BACKGROUND OF THE INVENTION Researchers have attempted to identify known genes for which there is a theoretical rationale for suspecting that their overexpression might play an etiologic role in various autoimmune diseases. Comparisons of the expression of these genes in disease states and in control populations are generally performed.

One example is the work done by Chabas et al. detailed in"The influence of the proinflammatory cytokine, osteopontin, on autoimmune demyelinating disease." (Science 294: 1731-5 (2001) ). Other researchers have used microarray technology to identify known genes overexpressed in disease states compared to control populations. (e. g., Becker et al. ,"Analysis of a sequenced cDNA library from multiple sclerosis lesions using cDNA microarrays,"J. Neuroimmunol. 77: 27-38 (1997); Whitney et al. ,"Analysis of gene expression in multiple sclerosis lesions using cDNA microarrays,"Ann. Neurol. 46: 425-428 (1999); Heller et al., "Discovery and analysis of inflammatory disease-related genes using cDNA microarrays,"Proc. Natl. Acad. Sci. USA 94: 2150-2155 (1997) ). Still other researchers have looked at the genomic level for genes or gene polymorphisms whose inheritance may be associated with a disease state, e. g. , Haines et al.,"A complete genomic screen for multiple sclerosis underscores a role for the major histocompatibility complex,"Nature Genet. 13: 468-71 (1996). None of these studies to date have identified new genes that are associated with multiple sclerosis or other inflammatory/autoimmune processes.

Thus, there is still very little information on genes whose abnormal expression contributes to the etiology of autoimmune diseases. This is largely because the known genes that have been studied have been shown to play a limited, if any, role in the cause of the diseases. Microarray technology is still largely confined to the study of known genes. Neither differential display nor subtractive hybridization, which have more potential to identify previously unknown genes differentially expressed in these diseases have been utilized to any significant extent.

Multiple sclerosis is an inflammatory, demyelinating disease of the central nervous system (CNS). Approximately one million people have been diagnosed with MS globally with approximately 300,000 of those residing in the United States. Females are more commonly afflicted with MS as the number of female patients outnumbers male patients 2: 1. (Conlon et al., Neurobiol. of Disease 6: 149-166 (1999) ). Frequently the initial symptoms and attacks of MS begin in early or middle adulthood; in the late twenties or early thirties. However, there have been reported cases of MS as early as two years of age and as late as 80 years of age. (Oksenberg, J. R. , and Hauser, S. L., The Molecular Pathogenesis of Multiple Sclerosis in Molecular Neurology Ch. 11, pp. 205-221, Scientific American Medicine (1998)).

Interestingly, epidemiological studies expose an increasing incidence of MS with increasing latitude as more Northern areas have a 3.5 fold higher incidence than Southern areas. (Hernan, D. P. H. , et al., Neurol. 53: 1711-1718 (1999); Allen, I., and Brankin, B., J. Neuropathol. & Exp. Neurol. 52: 95-105 (1993)).

However, it has been suggested that this latitude incidence gradient has recently begun to degrade. (Hernan, 1999). In the United States alone, the annual cost to society of MS is estimated to be $150 billion. (Oksenberg, 1998).

MS is characterized by the presence of plaques or lesions in the brain and spinal cord. These lesions arise from damage to the myelin sheath, and are most likely precipitated by an inappropriate immune system attack on these cells.

(Whitney, L. W. , et al., Annals of Neurol. 46: 425-428 (1999) ). Myelin sheath damage impairs action potential propagation along the exposed axon. MS can produce myelin sheath damage anywhere in the CNS white matter, and therefore, the clinical manifestations associated with the disease progression will be variable depending on the size of the plaque and its location within the CNS. Additionally, novel symptoms appear as the disease progresses temporally and spatially, continually involving more white matter. Typical symptoms include vision loss, double vision, nystagmus, disturbances of speech and language, weakness, abnormal sensations, bladder abnormalities, and mood alterations.

Histologically, the appearance of MS plaques varies along a spectrum, from old and gliotic to that of chronic active plaque to active, acute inflammation and demyelination. (Becker, K. G. , et al., J. Neuroimmunol. 77: 27-38 (1997) ). Upon gross examination, the plaques are distinctly defined lesions that vary in color depending on age; acute lesions appearing pinkish, while older, inactive plaques appear gray. (Oksenberg, 1998; Dhib-Jalbut, S. and McFarkin, D. E., Annals of Allergy 64: 433-444 (1990) ). Lesions that have incomplete myelin staining,<BR> referred to as"shadow plaques, "are also present. This shadow plaque characteristic is believed to be due to partial demyelination or partial remyelination. (Dhib-Jalbut, 1990). While MS plaques can occur anywhere in the white matter, they tend to concentrate in certain areas; specifically, the periventricular region, optic nerves and tracts, brain stem, cerebellum, cervical spinal cord, corpus callosum, and corticomedullary junction. (Oksenberg, 1998; Dhib-Jalbut, 1990).

Microscopic examination of acute lesions reveals focal demyelination and cellular myelin debris, while axons are relatively spared. (Oksenberg, 1998; Dhib-Jalbut, 1990; Whitney, 1999). Further findings include perivenular and parenchymal inflammation, with T cell, B cell, plasma cell, and macrophage infiltration. (Oksenberg, 1998; Dhib-Jalbut 1990). There are sparse inflammatory cells in older lesions.

There are four possible clinical courses for MS including relapsing- remitting, secondary progressive, primary progressive, and progressive-relapsing.

Relapsing-remitting MS is characterized by unpredictable, recurring attacks of neurological dysfunction. The attacks evolve over days to weeks and are followed by a variable amount of recovery or no recovery in the following weeks or months. During remission periods, patients with this type of MS do not experience a progression of neurological dysfunction. Secondary progressive MS commences with a relapsing-remitting pattern, but then proceeds to a progressive course. The onset of the progressive phase can be shortly after disease onset or not appear for years or even decades. A gradual progression of dysfunction between attacks, or a gradual progression of the disease with a lack of any attacks characterizes the progressive phase of the disease. Primary progressive MS proceeds as a gradual progression of neurological dysfunction from disease onset with no periods of relapse. Finally, progressive-relapsing MS is characterized by <BR> <BR> a primary progressive pattern with superimposed relapses. (Hauser, S. L. , and<BR> Goodkin, D. E. , Harrison's Principles of Internal Medicine Ch. 376,2409-2419<BR> (1998) ). Primary progressive and progressive-relapsing MS occur in a minority of MS diagnoses.

