 PAK 021EI0 392789 PAK 021 F06 51365341 PAK fj 021 F08 1771189 PAK e 021F09 4883025 PAK 021 F11 2522 9 PAK _ ; ? 021F12 6085503 ? PAK 021G01 6104643 PAK 6 021 G02 178851 PAK _ 021 G03 ^_"w. w w, _ 2522269 y_. PAIC.. _ ; 021 G03 2522269 ? ff PAK ? 021G05 1577478 ! PAK 021 G06 404874j PAK 021 G07 577497 PAK J'021G09 4103187 PAK" 021G10 3148097 PAK Q21G11 f""186052 PAK 1 021G12 ! 1086539J'PAK i 021 H01 25013951 PAK ? 021 H02 2522269 PAK H 3872613 PAK 021 H04 3872613 PAK 021HO4 3872613 PAK 021H05 1001912j PAK 021 H07 3753989 PAK ? j 021 H08 2522268 PAK j 021 H10 703214 PAK 023A01 j 1873208 PAK _s ? 023A02 1248256 j PAK 023A03 5307512i PAK 023A05513571 PAK 023A06 4443361 PAK 023A07 i 57412461 PAK ! 023A08 334359J'PAKi ? 023AO9 j 5891154'PAK 023AI0 16994571___ PAK 023A10 1 16994571 PAK 023A12 f _ 5998196# PAK _ 023A12 ! 5998196i PAK 023B02'1 687395i PAK fj 023B03 1574073 ! PAK 023B05 f 5057305 PAK ww < wFwwwwFww 023B05 ì 5057305 ! PAK PAK 023BO6 15205231 PAK 023B07'r 4549995j PAK f""023B09r"''5369448)""PAK"""" 023B10 i 3994085fj PAK 37289 023B11 jf 37289021 PAK 023C01 gf 3233482 ! PAK 023C02 j 41 63973j PAK 023C03) 3667874 PAK wwwwwwwwwww- 023C05 i 2578745 PAK z jf.. 023C06 i 3664490 PAK 023C07 f 1890482 PAK 023CO7 I 023C08 i 61 11439 PAK s 023C09 5034140 PAK 023C10 875574 PAK 023C11 4691338 PAK 023C12 5937879 PAK 023D01 302987 PAK 023D02 5513649 PAK j ; 023D02 5513649 PAK 023D03 1 1494250 PAK S wwws 023D05 3276337 PAK 023D064733116 PAK 0 PS H 9F 023D07 5464629 PAK 023D08 374285 PAK 3742851 PAK 023DO9 180610 PAK j_ 023D10 ! 32351221 PAK li 023D11 L 3847723 PAK 023D12 850932 PAK 023E01 4957043ii PAK ---wwww 023E02 577282j PAK 023E03 34271141 PAK 5137507 PAK 023ex2 q 023F03 1 3167836 PAK ww 023F08 ! 31678351 PAK iwwwww - wwwwwwwwwwwJ PAK i w w 023GO7 1814047ii PAK', '"023G12"r"2385112 PAK j W m wwwwwwwwnowwwwwwwww-w 023H02 1 1430988 PAK r 023H03 6092304f PAK 023H04 2235501 PAK 3 023H05 4968309 PAK 023H06 if 3972575j PAK h, f ! 023H07 2589897) PAK"' ! 023H08 ! 2270940j PAK zwwo 023HO9 2428623 PAK 023H10 L 61519921 PAK 49757971 _ __PAK 024A01 "'2998744 ! PAK'"" 3273707 ! PAK 024AO2 Q24A03 : 3273707) PAK. f 024A04 i 421 1295 ! PAK 024A05 ww_ ;, _, . 5805927 ; PAK 024A06 1120674 ! PAK 024A07'; 3847363'i PAK _... _. _ d '""024A09 j'1590327j PAK" : 024A10 1 4865593 PAK 024A11 i 582184 PAK 024A12 2314014 PAK 024B01 8876121 PAK 024 B02 812138 PAK 1 l f r 024B03 i 5454438PAK j 024B04 a 1422529 PAK 024B05 fj 840409 PAK 024B08 3887120 PAK G _ 024B09'5538951 PAK 024B10 1 2231391 PAK s 024B11 i5986505 PAK) 024B12 3268838 _PAK 024C01 3454969 PAK 024C02 1 3166825 PAK K--4i 024C03 if 3045547 PAK 024C04 1 4549940 PAK 024C05 t 4024205fj PAK 024C07 ! 5224518 PAK 024C08 618709717 PAK j 024C09 13962, PAK r 7821 PAK fj 024C11 5544419 ! PAK f 7 024C12 5549737jf PAK 024D01 224834 PAK f i Q24D02 1541365 PAK ! 'i 024D02 1541365 ! PAK f 1 024D04 5271081j PAK 024D03 2600561 PAK 024DO5 4387181 PAK a _ m 024D06 2506689f PAK 024DO7 376685 PAK 024D08 3753989 PAK'. ! 024D09"'477959) PAK j 024D10 4415413 PAK 024D11'""""1949144 PAK t 024D12 25740931 PAK 024E02397241 PAK j 024E03 1422615 PAK ff 024E04 5558858 PAK 024E05 248534i PAK r 024E06 2482205 ! PAK 024E07 6094556i PAK} 024E08 i 2089704X_ PAK L-024E09'" ;'579496 PAK 024E11"""1""1573198 PAK" I 024E12 i 960638 PAK 024E12 9606381 PAK 025A03 2585665 ! PAK - y 025A04 ; 2880224'PA_K 025A-03 25856651 PAC- 2 025AO4 2880224 PAK i- _ 025A06'""j'4008735 PAK" 025A07 j3049679 PAK i 025AO8 025A08 to PAK r"025A09" !''346094QS PAK"" ! 025A10 1314551 PAK 025boy 6186765 PAK 025B02 1 2370762 PAK f 025B03 X 4428734 PAK" ) 025B04 ! 242528 PAK ! 025B05 315160 PAK i _ 025B06 5076807L PAK 025BO7 3573568 PAK j 025B08'2173452 PAK') 025B10 5251498 PAK j 025C01 3126126 PAK j 025C02 3280479 PAK 025C03 5118049 PAK 025CO4 6894522 PAK x F l 025C06 2486212 PAK 025C07 274942 FK 025cl8 2830968'PAK 025CO9 2711664 PAK 025C10 _ = PAK 025C11-- 025CIl 2395192 PAK 025C12 j 5582311 PAK"i 025D01 956925 PAK 025D02 3907963 PAK f,''-025D03'-1535023 PAK 025D04 5681475 PAK i 025D06 I 5045391 PAK' 025DO7 3956187 PAK 025D08) 6147445 PAK 02 6231260 PAK f 025DO9---9-807-032 PAK 025D10 6231260 PAK 025Dll 6122296 PAK 025D12 6228503 PAK f 026A01 2783421 PAK 026A02 4413275 PAK. 026A03 4867611 PAK 6-26AO-3 4867611 PAK 026A04 1 6193243 PAK r 026A05 2661389 PAK1 026A06 [_ 2993040 _ PAK"'" '026A07]'5859934 ! PAK ; , _.. _.. _... _. _.. 026AO9 6091935i : PAK 6017292 ! i PAK "026A12 i'5997458 ! PAK"' 026A11'1534280 ! PAK ;.. ___ . _.. _.... _.... . 026A12 f 5997458 ; PAK 026B01'1286664i PAK 12 4-8 5 8'4 PAK v PAK Sj 026B06'i 3124858i PAK 026B06 J 3124858J PAK"' i 026B07 t 44965231 PAK 026B08 i 243633'PAK 5 026BO9 i 41 13174, PAK 026B 10 2471 714'1 PAK 026B11 621504j PAK 026B12 59293271 PAK 026C02 4490246 ! PAK 026C03 _ J 16461691 PAK 026C04 16140821 PAK QgQ--r"5833075J PAK 026C06 r"1757938) PAK 026C07 50389651 PAK 026C08 5484284i'PÅK 026C10 1614082rj PAK 026C11 142425j PAK 026CIl-.... 1, 424251 PAK.. 026D01 j 60934581 PAK 026D02 f 4872457 PAK 026D03 j 247641 3i PAK f 026D08 j'"5256245 ! PAK"' 026D05 j 3378631 PAK 026D06 _ 12710241 PAK 026D08 52562 5 PAK 026D09 2353267 PAK 026DO9 23532671 PAK'. 026D10 14249921 PAK 14249921 026D12 j 4836286 !" PAK 026D12 4836286 PAK 026E01 5633101 ! PAK 026E03 5200833E PAK ! 026E04 3710864) PAK 026E05 1026191'PAK"" 026E06 731222 ; PAK 026E05 1026191 fj PAK 026E08 6206863j PAK 026E06 f 7312221 PAK 026E07 43697581 PAK if 0 026EO9 j 219791 8i PAK - t f, 026E10 j 244907 PAK 026E11 59881 j PAK 026E12 4860198i PAK 026F01 1003254 PAK 026F02 3888838 PAK 026F03 f 4979513 PAK m 026F04 32822831 PAK i J859347"PAK 026F07 j 25451 16 ! PAK ,"""""'026F08"--j-""-5733113 ! p/\K'""""" 026Fos i 57331131 PAK 026FO9'1576S71i PAK 026F10 HãW PAK 026FO8 57331131 PAK B-""""''"-'"'6F12 ! 46835gi PAK ! 026G01'2516258 ! PAK 026G02__ i 169947i ! PAK 026G03 _ _ i 48_0072 ; PAK _ 026FI2 468359i PAK 026G04 ii 2836089 ! PAK ,'5835°8. .--_.. _.... _ ; 026G06'5135144j_PAK 026G07 2759139'PAK 026G08 _ _ __', 2395451 PAK 026G09'""""'''5353056 PAK"'1 026G 11'i 3039452 PAK 026G12 2858678 PAK 026H02 305543 PAK 026H03 18 6 PAK 1823060 026H05 o Wb-ns 026H05, 5752024 PAK 026H06 t 3839372 PAK j 026H07 5595512, PAK 026H08 6195270 PAK i 026H09 3769758 PAK j 026H11395319 PAK j 027A01 5986381 PAK 1 027A02 561 0518 PAK 027A03 5305691 PAK 027AO4 027A05 7 51 567f PAK H I 027A06 j 46619911 PAK _ AK -. _....... _. {.... I i 027A08 _ (3240695 PAK ; 027A10 5379446f PAK m r _ PAK QZ7BO r w PAK 027B01 2931204 PAK J 027B02 4221177 PAK 027B03'"""2055343 PAK 027B04 2605433 PAK 027B05 671637 PAK 027B06 3676181 PAK 027B07 2342964 PAK 027B08 892825J PAK) 027B09 546703 f'AK i 027BO9 546703 PAK <77 4611229 PAK 027B12 2910956 PAK ! 027C03'567842 PAK 027C04 2654831 PAK 027C05 1169335 PAK 027C06 3445041 PAK _ 027C07 _ 2498028 PAK 027CO8 11957341 PAK 027ClO 33778751 PAK 027Cl2 54T371-PAK '. 027D01 4389578 ! PAK : 027D01__'_ _<L_ PAK 027D02 4137710x PAK 38274591 PAK 027D04. 7846151 _ _ "027D05'1695147 ! PAK" 027D05 f. 16951473 PAK 027DO7 13313861 PAK f 027D08'1833778J PAK'] j 027D094423076 PAK" ; . 027D10 2304898 PAK, 027Dl I----ir--'4178289 PAK 027Dl2 2712791 PAK 027D11_ r 41 78289f PAK.. _ 027E01 _ 1 45106281 PAK 5480157 027E03 5367995J PAK 1 027E04 5745018 PAK f. 027E05 2770769 PAK 027E06 2326713 PAK j 027E07 3 _ 28450131 PAK 027E08''3753559 PAK') 027EO9 685539j PAK 027E10 441907s PAK 027Ell 10344691 PAK 027E12 4957339 PAK 027F01 3967875 PAK _. _.. _PA_K_ ; 027F02 PAK j 027F03 6163677 PAK "1 027FOS 6234--t ! 027F06 j 4588811 PAK 027F07' 4889646 PAK L 027FO9 4427504j PAK'i 4427504 PAK 027FlO 5389108 PAK 16322111 PAK rsw w__ S 027G01 30684| PAK ff [_ _ 027 S0Z < f 027G03 MãiF PAK 027G04 33071985 PAK 027G04"* 3307198J PAK' 027G05 _ 5947969i PAK 027G06 ^ 3273085 PAK r 027G07138747"PAK ! r of 027G08 j1888744 PAK j 027GO9 7313881 PAK 027GlO 161331 PAK 098=92i, PAK 027G12 t 1778562^ PAK_ 027H01 1 892327j PAK r w7g _ 027H03'1389378 ; PAK 027H04 3873101 PAK"1 j 027H05 j 5806340 PAK ! Hjj-0r-61G3720 PAK L''027H07 jr"6163720J JPAK i 027HO8 i 18001571 PAK fi _ 027HO9 i 1234041 ! PAK 027H10. 10537741 PAK 027H11 j 395319J PAK ; 028A01 1 3765920 ! PAK 028A02 55609681'PAK 028AO2 5560968 ! PAK 51301541 PAK ......------- 028AO7 3650968t PAK F 028A08 (2675069 ; PAK _ 028AO9 _ i 3645865í PAK F"028A10"j'2749094. ! AK ! 028A11''"") 5601444"PAK""' 028AI2 5932445 PAK . 028B01 3423519j PAK 028B03 5652023 PAK (028B04"4219974) PAK ; 028B05 2352534'PAK 2- ; 3b2534 028B06 505075s PAK _ 028B07__ 78114 PAK r 028B08"1 4729966 PAK 028B09 4247808 PAK 028BlO 20790701 PAK 028B11 1044061. PAK __ 028B<f 2 434886 PAK 028C01 4126950 PAK 028C02 5559372'PAK 028C03 1401 152 PAK 028C04 850425 PAK 1 028CO5 1679758 PAK 028CO6 3143823 PAK 028C06"3143823 PAK 028CO8 4709538 PAK f 028C09 3377875 fAK 028C10 1526202 ! PAK 4 3 028C11 218091ì PAK 028C11 218091'PAK 028D03 4895650 PAK OV 5 DO n r 028D03 4895650 PAK 028D04 4430143 PAK 028D07 PAK 028D06'5645307 ! PAK J"028D074167143 PAK i028D10"4009007 PAK {028D1T 1168403 PAK 028E02 _ 1929992 PAK 028E03 273913 PAK 028E03273913 PAK _ 028E05 _ 2822479 PAK 6 404766511 PAK j028E07'"f401774i PAK'"" 028EO8 PAK . _ PAK 028EO9 ! 5633478J PAK. 028E11 ; 6026380 ; PAK 028E12 ! 4160672 PAK"" _ 028FO1 1 2464814 ! PAK 028F02 34789591 PAK 028F03 t 4365617 ! PAK O. 8FX s73s2asl PAK 028F05 50735201 PAK 028F06 028F06 1796610 PAK 028F07 _ 155971-PAK k OZ B FOB 3054982 PAK 028F09 {_ 5051554 PAK 028F10 5662090 PAK" ! . ___ 028G01 6097792g PAK 028G01 6097792 PAK 028G02 519097 PAK 028G03 3606864 D : ! 8GS < PAK 028GO4 1352608 PAK 028G05 960638 PAK 028G07 5129901 PAK 028GO9 4627714 PAK 028GO9 4627714 AK 028G 10 5602270 PAK 028G11 5865952 PAK 028H01 3403124 PAK 028H02 5217688 PAK 028H03 3471740 PAK 028H04 6162649 PAK j 028H06 5141234 PAK 028H07 3444396 PAK 028H08 | 2374238 PAK 028HO9 21733 PAK 029A02 5207659 PAK 029A03 5756144 PAK 029A04 m PAK 029A05 3590611 PAK 029A06 41 33511 PAK 029A07'"""47760 PAK i 029A08 9836§ PAK 029A09 618491 PAK 029A10 343413 PAK 029A11 1418890 PAK 029Al2 PAK 1 029A12 1 43758911 PAK 1 029B02 2251126 PAK j 029B03 1 3776080| PAK 029B04 1 519 PAK i 029B05 511338 PAK 029B06 2179204 PAK 029B07 3006198 PAK ? 029B08 13862061 PAK 029B09 1022382 PAK 029B11 4135379 PAK 029B12 5522051 PAK 029C02 i, 1 295737i PAK 029C03 2556389 PAK : ! 029C03 1 2556389 ! PAK 029C05 i 4074681 PAK 029C06 ; __. _. _. 029cri 5226315' 029C07 ! 161414 ! ! PAK 029C08 Ij 49980461 PAK 173851 PAK 029C11, 7993361 PAK ejr 4280811| PAK 029FOI 42808Tl'l-PAK 029F02 ì, 16359651 PAK L-029F03 ! 5047054J PAK"" 029F04 1 53815301 PAK 029F05 {BI PAK 029F07 2386598 PAK 029F08 i 22373591 PAK 029F09 19524291 PAK 029F10 i 625852i PAK 029F11 1103593 ; PAK 029F 12 v as, ! 029F12 1034469i PAK _e 6718141 PAX 029G05 28494443 PAK 029G07 4140101 PAK 029G08 39451451 PAK 029GO9 29947401 PAK 029G10 1401775 PAK ! 1401775 ; P 029G111161506 ! PAK) 029HOl 029H01 2186632 PAK [''"029H03'"1863417)'PAK j 029H04 4120237j PAK 029H05 62268751 PAK l 029H06 3432045, PAK i 029H08 4998046ji PAK ii 029H09 3637364 ! PAK j029H11395318'PAK' ! s 'i 030A01 5 _ PAK t,, _. _ _, _ 2571 933ii PAK 030A04 1 098443j PAK w e 030A05 1656285 PAK 030A06 3196133J PAK ! 030A08 61 11034 PAK 030A08 61110341 PAK 030A10 928123i PAK 030A11 38058211 PAK 030B01 1675284 PAK U, 5utju ; e : : : : : =-'3453784 PAK 030B02 1 3453784 PAK 030B03 4395196 PAK 030B06 3243564 PAK 030B07 304864 _ PAK 030B08 1 1782181 PAK 030Bfl9 1771997 ; PAK 030B10 82173585 PAK''' 030B11 Z 2551514'PAK 030812 5744471i PAK 030COI 25029551 ! PAK 030CO2 5114608 PAK 030C06'2293379iZ PAK 030C06 2293379 22933791 PAK '"030C11 ! 4252912 ! PAK'' 030D01 ì 3690212§ PAK 030D02 ! 5789566i PAK 3690212, f PAK 030DO2 ! 030D06''4848635 PAK ; j030D07 L 1700770 PAK ; 030D08 1 2461514 PAK ----230DO8 030DO9 I 2033740 PAK 030DO9 030D10 i 735834 PAK Z 030D12 i 4702674 PAK 030E01 *i-w_J 030E02 3072170 PAK 030E04 3268528 PAK j 030E06 j 3951672 PAK i L 40210i11 ! 030E07"14021011 PAK"" 030E08 5447473 PAK 030EO9 1034469 PAK , 030E11 (^ 6210374 PAK 030E12 f 030E122322957 PAK'i i"030F01 1795161 PAK J 030F02 3727001 PAK 030F03"1008274) PAK J 030F04 2960227ii PAK PAK 030F05 2751723 PAK 030F06 3368821 ! PAK m9S7ot 28 n 030F07 28988911 W __ _. __ _ Z U30F10 Z 3191652 PAK Ij 030F08 2452830 PAK' j030F10 ! 3191652 PAK ! 24695021--. PAK 030G03 1 4238570jl PAK 030GO2 3627048 PAK 030G03_ 4238570 PAK 030G04 ! 928134j PAK" ! 030G07 44942451 PAK j 030G06 1326016 PAK'"1 030GO9 5272805i'PAK 030G11 _ 3494433 PAK r"030G09"5272805 PAK 1 030G 12 3410682 PAK. . 030G12'3410682 PAK' ! 030H01 194927 PAK 030HOl 19492 PA 030H02 030H02 4592027 PAK ! 030H03 852280 PAK 030H04 ; 5033043i PAK 030Ho5 1408282j ; PAK 030H06 x 030H06 58334521 PAK 030H07'36m PAK 030H08 40183831 PAR-"--- 030H10 879592 ; _PAK 030H10 e PAK 030H11 3953 PAK 031AOI 35968 031A02 2654389i PAK a, 031A04, 2333549i PAK 031AO4 031A05 1 32351221 PAK PAK 031A06'2953301 PAK 031 A07'. 3420473i PAK , _031A08 ; 517368 PAK' s 031AO9 ! 2262972 PAK 031A10 ; 6143767 ! PAK 031A12 i _ 5934945. PAK 031B01 1032092 ! PAK 031 B02") 6137622 PAK, ! . _. ____. _ Y 031 B04 1 4999629t PAK 031 B05 1 488665 PAK 031 B06 6082612 PAK m ow 031B07 j 2849330 PAK J 031 B08 f 307553 PA'K 031 B09 T 5586226 PAK 031B10 3481766 PAK) f t 031 B 1 1 320046'PAK 031B12 4401199 ; PAK 031COl 457853 1CO _ 031 C02 1 17873 PAK 031C03 j 3630643 PAK"J 031C04'6153040 PAK *"j 031 C06 f 304855 PAK 031 C07 6153040 PAK 031 C08 j5382017 PAK ! 031CO9, 3363510, PAK 031C10 i 4369870 ! PAK 031C11 j 9606381 PAK 031 D01 3 44949961 PAK 031 D02 3 1389378 PAK 031D04 s 374 o 031 D05 2748806S PAK 031 D06 W 1431043 PAK 031 D08 | 4624021 PAK 031 DO9 j 3352462 PAK 031D10 j 4786066 PAK" 031 D11 f 3432785 PAK 031 D12 ! 5077356 PAK 031E01) 1273307 PAK i 031 E02 1830833 PAK (031E03 1229021 PAK ! 031E04 J 1034469 PAK ; 031EO5-i5A-K 031E06 P 5061337j PAK 031EO7--PA-K 76968L,.. 031 E08 61372271 PAK 031EO9 ! __ 366354j PAK j_ _ 031 E10, m0T 031E12 ; 6204137 ! PAK r--------------j----. _j___. _ _ 031 F01 ! 937667 ; PAK 031 F026172249) PAK : 031F03 31136511 PAK 031F04 5399592'PAK"" 031 F05' 3767441 PAK 031 F06 ! 5860932 ; PAK 6233021 PAK ; 385378 PAK 4687080 PAK 031 F11 4745641 PAK 031F12 994387 PAK f _ 031 G04 1941512 PAK 031 G06 v 911406 PAK 031G07 T 3659778 PAK ; 031 G08 4361681 PAK 031 G09 4320676 PAK 031G19 ww_V"__, __ _ 3651699 PA' 031 G12} 4003606 PAK 031 H02 783325 PAK 031 H03 1 5992E PAK 031 H06 622897 PAK w 031 H06 622897 PAK 031 H08 365504 PAK 031 HO9 927977 PAK 031 H10 21073 PAK 031 H11 395319 PAK 032A01 3743984 PAK 032A02 I 4424173 PAK 032AO2 032A03 i 3469166 PAK 032A04 2971258 PAK 032A05 y 57145E9 PAK 032AO5 032A06 1-78. 1781752 PAK 032A07 2677866 PAK 032AO8 PAK 032AO9 1678032 PAK 032A10 5471197 PAK 032A11 I 34609401 PAK 032B01 T 1583037 PAK'J 032BO2 666644 PAK 032B03 j4463701 PAK' 032B06 : 5026321 PAK 032B07 i 48977400 PAK 032BO8 4119859 PAK 032B09 3971396 PAK _ 032B10 2101615 PAK j'032B11 3848049 PAK ! j 032C01 4419245 PAK 1 } 032C03 27343Si PAK 032C04 f __... _. _032C05.--..... __. _. f. _.. __. ___. _ 2151038 ; . . ____PAK _. .. ___. _.. 032C06-<'-' 032C07 i 5959665t PAK 032C08 9606384 PAK -p7 032CO9 _ 3788806} PAK 032CO9 3788806 ! PAK '_ 032C10 ; 133768 ; PAK 032ClO 1337681 PAK 032C 2 7 032D01 i 21343831 PAK 21343831 PAK 032D03 i H21 032DO3 703212L PAK 032D06 1 3161119 ; PAK r-, _wwww I _ 032D07 j 1415520 PAK'" ! _ 032D08 1 58193931 PAK 032D10 ! 944284} PAK 032D11 5151 4 PAK 032E01 2296065 PAK 032E03 1589174i PAK '032E04 3496720 PAK s 032E05 4703559 PAK 032Ë06 M1 g 09 ED'H 032E08 o= 032E06 3429859 PAK i 032E07 _ 1815893 PAK a 032E11 3785902i PAK 032EO8 4512079 PAK L 032E09"5800124 PAK' 032ego 1282182 PAK 032E11 3785902 PAK ; 032E12 032Ell--T 3-785902 PAK """ 55447881 PAK 032F01 ; PAK = 032F02 2333549 PAK 032F03 4115981 PAK 032F05 L 3818322 PAK 032F06 1923739i wPAK^ f 032F07 1595291 PÄK 032FO8 2543984 PAK 032F09 4741408 PAK 032F11 392299 PAK w-| 032F12 575331 PAK 032GO1 3884321 PAK 032G01 198630811 PAK 032G03 1431612 PAK ) 032G03 1431612 PAK' 032G04 3377875 PAK ow 032G05 4096444 PAK 032GO7.. 10344691 032G07 1034469) PAK 032G08'""5523553 PAK"" 032G09 1082517 PAK' 902337 PAK . 032G11 2285758 PAK 032H01 4432184 PAK 032H02 312089 PAK ! 032H03"* 3157954 PAK' 032H04 L 5920721 PAK 032H05-.--ggggj--p-- 032H06 _ t_ 5259025i_ PAK 032H07 i 50400841 PAK 032H08'5776175J PAK" _.. _. __. . 032HO9'. 1470035 ; PAK _.. _. __ _ 033AO2 59032921 PAK OSH11 395319f PAK 033AO5 20213601 PAK I _- _ __, _____ -___. __ __. __. __ 033A04 j 3068005 PAK PAK j 033A05 j 2021360 PAK J -- 033A06 i 4343557 ; PAK ___033A07 _, . w 4457135 PAK _ f"033A09'"'"j"''1703596 PAK'"" ! f. 033A11 ! 193593 PAK j | 30136481 033B01 52155201 PAK 033B02 735223 PAK 033B03 L 280214'PAK 033B06 5734271 PAK 033B07 464561, PAK 033B08"'4158275 PAK ! 033BO9 6076677t PAK 033B10 5846650 PAK _ 033B11'5139025 ; PAK 033C01 4565584| PAK 033C02 789593 ; PAK'. 033C03 j _L PAK 033C07 __ _ _ 5369447j PAK 033CO9 2223722 ! PAK 033C10 3703016i PAK T 541 PAK 033C12_L 17622171 PAK 033C12 1762217 ; PAK ! 033D01 !"808697'PAK 1 033D02 j 925021 PAK 033D03 1864941 jPAK ! ' 033D04 582632 PAK 033D05'1446241 j PAK 033D06 2677981 PAK ., 033D08 1420522 ; PAK 033D09 2915371 PAK j 033D10'5759953'PAK"j 033D11 3 PAK 033D124270927PAK 033EO : 3692905L PAK ! 033E02 3960621 PAK'1 033E03 159925| PAK 033E04 1146438 PAK 033E05 4876344 PAK 033E06 1401775 PAK 033E07 3648190 ! PAK ^ i i 033E08 {5155127i PAK 033E10 j 810029| PAK 7 -033Ell 5171321 PAK 033F01 i 5384776 ! PAK 033F02 !""'""1097480) PAK'"'" 033F03 ! Wi i<PAK 033F03 !""488949) PAK. .. _ 033F05 50478671 AK 033F06 '= 6139060 PAK 033FO6 033F07 1 32787281 PAK 033F08 2651957 PAK 033FO9 4214354 PAi-'-- 033FO9 4214354 PAK 033F10 5835416 PAK 033F11__ 3040970j PAK ,'033F12 r 5485671 jt PAK 1 033G01 j 4021011 PAK ! 033G02'" 2020848 PAK 1 033GO3 6035097 PAK 033G04 622576 PAK j 033GO5 6009158 PAK _ 033G04___ <L _ PAK 033G06 4921657 PAK j _ 033G06 4921657 PAK _ 033G07__ 033GO8 422371 033GO9 5496428 PAK 033G10338336 PAK ! 033G114872592 PAK ! 4872592 033G12 1 2006340 PAK 033H01 4283054 PAK 033H02 2971468J PAK i 033H03 5734163j PAK 033H04 267797, PAK 033H05 5611225 ; PAK ! ! 033H065120684 PAK ! j 033H07 5734795 PAK J 033HO8 PAK 033HO9 5222171 PAK ouo s- 033H10 1628993| PAK s, 31 033H11 395319j PAK 034A02 41 0 T PAK 034A03 1518453 ! PAK'1 034A03 i5R 5, 034A04 5871585 PAK 034AO7 3659895 PAK 034A08 2509101 PAK 034A09 5917488 PAK 1 034A10 4540962j PAK 034A ti 1 2979372| PAK 034A12 s63674r PAK 034B01 3761773 PAK ) 034B02 4976574 PAK 1 034B03 1459332 PAK 034B04 3231365 PAK 034B05 5932726 PAK 1 tv l 034B06 21697231 PAK 034BO9 51964721-A-K _ _.. w PAK,..... 034C01, 5972176j PAK zu 034C03"1169543 ! PAK"" 034C04 J 319792J PAK' {034C03, 1169543, PAK {_ 034C04 034C06 1691904'i PAK 034C07 i 4639252'PAK 034C08 J 4445806J PAK 034C09'""'29036501 PAK' , 034C09 v 2903650-PAK Z 034C10 j 5595620 ; PAK Hr t 11190337i PAK 034Cll 1119033 PAK 034D01 3689177 PAK J ! 034D02 J 265015 PAK : 034D04 _ 1 4349588 PAK 034DO4 4349588 15A-K 034D05 1786346j PAK 034D06 6155655 PAK 034D07 740970 PAK !' 034D08 62024061 PAK 034DO9 j 1781634 PAK 034Dl 0 1655416 PAK 034D11 5718969 PAK'" ! 034D12 4544971 PAK 034E01 PAK : 034E04 2838744 PAK 1 034É05 1 77057ìi PAK 034E06 582633 PAK 034E07 3641141 PAK j 034E08 3446172 PAK _1.. __. _ 034E10 3235122 PAK 034E11'219478| PAK _ 034E12 923502i PAK 034F01 3203535 PAK 034F02 6107689PAK 034F03 62298134 PAK 034F04 30853631 PAK 034F05 _ 284835 _ PAK r 034F06 1275941 PAK 034F07 3366377i PAK 034F08 4877665 PAK 034F09 33276iq _ PAK 034F10 5379007 PAK 034F11 1302733 PAK 034G01334869 PAK) < u t L 034G02 _ 3761 844Z PAK 034G03 _ HoS--i 034G04 H 034G03""'223530 PAK 034G04 1630367 PAK 034GO5 3693472 PAK 034GO6 1147273 PAK j 034G07 3069275 PAK 034G08 1081866 PAK ! 034G09 j187713 PAK ; 034G09 187713 PAK 034go PAK 034G11 1 697418 ! PAK j 034G12 ! 4080338 ! PAK J 034G12. 3 4080338} PAK 3 034H01 3 1970850} PAK ""034H02T"5145613'PAK 034H03 3076623 PAK 034H04 j3107297J PAK" 034H05'3444611 ! PAK J 034HO6 034H06 7 281283 PAK 034H07, 537388i PAK J w -0 H 034H08 3477891 PAK PAK ; 3477891 034H 10 2725178 PAK 3 - 0 +-* -w 034H11 395318 PAK 3 035A01 5367839 PAK 035A02 6202613 PAK 035A03 _ 4300487 PAK 035AO5 PAK 1 035A06 585070 PAK s 035A071085596 PAK 1 [ 6A PAK n 3 035A08 3786428j PAK 035A09 5929909 PAK 035A11 3884502 PAK 035A12 1 3602559 PAK 035B01 2516661 PAK 035B02 2420924 PAK 035B03 717964 PAK 035B05 5136645 PAK 035B06 5819437 PAK 035B07 605610 PAK 035BO9 5394247 PAK 035B10 4052994 PAK i 035C01 5044009'PAK 035C02 260t8171'''-PAK---3 035C03 2052191J PAK t 035C05 2816796 PAK 035C07 3900713 PAK 035C08 PAK 035C08"""'J2719111"PAK 035C09 1855637 PAK 035C11 6093300 PAK 035D013951836 PAK"""J 035D02 1 5926486i PAK 3 035D06 55139721 PAK ____035D08 2375909E PAK ; 035D09_ 76054 [PAK'' 035D11 1580830 PAK" 035D12 4041791 PAK 035EO3 035E03 5947596'PAK , 035E04 3449143 PAK 035E05 2925236 PAK ! 035E07 2540767 PAK j 035E09 36255301 PAK ; 035ElO ? 3484901 P-A K 035ex' .. __. 035E12 ! 1267731 PAK 035F01'200055} PAK 035F03 j 2961535 PAK" 035F04 I T0F, PAK 035F06 ! 4346022 ; PAK"" ! 035F07 742915 : PAK 035F08 ! 2678850 ; PAK' _ __. __ ___. ! _ ___. ___ 035FO9 3663131} PAK ^_ _ ___ _ 035F10 3307543'PAK 035F11 j1374677 PAK ! E Bibsos PA< i 035G01 61 59589i PAK 035G05 3421 826j PAK 035G06 j 4920889 PAK 035G07 1 4014955 PAK {- s ; (1360217 (PAK w_ --h 035GO9 1452953 PÅK z _1 035G10 j 3354574 PAK j 035G11 4689484 PAK 035G 12 32006891 PA'K } 035H01 5411217 PAK t 035HO2 36877011--PAK'' 035H03 5437535 PAK ; r 035H04 3872811 ! PAK1 035H05 41248291 PAK 035H06 4391916 PAK 035H07 5804150 ! PAK 035H08 4677790i PAK 035HO9 2759137j PAK 035H10 2703015i PAK 035H11 395318ì PAK i . b - 036A02 j 6207805j PAK 036A03 26687721 PAK 036A04 36911 88j PAK j036A05""5550063 ! PAK i 036A06 31762821 PAK PAK 036A07 42083171 PAK 036Aos 60125741 PAK 036AO9 1881088i PAK 036A10 5748225i PAK w L 036A12260467 PAK i j'036B01 1393440 PAK" ! 036B02 1-PAK '036B05'""""""2216501 PAK""" ! 036B08 5786387j PAK 036B09 14598351 PAK 036BlO 60881021 PAK 5 036Bll 2748177 PAK 036B12 2046957i PAK 036COl } 036C01 35215141 PAK r 036C02 v PAK 036C04'1195735. PAK 036C05 1 3956359'. PAK 3956359, PAK 036C06 j 6063016 ! PAK ! ~_'. _.. 036C07 | 4399820 PAK 43998201 PAK 036CO7 036CO9 i 60302291 PAK 036C10 45291121 PAK 036Cll 58715441 PAK 036C12 l 6963ûOS PAK 036D02, 54269251 PAK 036D03 3431378t PAK 036D04 3055528. PAK 036D06 5645722 PAK 7 036D07 25752301 PAK 036D08 178197a PAK 036D11 j 13747231 PAK 036DIl 1374' } 036D12 1 1034468 PAK 036E02 4835850 PAK 036E03 5477358 PAK L 036E04 2930906i PAK 036E05"'"'4622598J"PAK" 036E06 545866 PAK 036EO7 13020761 PAK s 036EO9 3423518 PAK 036EI0 50106551 PAK 036E11 2638015 ! PAK 036E12''5423385i PAK | 036F01 6478731 PAK 036FO3 1210896 PAK 036F04 5458650j FK D 036F05 19830221 PAK 036F07 2810951 j PAK l 6> 036F08 ; 3956359} PAK 3550 P 036FlO 9756121 036F10'975612t PAK 036F11 20826471 PAK ! 036G01 5373180 PAK', 036G03 4650508t PAK 036G04 401104i PAK 036G06 2545183 ; PAK 036G07 4833185 PAK 036G08 3423519 PAK 036GO9 2470356 PAK 036G11 2010587 PAK ! . _ 036G12 3996203 PAK 036H01 3125215 PAK 036H04 3125215 PAK 036H06 1619804 PAK 036H07 5491695 PAK 036H08 ( 036Hog 3980107j PAK 036H10, 96877'PAK !. [,-968771 ! 036H11 i 113651i PAK 036H11 ---f231259, PAK 037A03 m. d6ZB 037A04 1 7804721 PAK 037A05'. 5989449i PAK 037A06 1 2350667'PAK 037A07 J 878Qi PAK'' 037AO7 037AO9 10019981 037A12'271671 8ì PAK PAK 037B01 2007454 ; 037B02 1 5167396 ! PAK 037B03 ! 470703i PAK 037B07 1 21394151 PAK s 037B08} 345984 PAK 037B09 | 2659749 PAK 037B09 4798154 PAK-' 037B12 J . 4 t 037C03 29117711 PAK'. 037CO3 037C04 ! 4707041 PAK 037C06 j 2502614 PAK : 037C08 j 2139415 PAK) 037C09 1'345984 PAK''"1 037C 12 5076322 PAK'. Db7 DO1 5363209 PAK's 037D02 3235123'PAK 037D03 3721795 PAK 037D04 10384201 PAK 037D05 38569241 PAK <7gr = 037D07-708023i PAK ___. ; ,'037D08 618395} PAK 037D09 j 4966387 PAK) 037E02 6022358! PAK d 037E03 160705 ! PAK ss 037E04 ! 51917380 PAK 037E05 54999351 PAK 037EO8 28623241 PAK F 037EO9 1709356 PAK _ _ t__. 2421966| PAK 037F04 1573016 PAK 037F04 1573016 PAK 037F10 2736654'PAK l 4 037G02 1 4204883i PAK 037G04 6161681 PAK 037G05 120476 PAK, s 037G06 781042 PAK 037GO7 3735199 PAK {"'037G08"5774224 PAK'"" ! 037G09 1565917 PAK 037G10 5549729'PAK 037H02 K 037H03 377649e PAK 037H05 14528231 PAK s 037H08361431) PAK j 037HlO D PAK 037H11 97921 PAK 038A01 1 22213964 PAK 038AO1 22213961'PAK ""038A01"22213961 PAK' 038A04 4050601 PAK 038A03 6019381j PAK 038A04 4050601 ;-p--- 038A05' 1020286j PAK 038A06 615432J PAK i_ 038A08 5716882 PAK 038AO8 5716882, 5716 PAK 038AO9 59794501 PAK ! = 5860564# PAK 038A12 038B01 2531824 PAK 038B02 6150981 PAK 038B03"2950347 PAK' ! 038B04 1587631 PAK Qw B D05, 3472993 PAK 038BO7 4748755 PAK 038B08 PAK 2800987 PAK 4707866 T 038B10 j 645622 PAK 038B11 61 90304 PAK 038C02 3254208 PAK -Mb 4316201 PAK 038C04 ! 1924360 PAK 038C05 2658980 PAK t. e 038C06, 469623 PAK 038CO6 038C07 2587184 PAK w _ 4 038C08 516364 PAK 038C09 j 237725 PAK 038C10 2877920 PAK 038C11 5125422i PAK 5 038C12 3464971, PAK'. 038D01 T 2387338 PAK 038D02 j 113703 {PAK 038DO2 038D03 1436733 PAK m w 038D04 384589 PAK 038D05 i 2094100 PAK 038D06 570709 PAK OoSD08 5807652 v j 038D08 5807652 PAK j 038D10 5473393 PAK 038Dll 429568 PAK 038D12 5026321 PAK J PAK __ 038E02 ! 36423821 PAK 038E03 j 1171544j PAK 038E04 1 4207208i PAK 038E05 j 4826038j PAK 038E06 5600809 PAK 038E07 1 1 796309i PAK 038E08 3355560 PAK J 038E09 1 1924386 ! PAK' 038E10 | 6216289t PAK.' 038E12 1 5026320g5 PAK 038FOl 5222071 PAK 038F01 . ; 52220713 PAK ''038F03 !"5768619 PAK 038F03 _ 57686191 PAK i. 038F04 1 24316252 PAK 2 ~ 038F05 _ S _ 9149571 PAK 038F06 i 5925887i PAK 038FO7 506397 PAK )"'038F08'5148190 PAK'""" 038FO9 3839103 PAK Hfl 038F10 55855611 PAK 038F11 2882703i PAK . ___ 038GO1 2177222 PAK 038G02 2177222 PAK 038G026116317 PAK 1992425, PAK 038G06 1612335 PAK < 5 PAK__ i 038G07 1 1505271 PAK v 038GO8 38036431 PAR- s v 038G09 117478 PAK 038G10 1813557 PAK 038G12 538060 PAK 038G12 5380605 PAK 038H01 5970491 PAK 038H02 5096813 PAK # 038H04 1537284 PAK 038H06 5320147 PAK 038H08 8177731 PAK 038H09 1981334 PAK E 038H10 3983996 PAK 3953171 PAK 039AOI 18611731 PAK 2 039A04 1393864, PAK s m < 039A05 1987963 PAK 2 039A07 1498811 PAK 039A08'379701 PAK- ! 039A09 247994 PAK 33E0 r 039A1i w 039A10 3056328 PAK 039ait 76401 PAK ! 039B01 3590539'PAK t 039B04 7 m, PAK 039B06 i 3077321 PAK -l l 039B03 3038046 PAK 039B08 ; 40287851 PAK 039B07 3149436i PAK "'039B08 4028785 PAK 039B09 2693577 PAK a 039B10 5287105 PAK 039B12 t 968744 ! PAK ; 039B12 # 968744, PAK. 039COl 38759141 PAK 2 039C02 ; 380594722 PAK 2 039C03 2 3077322 PAK 039CÛ6'4968436 ; PAK 2 039C09 342829 PAK' ! _____ 039C 12 68152-8 V FAK _... _. 039D01 5167206 PAK ! H 2 039D021070658 PAK 039DO3 1969412 PAK ! 039D04 2757901-p--- 039D05 938477 PAK 039D06 j577497 PAK ; _. _".... _. _ : i2 039D07, 22008601 PAK 039D08 1388479 039D09 ; 31 9945j PAK 039D10 ; 3667735 PAK 039D12 PAK 039E01 2 4139119 PAK 4139119 PAK 039E02 2 39689701 PAK 039Eo3 PAK 039Eû4, 5547411 PAK.. 62419901 PAK 039E06 911407 PAK } T s 039E07345171 PAK 039E11 2 489783 PAK 039E12 22844001 PAK 2 039F02 906002 PAK 2 039F03 5098 156 PAK 039FO3 50981561 PAK -. 039F04 529320 PAK 039F05 845748 PAK 039F06 881382 PAK 039F073667045 PAK 039F10 792351 PAK 59986671 PAK 039Fl2 039G01 _ 1821233 ; PAK S 039G02 3075396 PAK 039G02 039G03 = 3897511 PAK 039G04 711492 PAK 039G05 j 5181188 PAK 039G06 5090749 PAK H v w 039G07 4136155 PAK j 039G09 4708061'PAK si 039GlO 4628661 PAK 039G12 5998667 PAK 039HOl 3057283 PAK 039H04 5915738 PAK 039HO5 5452946 039H06 __ 5429333 PAK 039H07 543741 PAK 039H07 543741 PAK 2 û39HO9 ; 16986651 PAK : 039HlO i 1189971 040A 1 434887 ! PAK-- 040A01., 434887i PAK 040A02. 342738'PAK 040A03 i 5385907 ! PAK 040A04 __ 1389522 ; _ _ PAK 040A05' ! 5262911i PAK. 040A06 J"2673778J PAK" 040A08 3377876a PAK 040A09 3 24992483 PAK 040A10 3231 186j PAK 040A12 4111281 PAK 040 B02'" !" 6151598 ! PAK'" 040B03 3 59945341 PAK 040B05 _ "_ 5894536i PAK 040B06 1623870# PAK 040B07 _ 361469 PAK < 040B08 5339439 PAK 040B091934092 PAK j 040B10 5864056 PAK S 040B11 3892936 PAK û4ûB12 _ 4845382 PAK 3 040C01 4438751 PAK J 040C02 28243661, PAK 040C03 5651282 PAK.' 040C04 659742 PAK 040C05 1261892 PAK 040C06 5765003 PAK M 040C07 776424'PAK j 040CO8 PAK i 040CO9 917224 PAK 040C10 1 5720295 PAK _ 040C12 v 62137091i PAK 040D01 J'6191429)'PAK"] 040D02 5499529i PAK -o o 040D04 54323071 PAK 040D05 _ _ 4709287. PAK 040DO6 1279250 040D07 1740896 PAK 040D08 2262209 PAK _ 04ûDO9 5187068 PAK 040D11 <'''PAKW t 040D12 35604543 PAK w o 040E01'46191143 PAK 040E03 1401775PAK" 040E04''4622307 PAK ! 040E05 103643 P A-K 040E06 i 040E06 3570436 PAK 040E07 1569295 PAK j ! _ 040E08 5296295''-PAK 040EO9 3055456 PAK 040E1Q'2110620 PAK j 040E10 2110520 _ PAK wi i. ____. 040E11 _. ___... __. __... ___. _. 5226445j _ f'A !"040E12""""3669216J"''PAK"""" ! 040F01 4682463J PAK ! 040E12 36692163 PAK -040F03"5831895 PAK ! 040F02 ; 7149 AK 040F05 (1402192 PAK -'540F-06 548. 6911 PAK j040F073423519 PAK HõiX iI 548691 j PAK 040F08 60160511 PAK 040F091161406 PAK, K '040F10'2220848 _PAK 31778421 PAK t 5 5 040F12 j 4044626j PAK t 040G01'"5651116J PAK) 040G02 í 43445441 PAK 3 loss 040G04'3251825 PAK'j 040G07 64056 PAK 040G08 53_97947 PAK ; 040G09 145393 PAK 040G10 660579 PAY-'! 040G11 3298307 PAK 040G12 5925184 PAK F 040HÛ1 3341973 PAK 040H025818863 PAK 040H033487096 PAK 1 040H04 S PAK F ; 040H053230271 PAK 1 040H06 512075 PAK 040H07 1988705 PAK 040H08 I 4854616 PAK ; 040H09} 5501819 PAK j 040HIO 3794579 PAK 3 041A02_ 5795280 PAK 0 041A03 5089134 PAK 3 041A05 9074051 PAK , 04 3 PAK 041A07 2606926 PAK 1 041A08"848937 PAK j 341AX s4es37 PAK _ __ 2703672 PAK 3 041A10 8901Û6'i PAK 3 041A11 4174020 PAK' 041A12 6179246 PAK r 041B01'991897 MK 041B02'"5588598"'PAK 041B03 3120577 PAK 041 B04 5243894 PAK 3 T_ 3303605 PAK 041 B06 3285144 PAK 441 B07 296431 ; PAK ; 041808957984 PAK j 041BO9 04111 61038411 PAK t 041 B11 H1 S 041B11 6103841J PAK !. 3 041 C02, <1C1t 041B12' ; 6065354 ; PAK" : 041 C04'1 873863j PAK 041 COS""""""'3511429 PAK' ! 041C05 t 31119383 PAK _.. , .. t 041 C06 1 428397i PAK t 041 C07 t 4594610 PAK 041CO8 -4401199 PAK 041C09 i 3174550 PAK i [041C11 j 4151288 PAK i 041C12 1 1287062 PAK 7 041 D01 5357973 PAK ; 041 D02 3875280j PAK 041 D03 4161168 PAK _ 041 D04 T93630 PAK 1 041 D06 j 6020700 PAK 041 D07 975945 PAK 3 041 D08 3675698 PAK i w 041 DO9 823998 PAK 041 D10 2622431 PAK 041 E01 1114978 PAK ; 041E02 3 375183t PAK 041EO4 4160672 PAK j 041E05 719611 PAK ! wo 041 E07 3 36549753 PAK 041 EO9 4008523, PAK 041E12 60905013 PAK 041 F01425648} PAK 041 F02 4828897j PAK ) 3 615898 PAK 041F04 807429 PAK 041 F05 1 3704053 PAK 1 041F06 3179248i PAK ! 041F07'2752420 PAK ! 041 F08""''362255 !"PAK 041FO8 3622551 PAK 041F09 5-PAK 041F10 3478603 PAK Me a 041F12 3 4212194 PAK_ I nY 4200709 PAK 041 G02 1084851 PAK 3 041GO3 45526241 PAK '"041G04 5283850 PAK t 041 G05""2139207 PAK |---i 041G06 3522249 PAK' 041 G09 1707246 PAK 041G10 PAK 041G1i 1129197 PAK 3 3 041G12 4444027 PAK (041H01 858382 PAK J 041 H02 1 358826 PAK "041 H03'" :"""4463639J"PAK"""""" 041 H04 ! 3440777 ; _P_AK_ 041 H03'44636393 PAK 041 H04 34407771 PAK 041HO6 5581759, PAK 041 H07 i 21 05927i PAK 041 H08'326563ûi3 PAK r 041 HO9 i 2495091 PAK 041 H09' ! 249509 ! PAK""'. -i-5655168 PAK 041HIO 041H11 L 3953193 PAK 042A02 ! 378096i PAK 042A03 1 51603951 PAK 042A04 i 48952053 PAK 042A06 t 2564555i PAK t 042A07 3 4403813 PAK ! 042A09 5009261 PAK 1 5 042A10 5041735 PAK 042A11 2643401 PAK 042A12 1 3327837 PAK 042BOI 90522 PAK t e 042B02 1206417j PAK --8149 042B03 581 PAK 042B05 1520411 PAK 3 04 Y PAK 042B08 49838211 PAK i 042B11 __ 1206904 PAK_ 042B 11 1206904 PAK 042B12 567257 PAK 042C01 1788289§ PAK 042C03'4911287 PAK 1 042C04 2871313 PAK"i 042C05 15268451 PAK 042C06 6072449 PAK 042C07 1197211 PAK 19 l 042C08 1845834 PAK 84 834. 042C09 4746475'PAK 042C10 967048 PAK 042Cll 174218-PAK 042C12 5457038 PAK w ee - t 042D01 682842 PAK PAK 042DO1 042D03 1696180 PAK 3 042D04 450314833 PAK 042DO4 042D05 59858261 PAK 3 391947 PAK 042D11 11357491 PAK _ _ 042D12 458934 PAK- 042E02 45211123 PAK 3 042E03 1289161 PAK 042E04 567786i PAK 3 l ! t 3 042E05 1 46984003i PAK r"042E06 5874350 PAK"1 û42E07 T PAK ; 042E07 189660 PAK F i iQ42E09 5144611J PAK .. _. ___ 042E09.. _. __.. _.. _____. _ 5144611 PAK.... ___.. ; 042E10 !, 12071 83} t PAK PAK 042E11 46777903 PAK 042E12 i 50482953 PAK 042F01'3 15903693 PAK 042F03 1 5225172 ! PAK 042F043353281 ! PAK !"'042F05 3027378) PAK 042F06 r 747048= PAK 042F07 ! 5487622ì PAK 042F08 5804696 PAK"1 042F09 1 255653, 3 PAK 042FO9-1 042F11 4647û76 PAK S_____... _ _--_---- 042F12 5504210 PAK 042G01 1971615 PAK ; 042G02 2848857j PAK 042G04_ 3628786 PAK 5446644 PAK i _ ! ! 042G06 5339050 PAK ! 042G07 2600779 PAK 042G08 1000091 PAK 042GO9--1-4904341 PAK 042G10 882130 PAK 042G11 1576895 PAK 042G12 3211687 PAK i 042H02 6130322 PAK 042H03 6010809 PAK'. S 042H04 3148251 PAK 042H06 630149 PAK 042H07 f'1240086 PAK"'"". S 042H084337743 PAK ! 042HO9 5937841 PAK 042H10 93560 PAK 043A01 1241426 PAK 043A02 57565053 PAK 043A04 5430288 PAK i 043A06 10384381 PAK 043A07"'1952435 PAK'"1 043A08 2728707 PAK 043AO9 3483872 PAK 043A10 2007454 PAK J 043A11586791 PAK 1 043A12 57438351 PAK 043B01 6197780 PAK 043B02 5936005 PAK] t--- 043B03 6177770 PAK 043B04 5548663 PAK j 043B05 4346022 PAK ! 043B06 _ 2127695 PAK 043B07 3013253 PAK j 043B08 1 52273963 PAK ____jr___ I 3 043B09 3 9693361 PAK 043B10, 16264281 PAK t 043B11 3 62w PAK ______ : 6200 3 043B12 3 13199891 PAK 043C02 3 168211333 PAK 043CO3 3565385'i PAK 043C04'.----... ___ 320046 M PAK 043C05 i 5874827t PAK 043C06. 4160773 PAK 043C07 + 3070964 PAK j043C08"'''1 Q76592 j PAK"j v | 043CO9 j 24993253 PAK 043C10 3 53175083 PAK t j P J 043C11 3998650 PAK 043C12 5142215 PAK 3 043D01 1401775 PAK --17-P-A- 043D02 1 3869634 PAK 043D04 513025 PAK' ! 043D05'3623934 PAK 1 z 280058 PAK Q43D09 14253179 PAK ! 043D1 D 1037742 PAK 3 043D11 3423519 I PAK t 043E015251835 PAK j 3 S > 043E03 2849558 PAK _ 043E04 5794941 i PAK 043E05) 4376118) PAK' : 043E06 1104648j PAK _ 043E07 043E07 3591110 PAK 1 1880000 PAK 043EO9 424226 PAK 043E10 3113416 PAK t 3 043E11 182449 PAK 043E12 4350798 PAK 043F01 46077111 PAK 043F023136124 PAK 1 043F03 4884632 PAK 043F04 1991424| PAK ii 043F05 1247975 PAK 043F06 1 3268077 PAK 043F07 i 2548617j'PAK 043F08 3 6182495 ; PAK =vw 043FO9 5084172 PAK 043F11 4886596 PAK ! i _.. 043F12 3701207 PAK 043G01 23880741 PAK 043G02 12824145 PAK L 043G03 758126 PAK ; T 4351288 PAK 043G05 3309414j PAK ! 043G06 1554849 PAK 043G07 1589174 (T PAK 043G08 5 15655265 PAK !' 