INHIBITORS OF INTERLEUKIN-lβ CONVERTING ENZYME

TECHNICAL FIELD OF THE INVENTION

The present invention relates to novel classes of compounds which are inhibitors of mterleukm-lβ converting enzyme ("ICE") . This invention also relates to pharmaceutical compositions comprising these compounds. The compounds and pharmaceutical compositions of this invention are particularly well suited for inhibiting ICE activity and consequently, may be advantageously used as agents against ιnterleukιn-1- ("IL-1"), apoptosis-, interfere: gamma inducing factor- ("IGIF") and interferon-γ- ("IFN-γ") mediated diseases, including inflammatory diseases, autoimmune diseases, destructive Pone, proliferative disorders, infectious diseases and degenerative diseases. This invention also relates to methods for inhibiting ICE activity, and decreasing IGIF production and IFN-γ production and methods for treating mterleukin-1-, apoptosis-, IGIF- and IFN- _\ - mediated diseases using the compounds and compositions of this invention. This invention also relates tc methods of preparing N-acylammo compounds.

BACKGROUND OF THE INVENTION Interleukm 1 ("IL-1") is a major pro- inflammatory and lmmunoregulatory protein that stimulates fibroblast differentiation and proliferation, the production of prostaglandms, collagenase and phospholipase by synovial cells and chondrocytes, basophil and eosmophil degranulation and neutrophil activation. Oppenheim, J.H. et al, Immunology Today. 7, pp. 45-56 (1986) . As such, it is involved in the pathogenesis of chronic and acute inflammatory and autoimmune diseases. For example, in rheumatoid arthritis, IL-1 is both a mediator of inflammatory symptoms and of the destruction of the cartilage proteoglycan m afflicted joints. Wood, D.D. et al., Arthritis Rheum. 26, 975, (1983) ; Pettipher, E.J. et al., Proc. Natl. Acad. Sci. UNITED STATES OF AMERICA 71, 295 (1986) ; Arend, W.P. and Dayer, J.M., Arthritis Rheum. 38, 151 (1995) . IL-1 is also a highly potent bone resorption agent. Jandiski, J.J., J. Oral Path 17, 145 (1988) ; Dewhirst, F.E. et al . , J. Immunol. 8, 2562 1985) . It is alternately referred to as "osteoclast activating factor" m destructive bone diseases such as osteoarthritis and multiple myeloma. Bataille, R. et al . , Int. J. Clm. Lab. Res. 21(4) , 283 (1992 ¹ . In certain proliferative disorders, sucn as acute myelogenous leukemia and multiple myeloma, IL-1 can promote tumor cell growth and adhesion. Bam, M.R., J. Natl. Cancer Inst. 83, 123 (1991) ; Vιda_- Vanaclocha, F., Cancer Res. 54, 2667 (1994) . In these disorders, IL-1 also stimulates production of other cytokines such as IL-6, which can modulate tumor development (Tartour et al . , Cancer Reε . 54, 6243 il994> . IL-1 is predominantly produced by peripneral biooα monocytes as part of the inflammatory response

and exists m two distinct agonist forms, IL-lα and IL- lβ. Mosely, B.S. et al . , Proc. Na . Acad. Sc .. 84, pp. 4572-4576 (1987) ; Lonnemann, G. et al . , Eur . J. Immunol .. 19, pp. 1531-1536 (1989) . IL-lβ is synthesized as a biologically inactive precursor, pIL-lβ. pIL-lβ lacks a conventional leader sequence and is not processed by a signal peptidase. March, C.J., Nature . 315, pp. 641-647 (1985) . Instead, pIL-lβ is cleaved by interleukin-lβ converting enzyme ("ICE") between Asp- 116 and Ala-117 to produce the biologically active C-terminal fragment found in human serum and synovial fluid. Sleath, P.R., et al . , J. Biol . Chem.. 265, pp. 14526-14528 (1992) ; A.D. Howard et al . , J__. Immunol . , 147, pp. 2964-2969 (1991) . ICE is a cysteine protease localized primarily m monocytes. It converts precursor IL-lβ to the mature form. Black, R.A. et al., FER.q Lett.. 247, pp. 386-390 (1989) ; Kostura, M.J. et al., Proc. Natl. Acad. Sci. UNITED STATES OF AMERICA, 86, pp. 5227-5231 (1989) . Processing by ICE is also necessary for the transport of mature IL-lβ through the cell membrane.

ICE, or its homologs, also appears to be involved m the regulation of programmed cell death or apoptosis. Yuan, J. et al . , Cell , 75, pp. 641-652

(1993) ; Miura, M. et al , Cell. 75, pp 653-660 (1993) , Nett-Fiordalisi, M.A. et al . , J. Cell Biochem.. 17B, p. 117 (1993) . In particular, ICE or ICE homologs are thought to be associated with the regulation of apoptosis in neurodegenerative diseases, such as

Alzheimer's and Parkinson's disease. Marx, J and M Baringa, Science. 259, pp. 760-762 (1993) , Gagliardini, V et al . , Science, 263, pp. 826-828 (1994) Therapeutic applications for inhibition of apoptosis

may include treatment of Alzheimer's disease, Parkinson's disease, stroke, myocardial infarction, spinal atrophy, and aging.