The cause of MS is unknown, although is it thought to be an autoimmune consequence of a microbial infection in a genetically susceptible host. MS patients tend to be immune hyper-responders to a variety of microbial and self antigens, suggesting an element of immune dysregulation in this disease. Little is known about the mechanisms through which this pathologic inflammatory response is generated and maintained.

Numerous epidemiological studies have convincingly demonstrated a strong genetic susceptibility to the development of MS. (Oksenberg, 1998; Becker, 1997; <BR> <BR> McFarland, H. F. , et al., Ann. NYAcad. Sci. 436: 118-124 (1984); Kurtzke, J. F., et al., J. Acta Neurologica Scandinavica 96: 149-157 (1997); Sadiq, S. and Miller, J. R. , Merritt's Textbook of Neurology 804-807 (1995) ). Racial studies reveal that Caucasians are the most susceptible, while Asians and Africans are among the most resistant to MS. Twin studies reveal a concordance rate in monozygotic twins of 30 % compared to a rate of 5 % in dizygotic twins, while the risk in the general population is 0. 1 %. (Oksenberg, 1998). First-, second-, and third-degree relatives also have a higher risk of developing MS. (Sadiq, 1995). However, the pattern of inheritance does not exhibit classic Mendelian characteristics. Studies suggest that one has to inherit the wrong allele of one or more polymorphic gene loci to develop susceptibility. In an effort to determine the genetic susceptibility loci of MS, a linkage study was performed on a Finnish population with a high rate of MS. (Becker, 1997). In addition, population studies discovered a higher frequency of chromosome 6 major histocompatibility complex encoded HLA B7 and DR2 in MS patients. (McFarland, 1984). In spite of these preliminary findings, the multiple genetic susceptibility loci have not been fully identified.

Epidemiological studies have evaluated large emigrating populations of people who have migrated from areas of high incidence to areas of low incidence of MS, and vice versa. Those studies suggest that patients with MS have been exposed to an environmental agent in their teenage years. Nevertheless, no direct evidence for infection of the nervous system in MS has ever been reported.

Inflammatory demyelinating lesions can be induced in laboratory animals by sensitization to a variety of myelin proteins. Thus, in these animals, an MS-like disease (experimental allergic encephalomyelitis) can be induced by strictly autoimmune means.

SUMMARY OF THE INVENTION The present invention provides a novel isolated polynucleotide sequence (SEQ ID NO : 1) and fragments thereof, polypeptides encoded by the polynucleotide sequence and fragments thereof, and immunoglobulins and fragments thereof which are useful in the study, treatment, and diagnosis of autoimmune diseases and cancer. Utilizing this novel polynucleotide sequence, the invention provides methods of diagnosis and treatment of cancer and autoimmune diseases, such as multiple sclerosis, as well as assay methods for screening for additional potentially therapeutic compounds and for suppressing or enhancing expression of the novel gene and the polypeptide encoded thereby. Additionally, the present invention provides compositions, including pharmaceutical compositions, useful in the treatment and diagnosis of autoimmune diseases and cancer.

BRIEF DESCRIPTION OF THE FIGURES Figure 1 contains the cDNA sequence for the novel gene that is abnormally expressed in MS and other autoimmune patients and in cancer cell lines.

Figure 2 shows the relationship between the novel gene identified with the PAC genomic clone, as well as the location of RTA, EST, and DD sequences within the novel gene and the PAC clone.

Figure 3 is a Northern blot demonstrating expression of the novel gene in various tissues.

Figure 4 is a Northern blot showing expression of the novel gene in several cancer cell lines.

Figure 5 is a Northern blot comparing expression of the novel gene in healthy and MS PBMCs using two separate probes which bind to the RTA and EST regions.

Figure 6 is a table comparing lengths of various transcripts detected using Northern blots in cancer cell lines, healthy PBMCs, MS PBMCs, and in healthy tissue.

Figure 7 shows the results of real-time PCR measuring expression of the novel gene in various tissues.

Figures 8A and 8B show the results of real-time PCR measuring expression of the novel gene in healthy subjects versus MS patients.

Figure 9 shows the results of real-time PCR comparing expression of the novel gene in healthy subjects versus subjects with various autoimmune diseases including Crohn's disease, Hashimoto's thyroiditis, and psoriasis.

Figure 10 shows the results of real-time PCR measuring the expression of the novel gene in healthy subjects versus those who have contracted influenza or received hepatitis B or influenza vaccine.

Figures 11A, 11B, and 11C show the results of real-time PCR comparing the expression of the novel gene in healthy patients versus MS patients, relapsing- remitting patients (RR MS), secondary progressive patients (SP MS), and primary progressive patients (PP MS).

Figure 12 shows the results of real-time PCR comparing the expression of untreated MS patients and MS patients treated with interferon- (3.

Figure 13 shows the expression of the novel gene in healthy versus MS patients as a function of age.

Figure 14 shows the results of real-time PCR comparing expression of the novel gene in various transformed cell lines.

DETAILED DESCRIPTION OF THE INVENTION The present invention provides a novel isolated polynucleotide sequence (SEQ ID NO : 1) shown in Figure 1, which is abnormally expressed in various autoimmune diseases, including multiple sclerosis and rheumatoid arthritis, and cancer. The complement of any of the novel polynucleotide sequences of the present invention is encompassed within the present invention. In one embodiment, the polynucleotides of the present invention are contained in a vector to facilitate expression of the polynucleotide sequence and corresponding encoded protein. The vector containing the sequence may be transfected into a host cell.

Also encompassed within the present invention are polynucleotide sequences with at least 75 % identity to the polynucleotide sequence of SEQ ID NO : 1, and complements thereof.

The present invention contemplates a method of producing the polynucleotide of SEQ ID NO: 1 of Figure 1 or the protein/polypeptide encoded thereby comprising culturing a host cell containing a vector with the polynucleotide sequence of the present invention under conditions that allow the expression of the polynucleotide and/or the protein/polypeptide encoded thereby, and recovering the expressed polynucleotide.