043GO9 I 5550834'PAK 043GlO 5485943 PAK 043Gll 6032332 PAK r 043G12). 4317166J PAK" E_. ___...... _... _. _. 043HOl 62185271 PAK 043H02 37061613 PAK : 043H03. J 4998126J PAK 043H04 _'23140141 PAK 043HO5 543532 PAK 043Ho8 < 34469 PAK 043HO7 4741047 PAK 043H08 2522082 PAK. 043HO9 2402285 PAK' 043H10 578470 PAK 043H11 395318'PAK : 1 044A01 (3746195 PAK , j 044A02'5563555 PAK 1 044A035936673 PAK j 044A043025913"PAK j 044A05 4897894 PAK ! 044A06'4705551 PAK"1 044A08 5261706 PAK) ; 43A T > ; 72 PAK 044A09896011 PAK j 044A10 1714299 PAK" 044A125995515 PAK'j 044B01 4710516 PAK 044B02 3591717 PAK 044B03 5005657 PAK 044B04'4376118 PAK"""'1 044B05 4544529 PAK' 044B07 6130031 PAK 7 044BOs 3108246 PAK 044B10 3721953j PAK 044B11 3490497J PAK ! w 044812 4059857 PAK 044C01 5548174 PAK j 044COl 5548174 PAK 044C02 577497 ! PAK , e e3 044C04 307553, PAK ner 307553 PAK 044C05. 3166235J PAK ! 044C06 3075531 PAK e e e 044C07 3694952 PAK 044CO7 36949521 PAK 044C09 5738810j PAK ve ee e e. ! 044C10 317871 _ PAK 044C11 2546122 PAK i 044D01 5518033 PAK 044D02 4601121 PAK 044D03 344216 PAK ; 33 344216 PAK 044D05 57699081 PAK 044DO4 3929164 PAK i 044DO5 5769908 PAK . __. _____.. 044D08 .. __, _ _ "^5719624f 044D09 044DO9 181018z ; PAK 044DI 0 51730791 ; PAK "044D11 r 5002559i PAK""" 044D12 ! 4214966 ! PAK .. _.. _.. _.. _ 044E01 5255502 ; -_ PAK 044E02 ! 441514 ! PAK '044E03 ; 30012524 PAK 044E03 b7S 044E04' ! 2755069 PAK 044E07 ! 1091 009i PAK 044EO7 1091009i PAK 044E08, 3105231 PAK # 044EO9 ìi 4415342 ! PAK 044EO9 44153421i AK !'044E10 ! 2190791J PAK <'044E12'"T"""3773614 ! PAK""""' 044F01 2149558 ! i PAK 044F02 18578 1 4 PAK _ 044F03 j 1213176 PAK 044FO4 57856351 PAK L 044F05 1 62293801 PAK 044F06711479 ! PAK 044F07 J 4201933PAK 044F08 30091341 PAK 044F09 5162055 PAK 044F10 849959 PAK 044F11 I 1239124, PAK 044F12 5390226'i PAK'i 044GQ1 T 5039673 PAK'J 044G02 I 3761438j PAK 044G03 5002559 ! PAK 044G03 1 5002559 ! PAK 044G04 1076592 ! PAK 044G05 j 56612741 PAK 044G05"5661274J PAK" 044G06 1 598742i PAK 044G07 4524349J PAK 044G08 3115861 ! PAK (044G09 1565779i PAK 044G10 2968961 j PAK .... ___. _.. . __, ___. _ _. _... _ _ __. _..... 044H01 6065767 PAK "044H01"""6065767 PAK 'i 044H02 802708j ! PAK i_s 044H03 4384287j PAK j 044H05543532 ! PAK r'044H06 5304973 ! PAK j 044H07"718206 PAK 044H08 3655006 PAK 044H09 1 s374555í PAK 044H10""'5865145 PAK"' 10 58651451 PAK 045A02 5954978) PAK 045A03 650632 PAK t i Q 045A04 57833201 PAK'. [""045A05 5432149 PAK'j 045Ao6 3819555 PAK 045A07 22821 07j PAK j"045A08''"T"582633s""PAK ! 045A11 ! 3330789J PAK ! ! 045A12' ; 1138641 j PAK, 045A11', 33307891 PAK 045B02 1034469'PAK 045BO3 41158401 PAK 045BO7 9846331 PAK 045BO8 42483961 PAK 045B07., 1. 98 3 i 045B09 !'5531123'PAK'"' ; 045BO9'55311231 PAK 045C02 2090688 PAK T 3724781 PAK 045C05'"1"''1017140 PAK""1 045C06 _ 1034467, PAK 045C07 J 4632926 : PAK'i 045C08"'160820 PAK j 045CO9, 3485030 PAK 045C10 1 2856410 PAK 045Cll 470704 PAK 045Cl2 195275 PAK 045DO1 58538801 PAK 045D02'2660295 PAK' PAK 045D03 6124651 PAK 045D05 j 478726 PAK ! 045DO6 1235858 PAK 045D07 5403076 PAK 045D09 2640476 PAK 045D11 1397290PAK j 045D12'w 4047933 PAK : 045E01 ! 1307839 PAK ! 045E024004627 PAK ! 045E03 1407619 PAK 045E041789921 PAK j 045E05 4692184 ; PAK) Pm 045E06 134 8 PAK 045E08 1819649 PAK 045EO9 36920031 PAK'. 045EII 2044843 PAK 045E11 2044843 PAK ; 045E12 1034469 PAK 045F01 4289483 PAK 045F02 426787 PAK 045F03 4237791 PAK 50r 1082878j PAK onsro7 _T 045FQ8)"3231365 PAK" ! 045F09 1 423716 PAK O4fFQO v 045F10 5958064 PAK 045F11 3926968 PAK 045FI2 58908731 PAK 045G01 T'5759866 PAK j 045G02 _ 1 4961128, PAK 52426651 PAK 045GO4 623-01901 045G05 ! 3380583i PAK L _w__ __, _ 7 045G06 ! 25845331 PAK 045G07 i 1988189s PAK !"""'045G08'"1--4-) 5go22j"'PAK"""" 045G08 1 4158022 PAK 045GO9 ! 21598761 PAK 045G10 ! 3293589 PAK 045H01 i 30607531 PAK 045HO2 188001 PAK 045H03 1595385 PAK 045H04 1 4696559 PAK 045H05 {1 197370} PAK 045H06 i 5656945 PAK fi J 045H07"372047 PAK ! 045HOS 2496534 PAK 045HO9 29229741 PAK 045H10 2458379 PAK 046A02 39799 PAK 046A03 3700941 PAK} j 046A04 1889947J PAK ! 046A05 3307543 PAK 046A06 5198450 PAK 1 046A0783564 PAK ! 046A08 5805380 PAK 046AO9 6949821 PAK 046A10 48776650 PAK 046A11 5022885X PAK ii 046A12 2649750 PAK 046B01 ! 11118031 PAK ii 046B02 t 5600143} PAK 046BO6 | wi 046B07 4338833, PAK 046B08 ! 3R PAK' 046B09 958891 PAK 046COl 545141 PAK 046C02 5 126650 PAK 046C03 1648426 PAK ii l 046C04 PAK 046C05 39992831 PAK 046C06 162981 1§ PAK 046C07 5355604 PAK 046C08 ! 2927047 PAK 046CO9 3696510 PAK 046CO9 3696510 PAK 046C10 2022919 PAK r"Q46C11 3033816 PAK"'' 3033816 PAK j _i 046D01 841026 PAK 046D02 L __ PAK t 046D03 j 4505583 PAK j 046D05 3113291 PAK 046D06 i 5425140t PAK 046D07 605472J PAK] 046D08 i 9820231 PAK 046DO9 12017521 PAK 046D09'j1201752 PAK ! HibC 38 39727i PAK 04 6D11 3834783i PAK 046D12 1778011 PAK""" 046E011420111 PAK 046E02.. ! 2896166 PAK' ; 046E03. .-. j 4907824 PAK 046E05 7911 39i PAK 046Ë06 r 6206678i PAK |_ ! 046E07 22759901 PAK 046E08 309450i PAK 046EO9 5830862 PAK 046E11 2927500 PAK 046E12 4842452i PAK 046F01 _ _ 2636974 PAK 046F02 1 2051474 PAK 046F05 3511809 PAK 046F06 6073758 PAK 046F11 i 2914409 PAK 046F12 1442679 . K 046G01 4131065 PAK 046G02 4974335 PAK st 046G043841817 PAK j 046G05 4881424 PAK ; 046G065416656 PAK 046G08 506389 PAK 046go 1085149 PAK 046H02 27146577 PAK 046HO3 6163618 PAK 046H05 i 6083533i PAK r 046H06 4897697J PAK 1 046H07 4108350 PAK) 046H08 6095642 PAK 046H09 5891644 PAK o 046H10 6224406 PAK __. _, 047A01 2032572 PAK'. 047A02 57744 PAK' 047A03 j 4883121'PAK ! 047A06 2038454 PAK - 047A07 5142593 PAK 047A08 5906879 PAK 047AO9 5212322 PAK - 047A10 1 6202406 {PAK L 047A11 i 6202406| PAK 047A12961308 PAK 047B01 5078374 PAK j 047B05 5121683 PAK ; 047B08 625674 PAT 047BlO 2473563 PAK 047C01 i 8680470 PAK 047c02 ! mL PAK 047C04 t 6052662 ! PAK 047C05 ! 531720'PAK 047C07. 936449t PAK 047C08 ! 4411168J PAK ! 047C09-.-... __........ f. _... _. _.. __.. _. __ 2560446 ; ... _.... _.. _ 047cos i 2560446 ! PAK 047C11 | 2458906i PAK 047Cll 24589061 PAK 3 047C12 E 4637926 PAK 047C12 J4637926J PAK J ,... _.... __047D02-.-.. _. ____. i_. __. ___. __ 62000621 __ pAK-___..... 047D02 3 6200062 ! PAK 047DO3--l-----f8-7O6-641 PAK 047DO4 34696401 PAK 047D04 1 34696403 PAK 047D05 1 4307149j PAK 047D07 X 2903114i PAK 047D09 572182 PAK S 047DO9 435360 PAK 047D10 _ 435360 PAK 3 047D11 5651 896 PAK 047D12 5478491 PAK 047E01145292 PAK ! a w 3, 047E02 567204 PAK 047E03 3241443 PAK 047E04 1520376 PAK 047E06 5400472 PAK w 047E07'213302 PAK J 047EO9 622460 PAK 047E10 4355869 PAK 1 047E11 4622390 PAK H PAK J 047F01 3418611 PAK i J""047F02""''"5467041 ! PAK 047F03 3 315529 PAK 047F04 5033157 PAK 047F05 3 3513768 PAK 047F06)"524915 ! PAK" 047F08 61392951 PAK _ PAK 047FO9 3393871 PAK 048B03 31564921 PAK 048B04 36456301 PAK v 048B05 5006994 PAK 048BO7 2324376 PAK 048B08 1 3976706 PAK 048BO9 3889620 PAK 048B10 5602961 PAK 048C02 6183698 PAK 048C05 2166572 PAK 048C06 2462035 PAK 048C08 5729364j PAK 046D01 =3g2y 048D04 434886 _ PAK _' 048D054422630 PAK ! 048D06 i 2211771 PAK 048D09 2670867 PAK 048DO9 i HL PAK 048D1 f"'T""4901353J"""'PAK"" ; 048D12 2671859 ; _PAK' 048H01 26718591'PAK < _ PAK 048H02 E 43243505. PAK 048H03'1557564 PÅK 048H04 ; 4996836 ! PAK ! 048H04 i 49968361 PAK 048HO7 54361851 PAK 048H08 _1 998174| PAK 046H10} 22619271 PAK 049A02 48272351 PAK t. _, 049A03 16304651 049A05 j4834673 ! PAK i 049A06 X 5694130i PAK ) 049A09 5433863i PAK 049A10 2024229i PAK 049A11 1149465 PAK t 049B01 5073520t PAK 049B03 _ 5301406i PAK 049B04 27454981-PAK 049B05 2747673 PAK 049B08 5727451 PAK 049B09 2900238 ! PAK 049B11 4961063'PAK 049B12 4600805 PAK PAK 049COI 049C01 5454008 PAK 45COQ s9t PAK _ 049C03 288967_3 PAK _''- 049C04 _ 3599081 PAK _ 66833661 PAK 049C06 4452090 ; PAK 049C08 ! 5912429) PAK 049CO9 i 59801731 PAK 049C 10 _ 579217 ! PAK 049C 11 41678651 PAK 12 56571771 PAK 049D01 5984634l PAK 049D03"'"466729 PAK'" P 049D042463041 PAK 049D05 1144192, PAK 049D06 4664900 PAK 049D07 1493775 PAK 049DO8 8385661 PAK 049D09 1 42026391 PAK TTt PAK 049Dll 5642982 PAK 049D12 4687527 PAK 049E01 5436192 PAK 049E02 1073568 PAK w w fi 049E03 4122641 _ PAK 049E04 401664 PAK 1 049EO4 : 016641 049 E06 1530440 PAK Q49E07 w PAK 050B05'1 47640i PAK 4383890 PAK 050B07 29045751 PAK 050B08 ! 2563342 PAK 050B08 ;'"2563342J PAK"" 050B10 ! ___ 55099820 PAK 050B10"j"5509982 ! PAK ! Eiim 6624931 PAK 050C01 1 33778761 PAK M t 050C02, 48765061 PAK 050C03 j'"4246816 PAK 050C04 j1130409 PAK j 5145793 PAK ', 050C06 t 56810621 PAK 050C08 1 3279137i PAK 050C10 í 3865780 PAK 050C11 L 1402477 PAK 050C12 1573691j'PAK'"" 050D01, 1 62187920 PAK 050DO1 r"050D02 3879741 ! PAK 050D04 13700311 PAK '050D05 841798 PAK 050D06 1 5970491 t PAK 050D07 ! 7035301 PAK 05DD08 X f 2295238 ! PAK 050DO9 40662631 PAK 050D10 15495731 PAK 050D11 1447778} PAK 050E01, 5187068 ! PAK' 050E02 4839441'PAK 050E03 4898763| PAK 050E04 33235631. PAK 050E05 4167233i PAK i 050E06' ! 5715126) PAK 050E07 L 41113111 PAK 17154941 PAK ! 050E09 5874715 PAK 050E10 3848466 PAK 050E10 ß 3848466t PAK 050E11 3183965 PAK x v m 050E12 3449937 PAK 050F01 ! 792454 PAK 050F02 1 1187266 PAK-! 050F03 4416817 PAK"' i '050F04 18861 PAK 050F04 18861 PAK _ 050F05 57 17346 PAK j'050F07931425 PAK 050F07 9314251 PAK 050F07 _ 931425 PAK 050F08 3241824 PAK 050F09 941643 PAK 050F10 873080 PAK 050F11 26610051 PAK 050F12 6239159 PAK ; 050G01 2876475 PAK _ , j 050G01 l, 2876475j PAK ------------ 050GO3 935576 PAK 050G05, 933576jj PAK 050GO5 933576,, ; PAK t 050G07 6409051 PAK 050G10 _ w 4375647 _ PA_K 050GO8 42145211 PAK 050GO9 33700291 PAK 050G10 4375647j PAK 050H01 050hot 23335491 PAY 050H02 4529076i PAK «-~ ', 050H02 4529076i PAK 050H03 1 646545, PAK 050H04 38=6341, PAK 050H05 1 5294371j PAK 050H06"5699434 ; PAK ! 050H091701115 PAK 1 PAK 050H10 1003254i PAK 4 | 050H11 395319i PAK 051A02 j 2514316 ; PAK ! 051A03 _ 5492589 PAK 051A04 8155111 PAK 051A05 5347600,'PAK 051A06 ! 452 AK 051A07 , _ 844307, 3 PAK 051A08 4300479 PAK 051AO9 1274236,'PAK w 3 a 051A10 462941 PAK 051A11 1 3608577 PAK 051A12 | 4253600j PAK j 051B01"6156485) PAK' t l 051 B02 5925124 PAK 051 B03 5873 PAK ! 051B05 ! 5966126 PAK ! 051B06 4603302 PAK i S. 051B07 3605154'PAK ! ''"'051B08"'3129079 PAK ! 5427253 PAK 051 BO9 I 051 B 10 489641 PAK ! 051B11 3029371 PAK 051B12 4334204 PAK 051 C01 266001 5j PAK 051 C02 3887675 PAK 051 C03 3638514 PAK' 051 C04 307732ij PAK 051C05 2389705 PAK 051 C05 2389705, PAK 051C06 3406169 PAK } 051 C07 ! 3262068 PAK 051 C08 2306782 PAK 051C10 4224160i PAK 051 C11 4035028j PAK 051 C12 37655131 PAK 051D01 i__ 6073198i PAK 051 D02 PAK 051003-Y"""'587339J PAK" : 051D04'. 1127364i PAK 051004'i 1127364 PAK OgQg---5512888""PAK""" 051 D07 K PAK 05TD08 2567886J PAK "'051D09' ! 49004 ! PAK' 051D10''"'T6073489J"""PAK' 051DIl 43472981 PAK 051D12 j 5661257 PAK 1 051D12 _ ì w PAK 051E02'"""T"'""2558964 PAK' ! 051 E02, 2558964 PAK ! 051E03"j 2151330J"PAK ! j 051 E05 ! 1677011 PAK j if--1677011 PAK 051 E06 E 3330660 PAK.' 051 E07 E, 970234 PAK 051E08 T 3247494 PAK"j 051EO9 29746561 PAK 051E10, 6082177 PAK 051 E11- ___6177074 PAK 051 E12 146554 PAK 051 F01 2660015 PAK 051F02 3887675 PAK ', 051F03 353233 PAK 051F04 2796090 PAK"1 051FO5 2942788 PAK v õMFõF v 051 F07 30680883 PAK f 051 F08 4224160 PAK' ! 051 FO9 Ij 2971447 PAK 051 F10 (618538 PAK 'j051F11"1913729 PAK ! 051F12 _ 9453841 PAK 051G01 ß 61564851 PAK j 051G02 2149543 PAK ! 051GO4 41662271 PA pat 051 G05 2890801 PAK 051 G06 1431643 PAK ; 051G07 _. 3894901i PAK f 051 G085018724 PAK ! 051 GO9 4188878 PAK s s 051 G10 2024237 PAK 5842936 PAK i 051G12 6083524E PAK 051 H01 5581870 PAK 051 H02 4355869 PAK 051 H03 1377184 PAK 051H04 PAK 3162750 PAK 051H06 52613731 PAK ! 051 H07 ! 3514190 PAK j 12742361 PAK 051 051 Hl 1 3953191 PAK 052A01 É 1815731 PAK _.2 ____ 052AO3 88491 PAK 052A03 t 8849iÉ-PAK 052A04 i 464341E PAK 052A05, 1146972. PAK 052AO7 5892199i PAK 052AO8 4624-79,, PAK 052A08 _ "-vAK~- 052A10 6135131 ; PAK 052A11 1 4382102 ! PAK ! s ; r, 5719746i PAK 052A12 5719746 (PAK 052BOl 62264841 PAK 052B02 3307160i PAK # 052B02 y-^ PAK w-.... 052B03 5769515 PAK j 052B04 5697132 PAK j f 052B05490905 PAK 1 052B07 2634938 PAK É 052B08 46182871 PAK | _ _ L 052B10 4106751 PAK j }'""052B12 6082612 PAK ! 052C02 4415846 PAK ; 052C03 1125243E PAK 052C04 É 1714442| PAK i 052C05 823070 PAK . ; 052C06 806769# PAK 052C07 50357831 ; PAK ; e v-e 052C08 1242014 : PAK 1 052C09, 521681i PAK 052C10 T 4907028i PAK 052C11 52525901 PAK 052C12 7925621. PAK 5 052D01 2897462 ! PAK 052D02 w PAK | 052D03 1774692 PAK ........ _.... 052D04 2319223 PAK 052D05 37311 54i PAK 052D06 4653700E} PAK 052D08 _575_8219t PAK 052D09 1190880j_. _W PAK 052Dll 37831971 PAR 19967411 PAK ; 052E01 5528427 PAK i 4s M 052E02 5149710J PAK ! = 052E03 11 65358t PAK 052E04 S55872 rAK 052E05 1 5936681 PAK Hw r 052E06 1 647899 PAK 052E07540833 PAK ! _ 052E08 5862506f PAK ; 052E08 ! 5862506| PAK 052EO9 tHoW 052E10 1 28655891 PAK 052ex 3i PAK 05211, 43_ H, PAK 052E12 ; 5785887'i PAK !'052F012378818 PAK 052 F02. 1393668. PAK 052F03 11 65359i PAK 052F04 1 888252'i PAK 052FO3 11653594 ! PAK 052F05 ; 518271 3j PAK 052F08_ 7 ZGS 8 SK D 52F08 2276266i PAK f 052F08 j"2276266 !"PAK j 052F10 j 464932J PAK'" 052G01 j 61936801 PAK 052G03 i 5139025 PAK 052G04 3358477'PAK 052GO5 F 052G05 _ 172168j PAK !"052G06 (6213709 PAK 052G07'645622, PAK 052G08 t 1556712j PAK'. !'052G09) 855434)'PAK 052G10 j 1078418 PAK 052G11 1843187 PAK j 052H01 5917685 PAK 052Hoi 5917685 PAK 052H021623038 PAK D OJ 285703i PAK 052H04 186782 PAK o* 052H05 50974091 PAK 052HO5 509740 PAK 052H06 (4383138'PAK 052H07 1 58701 86i_ PAK 052H08 {i 854053i PAK 052H09 2392123j PAK 052H10 i 7012141 PAK HZiw 95318i PAK 053A01 j 4214115t ; PAK 053AO1 m o-s ["053A03"3821418} PAK 053A04 41227151 PAK E 053A06 948519 PAK 053A08 VKW t l 053A07 5090358 PAK 053A08 1018261 PAK'. 053A10 4246591 PAK 053A11"1602036r"PAK J 053B01 5511939J PAK 053B03 çgr PAK 1 053BO3 3654665 PAK 053BO4 985206 ; 053B06 6150138 PAK ! 053B07 3244045 PAK 053BO8 31469231 PAK 053B10 L 28541531 PAK '053B11 ; 5848697 PAK 053B12 j 2291583 PAK 053COl 9313801 PAK 053C02 1 2867681 ! PAK s- ; - 5YCA 1903165 ! PAK 053C04. 5565761 ! PÄK t O. 3CO5 t 59 053C05 . _4593243f PAK ......... QggQQg-j---4880286 !"""'PAK '053C07 j'1526202) PAK 053C08 § 5865230, PAK 053CO9 271712 ; PAK _ _. __. _ 053C11 ".. -. _.. 1510728. .. _ PA_K. -.. 053Cl2 14058291 PAK !"'053C12"1405829 PAK' 053D02 5082816'i PAK 30360671 PAK 053DO3 053DO4 AK 053D06 356881 ! PAK 053D07 574892 PAK < 574892 ! PAK - 053D08 430496 PAK.. . 053DO9 5077902 PAK 053D10 5305628. PAK ii 053Dll 2536571 PAK 053D12 3511429 (PAK Mrw 053E01 57221 PAK 053E02_ 4304643 PAK 053E03 5191991 PAK, f 053E04 5686676'; PAK 053E06 383305 PA_K 053E07 ! 1950781 PAK 053E08) 5651169 PAK |<er 5551 AK L 053EO9 1202486'; PAK L 053E10 5304135, PAK 053EIl 15771661 PAK S 053E12 1 1750702 __ PAK 053F01 2654867'; PAK 053fi2_ 3983997 PAK 053F03 1360709 PAK OfoFO ;. 4 053fi5 4134624 PAK H0-r 3245337i PAK 053F08 3958767 ; PAK 053FO8 395876711 PAK i ; 053F10 2784406, PAK'. < 51 9043 PAK s ! 053G01 35670621 PAK 053G03 j _149731 PAK 3762265i PAK 053G05 2963823 PAK 053GO5 29638231 PAK , 053G06 5193396 PAK 053G07 4552422 PAK li 053G08 6103968 PAK 053G10 _ 31106131 PAK 053G11 i 1398847'PAK 053G12 6164856"PAK 013HO-57918181 PAK 053HO3 29033221 PAK ''053H04' ! ; 4928681 j'PAK 1 :"'053H05 !'"4487249J PAK' 053HO6 5104449i PAK 053HO8 6012213 ! PAK 053HO9 34197511 PAK 053H 10-5849526í PAK 053H11 i 39531 9i PAK 054AO2 5495678 PAK e 054z3 256014 PAK pat 054AO6 36820641 PAK 054AOS waE PAK 054A06 1 1895698 PAK 054A08 5008086 PAK 054A10 1 55608 PAK ) 054A085008086 PAK") Q54A10 ! 556089 PAK : 054A12 1707321 PAK 054BOI 4 054B01 1 4594778 PAK 054B02 1 5260462-4 054B03 74861255 PAK 054B04 1168709 PAK ! 054BO5 661081 OAK 054B06 1543671 PAK j 054B07 1168452J PAK j 054B08 15001170 PAK 054BO9 _ 3597137, PAK 054B10 48925301 PAK 054B11'1821913 PAK :' _ _ M1 S 4920970 _ PAK 054C01 i 6208258, PAK s s os4co3 9330291 PAK 054C05 1 1618956 PAK 054C06 1 1526098 PAK 054C09 1 924575% PAK 054D02 ! 3773034 PAK 054D05) 5867602J PAK ! - Q54DQ6'T"'1713750JPAK 054D07'"""T"1853899 PAK'"1 054D08 j 4334837 ; PAK ! j 054D10 T"1621974 PAK 054D11 1013616 PAK : L 054E01'"'2384674'PAK"t 054E02 4616964 PAK 054E03 5936588 PAK 054EO4 054E06 i 5004735, PAK 054E06"'5004735 PAK j s} 054E07 24273361 PAK e 054EOB _ v 054E08} 3140602 PAK j 054E10 17444 PAK 054E11 1 57847231 PAK 054EIl 5784723, PAK i !'0. 54E12'""j3022373 ! PAK ! 054F01 5151 905i PAK 054F02', 38098853 PAK 054F04 ! 3468637 PAK'. 054F04 i 3468637 ! PAK 054FO4 i 34686-3-71-PAK 054F05.. _.. _. _...... __.. _... _... _ 4677790j.. PAK_. ____. _. : 054F06 i 4115659j PAK 5376068 PAK ; _ 054F0_8- 568294 PAK 054FO8 5682941 PAK £.. ___. _. _ 054F09 PAK.. 054FIO 42299591 PAK 054F11, 6974180 PAK 054F12 _ ; _ v )"''054G01"''"" !"""3422289J'PAK 054GO2 4977243 PAK 054GO3 3442304 PAK 054GO4 186722 PAK 054GO5 41269501 PAK 054G06 5093213 ; PAK 054G07 3838803 PAK 054G08 1928099 PAK i 054GO9 342366 PAK 054G10 3959870 PAK' 054G11 1877028 PAK 054G 12 6216221 PAK 054H01 5829968 PAK 054H01 _ sa2ss6s PAK 054H02 1 3512372 PAK 054H03 {1569734 PAK <H 054H04 6242027 PAK " 054H05 919890 PAK 054H06 4155306 PAK 054H07 1733791 PAK 054H08 i 5924283 PAK f'054H09'j''"4066664JPAK' f 054H10 j 4868211 PAK 055All 11616401 PAK 055A12 m7> 055Al2 2160471 PAK 055Bo3 595688 PAK '055B03 j 595688 : PAK 055B04 763009 PAK 055B06 2553616 PAK 055BO7 1026784 PAK 055BO8 33758531 PAK , _ 704990 PAK 055B103777900 PAK 055BlO PAK 055Bll 5370857 PAK 055B12 5645395 PAK 055C01 3468645 PAK W 055C02 6133330 PAK ("055C04 5400274 PAK' ! 055C05 j"3833396 PAK""1 osscos T = PAK ;'055C06 ; 2023159i PAK .. __.... __. _.... 055C06. . w.,. _ _. _.... __.. 2023159j _,. N. T PAK. w. _ P w '055C08' !""266303 PAK 055C11. 429505r PAK 055cl 1 055C12 X 44993991 PAK 055D02 s 117900) PAK 055D03. ! 1132345 !'PAK' 055D01'351218917 PAK 055DO1 055D02'. 1179001 PAK 055D03 i 11 32345í PAK 055D04 1 6181750s PAK 7 055D06,. 1526961 ! PAK 055DO6 055D08 3 4399180 PAK 055DO9 ! 3472697 ! PAK 055D10 7 53820097 PAK L __ =, ___,., ____ F____,,, _,, _N 055D11 709457, PAK 7 055D12 7 4304891, PAK 055E01 2935281 PAK 055EO3 58376441 PAK 055E04 1415677 PAK 3 055E05 1 51180441 PAK we 055E06 3485816J PAK ! H 77 055E08 4607864i PAK 055E09"2225423 PAK 1 055E10 1395240 PAK 7 OSSF01 2134857 PAK ! ww 055F02 32669077 PAK 055F03 1097990 PAK ! 055F04 r"2736002 ! PAK" ; 055F05 3771431 PAK" ! H w 055F06 47698521 PAK 055F08 44153431 PAK 055FO9 2795438 PAK 055F10 3811629 PAK 055F11_ _ ! 51862513 PAK 055F12 5462747j PAK 055GO1 37282981 PAK 055G04 6131543 PAK 055G06 ; 4030558'PAK 055GlO 5521259 PAK !"055G11 3958267 PAK ! 055G 12 664961 PAK r _ r J 7 055H02 50373481 PAK tw -wnw 055H03 5412162t7 PAK ! 055H06 3830336'PAK H E ~ b r 055H07"T720397 PAK" 055H08 565447, PAK pat L 055HO9 59287311 PAK s 055H10 20067803 PAK '056A02 m 056A04 5409799 PAK 056A05 36723 ; PAK . 056A06 ! 3073376'PAK 056A07 199120 PAK"". 7 056A06 4544527 PAK 056A09 r 25904851 PAK '. 056A10 7 5133330 ! PAK 056A12 130695 ! PAK 056B01 1 50201261 PAK . ___. __ 056B02 37_____ PAK _. _.. _.. _.. 056B02 s 376447j PAK 056B03"645478 PAK J 056B03, s 6454783 PAK 056B041299668 PAK a56B05 3 9 PAK 056B06 i 33888801 PAK 056B08 i 5077346 PAK 056B09 7 3366077 PAK OggBOg)"3366077 PAK ! 056BIO 4238837 PAK f"056 B 11'""T 4607019 PAK""1 056B12 3316217 PAK 056C01 884258 PAK 056C02 _ 348317 PAK 7 056C03 7 1381290 PAK 056C04 3138659 PAK 056C06 1256831 PAK 056cl7 6190164 PAK 056C08 619609 PAK 056C09 4273914 PAK 056ClO 2462385 PAK 056C11 118998 PAK 056D01 3178167 PAK j j 056D02 1530368 PAK j 056D03 t 37090781 PAK 056D04 7 5141066 PAK 056D05'""'"4185403 PAK'" 7 056D06 i 1381795j PAK W 056duo7 4218516 PAK 056D08 1 962539 PAK 056DO9 _ 969390 PAK _ 356 D1 D_ 3165651 PAK 056D11 j 3716379 PAK ! 056D12 4353897 PAK r 056E01 w PAK 056E02 11648521 PAK t* n 056E03 548682 PAK 056E04 4538696s PAK - v 056E05 42776jj PAK 056E06 i 589908, PAK 056E08) 4359229 PAK j 056EO9 X PAK ! 056E09'2983152 PAK, f'056E10"6115866"PAK'""1 056E11"'3961019 PAK) 056E12 245490 PAK 056F01 3014304 PAK i 056F02 2622351 PAK 056F03 60605621 PAK )"056F04 112709"PAK J . p5. F05 ;. __.... _ 5494429.. _. _.. _ PAK. 056F06__, __ 1146439'PAK 056FO6 11464391 PAK 056F07 11242297 PAK 056F10 j"3286894 PAK : .. _... __. __.. 056F10 . ___ __.... _...... : 056F10 u 894 ms 056F12 j 5350474 ; PAK 056F12, 5350474'i PAK 056G01 X 339467j PAK v 056G02'7 5651486i PAK 056G03 11595773 PAK 056G04 5346270 PAK j 056G05 4529331 PAK 056G06 5246227 _ PAK r"'056G07'""'"'"'4219585 PAK'"1 056GO9 5244516X7 PAK 52445161 PAK 056GlO 12768171 PAK 7 056G11 2651427 PAK !'056G125841852 PAK"1 056H01 59723277 PAK 1, 056H02 5196732j PAK 056H03 48950927 PAK 056H04 5823416 PAK . 056H05 4579373 PAK 056H07 4930535 PAK ! R » t 056H08 4897723 056H09 3821421 PAK 056H10 936536j, PAK 3222686 v S 057A02 5564330 PAK ! 057A03, 386888i PAK ! 057A04j'3147690 PAK ! 7 057A05 7 9492627t PAK I, 057A06 1097681j PAK Wfw 057A07 < PAK., 057A08 4433640 PAK J X 057A08 i oL PAK 057AO9 2976163 PAK 057A10 5386652 PAK i öFTW Av 057A11 1741309 PAK""' ! 057A12 j 4450558 PAK 1 057B01 2077254 PAK 057B02 105317 PAfC. ' i v- 057B03 941448 PAK 057B04 2282302 PAK 057B04 22823021 PAK 7 057BOS ow PAK 057B06 3700271t PAK 057B07 6072365d PAK-- ! -B f 057B08 3835680 PAK 8 v t 057BO9 PAK v _ 057B10 52896561 PAK 057B11'j587706 PAK' ! i7'057B12', 23999581 PAK v afS 7 057C01, 2770008, PAK 057C02 1 2244827, PAK 057C03"""" !""""- 4055905 PAK""' 40559051 PAK 057C04 j. 4794916i PAK 057C06 i 4109109PAK ; > 057C06 i 41 0910 j PAK 057C07 1109858 ! PA__K .......... '057C10 !"2562533 PAK 057C11 j 5049360 PAK 057C11'7 50493601 PAK 057C12 i 2609503 PAK 057D02 r 4139488 PAK ; o H S 057D04 1 4162847 PAK } 057D05"'"1''751816 PAK"1 7 057D06 3503156 PAK 057DO7 4396197 PAK 057D08 94431 PAK i, 057DO9 5910700 PAK 057D09 ' 057D10 3179526 PAK HDF 3648803---i 057E01 3677358 PAK i w w s 057E02 4353101 PAK 057E03 6100458 PAK ; 057E03 6100458 PAK'I 057E045897925 PAK 4181113 057E05 j 4181113 PAK 057EO6 3452629 PAK i 057E07 6058048 PAK' 057E07 ì 6058048 PAK 057E11 7 6223829 PAK 057FOI 567570 PAK 195690 PAK 057FO2 057F03 5545226 PAK 057F05 53975651 PAK 057F06 1 59703281 PAK !'057F07 5716312)"PAK 057F08 29322701 PAK.' sL 7 057F10 62300937 PAK', 057F11 5251711 PAK 057F12 2286626 PAK 057G01 1201538 PAK 057G02 4108207 PAK O5G03 5728337 PAK j 057G04 5733688 PAK 057GO5 4742415 PAK 057GO6 4162599, PAK 057G07 1 3247159j PAK, i 057GO8---506-3491 PAK 7 057G09'3420712 PAK 057G 10 883970 PAK 057G12 751816 PAK 057H01 _ 3989226 PAK '057H02 1690946 PAK .. _. _.. __, _ _. 057H04 2196615 PAK y ti - ', 057H05 i 475058 PAK 057H06, 313054i, PAK 057H08'4482171. PAK , 057H10 L 2231259i PAK 058A01'148027j PAK 058AOI 058A02 3261207i PAK , _ 058A03 i 4 339735 : PAK __ 058AO4 11263831 PAK 058AOS 3374355i PAK 058A07 L 3446436 PAK 058AO0 "H 27528 PAK t~S r 058AI0 1459449 PAK {'"'058A12 j 6053393'PAK'j 058B01 5936170j P_A_K_ 058B02 895867i PAK 058B03 8406721 PAK 058B04 y 249132 PAK 058B05 3279749 PAK 058BO6 2508583 PAK 058B07, i 2842273 PAK h 058B08 v 3986339K _ L 058BO9 4363628 PAK 058B10 519227 PAK 058B12 i 3951513 PAK 058COI 4578591 PAK 058C02 i 1 884270i PAK x PÄK 058C03 6153466 PAK) 058CO4 PAK 058C05 4219961 PAK 058C06 T 4263732i PAK ! 058C07 !""4364050"PAK 1 058CO9 1 5756903 PAK 058C10 366017 PAK" 058C11 i 6072466 PAK 058C12 6201972 PAK to- .'i 058D01 1761408 PAK 058DO2 4525463 PAK 058D03 401591 PAK OSBDN 3N165 PAK 058D05 1744166 PAK ! 058D08 _1531853 PAK 058DO9 L 4901646 PAK r 058D101295999 PAK j 058D11 1711038 PAK ! U55 D1 1 1711038 PAK 058D12 3651388 PAK 058Dll 1711038 PAK 058E01 465049 PAK 058E02 29460 PAK M 058E03 6172291 PAK 058E04 6097273 PAK 058E05 1702230 PAK 058E06 L 4348206 PAK L 058E07 ì 4202129, PAK __ _-. .-_.... _ _ A _ _.'"__. _. _ _. _ 058E08'52526841 PAK 058EO9 4188857 ! PAK 058E11 ; 48 058E12 ì 349009i, PAK 058E_2 34_0 __. _ 058F01-4036463' !'PAK ! 058F02'5373493ì PAK 058F03 10701321 PAK 058F04 752714j PAK 058F05 f 1578230 PAK 058F06 T 691265, PAK 2911623 PAK ..... rv.. : 058FOE 1 PAK 058FO9 j 2713993 PAK 5527951, PAK 058F11 ; 4914872 PAK 058F12 ! 833346 PAK ; ~1< _ PAK _ 0 058G02 5367064 PAK Z_At 058G03 2241093, PAK 058GO5 4413996 PAK 058G06 2700347 PAK s 058GO7 4534777 PAK w P 058G08 6189474 PAK 058G10 t 444003 PAK 058G12 1 346517 PAK 058H01 5700263 PAK 058H02 058H02 3746060"'PAK _1517731 PAK 058H04 3991649 PAK ; 058H05 f 5520972 PAK m H i 058H06 l 399948 PAK 8926671 PAK 058H08 w 3931380 PAK Hob_ 843713 PAK 056H10 2903923 PAK S 5 059AOI 810409--PAK 059A02 2038512 PAK 059A031126439 PAK) 059A05 3727816 PAK | 059A06 1617471 PAK 059A09'472009 PAK J 059A10 5794399 PAK 059A11 202127 PAK 059B01 4336136 PAK 059B02 8065741 PAK m 059B03978820 PAK' ol 059B04 1 25671411 PAK < PAK |-l 2 059B05 4920588 PAK j 059BO6 1382253 PAK .... _. _.... 059B08 1, 59581871 PAK 059BO9 41631441 PAK L '= L 4183144 PAK ; 059BlO ""'059B11 j 1877002 PAK'"" f 059B12"S'"390316) PAK 059C01 ; 3911859 ; _PAK _ 059C02 ! 3400847j PAK 3400847'PAK 059C04 ? 5128863 ! PAK . _. _-s.. _....... E __ 059C06 381079 __ __PA_K 381079 ! PAK I'UbYUU8'L 059CO8 59166821 PAK ' :-059C09 4630070J PAK' : 059ClO 48501331 059Cll 10273581 PAK ; 059C12 5854589 PAK 059D05 4549333'PA_K' 059D06 5225128 PAK J 059D06 5225128 PAK j 059D08') 8839 PAK j 059D08 883 PAK 059D10 4471779 PAK _ 059D 10 447 1779 3Ãim 059D11 3463635'j PAK 059D12 3626993 PAK j m Lj 059E01 4750873 PAK 059E02 2310905 PAK 059E03 909000 PAK 059EO4 4927958 059E05 as 059E06 2833291 t PAK 059E06 2833291 j PAK] 059EO7 48883731 PAK J j 059E08'317772i PAK j H ) 059E09 482302'PAK'i a S 059F01 4348868 PAK 059F02 248801 31L PAK -l l 059F01 ! 434886 ; PAK i 059F02 2488013 PAK ! F F'059F05'4812241 ;'PAK J 059F06 1638061 PAK'1 059F07 3934960 PAK i L 059F08 4021 011 PAK 059FO9 4892909 PAK 059F10 4909623 PAK 31494291 059Fll PAK J'"059G01"""'"'"1538830)"PAK""j 059GO2 11487591 PAK 059GO3 2338604 PAK r 059G05 3737530PAK. i OiGG5 _ 373, 53 !"059G08 2991535 PAK ! 0 9GO-9 33246091 PAK 059GlO 1 , r OS9G12 < 1 83978i PAK ^ OggO r----5254773,"""'pAK""" ! 059H02 r 5254773i PAK 059HO2 059H03, 1166408, PAK 059H04 1 3021862'PAK 059H05 j 6162718J PAK : 059H06 t 4627364ï PAK 059H07 j3491421 PAK ! ''"059H08] 4692312 ! PAK 059HO9'_ 2343404i PAK 059H10 857252 PAK 21 PAK 059H11 395319 PAK 1 060A01, _t PAK 060A02 1, 5481085| PAK __ _ _ 5481085 PAK __" {"""060A03""2764009 !" PAK< 060A03 060A04 PAK 060A05 , 4012583 PAK 060A06 814341 _ PAK ! 060A08 5823742 PAK . 060A09 1182611 PAK 060A10 060A101017153 PAK ! 43342041 060All PAk 060A12_ 1860296 PAK_ 1 060B01 PAK S 473446 PAK H 060B05 4207414 PAK 060B06 909966 PAK 060B07 T 351 1315 PAK w 060B08 6060554 PAK j 060B094884088 PAK 1 , 060810 3119810 PAK 060B11 2998890 ; PAK"1 060C01 1 37631991 PAK j 060C03 806295 PAK ! 060C04 j 6087136i PAK 060C06 j 3806834} PAK 060C06 3806834 PAK i 060C07 5120922 ! PAK 060C08 s764747í PAK 060C091016409 PAK j 060C10 f 3756123 PAK 060C12 2128974 PAK ! 060D01 848689 PAK i 060D02 6055693 ; PAK 060D03 < 060D04 61527155 PAK 060DO5 3263979 PAK . 060D08 1 525258 PAK 060D09 3708939 PAK ; S 216491 060D11 2111512 PAK w 3061659 PAK 060E03 258823 PAK j f 060E04 5873250 PAK i ~-~ a =n, 060E05, 4128566 ! PAK 060E06 ! 4984079. PAK'' 060E07) 5984634i PAK xoeos 60391 58i PAK _.... _. _... ___ 060E09 _... __... _. 060EO9, 6066429i PAK 060E10 4505357i PAK 060E11" ! 5877438J PAK J 060E12' 3919380i PAK i_ 060F01 ! 1717288i PAK 060F02 1783494, PAK 060F02 i. 060F04 í, 3366078j PAK 060F04 060F05 56445731 PAK 060F06 617254 PAK 060F07 4876596i PAK t 060F08 5123149 ! PAK 060F09 55464651 ! PAK 060F10 5644573 PAK 060F11 409143 PAK 060F123973684 PAK i 060G01'2220236 PAK 060G031242407 PAK 060G04 814909 PAK _ 060G05 i 1480411'j PAK Z *s 14804111 PAK 060G07 139551 8t PAK 060G08822764 PAK 8227641 PAK 060GO9 171 8256f PAK 060G10, 2093229i PAK 060G11 (771355 PAK ' 060G12 6048608i PAK 060H01 15703401 PAK l-----------t 060H02 7279841 PAK,, ! 060H055905664 PAK 060H06} 25789241 PAK 060H07 t""4964458r'PAK 060H08 47428801 PAK 060H091472684) PAK 060H10404195 PAK 060H11 395319 PAK ; 061AO2 57582771 PAK pili- g w L 061 A032348738 PAK p ! ! i- 061A05 3135775i PAK pili .. _. _.. ____ 061A06 1 1413257'j PAK pili- 061AO6 14132571 PAK pili- 061AO7 3549821 PAK pili- t 061A07 354982i PAK pili- 061A08 3247735 PAK pili- L-061 A09 1027358 PAKpi ! i- 061 B 1 5955752 ? PAK pili- 061 B01 -865098 ; PAK pili- 061BO3 30274391 PAK pilai- 061 B04 32288391 PAK pili- 061 B05'. 26655i PAK pili- 061B06. 6701781 PAK pili- 061 B07'750339, PAK pili- 061 B08 6237574j PAK pili- f"""061 B08'6237574"PAK piiji 061BO9, 434887i PAK pili- 061B10'2594806j PAK pili- 061B11 2602819i PAK pili- 061 C02. tA=, 061 C02"""""'3669701 PAKpiii-" L r"061 COS 5501059 PAKpiii-" ! 061 C04 ; 6240453j PAK pili- !, 061C05 ! 339409 PAK pili- f 061C06 i 970713f PAK pili- 5991897 PAK pili- 061CO7 061C08 j 3845716 PAK pili- 061CO9 1987268 PAK pili- 061C10 2216666 PAK pili- 061C11 i 1674612 PAK pili- 061 C12 4185549 PAK pili- 061 D02 3970481 PAK pili- W- -f , i 061D03 1561309 PAK pili- 061D044524167) PAK pili- 061D06 4401199j PAK pili- r 061 D07} 4660568j PAK pili- 061 D08 1 58359961 PAK pili- s 061 D09 3441962L PAK pili-j 061DO9 061 D10 I, 4322962 PAK pili- 061D11 _1 5033212 PAK pili- 061D12 1 B0<. 061E01 i 6162007t PAK pili- 061E02 239855711 PAK pili- 061E04 472365j PAK pili- } 061E05 17a25111 PAK pili- 061E06 f 5930919i PAK pili- j 061 E07, 11462761 PAK pili- 061E08 | 4521488j PAK pili- 061EO9 4717236j PAK pili- 061 E11 4380032f PAK pili- w 061E12 4044343j PAK pili- 061 F01 33016761 PAK'pili- 061 F02 5828638 PAK pili-f 061 F03 5634333 PAK pili- 061FO4 53-189761 PAK pili- 061 F05 3420298j PAK pili- i- L 061 F06 6028099 PAK pili- 061 F09 2874916 PAKpi))-1 061F10 170223 | PAK pili- 061F11 164740 PAK pili- 061 F12 j 41695921 PAK pili- 061 G05 j 2126206 PAK pili- 5 ft 061G07 j 815297j PAK pili- 061G08 ! 62601871 PAK pili- 061G09'i 1347823i PAK pili- 061G10 37753991, PAK pili- 061G11 ; 4218405ì PAK pili- a 1166408j PAK pili- _.. , __. ___.. 061 H01 t _ 5609073t PAK pili- 061 H02 1, 4186785 ! PAK pili- 061 H03 = 3069909i PAK pili- 061H04'i 6121348i PAKpili- 061 H05 e pili- 061 H06 790965j PAK pili- 061 H07 _20615391 PAK pili- st 061H08 2874916i PAK pili- js 061 HO9 2456931 PAK pili- , 061H10 5207481j PAK pili- 061 H11 _ 395318 PAK pili- ; wf s 062A01 522496 PAK pili- C 062A02 2186046 PAK pili- sl 062A03 8816501 PAK pili- S 062A05 4573163 ! PAK pili- 06S05 v 062A06 45927781 PAK'pili-S 062A07 2767284 PAK pili- 062A08 245488 PAK pili- 062A09 245488 PAK pili- 062A11 4883451 PAK pili- 062A12 _ 245488 PAK pili-.' 052B01 5814642 PAK pili- 062B02 __ 972216 PAK pili- 062B03 2482611 PAK pili- 062B04 3763613 PAK pili- 062B07 6163753i PAK pili- 062BO8 48806-71 PAK pili- 062B09 {3363603j, PAK pili- 062B10 2023921 PAK pili- 062BIO 062B11 2454881i PAK pili- 062C01 2796578 PAK pili- 062C02 1421710 PAK pili- 062CO3 6193624 PAK pili- 062C04 4335461 PAK pili- 062C05 5582809 PAK pi 062C06 1887384 PAK pili- 062C07 2674834 PAK pili-_ 062C08 3594859 ; PAK pili-.. 062C10 6126368} PAK pili- _ 062C11 61263681 PAK pili- } | 062C12 6126368i PAK pili- t J 062D01 1 30630431 PAK pili-'i 062D02 1150387 PAK pili- 062D03 i, 4879780j PAK pili- 062D06 55223491 PAK pili-'. 3 062D07 i, 5567212t PAK pili- i062D09'j 6126368 PAKpij ! j 062D10 5 6126368í, PAK pili- 062D10 ^_ i PAK' 062D11'6126368i PAK pili- : 062D11' ; 6126368) PAKpiti- 062Dl2 61263681 PAK pili- 062E05 1, _1S PAK pili- 062E06'l _ 4351023i PAK piii- ___ 062E07 2219268 PAK pili- 062E08. 6126368 PAK pili- 062EO8 6126368 PAK pili- s 062E10 i 6126368 PAK pili- 062E11 6126368 PAK pili- 062E12 7 PAK piil- ! 062F01 J 434886 PAKpiti- j062F02'""")""577228 PAK pili- 062F03 s 1460121 PAK pili- s 062F06 6126368 PAK pili- 062F07 1 6126368 PAK pi li 062F08 j"'6126368 PAKpiti-j 062F09 6126368 PAK pit)-j 062F08 6126368 PAK pili- j 062F11'T6126368 PAKpi) i- j 062fol G 612636E < 062G01 1283697 PAK pili- 062G04 6126368 PAK pili- H 062G05 6126368 PAKpi))-j 062G04 6126368 PAK pili- 062GO6 6126368 PAK pili- 062GO7 6126368 PAK pili- f _ 062G07 612636R3 PAK pili- 062G08 6126368 PAK pili- 062G11 j6126368 PAKpiti- ; 062G12 1 6126368 PAK pili- s 062H01 1838765t PAK pili- r 062H02 j3931380 PAKpiti- 062HO3 205757 PAK pili- 062H02 __ ~ 062HO5 61263681 PAK pili- 062H05 6126368ì PAK pili- 062H06.. e 062H07 i 6126368 PAK pili- 062H08 6126368 PAK pili- 6126368 PAK pili- 062HlO 6126368 PAK pili- ili 062H11 1 6126368 PAK pili- 1864595 PAK s 063A02 4577583 ; PAK s 063A03 Si 4623271 PAK 063AO5 j''063A05 r"6187365 PAK'j 063A07 4396482 PAK 063A08 980960 PAK 063AO9 ! 5389145 PAK j - 063A10""'3714805 PAK 1 063A11-. 4859681 PAK ! 063A11 1 48596811 PAK i. 063A12 063All PAK 063B01 ; 58161i PAK pat 063B02 i 2480836. PAK 063B03 t 964761 l PAK 063B04 4323451 PAK 053B05 C, 3867238 ; PAK 063BO5 38672381 PAK 063B08" ! 5389781 PAK 063B08, 5389781 i PAK I 063B11 i4Q4986J PAK 063COl 38376261 PAK 063C02 i ; 467401 i PAK 063C05 i 617809i PAK 063CO8 58179261 PAK 063CO9 5976549ii PAK '"""Q63C10 4691492'PAK 063ClO PAK 063CI2 61353961 PAK i, 063D02 1 890907 PAK 063DO2 PAK 063D03 820642i PAK ! 063D05 6168347 PAK 063DO6 34180921 PAK xw 063D07 t ; 1099496 PAK 063D08 4185902 PAK 063D12 4828824 PAK 063E02 380103 PAK t 063E05 5457853i ; PAK w i'063E06 1292848j^j PAK 063E07 i 063E07 5861274 PAK : 063EO7 58612741.-PAK 063E09 5485515 ; PAK 063E10 662186 PAK 063ElO 662186 PAK 'i 063E11 _ 58104| PAK ii 063E12 38314351 PAK 063F01 39199201 PAK 063F02 4301739) PAK ! 063F04 1 4280034i PAK 063F05 1158788T'PAK" 063F07 6064109 PAK 1 063F08 3414689 PAK : 063F10 5035262 PAK . _.. t_.. _.. _____ ........ ___ p63F11 Y. 3813526',- PAK --_° 063Fll 26 PAK 063Fl2 6140999 PAK i 063G02 1857879 PAK e 063G03 1 080687i PAK « | 063G04 36401191 PAK !'063G051265153 PAK ! 063GO7 4508353 PAK 063GO9 1317210 PAK, 063G10 3050895i3 PAK - 063G11 4019209 PAK e 063H01 3634874 PAK PAK 063HO2 152357* J 063H03 3886848j PAK' ! r 063Ho4 PAK H ii 063H06 6085999 PAK _ 063H07 2789478 PAK 063H10'5580029 ! PAK 054A01, 910928, PAK 4. 064A02_ 1 8554361 PAK 054A03 f 5924276 ! PAK 064A04 t, 3633746í PAK 064A05 X, PAK 064A06 §, 5179182f'PAK [064A07 1276940 PAK 064AO9 61960 PAK 064A09 1 619609 PAK 1149859'PAK 064A11 ! 2559980 PAK 064A12 _ _ _ 3390116j PAK _ _ ', 064A12 _, 33901 161, PAK 064B01 1 Wiw PAK 064B02'i 4236620, PAK 064B03 5340297} PAK', ; _y 064B04, 4363981 PAK 064B04 43639811 PAK 064B06 _ 5605621 t PAK r 064B07 4571866'PAK . 064B09 3257360 PAK 064B11 _4 T 064B12 2375623 PAK 064C01 4102306 PAK 064C02 3048716 PAK 064C04 4538704 PAK'. 