ICE has been demonstrated to mediate apoptosis (programmed cell death) m certain tissue types. Steller, H., Science. 267, p. 1445 (1995) ; Whyte, M. and Evan, G. , Nature. 376, p. 17 (1995) ; Martin, S.J. and Green, D.R., £e_H, 82, p. 349 (1995) ; Alnemri, E.S., et al . , J. Biol . Chem.. 270, p. 4312 (1995) ; Yuan, J. Curr. Opin. Cell Biol.. 7, p. 211

(1995) . A transgenic mouse with a disruption of the ICE gene is deficient in Fas-mediated apoptosis (Kuida, K. et al . , Science 267, 2000 (1995)) . This activity of ICE is distinct from its role as the processing enzyme for pro-ILlβ. It is conceivable that m certain tissue types, inhibition of ICE may not affect secretion of mature IL-lβ, but may inhibit apoptosis.

Enzymatically active ICE has been previously described as a heterodimer composed of two subunits, p20 and plO (20kDa and lOkDa molecular weight, respectively) . These subunits are derived from a 45kDa proenzyme (p45) by way of a p30 form, through an activation mechanism that is autocatalytic . Thornberry, N.A. et al . , Nature. 356, pp. 768-774 (1992) . The ICE proenzyme has been divided into several functional domains: a prodomain (pl4) , a p22/20 subunit, a polypeptide linker and a plO subunit Thornberry et al . , supra; Casano et al , Geno ics . 20, pp. 474-481 (1994) . Full length p45 has been characterized by ms cDNA and ammo acid sequences. PCT patent applications WO 91/15577 and WO 94/00154 The p20 and plO cDNA and ammo acid sequences are also known Thornberry et al .. supra. Murme and rat ICE have also been sequenced and cloned. They have high ammo acid and

nucleic acid sequence homology to human ICE. Miller, D.K. et al., Ann. N.Y. Acad. Sci.. 696, pp. 133-148 ( ₁ 993) ; Mo neaux, S.M. et al . , Proc. Nat . Acad. Sci .. 90, pp. 1809-1813 (1993) . The three-dimensional structure of ICE has been determined at atomic resolution by X-ray crystallography. Wilson, K.P , et al . , Nature. 370, pp. 270-275 (1994) The active enzyme exists as a tetramer of two p20 and two plO subunits . Additionally, there exist human homologs of

ICE with sequence similarities the active site regions of the enzymes. Such homologs include TX (or ^ICE rel-I _I ^or ICH-2) (Faucheu, et al . , EMBO J.. 14, p 1914 (1995) ; Kamens J., et al . , J, BlQl , Chem, , 270, p 15250 (1995) , Nicholson et al . , J. Biol . Chem.. 270

15870 (1995)) , TY (or ICE _rel _ _III ) (Nicholson et al . , i_. R-iol . Chem.. 270, p. 15870 (1995) ; ICH-1 (or Nedd-2) (Wang, L. et al . , Cell. 78, p 739 (1994)) , MCH-2, (Fernandes-Alnemn, T. et al . , Cancer Res .. 55, p 2737 (1995), CPP32 (or YAMA or apopain) (Fernandes-Alnemn, T. et al., J. Biol. Chem.. 269, p. 30761 (1994) , Nicholson, D.W. et al . , Nature. 376, p. 37 (1995) ) , and CMH-1 (or MCH-3) (Lippke, et al . , J. Biol . Chem.. (1996) ; Fernandes-Alnemn, T. et al , Cancer Res . , (1995)) . Each of these ICE homologs, as well as ICE itself, is capable of inducing apoptosis when overexpressed transfected cell lines Inhibition of one or more of these homologs with the peptidyl ICE inhibitor Tyr-Val-Ala-Asp-chloro ethylketone results m inhibition of apoptosis in primary cells or cell lines Lazebmk et al . , Nature. 371, p. 346 (1994) The compounds described herein are also capable of inhibiting one or more homologs of ICE (see Example 5) Therefore, these compounds may be used to inhibit apoptosis in tissue types that contain ICE homologs, but which do not contain active ICE or produce mature

IL- lβ .

Interferon-garama inducing factor (IGIF) is an approximately 18-kDa polypeptide that stimulates T-cell production of interferon-gamma (IFN-γ) . IGIF is produced by activated Kupffer cells and macrophages m vivo and is exported out of such cells upon endotoxm stimulation. Thus, a compound that decreases IGIF production would be useful as an inhibitor of such T- cell stimulation which in turn would reduce the levels of IFN-γ production by those cells.