One skilled in the art can readily appreciate applications of the present invention which could utilize less than the entire length of the polynucleotide sequence of SEQ ID NO : 1, or the protein/polypeptide encoded thereby. Thus, the present invention also provides for polynucleotide fragments of the polynucleotide sequence of SEQ ID NO : 1, and for polypeptides encoded by such fragments. This specifically includes probes and primers comprising at least 15 consecutive nucleotides of the polynucleotide sequence SEQ ID NO : 1, or the complement thereof. In a preferred embodiment of the invention the polynucleotide fragment, probe, or primer is selected from the RTA, EST, or DD regions, primers, or probes shown in Figure 2 and described in the Example, including but not limited to SEQ ID NOs : 3-12, and complements thereof. Although SEQ ID NO : 1 is specifically referred to herein, it is understood that such reference also encompasses smaller fragments (including SEQ ID NOs : 3-12) as well as larger nucleic acids containing SEQ ID NOs : l and/or 3-12.

The present invention provides nucleic acid molecules such as SEQ ID NO : 1 or a fragment thereof, preferably in isolated or purified form. As used herein, "nucleic acid"is defined as RNA, DNA, or cDNA or is complementary to a nucleic acid sequence, or hybridizes to either the sense or antisense strands of the nucleic acid and remains stably bound to it under appropriate stringency conditions.

The present invention further provides fragments of the encoding nucleic acid molecule. As used herein, a fragment of an encoding nucleic acid molecule refers to a small portion of the entire polypeptide encoding sequence. The size of the fragment will be determined by the intended use. For example, if the fragment is chosen so as to encode an active portion of the protein, the fragment will need to be large enough to encode the functional region (s) of the protein. If the fragment is to be used as a nucleic acid probe or PCR primer, then the fragment length is chosen so as to obtain a relatively small number of false positives during probing/priming. Primers and probes are most preferably between 15 and 40 nucleotides in length.

Fragments of the encoding nucleic acid molecules of the present invention (i. e., synthetic oligonucletides) that are used as probes or specific primers for polymerase chain reaction (PCR), or to synthesize gene sequences encoding polypeptides can be easily synthesized by chemical techniques, for example, the phosphotriester method of Matteucci et al. (J. Am. Chem. Soc. 103: 3185-3191 (1981) ) or using automated synthesis methods. In addition larger DNA segments can readily be prepared by well known methods, such as synthesis of a group of oligonucleotides that define various modular segments of the gene, followed by ligation of oligonucleotides to build the complete modified gene.

In addition to the specific regions, primers, and probes identified in Figure 2 and the Examples (including SEQ ID NOs : 3-12), nucleic acids of the present invention may be of various lengths, including 10,15, 19,20, 23,24, 25,30, 40, 50,60, 100,200, 250,500, 750,1000, 1500,2000, 2600 nucleotides, or the entire sequence of SEQ ID NO : 1. Also encompassed are any lengths of the sequence SEQ ID NO : 1 stretching from any initiation codon to any stop codon.

The nucleic acid may be a nucleic acid having at least 75 % sequence identity, preferably 80%, more preferably at least 85% with the nucleic acid sequence of SEQ ID NO : 1; 90%, 95%, 96%, 97%, 98%, and 99% or greater are also contemplated. Specifically contemplated are genomic DNA, cDNA, mRNA, antisense molecules, enzymatically active nucleic acids (e. g., ribozymes), as well as nucleic acids based on alternative backbone or including alternative bases whether derived from natural sources or synthesized. Any hybridizing or complementary nucleic acids are defined further as being novel and nonobvious over any prior art nucleic acid including that which encodes, hybridizes under appropriate stringency conditions, or is complementary to a nucleic acid of the present invention.

As used herein, the terms"hybridization" (hybridizing) and"specificity" (specific for) in the context of nucleotide sequences interchangeably. The ability of two nucleotide sequences to hybridize to each other is based upon the degree of complementarity of the two nucleotide sequences, which in turn is based on the fraction of matched complementary nucleotide pairs. The more nucleotides in a given sequence that are complementary to another sequence, the greater the degree of hybridization of one to the other. The degree of hybridization also depends on the conditions of stringency which include temperature, solvent ratios, salt concentrations, and the like. In particular, "selective hybridization"pertains to conditions in which the degree of hybridization of a polynucleotide of the invention to its target would require complete or nearly complete complementarity.

The complementarity must be sufficiently high so as to assure that the polynucleotide of the invention will bind specifically to the target nucleotide sequence relative to the binding of other nucleic acids present in the hybridization medium. With selective hybridization, complementarity will be 90-100%, preferably 95-100%, more preferably 100%.

"Stringent conditions"are those that (1) employ low ionic strength and high temperature for washing, for example: 0.015 M NaCo, 0.0015 M sodium titrate, 0. 1 % SDS at 50°C ; or (2) employ during hybridization a denaturing agent such as formamide, for example 50% (vol/vol) formamide with 0. 1 % bovine serum albumin, 0. 1 % Ficoll, 0. 1 % polyvinylpyrrolidone, 50 mM sodium phosphate buffer at pH 6.5 with 750 mM NaCI, 75 mM sodium citrate at 42°C. Another example is use of 50% formamide, 5X SSC (0.75 mM NaCI, 0.075 M sodium citrate), 50 mM sodium phosphate (pH 6.8), 0. 1 % sodium pyrophosphate, 5X Denhardt's solution, sonicated salmon sperm DNA (50 ßg/ml), 0. 1 % SDS and 10% dextran sulfate at 42°C, with washes at 42°C in 0.2X SSC and 0. 1% SDS.

A skilled artisan can readily determine and vary the stringency conditions appropriately to obtain a clear and detectable hybridization signal.

As used herein, a nucleic acid molecule is said to be"isolated"when the nucleic acid molecule is substantially separated from contaminant nucleic acid encoding other polypeptides from the source of nucleic acid and/or which is not immediately contiguous with the coding sequences with which it is normally flanked. This term includes recombinant DNA incorporated into a vector, or into the genomic DNA or a prokaryote or eukaryote, or which exists as a separate molecule.

As used herein, a"coding sequence"is a nucleic acid which is transcribed into messenger RNA and/or translated into a polypeptide when placed under the control of appropriate regulatory sequences. The boundaries of the coding sequence are determined by a translation start codon at the 5'terminus and a translation stop codon at the 3'terminus. A coding sequence can include, but is not limited to, messenger RNA, synthetic DNA, and recombinant nucleic acid sequences.

A"complement"of a nucleic acid as used herein refers to an anti-parallel or antisense sequence that participates in Watson-Crick base pairing with the original sequence.

As used herein, a"probe"refers to a nucleic acid, peptide, or other chemical entity which specifically binds to a molecule of interest. Probes are often associated with or capable of associating with a label.