064C05 1780529 PAK r 064C06 1760522 PAK 064C07576267) PAK" r 064C07 576267 PAK r oucOf = 064C10 5126155t PAK 064C11 3679268 PAK 064D01 5081539 PAK 064D02 6104666 PAK 064D03 r'2266420PAK 064D04) 1770947 PAK 064DO4 17709471 PAK ) 064D06 13215213 PAK I, 064D07"""1077640 PAK 064D09 2904482p PAK 064D10 4303847 PAK 064D12 1713618 PAK 064E01 179957 PAK 064EO1 179957 PAK 064E02 2905531 PAK f 064E03 5293460 PAK 064EO3 5293460 PAK 064E04 3453385 PAK 064EO5 1045916 PAK 064E07 1 3153585 PAK 064E08 6234787 PAK 064E10 1025545 PAK 064FO2 1832530 PAK 064F03 M_ 4617041 PAK 064F04 _ 2503673 PAK w H 064F06 560354 PAK 064F07'20201 27z PAK --T-2 5 8"3"'8'f2i PAK 064F08 s 2583822 ! PAK S 064F09, 2532110. PAK 064F10 ! 321 3745f PAK 064fui2 9532051 PAK 064G01 3274554 ; PAK 064GO2 154806 ; PAK 064G05 7518165 PAK i""064G06''T'"''2839349)""PAK 064G07'3315574 PAK"" sw 064GO8 PAK 5, 064G08 5129696i PAK 064GO9 5815721 PAK 064G10 1292321', PAK 5S 064G11 273012', PAK 5 064G12 5258655 {PAK S 064H02 8642631 PAK PAK 064HO4 32549 t 064H05 4881106', PAK 064H06 i 5300816 PAK 064H07 2322929i PAK 5 064H08 6056031 PAK 064HO9 338714j PAK s ,, 064H10 42390631 PAK s 065A01 j 213053 PAK pili- 065A02 102027 PAK pili- S 065A03 3561848f PAK pili- 065A04 2827456'PAK pili- 065A05 36918725, PAK pili- _065A06 _- V 3811269 PAK pili- 065A06 1 381126 I PAK pili- 065A10 2365466 PAK pili- 065A10, 2365466j PAK pili- S 065A11 wjv 065A12 14655311 PAK pili- 065B01 1 54274834 PAK pili- 065B02 6109641 PAK pili- st- 065BO3 8957171 PAK pili- 065BO4 46613291 PAK pili- 065B05 ! 3373867} PAK pili- 065BO6 46835261 PAK pili- sS 065B07 3755105 PAK pili- 5 065BO9 931497 PAK pili- 065B10 3147506 PAK pili- 065B12 5 41568965, PAK pili- 065COl 28801941 PAK pili- S, 065C02 5, 31533951 PAK pili- 5 065C03 740899 PAK pili- 065C04 2374394 PAK pili- 065C05 1 5476873 PAK pili- 065C07 1 5831 10 PAK pili- 065CO8 25118991 PAK pili- 5 < _L J 065C09 1578675 PAKpiti-j r"'065C10' ! 4248094 ! PAKpitjI ............. ....... . gg"pAK pi) i-'" 065Cl 867526 PAK pili- 065C12 ! 1133179', PAK pili- 5431177 PAK pili- 065DO3 065D05, 4194736 PAK pili- 065D06'-40556i PAKpili- 065DO7 2531813 PAK pili- 065DO8 ; 1493098 ! PAK pili- 065D10'S 330197 PAK piii- 065DI 1 065D11 ji 220703 PAK pili- r u PAK piii- 065E01 1 29134691 PAK pili- 065E02 i 48214871 PAK pili- 065E03, 58159611 PAK pili- i t 065E04 1472344 PAK pili- E 065E06 197187 PAK pili- owl 065EO7 5493474 PAK pili- _. W . __. 065E08 t 5127092 PAK pili- i 065Ell 49018551 PAK pili-i Ls g 065FOI 3307955 Kpili- 065F02 f 4065385 PAK pili- p 065F03 146511 PAK pili- 065F04 5204674 ! PAK pili- 065F06 1 5677927j PAK pili- 065F07 aS PAK pili- S 065F09 4131954j PAK pili- o 065F12 3047361 PAK pili- 065GO2 3201028 PAK pili- . __-. ___. _ _______ PAK iIW ! 065G03 3798133 PAK pili- 065G04 3442846 PAK pili- 065G05 4543237 ! PAK pili- 065G06 _ 320024 PAK pili- 065G08 5093588 PAKpiti- I 065G09 3°748272 PAK pili- ! 065G10, 5888031 PAK pili- ; __ 065H01_ ; 395060'PAK pili- 065HO2 1234143 PAK pili- i 065H03 j 4282511 PAKpiti- H ; GP ; F PAK pili-iN H 065H04 1449253 PAK pili- 065HO5 6313971 PAK pili- 065HO7 9594441 PAK pili- 065H08 ! 44580i PAK pili- 065H09 | 4188992 ; PAK pili- tHir r 5252649i PAK pili- 066AOI 539405 066A02 i 950972} PAK 066A03 40969 10 PAK 066A04 792936 PAK 066AO5 28539981 PAK ', 066A06 ì 954708 PAK j 066A07 ! 5528278 PAK j 066A06 1 4717155 PAK ____... __. pAK . 066A10''"4514642) PAK 066A12'447015, HAS ' 066B01 __ í 3373489j PAK 066B02 i, 5262256'PAK 37 3855210ti PAK 066BO3 38552101 PAK 066B:4 W,. PAK 341365 066B05 i 341365 ! PAK 066BO9 19711031 PAK :. 066B10, 30675441 PAK 066B11 ; 18610281 PAK 066B12', 811 628i PAK "066C01""j"5134066 !"" PAK"' , i 066C01 5134066 PAK 066CO2 14005781 PAK 066C04'3408085 PAK 066C051152994 PAK ! 066C06'''2712094 PAK ! ) 066C07'1098422 PAK' 066C08 5538458 PAK 066CO9 4444772 PAK 066Cll 3148189 PAK 066D01 6010854 PAK 066D03, 5758451 PAK 066D04 235686 PAK J .......... 066D05} 3156353 PAK H0 PAK 066D07 j 2930757 PAK w 066DO9 PAK 066D10 90739E PAK 066E01 1 5203283i ; PAK î, 066E02 ___ _S PAK 066E03 Ij 962214 ; PAK 066E04 1 935502'i PAK 066E05 j 6132671 PAK , y 066E07 5169822 PAK 066E08 3569363 PAK 066E09 5511249) PAK ; 066E10 j 25126 ; PAK 066E11 j 5429260 PAK ! 066E12 i 4162302 PAK 066F02' 4551124 PAK ! D 7 PAK 066F04 759967 PAK ! 066F05 3965632 PAK 066F08 4910253 PAK 066fi9 4210502 PAK 066F10 3672579 PAK 066F11 _ 808137 PAK f 066F12 475140 PAK J 066G01 j 2269385'i PAK 066GO3 1480746 PAK 066G04 962539 ; '066G07 f734085 ; PAK ; 066G07 1 _3Lo 066G08 j 3679268^ ; PAK 066GO9 582812if PAK 4 066G 396335'PAK-. -... 066G11# 3241494 PAK . ; 1807080, PAK 066H01 ! 066H02 j 3397995 PAK 066H04 163200K m- 066HO5 1375100 PAK 066H06 i'3908428 PAK 066H09 3722790 PAK 066H11 395319 PAK 068A02 2094770 PAK pili- 068AO4 1987268 PAK pili- 068A05 5740235 PAK pili- 068AO6 3932206 PAK pili- W 068A07 1660607 PAK pili- 068AO8 1987270 PAK. pili- 068A09 3926324 PAK pili- 068A11 3590093 PAK pili-^ 068A12 1 ; 6120297 PAK pili 4. t 068B01 19872683 PAK pili. 068B02 5417934 PAK pili- 068B04 5563280 PAK pili- 068B05 5381209 PAK pili- 068B06 644690 PAK pili- 068B07 29010691 PAK pili- 068B08 3180329t PAK pili- 068BO9 _ 4547441 PAK pili- 068B11 3560647 PAK pili- PAK pili- 068B12 1373422 PAK pili-i 068C02 4114885 PAK pili- 068C03 4508483 PAK pili- 068C04 339410 PAK pili- 068C05T'"5998779 PAKpi ! !-' ! 068CO6 1438639 PAK pili- # 068C07 ; 5547182 PAK pili- 068C08 181598 PAK pili- 068C09 4347499 PAK pili- PAK pi- 068C10 4643796 PAK pili- 068C11 3382613 il'' 068C12 6126369 PAKpi))- : 068D01 X 61123633 PAK pili- 068D02 3 103219t PAK pili- 068D03 947985 PAK pili- 068D05 3835199 PAK pili-' w 5370063i PAK pili- 068D07 1 a 068DO7 39970661 PAK pili- i, 068D09 1 16093681 PAK piii- PAK. pili--........ _y 068duo r 1934449 ! PAK pili- 068D11 r 5861335', PAK pili- 068D12, 4010436j PAK pili- 068E03 fl 1147253 PAK pili- 53209661 PAK pili- 068E05 SL<eL 068EO5 17539441 PAK pili- 068EO6 1995183 ! PAK pili- !'"068E07 4306674JPAKpifi- }. 068E10 1137751 j PAK pili- 4314936 PAK piii- 068E11 4314936 PAK pili- 3_ 068FOI 3355326 PAK pili- 068FO2 5770189 PAK pili 068F03 1345134 PAK pili- ; 068F05 1090425 PAK pili- a 068F07 494263 PAK pili- i 068F08 4937550 PAK pili- 068F09 2079135 PAK pili- L 068F10 3237043 PAK pili- 068F11 1366071 PAK pili- 068F12 257671 PAK pili- 068G01 503796 PAK pili- 068G02 4024172 PAK pili- 068G03 720922 PAK pili- 068GO4 3520511 PAK pili- 068G06 1915614 PAK pili- 068G07 3056501 PAK pili- ; 068G10 679204| PAK pili-3 068G10679204 PAK pili- ! 068G12 1235181j PAK pili- 068hot 13879441 PAKpi-i 068H04 1291301 PAK pili- v 068H05 4432765 PAK pili- 068H06 5980173 PAK pili- 068H07 4459209 PAK pili- 068H08 2811 29 S ! L 3280854 PAK pili- 05SH1 O v 4419706 PAK pili- 069A02 395318 PAK pili- 069A02 1733608 PAK pili- 968280 PAK pili- 069A05 2017230 PAK pili- H t 069A06 4393279 PAK pili- 069A07 1992916 PAK pili- 069A08 3398642 PAK pili- 069A09 5742954 PAK pili- H 069A10 907682 PAK pili- . wFts 069B02 6224406 PAK pili- t t o 069B03 4325192 PAK pili- 069B04 i 5677171 PAK pili- 069B05 375214 PAK pili- 069B06 ! 4099483r PAK pili_. __. 069B07 2344645 PAK pili- 069BO6 i 069B08 4300487. PAK pili- 069BIO 25059091 PAK pili- .. _.. __ 069B11 795009 [p --.. _. 069B12 | 2566037j PAK pili- 069C01 ; 142679s PAK pili- 069C02 t 60183, PAK pili- 069C03 i 1275267i PAK pili- 069C05 i 58744l PAKpili- o 069C06 657822 PAK pili- L fl 069C06 657822 PAKpiii-' 069C07 i 32111901 PAK pili-i, 069C08 !, 6224405s PAKpili- 069CO9 3852574 PAK pili- 069C10 | 4254482 PAK pili- 069C11 i 3306237 PAK pili- 069D01 5097680 PAK pili-' 069D02 4569200 PAK pili- 069DO3 42335391 PAK pili- 069D04 37260061 PAK pili- 069D05 6230087i PAK'pili- 't 069D06 43457521 PAK pili- 069D07 3584153 PAK pili- 069D08 462181 PAK pili- 069DO9 59158001, PAK pili- 069D10 j 4671384j PAK pili- 069D11 1 2093840 PAK pili-'. v v 069D12 6036374 PAK pili- 069E01'""'5097680 PAKpi ! i-"1 069E02'6101688 PAKpi ! !- i 069E02 i 6101688j PAK pili-¢ 069EO4 23406461 PAK pili- 069E04 < 069E05 28145301 PAK pili- 069E06 | 330539 PAK pili- m s 1, 069E07 3007976 PAK pili- 069E08 20041481 PAK pili-3' 069EO9 5915800j PAK pili- 069E10 > 069Ell 3231213 PAK pili- 069ex2 1518864 PAK pili- 069F01'3934097 PAKpiii- v i 069F03 3379728 PAK pili- 069FO3 069F04 5789443i PAK pili-41 069F05 2259379 PAK pili- 069F06 115748 PAK pili- 069F07 i 120172 PAK pili-', 069F08 5796176 PAK pili- m 069FO9 6257841 PAK pili- 069F10 4436207j PAK pili- 069F11 556107i PAK pili- 069G02, 5097680| PAK pili- 069G03 1 2791022i PAK pili-. f""""""069G04'j'""2715493'"PAKpiti-'J F 069G05 r"1287218 PAKpi ! !- ! 069G04 2715493,'PAK pili- 069G05 12872181 PAK pili-, 069G06 j 4212743 ! PAK pili- 069G07 ii27 069G07 442295 ; PAK pili- 069GO9 ! 4573179, PAK pili- 069G10,., 55829013 PAK pili- 069G11 m1 2718515 PAKpili-. 069G12 3852573j PAK pili- ! 069H01'5784895)'PAK pit)-"" 069H02 2132702 PAK pili- '069H04 T 3952Z PAKpili- 069H05 2312020 PAK pili- 069H06) 2763870 PAKpiti-'j 069H07 _ ; 649830 PAK pili- j 069H08 659793) PAK piii-j 069HO9 1516254 PAK pili- 069H10 2000634t, PAK pili- 069H11, 4671383 PAK pili- s 070A01 | 2999079 PAK pili- , 070A02 2284966 PAK pili- 070A04 5803056 PAK pili- 070A05 2355279 PAK pili- t | 070A06 56415951 PAK pili- 070A07 t 933108i PAK pili- 070A082749792 PAK pili- 07Xg 5790133 PAK pili-, Æ 070A10 1710416 PAK pili- 070A11 185607 PAK pili-, 070A12 9751871 PAK pili-ii 070B01 2134856 PAK pili- 070B03 5913497| PAK pili- 070B04 3523037 PAK pili- 070B05 33933051 PAK pili- ~ v H 070B06 2422663 PAK pili- 070B07 1600371 ;, PAK pili- 070B08 1600380 PAK pili- 070B09 5759009 PAK pili- 070B10 2353738 PAK pili- F 070B11 _ 1029364 PAK pili- 070B12 3926918 PAK pili- 070C01 399202 PAK pili- 070C02 1060792'PAK pili-'. w w 070C04 5891379 PAK pili- 070C05 1 605654', PAK pili- 070C06 1 1376867, PAK pili- 070C07 662078 PAK pili- 070C08 6185545 PAK pili- t-070CO9 42475521 PAK pili- 070C10 pili- i 070C11 5384027 PAKpiii-j W 1 070C12 1855331 PAK pili- 070D01 j 51870261 PAK pili- 070D02 5725 i971 PM Hi-', 070D03 í 28572241 PAK pili- _ 070D04 1 _ 51 89745i'PAK pili- 5189745t'PAK pili- "070D06 2493646 PAKpiti-1 070D07 ! 1248501, PAK pili- 070DO9'ir 6224405f PAK pili- t L 070D10 56736031 PAK pili- '"070D11 i i PAK piii 070D12 i'2614864 PAK pili-' 070E01 i 5258962 PAK pili- 070E02 2991586 PAK pili-T 7921891 PAK pili- 070EC) 3 070E04 3576911 PAK pili- 070E05 1650792 PAK pili-j 070E06 6191015 PAK pili- 070E07 3368893 PAK pili-1 Ij 070E08 4300392 PAK pili- 070E09 '5048118 PAK pili-, _ j '070E10'395092 PAKpiti-' 070Ell 2063344 PAK pili- 070F01 i 1331463 PAK pili- 070F02 597078 PAK pili- 070F03 5084171 PAK pili- 070F041 3328183 PAK pili- ; 070F05 44815541 PAK pili- 070F06 44815541 PAK pili- 070F08 _ 5419204 PAK pili-', 070FO9 5809254 PAK pili- f wo 070F10 6224406 PAK pili- 070F11 1895395 PAK pili- 070F12 38316781 PAK pili- 3171271 PAK pili- ! 070G05 1016012 PAK pili- 070G08 5189682 PAK pili- T 070Gos 2574828 PAK pili- 070G10 34449231 PAK pili- 070G12 i SIK < 070G12 6065579 PAK pili- T 070H01 3833690§ PAK pili- i 070H02 _7_15025 PAK pili-_ H 313 MK p i 070H03 3479313PAK pili- 070H04 57438501 PAK pili- T, 070H05 _ 4931 184} PAK pili-, Di 070H06 T 3272903 PAK pili- ; 070H07 6017548 PAK pili- o 070H08 2697485 PAK pili- C 070HO9 5766050i PAK pili- 070H10 i 534983l PAK pili-.' 070H11, 395318T PAK pili- ; 071A01 1310161 PAK pili- 071A02 S 6019610i PAK pili- 071A03 i 53697297 PAK pili- i-071A04 2291134e PAK pili- 071A05 _ ! 1217393 ; PAK pili-_ 071A05 1217393J PAKpi ! !- J 071 A07 3071609 PAK pili- 071A08 12435511 PAK pili- '071A09599455J PAK pili- 071A10 j 465518'j PAK pili- 071A11 i 3875351. ; PAK pili- i PAK pili- 071 B025466739 PAK pili- 071BO3 6151696 PAK pili- 071BO4 1058650 PAK pili- tWe 071BO9 48094581 PAK pili- , 071 B10 3805947 PAK ili 4' a 071B111761897 PAKpi) i- r 071B12 ! 4720148 PAKpiii- 071C01 a7_ 5355415, 7 PAK pili- 071COl 071CO2 848621 PAK pili-1 071C03 446037 I PAK pili- 071C04 53667 I PAK piii- 071C05 731610 PAK pili- ; 071C07 4518581 PAK pili- 071C08 j 5849598 PAK pili- 071C09 841894 PAK pili- 071C10 1398779 PAK pili-. T 071C11, 1546649, 7 PAK pili- 071CII 1546649 PAK pii' 071C12 509330 PAK pili- 071D01 2999710 PAK pili- 071DO2 5772741 PAK pili 071DO5 6924611 PAK pili- t , 7 071D06 5292742 PAK pili- l t 071D08 _ __ 1894331| PAK pili- 071DO9 5903734 PAK pili- 071D10 2296916 PAKpi))- 071D11 3586198j, PAK pili- 071E01 i 5548314 PAK pili- 071E04 4005571 PAK pili- H LE 071E05 1160649 PAK pili- ; 071 E06 f 5292742 PAK pili-i ; 0711E07 _ 258491 Oi PAK pili- 071 EOS'5598484 PAKpi) i- 071 E10 1015314 PAK pili- 071 E11 6224406 PAK pili- 071E12 4276116 PAKpiii-S 071FOI 3852574 PAK pili- 071F02 ! 5693864 PAK pili- x ! 071F03''4617980 PAKpiti- 071 F04 6229444j PAK pili- 7 071 F05 | 8728011 PAK pili- -7---3513860 071 F06 35138601 PAK pili- 071F10 ii 8047271 PAKpili- ! 071F12 7 6684767 PAK pili- . _. _.. __ ___. _____. __. . _. _..... 071GOI 4863962i PAK pili- 071G03 § 5652001 ! PAK pili- 071G04 ! 4037390i, PAK pili- 071GO6 12975961 PAK pili- .......... 071G07 i 27216501 PAK pili- 071G08'i 416562i PAK pili- l 4165621 PA 071G11 3188162# PAK pili- L"071G12'"''"2165171 PAK'p ! ! !-"" 071H01, 222650 PAK pili- 071H02 1, 1019604i PAK pili- 071 H04 i w PAK pili- 071H05 S 12888601 PAK pili- 071H06 1699139} PAK pili- 071HO6 1 071H07 6224406i PAK p m 071H08 2931989 PAK pili- 0953l8 pi; ""072A01 1601639 PAK) oo 072A02 ! 1971606 PAK J 072AO3 3793264 PAK 072A04 1 6109305 PAK 072A05 230083 PAK 072AO7 5515460 PAK 072AO9 wi PAK 072A10 3642382 PAK I w fi Ht 3120294 PAK 072AI2 072B01 1457732 PAK J OTZ-a_ PAK --'--072B02 343305 PAK 072B03 2889964 PAK 072BO4 3976706 PAK R 072B05 984014 PA : 072BO6 67013, PAK 7 072B08 57962271 PAK P 072B10 1 161678} PAK 072B11 4248542 PAK ? * * 072B12 1627559 PAK 072C01 620240 PAK 072C02 ß 640680 PAK 072C03 2900702 PAK j 072C04 5755339 PAK 3 v o 072C06 661080 ; PAK 072C07 682578 PAK 072C08 581618 PAK 072CO9 5494588 PAK i 072C11 1757694 PAK 072C12 2070159 PAK j iZ PAK 072DO2 617 033 PAK 'PZ2D03 4247708J PAK J 072D04__= 3798285 PAK ) 072DQ5'932042 PAK ! _ 072D06 __ 3858099 ; PAK _ : 072D08'249501 PAK '"072D08 J 249501 PAK ---------- 072D11 i 1 977727L PAK 072E01 ! 5698414'j PAK : _. _. 072E02 í 101826 PAK I 8 072E03 1 2600263 PAK 072E04'í 2615709 ; PAK f'""072E05""'"'4243652J PAK""' 072E06'317679 PAK 072E07 ! 611 0086t PAK 072E08"" ! 5501819 PAK". 072E09 1 2190435 PAK 072E10 3048478j PAK 072E11 PAK 072E12 3065702j PAK W2501 2518515j PAK 072F02 5676942s PAK 072F03 1034468 PAK I PAK 072F04 21979 PAK e w w 072F05 1'323751 PAK 1 072F06 2688812 PAK 072F07, 2285131 j PAK 072F08 2135478 PAK" 072F09 33983451 PAK 072F10 1927952 PAK 072F11 3458073 PAK 072G01 4204972 PAK 072G02 6147445 ! PAK t F j 072G04 5662204 PAK 072G05 i 1774631 PAK 072G07 6091885 PAK 072GO9 776326 PAK 072G11 7 2142597 PAK 072G12 _ 2134874j PAK ; vas ; mr m 072H01 ! 1451770 PAK J 072H02'""""6024771 PAK"1 072H04 í 1458425t PAK i 1769824 PAK 072H063831679 PAK 072H07 22035251 PAK 072H08 5289656 PAK ! 072HO9 3231373 ; PAK 072HlO 5120195i PAK 073A01 j 4704997j ; PAK 073A02 51196541 PAK 073A03 3174130 PAK 073A04 1379831 PAK 073A05'3170739 PAK i 073A06 j 13457541 PAK 073A074383656 PAK' ! 073A08 : 5711339'PAK ........ gQ T'3211123 ;""'PAK'"""" PAK -- :. 1034469i 073A12 _ t_ 2236187ì PAK 073B01 ; 4970169'PAK 073BO2 073B02 _ 1 _ 1374715j PAK 073B03 1 1034469, PAK 073B04. J307732 ; PAK 073B05'51 92039 ! PAK r""'073B06"""4353584"""'PAK 073B06 ___ 4353584 ; PAK 073B08 1 o PAK 073BO9 59552051 PAK i 073B09 5955205 PAK r 073B12 | 2032581, PAK 073C01 3976656, j PAK 073C03 2538990 PAK D 7SCN 1923243 PAK 073C05 3901813 ! PAK 073C06 4911292 PAK o 073C096092304 PAK 073C10 1539345 PAK _.. _ _ _ v 073C11 3716552 PAK 073C12 3235544 PAK L 073D01 821711 PAK 073D02 3245793 PAK ___ 073D03 3439089 PAK 073D04 3520169 PAK 073D05 5420985 PAK 073D06 1034469 PAK_ 073D06 _ 10344691 PAK 073D07 5780923>K 073D08 1 4036534 PAK 073DO9 460315 PAK 073D10 341485,, PAK 073Dll 39877 073D12 578059Z PAK 073E01 358499 PAK 073E02 1814951,. PAK 073E04 162038, i PAK ow a 073E05 30077201 PAK z 073E07 21635691 PAK 073EO8 153741 PAK 073E09 1532348 PAK 3 073E10 2867679 PAK 073E11 3573935 PAK 073E12 1868778 PAK 073F02 24671111 PAK 073F04 37556521 PAK i 073F05 4297306 PAK 073F06 5058989 PAK 073F07 _ 3625059 PAK 073F10 1 36184691 PAK 073G02 | 136911 3t PAK 073Go3 1 31787780 PAK _. _. ___. ___. _. _ 0 '073G04"T"""5618494j"PAK ! 073G05 i-s PAK 073G06 ! 1313050 ! PAK 073G07"j'4179090 ; PAK' 073G08"""T""""6114122 !'"" PAK"""" 073G09 3297648 PAK 073G11. j494507 PAK ! 073G12'g 4834488 ! PAK "'""""073H01 ['""28871'PAK"" : 073HOl 288711 PAK 073H02 ? 1 PAK tj 073H03 w 61963911 PAK r 073H06 211 1752, PAK 073H07 6109641 ? PAK l | 073H08 633110 PAK 073H10 j 2006206 PAK 073Hll 3953181 PAK ......... 074A01 6055860§ PAK 074A02 5008086 PAK : 074A04 3262781 PAK 074A05 5023500 PAK 074AO6 2480392 PAK ? 074A08 O PAK, ? 074AO8 074AO9 6027327t PAK ? 074A10 3377875 PAK j 074A11 36498221 PAK f 074A12 4930454 PAK j 074B01 ? 524124 PAK i. 074B02 682645 PAK 074B04 t 1663993 PAK 074B05 34235191 PAK ? 074BO 5 4979236, PAK 074B07 9475 0 PAK = s 074B08 074BO8 1099431 PAK 0748096092656 PAK 074B11 6019055 PAK ? s4s2 36041247 [074B12)'"3804124 PAK i j074P01'"""1932008'PAK 074F02 3224625 PAK w 074F03 5298794 PAK 074F05 3731764 PAK ! 074F07 _ 5676942, PAK 074F08 39866641 PAK 074F09'4346467 PAK ! 074F10 3986661 PAK r""074F11 5305210 PAK 1 074F12 1034469| PAK i ? i 074G01 6213914 PAK i 074G02 2560460 PAK j j |. ! 074G03 5411418) PAK i 074G03 541141 8j PAK 074GO5 T'1591268 PAK J i, 074G06 ß 9783371 PAK . ! 074G07 !""6123918T'PAK" ; 074G08 5 61 44878s PAK 074G09 1 6097792i PAK 074G10 X 5935375i PAK 074G11 i 4614634 ! PAK 074G12 X 42340 ! PAK 074H02.. 396394', PAK L-. 074H03j 3581367F'PAK 074H05 i 37268071 PAK 074H06 R 45635501 PAK O'4 HO7 i r z 074H08 ! 443241 PAK 074ho8 44324 PAT 074HO9 4239771 PAK 074H10 3953191 PAK 074H11 395319 PAK 075A01 i 5656638 PAK 075A03 822399 PAK 075A04 44229825 PAK 075A05 2750712 ; PAK Ll 075A06814640 PAK j 075A08 506758 PAK 075A09532562 PAK ! 075A10 5 5745941 PAK H 075A11 4861227 PAK 075A12 1538208 PAK h 075B01 3123858 PAK 075B02 5702275 PAK 075B03 1770709 PAK 075B05 60275061 PAK 075B06 1514248 PAK 57713131 PAK 075B09 | 924998 PAK 075boo 2943370 PAK-.. _' 075B11 312093 PAK 075D10 J1659739 PAK ! 1 i 075E01 ! 581476 PAK 1 075E03'""')"4557777'PAK'1 075E05 417328 PAK 075E06 122584 PAK 075E07 614648 PAK s 075E08 25503661 PAK 075E09 4398601 PAK 1 075E10 1 5223759i PAK 075E11 1 941676t PAK 5 075E12 i 3280940i PAK @ 5 6048432i PAK ii 075F02 1 3168460i PAK 075F03} 53391241 PAK 075F04. _ 5771999 PAK-..-. 075F05 i 57719991 PAK 075F06 530707 PAK 1 - ZsJ i-. 469274 PAK ; 075FO9 j 61796634 PAK 6589671 PAK 075F10 658967'PAK 075F11 r % 84567 ! PAK "075F12 j 2243268 PAK ! 075G01 {1927607-''-PAK 075G02 j 574551 8j PAK 075G03 _ 2470827 PAK 075G05 | 16592404 PAK . w. __.. _ ___. _.. ___. _ _. _.. _.. 075G06 i 791999 ! PAK 075G07 1 521744 PAK oC 075G08 1 262902 PAK 075GO9 l 5168547 PAK _.. _. _... .. __ ___. _ _. _ 075G10 i 1283538 PAK 075G11 5538672 PAK u 075G12 929055 PAK 075H02 5213892 PAK 075H03 5877121 PAK 075H04 478140 PAK 075H05 3953947 PAK t 075H06 4892891 PAK 075H07 v 3864331 PAK 075H08 _733328 PAK 075H09 4665718 PAK j 075H10 l 3986145 PAK 075H11 395_319 PAK ; 075Hll 395319-.. 076A01 260880 PAK 076A02 ! 5531682 PAK m M 076A04 1147282 PAK 076A05 16462 PAK 076A06 5002921 PAK 076A08721498 PAK' 076A10 j1230709 PAK 076A11 5 5749716 PAK 076A12'3887730 PAK 076B01 4251952 PAK 076B02 5893058 PAK J "076803"""811122'PAK'" 076B046095758 PAK 076B05 6204818 PAK 076B06 2784084 PAK 076B07 i 4704880 PAK 076B08 540041 PAK , I | 5400412 076B10 4853308 PAK 076BlO 4853308 P-AK- 076B11 5 4540555 PAK 076B12 960638 PAK 076C01 i 1545087 PAK 076c02, _ L 3707642 PAK 076C03''j 1167113 PAK ! 5 076C04 i 1354061i PAK 076C05 t 521 1592 ! PAK j"076C06 i""4967044J PAK ! 076C07 X 3033012'PAK 49005531 PAK 076C10 1 3423519'PAK 076C12 ! 1993X5 PAK .. ___. _... _. _.... 076D02 4167845.. __. _. PAK.. _.. _.. T 076D03 (5800529 PAK 076D03 5800529Z PAK 076D04.. i 351028 PAK 076D05 i 44261 9i PAK 076D06 i 3217470 PAK 076D07 1 1419351 PAK PAK 076D08 6124971 PAK 076DO9 555929j PAK 076D11 ! 62400211 PAK ? 076D12 j 3377875 PAK ? 076E01 2350413 PAK 0076E02 5 5738127 PAK j'""076E035202612 PAK'1 076E04 1142928 PAK 076E05' 2778189 PAK ti 076E06 1988280 PAK 076E07 4396729 PAK 076E08 528431 PAK 076EO9 501 963C PAK 076E10 6172246 PAK 076ElO 6172249 PAK 076E11 5365848 PAK 076F01 1635210 PAK 076F02 369750 PAK w 076F03 5246142 PAK'. 076F04 j 1652270 PAK i, 076F05 | 6238494 PAK 3838107 PAK 076F07 5847589 PAK 076F08 3882920 PAK 076FO9 817776 PAK 076F10 ? l fflL PAK 076F11 1 508847t PAK 076F12 2352639'j PAK 076G01 3069945J PAK 076G022585153 PAK 1 076G03 1081372 PAK 076G04 j 4675503j'PAK 076G05 930548 PAK 076G06 5546850 PAK 076G07' !""'1691954 PAK' 076G08 765145 PAK 076G093836930 PAK j 076G10 1757837 PAK) 076G11 _ 1662009 PAK 076HOl 2133837 PAK 076H02 5743023 PAfC 076H03 2145275PAK i -------------- 076H05 s 7r 076H06, 14282951 PAK r 076H09 t 4950641 PAK 076H10 1 1468214 PAK 077A01 ! 223091 PAK 14682141 PAK 077A02 3756019 PAK 077A03 t 736069t PAK 077A04 !"1188885 ; PAK 077A05 {1188885 PAK _.. ; 7 077A06 3481240 PAK 077A07 59525 PAK_ í 077A08 4578056 PAK 077A09 | 1021934 PAK 077A10 6053485 PAK 077A11 1473965 PAK 077A12 5654603 PAK 077B01 M 3 PAK P 077B02 6200549 PAK 077B03 672251 PAK 077B04 5077212 PAK 077B05 3725227 PAK 077B06 5837678 PAK 077BO7 1298222 PAK 077BO9 102959 PAK 077B10 156187 PAK 077B11 2574160 PAK ! 077B12 1886313 PAK 077C01"'5974937 PAK' 077C02 1 5218416 PAK 077C03 1121295 PAK 077C05} 4432420'PAK 077C07"3898842 PAK i ; p 077C09 1828438 PAK 077C09'1828438 PAK ! 077C 10 833230 PAK 077C11 2252024 PAK 077C12 2170305 PAK 077D01 816371 PAK 324105 077D02 _ 324105 PAK w 077D03 1843256 PAK 077D04 965597 PAK 077D05 5893034 PAK 077D06 i 605009 PAK 077 D07 1845747 PAK - ! _ _077D09 T _ 3498828 PAK ; 077D10 4896729 PAK 077D11 5771546 PAK 077D12 5545974 PAK ! 077E02 4710515 PAK"I 077E04 1 8136601 PAK 077E05 2921895 PAK ! 077E06 1 1208241'PAK 5732702 ! 1 PAK 077E08 ! 2698545J PAK" PAK 077E10 f 43464678 PAK 077E11 1 6224406 PAK _ PAKi 077E12 PAK 077F04. E 5645309 PAK 077F05_ i 56453091 PAK 077F06 f 14931041 PAK 077F07 6219324 ! PAK ; PAK 077F08 4153071 ff PAK O7-FO-6 14931041 r'077 F09 J 1641223 ; PAK : 077F10 t 4561933 PAK # 077F11 12411811 PAK 077F12 1241181 PAK 077G03 4520846j PAK _ 077G05 106467 PAK 077G06 3081159 PAK 077G08 5385089 PAK S 077GO9 20 11 295 PAK wt tf 077G 10 3297732 PAK 077G11 2252032 PAK 077G12 2252032 PAK 077HO2 4160248 PAK o o 077HO3 3391643 PAK 077H06 917478 PAK 077H07 4920846 PAK 077H08 2963816 PAK __ _. 6203764 PAK 077Hll 7-4329 ! i PAK 077H11 _ 574329 ; PAK 078A01 3678902 PAK' 078AO3 22446851 PAK 078A04 3703741 PAK i 078A05 5403796J PAK L 078A06 3990854 PAK L 076A06-< 078Ao7 5516048 PAK.} 078A08 1343619 PAK 078AO9 5944735 PAK 078A10 1463440 PAK 078B01 4809759 PAK 078B03 4604479 PAK H {078B04 ! 1699194 PAK 078BO5 52929601 PAK 078BO9 !""5735051)'PAK 078B10 1 2927757 PAK s E 078B11 5025265 PAK 078F01 5320123 PAK 078F02 * 4406921 PAK j 078F03") 6240670 PAK 078F04 (697418. PAK j 078F05 4191601 PAK" _. _. _.... _. _.. _. 078F06 w . _ 4798239i _ P_AK_ . 078F07 1 25g7833, PAK 078F08 ! 667621'PAK 078F09 j 5532975j PAK , _. _. _. ____. 37878901 PAK 078Fll 078F11' ! 3787890 ! PAK ! 078F12. ! 2857054j PAK 078G01 ! 2806011 PAK' 078G02 j_, 1420709 PAK M 078G031003257 ! PAK"j 078GO3 078G05 494108 j PAK ! 078G06 6161266 PAK 078G07_ 3907119'PAK 078G08 3634677 PAK 078GO9 997822 PAK 078Gll 1270101 PAK 078G12 46875271 PAK 078H01 152964 PAK 078H02 5356413 PAK 078H03 318618 PAK 078H04 1834268 PAK i Q n 078H05 3254213 PAK 078H06 5530288 PAK 078H07 2010974 PAK 078H08 _ 1761171 PAK 3 078H09264047 PAK 078HID 5088529 PAK 078H11 395319 PAK t 079A01 763074 PAK 079A02"4627720 PAK 1 079A03 3748808 PAK 079A05 j 2301986 PAK ! 079A06'2895252 PAK' 079A07 2035641 ! PAK 203'SK 079A08 2629186 PAK e 079A09 3212093 PAK t 079A10 2965923 PAK 079A12 1 SB ! PAK 079B01 i 2893553 PAK X, 079B03 53098381 PAK 079BO3 079B05 6102601 PAK 079B06 j 2821177 PAK so1 079B08 5067967 PAK 079BO9 4568729 PAK --B-----5950520 PAK 079B11 5992225 PAK 079B12 1741685 PAK 079C01 3187329 PAK 079C02 t 52009261 PAK 079C03 i 4982667| PAK 079CO4 1 35020911 PAK 079CO6 1 56786311 PAK 079C07 1 2166887'PAK'i 079C08 ; 334697 ? PAK 079C09"'"2618287 PAK J 079CO8 334697i PAK 079C11 3563765 PAK ! 079C12 f4194359"''PAK'. 079D01 2099112 PAK ; 079D021139664 PAK L~ v 079D03 4201195 PAK i 9 079D04 4915077 PAK 079D06 j 2023060 PAK 079D07 11 33396s PAK 079G01 , _ 5732479 PAK 9 079G02 423295 PAK g 079GO2 079G03 4912335 PAK 3 079G04 5092982 PAK 079G05 ^ 9590, PAK 079G06 2632352 PAK 079G07 3718786 PAK 079G08 6024398 PAK 079GO9 3348529 F 079G11 1529892 PAK 9 079G12 5427253 PAK 079H01 1200473i PAK 079H02 J 6200450 PAK j 9 079H03 346517 PAK t j 079H04 4026893 PAK 079H05 3405074 PAK 079H06 4026893 PAK 079H08 J 4056144 PAK"1 ; 079HO9 4450298 PAK ; 079H11 395319 PAK' 080A01 4367833 PAK 080A02 3653261 PAK F 080A03 4636551 PAK 080A04 4163326'PAK 080A05 1554773 PAK. 080A06 2877511 PAK 080A07 2377852 PAK 080A08 1 53004841 PAK 080A10 zu 080A11 j 17534511 PAK 080A12 ! 36352981 PAK 080B01 2048639 PAK 080B03 6240021 PAK 080B04 2855772 PAK 3645052 PAK 080B06 4443513 PAK 080B09 5411515 PAK 080B10 4106210 PAK j 080B11 5034641 PAK J 080B12 _ 4437881 PAK E 3484061 PAK 080col .. PAK-. '.. : 081F05 {2174542i PAK r"Q81F06"j1618010) PAK 081 F08 1 36115569 PAK 081fi9 57281671 PAK 081F10 ! 2769512 PAK'" 081 F11 t9 1902906 ! PAK 081G01 s 518359t PAK 081G02} 1908611t PAK ; ; 3 PAK _ 081G04 | 464685s PAK 081GO7 1 2522083i PAK t UM/1 > PAK 081G08 t 43907821 PAK 081G10 t 2692956j PAK 081 G 11 l, 2212653i PAK '. 081 H01 9 55862269 PAK- 081 H03 2'PAK 3038230i 081 H05 2323962i PAK H ; 081 H08 5007784 PAK i 9 081 HO9 35131 11 vÃivl '081H10"'"''1034469J"'PAK" w 081H1 i 3953181 PAK g 082A02 1590327 PAK 082A03 _ 3728902 PAK 082A04 468359 PAK 082A065365306'PAK"j 9 082A08 3690212| PAK 082A09 343413 ! PAK ! 14529511 PAK 082A11 1 15119351 PAK 082A12 44533481 PAK 082BO2 45838101 PAK 082BO3 26119761 PAK 082B03 26119768 PAK 082B04 424679 PAK D 05 58 AK ' 082B06 3225490 PAK '082B07 4913117 PAK" 082B08 | 3120336 PAK 082BO9 4912352 _ PAK 082B10 5849730i PAK ; 082B11 1401775 PAK H m 082B12 5554549 PAK m 082COl 3337651 PAK 9575331 PAK 082C06 7731121 PAK 082C08 3899586 PAK t 082C09 5395375i PAK 082C10 5177027y PAK 082Cll 61875441 PAK L=m 1 14538318 PAK 082D02 E 1453831 PAK '.. ____. __ 082D04 __. _J____. _. ___... _2250214 082D05 i 3721017'-PAK 082D06 6258531 PAK 082D07 j 2926709i PAK 082D08 g 945275g PAK 082D09'11152941 PAK' g 082D10 i 58971'PAK 082D11 g 5386088'j PAK 082Dll 53860881 PAK 082D12 i 5496869' PAK _.. ___. _ 082E01 1389074. .... PAK V. "082D12 ! 5496869 PAK. 082EO2 5924626 PAK 082E02' ! 5924626 PAK 082E03 3388563g PAK g 082E04 1 1 835945i PAK 082E05 g 3938017 PAK 082E06) 5250961"PAK 082E07 í 5532364j PAK bzw 082E08 j 1783745 PAK 082EO9 3288186 PAK 082E11 1657385 PAK 082E12 3932347j PAK 082F01 4418797 PAK 082F02 4506646g PAK 082F03 1664581 PAK 082F04 1 5290266 PAK 082F06 i _ 1082476 PAK 082F06 g 1 082476t PAK'. 082F07 475486g PAK 475486 AK 082F08 3645337 PAK 082FO8 3645337--PAK 082F09 1534611 PAK d 082F10 5862122 PAK 082F12 2073209j PAK 082G01 2710202 PAK 7 082G02 1 2856157 PAK 'I 59383261, PAK _ 082G03 1 5938323 v 082G04 E_ _ j AK 082G05 3204370J PAK 082G06 g 46588691 PAK 082G07 4475854i PAK 082G08"""1916464"PAK"" 082GO9 4932770 PAK 031G 2048265 PAK g j"082G113521198J PAK 082H01 3471740"PAK 082HOl 3471740 PAK 082H01 3471740 PAK 082HO4 5865709 PAK 082H05 1168547 PAK 082HOS w PAK 082H06 1265153j PAK 082H07 4386353i PAK 082H08 r 22263 PAK 082H09 j 1285824 PAK 082H10 S 86352i PAK 082H11 1 3DS31 PAK , g 083A01 ! 1716B97i PAK ii 083A02 i 5722530 ! PAK """''""083A03""""" !"" 890590"""PAK""" _ 0. PAK 083AO9 I PAK 083A08 i 5462750X, PAK 083A09] 379701 PAK" 083A10 i 1 1 69335i PAK _ 083A10 1169335 '""083A11 j3659011 PAK : 083A121289717 ! PAK j 083B01 3650694j PAK 083B02 1 31101404 PAK _ PAK 083B03'3406321 PAK' 083B04 j 38087861 PAK 083B05 ! 5411333 PAK ! 083B06 292127 i PAK 083B07 1171633 PAK 083B08 4420132 PAK W 083BO9 31980 PAK 083B10 3907136 PAK 083B12 46859601i PAK w 40mr M 083C02 3022373i PAK 083C03 468523j v 083C04 4034151 PAK 083CO5 3961181 PAK 083C06 1 52936801 PAK_ 083C07 ! 1293431 PAK'"1 7 083C08 j 4401 199 PAK 083C09 1 3668671 PAK F e 083C10 6204818'PAK j 083C11 5187279 PAK 083C12 3872392 PAK 083DO1 28322511 PAK 083D02 1 1416748i PAK 083D03 44695981 PAK 083D04 5119182 PAK r os3Dos 083D06 5980257 PAK ) 083D07'''"4362468 !"PAK 083D08 3993541, PAK 083DO9 37708411 PAK 083D10 6237754 ; PAK j 083D11'1034469-PAK ? 083D12 6234059 PAK - t 083E01 4411673 PAK 083E02 3423518 PAK 083E03 1332604 PAK 083E04 5804638 PAK 083E05 1787707 PAK 083E06 5635763 PAK 083E07 _ 178198 PAK 083EO8 57896011 PAK 083EO9 3818650 PAK .......... 083E12 m_ 48907461 PAK 083F01'. 4203293i PAK 083F02 ! 5667462j PAK 083FO3 13861321 PAK 083fi4 925983r : 083FO5 48954701 PAK 083F06 ! 47073011 PAK < = < 083F07'576391 8i PAK 083F08 3640824j PAK t 083F09 2731781 PAK 083F10 1 4647353 PAK F F 11 5643969 PAK 083G01 5547683j PAK 083G03 79961 0j'PAK 083G04 5587827j PAK 083G05 2714398 PAK F-083GO5 083G06 1544844 PAK 083G07 4573074 PAK o s ( 083G08 5427542 PAK 083G10 5975093 PAK 083G11 4607366 PAK 083G 12 99263 PAK 083H02 3007368 PAK 083H04 2991762 PAK _ ; I 083HO5 674579 PAK -- 083H06 22565811 PAK 083H07 53844471 PAK 083H08 637531 PAK 083HO9 5768052i PAK s 083H 10 | 2879985 PAK 083H11 1 395319 PAK 084AOI 1553752 PAK i 084A02 479428 PAK -T-5 084A03 5270850 PAK 084A04 1 620240 PAK <, 1879652 PAK 084A06 6084097 PAK F--084AO7 4323707 PAK 084A07 43237071 PAK 084A08 11108701 PAK 084AO9 239961 PAK 084A10 1674912 PAK 084A11 5172503 PAK 084A12 5355408 PAK ; 084B01 2079699 PAK 5174413 PAK 084B03 1 3669990l, PAK 084B04 j1498898 PAK j s L 084B05 2211625 PAK ; 084B06 1476875 PAK j 084B08 w 7 PAK 084B07 3377877 PAK ! ) 084B08 36557 PAK ! 084bu8 r"084B10 f'947938 ! PAK"" d. 084B11 j 4924648J PAK'" 084B10, 1 4924648 ! PAK pat ""084C04"-1"--'535634ii"""pAK"""" 084bu2 2249277 ! PAK" 084B12 i 3508200j PAK 084C03 í 1525921 s PAK 084C04 i 5356341 i PAK 084CO4 084C05 j 2249277j PAK 084CO7 5977522ii PAK 084C08 j 19280991 PAK 084C11 1034469'PAK 084C 12 ; 1811918 ; PAK _. 084C12 j 1811918j PAK 084D01 i 21622902 PAK s 084D02 4 5211146i PAK 084D03 (_1599066 PAK r r 084DO4 32931791 PAK | : 084D05 j 704498g PAK 084D06 i 343751 PAK 084D07 5524752 PAK r 084D08 2111922 PAK ; 084DO9 58159421 PAK I 3 084D10 1566192g PAK k 084D11 494940 PAK z 084D12 1026770 PAK 084E01 2353428 PAK 084E02 4724795 PAK g 084E03 1470035 ! PAK 084E04 44556041 PAK 084EO4 4 K 084E05 1971606i PAK | 084E06 g 2375068j PAK 084E07''511254J PAK j 084E08 g, 40448043 PAK '= 084E09 (41351341 PAK 084E10 1 5294753i PAK 084E12 ií 61454811 PAK t ! 084F01 25645781 PAK 084FOI 25645781 PAK ! 084F03" 6120612 PAK 1 084FO3-61206121 PAK 084F04 18007803 PAK 084F05 1903894 PAK 084F06 g 5093257 PAK 084FO6 PAK i 084FO7 1 62166371 PAK ub4t-Ut$ 3174550 PAK 084F09 2889826 PAK _.. . --..-_-y 084FIO 2250597 PAK 084F12 1 1779101 PAK 084Fll 48097511 PAK 084_F12 177910 PAKJ ? 084G01"2929158 PAK ! 084G02 3741054 PAK E 084G03 848917 PAK 084G04 = 3648576 PAK r 084G05 3179811i PAK'1 084GO6 17413981 PAK 084GO7 ;-5 PAK :""'084G08"""""" ! 5854198r'"PAK ! ! 084G09 J 219333 ! PAK" 084G09 _ 1 2193331 PAK 084G10, w PAK 57352991 PAK 084H02 "5444353 PAK"'"' ! '''084H03 j'3891666 PAK ! 084H04 ì 40555993 PAK 084H05. 4399348', PAK . _ _....... _ 084H06 t 4398214i PAK 084H07 ì 2155088 PAK 084H08 4337823i PAK 084HO9 4637449 PAK 084H10 25913243 PAK 084Hll 3953171 PAK 085A01 3579960 PAK 085A02 | 5204218 PAK 4611603 PAK 085A04 5583129 PAK 085AO4 085AO5 396969 PAI. K,.-...--. 085A06 2361082 PAK 085A07 1164653 PAK H 085A08 j 790647 PAK j 085A09 2202520 ! PAK i PAK 085A11 1 6217614 PAK j 085A11"6217614 PAK j 085B02 5533229 PAK 085B03 1013896 PAK 085BO6 5220580 PAK j 085Bo7-'5279763 PAK 085BO9 6210806 PAK 085B11 3823842 PAK 085B12 | 3745512 PAK i 085C011141579 PAK 085C02 5788046 PAK 085C04 444335 PAK ; L 085C08 * 2941406 PAK ! r"'085C10 110460'PAK j 085D03 5914051 PAK 085D05 4929673 PAK t 085D06 5485464 PAK j 085DO6 54854 PAK 085D07"4929673 PAK 1 DS5D10 384281 vK 085D12 860399 PAK j 085E02 j 1787707 PAK 085E04 j 2428233 PAK 085E05 849987 PAK 085E10 3802283 PAK 085F02 6145100 PAK ; 085F03 1819420 PAK j085F05""6073415 PAK ! f 085F08 1742949 PAK J ', 085F05 __ 6073415 PAK o-85Fog-----T------1-4-23-3-7-5 [--PAK Hõy---Ta3S PAK 151 PAK 085F10 1 6082315X. PAK 085F11, 956872'PAK 085F12 ! 5067443, PAK 085G03 m 2i iS7S PAK 085G03 i 2711775i PAK '085G10 t 5505971', PAK l 085G11, j 6126368j PAK 085G12 1 28426412 PAK 086AO2 6204 PAK 086A02 62048984 PAK i 086A02'6204898 ! PAK""" ; L 086A04 54207711 PAK 086A05 3255956 ! PAK 086AO7 5612200 PAK 086A08 3047319 PAK ___P86AO8 086AO9 2879208 PAK 086A12 451833 PAK 086B01 5130454 PAK) E 086B01 086B03 4427961 PAK 086B04 3377876 PAK 086B06 1987963 PAK j 086B07 3865649 PAK 086B08 4915077 PAK r 086BO9 5458814 PAK 086B10 4349835 PAK i _ 086B11 2845521 PAK 086B12 4975737 PAK 086COl 3889661 086C02 2254621 _PAK 086C03'"'6202406"PAK""" } N 086C04 4466132} PAK : | 086CO6 57437L3 PAK 086C07 L 13150751 PAK 086C08 6660271 PAK 086C09 8840j PAK H H 086C10 5369448 PAK 086C 11 1742406 PAK 086C12 6142832 PAK 086D02 6206337 PAK 086D03 2867673 PAK 086D04 1455447'PAK 088D05 232171 PAK 086D06 3755500 PAK 086D07 36290200 PAK 086D08 1401774j PAK 086DO9 2920622 PAK 086D10 6109633j PAK 086D11 1 2781711 PAK 086D12 i 8642631 PAK 086E01 1 3914725j PAK 086E02 j 229374 PAK 086E03 i 6203541 | PAK', - 086E04 30801 i PAK '086E06 T 8563881 PAK 086E09 | 3864556 ? PAK 086E10 j 46350001 PAK 086E11 $ 37048581 PAK 086E12 L 2509916j PAK v 086F01 I 825986i PAK ."086F02 3706020 ?' PAK' ! 086fi4 60760931 PAK 086F05 582633 ! PAK """086F05 582633 pAK""" 086FO6 1873797 ! i PAK 086FO7 51563671 PAK PAK . $ 086F09 | 2501692 PAK 086F10 1 46029181 PAK o_ 086F11 484549 I PAK 086G01 14237291 PAK 086G02 1 034469t PAK', t 086G03 4593063 PAK 086G05 2024120 PAK W-d 086G06 1152487 PAK _.. . s 086G09 61228571 PAK I' 5372758 w 086H02 303960 PAK 086H04 465078 PAK 086H06 j 2979248 PAK 088H07 r R5259 5 PAK '086H08 5187084 PAK j 086HO9 6154678', PAK 086H10 4922402 PAK 087A03 1813824 PAK 087C01 2411124 PAK j 087C02 619136 PAK 087C04 3498567 PAK 087C05 1034469 PAK 087C06"'J 5454141 PAK'1 087C07 5994576 PAK J 087G08 4937051 PAK 087C09 ms 5028748 PAK 087ClO 6038840-PAK 087C11 2467419 PAK 7-.. P-AK 087C12 5026473 PAK 087D01 6161421 PAK 087D02 i 59239521 PAK '087D03 5947596 PAK 087D041558663 PAK""" 087D071171374 PAK 087D08'2941159 PAK j (t l 087D09 1444871 PAK 087D12 1 1800421'PAK'. 