IFN-γ is a cytokine with immunomodulatory effects on a variety of immune cells. In particular, IFN-γ is involved in macrophage activation and Thl cell selection (F. Belardelli, APMIS. 103, p. 161 (1995) ) . IFN-γ exerts its effects in part by modulating the expression of genes through the STAT and IRF pathways (C. Schindler and J.E. Darnell, Ann. Rev. Biochem., 64, p. 621 (1995); T. Tamguchi, J. Cancer Res. Clm. Oncol.. 121, p. 516 (1995)) . Mice lacking IFN-γ or its receptor have multiple defects m immune cell function and are resistant to endotoxic shock (S. Huang et al . , Science, 259, p. 1742 (1993); D. Dalton et al . , Science, 259, p. 1739 (1993); B. D. Car et al., J. Exp. Med.. 179, p. 1437 (1994)) . Along with IL-12, IGIF appears to be a potent inducer of IFN-γ production by T cells (H. Okamura et al . , Infection and Immunity, 63, D. 3966 (1995) ; H. Okamura et al . , Nature, 378, p. 88 '1995) ; S. Lshio et al., J. Immunol., 156, p. 4274 f 1996) ) . IFN-γ has been shown to contribute to the pathology associated with a variety of inflammatory, infectious and autoimmune disorders and diseases . Thus, compounds capable of decreasing IFN-γ production

would be useful to ameliorate the effects of IFN-γ related pathologies.

The biological regulation of IGIF and thus IFN-γ has not been elucidated. It is known that IGIF is synthesized as a precursor protein, called "pro-

IGIF". It has been unclear, however, how pro-IGIF is cleaved and whether its processmg has biological importance.

Accordingly, compositions and methods capable of regulating the conversion of pro-IGIF to IGIF would be useful for decreasing IGIF and IFN-γ production m vivo- and thus for ameliorating the detrimental effects of these proteins which contribute to human disorders and diseases. However, ICE and other members of the

ICE/CED-3 family have not previously been linked to the conversion of pro-IGIF to IGIF or to IFN-γ production vivo.

ICE inhibitors represent a class of compounds useful for the control of inflammation or apoptosis or both. Peptide and peptidyl inhibitors of ICE have been described. PCT patent applications WO 91/15577; WO 93/05071; WO 93/09135; WO 93/14777 and WO 93/16710; and European patent application 0 547 699. Such peptidyl inhibitors of ICE has been observed to block the production of mature IL-lβ in a mouse model of inflammation (vide infra) and to suppress growth of leukemia cells in vi tro (Estrov et al . , Blood 84, 380a (1994)) . However, due to their peptidic nature, such inhibitors are typically characterized by undesirable pharmacologic properties, such as poor cellular penetration and cellular activity, poor oral absorption, poor stability and rapid metabolism. Plattner, J.J. and D.W. Norbeck, m Drug Discovery

Technologies, CR. Clark and W.H. Moos, Eds. (Ellis Horwood, Chichester, England, 1990) , pp. 92-126. This has hampered their development into effective drugs. Non-peptidyl compounds have also been reported to inhibit ICE in vitro. PCT patent application WO 95/26958; US Patents 5,552,400; Dolle et al., J. Med. Chem.. 39, pp. 2438-2440 (1996) ; However, it is not clear whether these compounds have the appropriate pharmacological profile to be therapeutically useful.

Additionally, current methods for the preparation of such compounds are not advantageous. These methods use tributylt hydride, a toxic, moisture sensitive reagent. Thus, these methods are inconvenient to carry out, pose a health risk and create toxic-waste disposal problems. Furthermore, it is difficult to purify compounds prepared by these methods .

Accordingly, the need exists for compounds that can effectively inhibit the action of ICE m vivo , for use as agents for preventing and treating chronic and acute forms of IL-1-medιated diseases, apoptosis-, IGIF-, or IFN-γ-medιated diseases, as well as inflammatory, autoimmune, destructive bone, proliferative, infectious, or degenerative diseases. The need also exists for methods of preparing such compounds .

SUMMARY OF THE INVENTION The present invention provides novel classes of compounds, and pharmaceutically acceptable derivatives thereof, that are useful as inhibitors of ICE. These compounds can be used alone or in combination with other therapeutic or prophylactic agents, such as antibiotics, immunomodulators or other anti-inflammatory agents, for the treatment or

prophylaxis of diseases mediated by IL-1, apoptosis, IGIF or IFN-γ. According to a preferred embodiment, the compounds of this invention are capable of binding to the active site of ICE and inhibiting the activity of that enzyme Additionally, they have improved cellular potency, improved pharmacokmetics, and/or improved oral bioavailability compared to peptidyl ICE inhibitors .

It is a principal object of this invention to provide novel classes of compounds which are inhibitors of ICE represented by formulas:

(CJ 2'm ^"

/

S R ₁ -NH-X ₁

\

(CH ₂ ) _g -R _;

(I) , (VI) R ₁ -N-R ₂ ; and H

where the various substituents aie describeα herein. It is a further object of this invention co provide a process of preparing N-acylammo compounds by coupling a carboxylic acid with an alloc-protected am e .

BRIEF DESCRIPTION OF THE DRAWINGS Fig. 1A ICE cleaves pro-IGIF vivo. Cell lysates from Cos cells transfected with the various indicated expression plasmids or controls were analyzed for the presence of IGIF by separating proteins by SDS-PAGE and lmmunoblottmg with anti-IGIF antisera (lane 1, mock transfected cells; lane 2, pro-IGIF alone; lanes 3-12, pro-IGIF in combination with ICE, ICE-C285S, CPP32, CPP32-C163S, CMH-1, CMH-1-C186S, Tx, Tx-C258S, respectively) . Mobilities of pro-IGIF and the 18-kDa mature IGIF are indicated on the right. Molecular weight markers m kDa are shown on the left (Example 23) .