As used herein, "percent identity"refers to the percentage of residues which are the same (or conservatively substituted) when aligned for maximum correspondence, as described below. When used in reference to protein sequences or peptides, it is recognized that residue positions that are not identical often differ by conservative amino acid substitutions (discussed below) with similar chemical properties (e. g. , charge or hydrophobicity) and therefore do not change the functional properties of the molecule. Where sequences differ in conservative substitutions, the percent sequence identity may be adjusted upwards to correct for the conservative nature of the substitution (sometimes referred to as % similarity).

Means for making this adjustment are well-known in the art. Typically, this involves scoring a conservative substitution as a partial rather than a full mismatch, thereby increasing the percentage sequence identity. Thus, for example, where an identical amino acid is given a score of 1 and a non- conservative substitution is given a score of zero, a conservative substitution is given a score between zero and 1. The scoring of conservative substitutions is <BR> <BR> calculated according to, e. g. , the algorithm of Meyers & Miller, Computer Appl.<BR> <P>Biol. Sci. 4: 11-17 (1988), e. g. , as implemented in the program PC/GENE (Intelligenetics, Mountain View, CA, USA).

Methods for alignment of sequences for comparison are well-known in the <BR> <BR> art. Optimal alignment of sequences for comparison can be conducted, e. g. , by the local homology algorithm of Smith & Waterman, Adv. Appl. Math. 2: 482 (1981), by the homology alignment algorithm of Needleman & Wunsch, J. Mol.

Biol. 48: 443 (1970), by the search for similarity method of Pearson & Lipman, Proc. Natl. Acad. Sci. USA 85: 2444 (1988), by the computerized implementations of these algorithms (GAP, BESTFIT, FASTA, and TFASTA in the Wisconsin Genetics Software Package, Genetics Computer Group, 575 Science Dr., Madison, WI), or by manual alignment and visual inspection.

An example of an algorithm suitable for determining percent sequence identity and/or similarity is the BLAST algorithm, which is described in Altschul et al., J. Mol. Biol. 215: 403-410 (1990). Software for performing BLAST is publicly available through the National Center for Biotechnology Information.

An alternative algorithm is that of Needleman and Wunsch in the GAP program in the GCG software package (available at www. gcg. com), using either a Blossom 62 matrix or a PAM250 matrix, and a gap weight of 16,14, 12,10, 8,6, or 4, and a length weight of 1,2, 3,4, 5, or 6. An alternative algorithm utilizes the GAP <BR> <BR> program in the GCG software package (Devereux, J. , et al., Nucleic Acids Res.<BR> <P>12 (1) : 387 (1984) ) (available at www. gcg. com), using a NWSgapdna. CMP matrix and a gap weight of 40,50, 60,70 or 80 and a length weight of 1,2, 3,4, 5, or 6.

Another algorithm which may be used is that of E. Myers and W. Miller (CABIOS <BR> <BR> 4: 11-17 (1989) ) which has been incorporated into the ALIGN program, using a PAM120 weight residue table, a gap length penalty of 12 and a gap penalty of 4.

The nucleic acid molecules of the present invention may further be modified to contain a detectable label for diagnostic and probe purposes. A variety of such labels are known in the art and can readily be employed with the encoding molecules herein described. Suitable labels include, but are not limited to, biotin, radiolabeled nucleotides, fluorophores, enzymes, dyes, and the like. A skilled artisan can employ any of the art known labels to obtain a labeled nucleic acid molecule.

Antisense molecules corresponding to the coding or non-coding sequence may be prepared. Methods of making antisense molecules which bind to any part of the sequence of SEQ ID NO : 1, particularly SEQ ID NOs : 3-12, form triple helices or are enzymatically active and cleave TSG RNA and single stranded DNA <BR> <BR> (ssDNA) are known in the art. See, e. g. , Antisense and Ribozyme Methodology.<BR> <P>Laboratory Companion (Ian Gibson, ed. , Chapman and Hall (1997) ) and Ribozyme Protocols. Methods in Molecular Biology (Philip C. Turner, ed., Humana Press, Clifton, NJ (1997)).

The nucleic acids of the present invention can be inserted into expression vectors as is known in the art. Such vectors may be either self-replicating extrachromosomal vectors or vectors which integrate into a host genome.

Generally, expression vectors include transcriptional and translational regulatory nucleic acid operably linked to a polynucleotide sequence of SEQ ID NO: 1, or a fragment thereof. "Operably linked"means that the transcriptional and translational nucleic acid is positioned relative to the coding sequence of SEQ ID NO : 1, or a fragment thereof, in such a manner that transcription is initiated.

Many expression vectors are known in the art and can be used with the present invention. These include but are not limited to pUC plasmids, pET plasmids (Novagen, Inc. , Madison, WI), pRSET or pREP plasmids (Invitrogen, San Diego, CA).

Appropriate host cells include bacteria, archaebacteria, fungi, especially yeast, and plant and animal cells, including mammalian cells. Of particular interest are S. cerevisiae and other yeasts, E. coli, Bacillus subtilis, SF9 cells, C129 cells, HEK 293 cells, Neurospora, CHO cells, COS cells, HeLa cells, and immortalized mammalian myeloid and lymphoid cell lines.

Methods of introducing exogenous nucleic acid into host cells are well- known in the art. These include, but are not limited to, dextran-mediated transfection, calcium phosphate transfection, polybrene-mediated transfection, protoplast fusion, electroporation, encapsulation of the polynucleotide into liposomes, and direct microinjection of the nucleic acid into the nuclei.

The present invention also provides for an isolated polypeptide encoded by the polynucleotide sequence SEQ ID NO : 1, as well as for shorter polypeptide fragments encoded by shorter segments of the polynucleotide SEQ ID NO : 1. In one embodiment, the polypeptide contains at least 3 consecutive amino acids encoded by the polynucleotide SEQ ID NO: 1 or a fragment thereof. One skilled in the art will recognize that some conservative amino acid changes can be made without affecting the function of a protein. Therefore, the present invention also contemplates isolated polypeptides having at least 80% identity to the polypeptide encoded by the polynucleotide sequence SEQ ID NO : 1 or a fragment thereof.