087E01 i 5251463$ PAK 387=Uz 41t95S MK '087E02 _ _ 4449587 ; PAK r""0&n'j"4813877) PAK j ........-.. ....... ..... .......... .. 087E06 3596975 PAK S , _, __, 087E06, _, ~_l,, ~ 3596975L PAK J 087E07 T 3fl7732 ; PAK 087E08 3003011i PAK 087EO9 t 4155384 ! PAK 087E10 fi 4058622j PAK 087E12, i 2222581 PAK 087F04"' !"''1566192 !"PAK' 087F05 i 45847721 PAK 087 F06 j 5846587"PAK'. 087FO7 5766050 : PAK _.. _ ; 087F08 49112931 PAK 087F10 3831871) PAK ; 087F10 38318711 PAK __ 5315961 PAK J 087F122454528 PAK' 087G01 2713224 PAK 087G02 6145528 PAK 087G03 4192609 PAK 087G04 . ^ 5897517 PAK 087G05'3483981 PAK' 087G06 2940174 PAK : 087G07558968 PAK j 087G08 5698885 PAK" 087GlO AK i 087G10.. . 2335065''' PAK 087G 1 _ 087H02 I ^ 4911292 PAK 087H07} 1 775502t PAK 087H08 j 2419133 PAK 088A01 1 1924390 PAK 088A02 1$ 29741 97j PAK ! 088A03 j 2503673 PAK r 088A05 j1532047 PAK 1 088A06, i 1764006 PAK 088A07 38772601 PAK 088A08 711492 PAK ! ___. ___ 088A10-. W-. _.. _. _. 611033 PAK-.. _.. __ 088A11 5306830 PAK ) 088A11 5306830 PAK ! 088A12 5864830 PAK : DS8A12 H Pa 088B01 _ 38277041 PAK 088B03''30728021 o1 088B04 3799166 PAK 3 088B05 2962457 PAK 088B06"2938549) PAK : r wr PAK 088B08 1576571 ; PAK 088B10 1577666 PAK w 088B11 3789249 PAK 088B12 r 4669131'PAK j 088C01 ! 53112161 PAK 088C02 F 1786254'PAK 088C03""'4496054 PAK ! 088C04 goSo 1 PAk 1 088C05, 2812481 ! PAK 088CO7 4252575'it PAK 088CIO 2892202 ! i PAK 088C11 j 1431320 ! PAK 088C11, 1431320, PAK 'PAK t* PAK 088DO3 61529721 088D04'. 51 91990, PAK 088D06 1538858t PAK 088D07, 1905584 PAK 088D08 T 2789609 PAK' ! 088D09" 3267954 PAK i l'088D10 2569116i PAK 088Dll PAK ) 088D121235153 PAK) 3 g 088E01, 57562 PAK j 088E02 4207404 PAK _____ _ (--. 088E03 1078883, PAK 088E04 2820374 PAK 088E05 2916493 PAK 352150'PAK 088E07', 2752299 PAK S 5772985 PAK 088EO9 3701621 PAK 088E10 l, 111417j PAK 088E11 5559719 PAK 088EI2 279463 PAK 088F011330905 PAK j m r 088F02 3218437 PAK J 088F04 101672 PAK 088F04 ; 101672 PAK ! 088F05 62316761 PAK 088F06 5841435 PAK 088F07"125754 PAK"1 088F08 4079727 PAK 088F09 1 2475063 PAK 088F10 1 2900701 PAK 088F11 61891 78 PAK 088F12 5981325 PAK) 088G01 3770594 PAK 088G02 3439168 PAK 088G05 i 4383492 PAK 088G07 ; 496788 PAK 088G08 1 960638 PAK 088GO9 496787 088G11 3 62292821 PAK 088G12"T 716896 PAK j 088H01, 762L 088H02 3 55925001 PAK 3 088H03 1 40072951 PAK 088H04)'648881 PAK J 088H05 j 3870709 PAK j -- 088H08 j'5929961 PAK ! a 088HO9-, 1495443i PAK 088H10 t 5848854'PAK 089A01 i 1438646 ! PAK '-089A02 E 4720634 ! PAK 089A03""T"5503345'PAK'"" 089A05 j3783404 ; PAK 1 089A06 i 3461 3i PAK 089A07 J 3234408 PAK 089A10 1 1249101 PAK 089A11 40497681 PAK 089A12 5938920 PAK 089B01 295383| PAK 089B02 4730507 PAK 089B02 4730507 089B03 5458154 PAK', il ti 089B04 1286525f PAK 089B04 1286525. p K 089B06 2429475 PAK i-- ; 089B09 i 5586107 _ PAK _. 089C01 i, 4290698 PAK 089COl 4290698 PAK !'089C02)'4724369 PAK i 089C03 4818750 PAK 089C04 2056630 PAK i, 089C05 5129791 PAK wi 089C06 5034522 PAK 089C07 5892491 PAK , ! 089C09 490442 PAK 089C10 4922878 PAK 089C11 2275507 PAK 089C12, ! 3873804 PAK 089D02 1 5405971 PAK 089D04 5 PAK 089D05 1 5315770i PAK 089DO5 5315770 PAK 089D06 612978 PAK 089D07 _ 6129697 PAK _ 089D08 _ 1034355 PAK,. 089E02 t m PAK J""089E02 2940015 PAK"' ! 089E04 34903401 PAK 089EO3 I--036-4VI PAK r 089E05 3881601 ! PAK 089EO5 3881601 PAK 089E07 1 4850786 ; PAK 089E08 76681 l PAK 089EO9 PAK 089E10 1 4957966 PAK 089Ell 14602481 PAK t 089E12 1 1447089 PAK 089F01 j 5457538 PAK 089F02 1 6030099 PAK 089F03 1367268 PAK | 089F05 1853266 PAK 089F06 ; 6141275 PAK 089F07 T 6030030 PAK J o 089FO8 13220691 PAK 089FO9, i 595688, 1 PAK 0 8 9 F 1 0, 2 5 9 3 9 0 x P A K 089F11, 3735353 PAK 089F12 i 882433i PAK 089G01 jj 4921726ii PAK 089G0 . _ PAK 089G0 _ __, 0 089G03 986611 ; PAK 51728581 PAK 089GO5 089G06 i 1 626572i PAK 089G07 i"5179433} PAK '089GM ! 281319J PAK 089GO9' 3612080j PAK . ___.... _., PAK_. _, 089H04 335134 PAK 089H05 424291 PAK w 089H06 5414047j PAK "089H07 3191920) PAKj 089H08 1787657 PAK j 089H09 554383 PAK' ; __ 089H11 _. _ _ 395319 PAK... _. O90A02 1 1992615 PAK 090A04 6214172 PAK 090A05 675129 PAK P O90A06 1 3305445i PAK f 090A074600856 PAK'"" ! . 4 O90A08 1 1992614 PAK 090A09 (4627666 PAK T__.". _ i O90A10 4742860j PAK ii 090A12 48952791 PAK ; 090B01 12226 PAK O90B02 61 38740j PAK O90B03 j 2333499 ! PAK w !'090B04 ! 5241431 PAK 090B05464675 PAK ~ 533661 PAK O90B08 3573599 PAK _ O90BO9 5215401ii PAK 090B10 4472551 PAK O90B12 3553127j PAK 090col 40805101 PAK iF * O90C02 6098680 PAK 090CO2-------60-9-8-6-80T PAK 090C03 6054907 PAK 090C04 3081109 PAK f 090C05 272090 PAK ["'090C06'"'113883 PAK"'' S S O90C07 3876757 PAK 090C08 1023420'PAK j 090C09 1549165 PAK 090clo 5094045 PAK 090C11 i 3602160'PAK 090C12 i 2968429 PAK . _... _.. _. _. __. 90D01 __... _. _. _. _. ___________. 5401696. .- PAK.... __.. _. _.. _ 090D03 4345746 ; PAK . _______. _ _. _.. _ _ _4345746 PAK O90D04 ;'41 39828i PAK O90D05 i 4706334i PAK ____T_'_ _ 090D12 21469824i PAK v _090E01 s 3191920 ; PAK 09OE02 ;'""PAK"" = ~i O90D12 T 2146982j PAK O90E01'3191 920f PAK O90E02 f'445141 7i PAK 090E03 36201831 PAK r O90E04 i 873748if PAK 60941111 090E06"""60941 litPAK j 090E08 1838906 PAK S l O90E08 1 838906j PAK 3 090E09 5798170 PAK 090EI0 2384781 PAK 3909573 PAK 090Ell 090E12 51608777 PAK j 090F012537829 PAK 090F02 2922924 PAK 090F03 1781582 PAK 090F04 2414792 PAK 090F05 3826484 PAK 090F06 303454 PAK 090F07 3479263 PAK f 090F08 1781584 PAK i 090F09 PAK j 09OF10 i'4700118 PAK 3 O90F 11, 382654C PAK 1 090F12 809956 PAK ; O90G01 5403635j PAK 090GO2 090G02 f ___ 6078850 PAK s 090G03")""1452652J PAK"i g 090G04 1345427 (PAK j 090G05 (1034370 PAK -090G06 4190476 PAK ! 1_.... _. ___. _... .. 090G07 2831054 090G08 4298292 PAK 5786012 PAK 29915351 PAK v TTT O90G11 1 2251412 PAK |_ __Ti 090G12 41904751 PAK 090H01765565 PAK 1 090H02 1991122 PAK O90H04 j 558301 0j PAK 090H05 1589283 PAK 090H06 395318 PAK 090H07 6057929 PAK 09OH08 6108287 PAK 090H10 1107766 PAK O90H11 C, Fi) 395262 PAK 3395714 PAK 091A04 ! 765565 ! PAK 091A07 # 765565i PAK 091 A07'765565 ;' PAK ! 091A08 13976991 PAK 091AO9 ! 4529801i PAK 091A11 765565K 091A12 ! 3944818 ;'PAK 091 B01 i 6147237i PAK 091 B02 1 521 7569f PAK 091 B03 1 6203084 ! PAK ----- 091 B04 765565f'PAK 091 B06 34994433 PAK S 091 B08 62392551 PAK f 091 BO9 6203084i PAK 091 B10'426660 PAK 091 B11 3431890 PAK 091B12 789594 PAK 091 C01 6203084 PAK 796194, 091C03 2 091C04 6219417i'PAK I 091 C06-7T 3 091 C07 351 1416 PA'K f __ 091 C06 765565 PAK _ f 091C10 i 6219417 PAK If 091C08 2796195 PAK t 091C10 6219417 PAK j 091D02 5138906 PAK ___L_. ! 091 C12 1718503 _ PAK_ #, 091 D02 5138906 PAK 1 091D03 4381152 PAK j 091D04 4036811 PAK J '091D07 j""1532827 PAK'"' 091 D10 701270i PAK 091D10 "'701270) PAK 091 D12 4548215j PAK"" 4548215 PAK 4158798 PAK 091 E05 , rv 492392 PAK 091E06 609416 I PAK 091 E07 4158798 PAK . _. 091 E08--.-. _. w....... __. __ 4024826 PAK-_... _ 091 E08 4024826 PAK 582633 PAK 091 E09' 091E10 1971583 PAK 091EIl 5898406 PAK 091E12 424758 PAK ! 091 F01 5185520 PAK 3 091F03 6122087 PAK 091 F07 __, _ _. ,- 211737 PAK 091FO8 759235 PAK i, 091 F09389523 PAK 091F10 1 1561328 PAK 091F11 1034419 PAK ! 091 F12''5841748 PAK ! v 091 G01 1633402 PAK 091G04 i 1875814 PAK r""0 ? 1G05 !' 3844960 PAK 091 G06 PAK '. 091 G07 7 28022631 PAK 091G08) 5655022 ! PAK 1 091G09'765565) PAK ! 091 G10'44757391 PAK 091 G11'i 62385761 PAK 091 G12 5293459'PAK L 091 H01" ; 3176678 ! PAK 091H03 ! 3707444PAK"""" ; -l 7667V, PAK 091H07 30512 PAK ! 'i ç 5W PAK 091 H08 762959f PAK """091 H11 346680J PAK'"" ---7-30512 092A01 1530164 PAK 092A04'5371146 PAK 092A07 153016 I PAK 092A08 344000S PAK 092A10 1633344 PAK 3 092B02 6109594j PAK i092B06"j""4501135 ! PAK"' ! 092B08 1106685 PAK 092BO9 5699595 PAK 092B11 845976 PAK < 092B12 6073209 PAK 092C01 179397 PAK--I 092C06 3511413 PAK f ! 092C10 2613913 PAK j {*"092C12346680 PAK 1 ' 092D01 18661 37if PAK PAK 092D05 2355668 PAK '092D06 1102424 PAK il f-v 092D08 1138714 PAK j 092D10 1761178 PAK ! 092DIl 36277181 PAK !-092D12 4158888 PAK ! ~ AN E 092E03 2379175 PAK 23791751 PAK ; 092E04 4158885 PAK r 092EO4 41588851 PAK 092E07 3 5499578 PAK ! 092E08 1084294 PAK' - AK-w- 092E09 1 3466035 PAK 092E10'19014301 PAK 092E12""'"''645041 PAK"" ! 092F01 6109967 PAK 092F02 1548870 PAK 092F03 3392116 PAK 092F04 _ 2978707 PAK'i 092F06 r 3720645 PAK 092F07-'1 bT 2 092F07 i 6109967 ; PAK 092F08 j 5851968 AK ! 092FO9 39494831 PAK ___.. _ 092G01----'-. ----_-_-_-_- 3949482 ; PAK 092F11 S 15261 52f PAK 092G01 e 3949482 PAK m07 37635311 PAK 092GOI 39494821 PAK 092G03 _. _.... _........ _. _... __. 2922092 ; PAK _. 092G04 3899547f PAK 092G05 1 25030871 PAK 2922084,... 092G04"3899547 ! PAK 092G05 ! 2503087 ! PAK 092G08 J 2922084J PAK 092H01 1654209 ! PAK ;'092H04 2531522 ! PAK 092H05 61927081 PAK 092HOl 092H07 4859731 PAK i.. _.. _ ___ r'""""092H09""T'5371147 PAK""" PAK 092H10 13723561 PAK 092HlO 093A01 5554286 PAK 093A05 5866519 PAK 093A08 6091283 PAK r 093A093577646 PAK 1 z g 093A10 969610 PAK r 093A11 5866519 PAK f 093Al2 a 093B02 1 6082860 PAK t 093B04 1683592 PAK : F 5007967 PAK m ; 093B07 - 3825317 PAK '093B082333166 PAK ! i-233316e<5ÃiC JQ93B12'5279267 PAK 1 ft 093C02 1 568091 I PAK !''"093C04'""T""5189665 PAK'"] 093C05''402732s PAK'. ff S _ _ 358t PAK 093CO9 1 909358l PAK 093C11 4027323j PAK , 093D01 1659865j PAK 093D02 n--rW rv, 093D03) 2830872 ! PAK j 2830872 PAIC ° ; 093D04 5166142 PAK 093D06 4396748 PAK j 093D07 5375474 PAK f 093D09'1874931 j PAK 093D10 6203645 PAK j 093D11 1329010 PAK 093EO2 i 093E05 ì 52892711 PAK' 093E07'""'411617 PAK"'"1 093E08 4211245i PAK'f 093E09779446 PAK 093E11 5289271 PAK 093F03 _ r 2595222 PAK PAK 093F05 ; - 5425500 PAK 093F07 1 37499631 PAK 093FO7 37499631 PAK 093fi8 093FO9 2595222i PAK 093F10, 5887576i PAK 093F11 2531724 PAK'j :'"'Q93G02'" !"3226870 ! PAK"""" ! f"'093G03 j3488032 PAK : 093G04 t5292830 PAK' --PAK 093G03 1 3488032i PAK 093G04 1 5292830i PAK 093G12 093G06'6203645i PAK f ; 093G07'32 PAK 093G11'1 62036451 PAK ', 093G12 3410232i PAK 093H02 3226870 PAK 093H03, 3589486 PAK 093H04 5836582 (PAK 093Ho5 831017 PAK 093H06 402954, PAK j093H07 J103662 PAK 093HO8 648754 PAK j 35652 PAK 093H09 56 093H10 1895733 PAK 093H11 831 017 PAK 094A01 5903514 PAK 094A03 3986218 PAK i 094A04 25453861 PAK f 094A06 4419800 PAK 094AO9 3986218 PAK 094A1 1 1101735'PAK sEt 094A12 4419800 PAK 094B01 5228063i PAK f 094B02 4739899 PAK ! 094B04 1 38252601 PAK '094B05 3622968J PAK ! j"094B06 2726912 j PAK'" 2726912 PAK 094B08 426314 ; PAK s 094BO9 3061 193 PAK 094BO9 3061193 PAK 094B11 6065895 PAK 094C02 571133'PAK 094C02571133} PAK ! 094C03 5711 33í PAK O04COB. M158 K f . .,. PAK 094C05 2157836 094C06 2271 124 PAK 094CO6 2271124 PAK 094C07' 221 6040ff PAK 094C08 ì 22858671 PAK r_.. __. ___ 094C09 _"___.. __. ________ 5381585 PAK _ _ w 094CO9 5381585 PAK 094C10 r 5229133 PAK ! 094C12 3253777) PAK"1 094D02) 3107601 PAK ! 094D03 2729064 PAK f s 094D04 3114256j PAK 094D05255453 PAK' 094D06 v 2403M PAK ! 094D06'2403324 PAK 1 094D07 sl 5141 676i PAK 094D08 t 4431 820ì PAK Wob r 661246i PAK 094D11 | 255453f PAK 094D12'2403324''PAK 094E01 2925440i PAK L x 094EO2 2403324'1 PAK 094E03 ! 3479353JPAK" 094E04 i 1 003206ï PAK 094E05 t 601 0999i PAK '. 094E06 4398217l PAK r 094E07 16443091 PAK 3. 094E08 5808537f PAK i_ I 094EO9 2661331 PAK 094E103908456 PAK 094E11 i 95651 1 PAK f _ 094E12 1764262 PAK 094F01 1403687 PAK 094F02 5787723 PAK 094F03 4601560 PAK 094F04 330763 PAK 094F05 6203591 PAK 094F06 4639566 PAK} 094F07 __. 4398164 PAK f 094F08 57877231 PAK NFF < 094F09 4749329 PAK i 094F12 _ 362257 PAK ! 094G01 2459837 PAK j 094G03 i 17164411 PAK 094G04 6179905j PAK 094G06 754721 f PAK wi 7809171 PAK f -'-46007541 PAK 094G09 1716441 PAK 094G10'1321087 PAK 094G11 4377878 PAK j 5619103 PAK i'094G12 ___. _o f 094H01 1025325 PAK 1 j 094H03 5299440j PAK 094H04 5995139 PAK 094H06 301 8705i PAK 094H07 ^ 5947959 PAK' 094H08 J 5732970'PAK ! 094H09'1471272 PAK ! 094H11 _ 3018705 PAK f 095A01 4558158 PAK 095A02 6104055 PAK 095A03 182047 PAK 095A03 182047 PAK 095A05 5398247 PAK 095AO6 095AO8 1820471 PAK ) 095A08 182047 PAK ! 0 H .. _. _.. ___ ___. ___.. __ __ ___.. __. _. a __ 5436767'PAK 095B02 j 5768971 f PAK """095B03" !"''486920 ;'PAK : '. O95B06, 4263912i PAK 42639121 ; PAK 095B08 $ 343821 7i PAK 095B10 ; 1286952 ; PAK 095B12'i-307311i PAK 3073111 PAK f O95C04 i PAK 095C04 526166 PAK 095C06 K PAK 095C08 4460280ff PAK !"Q95C09 487643f PAK"'""1 095CO9 4876431 PAK 095CIO 40294581 PAK 2 095C10 4029458 PAK 095C11 1 30506942 PAK f 095D01 5401444 PAK 095D03 _ 2936842f PAK 095DO6 1232844 PAK 095D11 1232846 PAK r O95E02 WZlM 095E02 5482215 PAK _ ; 095E03 391 5316 PAK 2 095E04 61177361 PAK 2f 095E05 5897802i PAK 095EO6 4404169 PAK 095EO9 3915316 PAK 095E10 5160431 PAK 095E11 4128331 PAK 095EI2 2 L As 095F01'5124369'PAK"i 095F02452065 PAK) 095F03 _ _ 5725188 PAK' 095F05 5421427 PAK f 095F06''2720844 PAK m xl 095F07 f'6122018l PAK f 095F08 2724808 PAK 095FO9 5929690 PAK f | X S 095Fll 3166 PAK 095F12 2720845 PAK var 4119115 m 1 095G02 39197295 PAK f r 095G03 2272158 !'PAK) w-0 zj ! 095G051242650 PAK'j f O95G07 3635245 PAK L-095G09') 3431893 PAK 1 fl O95G10 r 2ssss37í PAK 095GlO 2 955371 PAK 095G11 1 10032031 PAK 095H03 159928 PAK ; 095H04 4113337 PAK 095H11 6109189 PAK 1 096AOI 530428 H es7si HAK 096A03 4389578 PAK 096A04 4 3040962 ; PAK 6 __ 531720 096A07 5492589) PAK ! 096A08 2j 1434589j PAK 2 096AO9 1381795, L PAK 096A10 i 13822531'PAK 096A11 i 5493498i PAK 096A12 ìf 530707j PAK 096B01 14338891 PAK 096B02 _ 41 53460i PAK 096B03 5317921 PAK 096B03""531792 ! PAK 096B05'27224131 PAK 2 096B06 217396| PAK AK 096B07 18070001 PAK f 096BO9 5732334 PAK i 096B071807000 ; PAK j 096B09) 5732334 PAK 096BlO 33057941 PAK 096B11 i 41607811 PAK ff t 096B12 1 478140 PAK y 096C01 2124731 PAK 2 096C02 6157287 PAK 096C03 432404j PAK 096C04 3375066 PAK 0096C05 3582397 PAK 096C06 1556031 PAK 096CO9 1236494 PAK j 096C10 1082081 PAK j 096ClO 096C12 2921847 PAK 096D01 5278037 PAK 096D02 t 4691929í PAK 096D03 1312761 PAK ! j 096D05 j"376633 PAK : 096D06'j 361883122 PAK f'2 096D08'j 3288101i PAK 096DO9 3393370 PAK 096D10 _ 5451697 PAK 096D11 2645568 PAK 096D12 i 435401 PAK 096E01 5559527fj PAK 096E02 j 6136512 PAK 1 096E03 6085113 1 PAK 096E04 3552384 PAK 096E05 71489 PAK 096E07 2 3364637ff PAK 096E08 ; 1031827 PAK 096E09 1, 4439932f'PAK 096EI0 5974070 PAK 096E10 5974070'j PAK 096E12 5897198 PAK 096F01 6090356 PAK 096F02 4623990 PAK 30010771 PAK 096F05'""582026 ; PAK j e P 096F06 21137212 PAK L __ __ _ _ _ A_ 096FO7 1 6177153 ! PAK PAK 096F08 ; 522311 j PAK 096F09 2480453, PAK 096F10 39676301 PAK 096 F 11'5463589 !'PAK"""' 096F12 r 1384430 ; PAK. 096G02 f 5934531 j PAK \. 096G03 j 831797J PAK 096G04 1 1 834383f PAK 096G05 j341113 PAK 096G05'34111 3f PAK "096G07 j"5069732 ! PAK 096GO8 5673352 PAK 096G08 5673352i PAK '"r 096G09""J''5603275 PAK'"i t 096G 10 3748246) PAK 096G11 2498661 PAK 096G 12 4378950 PAK 096H01 198769 PAK ', 096H05 f, 11 39969i PAK ; 096H06 2638223 ___ PAK 096H06 ì 2638223f PAK l h 096H08 3696870 PAK"i 096H11 395319g PA'K 097A03 24747 11 PAK 097A04 1555200 PAK' 097A051807650 PAK : 097A08'1832131 PAK' ) 097B01 r"762446 PAK"" : t 097B03 5817828 PAK 097B04 5920564 PAK 097B05 4811110 PAK 097B06 151 1755 PAK 097BO7 48373481 PAK K 5981470 PAK 097BO9 __ 097B12, 761330t PAK 097COl 3318058 PAK 097C02, 142689 PAK 097C03 2498661 PAK 097C04 46467071 PAK 097C05 _ 4697711 PAK 097CO8 2551153 PAK 097C10 2921847 PAK y fl 097C10 _1 2921847 PAK 097C11 3323555 PAK 4 L 097C12 i 2086538i PAK 097D01 5218314 PAK 097D02 ff 2791096 PAK 097D03 3170806 PAK 097D05 5859040 PAK 097DO6 6126766 PAK 097D07 305994 PAK 097D06 ! 231608C PAK 097D10 ff 845147 PAK 097EO1 19392 PAK i 097E01 e 097E02 T 5947030s PAK 097EO3 14551801 PAK 097E04"T"5354064 !'PAK 097E06 1 92131 f PAK 097E07 26617535 PAK 097E08 | 15343791 PAK v s 097Ell 9467161 PAK 097E12-) 760054f"""PAK". 097E11 946716 ! PAK 097F01"'1216981J PAK 097FO2 59362501 PAK 097 F02 097F04 46460601 PAK r -,-, _, _ HI PAK 5, 097F06 416322 PAK 5 097F07 807168 PAK 097F08 3958066 PAK 097FO9 6070674 PAK r 097F10 1 1015065 PAK f 5 097F11. 2079313t PAK 097F12 2944727I PAK ___4s _ _ _ _ _ 097G01 3306943 PAK"1 097G02 4600978 PAK 097G03 201256 PAK 097G04 1411BO PAK, 097G05 668598 PAK 097G06 930603 PAK "097G07 4683964 PAK ! r 097GO9 604637 PAK 097GO9 1169531r PAK 097G12 58648401 PAK 097H01 6144871i PAK 097H04 4128263 PAK 5715245 PAK 098A08 5186256, PAK 5 098B02 6098698 PAK 098C08 803486 PAK J"""'098D03""""5566011 PAK) 098D10 1749654 PAK ; 3 5566011 i PAK m 098E_0_7 _ __. _ 5548222 PAK 098EO7 554822211 PAK 1 OOA10 5633329 PAK 1 OOA12 2010887 PAK 100B01 4425203 PAK i 1 OOB05 38886 PAK 100B08 67542 PAK 100B09 4735712 PAK 1 OOC02 2937464 PAK 100C04 2991465 PAK 100C05 2104886 PAK 100C07 31551261 PAK i 100CIO 4887907i PAK 100C-n'4466283 PAK) ,. __. ___ 100D02 100D07 I PAK 100D06 6129650'PAK 100D10 1 3998375f PAK lOOE02 59828741 PAK 100E04 ! 35659777; PAK 100E07, _ 5926607 _PAK 1 OOE07 5926607ff PAK 10OF02 137770-9 PAK 10OF03 17098571 PAK 1 OOF03 17098571 PAK i 100F06 1630473J PAK J 5694215 PAK_ 100F11 1 2980997| PAK 100F12 5258731 PAK,' 100G02 3269100 PAK 1 OOG03 36830240 PAK ! 100G04 1883147 PAK j 100G06 5555224 PAK 1 OOG08 72076 PAK 100G09'"'5681235 PAK''j 100G11 1005293 PAK t 10OG12 1837677 PAK 100H02"978120 ; PAK' 100H04 _ _ 5281391 PAK 100H05 4556077 PAK 102A01 3452314 PAK 102A02 391703 PAK 1 02A03 3018408 PAK 102AO6 47319561, PAK 1 02A07 2497716't PAK j 102A08174831 j PAK : 1 02AO9 1854691 j PAK 1 02A10 551 7588i PAK 02R2 102A125498289 PAK' 102B02 j 3210226 PAK ! -102B03 5995516 PAK 102B044274315 PAK j 102B05 j 6088276 PAK i 102B07 4549073 PAK i 102B08'1513191 PAK ! 4e 102609 1157104 PAK ! 1 02B10 4299980} PAK 102C01 2893491 PAK j L 1 02C02 4707477t PAK.' 1 102C03 WTw 102C04 wjw 102C05' 21918122'PAK 102C12 ì-26196638 PAK 105A02 ; 3146111 j PAK t m PAK 29077111 : 1 05A05 i''-'6743731 PAK 105AO6 5 PAK _ 1 05A06'_ e 105AO7 157380 ; PAK ----- ? 105A09 167596 PAK 105A11-= rtT^ 3786585'PAK 1 05A12 r 621851 9ì PAK 10 55 3 1 52281081 PAK ."105B03 2920601'"PAK" : 105B05 I 5475565j PAK 1 OSB07. 1260544 PAK 105BO9 t PÄK 105B10 3727987if PAK & 105B12 5035853 PAK 1 05C01 t 4006611 i PAK 105C03 b393852 PAK {"'105C04"743777""PAK" ! 105C04 = 1 O. CD 5 < 105C07 3211243i'; PAK j 105C08 _ 1206226 PAK _Yj 105C09 2364618-PAK 105C10 4337751 PAK 105C12 6106838 PAK 105D01 2860132 PAK 1 05D02 3471740 PAK _f 105D03 4347642 PAK V 31 sssoe v 105DO4 3199505 PAK f 105D05 5121607 PAK j 105D08 6112599 PAK 1 05DO9 3565902 PAK 1 105D10 378677E PAK f 105E01 _- 3452071 PAK 34520711 PAK 1 05E02 5478080 PAK 105E03 1997012 PAK 105E03 ! 1997012 PAK' 105E05 i 5321880'PAK 105E06 PAK j 105E07) 5539005 PAK) 1 05EO9 1206904 PAK 105E10 3782392 PAK 105EIl 30099171 PAK 105E12 14074811 PAK 1 05F01 S 5097680 PAK 1 05F02 4204370 PAK i' 1 05F03 662194'PAK 1 05F04 5023097 PAK 4416494 PAK 105P08 2423594 PAK 105P09"'6215642 PAK 105F10 3950671 PAK 1 4619077 105Fl 1 4619077 PAK 105Fl2 5901833i PAK 105G01} 1027128i PAK 105GO2 13068791 PAK 105G03. 1430019i PAK '1 05G04 9106761 PAK 105GO4 9106761 PAK 105GO5 4819647i PAK 1. 05G07 r 411131l ! PAK"i 1 05G10 5471 094i PAK ff 1 05G11 g 4671 383ff PAK 105G12 X 5867911 PAK 105G12 586791 PAK" ! 1 05H01'3738509i PAK 105H02 _ _5408525 PAK ____. _. 105H03 543473 PAK 1 05H04 ! 4274328 PAK f 1 05H05 j 5310625,'PAK 105H07 418998J PAK' 1 05H08 42211777 PAK F 1 05HO9 5395031 PAK,' 1 05H10 20299 I PAK 1 06A02 1406242 PAK f 106AO5--A-K 1 06A05 4041900 PAK 106A12 j 1694196 ! PAK 1 1 06A12 1694196 PAK 1 06B01 3329053 PAK 106B03 5479369 PAK 106B04 4058977 PAK'f 106B05 5773245 PAK 1 106B06 4364910 PAK t f 106B07 3982497 PAK 1 106B08 J 5571575 PAK"i 106C02 46171841 PAK 106C06 3422994) PAK E 106CO' 36908411 PAK 1 06C08 3946546tf PAK 106C09 4628841 ; PAK 106C10 1638040 PAK 1 06C11 58873961 PAK _. _. _.-. _ 106D02 4908894 PAK'.. .. ; l l 106D05 1 1294085i PAK 106D06 j 4911795 PAK 106D07 j 3929164 PAK,' 1 06DO9 i 1969450 PAK 106D12'5385089 ! PAK'f L f 1 06E03 1 28765191 PAK 106EO4 PAK t 1 06E07 1 mir PAK 106E10 736975 PAK 1 06F03 1 3304927j PAK 106F04 j 5157575 PAK' 1-''06F07, 2795460j PAK j 106F10 _ _ 374804 PAK 106F11 5405974, PAK y '\ 106G01 1 41 34527i PAK 106GO1 41345271 PAK .'106G04 T'"1Q30460J'"'PAK'"""" F'106G06 !"1007081 j PAK. 1 06G06 tH0t PAK 106G07 i 32692112 PAK 106GO7 3269211 PAK ''"106G09 !'''4853252r"""PAK 106GO9 4853252 ! PAK _ 1 06H01 59743421f PAK _ 1 06H02 f'4475257 ! PAK f 1 06H03,, _.. 1 2824275j PAK 1 06H04 4894767i PAK 106HO4 48947671 PAK s 1 06H05 2438922 PAK 106H07 489641 ! PAK. 1 06H 10 44201 24f PAK ! 107A01-2870293 PAK" ! 107A01 m0g PAK 107A04 6195229 PAK 1. 07A02 3993035 PAK 107A06 1660062 PAK'""" 107A095700254 PAK 107AlO 1617888 PAK 107A11 4365702 _PAK __.. 4bofs 1 07A12 45726731 PAK . 107B01603009 PAK 107B02 6109633 PAK 1 07B04 i 4365857 PAK 1 07B05 _ 524124j PAK 107B06 5673352 PAK 107B07 5771521 PAK 107B08 5219074 (PAK 107B10 5216364 PAK 1 07B11 2142674 PAK 107812 2679063 PAK 107C01 799610 ; PAK 1 07C02 36277481 PAK 107C04 5832135 PAK < S 107C05 6203764 PAK 107C06 4126143 PAK '107C07"'"4340714 PAK 107CO9 2819728 PAK 107C11 3161156 PAK 1 07D01 | 2536757i PAK'f 2536757 uzE 1034469 < 107D04 5384777 PAK 1 07D06 7 PAK w 107D09 5122549 PAK 107E01'1291924 PAK 1 07E02 2899720 PAK 1 07E03 1654413 PAK 107E04 5478844 PAK 1 07E05 21733161 PAK 1 07E06 1 32373201 PAK 107E07 10750761 PAK. 107EO8 32999211 PAK 107EO9 3227200 ! PAK 1 07E10 í 4827607. PAK 1 07E11 3987706 ! PAK 1 07E12, 1867945 PAK 107El2 1867 _ 107F01 7 : PAK ___ -''107F03' j"2922973 ! PAK J' 29229731 PAK 107F04 _, 460916 ; P_AK 107F05 ! 4974335'JPAK'i 107FO5 i 49743351 PAK i 1 07F07 2948029 ; PAK 1 07FO9 PAK 107F10 4 14421861 PAK f 107F11 2699147t PAK f _ 107F11.. i PAK, _ 1 07F12 27287271 PAK i 107G01 2880186j _PAK 1 07G03 _i 1325920 PAK f 1 07G04 76728 PAK _. 1 07G05 3765920f PAK 107G06 22245 PAK_ 1 G7G 626945 PAK 107GO8 626945 PAK 107G10 j 3953527 PAK 107G12 4007303 PAK lv 107H02 1 6114720i PAK f ! 107H03"6234109 PAK J 107H05 5772985£ PAK 107H06 4122563 PAK 107H07, 4230542 PAK 107H10 j 2071810 PAK. ' 107H10 j 20718100 PAK f 107HlO 2071810 PAK 108AO1 8775751 PAK 1 08A02 1263274 PAK 108A03 689978 PAK ì'108A04 2626148 PAK 1 08A05 23831 45i PAK ' 108A06 f'2399611 PAK ! 108A07 2058525 PAK i ;'108A08 5189496, PAK f 108AO9 4480695 PAK 108A103765893 PAK j 108B02-2320898 PAK 108B04 5984775 ! PAK 108B06 5588598'PAK I I si 108B07 57370041 PAK 108BO8 T91320-71 PAK s-H < 1 08BO9 _ ì 5632702 PAK _ f iO8B10 T 681527f PAK 108BlO PAK 108C04 i 6084560 PAK 108C05 3498688 i 108C06'3318091 PAK rft 106C07 f m f 108C07'"1818501 PAK j 108C08 2590671} PAK . 108C09 2825852j PAK 1 08C10'5094238j PAK 108ClO 1 08C11 1 5087265 PAK 108C12 li 206549i PAK 1 08D02'j 2977831 PAK 108D03 J""6101833 PAK ! 108D04 2110665 PAK '. 108D05 3638719j PAK "108D06 ! 1509801 !" AK ! 3974201 108DO7 PAK 108D09 ! 3819312 PAK ! 1 08D10 38193121 PAK 1034469 108Dll PAK 108E02 5251812 PAK f 108E03 4405948 PAK vw 108E05 4158182 PAK j 1 08E07 _ 4647900 PAK 108E08 5263109 PAK A P 1 08E10 122843 PAK 108Ell 919489 PA. K 108F01 4388164 PAK 108F03 1445976 PAK 1 08F04 5272678| PAK xi 1 08F05 892822 PAK 108F06 399656 PAK 108F07 319164 PAK J 108F08 5815675 PAK ___ 108F10 18325391, __ PAK 1 08F11 60323321 PAK if 1 08F12 2972451 PAK 1 08G01 3455405 PAK 108G02 6149336 PAK 1 08G03 1431971 i PAK 108GO4 23102441 108G09 4707429 PAK - 1 08GO9 4707429 PAK 1 08G10 4516494 PAK 108G11 PAK1 M 108G12 5919111 PAK 108H01 5079442 PAK 1 08H02 40293851 PAK 108H03 4132821 PAK J 108ho4 4459263 PAK ! 108H05 2113085 PAK ; 108HO6 6-64331 PAK 1 08H07 r 59544261 PAK 108H08 1 4315226j PAK 108H09 3412809 PAK 108H10 1348174 PAK 109A01 1163504) PAK 109A02'"464685 ! PAK 109A03 23143521 PAK 109A04 5076765 PAK . __. _ 109A06, 3634921'PAK 1 O9A08 f wI PAK . ___.. _w..-.-109A09'F. ... ...... 2649129 ; PAK . 109AI 2649129s PAK 109B01 2994565 ;... PAK _..... 'PAK 109B02 41345185 PAK zu 109B03 11680091 PAK 109B04 44030191 PAK 109BO5 51489 ? 5L PAK '""""1Q9B05""T'"5148025 PAK"" j"'109B06 r 1360365'PAK 1 109B06 i 1360365i PAK 109B11 i 4834239ff PAK 109C03 5082885 PAK 109C04 51254551 PAK 1 O9C05 963281 f PAK < | ! 109C07 4098351 PAK 109C08 1906772 PAK , 109C10 554592 PAK 1 O9C10 554592 PAK 109C11 1712727 PAK __ _ 2976766 T 109D02 5739740 PAK 109D03 4111348 PAK 109D04 3348537 PAK 7 6 Y 109DO5 1653528 PAK 2586676, PAK 109DO8 2495337 PAK 109D09 1244933 PAK ) 109D103440332 PAK 109Dll 5081696 PAK 109D12 1414688 PAK 109E06 2869404 PAK 109E07 6119366 PAK 109E08 4438182 PAK ;"109E10 3462237 PAK 109E11 5978911 PAK 109F03 5164542 PAK 261272E PAK 109F06 2612728 PAK 109F07""'"'"'1431698 PAK 109F07 1431698 PAK' 109F09 5966111 PAK 109F10 3979443 PAK 109Fll 1895148 PAK 109F12 2502205 PAK 109G02 3405537 PAK t 7) ! 109G03'5302319 PAK 109G04 3421514 PAK 109G05 2241880 PAK 109G06 300721 PAK 109G08 974134 PAK 109G113672588 PAK j 109G12 5447669 PAK 109H07 751625 PAK-' j 109H08"3790156 PAK {.-. 109H09"'i'3017497 PAK 1 09H 10. 3221 700T PAK 109H11 i 395319 PAK 11 OA05 07<K 110A06, 3634921 PAK 11 OA07 f 4867606i PAK ! 110A06 3634921 PAK : 11 OB02 41 34518 PAK 11 OB03 f 1 1 68009j PAK 1 110A07'"4867606 PAK""""" 11OA09 2649i2 ! i, PAK 110B05, 51480251 PAK "110B02 j"4134518 ! PAK" 11 OB04 44030191 PAK 110B05 j 5148025' PAK 's 110B07 i 1925210j PAK. 11OB08 548578 PAK j 110B08 548578 : PAK'] 11OB09 1 283937 PAK 110B11 1281003 PAK 110C03 4564149 PAK 110C04 ! 1995686 PAK ! 110C05 6030412 PAK 110C06 5702292 PAK 110C07 5929333 PAK ! 110C08 1906772 PAK r'110C09 4379214PAK" 110C10 156178 PAK H 11 0C 1 1 5905997 PAK 110D02 5739738, PAK 110D03 4111347 PAK 110D03 41 11347'PAK 11 OD07 2602778 PAK'. : 110D08 2495337 PAK ) 110D09 1244933 PAK I 110D11"'"137127 PAK""1 11 OE03 i 2758060i PAK i 110E05 T 379166 PAK 110E06 5648127j PAK f 11 OE08 25525951 PAK 110E10 3462237'PAK 11 OE11 5978911 PAK M 5164542 PAK 11OF04 965825 PAK 11 0F06 26 1 2728 PAK 110F08 2457016 PAK 110F10 _f 3979443 PAK 110F12 2502205f'PAK 110G01 ; 4067217 PAK o 1 110G03 5302319 ! PAK ! 110G05 _ _ _. 2241880j P_AK 11 OG06 1 r I 1 0G07 1 10609851 PAK 110G09'1562812 PAK 110G10 1 2368017 PAK o 110G11 ! 3672587 PAK PAK ! 110H03 3788343 PAK 110H06 2131688j PAK'. 110H07 r 3251479i PAK 11 OH08 1 3694984,'PAK 110H11 i 395319. PAK 111A01 L9P0 < ---"-JHA02 j 5747812) JPAK ; .. _. __A. _. _. 5633087 ; 111A06 ; PAK 111 A07 [13844301 PAK 111A08 J3051085i PAK 111 B02', 5406824j PAK 111BOS I _ 57661911 PAK 111B09 1 5980113$ PAK , 111 B10 1232258 PAK 111 B11 5529641 PAK 111 C01 1668774 PAK 111 C02 3011480 PAK 111 C04 3363275 PAK .. _ 111C06 5051027 PAK o + 111C08 3270578 PAK 111 C09 3264267 PAK 111 C11 41100801 PAK IllEOl 5032839 PAK i 111E05 4227321 PAK 111E061015135 PAK 111E06 1015135 PAK _ 111 E07 3582879 PAK $ 111E08 2613746i PAK ! § - 1HE11"5580139 PAK l _ 43RD33 PAK_ 111 E11 5580139§ PAK 111 E12 13645831 PAK f 111F04 f 1555200 PAK 111F03-! f 111 F04 1555200 PAK 11 1 F05 51303531 PAK 3 111F08'2082204J PAK 111F10620059 PAK v 1 1 1 F11 41 08350j PAK 111F12 5145266 PAK ! 111G01 j 5437249 PAK '111 G03 (5319061 t PAK -i M t 111 G04 3900522 PAK 111G05 ! 2698040 PAK' 111 G06 j 5290709 PAK 111 G10 472122 PAK ! 111G11 1932663 PAK sH w '111H03 3508386 PAK z 111 803486 PAK H 11 1 H09 1 494852j PAK 111H10 _ 2014466'F'AK f 11 2A01 3779652'PAK 112A02'')'1561153 PAK 112A03'5426548 PAK 112A04'1532975 PAK .". ~r H . __"__, 11 2A06 24664471 PAK 11 2A07, 3624757 ; PAK 11 2AO9, 4174882, PAK H A78 1353512 ; f PAK 11 2A11 f'4859430, PAK 112B02 1089019'i PAK 112B04 2239498j PAK '112B07 j 4404806 ! PAK' 112B08 5548347i PAK '112B09'"'5602049 PAK X, 112B11 28036631 PAK r"112B12 t4672011 PAK i ^ - w ', 112C01 1 2183658 PAK Wo 5- ; 112C04 j 3845716 PAK_ 11 2C06 3589068 PAK f 11 2C07 4593704 PAK' s 11 2CO9 4978969 PAK r 112C12 -57-i r_ w 112DO2 2812641 PAK ' ! 112D03 > PAK f 112D04') 5385935 PAK 112DO5 62303281 PAK 11 2D06 235549 j PAK f 112D07 3788320J PAK"" 112D08 2951558 PAK 112D10544371 PAK 11 2D11 5086244 PAK 11 2E02 4436804 PAK f '"'112E05 T"4435404 PAK 112E07 5128726 PAK 112E09192388) PAK ! 112E10'3887007 PAK 11 2E1 2 305807 PAK 112F01 2642411 PAK 112F03 4847111 PAK 112F05 3272923 PAK 11 2F06 1 6230327 PAK 112GO1 4966562 PAK 112GO3 FIAK 1630609 112G05 1701238 PAK 112G07 1082725 PAK 112GO8 2633733 PAK 112G11 3049617# PAK _ 112G12 57463791 PAK 112H01 5064126 PAK 112H02 2561135 PAK 112H03 2125457 PAK 112HO4 1501154 PAK 112H05 6030636 PAK 112HOb PAK 112H07 2789497 PAK L 112H09 j 1433338PAK 112H11_ 1 395318'PAK 11 3A01 1 4267361 f PAK I 113A02 ;'"'5712Q45. j'""PAK] 11 3A04 j 4727927f PAK 11 3A06'5372033, PAK 113AO8 23545151 PAK 1 1 3A11 v < PAK 113B02'I 4967527', PAK j""""113B03""s 1030389J-p-' 11 3B03 1030389 PAK 113B06 5634258 ; PAK. ; 113B095094981 PAK ; 113B10 _ 3075241 PAK 11 3B11 3400907j PAK j 113811 PAK 113B12 5031005j PAK 113C01 1 189915j PAK L 11 3C02 61870581 PAK _. _ 113C03 5954488 PAK _ 190350 PAK 113C06 3753549 PAK 113C08''""5423318 PAK'" ! 113C09 6046780j PAK ! 113C105499271 PAK 1, 113D01 _ 3752919 ; PAK, 11 3D02 36443860 PAK 11 3DOS HiS f r-iw X m 113D06 4898887 PAK ! 46229571 PAK 113D08 57875141 PAK 113D09 4921747 PAK 1 1 3D10 51 5289s PAK i"113D12""4891587 PAK 1 113DI2 PAK r 113E03 5240724 PAK ! 113E04 5398114 PAK 113E08 3319655 PAK ! 113E09'""57232 PAK ! 113E101412997 PAK ! ! 113E11"5391998J PAK ! 113E12 4 4434744j PAK AK 113F01'1527902"PAK j 113F02'5393730 PAK 1 113F03 3317982'PAK 113fi4 5361481 113FO5 55561881 PAK 113F06 1 4898887j PAK 113F07 j3120188 PAK i 113F09 4595430 PAK ! 113F10 1 1296429 {PAK 113FIO 113F11 i 15835421 PAK 113F12, _ 1053521j PAK 113G02 S 817821t'PAK 11 3G03 ì, 3835225i PAK "I 113G04 3414144 PAK" ! 113G04 _ ! 34141441 PAK _ 47436-641 PAK t P o 113G07'2897186 ; PAK . _. __. _... _. __113G10--_____.. _.,... _. _. __ 2168773 ; __ pAK -.. _.. _ 113GlO PAK 11 3G11 i 43356331 PAK 113H01 i 2018084l PAK -'''13H02 ; 2743332 ! PAK : """"113H03"i"2526344'"PAK'" # s OS ! 113H04) 2367240 PAK 1 1 3H05 3707698 PAK 3844818 PAK _ __ 113H0 6 8 6465451 PAK ! 113H0972074 PAK 113H10 4655974 PAK 114A02 1814139 PAK 11 4A03 15248721 PAK j'114A041524872 PAK 1 5 m nt 114A06 2379222 PAK 114A07 T 2916569 PAK 11 4A08 265275i PAK 114A09 3490617 PAK 114A11 5947901 j PAK 114BOI 4154345-A K-,' 114B02 3380555 PAK 114B03 3380556 PAK 114B04 4229635) PAK 114BO5 PAK 114B06 4140179 PAK 114B07206485 PAK H 114B08317243 PAK f 114B10 4308507 PAK 11 B 11 47000601 PAK m09 z PAK 114C02 1823063 PAK 114C03''""""'4472975 PAK"""1 H w- 114C04 5585743 PAK t 114C05 i 4808708j PAK K | s 11 4C06 i 5667685 PAK 114C07 1 3213476 PAK 1275444 PAK -- 114C09 4706883 PAK 114CO9 _ 4706883 PAK 114C10 t °s 114C12 i 9930401 PAK'. 114D02 1 1812942 PAK' 114D03 5642070 PAK 114D05 2498661 PAK 114D06 1277286 ; PAK 114D07 2893252 PAK ! 1 14D08 114D08 j'918090 PAK 114D10 j 1855738PAK 1 -114D11 i 5877908i PAK 58779081 PAK 114Dl2 i 4248408 ! PAK 114E01 _] 25042841 PAK 114E02 i 13411541 PAK PAK 114E04 ì 4018663t PAK 43t PAK 114E05 i 60237 ; 114E06, 1051049f PAK l : - 114E08'1 2805183, PAK 114EO9 ì 57505611 PAK 114E10 ! 2934676 ! PAK 114F01 3152978f, PAK 114F03 f 2668374 PAK 114F04 1 4713147t PAK 2 114F05 2893168i PAK 114F05 2893168 PAK 11 4F08 42071 65l PAK'. 114F11 4817596 PAK 114F12 3200787 PAK 114G03 j 3259309f PAK 7341821 PAK 11 4G07 3939674 PAK 114G08 j4387778 PAK 11 4GO9 3375065 PAK 114G11 2878943 PAK"_' 114G11 1 2878943 PAK 2620965 PAK 11 4H02 43941 25i PAK t 114H04 í 2757732 PAK 114H05 2089418 PAK 114HO9 4424387f PAK 11 5A01 2876780t PAK 1 5K'5194834f PAK l F j 115A04 2013098PAK 15A06 1801859 PAK 115A07'1801859 PAK w 115A08 5225763 PAK w 11 _ _ 332199 PAK 115Al2 4905491 PAK 115B01 5290425 PAK F 115B02 2903653 PAK 115B04 I 3653186 PAK 11 5B05 2639950 PAK', 115B06752714 PAK v # 115BlO 5217873 PAK 11 5C04 1 1906491 PAK 115C05 {191640C PAK 115C06 2320058 PAK 115C10 581698 PAK 115C12 4222292 PAK 11 5D01 C 283757C PAK 115DO1 2837570 PAK 1< 53 AK 115D04-5361223 PAK 11 5D06 7 w0-E, PAK 115E01 [1165115 PAK __ 115E01 i = R 11 5E03 j 2359332i PAK 1 1 5E05 4661 340i PAK 115EO5 4661340 PAK 11 5F04 f 284446 PAK 115F07 3861626 PAK 115F09 1675285 PAK""' 115FIO 59398661 PAK 115F10 _ PAK i'11 5F12 43448331 PAK ! 115G01 3642619PAK' 115G02 5365853PAK' . ______. 115GO3 PAK ! 115G04 2745897 PAK i 115G05 2521910f PAK 11 5G06 3019131 PAK 115G08 1034367 PAK j 115G10306435 PAK ; 115G11 4501025 PAK 1 115H04 541918, PAK 115H05'"4451693 PAK' ! 11 5H06 5953333, PAK 115H07 _ 3210226 PAK 11 6A02 380079f PAK 11 6A04 4032652t PAK 116A05 3981474AK __ 116A07 4059459 PAK 11 6A08 4059459 PAK. f 116B01 6108826 PAK 116B02 4455104 PAK 116B03 j 3636514 PAK 116B04 5855701''PAK 11 6B05 1 5657416 ! PAK 11 6B06 2039724 PAK 116C01_ 2161954 PAK 116C03 5081696 PAIX 116C05 4067261 {PAK 116C06855456 PAK 116C07 j 3429703 PAK 116C12 _ 1010010. _ PAK 11 6D02 1952652 PAK 116D05 3429562 PAK 116D07 3735414j PAK ! t. 116D08 4495481 PAK 116D10'""""j"1801859 PAK" : 116D11 j 1801859 PAK a 116E02 4042381 PAK j 116E05 5435373 PAK i 1aseos z fi s 116E07 _ 3445426 PAK 116E09 3209959 PAK ye 116E10 I 3209959 PAK 116FOl 958346 .......... 6-FO-2------4 ll 7 l4i-P-AK '."'116F03 j4573238 PAK' 54106271 PAK . :''116F06. 5410627J PAK" 1 1 6F06 ? 54106271 PAK 1 1 6G02 j ? ~---'--1173665 ?---''''-''PAK''-''""''"'' 116GO3 28303031 PAK L 116G04J 1617471S PAK"" t PAK "116G05 ! 2074358'PAK 11 6H01 321 2064 PAK 116H02 5527227jS PAK 116HO2 5527227 PAK ? 116H04 4576086 PAK i _. ___. _ _. ---... _,... 11 6H05 24887 PAK -wu 116HO7 3827451 PAK 116H07 117A02 4493309 PAK 11 7A03 6046552 PAK 11 7A05 2307517 PAK 11 7A06 1 046276s3 PAK 117A07 ~ 117B01 3123527 PAK ! 117B03 1030389 PAK 11 7B04 267008 PAK 117B05 916143 PAK -s 11 7B10 760224 PAK 117C01 4405694 PAK -' 117C04 2937824 PAK 117C05 6156485 PAK 117cl9 __ 117C09 ___ ___ 5863398 _ PAK 117D01 3137411"PAK'' 117D07 4038275 PAK 117 6217425 PAK m m 11 7E03 46901 52 PAK 117EO4 3079163 PAK 117E05 5916316 PAK 11 7E06 2097750 PAK 11 7E11 4304783 PAK ? 117F03""'"'""4697711'PAK""') 117F053003279 PAK) i 117G01 4050608 PAK j s 117G02 30012533 PAK 117G03877131 PAK 1 xE 117G04 j 2965246 PAK ___ r 11 7G07 s3 6485631 PAK 11 7H02 1 5732667'j PAK 117H04 998397 PAK' 11 7H06 | 44236083 PAK 117H10 v__ 685112 PAK 118AO1 596782 PAK 11 8A04 1 3146865i PAK '118A06"1455130) PAK 1 s 11 8A11 1 36232151 _ PAK 1 1 8A12 6104538 ! PAK 118B03 ! 4676635 ; PAK _ __... _. PAK 11 8B05 i 3731 380i PAK 118B05 ! 37313801 PAK 118B06 L 1279661i PAK 1 1 8B07 i 3167549 ! PAK PAK 11 8B08 i 17835251 PAK 11 8BO9 i 72576i PAK 118B11 i 15407471 PAK 118B12, 31538883 PAK 118CO2 2236695 PAK 11 8C02 2236695j ; PAK 118C03 4063618 PAK f 1''8C04 ! 