Fig. IB ICE cleaves pro-IGIF at the authentic processing site vitro as shown by Coomassie blue stammg of proteolytic reaction products separated by SDS-PAGE (Example 23) . The proteases and inhibitors used were: lane 1, buffer control; lane 2, 0.1 nM ICE; lane 3, 1 nM ICE; lanes 4 and 5, 1 nM ICE with 10 nM Cbz-Val-Ala-Asp- [ (2, 6-dιchlorobenzoyl ) oxy]methyl ketone and 100 nM Ac-Tyr-Val-Ala-Asp-aldehyde, respectively; lanes 6 and 7, 15 nM CPP32 with and without 400 nM Ac-Asp-Glu-Val-Asp-aldehyde (D. W. Nicholson et al., Nature, 376, p. 37 (1995) ), respectively; lane 8, 100 nM CMH-1; lane 9, 10 units/ml granzyme B; ana M, molecular weight markers in kDa.

Fig. IC ICE cleavage converts inactive pro-IGIF to active IGIF which induces IFN-γ production in Th_ helper cells. Uncleaved (Pro-IGIF), ICE-cleaved (Pro- IGIF/ICE) , CPP32-cleaved (Prc-IGIF/CPP32) , and recomomant mature IGIF (rIGIFi were incubated with

A.E7 Thl cells at 12 ng/ l (open bar) and 120 ng/ l (hatched bar) for eighteen hours and the levels of IFN-

Y released mto the culture medium assayed by ELISA (Example 23) . A.E7 cells cultured with buffer, ICE alone (ICE) or CPP32 alone (CPP32) were assayed similarly for negative controls. The numbers represent the average of three determinations.

Fig. 2A Mature IGIF (18-kDa) is produced by Cos cells co-transfected with pro-IGIF and ICE-express g plasmids. Cell lysates (left) and conditioned medium (right) from Cos cells transfected with a pro-IGIF expression plasmid in the absence (-) or presence of an expression plasmid encoding wild type (ICE) or inactive mutant (ICE-C285S) ICE. Transfected cells were metabolically labeled with "S-methionme, proteins from cell lysates and conditioned medium lmmunoprecipitated with anti-IGIF antisera and separated by SDS-PAGE (Example 24) . Mobilities of pro-IGIF and the 18-kDa mature IGIF are indicated on the right. Molecular weight markers in kDa are shown on the left.

Fig. 2B IFN-γ inducing activity is detected in Cos cells co-transfected with pro-IGIF and ICE-expressmg plasmids. Cell lysates (hatched bar) and conditioned medium (open bar) from Cos cells transfected with a pro-IGIF expression plasmid in the absence (Pro-IGIF) or presence (Pro-IGIF/ICE) of an expression plasmid encoding wild type (ICE) were assayed for lFN-γ levels (ng/ml) by ELISA. Cos cells transfected with buffer (Mock) or an ICE-expressmg plasmid alone (ICE; served as negative controls (Example 24) .

Fig. 3A Kupffer cells from mice lacking ICE are defective in the export of IGIF. Kupffer cells from wild type mice (ICE +/+) or ICE-deflcient mice homozygous for an ICE mutation (ICE-/-) were isolated and primed with LPS for three hours. The levels of lmmunoreactive IGIF polypeptides in the conditioned media (ng/ml) of wild type cells were measured by ELISA (Example 25) . N.D. (not detectable) indicates that the IGIF concentration was less than 0.1 ng/ml.

Fig. 3B Kupffer cells from mice lacking ICE are defective m the export of mature IGIF. Kupffer cells from wild type mice (ICE +/+) or ICE deficient mice homozygous for an ICE mutation (ICE -/-) were isolated and primed with LPS for three hours. Primed cells were metabolically labeled with ³⁵ S-methιonme, proteins from cell lysates and conditioned medium immunoprecipitated with anti-IGIF antisera and separated by SDS-PAGE (Example 25) . Mobilities of pro-IGIF and the 18-kDa mature IGIF are indicated on the right. Molecular mass markers in kDa are shown on the left.

Fig. 3C Serum from ICE-deflcient mice contains reduced levels of IGIF. Serum samples from wild type mice (ICE +/+) or ICE deficient mice homozygous for an ICE mutation (ICE -/-) were assayed for IGIF levels (ng/ml) by ELISA (Example 25) .

Fig. 3D Serum from ICE-deflcient mice contains reduced levels cf IFN-γ. Serum samples from wild type mice (ICE +/+) or ICE deficient mice homozygous for an ICE mutation (ICE -/-) were assayed for IFN-γ levels (ng/ml) by ELISA (Example 25) .

Fig. 4 Serum IFN-γ levels are significantly reduced in ICE-de icient mice after an acute challenge with LPS (Example 26) . Serum samples from wild type mice (filled squares) or ICE-deficient mice (filled circles) were assayed for IFN-γ levels (ng/ml) by ELISA as a function of time (hours) after LPS challenge. Temperatures of the animals during the time course in degrees Celcius is shown for wild type mice (open squares) or ICE-deficient mice (open circles) .