Proteins/polypeptides of the present invention are those encoded by the novel polynucleotide sequence of SEQ ID NO : 1, or a fragment thereof. In one embodiment, the polypeptide is at least 3 consecutive amino acids encoded by the sequence SEQ ID NO : 1. In other embodiments, the polypeptide is at least 5,10, 20,50, 100,150, 200,300, 350,500, or 700 amino acids in length. In another embodiment, the polypeptide is encoded by a stretch of any polynucleotide sequence containing an initiation codon and a stop codon. Polypeptides which are at least 80 %, 90 %, 95 %, 98 % or 99 % identity with the polypeptide encoded by the polynucleotide sequence of Figure 1 are encompassed by the present invention.

Polypeptides of the present invention include those that arise as a result of alternative transcription events, alternative RNA splicing events, and alternative translational and post-translational events.

Polypeptides of the invention include sequences wherein conservative amino acid alterations have been made. One skilled in the art will readily identify such alterations. Modification to the primary structure itself by deletion, addition or alteration of the amino acids incorporated into the proteins sequence during translation can be made without destroying the activity of the protein. Such substitutions or alterations result in proteins having an amino acid sequence encoded by a nucleic acid falling within the contemplated scope of the present invention. Conservative residue changes include those where an acidic residue is exchanged for another acidic residue, a basic residue for a basic residue, a neutral/nonpolar residue for another neutral/nonpolar residue, or a neutral/polar residue for another neutral/polar residue.

The present invention also provides for immunoglobulins, including polyclonal and monoclonal antibodies, and immunoglobulin or immunoglobulin fragments to the polypeptide, or fragments thereof, encoded by the polynucleotide SEQ ID NO : 1 or a fragment thereof, including SEQ ID NOs : 3-12.

Immunoglobulins to the protein or any polypeptides encoded by the nucleic acid of SEQ ID NO: 1, or a fragment thereof can be generated according to standard protocols such as those found in E. Harlow et al., Antibodies : A Laboratory Manual (1988). Antibody probes are prepared by immunizing suitable mammalian hosts in appropriate immunization protocols using the peptides, polypeptides or protein of the invention if they are of sufficient length, or, if desired, or if required to enhance immunogenicity, they can be conjugated to suitable carriers. Methods for preparing immunogenic conjugates with carriers such as bovine serum albumin (BSA), keyhole limpet hemocyanin (KLH), or other carrier proteins are well known in the art. In some circumstances, direct conjugation using, for example, carbodiimide reagents may be effective; in other instances linking reagents such as those supplied by Pierce Chemical Co., Rockford, IL, may be desirable to provide accessibility to the hapten. The hapten peptides can be extended at either the amino or carboxy terminus with a cysteine residue or interspersed with cysteine residues, for example, to facilitate linking to a carrier. Administration of the immunogens is conducted generally by injection over a suitable time period and with use of suitable adjuvants, as is generally understood in the art. During the immunization schedule, titers of antibodies are taken to determine adequacy of antibody formation.

Anti-peptide immunoglobulins or antibodies can be generated using synthetic peptides. Synthetic peptides can be as small as 2-3 amino acids in length, but are preferably at least 3,5, 10, or 15 or more amino acid residues long. Such peptides can be determined using programs such as DNAStar. The peptides are coupled to KLH using standard methods and can be immunized into animals such as rabbits. Polyclonal antibodies can then be purified, for example using Actigel beads containing the covalently bound peptide.

While the polyclonal antisera produced in this way may be satisfactory for some applications, for pharmaceutical compositions, use of monoclonal preparations is preferred. Immortalized cell lines which secrete the desired monoclonal antibodies may be prepared using the standard method of Kohler and Milstein or modifications which effect immortalization of lymphocytes or spleen cells, as is generally known. The immortalized cell lines secreting the desired antibodies are screened by immunoassay in which the antigen is the peptide hapten, polypeptide or protein. When the appropriate immortalized cell culture secreting the desired antibody is identified, the cells can be cultured either in vitro or by production in ascites fluid.

The desired monoclonal antibodies are then recovered from the culture supernatant or from the ascites supernatant. Fragments of the monoclonals or the polyclonal antisera which contain the immunologically significant portion can be used as agonists or antagonists of the novel encoded protein activity, as well as the intact antibodies. Use of immunologically reactive immunoglobulin fragments, such as the Fab, scFV, Fab', or F (ab') 2 fragments are often preferable, especially in a therapeutic context, as these fragments are generally less immunogenic than the whole immunoglobulin.

The immunoglobulins or fragments may also be produced, using current technology, by recombinant means. Regions that bind specifically to the desired regions of receptor can also be produced in the context of chimeras with multiple species origin. Immunoglobulin reagents so created are contemplated for use diagnostically or as stimulants or inhibitors of activity of the novel encoded protein.

Transgenic animal models can be created which conditionally express the protein encoded by the novel gene identified in the present invention. General methods for creating transgenic animals are known in the art, and are described in, e. g., Strategies in Transgenic Animal Science (G. M. Monastersky and J. M. Robl, eds. , ASM Press; Washington, DC (1995) ) ; Transgenic Animal Technology. A<BR> Laboratory Handbook (C. A. Pinkert, ed. , Academic Press (1994) ) ; Transgenic<BR> Animals (L. M. Houdebine, ed. , Harwood Academic Press (1997)) ; Manipulating<BR> the Mouse Embryo. A Laboratory Manual (B. Hogan et al. , eds. , Cold Spring Harbor Laboratory Press (1994)).

Another embodiment of the present invention provides a method for diagnosing an autoimmune disease or cancer comprising hybridizing a nucleotide sequence of SEQ ID NO : 1 (or a fragment thereof), or complement thereof, to a nucleic acid of a subject to be diagnosed, quantifying the expression of the nucleotide sequence in comparison to a control sample, and diagnosing an autoimmune disease or cancer if the nucleotide sequence is overexpressed or underexpressed relative to the control sample. By a"control sample"is meant, <BR> <BR> e. g. , a sample taken from one or more subjects who do not have the autoimmune disease or cancer to be diagnosed or a standardized amount representative of expression in normal or healthy subjects. Standard diagnostic procedures known to one skilled in the art can readily provide various methods of preparing suitable control samples. In one embodiment, the subject is a mammal. Among other mammals, humans may be diagnosed by the present methods. In various embodiments, the autoimmune disease is multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis. Relapsing-remitting, secondary progressive and primary progressive MS may be diagnosed according to such a method. In another embodiment, the invention provides for utilizing shorter polynucleotides than the entire sequence of SEQ ID NO: 1. In one embodiment, the polynucleotide used in the diagnostic method comprises at least 15 consecutive nucleotides of the polynucleotide sequence of SEQ ID NO : 1, or complements thereof. In other embodiments, the polynucleotide used is a RTA, EST, or DD region, primer, or probe of Figure 2 or described in the Examples, including SEQ ID NOs : 3-12, or complements thereof.