5082624 PAK 11 8C04 i 5082624 PAK i 118C05 1129246i PAK 11 8C06 i 2077571 PAK 11 8C07 540936 PAK 118CO7 PAK 11 8C08 i 696768 PAK 11 8CO9 4885553 PAK 11 8C11 2878184 PAK 11 8D02 4898768 PAK 11 8D03 5939219 PAK 118D04892199 PAK ! 118D05 4768448 PAK 118D06 2790097 PAK i ! 118D07 5911639 PAK j 11 8D08 5139379 PAK 11 8D11 1160555 PAK 118ex1 3564930 PAK 118E02 J 5454857 PAK' 1 1 8E03 T 27292241 PAK t18E04 ! 1772986 PAK : 118E05 2786380 PAK 118EO6 3692856 PAK 11 8E07 i 768532 PAK 118EO8 PAK 118E09 ! 4671960 PAK av4 x£ 11 8E09 1 4671960 PAK r 11 Ber 7W2D PAK 1 18E12 48465561 PAK 118FOl 1500537-PAK..... 118fi2 847151 PAK 3709028 PAK 118F04416330 PAK J 118F06 1410985 PAK 118F07 3113621 PAK 118FO9 i 5131941j PAK 118F10 1 24915561 PAK 11 8F11. 10134621 PAK 118F12 1839922 PAK j 118G01 1703305 PAK j 11 8G03 6206293 PAK ! 118G05'1419492 PAK 11 8G06 245563 1 PAK 118G08 91337 _ PAK _ _ __, __.,. __. _.... ____-T' 11 8GO9 i 391 5937'i PAK 391593 PAK '"118G10 j5464552 ! PAK '118H01 i 6073528"PAK 18H 254010 ; 118H_3 _... __1 f- 37927301 PAK 118HO8 36911981 PAK 11 8H08 {36911 98i PAK 118H09 ! 5210141 PAK'' 118HO9'i 521014 ! PAK 118Hll 37927291 PAK 'i18H11 < PAK 119AOT-40419621 PAK L 9A03 j 2006172 ! PAK 60115191 PAK tod 119AO5 119A07 13951981 PAK 119A08 i 20061721 PAK r 119A09 451433 PAK'j j 119A10 5017614 PAK i 119A11 2911716 PAK w 11 9A12 1 6028132 PAK 119B02 1593697 PAK 119B03 1204601 PAK 119B04 2222204 PAK 11 9B06 4930396 PAK L 119B07 3961991 PAK 119B08 2998859 PAK 11 9BO9 1563340 PAK 11 9B11 5482330i PAK 119B12 2668897 PAK ! 119C01 1 1932412 ! PAK i 119C03) 5410564 PAK) 119C04 846093 PAK 119C05 -,-4838127 (PAK ! 119C06 j'"5958896 PAK 1 119C07) 1297009 PAK 1 >'>rm t (- ; J 119C09 -., _ I ^ _. _..,- 138438 PA_K j 119C10"J"1570707'PAK'i 119C12 j 5633960"PAK ! 119D01 j2503623 PAK j 119D02 j1146608 ! PAK ! 11 9D03 104935'PAK 119D04694997 PAK t 119D05 24142141 PAK 11 9D06 1 ; 2072014 ! PAK VDm 119D07"'1''"4200754 PAK 119D08 5398179 PAK 119D09 3210176 PAK 119D10 2414276 PAK ! 119D11 368416 PAK"1 119E01 !'1827891 PAK j 119E02'_-_ ; 2643520'i PAK 119EO3 26774761 PAK 1. 084416' PAK 1a84416i 119E06 ì 341141i _ PAK 11 9E08, 52032371 PAK - 9F02 j"'8307041""PAK'" 11 9F02 i 830704, PAK 119F03 T2477778J PAK". 119F05 375185j PAK 119F07 3264217j PAK 119F08 PAK 119FO9 3348143i PAK 11 9F10 1 35607711 PAK f"119F1T !) 302215T PAK J 11 9F12 2795858 PAK 119GO1 1376552 PAK 119G02 j 2917399 PAK ; 1 1 9G03 3178048 PAK', 119G04 164603 PAK 11 9G06 3959145 PAK 11. 9GO7 22362851 PAK 11 9G08 5135211 PAK 119G09 243060 PAK 119G10 935600 PAK T 119G12 5244149 PAK 11 9H01 1131422 PAK 119H02 ! 5712135 PAK"1 119H04 52441491 PAK 119H06 119H07 4011918, PAK 119H08 6190473'PAK 119H09 4189007 PAK 119H10 23706211 PAK 119H11 395318 PAK 120A01 4309453 PAK 120A02 4214324 PAK 120A04 1279710 PAK 120A05 4320673 PAK 1 20A07 __ _. 7 PAK Y 1 20A08 75194 PAK 120A09 5751705 PAK 120A10 4379999 PAK E 120A11 1947587 PAK 120B01 4180722 PAK 120B02 2845110 PAK j 120B03 A=iR 120B04""'2194119 PAK 120B05 1920105 PAK 120B07 2262228 PAK B PAK 1 20BO9 i 527433 PAK 1 20B11 1920048 PAK 120B12 1694215i PAK 120C01 m ; 772175iv "120C05 T""204930J'PAX""" '120C07 T 1626162 PAK 1 j 20C07 ! 16261621 PAK '120C08 1934198j PAK 1 20CO9'; 52i29098i PAK 120CO9 52290981 PAK 120C10 i 5693816'j PAK 120C11 50991941 PAK 120C11 jl-5099194 PAK iS s 120C12 i 1883262 ! PAK :'120D03) 980104 PAK 120D04 i 511523j PAK 120DO4 120D07 i 51366181 PAK 120D08 980105'PAK 120DO9 3244361 PAK r 120D10 i 3714775 PAK 1 20D11 1134850 PAK 1 20E02 3580943 PAK 120E03 j 6055457 PAK ! PAK 120E04 61428811 PAK 120E05 2702406 PAK S 120E06 279250 PAK 120E08, 1167157 PAK _", 120E09"2375315 PAK'j 1 20E11 279250 PAK 1 20F01 946534 PAK 120F02 2802047 PAK 1 20F03 5861742 PAK | > 120F04 1166666 PAK ---l 120F05 1310691 PAK 120F08983009 PAK' 120FO9 182416 PAK 120FIO 3702486 PAK q 120F12 j 5911669 PAK F 120G03 5368416 PAK 120G04 40788451 PAK 1 20G05 1024299 PAK 120G06 ! 751030 PAK 120G07"'1760889 PAK) 1 20G09 1 48673991 PAK | ! 120G101024240 PAK e 120G11 j3287597 PAK ! 120G12 3689760 PAK 1 20H01 1 18284801 PAK 120H03 3946394 PAK 120H05 ! 4810601 PAK 120H08 J 3494218 PAK ! 1 20H09 | 30844231 PAK 120H09 ,' 120H11 1 481060 PAK 1 27A01 1 1811021 PAK 127A02 1 882614l PAK 1 27A03 23208091 PAK 127A04 3066514 PAK ! 127A06 1 1971116 PAK j 127A07 ! 3844243 PAK J ---yOg--- 5358968 !"'"PAK" 127AO8 5358968i PAK 1 27AO9 _. __3E PAK 127A10 ; 2591334i PAK 1 27A11_, _ 5002353 j PAK 127A12 1718383 ! PAK 127B01 _1 50488921 PAK 127B02 6121566i PAK 127B03 i 35106551 PAK 127B04 1 2846515j PAK 127B05 3682765j PAK 127BO4 ;. _........ 127B08 . T.... 2108051 ; PAK 127B08'í 2108051 PAK 127B09 1 383221 j PAK 1 27B11 ! 3379074 PAK. t 127B12 3724462 PAK 1 27C01 i 4578437 PAK j"127C03 r 1475122 PAK 1 127C05 967946 PAK" 127CO5 9679461 PAK )'"127C07 i 1281326 PAK 1 1 27C08 499484 PAK 127CO9 2239498 PAK w <e 127C101437352 PAK 127Cll 5406124 PAK _127C12 640654 _ PAK 127D01 678637 PAK fl 127D02 4685854 PAK 127D03 J 2388838 PAK ! 1 27D04 5851280 PAK 127D05 3062288 PAK ! 127D06 4822945 PAK 127D08 j 4515092'PAK ! 127D09 !'5304143'PAK : 127D10 127D11 4118014 PAK ! H < 127D12 5657415 PAK - ^ 127E01 2610841 PAK 1 2ZE02 6176754 PAK 127E04, ; 127E04 3578490 PAK ! 127E05 5439348 PAK 5439348 127E08 2263412 PAK 127E09 1509151 PAK H i 127E10 1 5200345 PAK 1-27ElO 5200345 127E12 2058491 PAK 127F01 909979 PAK 127F02 106186 PAK 127F03 _ j _ 1650446 PAK 127F04 5975581 PAK J 127FOS__ L 5760379§ PAK 127F06"'2619599 PAK" ) 127F07' 4502367J PAK ! I"'127F08'"" !'"3280101 !'""PAK""" 127F09j 3879360 !' PAK J 1 27FO9, 3879360r PAK "'""127F10'j. 246350 PAK'" 127Fll 555094'i PAK 127F11) 555094) PAK' 127F12 | 4163540i, PAK 127G01 i 2830608t PAK 127G02', 4636291 {PAK -"" 127G03 f 2000932 ; PAK" .-Q-"4364604 ! p---- 1 27G05, 56408920 PAK 1 27G06 2576880 PAK 1 27G07 i 3420773 PAK 127go7 127G09 2263881 PAK _ r 127GO9 I 2263881 PAK j 127G101431799 PAK ! S 127G11 2455357 PAK 1 27G12 1645123 PAK 127H01 2936396 PAK 127H02 1474974 PAK 1 27H03 5708828 PAK 127HO4 783067 PAK 1 27H05 2438429 PAK 127H06 5713811 PAK l s 127H07 5910084PAK ) 127H08'3199304 PAK 1 27HO9 _ 4459199 PAK 127H10 50745201 PAK 128A01 zL PAK r"128A02 1558017'PAK"j i 128A03 3610065 PAK ! 128A04327934 PAK r n PAK 128A05 ! 693580 PAK 1 28A06 4336159 PAK -- 1 28A07 2045727| PAK 128A08 j3584390 PAK PAK 128A09 6231294 PAK 128A10'"'"5263318"'PAK 128All 1828589 PAK 128A124117859 PAK 128B015028959 PAK 128B02 1 5834361i PAK L 128B03 I 1309097 PAK' 128BO4 5927460 PAK 128B05 1 2823175 PAK 128B06 _ 10133611 PAK 1 28B07 f 5392906T PAK 128B08471140 PAK 128B09 11582444 PAK 128B10 1 t 128B11', 319164i PAK '128B12 *"1274286 PAK" i28C01 r 29Q3863 PAK ,.... _. ______128Cfl3 . . . ______. __ 1583556. __.... _ PAK. _. __... __ 1 28C04 1 42399501 PAK 128C05 352630i PAK 22382 () 31 PAK 128CO6 ; 6 22382n3, 1 28C07 1 X, PAK 4502551'i 128C09 1 4502551, PAK 128C10'I 5787794j PAK """"128C11 5966404 PAK"". 1 28C11 5966404 PAK 128C12 1518050 PAK P 128D01 5794578f PAK 1 28D02 3991703 PAK {'128D03 16196J'PAK" 128D05 3984128 ; PAK) 128DO7 3794299 PAK 128D08 5995517 PAK 1 28D09 | 2680954 PAK 1 28D10 1569337 PAK 128D11 2921335 PAK 1 28D12 < 2425044 PAK 128E01 5966111 PAK" ! l 128E02 3306943 PAK o s 128E03 2741690 PAK 3 1 28E04 4391349 PAK 1 28E05 5871 610 PAK e 128E06 6172919 PAK 128EO7 5467036 PAK 1 2BEOB 498448E PAK 1 28EO9 274383 g PAK 128E10 2089868 PAK 128E11 129593 PAK 128E12 1157196j PAK 128F01 1188885j PAK 128F02 2964269 PAK L 128F03 5147397 PAK i 128F04 1788764a PAK 128FO4 i-PAK 1 28F05'271 1533 PAK 128F06 1998957 PAK ; 128F07 ! 31286631 PAK 128F08 41607311 PAK 128FOg 6047221 iw M 128F10 4183202 PAK 128F11 | 5040209'j PAK 128F12 1119633 PAK i 128G01"""""577858 PAK s 1 28G02 5467600l PAK 128G03 j 2011826 PAK 4809021 PAK 1 28G06 1 842835 PAK 128G07 3416704 PAK ! 128G08 . 2799545 PAK ; 1 28GOs 1 32862241 PAK LLI-lGIO j'""4204052"PAK"j 128Gl 1 1998460i PAK 128G12'j3417081"PAK 128H01 4315005i'PAK 128HO4 2055604i PAK 1 28H04 1 2055604j PAK 128H05" ! 5262156) PAK 1 28H06 i 5642070t PAK 1 28H07 51959 1 i PAK 128HO8 PAK 1 28HO9 7399911 PAK 128HO9 31217711 PAK 128HlO 129A01 2866331 PAK 1 29A02 2 PAK 129AO3 61105451 PAK 1 29A04 1 12487 PAK 129A05 5436525 PAK_ r 129A06940724 PAK 129A07 51bX 1 29A08 | 1748856 PAK 1 29AO9 2008660 PAK 129A09 2008660 PAT'J , 1 29A11 577069 PAK 1 29B01 46130824 PAK 129B02 2393422 PAK 129B04 10_68552 PAK 1 29B05 3669772 PAK 129B07 2653945 PAK ! 129B095803423J PAK 129B11 2627706 PAK 129B12 5019357 PAK 1 29C01 49439t PAK 129C02886575 PAK 129CO3 1 29C03 6152725 PAK 129C04 1420504 PAK 129C05 6223113 PAK 129C06 6195107t PAK 129C10 2096736 PAK 129C11"3426881 PAK 1^9CA 1 129C124034076 PAK 129D02 59620761 PAK s 1 29D03 507352 PAK 129D04 6017548 PAK 1 29DGS 436380E PAK 129DO6 PAK 129D07 3900463 ! PAK 129D08 914248 PAK 1 29DO9 3667024i PAK 129D10 L ; Zl V 129D10 5716492 PAK j F-129DII 38042331 PAK ! 129D12 5286074 PAK j 129ex1 129E03'1533061 ; PAK 129E03'1533061i PAK ^. ;"129E04' ! 1192376 :' PAK 129E05 X 2946232i PAK 946232,', PAK 129EO5 129E06 3 5289773j PAK 129E07'17155833 PAK 129E10 v j 1528293 ; PAK 129E10.. ì 15282933 PAK . 129E11 r 34728941 PAK :'"'""129F02 F 4510298 ; PAK"' ; 129F02 F n0W PAK J129F03 j 2476570J PAK j 129F04"T 5876425 PAK'"j i'129F05"""'""'5866423 PAK"" Ws -r 129F06 1147530 PAK 1 29F07 _9 PAK 129F08 4883792 PAK j 129FO9 PAK 1 29F10-3944667 PAK 3 129F11 1423536i PAK 3 129G01 16098821 PAK 129G02 J 3189360 PAK 129GO3 4416531 PAK 1 29G03 miS 129G04534444 pAK ! 129G05 3224468 PAK' ___ _ 129G06 _ 5838157 PAK 129G07 431713 PAK 3 129G08 37841603 PAK 129G09 2706647 PAK 129G10""4041242 j PAK 1 29G 12 4005226 PAK. ! 129H03) 1312197 PAK ! 129H04 1188103 PAK ! 1 29H05 4264036 PAK 129H06 25470511 PAK 129H07 19878121 PAK 129H08 4620051 PAK 129H10"""4490870 PAK 130A01 5677731 PAK 130A03 2048965 PAK 130A05 2633009 PAK 130A06 705721 PAK 130A07 _ 3784593 PAK ; 130B02 4355931 PAK ! 130B03 4901120 1 30B04 4795721 PAK 130B05 5 15245 PAK 1 30B06 3403471 PAK PAK 130B07 _ (1777346 PAK i 130B08 j 846143 PAK 130B11 44097591 PAK 130B12 5424286 PAK 1 30C02 j 45961 76i PAK 1 30C05', 3274923i P4K 1 30C07, 17151 52i PAK 3034701 PAK 130C08' : 303470) PAK ! pat 130C10.. _... _. _. __ 2484159_. _.... _ PAK_.. . _.. 130C11 49011201 PAK 130C12 J 130C12.'60660 PAK ! 1 30D01 i 2380588j PAK . _. _... __ 130D02-_.. ___.. _.. ; ___. ____.. __ 2813674__ PAK-.-. __w. ; ; PAK 1 30D03 24986653 PAK °'PAK 130D03-2498665 PAK"" ; 1 30D04 t 15110423 PAK 130D07 3 1851283i PAK [130D08'"T 1120861 PAK'"" ! ) 130D114637417 PAK) 1 30D12 2845867 PAK 1 130E01 5578202 PAK 3 130E03 3 2631742 PAK ; 130E04 2498664= PAK tH m 130E06 3 4921237j PAK 130E07 5916690 PAK 2912318 PAK_ 130E08 130Ell 41807861'PAK 130E12 j 1757975 PAK 130F01 _ ; 1589032 PAK ! 130F02'5138168 PAK". 130F04 511658 PAK 130F06 i 1683308# PAK E -. 130F07 4412984 PAK 1 30F08 341 6448i PAK 44129841 PAK 130F07 130F09 5750325 PAK s 130GO1 24332891 PAK 130GO2 4635662-OAK 130G03'"'5747917 PAK 130G04 ; 5023683 PAK 1 30G06 1866164 PAK 1 3 DGO7 = 130G07 347966 PAK ! 130G08 _ _ 1 30G09 {137978 PAK 130G10 1 334670 71 130G11 i _ 16055C PAK 130G12 2928625, PAK 12 130HOl PAK ! 130H03 j"5127696J PAK" ! 130H07 m wer PAK 130H08 5952873 PAK 3 130H10 i 1319364 PAK 132A02 2388185 PAK 132A03 5611705 PAK j 132AO4 3123426 PAK 132A05 8 2461358j PAK 1 32A06'_ > 1 32A08 | 23 O PAK ! 132A08'""T 2316080J PAK ! r132A09"""r""591118J PAK 1 32A10 1 36350991 PAK 132A125992210 PAK' ! 132B04 | 195003 PAK 32B05 .. _. ; ____... _. _.. _. __. _3263455j PAK __ 132B05 _ X 3263455j PAK 132B06 {1473630i PAK 132B07 523921, PAK 32B08 512067s PAK . _. ______. __J _. _. _. _ _ _S ___. 132B09 1 4811609i PAK 132BlO 1769346 p 1 32B11 11 62098 PAK 132L ; ul 4385881 PAK 132C02 1430231§ PAK d 132C04 3997502 PAK 132C05 3370062 PAK 132C06 4310844 PAK ; ,. __ 132C07'"''3001643 PAK j 1 32C08 362735 PAK 1336587 132C09 1336587 PAK i 32C10 601 0516 7 132C11 2737797 PAK 132C124288568 PAK 132D01 5160219 PAK 132D03 94432 PAK w 132D04 110176 PAK ! J 132D05 3517147 PAK 132D061574174 PAK j 132D08 3823602 PAK 132DO9 4246220 PAK 132Dll 4157483 PAK 1 32D12 3894010 PAK x webz 594378 PAK' 132E03 j"615724 PAK 132E04, 52583121 PAK 1 32E05 i 2830303 PAK t 132E06 3500842 PAK 132E08"' 4242780 _''PAK 132E095056423 PAK 132E105554287 PAK Wb w PAK 132E122871862 PAK 132F01 4165625 PAK H 132F02 1839911 PAK 1 32F03 40421 ! PAK 1 32F04 Sj 779641 PAK 132F06 i 1091339i PAK 132F07 4824482 PAK 132F08 454130 PAK # 132F09 1 _ 6259212-PAK 132F10 . 646945 PAK E 132F11 i''967493 PAK 132G03 310780PAK 132G05"'2920616 PAK w__,. ___. _.. ___. _ _ 1 32G06 g 7949 PAK "132G071166781J PAK 1 32G08 3044930 ; PAK 132GO9 61853001 PAK 132G12 5603070 ; PAK r 1 32H01 2656025i PAK 132HOl 132H03, 4214521ij PAK 132H04 j 6091795 ! PAK' 21137211 PAK 1 32H08 5 i 23071 i PAK L. 133A01 1342175 PAK : 1 33A04 2519425 ; PAK r"""""133A05) 6220607 PAK'" | 1 33A06 5359765 PAK L 133A07 4721220 PAK 133A092505755 PAK 133All 3224463 PAK 133A12 4746483 PAK 133B01 998262 PAK _ 133B03 _ _ 2473175 4 PAK _ ! 1 33B04 1872786 PAK'. 133B05 3369314 PAK 133B06 3975064 PAK 133B07'4150485 PAK : 3 : 1BU3 1ss21a PAK Rk 133BO9 2063113 PAK 133B115180841 PAK _ 133C04 646956 PAK-," 1 33C06 5066204 PAK 1 33C07 2199980 PAK 133C11 j 2830716 PAK 133C12 3808897 PAK 1 33D03 5684456j PAK 133DO4 2861464 PAK 1 33D06 5867534 PAK 133DO7 3704046 PAK 1 33D08 1647665 PAK sM 133D09 T 3788320 PAK 13SD11 133DIl 29724601 PAK 133E01 3512813 PAK _ 2340727ii PAK l : ~-; t 133E04 5088644 PAK 133E06 888027 PAK 133E09"5860338 PAK 133Ell 5434071 PAK 133F01 1169996 PAK 1 3F02 3284846 PAK m E 133F03 3791674 PAK j i 3001638'PAK ! 133F05"1974955 PAK 133F06 i < 1 33F08 m 347275l, PAK 133F11 ! 4173414J PAK'' L"133F12 j2830716J PAK 133Fl2 133G01 J 4417306 PAK 133G02")"5469588 PAK""" 1 33G03 i 2311301 PAK 1 33G05, 1 2090369j PAK r 133G06 J 3986117 PAK '133G07""3788320 PAK J 133G08 1562167s PAK 133GO9 1514982'j PAK ! L 133G11 4173414 PAK 133G12 i 543407 PAK 1 33H01 4748483 PAK 133H03 1402490 PAK 133H04 1402491 PAK 133H051588214 PAK ! 1 33H06 i 2222680 PAK 133H07 _2222680_ PAK 133H08 1384431 PAK 133H09 5994419 PAK'"") 134A02 2576753 PAK s 134A04 5494077 PAK 1 34A06 26884531 PAK w 1 34A07 716818 PAK _ Y 134A09 3173887 PAK _. __ 134A10 597468 PAK 134A11 689062 PAK', 1 34A11 689062 PAK 134A12 589475j PAK'i 134B01 2964017'j PAK 134B03 1004613j PAK 'o 134B041076888 PAK j 134B05 4434207"PAK'1 13 3369630i PAK' 1 34B08 3565805 PAK rt m 134B09 1079265 PAK j 134B10''"5081696'PAKj 134B11 1711170 PAK i 134C01 2985756 PAK j 134C03 2685404 PAK 134C04 3933050 PAK 134C054056662 PAK ! H 134CO8 56574151 134C10 1 6015057j PAK "'"134C12"5976740 PAK j 134DO1 1 34D03 1 2052537i PAK 134D04 2213259 PAK 134D06 4634700 PAK 134D09 j 5316951 ; PAK f 134D10 1 760164j PAK 1 34D11 f 44232881 PAK f 1 34D12 f 5736987f PAK 1 134E01 2500195J PAK 5736 134E02'2500193J PAK 2500193i PAK 134E03 1474058) PAK 1 34E05 3176728 ! PAK 134E083081818 PAK ! 134E10. j 4475036j PAK 134exil 5651569 PAK 134E11'f 5651569 ; PAK 134F03'''"f76484"''"PAK s z '134F043898881 PAK 1 34F05 ! 1576837 PAK ['134F08 1760938 PAK r'134F09 1362626.""PAK'"' f 134F102038176 PAK 134F123923558 PAK 134G01 1913587 PAK r 134G04 4974035 ! PAK 1 34G10 541 2162 PAK 134G11 6048785 PAK 134H03 1409584 PAK 134H04 2553883 PAK 134H05351470 PAK 134H06 2322164 PAK 134H08 2316080 PAK 134H10 4697711 PAK 135A01 5761946 PAK 135A03 6140275 PAK 135A04 5966111 PAK 1 35A05 3607877j PAK 135A091707330 PAK 135A11 6150757 ! PAK t 135B03 1608735 PAK 1 35B04 2930973e PAK 2917720 PAK 135B09387593 PAK 135B10 6143502 PAK j 1 35B12 5925381 PAK 135C03 2820191 PAK 1 i 1 35C05 1879863 ; PAK 135C08683870 PAK 135D01 5910711 PAK 1 35D03 16764171 PAK 13DDO4 v a 135D08 4108215 PAK 135D09 X 61922921 PAK 135D102488160 PAK 135Dll 5849598 PAK 135D12 4106784 PAK 1 35E01 j 28090801 PAK 135EO3 PAK i 59813231 135E05 = 647382. PAK 135E08 2243817 PAK 135ElO 15750391 PAK 1 35F01 1 4732060 ! PAK 135F04 2239138i PAK 2239138, PAK 135FO5 23343651 PAK 1 35FO9 53536361 PAK 135F12 f 817239í PAK _ 135G01 _ I _ 5719352 ; __PA_K_ 135G03' !''1882537'PAK'"" 135G04 135G04 1315517 PAK 135G05 _ 1273594 PAK 1273594 PAK 1 35G08 1342941 s PAK} 135G09"""'1952650"PAK'"1 135GlO 8647231 PAK 135G11 4636291f PAK 135H03 57847281 PAK, f 135H08 3782326 PAK !'135H095184760 PAK 1 135HlO 5952152 PAK 136A011718165 PAK 136A02 2393400 PAK 136A03524575 PAK j 136A05 5384089 PAK s 136A06 4976538 PAK 136A07 2057442 PAK 136AO9 4387245 PAK 1 36A11 5648833 PAK ff 136Al2 503825 PAK 1 36B04 | 505555 PAK 1 36B06 1 92131 PAK 136B07 376806 PAK 1 36B08 1890229 PAK 136BO9 3064388j PAK} 1 36B11 4927081 PAK'f 136B12 4500512 PAK 136C01 766735 PAK 136C02 1120523 PAK 136C03493715 PAK ! # 136C04 I 1757430 PAK 1 36C05 226108 PAK'I f 136C07 | 6108826 PAK HõiC « PAK {136C08"j 4839045 PAK i 136C09 ! 3174664 PAK 136ClO 13844301 PAK 136D01 311047 PAK 136D03 1 2362509f PAK 136D04 4450952 PAK 1 36D07 1 1 828522i PAK 136D08 _ _204929 PAK s 136D09'5686350PAK fi 136D10 i 5148392, PAK f 136Dll-21880261 PAK i '136D12"T3518139"PAK ; _ 136E02 2341044j PAK' 1 36E04, 2052537f PAK _ 136E05 2266499 PAK-.., f"'"136E06'""""252573 PAK""" ! l 136EO7 481060 PAK 136EO9,, 802563f PAK 1 36E10 ! 11 92902f PAK 136E11 if 1168239, PAK 136Ell 1 36E12 6148002 PAK v fi 1 36F01 5985574 PAK 1 36F02 2500955 PAK .......... 1 36F03 3155936 PAK 136F04 434199 PAK 2 136F07) 1516167 PAK j 136F08 3873389 ^_, _ PAK ; 136F11 1079265 PAK 7 1 36G01 2610451 PAK 136G03 5455694 PAK 136G04 4333629 PAK i 1 136G05- 1534346 PAK ---- ( 136G063437629 PAK j 136G07 5710982 PAK ; 136G08 2570304 PAK _ F 136G09 3052625 PAK 136G10 5914201 PAK 1 36G12 2660880 PAK f 136H01 1 3885014 PAK f, 136HOI 136H02 2815750 PAK l 1 36H03 1287875 PAK 136H043615427 PAK i 379 PAK 136H06 2647365 PAK 136H10 f 142776 PAK 137A03 1 718749 PAK v 137A04 1 4709718 PAK 137A05'""'2114742 PAK i 137A06 4887907 PAK s 8619071 1 37A07 925287 PAK 137A091298874 PAK. 1 37A10 1 5560950 PAK f 1 37A11 f 17750251 PAK 137A123648233 PAK j 137B02 1159179 PAK i 137B03''4101984 PAK) s 137B04 4101984 PAK 137B05 3107680 PAK 137B06 1569296 PAK 137B07 1419150 PAK_ ! 137B08 2458915 PAK 137B091833616 PAK) 9 ! 137B10 j 2141916J PAK'*1 .....,.......-..,. . 1839893 : PAK'" : 1 38F02'18398933 PAK 138F03 S 61172271. PAK 138F05 J3628426 PAK 1 138F06, 6101733í PAK 138F07 ì 27212353 PAK 138F08, 52471243 PAK,' 138F10 841069F PAK 138F11 3 49129090 PAK 138Fll 4912909 ! PAK 138F12'4202904 PAK 1 38G02 ì 6035564 PAK g Z PE s 138G03 1 2062404't PAK 138GO3 2062404 PAK 138G04, 2914978i PAK J"'138G06''"T"5371569} PAK"j 138G07 4898889 P_AK 138G08 2032484 PAK 1 38GO9 | 1555200 PAK 138G11 4246599 PAK) 138H03 3472994 PAK' 138H04 848629 PAK 1 38H06 4144805 PAK 1 38H07 6209136 PAK 1 38HO9 551781 PAK 3 x 139AOI 4565522 139A02 1059423 PAK _ 1 39A05 6145447 PAKm 139AO6 3168170 PAK ! 139A07 j595354 PAK us 1 39A08 3177097 PAK _ 1 39AO9 566924, PAK s 139A11'2236609 PAK 139A12 PAK 3 139B03 3 2491006 PAK 1 39B04 3 3362546 PAK 3 139B05 33 5855139 PAK 3 139B06) 4113348 PAK 139B08... ___..... _. _.. _. __ 5278808 PAK _.. _. __ 1 39B08 5278808 PAK t 139B08""'5278808 PAK ru 139B10523252 PAK 139B12 3 57608, PAK 5 < 1 39C01 5357965, PAK 3 139C02 44447163 PAK 139C04 4246599, PAK e 1 39C06 ! 20252103 PAK 3 139C07, 51878053 PAK 3 139C08 5350177 PAK ! 139C09"'5519304 PAK s PAK 139C11'5159293 PAK j 139DOI 818243 PAK 3 1 39D02 3 5270676, PAK 139D04 1 2951345, PAK |, 7 PAK 3 IIIZ39D07j''1280009 !"""' PAK""""" L-139D08')"953023 ! PAK' '"'139D10" !"'733829 ! PAK'" 1 39D08'953023i PAK 139D11 J 6224157 AK -'-1 39D11 62241 57j PAK 1 39D12 59943081 PAK 1 39E02 5077239'j PAK 139E03, i 6123477i'PAK 1 39E04' 5657823 ji PAK 3 1 39E05 SL PAK 1 39E06 2800578 ! PAK 139E06 2800578} PAK'" 139E07'"'4926167 PAK ; 139E09 j 2800848 PAK _139E10 = 3688837 PAK j [139F01 1240595 PAK 1 j139F02'258947 PAK : 139fi3 2999079 PAK "139F053603321 PAK" ; 1 39F06 2009424 PAK # 139F07 6168388 PAK 139F08 3663212 PAK 1 39FO9 3653261 PAK 1 39F11 5542521 PAK 139F121919267 PAK ! 140A05 PAK 140A06 i 9563798 PAK 140A07 1168719 PAK 140A08 1016483 PAK 140A09 5270661 PAK 140A10 4623477 PAK 140A12 2633129 PAK 140B01 4298474 PAK 140B02 i 5157575 PAK 140B03 PAK _ m7< PAK 140B05 5977608 PAK 140B06, 829418 PAK 140B08 3832516 PAK 140B08 3832516 (PAK 140B09 3480355 PAK ! 140B10 4038577 PAK 140B11 4038569 PAK ; 140B12 1 5949521 PAK f. 140C01 1923620 PAK Ix 1600315 PAK X 140C04 "1600315 PAK ! 3 1 40C06 1 902876i PAK 140C06 1902876 PAK""""' 140CO7 2981848 PAK--- 140C08 2461473 PAK 140CO9 2013794 {PAK _ g J 140C11 5585891PAK ! H0605 5651912i PAK 140D03 j 21484021 PAK 140DO4 i 35745621 PAK 140D06 3 3383538i PAK 140DO7 140D08 1 40D08 i 1564249 ! PAK '140D09 : 3770926 ! PAK' . _ 140D11, 6051112 ; PAK _ 140D12 4 4808966i PAK 140E02'i 3985271 PAK 140E04 w--. _- 4841791 i-. PAK ... ___w 140E05 j 48271971 PAK i140E06 6212401 PAK ; 140E07 4057572' PAK 140E09 53614 : 9-1 PAK 140E10 28981381 PAK w AK 1 140Ell 21276921 PAK 140E12 _ 1683120 PAK. 140F01 3519919 PAK ! 140F02'3419732J PAK' ; 140F03 1 1587836, PAK 140F04 2353285 PAK 140F05 2370762 PAK 140F063023871"PAK"1 140F08 (5918849 PAK 140F09 5153893 PAK 140F10 1578205i PAK.' 140F11 PAK PAK 1 140F12 189664 PAK 140G01 _. 1837588 _ PAK M ; 140G04 44249_31, PAK y 1 40G05 995744 PAK 140G06 2981848 (PAK E g s} 140G07 PAK 140G08 3149367 PAK 140G10 ; 1 40G10 51668001 PAK 140G12 i 5552731 PAK 140H01 HoElHiC 140HOl 272063611 PAK 140H05 6029781 ! PAK 140H05 6283801 PAK 140H06 j628380 ! PAK ! 140Ha 32815£ PAK 140H08 (3281562 PAK t 140H09 2747356 PAK j 1 40H 10 29527521 PAK 140H10 29527521 PAK 141AO1 3175713 PAK 3 141A02 1 853263 PAK 141A03 4425519 PAK _ __ 141A_0_4 _ 5437535 PAK ; 141A05 21810 PAK (' 141A06 {1309993 PAK < l a 141A07, 5645688'PAK 141A08 1 1182618 PAK m 141AO9, 3210065 PAK """141A10"r'"1989911 !'""" PAK ; ."141A11'3129901 j PAK J _... _.. _. ; ___...--... ___ : 141A12, 3110621. PAK 94Wb. , 1574713i PAK - g0 j-""-2096074""PAK""""" LL 141B03 i'4520836J PAK'' 141 B02 l 2096074, PAK 141B03 í 452083'3. PAK 141BO4 18954721 PAK 141BO5 141 B06-.. _. _. __. _..... ___ 5291174 . PAK"...... 141B06 5291174 PAK 141B07 j 5794998J PAK 141B10229130 ! PAK ! 141B11 3211432'PAK __. __ __... _ _.. 141C01 3 58064203 PAK 141C03 3571637 PAK ! 141 C04 41 11230 PAK 5 J ! 141 COS 4176435 PAK ! 141C06 5571127 PAK 141 C07 44303063 PAK 141 C08 59341 60t PAK r w-| 141C09 5031712J PAK ! 141 D02 3 3424904 {PAK 141D02 3424904'P_AIC 2414678 PAK 141D05 3 5367831j PAK 141 D06 38281 80i PAK ì' ) 6 3828180 PAK 141 D07 15418, PAK 141DO8 51108461 PAK 141 D09 2831288 _ PAK'. 141D11 53535833 PAK 141D12 44041491 PAK 3, 141E01 177 3 141E02 l 3859181 PAK _ 141 E04 = PAK 141EOS T 1581069 PAK 141 E06 3824649 PAK 3 141E07 4619833 PAK ! 141 EO9'197608 PAK 141 E1 O 2288920 T 141E11 ! 2398410 PAK 141E12 3 5728561 PAK 141F01 t 572855'PAK L v j 141F02 2511098 PAK t 141FO3 57866881 PAK 141F05"4481788 PAK 1 141 F06 3 400977 PAK 141 F07'39594e PAK 1 '41 F1Q 26885. PAK 3 141 F11 4140889 PAK i 141F11 _ 4140889 PAK ; 141GO2 3767627 PAK 141GOS e 404807811 PAK 141GO6 6276931 PAK 141 G07 L 4522019. PAK'. 141GO9 j 62017913 PAK 141 G07 141 G10 368828 PAK 141 G11 5756759 ! PAK 3 141 H02 5272668'PAK 141HO4 3235122i PAK 141 H04 3 3235122j PAK 141 H05 60355641 PAK 141 H06 j 6035564 ; PAK 141 H08 50331563 PAK 142AOI 31316531 PAK L-142AO5 58020 PAK 1 42A05 3 58020 PAK F 142A05 58020 PAK j 142A07 58020 PAK 142AO9 3400008 PAK '! 142A10 2893581 PAK 1 42A11 558241 2 PAK 3 142B01 3383351 PAK f 142B03856389 ! PAK'"'" 3 142B04 4835144 PAK t. 142BO5 1248145 PAK . _. _ 142B06 2272288 PÅK 142B07 1354644 PAK 142B08 5140846 PAK 142BO9 696203 PAK 142B12 740871 PAK, 3 142C01740871 PAK 142C02 2485163 PAK Ab 1 42C05 1034469 PAK 10344691 1 42CO9 4255622 PAK 142C11 2032316 PAK 142D02 _ 4497209 ; PAK 1'2 DO3 34850541 PAK} 142DO5 3433005 PAK 142D06 31 16955 PAK 3 1 42DO9 3509590 PAK w 3 142D10 5437249 PAK 1 42D12 1644597 PAK 142E01 5890073 PAK 142EO1 142EO2 5890073 PAK 142E 6102318 PAK 142E06""380679 PAK' 142E07400655 PAK d 142E10 3 1034469 PAK 142E11 3014982 PAK 3 142Ell 3014982 15AK- 142E12 789444 PAK 1 AK 142F03 1 19051841 PAK 142F04 4873021 PAK 142F05 3084524 PAK 142F06 2930906 PAK 142F08 r 489002 PAK 142F09'r 3974710 PAK . _ _ ! 142F10 1 5154909j PAK 142F12 ! 4182335J'PAK"""" '"142G03"967784 ! PAK'II. 142G04''5717407)""PAK 142F12 t 4162335 PAK . _. _.. _... _. 142G04 . _.. 5717407f.. ____ PAK ____. s ! 1 42G03 9677841 PAK 142GO4 5717407'PAK 142GO5 896150i PAK 142G05 s 896150s PAK 1 42G06. 50990483 PAK 1 42G07 61471933 PAK 142GO9,, 3 710756i PAK 142G10 i 8078313 PAK 142GO7 5292638 ;'"PAK"' 3 142G12 4379409 PAK r142H01 2808940 PAK . .... .... .. t"'142H02"T""3627334J"PAK,' ! S 1 42H06 3 3606426 ; PAK 142HO7 PAK 142H08'3996492 PAK' 142H09 3505737 PAK J 1 42H 10 1103395 PAK 143A02 24909s PAK ; 1 43A05 36720 PAK 1 43A06 3924250s PAK s'1 43A07 1739662 PAK 143B01 485965 PAK w 143B05 5516048 1 43B06 1582135 PAK 143BO7 5590983 PAK 143B07 559098} PAK ) 143B08 6189775 PAK 1 143BOI) 1537840 PAK F H t 143B10 | 3188262 PAK 1 143B11 33 3188262j PAK 143C02 60243971 PAK 36562463 PAK 1 43C08 L 6020044 PAK 3 143C10 s 459263 PAK 143Cll 45641951 PAK j 143C12 - 1323321 PAK 143D02 _ 221817 PAK 1 43D02 221 817, PAK. b b i 1 43D03 515250 PAK'. r aBD=) 143D06 3 14749345 PAK 143D08 3 15085023 PAK 143D09 2060200 PAK 143D10 s 50520161 PAK 143D11 j 3780756 PAK 143E01 905329 PAK v zwz 143E02 3857639 PAK""1 3 143E03 2507161 PAK s 143E05 ^ 6244985 PAK ; 143E06 4999766 PAK ! 143E07 4641998 PAK"1 143EO8 51869651 PAK 143E09'62012281 PAK 143ElO 57128021 PAK 143E12 ! 1416290i PAK 143F02 ! 3235122j PAK 143F04 ! 5618608j PAK '""143F05 j 574080 PAK 143F06 0 2500014j PAK 143F07} 5075495j PAK : __ 143F08 E 1116364 ; PAK ..'"143F09'j3260439 !" PAK ;'"143F12" (6065303 PAK" 1 43G01 10255451 PAK 143G02 598013 PAK 1 43G04 5399574j PAK r"""143G05"'"'"3309414-p--l 143GO5 143GO6 5437908 PAK 1 43G07 3031647 PAK 1 43G08 i 4345476 PAK} 1w 1 s43s2s3 PAK . 143G12 2684849 PAK 1 43G 12 2684849 PAK ii 143H02 6223363 PAK ...., 1 43H04 35746341 PAK 143HO4 35746341 PAK 143H05 2545454j PÅK 143H06 508018 I PAK 1 43H07 2577489 PAK 143H08 1711787 PAK 1 43H09 5112371 PAK 143H10 1400592 PAK 144A06 4111916'PAK _ 144A08 I 6194060 PAK' 1 44A11 5500080 PAK s 144A12 1260783 ! PAK 144B01 1 589232j PAK 144BO3 PAK 144B07 5966271 PAK 1 44B08 4404556 PAK 144B09 678164 PAK 1 44B 10 4 107242 PAK 144Bll 423912 PAK w _ 423912 PAK 144B123572867 PAK w 144COI 2259359 PAK 144C03 752819 PAK 144C04731318 PAK 1 44C05 2291382 PAK 144C07344331 PAK 1 44C08 29252361 PAK 1 44CO9 5221428 PAK 144C09 5221428 PAK 144C10 5865311 PAK 144C12 5395375 PAK 144D03 5572038 PAK 144D05 4493922 PAK 144D06 j 3110659| PAK 144D08')"2526366j PAK ; 144DO8 25263661 PAK . _... ____... __. 144E02 t 5191997i PAK 144E03 1 2193252j PAK 144E04 T HõX PAK """144E03--j--2193252 ;""PAK". 144E06'1403737j PAK 144EO6 14037371 PAK., :'144E07 ! 5538436J'PAK 144E10"T"3503226PAK ----J44E12"""" 1361870 PAK""" : 144F02 5727752 PAK ! 144FO2 57277521 PAK 144F03 61454 PAK 144F04 381962 PAK r''144F05"'5668640)'PAK'"1 1 44F06 9982751 PAK 144F08 5937166'PAK J 144F091326016 PAK 3 144F11 t 3055208j PAK 1 44G02 45S955 HAK 144GO3 209539 PAK 144G04 5951246 PAK ! 14. 4G05 1745997 K z 144G061746006 PAK' 1 44G08 51763031 PAK', 144GO9 5569024 PAK. j 1 44G10 4814592 PAK 144G11 3658944 PAK S J 144H01 3933215i PAK 144H023429885 PAK ! 144H03 _ 824899 PAK 144H05 3582889j PAK.. _ 976845j PAK_ i 1 1149911 145A01 i 2310384 PAK 145A03 32134) PAK 1 145A04 428270E PAK r 145A07 2720151 PAK 1 45A08'1092513 PAK 145A11 2465040 PAK : 145BOl 266471 PAK 145B02 5635467j PAK i 145B04 4443197 PAK w s 1 45B05 5667263 PAK 145B06 5153158 PAK ! 145B08 1117276 PAK j !''145B09 3331124 PAK ! 145B10 T 26008631 PAK T 145B11 1 4592831 PAK 145B12 882282 PAK 145C01 1 26950881 PAK 145C02 j 231 1106t PAK 26247791 PAK 145C04 1 51491241 PAK i""""145C05"""""""""""'4898888 PAK" : r"'145C06 j 3500842 PAK _.... _.. _ _. 145C07 ! 3857015i PAK 1 45C08 i 1082277'PAK r""'145C09'""'T'''2452515""'pAK" 145CO9 2452515s PAK 145C11 e 3596975, PAK 145D01 t 5530798, PAK ; 145D03 5533221 PAK 145D05 0 2927667j PAK 145D08 l 6020131t PAK ["145D11715367J PAK )"'145D12 3127776JPAK 145E01 j 1869192t PAK 145E02 j5712193 PAK ! 145E03 1079672 PAK 145EO4 PAK --1454770 145E05 3 1122220 PAK 145E06 1 5903062 PAK 145E07 l 5656621 PAK i 145E09 21779791 PAK 145E10 j 14373513 PAK 145ElO-PAK 1 45E11 452549 PAK 145E12 3 3455820 PAK 145F02 ; 293474-PAK 145F03 2214627 PAK w e ffi 145F04 3 5589978j PAK 145F05 390903 PAK i 145F06 1818090 PAK 1 45F07 310736 PÅK 145F08 86193 PAK 145F09 5401985 PAK i 145F10 50749261 PAK -p7 145F12 4957248i PAK 1 45G02 1 54556941 PAK e 145GO4 l 145GO5 39446591 PAK 145G05 3944659j PAK 145G06 j 5860932 PAK 1 45G06 1 5860932 PAK 145G07 i 5017788 PAK w 145G08) 4656499 PAK 145G093872065"PAK 145G10 {1746793 PAK '145G12 _ 1 581560'PAK 145H01 3 5077359j PAK t 145H04 r 1270409'PAK 1 v 5467593 PAK 145H07 T2752701 PAK 145H08 2185296 PAK 145HO9 2534012 PAK 145H10 i 397477'PAK 146AOI 4601205 PAK 146_A01 j"146A02 5372123 PAK ;. _.. _....... ___.. 146A04 3667034 ;----...-. PAK.. _ : ^_ 146A05 ! 3129120i PAK s PAK 1 46A06'38898101 PAK 146A07 1 719491. PAK 146AO7 719491j JPAK .... gpg-j-339Q278r""PAK""" 1 46A09 f 5822926, PAK 146B01 i 5210123s PAK 146BO2 2797191 PAK 146B03'1707230 PAK ""46B05 ! 394249 PAK 146B07 3010618"PAK Z 146B08, 15618201 PAK 146B09,. 259527 PAK 146B10 1201858 PAK f 146B11 5119490 PAK ! 146B12 5048891 PAK j 146C01 50488921 PAK r 146C04 6239357 PAK ! 146C05 1384431 PAK i 146C06 2786430 PAK 1 46C07 4240377 PAK 146C08 1705239 PAK 146C09 572961 PAK 146C10 994911 PAK 1 146C11 2601387 PAK 146C12 2459337 PAK 146D02 4559343 PAK 146D04 _ 5944261 PAK 146D06 4887907 PAK 1 46D07 5904579 PAK 146DO8 1445263 PAK ! 146D09 1310580 PAK i 146EO2 3247070 PAK 817690 PAK A-e N 146E05 4542919 15AK 14GSS v Bi975RS PAK 146E08 3040574 PAK 146E06 3797655 PAK j 1 46E10 4122865 PAK 146EO8 3040574 PAK 1 46E12 1382456 PAK 146ElO 41228651 PAK ! 146E12 1382456 PAK j 146F01 j 3022174 PAK j 146F03 2854123 P_AK '146F05 4521892 P_AK i-146F08 t 62217E PAK ------------ 146F09 i 79673 PAK L 146F10 841043 PAK--- 146Fll 1002796 PAK l w 146GO1 3210226 PAK 146G03 5751097 PAK 146G06 j 3763199 PAK ! 146GO7 PAK .'""146G08" T"""'3770700i""""pAK"'"" 146G08 i 3770700j PAK 146G10 i 54216323 PAK 146H01 3 4586115ws PAK :'146H04 J 4716342) PAK 1 46H06 994092i PAK 146H07 2757922 ; PAK 27579221 '146H09.. j 4721933i PAK" 147AOI 24539831 PAK 147AO2 56 .'147A03 J""3114040 PAK" ! ! 147A04 j5898272 PAK : 147AO4 5898272 PAK-- 147AO5 2344149 PAK 1395082 1 47A06 i PAK Z 1 47A08 11679071 PAK s 1 47AO9 3638868 PAK 1 47A11 3042034 ; PAK 1 47A12 803486'i'PAK Z 147BOI 269T8-7-bi-P.. A. K 147BO2 46487991 PAK !"147B03 j 329704 PAK' i 147B04 i 2176505 PAK A 1 47B05 i 4982074 PAK 3 147B06 1 35014 PAK Z 147BO9 PAK 1 47B10 3659659 PAK lZ 147B11 3958094iZ PAK H J 147B12 5702608 PAK 147C02 2505127 PAK j147C04"4672010 FAK""" ! 18609063 PAK s 1 47C06 53847681 PAK S E 147C07 34069111 PAK Z r 147C08 851773J PAK 147C09 3029578 PAK 147ClO 24770091 PAK f 147C12 5981818 PAK )''147D02'2032572 PAK 1 1 47D03 6083524 PAK Z 147D04 569045 ; PAK 147D05 _ 5659476 PAK ... 147D06"'4363781 PAK 1 147D07 3 1631833i PAK v '147D08 j1940369 PAK' 147D09 1342088 _ PAK Z 147D10 1581147 PAK 147D11 5397430 PAK 147D12 1150858 PAK 57r v --00261 01 PAK 147E04 4154804 ! PAK'ì 147E05 3400991 PAK . ---- Z 147E06 s 933215F PAK 147EO7 741'PAK 147EO9 29818481 PAK ."'"147E12 3225838 j PAK"" 147F01 792524'PAK 1 47F02 54821 Oj PAK 147F03 3634920 PAK 1 47F04 3837435'3 PAK '". 147F05 j 1596282 PAK' 147F06' 6764171 PAK ;"147F08 2235989 PAK"""" 147FO9 5679156 PAK Z 147F10 2154856 PAK t o 3444352T PAK 147Fll 1 47G01 5600549 PAK F 147G03 5854992 PAK j 147GO3 147GO4 6701111 PAK i H 147G05 3472902) PAK) 147G07 2663140 PAK -| 147G08 T862656 PAK' 147G09 1378207 PAK : ; 147GlO 5459807 PAK 1 47G 11 3494899 PAK 147G12 3225838 PAK 147H04 5686691 PAK 1 47HOf 927593 PAK'3 -i5A-K 147H07 5058546 PAK 147H08 2516026 PAK 147H09 256971 PAK 148A01 1517114 PAK 1 148A02 3774332j PAK 3 148A03573881 Oj PAK j 148A04 5399725 PAK 1 48A05 3938899 PAK 1 48A06 27954021 PAK 148A07 1856834 PAK j 148A10 4661339 PAK '148A11 619175 PAK j , 1 48A12 2892684 PAK Zi 148B01 227554 PAK r"148B02 j 4976058 PAK ! 148BO3 3781351 PAK lw 148B04 -2235908 PAK 148B05 94206 PAK 148B07 4505173 PAK 148B08 1 2473610 PAK 148B11 _ 716901 _ PAK 148C02 _ 938135 PAK i 148C03 5504728 PAK ! 148C04 3581560PAK i 148C05 5742954 PAK 1 48C06 56339761 PAK 148C07 ; 43209 PAK 148CO8 1598622 PAK , . 148C09 4889471 ! PAK '. 148C11 1 1655142 PAK 148D02 t 5254615l PAK 148D03 i 204929 PAK 148D04 j_. __. ____ 1454637' PAK 148D05 ! 609041j PAK 3 148D06 j 8864055 PAK 148D07 S 29687591 PAK 148D08 918914 PAK 1 48D09 6204695g PAK 148D10 j 5582412 PAK J 148D11 27008225 PAK 148E01 3 1341154 PAK 4906766 PAK 148EO5 4097476 PAK j13 148E07 3331171 PAK 148E08 5186946 PAK 148ElO 369521 PAK 148Ell 1-894331 PAK 148FOl 3781629 PAK 1 48F02 338786 PAK a 1 48F03 2287009 PAK l 148F04 5938188 PAK 1 48F05 546759 PAK r 148F06 2609402 PAK 148F07 4308508 PAK 148F08 5466730 PAK ; 148F09 1984189PAK 1 48F09 1984189 PAK 148F10""'634058'PAK ! 148F11 338715 PAK 3 i 148GO2 1 4431849 PAK 148G03 537178 PAK) 3 148G04 1 4317259, 3 PAK 1 48G06 18994673 PAK 3 148G08 61068511 PAK g 148G09 3576563 PAK __. _.... __. 148G10'1980773 PAK , 148G11 5494285 PAK 148G12 44760183 PAK 148H01 1560740 PAK 1 48H02 1980773 PAK 148H03 1457074 PAK 1 48H04 1 3745601 PAK 148H05 i 5775135 PAK 148H06'1220901 PAK 3 | 148H08 3 2067401 PAK 148HO8 2067401 PAK 148H09 4149862 PAK 148Hlo 5877561 PAK 149A01 2719832 PAK"1 149A02 1 26801745 PAK j 149A03 t"2664188 PAK j i 149A04 3 345984j PAK : _. __ _ 149A05 ; 2682401 PAK ""149A07) 2715493J PAK". 149A08 1 1165057i PAK 149A12 t 2671137 ; i PAK 149BOl 26617531 PAK 149B01 1 26617531 PAK 149B03 959779'; PAK 149B04"j"6143862J"PAK'. 149B05 J 333405 AK j'149B07""1262344 PAK"' 149B08 ; 3490576 PAK 4 9 B-0 8 34905761 PAK 149B11 _ 1419164j PAK 149B12 3018334j PAK .......... 149COl 1388385t 149C02 | 1110268| PAK 3401418 PAK 149CO3 J 149C04"5151657 PAK j 1 49C05 973853 PAK 1 49C06 2497369i ; PAK 149CO6 É 149C07 3805173i PAK 149C09 311661 ; PAK 149C11""3041586'PAK'1 149C11 3041586 PÅK 149D03 2379612 PAK 149DO3 2379612 PAK 149D04 4449369 PAK 149D05 3586854 PAK 149D06 5203940 PAK r 149D08 6148049 PAK 1 S S 149D11 2708931 PAK 149D12 1392368 PAK 149E02 ; 5913940i PAK 149E03'5033821 PAK 149E04 5249113} PAK i ) 149E05 944760} PAK 1 149E06 _ 3029737i PAK 30297371 149E07 42161 ; PAK 149E08 5 2270211 PAK - 0 149E09 ; 5661762 PAK 149E09 5661762 PAK ! 149EIl 5715245 PAK 149F02 2185216 PAK Aw 149F03 1068488 PAK 149F04 5657415 PAK ---r---5885039 149F05 58850391 PAK 149F06 3405166 PAK .......... 149F07 888188 PAK 149F08 j531458) PAK ! 149F09 1 3677847 PAK t 149F10 1 804821 PAK 149F12 4455163 PAK 149G02 3804648 PAK 1 49G03 ! 