Fig. 5 The ICE inhibitor, AcYVAD-aldehyde (AcYVAD-

CHO) , inhibits LPS-stimulated IL-lβ and IFN-γ synthesis by human peripheral blood mononuclear cells (PBMC) . Percent (%) inhibition as a function of inhibitor concentration (μM) is shown for IL-lβ (open squares) and IFN-γ (open diamonds) synthesis.

Fig. 6 Compound 214e inhibits IL-lβ production in LPS-challenged mice. Serum samples from CD1 mice were assayed for IL-lβ levels (pg/ml) by ELISA after LPS challenge. Compound 214e was administered by intraperitoneal (IP) injection one hour after LPS challenge. Blood was collected seven hours after LPS challenge (see Example 7) .

Fig. 7 Compound 217e inhibits IL-lβ production LPS-challenged mice. Serum samples from CD1 mice were assayed for IL-lβ levels (pg/ml) by ELISA after LPS challenge. Compound 217e was administered by intraperitoneal (IP) injection one hour after LPS challenge. Blood was collected seven hours after LPS challenge (see Example 7) .

Fig. 8 Compound 214e, but not compound 217e,

inhibits IL-lβ production m LPS-challenged mice when administered by oral gavage . This assay measures oral absorption under similar conditions as those described for Figs. 6 and 7. These results indicates that 214e is potentially orally active as an ICE inhibitor (see Example 7) .

Fig. 9 Compound 214e and analogs of 214e also inhibit IL-lβ production after IP administration. These results were obtained the assay described for Figs. 6 and 7 and Example 7.

Fig. 10 Compound 214e, and analogs of 214e, also inhibit IL-lβ production after oral (PO) administration. These results were obtained in the assay described for Figs. 6 and 7 and Example 7.

Figs. 11A/B Compounds 302 and 304a show detectable blood levels when administered orally (50mg/kg, 0.5 % carboxymethylcellulose) to mice. Blood samples were collected at 1 and 7 hours after dosing Compounds 302 and 304a are prodrugs of 214e and are metabolized to 214e m _. vivo. Compound 214e shows no blood levels above 0 10 μg/ml when administered orally (Example 8)

Fig. 12 Compound 412f blocks the progression of type II collagen-induced arthritis male DBA/lJ mice (Wooley, P.H., Methods n Enzvmoloαy. 162, pp. 361-373 (1988) and Geiger, T., Clinical and Experimental

Rheumatology, 11, pp. 515-522 (1993)) . Compound 412f was administered twice a day (10, 25 and 50mg/kg) , approximately 7h apart, by oral gavage Inflammation was measured on the Arthritis Severity Score on a 1 to 4 scale of increasing severity The scores of the two front paws were added to give the final score (see Example 21) .

Fig. 13 Compound 412d blocks the progression of type II collagen-induced arthritis in male DBA/lJ mice. The results were obtained as described for Fig. 12 and in Example 21.

Fig. 14 Compound 696a blocks the progression of type II collagen-induced arthritis m male DBA/lJ mice. The results were obtained as described for Fig. 12 and in Example 21.

DMF dimethyIformamide

DIEA N, N-diisopropylethylamine

EDC 1- (3-Dimethylaminopropyl) -3- ethylcarbodiimide hydrochloride

Et ₂ 0 diethyl ether EtOAc ethyl acetate Fmoc 9-fluorenylmethyoxycarbonyl HBTU O-benzotriazol-1-yl-Jv, N, N' , N' - tetramethyluronium hexafluorophosphate

HOBT 1-hydroxybenzotrιazole hydrate MeOH methanol TFA trifluoroacetic acid Alloc allyloxycarbonyl

Definitions The following terms are employed herein: The term "interferon gamma inducing factor" or "IGIF" refers to a factor which is capable of stimulating the endogenous production of IFΝ-γ.

The term "ICE inhibitor" refers to a compound which is capable of inhibiting the ICE enzyme. ICE inhibition may be determined using the methods described and incorporated by reference herein. The skilled practitioner realizes that an in vivo ICE inhibitor is not necessarily an in vitro ICE inhibitor. For example, a prodrug form of a compound typically demonstrates little or no activity in vitro assays. Such prodrug forms may be altered by metabolic or other biochemical processes in the patient to provide an in v vo ICE inhibitor.

The term "cytokine" refers to a moLecule which mediates interactions between cells.

The term "condition" refers to any disease,

disorder or effect that produces deleterious bioiogical consequences in a subject.

The term "subject" refers to an animal, or to one or more cells derived from an animal. Preferably, the animal is a mammal, most preferably a human. Cells may be m any form, including but not limited to cells retained m tissue, cell clusters, immortalized cells, transfected or transformed cells, and cells derived from an animal that have been physically or phenotypically altered.