In another embodiment, the present invention provides a method of diagnosing an autoimmune disease or cancer comprising measuring levels of binding by an immunoglobulin or immunoglobulin fragment to a polypeptide sequence encoded by a polynucleotide sequence SEQ ID NO: 1 or a fragment of SEQ ID NO : 1, comparing the levels of binding by the antibody or antibody fragment to a control sample, and diagnosing an autoimmune disease or cancer when antibody or antibody fragment levels are lower or higher than control sample. In various embodiments, the autoimmune disease is multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis. Relapsing-remitting, secondary progressive, and primary progressive MS may be diagnosed by the present method. In a preferred embodiment, the subject being diagnosed is a mammal. In a particularly preferred embodiment, the subject being diagnosed is a human.

The present invention provides a method for preventing the overexpression of a nucleotide sequence SEQ ID NO : 1, or the complement thereof, comprising supplying an antisense nucleotide sequence of the nucleotide sequence SEQ ID NO: 1 or a fragment thereof to a cell to prevent overexpression of the nucleotide sequence of SEQ ID NO : 1. In one embodiment, the antisense nucleotide comprises at least 20 consecutive nucleotides of the nucleotide sequence SEQ ID NO : 1, or complement thereof. In other embodiments, the antisense nucleotide is one or more of the RTA, EST, or DD regions, primers, or probes, including SEQ ID NOs : 3-12, as seen in Figure 2 and described in the Examples, or complements thereof. Such a method may be used to treat autoimmune diseases and cancer.

Among the automimmune diseases which may be treated in this manner are multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis. If the autoimmune disease is MS, relapsing-remitting, secondary progressive, and primary progressive MS may be treated the present method. Such treatment may be used for humans and other mammals.

In an alternative embodiment, the present invention provides for a method of increasing the expression of a nucleotide sequence SEQ ID NO: 1, or SEQ ID NOs : 3-12, comprising supplying a nucleotide sequence SEQ ID NO : 1, or the complement thereof to a cell. Such a method may be used to treat autoimmune diseases and cancer. Among the automimmune diseases which may be treated in this manner are multiple sclerosis, rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis. If the autoimmune disease is MS, relapsing-remitting, secondary progressive, and primary progressive MS may be treated the present method. Such treatment may be used for humans and other mammals.

The present invention further provides for a method of treating an autoimmune disease or cancer comprising administering an immunoglobulin or immunoglobulin fragment to a polypeptide encoded by the nucleotide sequence of SEQ ID NO: 1, or a fragment thereof, to a subject in need of such treatment. In one embodiment, the subject is a mammal. Among other mammals, human subjects may be treated. In some embodiments, the polypeptide is at least 3 consecutive amino acids encoded by the polynucleotide sequence of SEQ ID NO : 1, or a fragment thereof. In various embodiments, the autoimmune disease is multiple sclerosis (including relapsing-remitting, secondary progressive, and primary progressive MS), rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis.

The present invention further provides a method of screening for small molecules which affect the expression of a polynucleotide sequence of SEQ ID NO : 1, or a fragment thereof, and/or the polypeptide encoded thereby comprising adding a candidate small molecule to an assay system and measuring the expression/function and/or function of the polynucleotide of SEQ ID NO : 1, or a fragment thereof, and/or the polypeptide encoded thereby, and determining whether the small molecule affects the expression/function of the polynucleotide SEQ ID NO : 1, or a fragment thereof, and/or the polypeptide encoded thereby. In a preferred embodiment, levels of mRNA or the polypeptide encoded by the polynucleotide sequence of SEQ ID NO: 1, are measured in the assay.

The present invention provides for the use of small molecules, including nucleotides, peptides, lipids, carbohydrates, and other organic compounds, including those identified in the above-described assay, which alter the expression/function of the polynucleotide SEQ ID NO : 1, or a fragment thereof, and/or the polypeptide encoded thereby as therapeutics to treat autoimmune diseases or cancer. In a various embodiments, the autoimmune disease is multiple sclerosis (including relapsing-remitting, secondary progressive, and primary progressive MS), rheumatoid arthritis, systemic lupus erythematosus, Crohn's disease, Hashimoto's thyroiditis, or psoriasis.

Compositions comprising the polynucleotides, polypeptides, immunoglobulins, and or other small molecules identified by the methods of the invention and a carrier therefor are encompassed within the present invention. In one embodiment, a pharmaceutical composition comprising the polynucleotides, polypeptides, immunoglobulins, and or other small molecules identified by the methods of the invention and pharmaceutically acceptable carrier or excipient are provided. The present invention provides for pharmaceutical compositions and methods of treatment of MS, other autoimmune diseases, and cancer. A pharmaceutically acceptable carrier or excipient is intended to mean any compound used in forming part of the formulation that is intended to act merely as a carrier, i. e., not intended to have biological activity itself. The pharmaceutically acceptable carrier is generally safe, non-toxic and neither biologically nor otherwise undesirable. More than one pharmaceutically acceptable carrier or excipient may be used in a formulation. By"treating"an autoimmune disease or cancer is meant obtaining a desired pharmacological and physiological effect. The effect may be prophylactic in terms of preventing or partially preventing the disease, symptom, or condition thereof and/or may be therapeutic in terms of a partial or complete cure of the disease, condition, symptom, or adverse effect attributed to the disease. An"amount effective to treat an autoimmune disease or cancer"or a"therapeutically effective amount"is an amount that brings about one or more of the effects of treating the diseases discussed above.

The polynucleotides, polypeptides, immunoglobulins, and/or other small molecules identified by the methods of the present invention may be administered in a therapeutically effective amount by any of the accepted modes of administration for agents that serve similar utilities. The compounds can be administered by a variety of routes, including, but not limited to, oral, parenteral (e. g., subcutaneous, subdural, intravenous, intramuscular, intrathecal, intraperitoneal, intracerebral, intraarterial, or intralesional routes of administration), topical, localized (e. g. , surgical application or surgical suppository), rectal, and pulmonary (e. g., aerosols, inhalation, or powder). The compounds may be infused continuously or by bolus injection. The actual amount of the compound of the subject invention, i. e., the active ingredient, may depend on a number of factors, such as the severity of the disease, the age and relative health of the subject, the potency, the route and form of administration, and other factors. Toxicity and therapeutic efficacy of such compounds can be determined by standard pharmaceutical procedures in cell cultures and experimental animals, e. g. , for determining the LD50 (the dose lethal to 50% of the population) and the ED50 (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index, expressed as the ratio LD50/ED50. Compounds that exhibit large therapeutic indices are preferred.