5200253 PAK 149GO6 39005381 PAK 149G07 t 5293179 ; PAK _ 149G08 3177097 PAK 149GO8 AK 149G10 T 51346201 PAK 149G11 ! 3348153 PAK 149H01 4108103i PAK 149H02 m PAK 1 49H03 i 4421910 PAK 149HO3 44 PAK 149H04"1768379J PAK ! 149H05 1 7803281 PAK 149H06'. 2021476ì PAK 149H07 X 4206245'j PAK r 149H08 ! 4370471 PAK j zs 149H10 ; 5178807 ; PAK _ 1 50A01 j 5482026i PAK 14513731 PAK 150A0 PAK j 150A06"354189 PAK j 2930587 PAK 1 SOA08 692780 PAK 15OA08 692780 PAK 150AO9 2548941 PAK 150A10 5075363 PAK 1 50A12 1209014 PAK 150B01 4353831 PÅK 150B02 083524 PAK l z 150B03 i 5642143 PAK s 150B05 1827578 PAK''. r-150B06 602828 PAK 150B08703522 PAK' "150B09 t2969682 PAK 150B11 4047635 PAK 150B12 16992, 0 PAK X 150C02') 67774 PAKi 1187780 PAK 150CO3 150C04) 2804482 ; PAK T<7 E 150C05 985330 PAK 1 50C06 4373. 139 PAK && 1 50C07 690165 PAK 1 50C08 1769816 PAK 1 50C10'5830882 PAK L 150C11) 5936353 PAK 1991158 150D01 2023091 PAK 150DO3 32021341 PAK 1 150D07 6195267 PAK 0 5 _. _. ; F- 1 50D10 186653 PAK 150D11 1429947 PAK 150D12 3963109 PAK 150E06 6097051 PAK 150E07615432 PAK 150E08 _ 1127784 PAK 150E09 ( 5892285j PAK 150E10 29331013 ; PAK ; 150E11 f'3642270 PAK J 1 50E12 1 20525371 PAK 1 50F01 621 9367i PAK 150F03 3034698i PAK 15OF04 58971981 PAK '150F06"'"""' !"""1804330'"'PAK. 150F08 29040661 PAK r.'150F09 ! 2735385 PAK 1 50F06 1804330 PAK 150F10 3196491 PAK 1 50F09 i 2735385 ! PAK 1 50F10 1 3196491 PAK -J50FH"""}"''934669 ! PAK'' 4516118. ! 150F12'4516118 PAK j 1 50G01 4560628E PAK '150G03 ! 4879694J PAK ! ____. __ x__. _. _. ___.. ____ 1282395 ! __w.. PAK-_.. _. 1 50G04 1 282395E PAK 1 50G06 3462131 PAK 150GO6 34132131 PAK !" 150G07j5747739 PAK) 150G10) 2925246 PAK ! E 150G11 _ 5554112 PAK 150G12 1259007 PAK 150H02 2337293 PAK -i50H04 1310689 PAK 1 50H06 2823453 PAK 151A01 2024252 PA01 s 1 51A04 5290020 PA01 t 151A08 2593196 PA01 . __. 151A12 1 1887414 PA01 151BOI 3956855 PA01 151B02 2769540 Paon x 151 B03 449667 PA01 151 B04 3314648 PA01 151BO4 PAOI 151B05 3266169 PA01 s 151B10 4326921 PA01 151C01, _3881730 PA01 __.-_ 151D02'4884235J PA01 J 151D03 5367474 ; PA01"J 151D05, 5734735 PA01 151D07 3507034 PA01 151 E02'451455 PA01 151E03 5648190 PA01 151E05 3435494 PA01 151EO9-2299548 PAOI 151E10 2529950 PA01 151F01 3368456 PA01 i 151F055416526 PA01 151G02 1077526 PA01 151G03 625714 PA01 151G05 1053513 PA01' 151GO7 3008268 PA01 151GO9 1195792 PAOI 151G10 2502271 PA01 i i 151G11 . 5721127 PA01 : 151HO7 2803218 PA01 151H09 PA01- __...... _.-, 152A02 L 4122428 PA01 1 52Ä04 270701 PA01 152AO2 4122428, PA01 270701 152A05T 1052246) PA01"J 152AO6 41016051 PA01 g 1 52A1 0 1 5821 35j PA01 152BOI 290650 PAOI 152BO3 3649040 PA01 152B11 33766915 PA01 1 52B12'603069 PA01 ' ! 5197602 PA01 152CO3 4890017 PAOI 1 52C05 2008645 PA01 152CO6 1601881 PAOI 152C11 5 2774001 PA01 152D02 3356924 PA01 152D08 5863981 PA_01 '152D10 5429316 PA01 1 152E01 4067073 PA01 I 152E03 4114598 PA01 1 52E05 2261801 PA01 1 52E07 5294995 PA01 152F01 3716487 PA01, 152F03 1618948 PA01 152fi9 1098937 PA01 '152F11 j3507034 PA01' 152GO1 1581482 PA01', 152GO4 53674741 PAO I 152GO6 11164421 PA01 j 152G075878443 PA01 ! 152GO9 5775034 PA01 152G11 l 1298017 PA01 1 52G12 14004511'PA01 152H01 5727451 Paroi 152H02 T1964590 PA01 j 152HO5 1798156 PA01 ; 152HO6 3861943-PA01 152H08 ( 258362 PA01 152H09 6125519 Paroi 1 52H10 2007157 PA01 1 53A01 1642376 PA01 1 53A02 3285673 PA01 1 53A05 58226855 PA01 5822685 PAOI 153AO5 153AO9 1582135i PAOI 1 53A10 1 60756171 PA01 Lu 153Al2 5583931 PAOI 153801 _1_ 1048428 PA01 15 869436 PA01 153B09'r'""5850910 PA01' 153B10 1 45158041 PA01 153Bll PAOI ______.... ^^_153C02 M 195328fii PA01 _ 153C03, _ 1001886j PA01 ""153C04 r1930152) PA01'" 1 53C05 i 12620993 PA01 "153C10" !""'"4155540 PA01'"""' 153Cl2 50874131 PAO 1 153D03 42760023 PA01 1 53D04 wor 1 53D05 ; 3020242 PA01 1 53D07'-67563 PA01 H 1 53D08 1 02538i PA01 t . 153D10 i 3177675 ; PA01"' ! , ["'"153D11""'j"1001886 PA01'. 153EO1 2978088 PA01 153EO2 5151949 PA01 153EO3 279820 PAOI .......... 1 53E04 3290328 PA01 1 53E05 3813760 PA01 153E06 1562159 PA01 ! 153E10 3808959 PA01 e i53FO3 1648474i 153F04 6057244 PA01 1 53F05 4921607 PAO 1 1 53F06 5045793 PA01 1 53F07 4007300 PA01 1562159 PA01 1 53F11 1 58052031 PA01 1 53G02 4926330 _ PA01 1 53G04 3 284033s PA01 153GO5 22387881 PA01 153HO2 58666301 PA01 153HO3 PA01 0933'J. r 153H08'j'6231871J'PA01 ! 1 53H09 62048151 PA01 153H10 2461359 PA01 r 153H11 5092983PA01 ! 157AO2 4884700 PA01 1 57A03 5975186 PA01 157A04 1908237 PA01 157A05 5958618 PA01 1 57A06 8244035 PA01 157A07 15858188_ PA01 157A08 ; _ 3818917 PA01 157AO9 47b366 PAOI 157A10 4551123 PA01"1 157All 273807 PA01 157Al2 1859426 PA01 157B02 5850794 PA01 j 157B03 ___ 2288861 PA01 r-157BO4 1 31166321 PAOI t_ I 157B07 j 3767294 PA01 ! 41241121 PAOI IIT'157B09"""T"'"""42573 !"'PA01" 1 57B1 i'50 PA01 ""157B11'J 2680259J PA01" 1 57C03 2980754i PA01 157C03) 2980754) PA01 157C05"'J'"5723459 !""PA01 157C06 ! PA01 1 57C07 500731 PA01 157C11'"404801) 1PA01 '157C12 5397714 j PA01 157D01572597 PA01 1 57D02 61 57015 PA01 157DO3 1448947 PA01 157DO5 3250646 157D07 3 4891764 PA01 1 57D08 1 4662342 PA01 s 1 57D09 4247751 PA01 1 57D12 17138281 PA01 157EO2 52599201 PA01 157EO3 13510431 PAOI 1 157E04 5823535 PA01 157E05"4980162 PA01 _H 157EO6 41870 PAOI ; 157E07 3504641 PA01 e 157EO9 10362081 PA01 157E10 1223356 PA01j 3 157F01 3179077 PA01 157F03 6205197 PA01 87FH a 157F07 _ _ 6108163 PA01 1 57F08 4046311 PA01 1 57FO9, 298662 PA01 157F11 1 5821324 PA01 P 157G02 5609452 PA01 3 157G_03 _ 5971194 PA01 oR 325611'PA01 157G06 3660559 PA01 157G07 , rv w 226728 PA01. 157GO9 1246547 PA01 < l 157G11 5887357 PA01 157G12 3418092 PAO'I ; 3304923 PA01 157HO ? 157H03 1 1126952 _ PA01 157H04 3461804 PA01 i v 157HO5 4153082 PA01 1 57H06-ra 157H06'5695631 PA01"1 1 S'U 1 1 7 3 w 157H10 3474932 PA01 ' 157H11 2024252 Paroi 158A01 6080414 Paroi 158AO8 5193409 PA01 158AO9 3678189 PA01 158A10 2526109 PA01 L 158A11 3 33802811 PA01 158Al2 2190466 ! i PA01 158B01'5321702 ! PA01 158BOl 3-217-021. PA01 158B08 i 381452t PA01 158B08 J 381452 PA01 : 1 58B 10 1 292665i PA01 PA01 158B11 _1 5712347'i PA01 158C02 i 3268192j PA01 '"I 158C05""j 4998604PA01'" 158C06 4514580i PA01 158CO5 49986041 PA01 }. 1 58C08 6241 384'j PA01 1 58CO9 i'5063251 PA01 158CO8 6241 158C12 i 597514 PA01 ) 158C12 597514 PA01 1 58D01 657988 PA01 1 58D02 5032955 PA01 158D03 4573441 PA01''. 1 58D04 4037942 PA01 !'158D05 3066722 PA01 i 1 3D07 7 s 158D07 813072 PA01 158D09 961771 PA01') 10 46038 PA01 158D11367607 PA01 j 158E01 5368567 PA01 158E02 5218504 PA01 158E03 5397714 PA01 158EO4 3483171 PA01 158E05""1290452J PA01) 1 58E06 3332267 PA01 158E07 1 4057053 PA01 1 58E08 i 2903436 PA01 158E09 3090784 ! PA01 tv 158E10 2022774 PA01 158FOl 5020600 PA01 156F02 1-3140135 PA01 158F03 1137141 PA01 j 1 58F05 T 1984077 PA01'i 158F06 5841792 PA01 158F086054284 PA01 1 58F09 231939 I PA01 1 58F10 5623913 PA01 158F12 365538 PA01 : 58303 2925319 PA01 1 56G05 t 77r PAD' 1965759-T-'I 158GO9 4424187 PA01 5949402 PA01 158G11 828727 PA01 _ _i 1758902 PA01 158H01 r 2850997 PA01 158HO2 46091561 59 MG1 r 158H03 j 3405846 ; PA01 ! 158HO5 2282871 PA01 1 58H06 {, 2850997 ! PA01 .. _. _. _t "158H07"j""5968219) PA01'""' 158HO8 31690451 PA01 mi 158H09'1"3225429J'PA01""" "158H10 !"2842829 ! PA01 158H11 i 2024252, PA01 159AO2 2670329'PA01 29600331 PAOI f v 159A04 3148519# PA01 v 1 9A06 4057053 PA01 1 59A08 2148180 PA01 ! 159A09357524 PA01 1 59A11 3357471 PA01 1 59A12 108054 PA01 159B04 2059801 PA01 159B05 1542567 PA01 sS s 159B06 1430926 PA01 t 159BO8 4250418 PA01 159B10 4257734 PA01 159B11 T 2385339 PA01 H s 159B12 1517113 PA01 159C01 573910 PA01 159C03 464333 PA01 159C04 j 2507094i PA01 159C05 3960045 PA01 159C07 60835251 PA01 159C08 408554 PA01 159C09 J"5768487 PA01" 159C10 968173 PA01 159C11 4099011 PA01 159CI2 889493 PA01 159D02 37420401 PA01 159D04 5156500 PA01 159D07 5958709 PA01 - 1 59D11 2420856 PA01 159D12'"1481549'PA01' 159E03 71951 PA01 159E06 1060979j PA01 1 59E07 1 838870j PA01 G1 159E10'6169036j PA01 159Ell 3380281 PA01 159E12 4321995 PA01_ 1 59F01 | 52599201 PA01 1 59F02'3650993l PA01 1 59F04 t 4276151 PA01 1 __ 159F05 4425275 PA01 159F06 1355033 PA01 159F07 1894788 PA01 159F08 1 29745210 PA01 159F09 1 3342162 PA01 159G01 il 1951933i PA01 1 59G04 i 4985650 ! PA01 159GO6 16366801 PA01 159G07 1024001 PA01 i59Go7 1 1024001s PA01 t 1 59GO9 sX 26008633 PA01 159G10 !"1019885 ! PA01 159G12 6178053$ PA01 1 59H01 8248983 PA01 e_ __ 2024291 s PA01 159H04 2024291 PA01". 1 59H05 j 2670329 PA01 3 159H07 i 9092231 PA01 gpjQg--"--6168577"PA01' 159H09 2337293 PA01 1 59H10 3474932 PA01''''--' 1 59H11 2024252 PA01, 3 940076 PA01 160A01 1 60A02 2887551 PA01 s 160A04 108053 PA01 i 160A06 255065 PA01 160A09 1403079 PA01 160A102080596 PA01 i 160A12 2479953 PA01' 160B02886880 PA01 160B03 6140782 PA01"* w z 160B04 15821341 PA01 1 60B04 Hj PA01 3 160B08__ _ 1405005 PA01 160B09'3773433'"PA01'"j | l - '160B10'771730 PA01 i 160B10 16OB12 11921001 PA01 wO9 957984i PA01 11508331 160CO4 160C10 19519343 PA01 7 ca H. WDF R t 160D03 3986008 PA01 ) 160D07'""1582134 PA01 160DO9 1789005 PA01 3 160D11 1 17041863 PA01 i 160D12 1 17834271 PA01 160E02 1 6260275 PA01 s 1 60E03 j 3022373 PA01 L 160E04 5891 106 PA01 160E07 2988351 PA01 s 160E09 1610535 PA01 160E10 112498 PA01 < PA01 ) 160E11 5981231 PA01 160F01 428867 PA01 i F 1 60F02 1942528 PA01 160F02 19425281 PAOI , 3 160F03 s 964609 PA01 160F04 x t 439014 PA01 160F06 1 1963010i PA01'. PA01 160F07 51770921 PA01 160F08 1 330279s PA01 !""""160F09 J5561460) PACT 160F10 1 1504725i PA01 160F1 1 28631761 PAOI 160F12 1 14057931 PA01 160GO4 58924481 PA01 j'160G05 1019886'PA01'""" 160G06 2702962i PA01 s 160G07 3706540 PA01' 160G09 _ : 1 60G09 3235122} PA01 160GO9 23372931 PA01 160G10 s 160G12 4884700 PA01 j 160H01""3767291 PA01 160HOI 37672911 PA01 1 60H02 439437 PA01 160H02 439437 PAOI 160H06 539660 PA01 160H09 5006039 PA01 160H10 4398438 PA01 m. 4 160H11 2024252 PA01 161A01 2789375 PA01 161A03 2658999 PA01 m 161A044001994 PA01 _ 161A05 5424453 PA01 161A07 2095679 PA01 161A07 2095679 PA01 161A09 58284 PA01 16IA09 58284 PAOI 161A10 3925556 Paroi X ; 7 ; T 1517114 PA01 161A12 1704186 PA01 i 161B01 6215279 Paroi '161B03 1420692 PA01 is 161 B04 4516554 PA01 , s _.. 162321 j PA01 161 B07 2835740s PA01 161BO7 28357401 PAOI 161 B08 53678301 PA01 5006037 PA01 161 B11 s 5529376 PA01 H_ PA01 161C01 | 818572 PA01 161 C023053943 PA01 ! 161C03 5368567 PA01 161C04853216 PA01 ! 161 C05 5395878 PA01 j 161 C06 5407090 PA01 161 C08 1 3997461 PA01'. 161CO9 5500201 PAOI 161C101219522 PA01 ! 161cil 3678583 PA01 161C12 3592235 PA01 1 161D02 s 18671421 PA01 161 D03 1 55293751 PA01 I 1314830 PA01 _... __.. _. _____161 __.... _..., -jg-jpQY---r--'6155451j ppi" 161 D08 4121641 PAOI r 161D10 i'738857 PA01'", 161D11 $ ; 1337553 ; PA01 _ 369507- PA01 161E01 ; 369507 ! PA01 161E02 l 47209868 PA01 F-1046904 PA01 161 E03 t 1046904 PA01 161E04' 6157015'; PA01 161 E07 ; 1740616 PA01 '; 161E08 1 4134183 PA01 -'"" 161 E08 4134183 PA01', 161E10 1 35056571 PA01 161E11 657988 PA01. '"161E12 !"4492441 PA01"1 re 161FOI 50574501 PA01 1458426 PAOI | 161FO5 5623913 PAOI 161 F06 4492441 _ PA01', 161F07 3266073 Paroi '161F08 j 386935 PA01-- 161 FO9 _ 5020603 PA01 Fll 5651280 PAOI 161G01 5540538 PA01 161G0362734 PA01 161G04 8916811 PA01 161 G05 5053679 PA01 0 k J 161 GO 43672731 PA01 161G07 3915718 PA01 _ 161G08 _ 41305091 PA01 161G10 1 891681 PA01 161G11 23349 PA01 161 H02 2758037 PA01 161HO4 16867601 PA01 161HO5 1813416 PAOI 161 H07 5718751 PA01 161H08 3647317 PA01 161 H09 2960217 ; PA01 161 HO9 ; 2960217. ; PA01 7 161HO9 29602171 PA01 162B01 1 26815131 PA01 j 162B02) 4199275 PA01 162bu9 41870 PA01 162BlO 4324206 PAOI 162B12 43291971 PA01 162C04) 331446 PA01 r z 7w. 162ClO 4200393 PA01 102C13 mi m 162C11 5058150 PA01 162C12928837 PA01 162DO4 4866383 PA01 162D05 1 2900660| ; PA01 162D06 4321996 PA01 162D07 1 20724321 PA01 162DO8 47457041 PA01 *"162D09 ! 366266 PA01 J 162Dl 1 20437851 ! PA01 162D11 ì 2043785 ! PA01 162D12 3019863'PA01 ' 162E02' 61916812 PA01 s wow 1 62E08 3634669i PA01 r 162E10 i 1740405jj PA01 162FOl 61780801 PA01 162F03 _- 545656_7j _ PA01 i"162F04 86151 PACT" 162F09 614801'PAOI 162FIO 13202321 PA01 i"'162G01 j 2013897 ; PA01 162G02 25496291 PA01 162GO3 5288830 PA01 162G04 3304923 PA01 1 62G06 4133455 PA01 162G11 1077252 PA01 f 162H01 3615173 PA01'; 162H02 5673778 PA01 S 162HO4 1906807 PA01 1 62H05 1223356 w 5 1 62H07 1 898995 f PA01 162H08 3053943 PA01 j 162H09 554266 PA01 _ _ _ _.-. _____ LYH 5254935 PA01 1 162H11 2024252 PA01 1 63A02 ffll 163A011389074 PA01 163A021450136 PA01 ! 163AO5 34613651 PAO 1 163A08 1885657 PA01" 163AO8 163B06 t 61933011 PA01.. 163BO8 427385 PAOI 16331O 6049867 PA01 s 1 63C05 2938842 PA01 P o 163C06 5251985 PA01 1 63C07 3367564 PA01 163C08 1 1959908| PA01 163C10 767555 PA01 163C12 _ 4371658t PA01 163D01 60614b3i PA01 m 163DO5 1021 PAOI 163D06 3460638 PA01 j 163D09 _ 1 6178946 PA01 163D10 1 300674 PA01 163D11 1185026 PA01 163D12 4371658jj PA01 163E02 3341290 PA01 163EO4 PAOI 163EO7 8946301 PAOI 1 63E09 | 36583921 PA01 163E11. 18624681 PA01 .'"""163E12""J""676520J"PA01"'"' "163F01 ! 5006037S PA01'" - gpOg--'j4615607J PA01'' 163E12 6765204 PA01 s 163F01 1 H-0-0t PA01 163F05 j 4615607 ! PA01 '"""163F07 j 6022307 !"PA01 163F08 {303673j PA01 1 63F10 l 5909814'PA01 163Fll 1320232 PAOI 163GO1 5605559 PA01 163G04 4042731 PA01 PAO 1 H M 3 163G05 4220190 PA01 1 63G06 6240253 PA01 163GO6 6 PAOI 163G08 1 714975 PA01 f J163G09 1557400 PA01 163GlO 3592227 PAOI 163G11 4437335 PAO 1 -A 0 1- 1 63G12 341023 PA01 163HO2 4517354 PA01 163H03 5942350 PA01 f 163H04 5043623 PA01 163H08 419887 PA01 163H09 4112926 PA01 164AO1 1423321 PA01 'UM2 2058994 71 164A03 5844539 PA01 j w 164A04 2412680 PA01 1 64A07 5220414 PA01 164A08 2152205 PA01 1 6M10 920155 PA01 1 64A11 9201501 PA01 164BOl 85315 PA01 164BO3 252365 PA01 164BO5 1022558-PA01 164B08 1655424 PA01 164B09 1137119 PA01 ! 164B10 1296762, PA01 164B11'''-1599165g PA01 164B12 3218774 PA01 1 64C01 52713651 PA01 164C02 6133958j PA01 164C03 5556276, PA01 164C04 4691547 PA01 1 64C05 _ 545692E PA01 164C06 1 _ 12907411 PA01 ""164C07'"5481297 PA01' ; 164C08 2684131 PA01 1B4C09 4521214 PA01 164C115768035 PA01 164D01 5721924 PA01) 164D03 1582132 Paon 164DO4 5040637 PA01 164D06 r 1429084 PA01 ! t___. _. __. __ _. _.. __.... _ 164DO7 26787-661 PA, 01 164D08 2626339 ! PA01 1 64D09 i 39799 ; PA01 164D10 L 4932888j PA01 _ 1 64E01 1 1 30348s, PA01 _ 164EO2 59030621 164EO3 8780141 PA01 164EO6 940747t PA01 _.,... _. ___. _. __... 164E07 599615 (_ PA01 T.... i_.. _. _ _. _ _ 164E08 1 5263348 PA01 164EO9 8946301 PA01 ts l 1 64E10 1906892 ! PA01 ; 164E11 1601881 PA01 164E12 2781791 PA01 1 64F01 5994594 PA01 L 164F03320752 PA01 j"164F05 4472097 PA01 I 1 64F06 5142000 PA01 164F09 946484 PA01 1 64F1 O v 164F10 5083277 PA01 164F11 5854455 PA01 164GO2 45512471 PA01 164GO3 3751362 PA01 1 64G04 5434902 PA01 164G05 | 1203434. PA01 164G06 1297547 PA01 164GO7 1152093'PA01 164GO8 55672761 PA01 , 164G09 1757420 ; PA01 164GO9 PA01 164G10 2300649 PA01 1 64G11 4810847 PA01 1 64G12 44403671 PA01 1 64H02 481393 PA01'. E 164HO2 481393-P-A--0-'l- 164H034284005 PA01 164H11 i 2024252 PA01 1 65A06 46183890 PA01'. 1 65A07 5694210 PA01 165AIl 761876 PA01 S 165BOl 32317371 PA01 165BO4 4047635 PAOI 165B07 3706869 PA01 165BO8 1139296 PA01 1 65BO9 3643355 PA01 [165B12 r"5653582 PA01 ! 165C02 __ 5694210j PA01 1 65C03 23990191 PA01 1 65C07 1 544808t PA01 L 165C07544808 PA01 j 165C08. 1711301 j PA01 ! 165C10 | 946484i PA01 165ClO 9464841 PA01 165C12 44403671 PA01 't. _. _.. 165D01 PA01Y... W... _ 165EO3 15307091 PAOI 165E04 1 2515739'PA01 165EO6 20242901 PA01 r'165E08 931505 PA01' 165EO9 660=566 PA01 19992031 PA01 165ElO _165F01 3979079 PA01 165F05 i 28377281 PA01 j_ Æo n PA01 _ 165F11 1 1351298 PA01 165F12 1470527 PA01 .. 165G02 7618761 PA01 !'"""165G03'"5033378 PA01 ! 165GO4 22828351 PA01 1 65G08 607160 PA01 165G09 1 954087 PA01 165G10 4870890 PA01 165H01 661998 PA01 s 165H02 2375963 PA01 r 1 65H04 _ 1746776 PA01 165H06 X 165H06 4749361 PA01"'1 3644301 165HO9 10788941 PA01 > p 165H11 2024252 PA01 166A02 3505585 PA01 166A03 6219617 PA01'' 166A041170196 PA01 j 166A052147215 PA01j 166A08 {5501093 PA01 1 66A10 4522687 PA01 H 166A12 1835685 PA01 166BOl 1 286580j PA01 1 66B03 1079350} PA01 166BO5 640385 PA01 166B06 6227025 PA01 166BO8 2906882 PA01 166B09 1974767'PA01 w 166B11 51239351 PA01 t 166C01 2668026j ; PA01 1 66C03 2570611 PA01 w 1655999 PA01 166C061115069 PA01 j 166C07 1 2024704 PA01 166C08 __ 5456821 PA01 ; i r'"166C10""'"5564061 PA01"1 j'166C11 6706861 PA01 | 166Cl2 323308 PA01 1 166D01 5559912 PA01 1 66D06 5050984 ! PA01 m-5, 7H, 7 e S -166D10 4589642 PA01 ! D1O wiS 1 66D11 i 4483454i PA01 _ _ _.. r.. 166EO1 1183788i PA01 H-E 166EO3 5449046 PA01 1 66E04 T 62270251 PA01 166EO4 62270251 PAOI 166E08''i 3306499 PA01 166EO9. 21734901 PA01 166EI0 5055881 PA01 _ t 4585465 PA01 1 66F02 4365789 PA01 -S 166F03 6228869j PA01 166F074 5770155 PA01 9 166F08 t 1927015 Paon 166FO9 i 4414026 PA01 166Fll 622095-PAOI 166F12 961274j PA01 ; ? 166G_03_ 1302068 PA01 166G03 1 1302068 PA01 "166G065698552 PA01 166GO6 5698552 166G09"5977582 PA01 166G11 6035646 PA01 1 66H01 1972286 PA01 t 166HO2 912492 5A 0 166HO3 2726657 PA01 w Mi 166H04 f 32142921PA01 J 166H06 5254049 PA01 166H07 2019843 PA01 i i 166HO8 44942271 PAOI 166H09 3986398 PA01 ! 166H10 i 2557656'j PA01 t 166H11 2024252 PA01 167AOI 177923 PAOI 167A02 3804716 PA01 .......... 167A04 i5118187 PA01 j 167A05 _ ( 659142 PA01 167A06'"""715509 PA01 1 s 167A07 5684985 PA01 167A08 2058994i PA01 1 67A09 _ 3955647 PA01 1 67A10 41 18673 PA01 167A11 17463641 PA01 167A12 18300691 PA01 167B04 49754651 PA01'i 5461641 PA01 167BO5 167BO6 3420969 PA01 167B07 5736841 PA01 C 167B08 4538762 PA01 j 167B09 3658392 PA01 167B10'2075793 PA01 167B11 43921051 PA01 167B12 167C02 | 377871i PA01 167CO3 3213694i PA01 ''167C04 801157s PA01 167C05 t 226076e PÄ01 167CO7 43675741 PA01 167C07- ! 4367574 PA01 _ Si 167C10 i 13837964 PA01 167CIO 167CI2 8144301 PA01 s 1 67D01 5357665 PA01 it 167D02 5026326 PA01 1 67D03 12204133 PA0 1 167D04 _ 35228871 PA01 167DO6 9124921 PA01 167D07 5032357 PA01 167DO8 632607 PA01 167D10 4299389 PAOI 167D11 5539080 PA01 167D12'16570831 PA01 1 67E03 678072 PA01 167E04 940619 PA01 s, 167E05 _ 5375361 P'A01 167E07 3627888 Pua01 167EO8 1962430 PA01 167E09 687550 PA01 167E10 5056159 _ PA01 r 167E11 5280103 PA01 v 167E12 170396 PA01 H 167F01 _ _ 228616 PA01 167F02"793590 PA01 167F03944736 PA01 167F05 1 7935903 PA01 # 1709171 PA01 167F08 480370j PA01 1 67FO9 m 167F10 5648183 PA01 167F11 3847279 PAOI 167G01""'4650013'PA01 167G02 5594460 PA01 1 67G02 5594460 PAO 1 167G03944736 PA01 s 167G04-j. 1050218 PA01 _' 0 167GO5 12278161 : # w3 167G06 _ 3464395j PA01 167GO7 52714011 PA01 s 167G08 _1 3213694 PA01 167G09 (4883121 (PA01 167G10 1574191 PAOI 167G11 t 1574191 PA01 167G12 3237341 PA01 3 167H01 1 16252711 PA01 167HO2 51894761 PA01 50025631 PA01 j167H04"j"376399 PA01 167HO4 3763991 PAOI r"'"167H05" !""2668026) PA01 : a -PA01 167H06 < PA01 167H07 s 4212283'PA01 167HO9 5936162 ! PA01 """"167H10"i95407 PA01"" __ 168A01, 54302191 PA01 168AO3 47398341 PAOI 'I 168A03 j 4739834 ! PA01'' 168AO5 22368961 PA01 166A06 3123552 PA01 168A11 s 355836 PA01 168901 9794s PA01 168BOl 979433 PA01 1 68B03 2694526 PA01 168BO2 19001101 PAdi 1 68B06 3374258 PA01 168B06 3374258 PA01 168B08 J1'566406 PA01 168BlO 1 1274045 PA01 _168C01 5547896 PA01 m ; 3 168C02 261377 PA01 li r 166C03 v 1151573, __ 168C04 3403335 PA01 168C05 229062 PA01 s 168C06 _ 1127986iS PA01 168C07 3036987s PA01 168CO7 30369871 PAOI ! 168C10 1 1343505 PA01 ; I u 34sSs P 3 168C11 1 2686627i PA01 ____ _ 168Cl2 PA01 j 168D014501410 PA01 168D02 19861051 PA01 168D03 , 1429084 PA01 168D05 48103591 PA01 48103591 168DO6 10183881 PA01 1 68D09 36592681 PA01'. 168D10 li 6198870j PA01 '-"""---6D11 j'-"'300674St PA01 168D12) 3072972 PA01 168E01. 5176497 ; PA01 i j I A01 168E02 5479579 PA01 168EO3 1011138 PA01 166E03_ 10 168E04 1772965PA01 1 168E06 43001301 PA01 H 168E08 2677709 PA01 168E09 5649789T PA01 L FO 1 r i 168F02 5000428 PA01 168F04 l 3659896li PA01 )'168F05 3698084 ; PA01'"j !''68F06 3979081 PA01 j ) 168F07 r 5919682 PA01 j 168FO7 5919682 PA01 168Fl 1 i 426001 PA01 ---T-1716600' PAOI 168F12 i 1716600j PA01 166G01'5583826i PA01 3 168G02 Di 5807299 PA01 . W__... _ ___---ì 168G05 ! 4680833 PA01 ii 168G06 i 6954313 PA01 168GO6 695431i PAOI 168GO7 20379791 PA01 168GO9 4529101 PA01 168G11 4138587 PA01 t 168G121572717 PA01 J 168HO2 3926327 PA01 168HO4 223060'PA01 168HO5 1988302 PA01 168H06 4320040 Paroi 168H07 3616674 Paon 168H09 Mol PA01 168H10 3474415 PA01 168H11 671637 PA01 - 169AO4 4401580 PA01 169A08 45914483 PA01 169AO9 5254049 PA01 169A11 657616| PA01 n ; 169A12 _ 4810359 PA01 169B01 5118186 PA01 169BO3 33838091 PA01 v 169B04 1963821 PA01 --A-0 1 169B07 3704053 PA01 169BO8 45854651 PA01 169B09 4118672 PA01 169B11 5159339 PA01 1 69B12 4596076 PA01 169F01 5282875 PA01 169F07 3988922 PA01 1 169F08 53102711-PAOI 169F11 4365789 PA01 169F12 3306499 PA01 169G02 4587769 PA01 ; 169G07 2116304 Paon 169G08 711492ii PA01 169GO9 j 5407752 PA01 169G10 547097 PA01 169G11365142 PA01 ! 169H01- % PA01 169H02 51493961 PA01 t 169HO3 1625271 PAOI 169HO7 5965717 PA01 169H10 1604979 PA01 W 169H11 671637-PAOI J 170A01 T 3882319 PA01 1 170A02 1427331'PA01 170A03J 1894542 PA01 170A05 48140771 PA01 1 70A06 f. 170A07 ! 47961251 PA01 oj PA01 170A08) 2147214J PA01"" -""170AQ9268244 !"PA01'" 170A10 ! 18988338 PA01 -'-PA01 170AI 1 52569331'PAOI 1 70A12'1021 792i PA01 170A12 PA01 170B01 L 28922011 PA01 170B02 315272'i PA01 1 70B03 1 3327835} PA01 170B05 50069761 170B06 1641307 PA01 170B07 1818388 PA01 170B08 3264426 PA01 l G H. 1 70BO9 1567960 PA01 170B11 1327867 PA01 170B12 1064475 PA01 170C01 4627156 PA01 170C02 5773359 PA01 1 70C03 316557 PA01 G G 170C04 _ 93744 PA01 170C065820044 PA01 G G G 170C07 3295709 PA01 1 70C10 1482922 PA01 170C11 2122537 PA01 170C12 1 026922 PA01 170D01 _ __ 632299 PA01 _ 170D01 632299 PA01 170D02 603202 PA01 170DO2 603202 PA01 170D03 316557 PA01 170D04 141279 PA01 170DO6 70D06 5210498 PA01 170DO8 1263671 PA01 170D10 5098394 PA01 170E01 5646839 PA01 G o 170E02 417042 PA01 1 70E03 5005306t PA01 - _ 170E05 5263318 PA01 170E06 3565815 PA01 G G 170E07 5254049 PA01 170E08 452551 PA01 170E10 323308 PA01 oG G G G G 170E11'i 5032357i PA01 170Ell 5032357 PA01 170F02 4489897 PA01 170F03 1830069 PA01 170F06 4559762 PA01 762 H G 170F09 2025751 PA01 170F09 2025751 PA01 170F10 5186394 PA01 170F12 t 42565701 PA01 0 170GO1 49906651 PA01 1 70G02 dE r '170G05')"4736296 !'"'PA01"""" 1 70G06 1 3974627i PA01 170GO7 9667351 PA01 170GO8 30468251 PA01 170GO9 861892 ! PA01 1 70G10 i 2661773 PA01 1 70G11 3047204 PA01 170G12 _, i. _ 918545s PAO_1_ry... _... _. 1 70G12 91 8545if PA01 1 70H03 2976291. ; PA01 ii 1 70H04 < j"170H04 1"478669 ; PA01'" '--F-61523211 PAOI 170H08 34043f PA01 !"'"'170H09"i'"'"5930686'PA01""" b tn 170H10 1 4786074 PA01 171A01 5515089 PA01 171AO7 203394, PAOI r"171A09 2729734 PA01'" 171A11 5184209 PA01 171BOl 3505585 PA01 171BO2 A01 171BO3 3203982 PA01 171B04 3258876 PA01} 171 B05 362761 PA01 171B07 6104962 PA01 171 BO9 37, 39434 PA01 171B11 | 110478 I PA01 171C01 397111 PA01 H < w 171 C03 4657805 PAO 1 171C04' 5415103 PA01 171 C05 4917936 PA01 171C06 30916591 PA01 171 C07 3572626 PA01 Di 171 C09 2931077 PA01 171C10 6123879ff PA01 fi 171C11 j 1129976 PA01 Pl 171 D07 6050836 PA01 171D10 5165457 PA01 171D11 1444725 PA01 ! 171D12 3293888'PA01) 171E01 5530237 PA01 171EO4 747510 PA01 171 E12 5201685 PA01 f 171 F06 1660413 PA01 171S _ 6 PA01 171F08 10070581 PA01 171 FO9 709828'f PA01 fj 171F11 5913087 PA01 --l f ' 171G01 1 54854751 PA01 171G04 4853308 PA01 ! f171G05 5956461 PA01 1 fo 1562289 PA01 171GO7 5685021 PAOI fi 171G07 j 56850211 PA01 171G08 i < PA01 . _.. _. _____ 71 G09. ... __. w_.. _ _. __. _. ___ 3636699 ;.-. ____ PA01.. ___.... w_ 171 G'l 0 5632974= PA01 171 G10 1 5632974'i PA01 i _ 171G11 1375885 PA01 171H01 5291470is ; PA01 171HO2 26314461 PA01 "i. 171H03 4650014 PA01' ; ""171H04. j5906182 PAOl"' 171H06 1452418 PA01 , ; 171H07 ! ; 833297i PA01 171H08 833297'""pAOl"'" 171HO8 7608001 PA01 171H09415390PA01 171 H10 5456821 i PA01 671638 PA 1 72A01 401 5252i ; PA01'i 172A02 5433569j% ; PA01 X 172A04 4673714 PA01 172AO9 272981 PA01 172A10 1188378 ! PA01 ws 172AI2 62422381 PA01 172B04 2288870 PA01 172BO9 6072616 PA01 172B11 2333501 PA01 - 172B12 304311 PA01 172C01 1 2898525 PA01 172C04 940619 PA01 v 172C05 3979079 PA01 - 172C07__ 3979079'PA01 _ 172C09 5407752 PA01 172ClO 3954605 PA01 172Cl2 142332 PA01 172D01 5431716j PA01 172D02 5254106 PA01 172DO2 172D04 7674611 PA01' 172D05 3805104 PA01 s 172DO9 2345056 PA01 172D10 _ 3076721 PA01 172D11 2538241 PA01 ii H 172D12 2538241 PA01 172E01 5803364 ! PA01 1 72E07 1 269623'i PA01 172E08 5300630 PA01 172E09 4501878 PA01 172E12 5456928 PAfl1 172FOl 3608762 PA01 172F03 ii 28531171 PA01 172F08 6193201 PA01 I 172F09 5594460 PA01 172F101274507 PA01 172Fll 5705812 PAOI 172GO1 938940 PA01 172GO2 3835227 PAOI 172G07 ; 411726, PA01 172G08 r 3515481, ; _ PA01 172G09 ti 5373814 ! PA01 !"'172G10 s332444I"PA01 f'172G11 4257085 ! PA01" LIL-172G12 974001 !''PA01 ''172H03 j4485523 ! PA01 172HO6 2380377 ! PA01 172HO8 13837961 PA01 r"172H10 2025751 PAOl''' 20257511 PA01 172HIO 173A01 4607711 PA01" 173AOI 4607711 L 173A02 1104569 PA01 J 173AO3 1835685 PA01 ! 173A04891689 PA01 173A05 4741858 PA01 173A06 5764636 PA01 173AO8 : DA01 173BO5 5358757 PA01 173B06 1 1987056 PA01 173BO8 5768034 PA01 173BO9 36968701 PAOI 173B09 1 3696870 PA01 H 173B11 61 18108 PA01 173B12 3875131 PA01 173C01 6226412 PA01, ; vw 173C03 1382220 PA01 173C04 5163874 PA01 173C05 4284077 PA01 s t 173C06 _ 5721924 PA01 173C07 T 149820 PA01 173C08 if 918947 PA01 ; 173C09 2686824 ; PA01 -i i 173C10 4366772 PA01 173ClO 721 173Cll 2558353 PA01 1 73D03 1894540 PA01 173D041278473 PA01 1 73D05 183006 PA01 1 73D07 1963822 PA01 173D08 6200971 PA01 173D12 1439067 PA01 173E02 1103071 PA01 -wt s 173EO4 42103331 PA01 _ 4898212 t 173EO6 4834919 PAOI 1 73E07 41 6132 PA01 173EO8 PA01 il-l l 173E09 3474415 PA01 ! g 173E12 4664571 PA01 173FOI 3263727 PA01 173FO2 5449046 PAOI ! 173F03 2726108 PA01 j _ 173F04 w j 5672632 ; PA01 ) 173F05'T' 953252 ; PA01 1 173F05 i 953252j PA01 f, 173F06 i 5584391i PA01'i "173F07'j 223060, PAD1 j r'"""173F08 = 4047002'PA01"" 173F09 i wL PA01 173F10 1 1971286 ; PA01 173FI 0 19712861 PAOI 173F11 T 3521422 PA01 173F12 120795 PA01 173F11 !"3521422 ! PA01" 173F12. ! 120795 PA01 173GO1 14341301 PA01 173GO4 60508381 PA01 F,.... _.,....- = 173G07 s 1291331| PA01 173GO7 i 1 173G09 55562781 i s 173G10 59870631 PA01 173HO2 1416748 PA01 173H04 3597983 PA01, j 173HO4 I 173HO5 40801351 PA01 173H062797587 PA01 ! l 173HO7 36251661 PA01 173HO8 52732921 PA01 174A05 4834919 PA01 1 74A06 3393156 PA01 174AO7 10023901, PA01 174A08 5530237il PA01 s 174A106219617PA01) S 174A11 1781790 PA01 j S oi 174A12 4392105 Paon 174B01 i 6193301 PA01 x 174B02 T 338950 PA01 174B03 547097 PA01 -w 1 74B04 3578842 PAO 1 ; 174B05 j 3613401 PA01 ; 174BO6 1370522 PA01 174B08 i 4392178i PA01 ----23803771 174BO9 PA01 s 174B11 i 5101927 PA01 t w t 174B122136510 PA01 -. 174C05 3062996 PAD1, s 174C06 4810359 PA01 174C07 3462288 PA01 1 74C08 5214226 PA01 174C09 6193301'PA01 174C11 1 15132431 PA01 , 174D01 6194108j PA01 & s _i 174D043804716 PA01 174D06 34043 PA01 1566405 PA01 j 174D08 j"489696 PA01 174DO9 2152205 PA01 174D10 2136510 PA01 174E0260106 PA01 "174E06"'1878481) PA01 174EO6 s 174E09 1 663176 ! PA01 174EO9------631-7l PA01 ii 1 74E11 5j 1 296762'i PA01 174E12 ! 3053978 ! PA01" ! i74FO2 í. 0t PA01 174F03 {1Q44464 pA01 44203221 PA01. "174F05') 5183351 PA01' 174F06 5447669 PA01 174FQ7'j 3757343 PA01" . 174F08"j"719830 PA01""" PA01 r 174FO9 ss6a4ss PA01 5968489 PA01 174FIO 554927 PAOI 1 4GO 311 5342 PAO 1, ? 174GO2 1991177 PA01 1 74G04 5472978 PA01 1 74G05 894630 PA01 174G08 5382429 Paon 174G10 5 6108965 PA01 9 j 174G11 1 3201319 PA01 1 74G12, js 21 36510 PA01 1 74H03 s 5062705 PA01 s '174H08 1452418 PAO'I 174H095256933 PA01 175A01375528 PA01 L 175A02 1170196 PA01 175A03 5002041 PAOI 175AO5 5472979 PA01 iX i 175A07 3323326 PA01 1 75AO9 361 5180 PA01 1 ___ _. 1 75A10 _ 5509978 PA01 175All 4591448 PA01 175B012693035 PA01 175B04 1044754 PA01 175B05 6242239 PA01 175B08 5697208 PA01 175B11 290549 PA01 ; 175C02 5964853 PA01 175C03533560J PA01 ! s s _1_75C04 1715494 PA01 175C05 1082558 PA01 175C06 961274 PA01 ! 175C07 5728050 PA01 r 175C083690651 PA01 ! 175C10 4138587 PA01 ! 175C11 4691547 PA01 175D01 3218918 PA01 175D03 5515089 PA01 175D041530709 PA01,' 1 75D05 v w !'175D05 4998867 PA01 j 175D06 5692569 PA01 j s 3400008i PA01 r 175D08 670970i, 1'A01 , ____.. ___ _. _ ___ _. _.. ____.. __. ___. _.. __ 175D10'. 2042245 PA01 175DI 1 2042241 PA01 r 175D12"J''''5026326 PA01' : 175EO3 18527181 PA01 175EO4 1045997 ! PA01 175EO5 46737141 PA01 ; 175E07 55973 _P_A01, ! . 175E10'j 2122725 PA01 *. 175E12 5 _ 2000354 PA01 i 175F01 P'2089460 PA01"' : ; _ _175F01 2089460 PA01 175F04 175FOI 4846618 PA01 j 175F05 175F07 1 34940925 PA01 j 175F08 5764636} PA01 175F09 _ (3560813i, PA01 175G01 544809 PA01 wN 175G02 4100725 PA01 175GO2 4 r 175G03 5 709828T PA01 175G04 i 47269095 PA01 175GO4 47269091 PA01 1 75G06 2471654 PA01 5 1 75G09 4657805 PA01 175G10411276 PA01 H 175G11 3560822 PA01 1 75G12 261377 PA01 5 175H01 ~3 PA01 1 175H03 3889588 PA01 m7r j 3385881 PA01 175H08 1278969 PA01 176A01"'5476139 PA01 1 76A02 5 2300649 PA01 v v _ 176A03 5948328 PA01 5 176A04 980186 PA01 f S i 176A06 t'5702294 PA01 176A10 1288870 PA01 176A11'3166359 PA01 176A12 3026526 PA01 176B03 974003'PA01 176B04 3434144 PA01 176BO6 189496 PA01 176B07 2658326 PA01 176B091672877 PA01 176B10 4156563 PA01 ; 176C01 3624552 PA01 176CD2 _ L 176C05 39970391 PA01. 5 176CO5 39970391 PA01 176C06 13123971 PA01 176C07 2420191 PA01 176C08 4600725 PA01 - v va ''176C09'5361094 PA01 176C10 5746383 PA01 L < 176C11 5 6021128 PA01 '176C12 948082 PA01 L_____ ___. _. _. ____.. L_.... _.... _. _... _... __, 176D03, 8916895 PA01 44343971 PA01 176DO5 3981911 PA01 176D07 ! 5029046j PA01 176DO7 50290461 PA01 , 176D09' ! 5728050 PA01" 176DO9 57280501 PA01 f 176D12 j 2684131 PA01. L.-176E03 j 4251143J PA01' 176EO4 23120231 PA01 ! 176E05'5201820 PA01 1 5 176E06 _ 7 PA01 176E11 g 25163865 PA01 T176E12 ; 551781 PA01 _ 1 76E12, 5 551781 PA01 176F01 4748413 PA01 176F03 5565126 PA01 176F04 5867397 PA01_ 176F05 616890 PA01 176F06 4531158 PA01 W 176F08 2007205 PA01 176FO9 1851568} PA01 176F10 5501548 PA01 1 6208257 PAOI l ww 6208256 176G01 2705050 PA01 176G02. . 2282835 PA01 1 76G02 2282835 PA0 1 H 176G06 824096 PA01 176GO6 824096 PA01 176GO7 4810359 PAOI 176G10 5375334 PA01 j 176H01 4234156 PA01 176H02 6178521 PA01 176H04 2408884 PA01 1 76H06 22589325e PA01 176H10 48410305 PA01 176H11 1548917 PA01 i l 177A05, 2322366 Pua01 177A07 5931558 PA01 ... _... _ 177B06 1963063 PA01 m 177B07 3123552 PAOI am 177B08 1029251 PA01 177B09 1574191 PA01 l 177B10 1802886"'PA01) 177B11 j 5321517j PA01 5 177F08 j 6232610 PA01 177Fll 48669601 PA01 1 77G07 r w PA01,. 177G11 1 5086573j PA01 177G_12 624224 PA01 ; 177H05 1991177 PA01 177HO8 1306839 PAOI t 177H10 1 4350073, PA01 177H11 j 61228411 PA01 178AO1 2661771 PA01 ....... ........ i963822r'PA01'"" 178AO4 6762671 PA01 7, 178A04 i 676267i PA01 178A05 t 19638191 PA01 178AO6 55598901 PA01 __ 178A07 1491198 ! PA01 178A09 1 5981344. PA01 Z 178A10 i 53195235 PA01 ! 178A11 2322698J PA01 178A12 5, 6133959i PA01 178B03 7842775 PA01 178B04 31161731 PA01 178BO6 36104211 PA01 . . f. __..... » ,. rt 1 78B07 1 7935905 PA01 178B08 1064932 178B10 3922167 PA01 178B11 5174040, 5 PA01', b lX 178C01 T 3876264 PA01 178C02 4348968 PA01 178C09 5913087 PA01 ; 178C12 4794311} PA01 3 178D03'4488316 PA01 s 178D06 1151572 PA01 178D08 4134534 PA01 178D10 1289165 PA01 178DIl 2215589 PAOI 178D12"'4002033'PA01 ! 178E01 5667218 PA01 178E10 1382221 PA01 5 178E11 2734809 PA01 178FOl 9087971 PA01 178F02 paroi 178FO2 178F03 52947361 PA01 5 178F04 17707091 PA01 | 1 78F05 553937 PA01 178F07 _ 5729721 PA01 1 78F08 6130445 PA01 | . 178F10 4864670 ; PA01 178F11 1535897 Paon 178F12 | 51553661 PA01 178GO2 60588641 PA01 178GO4 3688998 PA01 178G05 5488437 (PA01 178G07 1 51266963 PA01 178G08 5247546 PA01 178G09 i 54499135 PA01 3 178G10 3208354 PA01 ____ t 178H02 5294020 PA01 178HO3 1261827 PAOI 178H04 4870724 PA01 178H05 105482 PA01 1 78H05 1 1054821 PA01 5 3 178H07 2780078 PA01 178H08 J 4213280 PA01 178H09 5 3612678Z PA01 178HO9 126781 PA01 178H10 5970802 ! PA01 ;"'178H11 r"553937 ! PA01" PA01 182A01 J 1428840 PA01' 182A02 2652983 PA01 t'182A03 ! 729799 PA01 ! 1 82A03 t'729799 PA01 182A04,. 5 954087 PA01 182A05'j 2356388f PA01 j'"182A06"""5422237 PA01" 1 82A07 5930881 PA01 182A08 i 16278435 PA01 182AO9 10735731 PA01 182AI0 4627156 PA01 182A11 4455075 PA01 182Al2 3066338 PA01 1 82A12 3066338 PA01 1 82B01 6 5AoC 182B02 1005515 PA01 3 182B03 4490119 PA01 182B04 2408226 PA01 182B05 5476139 PA01 182B05 5476139 PA01 5 1 82B06 5 5188479 PAOß 182BO7 3577840 PA01 w 182B08 3115342 PA01 182BO9 2420143 PA01 v 182B10 3201337 PA01 1 82B11 66056 I PA01 182B12 272611 PA01 182C01 2504200 PA01 182C02 4080366 PA01 X 182C03 3804716 PA01 |- 1 82C04 46271561 PA01 __182C05 5730055 PA01 _ 182C06 j 5831252 PA01 182C07 3153882 PA01 1 82C08 4257084 PA01 182C09 1912838 PA01 182C10'""3231739'PA01 182C12 2963758 PA01 182D01 5441160 PAOI l 4 182DO2 5707062 PA01 1 82D03 1 16748005 PA01 182D041604979 PA01 J 182D05 3653147 PA01 j 182D06 5005306 ! PA01 j 1 82D07 ! 32588765 PA01 5 1 82D08 1 61894461 PA01 182D10 1 4008708'PA01 182Dll 2658326 PA01 _I 182D12 4161229 PA01 ! 182E_01 _ j _ 5086573 PA01' 3 1 82E03 i 2888325 PA01 3 4233110 PA01 5 1 82E05 5r 1753681 t PA01 182ex5 1753681 PAOI 182E07 51 59315581 PA01 182E08 j 3197084 PA01 f'"182E09 3115342 PA01'i 5 182E10 | 188226515 PA01 182ElO ! 2971537PA01 182EI2 5508537 PA01 1 82F01----5*--al PA01 182FOl 5901481 PA01 so 1 82F03 5 5913087 PA01 182FOT----, ' 995424 PAOI 182F05 2915395j PA01 182F06 3804716 PA01 182F07 5806839 PA01 182F08 5295342 Paon 1 82F09 2479696 PA01 5 182F12 6208260 PA01 182G011345184 PA01 182G02 2668026 PA01 182G04 2844615 PfAO'I ! 182G053090579 PA01 182GO6 18145611 PA01 15665491 PA01 182G091526024 PA01) 3 182G10 1BBZ65 PMa 182G113383809 PA01 j 182gel2 182HO2 5289018 PA01 182HO3 5633947 PAOI 182H04 1293986 PA01 j 3 1 82H06 3479637 PA01 182H08 199249 PA01 1 82HO9 w0-E PA01 182H10 (1011868 PA01 ! 182HlO 1011868 PA01 i 183A01 5 940611 PA01 183AOI 940611 PA01 183AO2 4585465 PA01 183AO3 1462511 PA01 j 183A04 5509978 PA01 ! 