The term "active site" refers to any or all of the following sites in ICE the substrate binding site, the site where an inhibitor binds and the site where the cleavage of substrate occurs The term "heterocycle" or "heterocyclic" refers to a stable mono- or polycyclic compound which may optionally contain one or two double bonds or may optionally contain one or more aromatic rings. Each heterocycle consists of carbon atoms and from one to four heteroatoms independently selected from a group including nitrogen, oxygen, and sulfur As used herein, the terms "nitrogen heteroatoms" and "sulphur heteroatoms" include any oxidized form of nitrogen or sulfur and the quaternized form of any basic nitrogen Heterocycles defined above include, for example, pynmidmyl, tetrahydroqu olyl, tetrahydroisoquinonl yl, pur yl, pyrimidyl, indolinyl, benzimidazolyl , lmidazolyl , lmidazolinoyl , imidazolid yl, quinolyl , isoqumolyl, dolyl , pyridyl, pyrrolyl, pyrrol yl, pyrazolyl , pyrazmyl, qu oxolyl , piperid yl, morpholmyl, thiamorpholmyl , furyl , thienyl, triazolyl, thiazolyl, β-carbolmyl , tetrazolyl, thiazolid yl , benzofuranoyl , thiamorpholmyl sulfone, benzoxazolyl , oxopiperiαmyl , oxopyrrold yl , oxoazep yl, azep yl, isoxazolyl ,

- 1 !

tetrahydropyranyl, tetrahydrofuranyl , thiadiazolyl , benzodioxolyl, benzothienyl , tetrahydrothiophenyl and sulfolanyl. Further heterocycles are described in A.R. Katritzky and C.W. Rees, eds , Comprehenslve Heterocyclic Chemistry. The Structure. Reactions.

Synthesis and Use of Heterocyclic Compounds. Vol. 1-8, Pergamon Press, NY (1984) .

The term "cycloalkyl" refers to a mono- or polycyclic group which contains 3 to 15 carbons and may optionally contain one or two double bonds. Examples mclude cyclohexyl, adamantyl and norbornyl .

The term "aryl" refers to a mono- or polycyclic group which contains 6, 10, 12, or 14 carbons in which at least one ring is aromatic. Examples include phenyl, naphthyl, and tetrahydronaphthalene.

The term "heteroaromatic" refers to a ono- or polycyclic group which contains 1 to 15 carbon atoms and from 1 to 4 heteroatoms, each of which is selected independently from a group including sulphur, nitrogen and oxygen, and which additionally contains from 1 to 3 five or six membered rings, at least one of which is aromatic .

The term "alpha-ammo acid" (α-ammo acid) refers to both the naturally occurring am o acids and other "non-protein" -amino acids commonly utilized by those m the peptide chemistry arts when preparing synthetic analogues of naturally occurring peptides, including D and L forms The naturally occurring ammo acids are glycine, alanine, valme, leucine, iso- leucme, serme, methion e, threonme, phenylalanme, tyrosine, tryptophan, cysteme, prohne, histidine, aspartic acid, asparagme, glutamic acid, glutamme, γ carboxyglutamic acid, argmme, ormthme and lyεme Examples of "non-protein" alpha-ammo acids mclude

hydroxylysine, homoserine, homotyros e, homo- phenylalanine, citrulline, kynuren e, 4-ammo- phenylalanme, 3- (2-naphthyl) -alanine, 3- (l-naphthyl) - alanine, methionine sulfone, t-butyl-alanine, t-butylglycme, 4-hydroxyphenylglycme, am oalanme, phenylglycine, vinylalanine, propargyl-glyc e, 1,2, 4-trιazolo-3-alanme, 4,4, 4-trifluoro-threonme, thyronine, 6-hydroxytryptophan, 5-hydro-xytryptophan, 3-hydroxykynuren e, 3-aminotyros e, trifuoromethyl- alanine, 2-thιenylalanine, (2- (4-pyridyl) ethyl) - cysteine, 3 , -dimethoxy-phenylalan e, 3- (2-thiazolyl) - alanine, ibotenic acid, 1-ammo-l-cyclopentane- carboxylic acid, 1-amιno-l-cyclohexanecarboxylιc acid, quisqualic acid, 3-trifluoromethylphenylalan e, 4-trιfluoro- ethylphenylalan e, cyclohexylalan e, cyclo-hexylglycine, thiohistidine, 3-methoxytyrosme, elastatinal, norleucme, norvaline, alloisoleucine, homoarginine, thioproline, dehydroproline, hydroxy- proline, isonipectotic acid, homoprolme, cyclohexyl- glycine, -amino-n-butyric acid, cyclohexylalanme, ammophenylbutyric acid, phenylalanmes substituted at the ortho, meta, or para position of the phenyl moiety with one or two of the following: a (C^C. _} ) alkyl, a (C]_-C ) alkoxy, halogen or nitro groups or substituted with a methylenedioxy group; β-2- and 3-thιenyl- alanine, β-2- and 3-furanylalanme, β-2-, 3- and

4-pyridylalanine, β- (benzothienyl-2- and 3-yl ) alanine, β-(l- and 2-naphthyl) alanine, O-alkylated derivatives of serme, threonme or tyrosme, S-alkylated cysteine, S-alkylated homocysteme, O-sulfate, O-phosphate and O- carboxylate esters of tyrosme, 3-sulfo-tyrosme, 3- carboxy-tyrosine, 3-phospho-tyrosme, 4 -methane sulfonic acid ester of tyrosine, 4-methane phosphonic acid ester of tyrosine, 3 , 5-dιιodotyrosιne, 3-nιtro- tyrosine, ε-alkyl lys e, and delta-alkyl ornith e

Any of these α-amino acids may be substituted with a methyl group at the alpha position, a halogen at any aromatic residue on the α-amino side chain, or an appropriate protective group at the O, N, or S atoms of the side chain residues. Appropriate protective groups are disclosed in "Protective Groups In Organic Synthesis," T.W. Greene and P.G.M. Wuts, J. Wiley & Sons, NY, NY, 1991.