EXAMPLES The present invention is described by reference to the following Examples, which are offered by way of illustration and are not intended to limit the invention in any manner. Standard techniques well-known in the art or the techniques specifically described below were utilized.

EXAMPLE 1 MS is a complex disease likely predicated and maintained by multiple genetic and environmental factors interacting with the afflicted individual's immune system and CNS. While numerous gene products could reasonably and logically be implicated in the disease process, attempting to investigate systematically their potential involvement in MS would be an insurmountable task.

Rather a technique should be employed that would allow screening for genes that are differentially expressed in MS patients versus controls. In the present invention, in an effort to elucidate further the mechanisms that underlie the development and clinical course of MS a differential display was performed on an identical twin set discordant for MS. (Grekova, M. C. , et al., Annals of Neurol.

40: 108-112 (1996)).

Differential display employs PCR to reverse transcribe the entire mRNA population in any given cell population. This reverse transcription is accomplished using a set of oligonucleotide primers, one being anchored to the polyA tail and the other being short and random in sequence to allow it to anneal at arbitrary positions along the mRNA. This technique is highly reproducible and permits the detection of differentially expressed genes without bias or <BR> <BR> preconception regarding their identity. (Liang, P. , and Pardee, A. B., Science<BR> 257: 967-971 (1992) ). When performed under relatively non-stringent conditions every mRNA should theoretically be bound by at least one primer set. (Liang, 1992).

Differential display on an identical twin set discordant for MS on peripheral blood mononuclear cells (PBMCs) revealed that 20 mDNAs were detected in one twin, but not in the other; some were expressed in the healthy twin, while the remaining were expressed in the MS twin. Following gel purification and sequencing, the partial cDNA sequences were compared with the GenBank database.

Two sets of differential display primers were employed in screening for genes differentially expressed in the discordant MS twins. One set of primers, reverse primer"T11CC" (5'-TTTTTTTTTTTCC-3') (SEQ ID NO : 2) and random forward primer"RP15" (5'-CGCGTTATAC-3') (SEQ ID NO : 13), amplified a cDNA fragment designated TllmC15H2. A second set of primers, reverse primer "T11AC" (5'-TTTTTTTTTTTAC-3') (SEQ ID NO : 14) and random forward primer"RP10" (5'-TCATTCCAC-3') (SEQ ID NO : 15), amplified a fragment designated TlOmClOH2. A preliminary population study was performed on a partial cDNA sequence (designated as"DD"in Figure 2, SEQ ID NO : 11) amplified from the PBMCs isolated from the MS twin, but not the healthy twin.

The population study revealed that 78% of MS patients (n= 18), 80% of rheumatoid arthritis (RA) patients (n=5), and one of one systemic lupus erythmatosus (SLE) patient expressed this gene. One patient with myasthenia gravis was negative. However, only 33 % of healthy controls (n=15) expressed the gene.

The cDNA fragment was somewhat small (301 bp) and more sequence data were necessary to construct better primer sets to confirm this data. A PAC clone (RP4-1139P1) available in the GenBank database (AC003999 at www. ncbi. nlm. nih. gov) contained the 301 bp sequence with complete identity, providing the genomic DNA sequence to aid efforts to sequence the cDNA.

5'RACE sequencing on Clontech's Marathon-Ready cDNA was performed, assuming that the sequencing data contained the 3'end, as one primer in the differential display should anneal to the polyA tail of the mRNA transcript. At approximately the same time, sequence data were obtained from the second differential display fragment, also amplified from the MS twin. This new cDNA fragment also matched with 100% identity the same PAC clone containing the initial cDNA isolated. However, this second cDNA fragment was a different sequence from the first cDNA fragment identified.

Examination of the PAC clone and the two partial cDNA sequences revealed that one of the cDNA fragments was in fact at the 3'end, while the other was 5'to the first with the differential display primer annealing at an interior poly A region.

In light of this information, both fragments were subsequently sequenced in 5'and 3'directions in an effort to confirm all of the sequence data obtained and to acquire the remaining sequence on the cDNA. This process generated approximately 2.5 kb of sequence which likely represented the entire cDNA sequence, as multiple 5'RACE reactions end at the same point. This cDNA is shown in Figure 1 (SEQ ID NO : 1). Two cDNA fragments (2.5 and 1.3 kb, SEQ ID NO : 3 and SEQ ID NO : 4, respectively) generated from RACE reactions and their respective relationship to the PAC clone are shown in Figure 2.

Two probes were generated from the cDNA sequence in order to perform Northern blots. Primers ATCAGCATGGTACATTATTTTGCTAAA (SEQ ID NO : 5) (forward) and GCATCATTCCCCTCTTGCA (SEQ ID NO : 6) (reverse) were created to amplify the RTA (Real Time Amplicon) region (SEQ ID NO : 12) shown in Figure 2. For Northern blots, a smaller section of the RTA region was used: ACATCTTTGCCTTCCAAAGCCACCAGT (SEQ ID NO : 7). Primers ACTAGTAGTCGCCACTTCTGAAA (SEQ ID NO : 8) (forward) and CCATTATACAGTAATCGGACAATC (SEQ ID NO : 9) (reverse) were used to generate the EST region shown in Figure 2. The entire EST region was used to as a probe for Northern blots: ACTAGTAGTCGCCACTTCTGAAAAGAGTTATCAATTCAAAAGGAATCTT TGTGTTTGCATATTTAAAGCCAAGATAATTATTGGTAGTGTCTGCATAA CAAATGTAATTTCAATTAGACTGTTTTTCTCAATTAAAAACTATTGCTTG TGTG (SEQ ID NO : 10). This EST probe spans nucleotides 104,792-104, 943 in the PAC clone. The relative position of these various regions and probes in the 2.5 and 1.3 kb sequences generated from RACE is shown in Figure 2.