183A05 45943141 PAOI 183A06 _ 4157011If PA01 3578834 PA01, 1 83A08 29960871 PA01 183A09 5736496 PA01 lo 4597353 PA01 183A11 4417872 PA01 183801 3904412 PA01 183802 1 6037542 {PA01 3 183803 2300649 PA01 183B04 1 113711B3 PA01 t 3 9 183BO5 40801351 PA01 183B06 ! 4177707 PA01) 41345351 PAOI 183BO8 9406111 PA01 183BO9 16278431 PA01 , @ 183B10 L 3117862i PA01 183B11 T 2317876 PA01 184A02 2051514 ! PA01 J 184A03'"j 109116J PA01" 184A04 588504J PA01 1 84A05 712594 PAO 1 184A061843818 PA01" 1 84A07 32211 94i PA01 184A09 450677 PA01 1 84A11 4382673j PA01 184Al2 1429515 PA01 m 184BO2 1075520 PA01 184B05 4832027 PA01 _ 184BO6 3175439 PAOI 184B08 5031738 PA01 184B10 | 5820044 PA01 184B11 54537 PA01 4 3 184B12 5032227 PAO'I 184C01 1064475 PA01 184C04 442247 PA01 184C05 4138587 PA01 184C06575242 PA01 W 1 84C07 3494091 PA01 184CO9 1256610 PA01 184C10 2215589 PA01 1 84C11 | 5807299 PA01 184C12 5774878 PA01 184D01 2641137t PA01 184D02397420 PA01 --. _.. 1 84D04 1 1865221 PA01 J 1 84D05 5082225 PA01 184D06 5008341 PA01 1 84D09 2858100 PA01 L 1 84D10 4990665 PA01 184D11 1638651 PA01 8 184D12 818865 PA01 n 184E01 5939634 PA01 1 84E02 2477596 PA01 184E034704214 PA01 j 184EO4 4432254 PA01 184E05 _ _ 1675650 PA01 j C 1 84E06 1 10706761 PA01 184E07 1138633 PA01 184E08 2981764 PAOI 184E10 5123392 PA01 184EIl 112440 PAOI 184E12 1 5759817i PA01 f J 184F01 5165608 PA01 1 184F02 1 5211233l PA01 1 86C02 a 3292647T PA01 1 1 86C03 3237390 ! PA01 __. . 186C04_ ; _1184851 ; PA01 186C05 j 3565815 PA01 .... ggpg--1897572'"'"'PA01'"" 1 86C06'897572i PA01 186C07, 1104569j PA01 186C08 _ I 94180 ! PA01 186CO6 PAOI 1 86C11'41 5374T PA01 186D01'"'"t'2409164S"PA01""' ! 186D03 j 1665013 PA01 ii--i 186D04 2712102 PA01 1 86D05 | 38096831 PA01 186DO5 38096831 PAOI PA01 186DO8 5140311 PA01 1 86D10 5366890T PA01 C C 1 86D12 5919321 PA01 1 86E02 1635441 PA01 186EO4 394454 PA01 w 186E052356388 PA01 s b t 186E06 998878 PA01 186EO7 3997039-PAOI |i 186EO8 4201186 PA01 tu 1 86E09 1568877 PA01 186EI0 5319920 1 86E11 4283770 PA01 r 1 86F01 250486 I PA01 186F02 __4194427 PA01 w n <09 PA01 T 186F06 i5526603 PA01 186F08"") 5915708 PA01 i 1 86F09 | 2837048 PA01 T 1 86F10 547097 PA01 186F11 3329714 PA01 186G01 1133808j PA01 186G03 944073i PA01 186GO4 50004281 PA01 186G05 T 3218919t PA01 f 186GO6 10225091 PA01 186G07 4501878 PA01 186GO9 4910846 PA01 186G112026225 PA01 j 186H01 3269233 PA01 a 186HO3 4335652 1 86H05 ! 4627085 PA01 186H06 489696 PA01 i 186HO7 3288834 PA01 186H08514030 PA01 ! 186HO9 1262980 PA01 1 86H11 ì 4456344i PA01 1 87A01 1 53587541 PA01 ' 1 87A03 T 35277081 PA01 187AO6 27982121 PA01. i 187A07 j 3643734 PA01 ; 1 __ _. __. __ _ _. ____. _ __. e :"'""187A08'r""'"3169709' ! PA01'" 187B02 i 12482041 PA01 1 87B03 ! 620033i PA01 187BO5 1672871 PA01 ! PA01 187BO6 187BO9 207028§1'PA01 1 87B09 _SL PA01 ;'187B11 6122838J PA01 r'"''187B12''" 1425075 ;'-p-' f 187C04 2893369 ! PA01 187CO5 4194335 PAOI L-187C08 558371 PA01' 1 87C08 558371 PA01 w 187C09 ; 1630609f PA01 L 187C11 5725265ì PA01 187D04 2080505j ; PA01 1 87Do8 4704465 PA01 187D10 171220 PA01 187D11 359303 PAO_1 187D12 565772 PA01 s 187E01 3036987 PA01 '187E04"4875866 PA01 187E06 2116304 PA01 187E09 i 1712201 PA01. ! 187E10 4826613 PA01 187E12 1641218 PA01 187F06 4846617 PA01 ..........--- ! 187F0_8 4280266 PA01 ; L 187F09 306705 PA01 1 87F11 5282097j PA01 W di 187GO1 5754589 PA01 187G02 5983927 PA01 187G03 2686946 PA01 187GO4 PA01 1893427 187G07 4047635 PA01 187G08 6112599 PA01 S 1 87G09 5054289 PA01 1 87G11 2333501 PA01} 187H01 1166301 PA01 l m 187H03 14625111 PA01 187H04 804767, PA01 187HO5 4210666 PA01 187HO7 4047636 PA01 1 88A05 397380 PA01 188AO6 1660313 PA01 188A09 1 1296762ii PA01 188A111974767 PA01 188A11 1974767 PA01 188A12 i 2916631j PA01 188B01 4998865 PA01 --i 188BO2 1842339 PAOI 188B04 3508767 PA01 188B05 62407351-. PA01 l 1 88B05 1 6240735 ! ; PA01 188B06 4856918'; PA01 188B07_, _ 1837677 PA01 _ 188608 56485171 PA01 , 188B10 _2 5358757 ! PA01 188B11 1832265 PA01""" 188B12 1858598a PA01 1 88C01 4055589 PA01 188COl 40555891 PA01 188CO2 3918104 5A-O 1"- 188C03 370932 PA01 188C04517029 PA01 vi 188C05 1078894 PA01 188C06"2375365 PA01 1 88C07 6155862 PA01 1 88C08 17729651 PA01 1 88C09 1 5742183 PA01 3213 PAOI 188C10 3213549 PA01 ! ; 188Cll 3893453 Paon '188C121381577 PA01 PA01 j 188D01325965 PA01 iw : 188D02 49021 10 PA01 188D03 2412680 PA01 i 188D03 2412680 PA01 188D04 5508400 PA01 j 1 188D05 789435 PA01 , 3 188DO6 14290841 PAOI 188DO7 i5764162 ! PAO 1 188D07 5764162 PA01 1 88D08 5062994 PA01 1 88D09 63823 PA01 1 88D10 321 7315 PA01 188D11 1'3975557"PA01 188D12 5358757, PA01 188E01 j 34796371 PA01 1 88E02 1 47445391 PA01 i 188E03 1601421 PA01 1674800 PAO 1 1 88E05 4821722 PA01 w 188EO6 5126695 PA01 -. . 9 - 1 88E07 5729357 PA01 188E08 2437187f PA01 ; s 1 88E09 5597084 PA01 188Ell 40803661 PAOI 188FOl 45810561 PA01 188F02 6139211 PA01 188F03 14520811 PA01 188FO4 4435277 0 1 188F05 1006391 PA01 188F06 5424187 PA01 188F07 623372 PA01 ; _ 188F08 _ 5919681 PA01 188FO9 2472466 PAOI 188F11 12 6 PA01 188Fl2 9332811 PAOI ! 188G03 [' 2097505 ! PA01 391420 m...., 188GO5 48450871 PA01 ___.. ... 188G05-.-.. _ __.. _. _. _. 4845087 ; .. PA01 1 88G06, _ 5699954 ; PA01 ''88G07' !' 1919371 : PA01 188GO8 36592681 PA01 188G09 1 490i4491 PA01 "188G10"""r 1022558 ! PA01 188G11 2125613, PA01 188gel pua01 188HO2 1365594 PA01 188HO3 1924832 PA01 188HO4 5776167 PA01 1 88H03'1 924832t PAOi 188HO7 5764951 PA01 188HO8 9958371 PAOI j 1 88H07 T _ PA01 188H08 7 9958374 PA01 1 88HO9 420238 PA01 9'0 1 1 188H11 4835152, PA01 1 89A02 2683697 PA01 189AO3 2204091 189AO4 6135875 PAOI R 189A05 2686275 PA01 189A07 5824535 PA01 189All 413341 PA01 189A12''658522 PA01 ! 189BOI 3209115 PAOI t 189B02'] 4210333 PA01 : 189BO3 50389331 PA01 189BO4 3760820 PA01 189BO6 377871 PA01 189BO7 4673714 PA01 _ 189BOS _ _ 4066923j PA01 _ i 189B09 5554732 PA01'1 189B10 4566265 PA01 189B11 5247554 PA01 1 89B12 46271 56i PA01 1 89C01 399648. PA01 o 189C02 1 50333771 PA01 189C03 2367412 PA01 1 89C04 1 1878482 PA01 189C05 5282594 PA01 189C07 (. _. _. 6108965 PAD1 1 89C08 _ 323309 PAK 189C10 5184209 PA01 , 189C11 1 365296 PA01 189D01 3329714 Paroi 189D02 _ 3203981 PA01 ; l l-wi 1 89D03 | 5530237 PA01 189DO5 59306861, PA01 1 89D06 i 27306071 PA01 189DO8 5112721 PAOI ...................., .--.-..... ...-.--5254058 !"PAO'1 ; 1 89DO9 i 5254058'; PA01 189D10'4368761 PA01 189D11 4064352 ! PA01 . O 1.. _ _ _... __, £..... _.. 189DIO 4368761 PA01 982332 189E06 PA01 - _ 2 __.. 189EO6 9823321 PA01 . 189E09 1562289J PA01 189E10-.... ___ __.. ___. _. _. .. ..-_.- 189ElO 24402011 PA01 4819723 189Ell PA, 01 1 89F02 4800094 PA01 o 9tH -g 1 89F04 5994593, ; PA01 189F08 189670'PA01'"j 189FIl 5087607 PA01 189GO1 5042230 PAOI 1 89G02 4834919 PA01 189GO3 1075520 PAOI 189G04 3327837 _P_AO_1 , 4 3327837 PAOI 1 89G05 1569993 PA01 189G06 168446 PA01") I- 189G07 j 4488 PA01 Sl 189G08 3814644 PA01 189G09 4834919 PA01 189G115913088 PA01 ! __ _ 'ì 1 89G12 1300919 PA01 1 89H01 348990 PA01 ' 1 89H02 2975145 PA01 1 89H03 _ _ 1 3s46sa ~~~' 1 89H04'; 4130479 PA01 m t 189H06 1502133 PA01 189H07 6034355, PA01 189HlO 60768671 PA01 189H11 2666444,'; PA01 1 90A02 1332750, ; PA01 1 90A03 4587717 PA01 190A04 2984129 PA01 190A06 3616674 PA01 x 190A07 293884 PA01 H 190A101155875 PA01) 1 90A11 45085695 ; PA01 ' 190A12 1885660,'; PA01 190B01 1985278 PA01 s sì 190B02 5749808 PA01 190B04 168083 PA01 1 190B06 523322 PA01 r 190B07 ; 517604| PA01 190B09 4796125 PAOI , ; 190B12 1 1849783 PA01 190C01 126366 ; PA01 190C02 1 55541171 PA01 190C03 1 39582931 PA01 ! 190C04 J848392JPA01 i 190C05 ; 5641136i PA01 ___. _ . _ 1 t 1 90C07 1 3306499 PA01 1 90C08 t 423311 °È PA01 !'190C09 442247J PA01 r'"190C10 3122931J"'pAQi'"" 190C11 E 3590984 PA01 L 190C12j""150670j PA01 190D02', 3741 172i PA01 190D03 1394657 PA01 190D04 3255250 PA01'" : s e e 190D05 i 5321517 PA01 ; L_ ee we 1 90D06 2333501 PA01 190D07 4156562 PA01 190D08 5280699 PA01 e e 1 90D09 6089159 PA01 e e 1 90D10 605572 PA01 1 90D11 3997039 PA01 190D12 4892448 PA01 190E01 4026261 PA01 190E02 5633947 PA01 190E03 4901449 PA01 1 90E04 E 434426 ; PA01 190E054044314 PA01) B8M 402488'PA01 190E07 2687188 PAO 1 190E08 3920652 PA01 190E09 _ j 449835 PA01 w, 1 90E10 2333501 PA01'; 1 90E1 1 8992041 PA01 190E12 5560519'; PA01 190F01 5187753i PA01 ! 190F02 5187753 PA01 : 19OF03 2042241 PAOI 190F04 5568853 PA01 j e e ee. 1 90F05 1402129 PA01 f _ e e_r 190F06 6143311 PA01 _ --e _. w_ __. _ _----1 190F07 E 3509985 ; PA01 190F08 6174656 PA01 1 90F10 É 202376C PA01 190FIl 26314461 PA01 190F12 808490 PA01 190G01'5823734 PA01 ! 1 90G02 PA01 190G04 5370879 PA01 1 90G06' 5752421 PA01 190GO7 3442739 PA01 190G10 4492082 PA01 190G11 1383796 PA01 j 190G12 628495 PA01 190HOl 5535774 PA01 1 90H02 1 ; 11 83789t PA01'. : 1 90H04 t 229062'; PA01 . _.. _. ___. __... 190H06 4244764 :-. _. ___. _. AD1... __.... _. _. _. : - 190H07 3672132 ! PA01 - PA01 190H07 J3672132'. PA01"'""" 19OH08 1413753i PA01 __ 191A03 6050836 PA01 i 191 A02"' ! 3479637J PA01 191A03 93023 _PA01 31871 PA01 5 191A04 í 19638221 PA01 191A06 893023 PA01"" ! 191 A07 , 62 5 191A06 5 893023E PA01 191A07 5j 62318715 PA01 5 5 _ 191A08_ I BL PA01 191A09 T 60752745 PA01 191A10 3335342i PA01 2356388-PA-0''1-*,, '191A11 5420760 PA01 59-1 91A12 5187700 PA01 191B02 PA01 191 B02 3005393 PAfl1 ; M-fi 191 B03, 2047361 PA01 _ # 191 B05 i = PA01 191B05 831276 AOI 191BO6 3640412 PA01 191B07 1997316 PA01 191 B08 2368341 PA01 191 3348319 PA01.' l9lBll 25861941_ PA 191C01 ! 3916435 PA01 :' 191C02 t 191C04 E 34219635 PA01 191C04 34219631 PAOI 5 191C07 517451} PA01 í5 191C07) 517451J PA01 ! 191 C08 _y PA01 191C09 1586100 paon PA01 ; 191clo 50446061 PA01 191 C11 5 1356201 PA01 191 C12 1 5202152 PA01 191D02 5 4331437j ! PA01 E 191D03 E 1701383l PA01 r 191 D04 t 34219' '191 D051384927 PA01 J 191D06 E 1681776i PA01 5 1911D07 3175439 PA01 191D08 1011868 PAa1 5, 191D10 tw 12 »' '191D10 1241897J PA01 191 D12 454399 PA01 191 E01 5718784 PA01 n5 191 E02 1234613 PA01 191 E03 2652983 PA01 3812386 PAOI 191E06 r 52609 _ PA01 F 191E06 j"3878268 PA01 ; 191E07 5 19599965 PA01 i. 191É08 1 3216381i PA01 191 EO9. 5 10793501 PA01 ""191E10 J"1306423 PA01'" 191 El 1 1871262i PA01 ... g pQ---j-2558158 PA01""" 191 F01 1, 2558158'j PA01 191 F03 ! 12789691 PA01 191 F05 i 37078601 PAOI 9l F06-- 191 F06 2 5257401 j5 PA01 191 F07 r 59958R PA01 5 191F08 25wpo0 PU 5i 191FO9 23835271 PA01 _____.. ______E __o ! 191 F10 1 24557115 PA01 f'191F11" !""1293986 PA01"1 191 F12 59446315 PA01 t b r 191 GO1 43285085 PA01 191FIl 191 G02 . 437155 PA01 . __. _ __ 191 G03 59564621 PAOI 191 G04 5805792 PA01 191 G05 632969 PA01 191 G06 7894890 PA01 191 G07 45311581 PA01 191G08 19061391 PAOI 191 G11 3712733 PA01' 191G12 466234 ! PA01 191HOI _806839L-P"A 0 1 v 1 177Z965i PA01 ltJ r 191H02 1772965"PA01 j 191H03 35912421 PA01 191 H04 1985278 PA01 s 191HO5 53654511 PA01 H 191 H08, 31125, PA01 191HO9 926841", PA01 191H10, 2673692 ! i PA01'j . l9lHll 35788341 _EAOI ! 192A01 j 4704214 PA01 j 192A02 962506j Paon 192AO4 26862751 PA01 5 1 92A05 1 1823276 PA01' 192AO6 1620769 PA. 0 192AO8 1079350 PA01 192AO9 4845087 PA01 192alto 2726343'PA01 ! 1 92A12 r cs q ? r 192A12 T 5888034J PA01"1 192B01 3658392 PA01 192BO3 2017791 PA01 1 92B05 3264426 PA01 22 .......... 192B06 1288868 PA01'i 3627888 PA01 192B08 j 4824482 PA01 j j 192B09 r'4589642 PA01 j 192C01 _i 2191509t PA01 w09 r w PÄ01 192C02 j'"4589642 PA01 i 9'"4138075 PA01. ! ......,......-.-.-............., .., 33gggj p-- 1 2749174 ; _PAa1 , __.... 192C06 _ _ _' 3117882 ;. PAd 1 __.. _. 192C06 31178621 PA01 1 92C07 !, 3434368i PA01 192C09 2 5441159i'j PA01 192CIl 49824251 PA01 192Cl2 1473291 PAOI 192C12 2 1473291_ PA01 192C12 j 147329 PA01' I'192D03 6053399 PA01" 192DO5 17325841 PA01 192W6 46703128 PA01 } 192D07 3209115'j PA01 2-----_. _ 2300649i PA01 192Dll 2041177 PA01 1 92D12 1 5857t PA01 L 192E01 2 3760820 PA01 192EO2 22165641 PA01 192EO3 48450871 PAOI 192E05468401 PA01 _ 3954605 PAO1 192EO9 3250915 PAOI 192F01 2641298 PA01 1 92F02 894630 PA01 2 192F03 5022834 PA01 192FO4 2423759-PAO-1 1 92F05''3144593 PA01 . 92F06 _ 60122671 PA01 _'. 192F07 j 5393185 PA01'i 1 92F08 5073539j PA01 1 92FO9 5842394i PA01 192F11 9169422 PA01 2 192F12 2 605490 PA01 192GO1 1526024 PA01 1 92G0Z 783180 PA01 192GO3 5142 192GO5 2849806 PA01 192GO6 2004161 PA01 192G07118239 PA01 j 192GO8 5157544 PAOI 192GO9 PA01 5143606 192GlO 670970 PA01 192G11 2 5950602 PA01 1 92H01 2719500 PA01 2 192H02 J 5998040 PA01" ! 192HO4 1530709 PA01 192H05 1006391 PA01) r 192H06615372 PA01 j e < 61 53i2 PÄ01 192H08 1289165 PA01 192H09'4481438 PA01 2 192H10 833296j PA01 ! 2 1 92H11 2 2047361 PA01 ) 193A01 J 3393219 PA01 j 1 93A04 2 _ 54365331 PA01 193AO5 5781635 PA01 193A06 2 59463282, PA01 ; PA01 1 93A07 1 7E84 PG 1 Z'"193A08"1018388f'PA01 193AI0 43252441 PA01 12 193A11 _ 178805022 PA01 2 193A12'I 5838773Z PA01 193BO2 3067051 PA01 193BO3 853171 PA01 193BO4 52190901 PA01 L 193B05 j 3474415) PA01"" : 193BO7 24201431"'-PAOI- 193BO8 1561054 PA01 193BO9 4334349 PA01 193B10 3057774 PA01 193B12 1599173 PA01 193COI 1429515 PA01 193C02 1469855 PA01 193C03 399648 PA01 193C04'"""2012772 PA01 r 1 93C05 1388277 PA01 193C06 | 4901449, PA01 1 93C07 _i 51 51949 PA01 193CO8 6139211 PAOI 193C091018388 PA01 1 93C10 1968943 PA01 . E m. 1 193Cll 57862061 PA01 193C12 4238213 PA01 ; 193D01'S2283 8 PA01 193DO2 32616101 PA01 193D04 45943i27 PA01 193DO6 57646361 PA01 193DO7 44339471 PA01 193D091947677 PA01 193D10 1 34238532 PA01 193D11 2516384 PA01 1 93D11 2516384 PA01 193D12 1814028 PA01 .--- 193E01 5291470 PA01 193EO2 3974627 PA01 193E03 1524451 PA01 ; 193E04") 1876783J PA01 193E05 336119 PA01 193EO6 1513243-PAOI 1 93E07--'-' PA01 193EO8 4334349 PA01 193EO9 5791602 PA01 L 1 93E10 177669 PA01 f 193E11 j2300649 PA01 _ 1 93E12 2 834659 ! PA01 7 1 93F01 ì 663862 ! PA01 __~__. í 193F02 i 40443127 PA01 1 93F03. 2057S29i PA01 1 93F04 _ 6239369. PA01 193F05 : 4013215, PA01 '193F06 ! 2963758J PA01 193FOg 1896701 PA01 J'193F10 J3306499 j PA01'"" 193F11 _ 517029 ^PA01 193F11 < 7ar PA01 193F12 7 44337371 PA01 ___ dz ! .. _.... __193F12____. ___. ___ 4433737j _P_A01. w...... 193GOI 38751311 PA01 ! 193G06) 3844818 PA01', 1 93GO9 I 57387747 PA01 ! 193G11 2753846PA01 r"""193G12''858251'PA01 -171422 PA01 193HO3 193HO4 4892448 PA01 PA0. 1- 193HO7 641937 PA01 1 93H08 1008182 PA01 f 193H09_ 6166514 PA01 193H10 5959116'PA01 1 93H 11 = _w--2 193H11'3235377 PA01 ! 194A01'6075274 PA01 }'194A021657083 PA01 194AO3 5056159 194AO4 6019919 PA01 194A05 5634042 PA01 194A06 2812906 PA01 194AO8 23674151-AO-1 194AO9 61987561 PA01 194A11 2095138 PA01 1 94A11 20951381 PA01 1 94B02 399332 ! PA01 7 194B065695090 PA01" 194B07 5913087 PA01 194BO7 59130871 PAOI 1 94B07 ; m !. . _. _.. __. .. _ 194B12-. y__. _. ____. _.. __. 3748607 PA01 194B12 1 3748607 PA01 H n = PA01 194C01 2685290 PA01 194C02196608 PA01 194C03 2978019 PA01 194C04 14037281 PA01 27 194CO4 AOI 194C06 4864670} PA01 194C07 61007853 PA01 T'''-194C06 1274854 PA01 paon 194ClO 9247561 PA01 194C11 3056553 Paroi 12991181 PAOI 1 94D01 7 2652983 PA01 ! 194D02"'1907299 PA01 ! 194D03 2 6231671| PA01 194DO4 38884811 194D07 519951 PA01 '194008'- ;"---- 5060661j PA01' 194D11 5794761', PA01 194D12 !, 32312912 PA01 194EO1 32949591 PA01 194E02 _ ; 6239304i PA01 194E05}, 4589642Si PA01 194EO6 52519851, PA01 194E07'"T""'4697847. PA01'""' . _. ____. __ 194E07 1 94E08 1 31 09205t PA01 ìç i°E PA01 "194E10"'1588305 PA01' ! . __. _ 194 E 10-_ ... _. _ __. '194E12'""''r""5444779 PA01 ! 194FOl 5159016 PA01 1 94F02 5862707 PA01 194F03 5736841 PA01 194F04'3553451 PA01"1 194F05'"3980804 PA01'J 194F07 4488318 PA01 j #S 194F08 1429515 PA01 1 94F11 2 11 4038T PA01 194G01 24775952 PA01 1 94G02 1230430 PA01 y J 194GO5 2729736 PA01 194GO6 2614405 PA01 M i _ 532991 i. PA01 194GO8 532991 PA01 194GO9 2933151 PA01 194G11 1 2471654i PA01 194HO2 13604 PA01 194H03 1 19134701 PA01 194HO6 6019919 PA01 ''194H07 1064475 PA01" 3 iM T 663176'PA01 194H10 2423759 PA01 1 95A03 1883259 PA01 ------ 2888---4j 1 95A05 2888474 PA01 m i 195AO6 5834406 PA01 I 195A08323308 PA01 ! 195A09 1 2399019l PA01 195A10 T_r 5938440 PA01 i 195A11 4490119 PA01 + 186851Z PA01 195B06 1781790 PA01 195BO7 2906880 PA01 195B08 1382220 PAOI 195BO9 934913 PA01 195810 5358754 PAOI 195B11 5930686 PA01 2, 195B12 1 2697321 PA01 e < 1 195C01 _ 48349199; PA01 195C02 8075971 PA01 195CO5 297920i PA01 195C05 !. 29792Q ! PA01 1 95G05 i 2979201 PA01 1 95C07 19722782 PA01 1 95C08'i 31 99850i PA01 195ClO 34899021 PA01 195C12'1579968'PA01 195D05 i 1599173 ! _PA01 195D06 J"1155875F PA01'"" E """""195D07'"'2894526 ; PA01""' l95DlO 15799681 PA01 195D11 J"4673714rpA01""" .. __ 195D12.. ___. ' ..... _. 3250915, PA01 _. _.. __. 195Dl2 i 32509151 PA01 195EO2 PA01 31949271 ) 195E03'1746364 PA01" ! 195E04 3408830 PA01 1 95E05 ; S 547097 PA01 2 1 95E06 L zPA01 2 195EO7 23120231 PA01 195EO8 3494061 PAOI i'1 95EO9 miv 195EO9 2538241 PA01 H 8 m i 1 95E12 3158748 PA01 1 95F01 _ 5086573 PA01'; 195F02 894627 PA01 i 195F05 2705053 PAO' ! J"195F09 r 6190659 PA01 t-i 195F10 2312027 PA01 ; 195F12 5948087 PA01 195G01"'1082558 PA01' j 195G02 2437188 PA01 195G03 559478 ; PA01 ! 195G04 2516386 ; PA01 i"195G05""2247698 PA01 195GO6 1709171 PA01 1 95G07 i 5509978f PA01 19 PA : 195GO8 62313711 PA01 j195G09'5358757) PA01' 1 95G10 6226922Ç PA01 195G11 4061276 PA01 f 195H02 £, 195H02 50421244i PAOI 11 i 195HO4 430796 PA01 195H05 1367221} PA01 195H06 I 32391181 PA01 195H06 32391181 PA01 t. A# s ~ 195HO7 9179131 PA01 195HO8 3400008'PA01 195HO9 34000081 PA01 195H10 1010631 PA01 195H11 3653147 PA01 196au2 1300919 PA01 196AO3 4666239, PAOI 196A04 v3362994 ; PA01 196A05 4631871i. .. PA01 ' r. _____. _ _. _. ___. _ PA01 196A06 : 217017 PA01 196AO7 52574001, PA01 1 96A08, 50343031 PA01 s 1 96A09 li <, BL PA01 196AO9 18778481. __ PA01 196A11 43177832 PA01 196AIl 1778321 PA01 s 196A12 J1885660 PA01 196B02 % 2720143 ; PA01 196BO3 1500753, PA01 1 96B04 s 2683697 PA01 196B05 f ; 1788050 PA01 1 96B06, 5685997 PA01 s 196BO7 40654881 PA01 196BO8 1530709 PA01 196BO9 1111876 PA01 196B10 2236896 PA01 196B11"1627845 PA01 1 96B12 3795763 PA01 196C01 3329714 PA01 196C03"'3592736 PA01' 196C04 2285378 PA01 196C07 6162849 PA01 196C08 31601 6S PA01 196C09 40623301 PA01 1 Ds320321 PA01 1 96C11 660973 PA01 196C125251750 PA01 ! 196DO1 479737 PAOI 196D02 632607 PA01 1 96D03 5961995 PA01 1 96D04 _ 5690634 PA01 196D06 1087675j PA01 196D07 6012267 PA01 1 196DO8 61785201-PA01 196D09 J 4594391 PA01" ! 196D11 _ 3712792 PAO1'. 196D12 1548917PA01 X 196E02 3941477PA01"1 196EO3 4662341 PA01 196E04 2719500 PA01 1 96EOS 9 EX _ 196EO5 3832211 PA01 196E06 _ 2888987 PA01' 196EO7 3627611 PA01 196E08 _ 129754e PA01'' 196EO9 2027466 PAOI 196E10 620889 PA01 ; 196Ell 306705 PAOI s 196E12 1525219, PA01 PA01 196F02 PA01 21921721 1 96F03 í 11 52092t PA01 s 196F04'""T"""5743512 ;'"pA01"""" 196F05 i 6165886is PA01 ----ggpQY-Iggyjp---" 196F07'31157i PA01 1 96F08, 3598508j PA01 1 96F09 5 2547870i PA01 196FlO 60752271 PA01 1 96F11 15500241 PA01 196F12 i 5188479j PA01 ; 196G01 i _ 7_8_9435 __. _ PAO... __.... _. _.. 1 96G01 1 789435 PA01 196GO2 PAOI 196G04 _ i 5321565 PA01 1 96G04 i 5321 565'j PA01 196GO----l 4538762 PAOi-- : : 1 3935665 PA01 196GO6 196GO7-1-1985981 PA01 1 96G08 4367574 PA01 196G10 362761 PA01 1 96G11 2399019 PA01 196GI2 i 57060231 PA01 196H01 1 3418100t PA01 196H02 1304734 PA01 j 196H03632607 PA01 1 96H04 1830069 PA01 1, -A 0-1 1 96H05 974001 PA01 s 5 196HO6 582086 PA01 196H07 1894541 PA01 ; 196H08 1 5737710j PA01 1 96HO9 5821 316 PAO 1 1 96H10 916942 PA01', 197A012477596 PA01 197AOI 2477596 PAOI S 197A02 5284518 PA01 1 97A03 6259458 ! PA01 197A05547097 PA01 197A061046252 PA01 197AO6 10462521 PAOI 197A07 5158778J PA01"1 e 1 97A07 1 SL PA01 197AO8 3087708 PA01 197A09338950 PA01 1 1 97A10 3329549 PA01 197AIl 5497562 PA01 197Al2 1572853 PA01 197B01 j 621214 PA01 ! 1 97B02 51 20966j PA01 197B03 5906859) pAOT" 1 97B06 561 1217'PA01 r 1 97B07 368323i PA01 197BO8 2729735 PA01 197BO9 4654778 PAOI I_ 197B10 32509151 PA01 ! 197B11 1082558 PA01 i 197B12 1494950 PA01 L 197C01 < PA01 197COI 6212141 PA01 197C02 1 497025ii PA01 197CO-' ! 4049954i PA01 197CO4 13300584 PA01 1 97C04 1330058, PÅO 1 197C05'. 3407713i PA01 197C06 3350770FT. 197CO7 1576228i PA01 1 97CO9 i 423257i PA01 '."'197011 5007738) PA01 1 97C 12 1 104381 8t PA0 1 197Cl2 1043818i PA01 'i 1 97D01 2767307 PA01 197DO2 14362991 PA01 197DO4 PA01 197DO6 58908351 PA01 197D072215589) PA01. 197D09 1 21292991 PA01 197D10 '50323341 PA01 197Dll---. 52540491 PA01 197D12 _920155# P_A01 1 97E01 i 5476826| PA01 197E02 |_ 10876771j PAO, 1 '197E03 397255 PA01) 197E04 5306956, PA01 1998167 PA01 197EO6 3922684 PA01 197EO7 PA01 48425031 197EO8 46330661 PA01 197E09"2367415 ; PA01 j 1 97E10 _ 7w 1 97E11 w PA01 1 97E12 v 197FOl 10183881 PA01 197F025702292 PA01 j 197F033659896 PA01'' 197F05 36890011 PA01 197F06 413341 PA01 197FO7 874599'PAOI 197FO8 PAO 1 a l s 197F10 521754j PA01 197F09 j3958042 PA01 ! 197F11 177923i PA01 197Fll 17792 PA01 197F11 r 177923 :"PA01 j 197GO1 217731 PA01 1 973X 1 Bs550 PAD1 1 97G03 MZB§H 1 197G04 1 97G04 _ 46962291 PA01 197G05 57542 PA01 197GO6 16354411 PA01 197G07 518755i PA01 1 97G08 4328537 PA01 t 197GO9 PAOI se 197G10 ! 1307376 PA01 ; 197GlO 1307376 PA01 197G11 1625272i PA01 197G12 i 532802i PA01 197H01 1 2024704'PA01 197H03 J""'"'1349379J PA01 '. 197H05 ii 52731993 PA01 1 97H06 i 1394657. PA01 197HO6 1394657 PA01 1 97H07 i 54761391 PA01 197H07 !'5476139) PA01" 197H08 i 2790051'PA01 197H09 _ ! 4844962s PA01 197HlO 52408071 PAOI 197H11 461 1050'j PA01 s o s 198AO2 670788 PA01 1 98A03 4831383 PA01 r"""198A04'2302736 PA01 ! 198A05 3578842 PA01 198A06 5083277 PA01 1 98A07 369075i PA01 ii . _. __ I 198A08 4233408 PA01 1 98AO9 4623736i PA01 198AO9 46237361 PAJOL 198A10 2345225 PA01 1 98A12 2626060 Paroi 1 98B05 | 2842463 PA01 198BO5 198B06 si 6183482 PA01 198B07 1175244 PA01 ) 198B08 1353913 PA01j 198BO9 1576228 PA01 198B10 1892190 Paon e _l 198B12 63933'i PA01 198C015069695PA01 j 198C02 4970251 PA01 1 98C03 4664571 PA01 1 98C04 407700 PA01 198C05 12629811 PA01 198C06 L 4576467j PA01 198C07 1 821358 PA01 A s-z< 198C08 2626060 PA01 198C09 _ (_,. 953007j PA01 198C10'""Y"""H84851 PA01'") 198Cll 198C12"1985981} PA01) 1 98C12 19859813 PA01 198D01 1380721J PA01 j 198DO2 PAOI 198D02 1300396i PA01 198D03 51873631 PA01 198D04 34624823 PA01 198D06 1756viO3'i PA01 1 98D07 54083201 PA01 198D08328549 PA01 198D09 1 931235 PA01 198D10 5254049 PA01 1 98D11 975370 PA01 198D12 1 53885361 PA01 198EO1 10755201 PA01 12810211 PA01 ,"'"""198 EOS"" ;"'"" 5983858 ! PA01 ! 198E04 ! 4210693 ! PA01 1 98E04 -421 0693j PA01 198EO5 30693101 PA01 198EO6 17055681 PA01 - mj 198E07'""""'5003203 ! PA01' 3 1 98E08 m 2343238f PA01 1 98E09 3809683i PA01 198E10, 1417026 PA01 j"198E11"" ['"' 881939""PA01 1 98E12 2519304 PA01 198F02 57950921 PA01 j"198F03 j"'3031T1JPAOf" '''198F04'"J"1940601 PA01"'" 198FO5 1744773 PAOI 198F06 5930687 PA01 198F07 5502181 PA01 198F08"'j 4529101 PA01] r 198F09"63934 PA01 1 98F11 639331 PA01 198GO1 2868773 PA01 198GO2 5906182 PA01 198G03 1474344 PA01 198GO4 2380377 PA01 r 198G05 321061 PA01 .......... 198G07 3574398 PA01j 198G08 1. 5756509PA01 198G10'2774085 PA01 .......... 1 98G11 63933 PA01 1 98G12 41 34535i PA01 198H01 4864670j PA01 198H02 4864660 PA01 i 1 98H03 _ 807597i PA01 198HO4 43076441 PA01 1 98H06 2024860i PA01 -v L 198H07 1429218 Paroi 198H08 4650014 PA01 198HO9 5556278 PA01 198H10 1206000j PA01 198H11 1006404 PA01 199A02 i 5149050, PA01 199A03 1 1151673 PA01 199A041005820 PA01 199AO5 5775844 PAOI 1 99A06 8011 581j PA01 i''199A07'"""4344260 PA01"'1 v 199A09____ _ 3566494 PA01 1 99A11 1 4153214 PA01 l 1 99B01 1 5547725 PA01 199B02 1756716 PAO ! 1 99B03 v 710< 1 99B04' 588504 PA01 199B04 __ _ 588504 PA01 T99B-I 5278577f -199B07, 5278577'j PA01 199B08 i 4831383i PA01 199B10 4559762E PA01 199B10 ..........-- 3099144 PA01""" ! 199C01 3 3099144'j PA01 199C02 50735391 PA01 "199C04 3744782J"'PA01''" 199cl4 PA01 199C04 3744782 ; ; 1 99C05, 44403671 PA01 199C06 4354058 PA01 199C08 Z 4054030t PA01 1 99C09 i 1402129 PAO 1 199C10 L 4531158, j PA01 (199C12 1439067 PA01 3 199D02'471331 PA01 199D03'i 1037317 PA01 199D04 2345056 PA01 199D05 i 4866960 PA01 l. 199DO6 5559905 PA01 199D08'4872115 PAp1) 199DO9 858252-PA01. 3 199D10 4559159 PA01 5820861 PA01 199D12 831276 PA01 199E01 6199101, PA01 I 199E02 5587391 PA01 199E03 v 27ao12s 199E04 2183884 PA01 : : 199E05 1370589 (_ PA01_ 199E06 1356200 PA01 199EO7 62386691 PA01 199EO8 35704631 PA01 199E10'j'4814077J PA01 i 199E11 5444780 ! PA01 199E12'i 960376, PA01 199EI2 .......... r-199FOl 40540301, _ 5127425 ; PA01T < n 199F04 _ 5083277 PA01 19iF 1 PA01 199FO5 10876751 PA01 1 99F07 246641 PA01 199F08 6118109 PA01 10480561 PA01 t 199F10 3479048 PA01 _ 199GO1 4704106 PA01 199GO2 3505585 PA01 3j l 199G03 3810859 PA01 1 99G04 4125268 PA01'Z 199G05 5083277 PA01 _.... _.. ___ 199GO7 56414771 PA01 f 199G09 5632007 ; PA01 ! . : 199G10 ; 356993 PA01 . ; jggQ-.--..... ggggj-p-"-- 199G12Y ; 3733759 ! PA01 - 14316201 PA01 199HO2 8047671 PA01 ___...... __. ! _. _ _. _ _ 199H02, 804767i PA01 199H05 ; 1240147j PA01 199H06 _ 6093484f PA01 1 99H06 i--D5334 FAD' 6093484,'PA01 199H07'" ! 5187700 PA01 _ _ _ _, ___ _, _ ___. ! "'-''''''' 199H08'i 1434130 PA01 199H09 j 5271365j PA01 199H10 i 58908340 PA01 199HlO 5890E 199H11 i 6141394tj PA01 r""""'200A01''""4998867 ; PA01""""i 'i 200A02 2479696 PA01 200A04 5198857 PA01 200A05 51519491 PA01 200A06 1018388 PA01 - _.. 200A07 4025432 PA01 200A08 1611467 PA01 ' 200AO9 15700793 _ PA01 200A111234613 PA01) 20OAll 1234613 PAOI 2, 2 3 mU1J 200A12 2522176 PA01 200B01 3060202 PA01 -* s. 200B02 3416856i'PA01 200B03 4896961 PAOI 20OB04 16424361 PAOI 200B05 36592681 PA01 200B06 3 3961517j PA01 ij 200B08 i 4153214 PA01 200B09 4153214 PA01 200B10 6067436 PA01 200B11 3652820 PA01 200B12 3 2349849 PA01 200C01 2538241 PA01 200C03 1588305 PA01 200C04 61 96985t PA01 200C05 5768034j PA01 _ 200C06 21163043 PA01 200C08 1698386 PA01 16983861 200C09 5183525 PA01 3 200C11 3122931 PA01 200C12 3250914'j PA01 .. _..,.. _ _ ; 200D01 __ .,-_ 5436533 ! _ PA01 _, ; 200D02 61761041 PA01 200D03 109116j PA01 200D04 1 3816551 PA01 . tf-H 200D05 2602286 PA01 200DO7 5173989 PA01 200D08 i 58538121 PA01 j 200D11 114208 PA01 j ' 200D12 1 51187611 PA01 200E02 1781790 ; PA01 i'200E03 j 3904412i PA01' : 200E04.. 1292952| PA01 *J _ 200E05_ 4'_ 39885904 _ PA01 200E06 i 2345056T PA01 !-. 200E07""j'3685973 PA01"" 200EI0 32938881 PA01 163544111- ; 200E10"i 3293888 PAQI" 20OF02 ! 200E12' 1293986 PA01 _ 200E12' Lt 16018811 PA01 20OF03 20807401 PA01 20OF04 24371871 PA01 200F05''3979079 PA01) 20OF06 33931561 PA01 200F07 1 996444j PA01 20OF08 31348521 PA01 200F09 t1321072 PA01 1 9 3OFDD M s i 200F11 1010779 PA01') 200G01"3069310 PA01 j 200G02 1119528 PA01 200G03 4414026 PA01 200G066122316 PA01 200G07 2080740 PA01 200GO8 471331 PA01 200GO9 1429515 PA01 200G11 28556351 PA01 200G 12 4138075'PAO 1 .......... 200H01 I 2423550 PA01 . 20OH02 14172091 PA01 20OH04 24807651 PA01 200H05 40481731 PA01 20OH07 15043731 PA01 200H09 T 4514834 PA01 200H10 !"887586 ! PA01 201 2183884 PA01 201AO6 PA01 201AO7 1991177 PA01 5 oz 201A08 1278212 PA01 ! 201A09""2095138 PA01'j S t 9D38 20, 1A12 1 1991177i PA01 201BO2 6239304 PA01 201BO7 1802886 201BO8 2095166, PA01 s-i m 201B12 481393i _P_AO_1 ; 201C03 3400008 PA01 1 201C08 4118672 PA01) 201C115768034 PA01' 20lCl2 201DO5 3595641 PAOI 201 52633481 PA01 201 D08 _L 38470561 __A01 _, !'201 D09279736 ! PA01' 201DO9 2797361 PA01 201 D12 __ _ 5937406 201 E03 i 4501 878i PA01 201E03 450187811 PAOI 201EO8 PA'01 201E09"5800121 PA01 _ _'T PA01 201 F01 j--3294959JPA01 _..... _. w. 201 F01.. __. __. _... _. _ _____.. _ 32949 g _ PAO-.. _........ 201 F01 ; 3294959} PA01 ° 201F09 ; 6012267 PA01' ! 201 G07 2655369J PA01 'i 201 G07 a PA01 r"201 G11'"T'5169536 PA01 46500141 PA01 201 H07767461 PA01 j_ 201 H08 _ 4481437T PA01 _ 201HO9 1064475 _ 202A01 45896421 PA01 202A02 4589642 PA01 202A04 2129299 PA01 202AO5 2298479 PA01 202AO6 588504 PA01 202AO7 359564 PA01 202A08 35954171 PA01 202A09 5433632 PAO'1 . 202AI0 9825521 PA01 202All 5994 m ; ; PA01 T 202B01 28145991 PA01 202B03 2930684 PA01 202B04 5005306 PA01 202B05 1 3612678'j PA01 202B06 5 54692031 PA01 i 202B07 i 3847281 PA01 202BO8 51519491 PAOI 202B10 3760820 PA01 PA01 202Bll 33857581 PA01 202C01 PA01 202C02 4284077 Paon H . 202C03 i 1512997 PA01 _ 202C04 2129411 PA01 _ 202C08 1530709 PA01, T T 202Go7 5373812 PA01 202C08 32232531 PA01 202C10 F-202CO8 32232531 PA01 202C12 1 10825581 PA01 202D01 4212283 PA01 202DO2 222110 PA01 202D03 94180 PA01 202D04'3046825 PA01 s ;. _.. _ ___. __ 680915l 202DO6 4345761 ; PA01 , _ PA01 ; 202D08 < _. ___ _, ___.... _.... 202DO9'4308064i PA01 202D10 í 3505585L PA01__ 202D11 < 1 335367i PA01 ''202D12 4794311i PA01 f"202E01 1782659 PA01' 3 202E02 3 4275942, PA01 '202E03-j--1898833J PA01" [202E04 j"5776318) PA01 202E05 j 71 0987i PA01 202E06 3236850 PA01 L= w 202EO7 5247546 PA, 01 202EO8 4035071 PAOI 202EO9 204518 paroi 202E10 _ 1560670 PA01 202E11 5200932 PA01 202F02 5060661 PA01 202F03 1124960 PA01 202F04 _ 36583921 PA01 202F05 PA01 202F06 _ 2658277 PA01 '202F07 1853284 PA01 202F08 3076721 PA01 202F09 17_77702 PA01 202F10 6198756 PA01 202F1 1 435027 PA01 202F12 . .. . _". 2477889 PA01 202GO1 3442739 PA01 202GO2 4494227 PA01 202G03 104799j3 PA01 202G04 4350073 PA01 2 4694750 PA0 1 202GO6 5583826 PA01 202GO7 55843911 PA01 202G08 48478641 PA01 202GO9 21624501 PA01 202G10 r 202GlO 20015131 PA01 r'202G12'"1018388 PA01 1 202H01 43080641 PA01 202H02 3129165 PA01 202HO4 4257084, PA01 202H04 lm 202H06 5086573. PA01 202HO7 48609471 PA01 H j 202H10 6090707 PA01 J t-'-202H11 T 4138588|. PA01 203A01 1 50773601 PA01 203AO7 899039 PAOI 203A08 2000354 PA01 L 203AO9 _ 973442 PA01 2_03B01 j 50773601 PA01 203B03 r 2310593i PA01 ç v s 203B04, 2310591 PA01.' _ _ 1388277 : PA01 203B08 ! 5987063} PA01 203B09 j 3759817 PA01 203B10 3433540f PA01 203C05 l. w PA01 203C09,, 5393185 ! PA01 '203C10 2399019 ; PA01' 203C11, 4523815j PA01 030 r g gyQgg pAQ1'"" paon 203D02 1 3608762 PA01 j 203D08 47Q7421 PA01 j 203D09 4130479 PA01 203D11 1 4170091 PA01 203E05 (4492081 PA01 203EO6 4194333 PA01 203E07 4632089 PA01 J 203F03 _ 30371 PA01 203FO9 1375885 PAO 1 203F11 1 944736 ! PA01 203FI2 246651 PA01 '203G02"'"'3329714 PA01 ! 203G055475672 PA01 203G06 1510511 PA01 203G09 5318004 PA01 203G12 j2117618 PA01 i 203H02 r 441133 » 203H07 1 1164559 PA01 203HO7 11645-5-91. PA01 203HO8 5451, AO 6092467 PA01 204A01 1064475 PA01 204A03 4145224t PA01 204A05 1 37064621 PA01'. 204A06 | 3175439i PA01'. 204A07 2506126 PA01 204A08 _ 3288834 PAO1 204AO9 1972791 PA01 |b 204A10 138297 PA01 ; 204A11 ; 1126432 (, PA01 204A12 2976291f PA01 204BOA 2so4s63E PA01 ~ 204B02 5571358 PA01 204B03 3577840 Paroi 204B05 486675 PA01 204B06 52810 PA01 204BO7 670970 PA01 204B08 4585465 Paon 204B09 4350073 PA01 a 204B11 ^5201685 PA01 ; 204B12 L 2915395 PA01'. 204C01', 5648517i PA01 --44 204CO3 47801 PA01 204C04 j 5401050] PA01 i 204C04'"J"5401050 ! PA01 i 204CO5 1078894 ! i PA01 204CO6 202470TI, PA01 204C06 i 2024704i PA01 ='""204C08 ! 4547868) PA01 204cil 1 28370481 PAOI 204cos ! 15826453 PA01 204C10 t ; 28370481 PA01 204Cl2 46578051 PA01 H s 204C12 i 46578053 PA01 11851 PA01,,, _, 24965161 PA01 204D06 i 31887863 PA01 204DO9. 1283125 PA01 -1 204D10 i 4871941i PA01 204D11 16410781 PA01 204D12 6183483 Paon 204E02 1166059 PA01. 204EO3 5183525 PA01 s 204EO4 5946328 PA01 4 204E05 4558862 PA01 204E06 540731 7t PA01 204E08 3417511 PA01 204E09 5158635 PA01 tS 5 204E11 894630 PA01 204El2 946484, PA01 204F01 144732i PA01 Lo ^ 204F02 j3 54527051 PA01 204F06 39970391 PA01 204F07 2453351 PA01 204F08 632969 PA01 204FO9 5157544j PA01 204F10 1546129 PA01 i 204Fll : IA01 204F11 4392178 PA01 - 204F12 3418100 PA01 204G01 1 1681776 PA01 204G02 5 5286965 PA01 204G03 4813041 PA01 204G04'j---3986398 PA01'"'1 s 204GO5 2302736 Paroi 204GO6 1086488 PA01 204GO7 54761391 PA01 3 204GO9 552176 PA01 204G10 59346573 PA01 --05- 204G11 2051514 PA01 j 204G12 1 51495441 PA01 ! 204H01 1002390 PA01 j 204H02 5431716l, PA01 ; 204HO3 55089701 PA01 ! 204H04 1 55089701 PA01' 204H06 32883 PA01. F s 204H08 5 2951328i PA01 3 204H09 L 37512101 PA01 13978281 PA01 800304 PA01 205AO6 36532561 PA01 i''""205A08 ''"5309318j PA01'""" 205AIl PA01 205BO5 26868251 PA01 205BO8 34181001 PA01 !'205B09 5040742 PA01 205B11. mL PA01 ? 205C03 3 45150131 PA01 E 205C04 5500123 PA01 205C04 s 55001233 PA01 r*"205C08"1038724 PA01 J i'205C09""''1021791 PA01 f"""205C11"""f"5398475"PA01'"'J 53984751 205C'12 14369041 PA01 205DO7 PA01 205E05 L 1866247 PA01'' 205EO6 43252441 205E07 1 2256103i PA01 s ! 205E09 1567960 PA01 ; 205EO9 A01 205E11 899039 PA01 . _... ___. 205E12 46554533 PA01 5 205F01 61 sasas PA01 205F03 5000428 PA01 7 51S7700 PA01 3 __. k 205F09 5983927 PAO_1 205G05 5398475 PA01 205G06 5398475 PA01 205G09 2440205 PA01 205HO2 11738041 PAOI 205H05 530714 PA01 205H07 1 3202112 PA01 205HO9 885011 PA01 206A02 _ 1260924 PAO 1 206AO3 1906891 PAOI 206A06 2162449 PA01 3 20S08-3 s 206AO8 3408993 PA01 206A09 T4570312 PA01""" 206A12 1382220 PA01 206B02 269731 PA01 206BO2 269731 PA01 3 206B12 59061823 PA01 s s 4 206C01 5764162 PA01 4531368-PA01 206C04 3839120 PA01 J 3839120-PA01 206CO5 PA01 206C06 2023760 PA01 206cos 3 34335401 PA01 3 206C10 ? 30693561 PA01 206CI2 27050531 PA01 206D02 1 14607371 PA01 206D02 j 1460737 PA01 1 ) 3. 588487911 PA01 """2b6D06'1351298 PA01"'" s 206D06'1351 298i PA01 1 206D08 j 419433lTPA01. 206D10"1513243 PA01] 206D12 1 18856601 PA01 206EO1 843356 PA01 206E03 j5513935 PA01 J 206E04 4280266j PA01 1_. _. _.. _ _ _____ _ _____ 206E06 1427492 PA01 206E08 716260 PA01 206E10 2559947 PA01 206E12 _ 1018388 PA01 : 206EI2 ----5918900 PA01 206FO7 3434587 PA01 206F08 1353959 PA01 j r 206fiv 1007058 PAOI i 206F111007058 PA01 1 z L 206F12 4896949 PA01 206G01 715509 PA01 ' 206GO2 6761 PA01 206GO3 4446673 PA01 206G06 93913 PA01 206G09 2794950 Paon 206G10 3108154 PA01 206G 11 946926 PA_0_1 ! 206G12 4452477 PA01 206H01 1 1548077 PA01 - 7m w 206H03 1329770 PA01 H" 206H04 1402129 PA01 206H06 5953052 PA01 767363 PA01 206HO8 15728511 PA01 206H 11 3608762 PA01 207A02 6193301 Paroi 207A03 5930214 PA01 207A04 3374216 PA01 207A05 375528 PA01 207A06 j 2506126 PA01 207A07 1010520 PA01 207A08 1164559 PA01 207 _ 1636026 PA01 207All 5420760 PA01 207A12 j ~ iisO 207Al2 PA01 207B02 1 916942 PA01 207B02916942 PA01 207BO4 5094530 PAOI 207B05813366 PA01 j 207B06 5539080 PA01 207BO7 1963822 PA01 207BO8 6022758 PA01 s S x 207BO9 2506126 PA, 01 , ___.. _. __. __.. 207boo 758473i PA01 207B11', 6118085, PA01 207B12"""'"L"1137119 PA01""" ! 2480764 207C02, 5768034j PÅ01 207C02 w.. __... -_ 576 PA01 207C04'2399017 PA01 207C05. 