The term "substitute" refers to the replacement of a hydrogen atom in a compound with a substituent group. In the present invention, those hydrogen atoms which form a part of a hydrogen bonding moiety which is capable of forming a hydrogen bond with the carbonyl oxygen of Arg-341 of ICE or the carbonyl oxygen of Ser-339 of ICE are excluded from substitution. These excluded hydrogen atoms include those which comprise an -NH- group which is alpha to a -CO- group and are depicted as -NH- rather than an X group or some other designation in the following diagrams: (a) through (t) , (v) through (z) .

The term "straight chain" refers to a contiguous unbranching string of covalently bound atoms. The straight chain may be substituted, but these substituents are not a part of the straight chain.

The term "K ₁ " refers to a numerical measure of the effectiveness of a compound m inhibiting the activity of a target enzyme such as ICE. Lower values of K- _L reflect higher effectiveness. The K _λ value is a derived by fitting experimentally determined rate data to standard enzyme kinetic equations (see I. H. Segel, Enzyme Kinetics, Wiley-Interscience, 1975) .

The term "patient" as used in this application refers to any mammal, especially humans. The term "pharmaceutically effective amount" refers to an amount effective m treating or

ameliorating an IL-1-, apoptosis-, IGIF- or IFN-γ- mediated disease in a patient. The term

"prophylactically effective amount" refers to an amount effective in preventing or substantially lessening IL-1-, apoptosis-, IGIF or IFN-γ mediated diseases m a patient.

The term "pharmaceutically acceptable carrier or adjuvant" refers to a non-toxic carrier or adjuvant that may be administered to a patient, together with a compound of this invention, and which does not destroy the pharmacological activity thereof

The term "pharmaceutically acceptable derivative" means any pharmaceutically acceptable salt, ester, or salt of such ester, of a compound of this invention or any other compound which, upon administration to a recipient, is capable of providing (directly or indirectly) a compound of this invention or an anti-ICE active metabolite or residue thereof Pharmaceutically acceptable salts of the compounds of this invention include, for example, those derived from pharmaceutically acceptable inorganic and organic acids and bases Examples of suitable acids include hydrochloric, hydrobromic, sulfuric, nitric, perchloric, fumaric, maleic, phosphoric, glycolic, lactic, salicylic, succinic, toluene-p-sulfonic, tartaric, acetic, citric, methanesulfonic, formic, benzoic, malonic, naphthalene-2-sulfonic and benzenesulfonic acids. Other acids, such as oxalic, while not in themselves pharmaceutically acceptable, may be employed in the preparation of salts useful as intermediates m obtaining the compounds of the invention and their pharmaceutically acceptable acid addition salts Salts derived from appropriate bases mclude alkali metal (e.g , sodium) , alkaline earth metal (e g , magnesium) , ammonium and N- (C _] __ ₄ alkyl) ₄ ⁺

salts .

This invention also envisions the "quaternization" of any basic nitrogen-containing groups of the compounds disclosed herein The basic nitrogen can be quaternized with any agents known to those of ordinary skill in the art including, for example, lower alkyl halides, such as methyl, ethyl, propyl and butyl chloride, bromides and iodides; dialkyl sulfates including dimethyl, diethyl, dibutyl and diamyl sulfates; long chain halides such as decyl, lauryl, myristyl and stearyl chlorides, bromides and iodides; and aralkyl halides including benzyl and phenethyl bromides. Water or oil-soluble or dispersible products may be obtamed by such quaternization.

The ICE inhibitors of this invention may contain one or more "asymmetric" carbon atoms and thus may occur as racemates and racemic mixtures, single enantiomers, diastereomeric mixtures and individual diastereomers . All such isomeric forms of these compounds are expressly included in the present invention. Each stereogenic carbon may be of the R or S configuration. Although specific compounds and scaffolds exemplified m this application may be depicted in a particular stereochemical com_guration, compounds and scaffolds having either the opposite stereochemistry at any given chiral center or mixtures thereof are also envisioned.