Northern blot analysis of normal tissue demonstrated that the gene of Figure 1 is ubiquitously expressed in numerous human tissues, including leukocytes, placenta, and several organs. (Figure 3). Initial Northern blot analysis in four different cancer cell lines revealed a single band at approximately 2.0 kb but 5' RACE and 3'RACE studies demonstrated approximately 2600 b. p. of sequence information, indicating that either the Northern blot band was incorrect or that there was at least one additional transcript related to this gene. Subsequent refinement of Northern blot technique revealed four bands in two cancer cell lines (ASPC and CCREF-CEM) at approximately 1.0, 1.3, 1.8, and 3.5 k. b) using the EST probe. (Figure 4). Using the RTA probe, three cancer cell lines (ASPC, CCRF-CEM, and ME180) showed bands at approximately 1.0, 1.8, 2.5, and 4.9 kb. (Figure 4). Healthy control PBMCs displayed four bands at approximately 1.0, 1.3, 1.8, and 2.5 kb with the EST probe. (Figure 5). MS PMBCs displayed the same four bands with the EST probe. (Figure 5). Using the RTA probe, both healthy and MS PMBCs displayed four transcripts at 1.0, 1.8, 2.5, and 4.9 kb.

(Figure 5). Thus, it appears that there are 6 possible separate transcripts produced from this gene, five of which are likely identical in normal PBMCs and in cancer cell lines, but with the 3.5 kb transcript differing between cancer cell lines and normal PBMCs. (Figure 6).

Real-time PCR was performed on healthy tissue to determine expression levels of the novel gene. (Figure 7). Expression was readily detected in all the tissues samples. Real-time PCR was utilized to examine expression differences in healthy subjects versus MS patients. Unexpectedly and in contrast to the preliminary study described above, this cDNA was amplified from nearly all the subjects. This discrepancy may be due to newer, more efficient polymerases than used in the initial studies and negative results obtained previously are perhaps due to threshold detection differences with the older polymerases. The Perkin Elmer Applied Biosystems ABI Prism 7700 was used to perform real-time PCR in order to obtain quantitative gene expression data on the transcript. Figures 8A and 8B demonstrate that, on average, MS patients have levels of expression which were 6.8 times that of healthy patients (p< 0.029).

As real-time PCR revealed that MS patients differentially expressed the novel gene compared to controls, other autoimmune patients were examined.

PBMCs from four patients with Crohn's disease, one with Hashimoto's thyroiditis and one with psoriasis were tested and compared to controls. Interestingly, the change in expression of the novel gene for these patients was in the opposite direction from that of the MS patients previously examined compared with healthy controls. (Figure 9).

As a further study, real-time PCR was used to examine the expression of the novel gene in other settings of immune activity. Figure 10 demonstrates the difference in expression levels of the novel gene during (sick) and several months after (baseline) infection with influenza and before and after receiving the flu and hepatitis B vaccines. Four subjects donated blood when they were feeling well and then again while having influenza. Four additional subjects donated blood before and shortly after having received the influenza vaccine. One additional subject donated blood before and after (at 4,8, and 17 days) having received the hepatitis B vaccine. The lower levels of expression of the novel gene after subjects were vaccinated indicate that the increased levels of expression seen in MS patients is not simply due to ongoing immune response.

The expression of the novel gene in various MS disease subgroups was also examined. Figures 11A-C show the level of expression in relapsing-remitting patients (RR MS, Figure 11A), secondary progressive patients (SP MS, Figure 11B), and primary progressive patients (PP MS, Figure 11C) compared to total MS patients and healthy subjects. The level of expression of the novel gene is high in both relapsing-remitting patients and secondary progressive patients. The data indicated a possible slight trend toward greater expression in secondary progressive patients over relapsing-remitting patients but the difference did not reach statistical significance. Blood samples from only two primary progressive patients were available. Levels of expression of the novel gene in these two patients were not different from healthy controls. Though greater sample numbers are needed to statistically confirm this finding, these data do support the hypothesis of a number of researchers that primary progressive MS is fundamentally different from relapsing forms of MS.

Interferon-P is used to treat MS. A cross-sectional analysis of expression of the novel gene in patients not on immunomodulatory treatment versus patients being treated with interferon-P was performed. (Figure 12). The patients on interferon-P expressed levels of this gene that were approximately the same as healthy controls. This suggests that interferon-P treatment reverses the abnormally high level of expression of this gene observed in untreated MS patients. Such data reinforce that idea that suppression of expression of the novel gene may be a useful therapeutic method for treating MS.

A study was performed to screen for potential age-related alterations in gene expression. Figure 13 shows the data on subjects arrayed on the graph from youngest to oldest (left to right). These patients ranged in age from 20-59 for healthy controls and 28-61 for MS patients. No demonstrable age effect on the levels of expression of the novel gene in either healthy or MS patients.

As earlier studies with Northern blots indicated that the novel gene was differentially expressed in cancer cell lines compared to healthy cells, real-time PCR was also performed on a wide variety of transformed cell lines. Figure 14 shows the difference in expression of the novel gene among different cancer cell lines and reinforces that the present invention may be useful in diagnostic and therapeutic applications in cancer.

EXAMPLE 2 Using the cDNA sequence of SEQ ID NO: 1 or a fragment thereof, the cDNA can be in vitro transcribed and translated using, e. g. , the Promega TnT kit.

The resulting protein or polypeptide can be N-terminal amino acid sequenced.

The amino acid sequence will be readily deduced and can be purified using 2D gel electrophoresis. Vectors containing the novel cDNA can be transfected into various cellular systems to obtain large amounts of protein.

Once the protein or polypeptide is expressed in a cellular system, monoclonal or polyclonal antibodies can be raised using the entire protein sequence or a shorter polypeptide fragment.

Various cellular assays employing the polynucleotides, polypeptides, and/or immunoglobulins of the present invention can be used to screen for small molecules that affect the expression/function of the polynucleotide and/or polypeptide of the present invention as candidate compounds to treat autoimmune diseases or cancer. The design of such assays is well known in the art, and may include analysis of mRNA and/or protein expression.

While the invention has been described and illustrated herein by references to various specific material, procedures, and examples, it is understood that the invention is not restricted to the particular material, combinations of material, and procedures selected for that purpose. Numerous variations of such details can be implied and will be appreciated by those skilled in the art.

All references cited herein are hereby incorporated by reference in their entirety for all purposes. This application claims priority to U. S. provisional application 60/374,820, filed April 24,2002 ; the text of which is herein incorporated by reference in their entirety for all purposes.