4847345 : PA01 207C06 i4833047 PA01 207C07"""I"3888481'""PA01"'"" 207C08 j1830069 PA01' 207C08 18300690 PA01 w Ho7n 207C10 3 1394657 PA01 207C11 39746277 PA01 207C12 1203434j PA01 207D01 j 5795988 PA01 207D02 3652820 PA01' 207DO3 5315658 PA01 207D045040742 PA01 207D0693744 PA01' m 207D07 13512988 PA01 . _ _ __, 207D08 j 6208897 PA01 207D095981336 PA01 t 207D10 5679371 PA01 207D11 4507688 PA01 207_E03__ 179242 PA01 207EO4 5256962 PA01 207EO7 41998001 PA01 207E08 802522 Pua01 207E10 7 5273292 PA01 207E12 767363 PA01 207F04 5854080 PA01 i 207F07 4134535 PA01 207F10 _ 28483 2PA01 207F11 5214226 PA01 207G01 3250915 PA01 207G03 4845292 PA01 207G06 4865696 PA01 207G07 2990245 PA01 w 207G10 711492 PA01 207G12 i 18745701 PA01 _ 2116427j PA01 207H03 5282876 PA01 207HO4 427386 PA01 207H0594180 PA01 J 207H06 1006391 PA01 207H07 30006117 PA01 1 207H08'3479636 PA01 i 207H09 38079 PA01 207H10 6161381 PA01 207Hll 33742161 PAOI <mv 208AO1 1 51697001 PA01 208A02 1 6207447', PA01 __ _ PA01 208AO5 1818388'PA01 208A06 1 3644300, PA01 208AO7 1 11848511 PAOI 208AO8 8990391 PAOI 208A08 208AO9 j 1 579968j PA01 208A10 ì 3748677X. PA01 !'208A11' ! 1753681"PA01 208Al2 39557081 PA01 208B01 2147215j PA01 3 208B02 10510753 PA01 208BO3 5751317i PAOI 208B04 1 27062231 PA01 208BO5 29637581 PA01 208B07 54527983 PA01 l, 208BO9 551772& PA01 208B10 26969251 PA01 208B11 18685121 PA01 v 208B12 j789906 PA01 ! .......... 208COl 2144553 PAOI 208C03 3 1884350 PA01 3 208CO3 1884350 PAOI 208C03 1884350 PA01 ; 208C04 2595198} PA01 208C05 468401 PA01 208C06 2 2516386 PA01 208C07 1 323308 PA01 208C08 1906892 PA01 w 208C09 6226412 PA01 J 208ClO 33977741 PAOI 208C11 j 369550 PA01 208CI2 12951661 PA01 208D01 _ 246643 PA01 208D02 1426102 ! PA01 208D03 5000428j PA01 208D05 5041900 ! PA01" 208D06 H 915773 208D07 2453351 Paroi 208DO9 807493 PA01 b 208D10 2364618 PA01 208D11 2495714i PA01 208E01 22828351 PA01 208EO2 12743701 PA01 571457 PA01 208E05 L 32371933 PA01 208E06 1 5729356 PA01 3 208E07 1 13009201 PA01 3 208E08 2614404 PA01 v 208EO9 5726385 Paroi 208E11 4707308 PA01 208E12 5405477 PA01 3 208FOl 56689521 PA01 L 208F05 í ! 60548i PA01 . 208FO8 4366772' : PAOI 208F09'25586151 PA01 208F10'2368341i PA01 208F12 1 5440088i PA01 208G01 ! 1203434, PA01 208G02 1 4164444 ! PA01 208G04 ! 3250914T"PAOT'' PA01 )""'208G06'""T"1566549"PA01"'' 208GO7 57513171 PA01 208GO8 9061841 PA01 MoF,, sany HAOZ 208GO9 36531481 PA01. 208G10 _|__ 40301171 PA01 4288041 PA01 208glu 208GI2 PA01 208H01 i 1203434 PA01 208HO2 PA01 208H03 Ij 62gM7 PAD1 j208H04 1656566 PA01 1 208H06 1047003 PA01 208HO7 3712793 PA01 208HO9 60456161 PA01 auS s v- 208H10 ; 1972791 PA01 208HIO 197271-1----PA01 209A01 t gptffl3201 37957631 PAOI 209A02 15080941 PA01 209AO3 34369491 PA01 209A05 3464395j PA01 209A06 4351 076r PA01 209AO8 142790 PA01 209AO9 12479591 PA01 209A10 1 54616t PÄ01 209A11 4724385i PA01 209A12 4167152 PA01 209B02 29388421 PA01 209B03 _ 59814051 PA01 209BO4 3059063 PA01 209BO5 5306956 PA01 209BO7 3060202 PAOI 209B08 50608631 PA01 209B09 31754391 PAOI 209B11 2016265 PA01 ) 209B12 6231371 PA01' 209COl PA01 209C03 i 10023901 PA01 209C042567099 PA01. 209C05 112162 Paroi 209C07 5649595 Paroi 209ClO 3201319 PAOI ; 209C11 4161229 PA01 ! 209C126139876 PA01 1 209D01 1 01 209DO2 5302623i PA01 209D03'"'"5539080 PA01 209DO4 1 4130479J PAOI 209D05 ; 5550334i PA01 OgpOg-2097505} PA01""""" 209D06 2097505'i PA01 ,'; 209D07, 24914491 PA01 '209D10'] 2007205PA01" ----- ;---.---- 209D10 | 20072050 PA01 209D11'; 1434130 PA01 209D12 365141 PA01 209E01 1078894 Paon 209E02 5006975 PA01 209EO3 2375364, PA01 209E04 6122838 PA01 209EO8 60557011 PA01 209EO9 55640611 PA01 209E11 1 1849784 PA01 5163272 209E12 5163272 PA01 209F01 2129412 PA01 209F06 1756203 PA01 i _ 209F07 31 31148 PA01. j 209F08 4976159 PA01 H 209F10 4998866 PA01 209G04 1215123 Paroi 209GO9 209GO9 4152886 PA01'. 209gel 209G12 16817761 PA01 209H01 2607884 PA01 209H03'j'3914200 PA01 ! 209H04 2958261 PA01 209H06 4100728 PA01 209H07 3418100 PA01 209HO8 27800791 PA01 s g 209HO9 6153237 PA01 209H10 5768034 PA01 209H11 2070291 PA01 210A01"""1566548'PA01 ! 210A02 1566549 PA01 210A03 2978019 PA01 21OA03 210A04 342605 PA01 í__ _. ___. _ 210A05 204224 PA01 210A06 3932330 PA01 21OA07 1018475 PA01 210A09 _1231310 _PA01 .......... 210A10 2229888 PA01 T 21 OA11 1 3220503} PA01'i 21OB01 2979372 PA01 21OB02 1300919 PA01 210B03. 3914199 PA01 ! _4 U746>3 P/\01 w 210B05 3591242i PA01 ! 210B05) 3591242 PA01 ! 21OB07 10825581 PA01 210B08, 1161513. PA01 21 OBO9'. 397732'PA01 210B11. 2978019s PA01 210C01 i 2124983, PA01 __ _ _ _ _ __ _- ! "''' _ m_ 21 OB09 PA01 3977 321 21 OC04 2082490 ! PA01 210C05 2082490 ! PA01 210C07' {20468811 PA01 210C08 1 5768034 ; PA01 PA01 1016630 210C10 1080473 PA01 L-, 210C11 j 915803 PA01'"" ! 21OC12 344273§1 PA01 21 OD01 3744782 PA01 210D02 j 1383796} PA01 : 21OD04 1938348i PA01 ^ 21 OD05 3496050 PA01 210DO7 566400 PA01 210D08 1 1199969 PA01', 210DO9 2847431 PA01 210D113627888 PA01 ! 210D12 4839272 PA01 --- 21 OE01 4531 158 PA01 210E02 3839120 PA01 1 2'I OE03 5225978 PA01 210E03 1 5225978 PAOX 210E04 | 6054624 PA01 21 OE05 5791803 PA01 210E06 OE06 3262459 PAP1 210E07 1028922 PA01 21 OE08 5736496 PA01 21OE08 210E09 1290741 ; PA01 21 OE10 81 9958i PA01' 21OE11 26411371 PA01 210E12, 3005783 ; PA01 210F01 ; 9481261 PA01 _21OF02 517 21 OF02 51740411 PA01 210F03 2729756 ; PA01 , t1 210F04 2437164 PA01 21 OF05 120468 PA01 M 21OF06 4492082 PA01 21OF07 1225209 PA01 21 OF08 1 3995547i PA01 210F11 1 2089460 PA01 210F12, 2090489 PA01 j 210G01''1109319'PA01') , _ 210GO2 12229061 PA01 210GO3 56672171 PA01 j 210G04 5456821 PA01 210G06 i 5118668i PA01 511 E 21. OG08 4237859 PA01X 210GO9 ! 1185192L PA01 ............ -.-.--.. g--p-- 210G12 5648597) PA01"J ! __ 210G12. _ 56485g7f PA01 210H01'. 2262738 ! PA01 210H02"498406J PA01' 21OH03 3307531 PA01 21OH04 34562661 PA01 21 OH05 f ! <7m ; ; Es 21OH05 27050531 PA01 210H06} 5247545'PA01'" ,-210H07"'"i'3685973 !"' PA01'"" 21OH08 1847611 PA01 210H10 1513243ç ; PA01 21OH11 234522541 PA01 211A01""""'""'"'1041171'"'PA01""] 211A02'5530237 PA01'"1 211A03 1746364 PA01 i 211AO4 5493271 PA01 211A05 31998501 PA01 t ; 211A06 4251 879j PA01 211A07 1008183 Paroi 211AO9 3233217f'PAOI 211A10 7<--'-'1 211A11 2122725 Paroi 211A12 1 6183483 PA01 211 B01 i 4047636 PA01 l ---v v r 13 PA01 ; 211 B03 1 49112961 PA01 211BO3 211B04 5806839 Paroi 211 B06 2560986 Paon 211BO7 4351074 PA-0 211 B08 3288834 PA01 - 211B09 4666239 PA01 211 B10 2349849 PA01 211 B11 1838025 PA01 f 211B12 5890628 PA01 211 C01 6133959 PA01 211 C04 5890628 PA01 ; r"211C04 5890628 PA01 !"'211C05---gog po 211C06 42840771 PA01 & 211C07 4414026t PA01' 211 C08 1103071 ; PA01 j 211C10 6054624 PA01 r e -60555 5 ms wi 211C12 34796371 PA01 ! 211D01 5611963 PA01 211 D03 54040501 PA01 _ 211D041717810 PA01 211D06 5736945 PA01 211D07 5915883 PA01 t 211D081439067 PA01 211 D10 709828 PA01 211D11 3574398 PA01 r 211D12 5058053,'PA01 j ! 211 EC 1"""""]'"5310269 !'" pA01""""" 211 E02 _ '_4923520 PA01 M : 211 E01 53102693 PA01 _ 211 E02 _ i 49235201. _ PA01 1. 211 E03 5530236, PA01 s 211 E04 i 61775903 PA01 211 E05 3 55367323 PA01 211EO7 6212141 PA01 211 E08 3 7796303 PA01 211 EO9', 8582521 PA01 211E11 ! 9831063 PA01 211EIl 983106 ! i PA01 211E12" ! 5881570 ! PA01" : 211F03 1 17934741 PA01 v wo 211 F04 f 2919009 PA01 HI 211F05"""T---5Q38237 PA01 i _ 211 F05 211 F06 1 1298975 PA01 211F07 _ ! 3988591 PA01 211F08 2705052 (PAOI 21IF10 431629 ! PA01 211F11 4618389 PA01 ? 211FI2 6178519 PA01 211G01 1417026 PA01 "211G02310573 PA01"J 211 G03 1635441 PA01 ! 211GO4 1576228 PA01 211 G06 1 383796g PA01 211GO7 673714 ! PA01 211GO8 37639811 PA01 211 GO9 4273050ì PA01 t _ < FF _ 211 G10 _ 171220 PA01_' 211 G11 3t 4866743 PA01 211G12 3 44817603 PA01 211 H01 5565441 PA01 3 211 H02 14567771 PA01 211H04 4185121PA01" 211H04 4185121 ; PA01 i 211H06 287970 PA01 i 211 H06 287970 PA01 r 2 r r 3 sS-~--211 H07 1 25078381 PA01 ss v 211HO6 2879701 PA01 s g 211H09 T 2507837J PA01" 211 H10 3965601, PA01 211 H11 644769 PA01 Es f 212A01"'3054726JPA01"' , 212A02 3518465 PA01 212A03'1878482 PA01'1 212A04 !'"""''2139722 PA01 i 212AO5 16902131 PA01 Ij 212A06 33039103 PA01 WZÇ 11556363 PA01 Ji 212A08 204225 PA01 ! 212AO9 f 9406i1i PA01 ,... _ 2559947 212A12 4097853 PA01 i _ 212B01 _ j 4871941, 5 PA01 212BO3 42371 LJ 212B04"""1353369 ! PA01" 212BO4 13533691 PA01 212B05 1016481 PA01 212B08 i 1079350i'PA01 212BO9 ! 1489268J PA01 2126104543990 ! PA01'" ) 212B11'j 2437187iPAOf"" 212B12 ! 9562815 PA01 4 212C02 2634700 PA01 21 2C03 45 2418322 PA01 212C05 i 3217315 PA01 PA01 212C06 2783180 PA01 212C07 1 6077307 PA01 212C09 4868953 PA01 J 212C11, _L_ 2253177 PA01 212Cl2 33838091 PA01 212D01 44426 PA01 _ 5 212D02 5869999, _ 268244 P . P""i 212D05 5169708 PA01 3 212D06 4548485 PA01 212D07 2924072 PA01 _ 212D08 1884350 PA01 212DO9 1047003 PA01 iR ~ 212D10 3225955t PA01 212D11 1627843 PA01' 21 2D12 1 53689C PA01 212EO1 3577840 PA01 21 2E03 1006405 PA01 212E05 4515966i PA01} 212EO5 212E06 3323357i PA01 212E07 1 33297141 PA01 x il 212E08 5493271 PA01 ° 212ElO PAOI 212F01 4097853 PA01 w 21 2F03 6026292 PA01 212F04 2513187 PA01 212F05 30053925 PA01 212F07442247'PA01 j ;, 212F08 1 2173490 PA01 212F09 1 93881 PA01 J f 21 2F10 1 1920197 PA01 , _ 212F11 5 35743981 PA01 31495611 PA01 212GO2 8990 j_ 212G03 1868512_ PA01 ! 212G04 5401097 PA01 j 21 2G05 i 24945218 PA01 r 212G07 4433790 PA01) 212GO8 5256962 !, PA01 4949481 pua01 212G11'2116304i PA01 '212G12"1523526 PA01"". 212H03 i 2$38 212H04 204225i PA01 212H05 i 1966081 PA01 212H06 575242i PA01 212H07 53175511 PA01 r""212H10'r"'5173878'PA01'' i"212H11'1'1799610 PA01 212H11 e PA01 F 213A01 I 1802886 PA01 213A03'"1185192 PA01 _.. _. _ _ 213A04 1 4481799 PA01 481=799 PA01 213A05 _ _ 4339105 PA01 213AO5 43391051 PA01 213A06 1 1985981j PA01 5302623 PA01 _ 213A07 1776862 PA01' ! 213A08 213AO9 2092352i PA01 | Z 21 3A10 3974627 PA01 !'213A115085439 PA01 j w ! 213A12''547097 PA01") 213B01 154_0029 PA01 213BO2 33838091 PA01 213B04 3897607 PA01 j 213B056050836 PA01 ! 213B07 5740849 PA01' 213B09 6050300 PA01 213BIO 23803771 PA01 213B11'1 37611891 PA01 213B12 6099646ii PA01 213C01 16350201 PA01 ii 21 3C02 i 5398475 PA01 i 213C03 _ 1114089j PA01 213cl3 213C05 5062994 PA01 21 3C06 415993 PA01 ; 213C07 325029 PA01 213C08'"''"5497562 ! PA01 , 213C10 4836928 PA01 - 213C11 6014682 PA01 2 1 3C 12 4 1 76072i PA01 213D01 1078989 PA01 ; 213DO2 32353771 PA01 213DO4 PA01 213D05 1963822 PA01 I 213D06 359488 PA01 ; j 21 3D07 1 13604703 PA01 213D08359488 PA01) 213D11 1 546268j PA01 I l | 9 i 213D12 3876354 PA01', _ _. _. _ 213E01 ! 1781790j PA01 4119159'1 PAOI 213EO3 213EO5 21365101 PA01 213E06 j _ 817116 ! PA01 213E07 J 1304734j PA01 21 3E08 3 3288834i PA01 213EO9 6129947, 1 PA01 213E10 5431715'j PA01 213E11'5781283j PA01 213EI2 5094530 PA01 3595641 PA01 --. _. ___ 213F05 1814561, PA01 21 3F07 4097371 PA01 21 _ 65418 _PA01 21 3FO9 j 2269034| PA01 _ 213F10 1 2907156i PA01 213F11 621214| PA01 213F12 4618778 PA01 H 213G0250610 PA01 213G03 1 4013674'j PA01 213G05 1175244 PA01 213GO6 870533 PA01 213G07 _ _2848392 PA01_ P7 213G08'''1884350 PA01'' 213GO9 5318004 PA01 s 213G11 5649851 PA01 213H01 i 1948242i PA01 21 3H02 < 213HO3 204224 PA01 213HO4 4485523 PA01 213HO5 359564 PA01 213H06 5743036 PA01 213HO7 4721155 PA01 213HO9 4921261 PA01 213H10 288426J PA01 ! 214A01 3643355j'PA01 214A02 2023760 Paon 214A03 6178520 PA01 t 214A04 1911547 PA01 214A05 1530709 PA01', 214A06 1832265 PA01 214A07 | 2029012 PA01 ~1 4531 369i PA01 214A10431629 PA01 ! 2 1 4A12 306705 PAO 1 j214B01554311 PA01 ! 214B02 4810359 PA01 214BO5 1354643 PA01 214B07 1 4204238 PA01 214B08 3510655 PA01 214B09 5424122 Paroi 214B11 3 1926174t PA01 214B12 1 46645718 PÅ01 214C01 1 2208458j PA01 214C02 3 2495716i PA01 F-214C, 02 24957161 PAO 2i4C03 10793501 PA01 f ; 10793501 PAOI 214C06 r < PA01 f""'214C06"'""') 2705053 !" PA01 214Cl2 27261061 PA01 T 214D04 2943719'PA01 214D05 E 5854085 ! PA01 214D06' ! 18334581 PA01 ! 214D06 J 1833458 ! PA01" 214DO7 4199791 PA01 214DO8 4403888 PA01 H 214D10 j 2343237 PA01 J 214DlO 214E01 1 931505 PA01 214E03 | 3442739 PA01 214E05 1 5979223 PA01 214E06 ! 5979223l PA01 3704676 PA01 214E07 21 4E08 4492082 PAO 1 214E09 937742 PA01 ' 214E10 2215587 PA01 d _ 214E11 ; 398190 PA01_ _ 214FOI 2888987-PA01 214F02 3374109 PA01 214F035714574 PA01 ; E 214F04 4553579 Paon 214F05 22306C PA01 m 214F06 2668026PAOT -v S 214F07 1 5358757 PA01 21 FOD ZU1 1 37 i __ 214F09 _ 2641137 PA01 _ £ 214F11 2719501 PA01 214G05 2712102 PA01 214GO6 19248321 214G07 _ 32637271 PA01 214GO8 1 214GO9 8002991 PA01 m ; aar < 214G11 2477596 PA01 214G12""""552448"PA01'1 215A01 1 1669748 PA01 215A03 t 1403774 PA01 215AI0 3595641 PAOI j 215B01 6152322 PA01 1 215BO4 40340191 PA01 215B05 2389714 PA01 21 5B06 4839271 PA01 215B07 4155066'PA01 215B08 4098085 PA01 215C09 546269 PA01 215DO2 1551037 PA01 215D11 1078823 PA01 215E02 32041601 PA01 Lx^ Ae 21 5E03 T 3929603j PA01 Ir L 215E04 3397911]"PA01 i ! 215E12"" !'4313378J'"PA01"""" 21 5F04 l 2345224j PA01 {215F11 i 31697091 PA01 215FIl 31697091 PA01 215GO3 T7768641 PA01 215GO7 14286591 PA01 21 5H02 4492082i PA01 215H03 ì 3712733i PA01 215HO4 20072051 PA01 s 215H081995877 PA01 216A08 21 6A08 1070675 PA01 216A11481393 PA01'" 216B08 w 6198757 PA01 w--. 216BO8 PA01 216B11, 3358655tj PA01 216B12 i 2990462 PA01 - 216C03 5056159 PA01 216C05 866792 PA01 216C05 886792 PA01 216C10 4420322 PA01 216CIO 44203221 PAOI 216D05 6087728 PA01 216DO7 2116304 PA01 j 216D09 3201319 PA01 216G051117230 PA01 9 216G06 3870651 PA01 216H03 1045876 PA01 216H07 1526024 PA01 217A02 5270098 PAOf"1 217A03 S PA01 z 217AO9 6612341 PA01 217AO9 6612341 PA01 217B05 5263318 PA01 217BO6 59684891 PA01 217B08 5390024 Paroi 217BlO PAOI 217B12 _ 2333500 PA01 217CO4 2012771 PA01 s 217C05 4149020 PA01 217C07 546268 _ PA01 _,. _. _ _ 217CO9 546268 PA01 217C10 546270 PA01 217C11546268 PA01 R 217D021286664 PA01 j 217D06 546268 PA01 217D07 1289165 PA01 217D08 | 546268j PA01 j217E01 4251879 PA01 r 217F01'"''"5646692 PA01" 217F02 1687894 PA01 217F05546271 PA01 217F07 338950 PA01 ; 217F09 2506126 PA01 217F11 3390739 PA01 217F12 3390740 PA01 217G05 6fl12265 ; PAD1' _. _ . w_.. _.. _ 546268s PA01 21 7G07'. 546268j PA01 217GO9 í 1146734si PA01 !-217G11'J 3515481PA01 217HO2 5462691 PA01 217HO4 40317861 PA01 38919611 PAO 1 217HO6 57680371 PA01 L'217H08--"'546268J'PA01'""" 217Hll PA01 218AO1 9540871 PA01 21 QA 2 PAO 1 218A03 _1 38096830 PA01 218AO4 1972791 PA01 _ 5568853 PA01 218A06 4910637 PA01 ! 218A08')""5217883 PA01"1 218AO9 4492177 PA01 218A10, j 1830069 PA01 218All 4257084 PA01 218A12'"'"65418 PA01 1 w 218B01 4144351 PA01 mS 218B03_ 767461E PA01 218BO5 4362401 218BO6 4362401 PA01 218BO7 21734901 PA01 218B07 ; 2173490 PA01 i ! 218B08 2173490 PA01 28s c m-' 218B12""T"'5147713 PA01"" 218C02 0 307866 PA01 21 8C03 492126 PA01 218C05 2453351 PA01 218C06 4704214i PA01 218C07 T 371914 PA01 ! 218C08 2408226 Paroi j 218C11 ; 6228869 PA01 218D02297517 PA01 ! T T s 2975171 PA01 218D04 297519 PA01 ! 218D06 3725010 PA01 j"218D07'1985278 PA01 i 21 8D08 999927 PA01 218DUS 31920851 PA01 218DO9 21 8D10 4284004'PA01 21 8D11 3707859 PA01 218E01 3627888 PA01 t 218EO2 5980173 PA01 21 8E03 2963758 PA01 !'218E07 3578842 PA01 j ! 218E08 946484 PA01' 218E10 1064932, PA01 21 8E11 6838zo PU1 .. ......- g..... -.-, 4g4-..-- 218E12 i 4748413S PA01 218F02 3816551'PA01 ""218F03'3 339460J PA01'' 21 8F04, 5982276, PA01 218F05 5142000 PA01 21 8F06 1 2023760l PA01 21 8F07, 4275578S PA01 218F06'i2023760 ! PA01' ; : _ . _. _.... 218F08'" 6122079 PAqi"" '218F09'"'''"'' 565522 PA01"' r 218F10'4314876 PA01 218F115147705 PA01 ; 218GO1 16902131 PA01 218GO2 6227025 PA01 218G03 4990664'PA01 s 218GO6 1809683 PAOI 218GO7 14290841 PAOI 21 8G08 125185 PA01 218G09 5944773 PA01 s 218G10142140PA01) 21 8H01 3748607 PA01', 218H03 i 49021 11 PA01 218HO3 4902111 PAOT 218HO5 3389501-A 0 218H06 ì 4835152 PA01 21 8H07 4835152 PA01 218HO8 2535511 PA01 218H11 768212i PA01 219AOI 3954605 PAOI 219A02 2124983 PA01 219A03 | 1018388 PA01 219AO4 894630 PA01 s 219AO9 _ 6189403 PA01 21 9A10 1427357 PA01 J'219B02 4675165 PA01 219BO2 46751651 PAOI 219B04 2959606 PA01 < 2959808 PA01 | 219B05 __ 5500125 PA01 21 9B08 5163272 PA01 21 9B07 739442 PA01 21 9B10 1186050 PA01 . . _.... _.. _ 219B11 135464 PA01 219C01 5807299 PA01 219C045842394 PA01 219C05 ! 1428659 PA01 219C07 147329 PA01 21 9CO9 3659896 PA01 219C114299389 PA01 219Cll 4299389 PA01 219D02 1717810 PA01 i 219D03 2375365 PA01 219DO4 3636321 PA01 f 219D05 5157544 PA01 ! 219D06) 5256933 PA01 ! 124921, PA01 _ 219D10 1 3209115, PA01 ! 219D12"T-229062 PA01 * 219EO4 8071801 PAOI _ 21 9E01 ! 3643734i PA01 i 219E04 i 807180i _PA01 219E06 ; _ 4623728 PA01 ,.'"219EQ5'""""j"""""5497561 PA01' 219E06 j 4623728 PA01 219E08 s 46237281 Fo i 219E09'"j 5280699 PA01 i""'219E10r 1513243 PAOf""" 219E11 f 5694210 PA01 21 9E11 5694210 PA01 w-s 219E12 _. ; 874289 PA01 j"219F03"T6192289 PA01 _ 219FM 537342S PA01 21 9F05 2544966i PA01 21 9F06 _ 1889748 PA01 i 219F08 12747845 PA01 ; ' 21 9F10 1 1535896 PA01 219F11 a PA01 219F12 51924 PA01 219GO1 3341291 PA01 219 219 219GO2 PA01 219G02"""5980173 PA01 ! 219GO4 2780079 PA01 219G06 1260624 PA01 219G08 5807299 PA01 219G11 82121S PA01 219G12 _ 2341527 PA01 219HO2 3748607 PA01 219HO5 5254106L 21 9HO9 4864670'PA01 P a 219H10 1 46050591 PA01 219H11 3578842 PA01 ! 221A03 5165608 PA01 221A04 3616674 PA01" 221AO5 361667411 PAOI S 221AO9 41944271 paon 22lAlO 5697208 PA01 221A11'906144 PA01 221BO2 1128863 PA01 221304 r PA01 221 B07 5807299 PA01 221BO8 389138 PA01 221B09 1535898 PA01 221B101524451) PA01 21 BXo 1 UN45s M1 } 221C01 1351298 PA01 ! L 221 C02 1428659 PA01 221 C07 2780079 PA01 221 C09 6147917 PA01) 221D02 _ 1876783, PA01 221 D03 441618 PA01'1 221 D04 114208t PA01 221DO5 1927, 015 PA01 f il. i 1927015 ; PA01 221 D07 389138'i PA01 221 D08 _ _'4284004, _ PA01 221D09 1 2129299 PÄ01 221 D1 _ l 28161 37t PA01 ! 221ED1 3149421 ; PA01 ; __ 221D12 1 1954769 ! PA01 221E01 !, 3149421 PA01 221EOI ! 221 E02 1954769 PA01' 221EO4 2958261 PA01 ! 221E04"295826 PA01 ) 6 23452251 PA01 __. _. _.. L 221 E06 _ _ 23452251 PA01 221 E07 1 028922r PA01'. 221E08 4665321 PA01 221 EO9'12589801 PA01 221E10 T 4911294 PA01 221 F02 j 5807299 PA01' 221 F03 1412674 PA01 m w 221 F04 5222012i PA01 221F05 5793067 ! PA01 29 8242 PA 221F08 2253537 PA01 c 221 G02 54536 PA01 221 G03 2282835, PA01 2282835, 221 G03 2282835 PA01 221 G04 5659898 PA01 221GO5 35223831 PA01 221 G06 5868602 PA01 221G08 | 3659896 PA01 221G11 3659896 [___PA01 _ 221 H01 455856 PA01 221HO2 221 H02 6215271 PAD 221H041037317 j PA01 _ 221H04 A 1037317 PA01 221 H05 1 6075274t PA01 221 H07"3146923 ; PA01 22 F OB K 221HO8 55517111 PA01 221HO9 1383796 PA01 221 H10 2849w PA01 221 H11 1164559i PA01 222A05 52540490 PA01'. 222A11 1064475 PA01 222B01 35788421 PA01 222B08 6160886 PA01 222C01 4866959 ! PA01 m 222C06 | 2849701, PA01 222C08 __21653612 PA01 222E12 47902951 PA01 222F05 5272676 PA01 <2FS 5 7t 222FIl 5676227 PAOI 222G07 1426101 PA01 # 222H09 3456266 PA01 223AO2 5905666, PAOI i J j 1Q44464J PA01 ! S 223A08 i. 5242954i PA01 223AO9 800304i PAOI 223A11-4194332 ; PA01 223AIl 223A12 ! 973842 PA01 223B01 i2022761 PA01 ! 223B03 j1832265) PA01 ! 223B05'. ! 3876264 ! PA01 223B07 : 5069695 ; PA01 223B11 T 4194332 !""PA01'"" 223CO3 32391171 PA01 223C04-- ! 5263348 ! PAO_1 ) 223C05 !'3848409) PA01 r""'223C08""" !""' 556544) PA01"""" 223Cll 60555151 PAOI 223C12 6168358 PA01 t 223DO3 39166041 PA01 223D06 503879 PA01 223D03 j 3916604i PA01 223DO8 51239351 PA01 223D09 3219768 PA01 223D10 3293888 PA01 223D12 T 899039 PA01i 223E01 3926495 PA01") 223E02 41447831 PA01 223E03 340386 ; PAO_1 ( 223EO5 13546411 PA01 223E06 J 4501879 PA01 i m 13 m 223E07 1 1906891 PA01 223EO8 2471654 PA01 223EO9 4845087l PA01 223E10 51551591 PA01 . i J ; 223E11 _ 5155159 PA01 i i, 223E12 4585465, PA01 223F01 2428896i PAOI 223F02 1289165 PA01 223F03 2375364 PA01 223F04 5913087 PA01 223F055173878 ! PA01j 223F06 59670181 PA01 i 223F07 5967026 ! PA01 ! 223F09 3472893§j PA01 223F10 6122079 PA01 i _23F11 2. 92097 PA01 223F12 L 11030711 PA01 223GO1 4627085 PA01 223G04 1195802 PA01 223G05 5171632 PA01 223G07 5632974 Paon 223G08 3627888 PA01 '-223GO9 4494640, PA01 Hm 2223G10 190613T PA01 ; < B8 PA01 223H03 1 876432i PA01' 223H05', 2930684j PA01 223H06, 5930686, PA01 223HO8 40161501 1 223H08 i 40161501 PA01 '"""223H10 t""170396""''PA01I 225AO2 16528171 PA01 225AO3 247511 PAOI 225A03, l 247511. PA01 jA1i 3398642 PAK A1 j 3398642j PAK t A1 i K PAK L A2 3379723 PAK A3 2791021 PAK A4 2715492 PAK A5 1 2733396 PAK B4 B4659794 PAK ! B6 3509503 PAK B6 3509503 PAK BEMA01 58226871 PA01 BEMA02 1876791 PA01 BEMA03 4708706 Paroi I BEMA04 1970426 PA01 BEMA05 1017919. PA01 BEMA06 5804328 PA01 BEMA07 1901425 PA01 BEMA09 1897874s PA01 ; 531 BEMA11 5316153 PA01 t BEMA12 1970426"PA01 s BEMB043510219 PA01 j BEMB05) 518952 PA01 ! -- BEMB05 518952 PA01 BEMB06 1522099 PA01 BEMBO9 884859 PA01 BEMB10'10239011 PA01 E BEMC01 2798272} PA01 ! BEMC09'5957696'PA01 j BEMC10 5685243 PA01 BEMC11 15868171 PA01 J n C1 4583326 PAK C4 3144781 PAK t C63509503 PAK ! n t D1 ; 1 4583326 PAK D2 3509503't PAK D4 46382604 PAK t D6 PAK yq-tray-434 5707222'1 FiA-K-,' yq-tray-434 5707222 ; PAK yq-tray-438 1725057 PAK yq-tray-438 i 17250571 PAK yq-tray-440336321 PAK. yq-tray-441 3761498 PAK yq-tray-445 1 52999191 PAK yq tny 99 3659364i PAK yq-tray-509'3659364 PAK i ! yq-tray-510 5252933 PAK 1 PAK - tra-514 157070 ; I PAK yq-tray-515 1 w FK r yq-tray-517 ! 1051875i PAK yq-tray-519 ! 5617558 PAK J" = yq-tray-519'. 561 7558i PAK PAK yq-tray-520 i 3593363s PAK yq-tray-522 1 339721 f PAK PAK yq-tray-523 ; 456995'PAK --947-588. 1' PAK yq-tray-L2 772748i PAK yq-tray-L4 974632 PAK yq-tray-L6 4711864 PAK yq-tray-L6 L yq-tL'be-423T 6154439 PAK, i yq-tube 425'PAK yq-tube-426 1 19228901 PAK I PAK yq-tube-427 455162j PAK yq-tube-432 5429711 PAK tj yq-tübe-433 r 3551095, PAK ........ PAK yq-tube-436 6154439 PAK yq-tube-438 1 725056i PAK yq-tube-438 yq-tube-440 336321 PAK yq-tube-441 3761498 PAK yq-tube-443 2905443 PAK yq-tube-445 5299920 PAK yq-tube-509 3659364 PAK V9 tube ; 10 5252933 PAK PAK yq-tube-511 5863244 PAK yq-tube-512 1921018 PAK PAK yq-tube-514 157070 PAK yq-tube-515 4788598 PAK _ !, yq-tube-518 1051874 PAK yq-tube-520 3593364 PAK yq-tube-521 t yq-tube-522 339721 PAK yq-tube-523 456995 PAK SS J yq-tube-525 420142 PAK w wo yq-tube-526 3947590 PAK tj yq-tube-L2 772748 PAK yq-tube-L4974632PAK ! yq-tube-L5 842580 PAK yq-tube-L6 _ 4i11864 _ PAK 71 yqO01 346171 PAK yqO02 3461711-15AK-l' PAK yqO03 5010879 PAK yq003 yq004 4815201 ! PAK'1 yqO05 1 34408107 PAK yqO06 1 40605661 PAK yq007 5621597 PAK y009 yq008 5450213 PAK : yq009 5852319 PAK' yq010 5336484 PAK i yqO11 7 42D422, PAK fi 718708 ; PAK ' !""""yq013' !''1051362J''pAK'""" 'yq014"'""'1433889) PAK' yq015""""5304562 PAK yqO15 J 5304562 PAK VqOl6 617f PAK yqO16'. 3461 71, PAK yqO17'. 5638092 {PAK | yqO18 ; 5010879j PAK PAK yq019'4815202 PAK Vq02O 34408101 PAK r"yq021""""'14060566J'PAK"'. ;. _ __. yq022 5621597 PAK yqO24 5852319 PAK yq024''5852319"PAK yqO25 53364831 PAK yq026 420422 PAK .......... yqO27 i 718708 PAK yqO28 l 1051363 PAK J yqO29 1433889 PAK'. yq030 5304562 PAK j PAK yqO44 4910942 PAK j yqO45 3158388 PAK' yqO46 5781323 PAK yqO47 3462938 PAK yq048 4806787 PAK yq049 5254917 PAK yqO50 879367 PAK yq051 3666061 PAK yqO52 5682932 PAK yq054 4437930 PAK i yq056 2355967 PAK yq057 1036633 PAK yq058 23108641 PAK yqO60 ! 3968 ! PAK : yqO62 53263591 PAK u v yq063 4787579 PAK yq064 3006981 PAK yqO65 24632 PAK i yq066'" !"'5197201 PAK yq067 17465 PAK' yq068 1855301 PAK yqO69 5376060 PAK S i * yqO70 1 5781323 PAK yq0711868969'"PAK j yq072 2341355 PAK yq074 7607 PAK' yqO75 1 2668034l PAK m i yq076 6002335 PAK yq078 5045325 PAK ! yq079 136420 _ PAK _ yq080 450182 PAK ; yq081 5342602 PAK yq082 (4960596 PAK ! yq084 6184207 PAK i __ V_ _'Yq086 . _.-. _'.. .. __-6069286 ! PAK. , _, yqO85 s 4540967$ PAK yqO86 i 6069286$ PAK yqO87'4863021 ! PAK yqO86 6069286 ! PAK yqO87 48630211 PAK yq088 ^ 5943943 ; PAK yqO89 6105445i PAK 4922981 PAK yqO9o yqO91 5640098 PAK yqO92 3573502 PAK j"""yq093'L 3947134 !'" PAK" yqO94 60141401 PAK yq095 J 4060078 PAK j yqO96 2738432i PAK yqO97 ! 3142555 ; PAK yq098 1349094i PAK yqO99 j 5255164j PAK yq100 4939275 PAK yq101 1958774 PAK yq102 6256002 PAK yq103 5449654 PAK yq104 5303638 PAK yq105 5855552 PAK yq1061355230 PAK j yq1076014340 PAK yq1097211 PAK yq111 1725699 PAK yq112 4792140j ;. PAK $ yq113 3525719 PAK yqll4 yq114 3562829 PAK ii yq115483336 PAK yq116 3948019 PAK 0 yq118 3551530 (_PAK Z PAK ! yq120""5674845 PAK yq121 6132273 PAK yq122 ZIDoD sK $ yq123 5993718 PAK yq124 4904227 PAK r yq125''"5827382 PAK yq127 5232107 PAK M yq128 4191195 PAK yq129 4281645 PAK yq131 j 4079776 PAK $ yq132499212 PAK yq133 1445149j PAK oe yq134 _ 18485771, ___ PAK yq135 j 5617827j PAK yq136'"3769518j"PAK yq137 3324609 PAK yq138 4787523 PAK yq139 4314367 PAK yq140 274655 PAK yq141 ! 4013122j PAK yq142 ii 1091008 : PAK __. _____------r--''~'~~~ yq144 1 5273651 PAK 5 52736511 PAK yq145't5273651 iPAK ! T. yq146 ! 1050594i PAK yq147 1 5844719 ; PAK yq148 i 4790607 ! PAK yq149 ! 2955955 PAK"" yq149 i 2955955i PAK yq150 i 2605446 PAK i yq151 i 6132505 PAK yq 152 5764392 PAK yq153 467804 PAK yq154 ! 52244781 PAK _. ___. Yq155 _____. _, _. _5943918J. PAK. __' yq156 45231 97i PAK ii yq 155 59439181 yq 4523197 PAK yql5 3418100 PAK yq158 i 3445426 PAK yq159 5209130 PAK yq160 3658891 PAK yq161 5968499 PAK yq162 38793991 PAK yq163 5923053 PAK i yq165 4998512 PAK yq167 4508569 PAK yq170 5781283 PAK yq171756481 PAK ! 'yq172 6032525 PAK""j yq172 60325251 PAK yq173 j5301398 PAK""j yq174 6013215 PAK yq176 488500 PAK yql77__ 3474448 PAK x m yq179 35935271 PAK yq180 4831330 PAK yq181 6106545 PAK yq182 1600391 PAK yq184 3070088 PAK yq185 5638129t PAK yq186 450406 PAK yq189''4525467""PAK yq190 2913281 PAK yq191 124495 PAK ii yq192 1748207 PAK yq193 43039 PAK = yq194456035 PAK yq195 5342235 ; PAK yq196 _ _3552017j PAK _ : yql98 1081709 PAK yq199 4860003 PAK yq201 608110 PAK yq202 5853213 PAK yq203 6138043 PAK J yq204 6138043 PAK yq206 3190834 PAK L yq207 L 12275181 PAK 6077287s PAK ___ : L yq209 J396394 ! PAK' r yq210' ! 18585931"PAK' !. yq212 i 1920624 AK 1 yq212 19206241 PAK yq214 ; 4057373a PAK yq216 [5707528a PAK i yq216 5707528, PAK Vq2l7 4792484t PAK yq217 i 4792484i PAK i, yq2 18 i 3630984i PAK yq2l9 1 33239011 PAK f"yq220""5346101 PAK j 43359381 PAK s yq223 ; 395319i PAK yq224 i 4790530j PAK t i yq2274799812 PAK j yq228 4525490 PAK ! yq229 41586581 PAK j"yq230 355575 PAK j yq231 1664781 PAK yq232 5618190 PAK yq233 1 _ 448154 PAK yq236 4783201 PAK B yq237 3631841 PAK yq238 52794261 PAK yq239 802631 PAK yq240 4060540 PAK Fi yq241 5750274 PAK .......... yq242 61360551 PAK yq243'"'457532 PAK yq244 5054238 PAK yq245 5340298 PAK yq246 12141 PAK yq246 5442141 PAK yq247 1752445 PAK yq248 26811 PAK yq249472171 PAK yq250 53100201 PAK yq250 _ _ 531 00201j PAK -w yq251 6258564 PAK yq25l PAK yq252 3631270 PAK yq253 3986330 PAK yq254 1909905 PAK j yq256 4961011 PAK ii o r yq257 5344886 PAK yq258 1794056 PAK yq259 1 5622663 PAK -yq260 1 1920818 PAK ii yq260"'1920818"PAK") yq261448226 PAK i yq262 5622870 PAK yq263 1848341 PAK yq264 1724204 PAK H yq265 4985498j PAK yq266 1 1 727594J PAK f---yq267 3173887 ! PAK j yq269 ! 20580i PAK _ yq270 _'. _ 47520541 PAK_ yq271 i 2059133i PAK L'yq272 ! 6006278 !'PAK --l 22-299T-PAK yq274 yq275 _ i 41909851 PAK 6260937 ; PAK y276 yq277 6006151 PAK yq280) 4260408 ! PAK'" yq280 4260408m rm 1 8M85i PAK ii yq282 1 7St PAK yq283} 61850771 PAK t yq285 ; 5944595j PAK yq286 4522691 PAK t_ yq288 i 4191034j PAK 1662859 PAK yq289 yq290 5787228 PAK yq291 35099451 PAK 5457826 PAK yq293 4161674 T PAK yq293 _ 4161674 PÅK yq294 6218220 PAK yq295 4909720J PAK yq296 3242506 PAK yq299"4785423 PAK yq300 1053171 PAK yq301 3481634 PAK yq301 Ms PAK ! t = 3604968jj PAK yq30l 3481634 PAK yq303 1848611 j PAK yq304 5556783 PAK yq304 5556783, 1 PAK yq305 29941231 PAK i_ yq306 532805i PAK yq307 4909720 PAK i yq308 4652185 PAK -4652T8-5 PAK yq309 2183791 PAK __312 _ 514649 PAK yq313 514649 PAK yq321 2922983 PAK yq321_ 2922983 PAK yq322 39383050 PAK yq323 3008585 PAK i yq324 5706853 PAK yq325 1955778) PAK _ yq326 ( 2060699 PAK yq327 2060699 PAK yq329 1683461 PAK yq329 1883461 PAK yq330 453170 PAK yq330 453170 PAK yq331 328420 PAK ; yq332 4816371 PAK yq333 5551527 PAK yq337 5408952E PAK 36562201 PAK yq339 1 6246268 PAK Vq340 56898451 PAK yq343 ! 3129643j PAK yq344 J 4942834i PAK 3129643i PAK - yq344"""4942834 PAK'J "yq345 4962990"'PAK"1 yq346 i 3593373j PAK : _ _Yq347-___. . 4862188 (PAK yq350 ! 4475236i PAK yq352 2 56872381 PAK __. ____. _.. _. _.. _. __ _. _. _ F PAK-. _...... _ 1___. _ s _. _'I vq. 354 I PAK yq35-52549861 PAK ! yq359 404488 PAK. yq360 4579247 PAK | yq362 f 3364174 PAK yq363 420046 PAK yq365 1554758 PAK yq366 2178380 PAK yq368 5642385i PAK yq369 j1051695 PAK J yq370 1 483080 PAK yq372 1954705 PA yq3731725290 PAK s yq374 398646 PAK . p- yq375 241422 PAK yq376 341 5649ii PAK, i. yq377 22169080 PAK yq378 4248879 PAK yq380 4016636 PAK 804155 PAK yq381 yq382 3230 PAK yq383 482768 PAK yq386 5707528 PAK yq387 5327307 PAK J yq388 204 PAK yq389' ? 37883 PAK ! yq390 2227022 PAK yq391 1831923 PAK yq392 5208464a PAK yq393 5918375 PAK yq394 i 4248933i PAK yq396 7 UF" yq396 1751917 PAK yq397 5104237 PAK i yq398 514693 PAK yq399 5827390 PAK yq400 2934612 PAK yq401 1 2672028 PAK yq403 5254098 PAK yq405 3593339 PAK yq407 3593640 PAK ' ; yq408 636054 PAK j r 456578 PAK _ yq409 A, __ 4565781 PAK yq410 L 3 __. _ : C yq411. 479231 9j PAK i ; yq412'6033032 ! PAK yq4l4 4535 1 yq4l5 4733671 PAK yq416 r 6007245i PAK yq417 i 3324453j PAK yq4l8 4801907f PAK yq420 ,-. . _. yq420 60077021 PAK PAK yq423 4478003 PAK yq425 61 54439i PAK ,,,, yq432 _-.-<L PAK _, yq440 336321 PAK w a yq441 3761499 PAK yq449 457460 PAK yq451 1954013 PAK s yq453 ! 6200072J PAK r yq454 5694746 PAK ! yq456 1501881 PAK yq462 1380923 PAK j yq465 833533 PAK yq466 3415145. PAK ; L V PAK yq467 3415145 PAK' yq468 6033567} PAK ! yq469 183469 yq470482451 PAK' yq471 | 61 5716 PAK - yq472 5623696 PAK ! yq473""4466909"PAK' yq475 615716'j PAK yq476 5617195 ; PAK j 6184599 PAK' yq486 56948991 PAK yq490 5616691 ; PAK yq492 5855086 PAK i yq493 39494231 PAK yq494"""474372 PAK') yq495 7182411 PAK'. yq496 1349427 PAK yq497 273258 PAK q498 585928E PAK J yq4994274525 PAK) yq501 6181080 PAK yq502 5415806 PAK yq503 5707622 PAK 1 ) yq506 4273277 PAK i yq508 4862384 PAK yq5275530108 PAK yq528 6083751 PAK yq535 455290 PAK yq536 3606825j PAK _ _. __. _ ; yq540----gggg p ; yq541 i 4861418-PAK yq542,'j'"'6007715j PAK" yq545 3281356 PAK yq546""T"'5694889J'""PAK yq545 t yq546'. 5694889q PAK yq547'T"'"3554932JPAK" yq548. 4819920 ! PAK 549 4791519 ! PAK yq551"""r"'5260804''PAK yq556 ; 4801971 j PAK yq557 ì 642573j PAK s yq558 1 43171661 PAK yq558 i 3324609 PAK --------- q559 3324609 PAK v yq560 T 4800242 PAK yq561 5197173l PAK yq56'2"5253316 PAK' yq563 5556621 PAK yq564 5922452) pAK""" yq568 4804815i PAK yq569 4807928 PAK yq570 l 4261077 PAK S yq571 1719155 PAK i ) yq572 4988719 PAK R-n yq574 3324900 PAK yq575 4536660 PAK wJ yq576 419363 PAK yq580 j456046J PAK yq580. yq580 456046 PAK j yq583 5991336 PAK r yq581 1 855748j PAK yq584 5853904 PAK 584-F yq583 5991336'PAK yq5855694892 PAK yq585 yq586 548451011 PAK yqS88 w PAK yq587 f 454274JPAK yq588 5788824 _ PAK yq589 5857361 t PAK J yq590 5707319l PAK S s- yq592 5916385= PAK' 42750781 PAK yq594 3936955 PAK PAK j yq596 3551821 PAK yq597 5208616 PAK 6132782 PAK yq602''"454908 PAK yq603 1 4383148t PAK j'yq6041424381 j PAK yq605 4802407 ! PAK j Medline Ul Gene Organism PA_ID 94049123 metK Escherichia coli 546 97075927 rpoD Rhodobacter capsulatus 576 98414051 ygjD Escherichia coli 580 90330537 surA Escherichia coli 594 88262245 era Escherichia coli 771 97295239 era Salmonella typhimurium 771 97113525 tolQ Pseudomonas aeruginosa 969 97113525 tolR Pseudomonas aeruginosa 970 97113525 tolA Pseudomonas aeruginosa 971 92355498 dapE Escherichia coli 1162 95095976 flhA Paracoccus denitrificans 1452 98414051 ycfB Escherichia coli 1678 98429489 clpP Caulobacter crescentus 1801 98429489 clpX Caulobacter crescentus 1802 93224448 Ion Myxococcus xanthus 1803 99065127 lolA Escherichia coli 2614 94110226 infA Escherichia coli 2619 98241618 IpxK Escherichia coli 2981 91348525 metZ Escherichia colis,. 3107 92193258 folC Escherichia cöli 3111 96405645 htrB Escherichia coli 3242 95014035 surE Escherichia coli 3625 94240115 frr Escherichia coli 3653 93077430 smbA Escherichia coli 3654 96228708 ispA Shigella flexneri 4043 88163790 tufA Escherichia coli 4265 90264268 rpoB Escherichia coli 4270 96107188 IpxC Escherichia coli 4406 84236117 ftsZ Escherichia coli 4407 84236117 ftsA Escherichia coli 4408 93003529 murG Bacillus subtilis 4412 97361813 ftsW Escherichia coli 4413 99047598 mraY Escherichia coli 4415 99029898 rluD Escherichia coli 4544 99000128 obg Streptomyces coelicolor 4566 97284515 ispB Escherichia coli 4569 93259941 murl Escherichia coli 4662 91311678 infB Escherichia coli 4744 92355498 dnaj Escherichia coli 4760 92355498 dnak Escherichia coli 4761 98414051 yjeQ Escherichia coli 4952 96070892 kdtA Escherichia coli 4988 96405645 msbA Escherichia coli 4997 96347399 trxA Synechocytis 5240 97177775 trxA Rhodobacter sphaeroides 5240 93125123 polA Streptococcus pneumoniae 5493 94012475 glmU Escherichia coli 5552 REFERENCES Hardalo, C. , Edberg, S. (1991), "Pseudomonas aeruginosa: assessment of risk from drinking water", Critical Reviews in Microbiology; 23 (1), 47-75.

Stover, K. , Pham, X. , Erwin, L. , Mizoguchi, D. , Warrener, P. , Hickey, J. , Brinkman, S., Hufnagle, W. , Kowalik, J. , Lagrou, M. , Garber, L. , Goltry, L. , Tolentino, E., Westbrock-Wadman, S. , Yuan, Y. , Brody, L. , Coulter, N. , Folger, K, Kas, A. , Larbig, K. , Lim, R. , Smith, K. , Spencer, D. , Wong, G, Wu, Z. , Paulsen, I. (2000), "Complete genome sequence of Pseudomonas aeruginosa PA01, an opportunistic pathogen," Nature. 406 (6799), 959-964.

Bodey, G. , Bolivar, R. , Fainstein, V., Jadeja, L. (1983), "Infections caused by Pseudomonas Aeruginosa, "Reviews of Infectious Diseases, 5 (2), 279-313.

Tummler, B. , Bosshammer, J. , Breitenstein, S. , Brockhausen, I., Gudowius, P., Herrmann, C. , Herrmann, S. , Heuer, T. , Kubesch, P. Mekus, F, Romling, U. , Schmidt, K, Spangenberg, C. , Walter, S. (1997), "Infections with Pseudomonas aeruginosa in patients with cystic fibrosis,"Behring Institute Mitteilungen, 98 249-55.

Reznikoff, W. (1993), "The Tn5 Transposon, "Annual Review of Microbiology; 47, 945-63.

Blumenthal, S. , Dayhiya, R. C. , and Gross, A. j. (1978), "Estimating the Complete Sample Size from an Incomplete Possion Sample, "Journal of American Statistical Association, 73,182-187.