The ICE inhibitors of this invention may comprise ring structures which may optionally be suostituted at carbon, nitrogen or other atoms by various substituents Such ring structures may be singly or multiply substituted Preferably, the ring structures contain between 0 and 3 substituents When multiply substituted, each substituent may be picked independently of any other substituent as long as the

combination of substituents results in the formation of a stable compound

Combinations of substituents and variables envisioned by this invention are only those that result in the formation of stable compounds. The term

"stable", as used herein, refers to compounds which possess stability sufficient to allow manufacture and administration to a mammal by methods known in the art Typically, such compounds are stable at a temperature of 40°C or less, in the absence of moisture or other chemically reactive conditions, for at least a week

Substituents may be represented in various forms These various forms are known to the skilled practitioner and may be used interchangeably For example, a methyl substituent on a phenyl ring may be represented in any of the following forms

rious forms of su σbstituents such as methyl are used herein interchangeably.

DETAILED DESCRIPTION OF THE INVENTION

In order that the invention herein described may be more fully understood, the following detailed description is set forth.

The ICE inhibitors of one embodiment (A) of this invention are those of formula α

(CJ ₂ ) _m -T / α _. R ₁ -NH-X ₁

\ (CH ₂ ) -R,

wherein

X _χ i s - CH ;

each J is independently selected from the group consisting of -H, -OH, and -F, provided that when a first and second J are bound to a C and said first J is -OH, said second J is -H;

T is -OH, -CO-C0 ₂ H, -C0 ₂ H, or any bioisosteric replacement for -C0 H;

R _l is selected from the group consisting of the following formulae, in which any ring may optionally be singly or multiply substituted at any carbon by Q^_, at any nitrogen by R5, or at any atom by =0, -OH, -C0 ₂ H, or halogen; any saturated ring may optionally be unsaturated at one or two bonds, and wherem R- _j _ (e) and R- _L (y) are optionally benzofused;

R ₂ o is selected from the group consisting of

⁽ gg ⁾

wherein each ring C is independently chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R ₃ is:

-CN,

-CH=CH-R ₉ ,

-CH=N-0-R ₉ ,

-(CH ₂ ) ₁ _3-T ₁ -R ₉ ,

-CJ ₂ -R ₉ ,

-C0-R ₁₃ , or

/R ₅

-CO-CO-N

\Rιo ^; each R ₄ is independently selected from the group consisting of : -H,

- R9 ,

-T _] _-R ₉ , and

each T_ is independently selected from the group consisting of: CH=CH-, -0-,

-S-, -SO-,

-so ₂ -,

-NR ₁₀ -, -NR ₁₀ -CO-,

-CO-,

-0-CO-,

-CO-0-,

-CO-NR ₁₀ -, -O-CO-NR ₁₀ -,

-NR ₁₀ -CO-O-,

-NR ₁₀ -CO-NR ₁₀ -,

-SO ₂ -NR ₁₀ -,

-NR ₁₀ -SO ₂ -, and -NR ₁₀ -SO ₂ -NR ₁₀ - ;

each R ₅ is independently selected from the group consisting of :

-H,

-Ar^ , -CO-Ar^

-S0 ₂ -Ar ₁₍

-S0 ₂ -NH ₂ ,

-R ₉ , -CO-Rg,

-CO-0-R ₉ ,

-S0 ₂ -R ₉ ,

and

R ₆ and R ₇ taken together form a saturated 4-8 member carbocyclic ring or heterocyclic ring containing -0-, -S-, or -NH-; or R ₇ is -H and R ₆ is

-H

-Ar _{l t}

-Rg, an α-amino acid side chain residue;

each R ₉ is a C ₁ _g straight or branched alkyl group optionally singly or multiply substituted with -OH, -F, or =0 and optionally substituted with one or two Ar^ groups;

each R ₁₀ is independently selected from the group consisting of -H or a C _1--6 straight or branched alkyl group;

each R ₁₃ is independently selected from the group consistmg of -Ar , -R ₄ and -N-OH \

Rs ^; each Ar-, is a cyclic group independently selected

from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, a cycloalkyl group which contains between 3 and 15 carbon atoms and between 1 and 3 rings, said cycloalkyl group bemg optionally benzofused, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocycle group containing at least one heteroatom group selected from -0- , -S-, -SO-, -S0 ₂ -, =N-, and -NH-, said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted with -NH ₂ , -C0 ₂ H,

-Cl, -F, -Br, -I, -N0 ₂ , -CN, 0

/ \ =0, -OH, -perfluoro C _λ _ ₃ alkyl, CH ₂ , or -Q-,,

\ / 0 each Ar ₂ is independently selected from the following group, m which any ring may optionally be singly or multiply substituted by -Q and -Q :

d i : ^" I

.]] - and

^N --,

!kkl -O

each Q _] _ is independently selected from the group consisting of: -Ar ₂ -0-Ar ₂

-Rg,

-T^-Rg, and

each Q ₂ is independently selected from the group consisting of -OH, -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I,

-N0 ₂ , -CN, -CF ₃ , and O

/ \

CH ₂ ; \ /

0 provided that when -Ar-^ is substituted with a Q^ group which comprises one or more additional -Ar^ groups, said additional -Ar^ groups are not substituted with Q _ι;

each X is independently selected from the group consisting of =N- , and =CH- ;

each X ₂ is independently selected from the group consistmg of -O- , -CH ₂ -, -NH- , -S-, -SO-, and -S0 ₂ -,

each X ₃ is independently selecteα from the group consisting of -CH ₂ -, -S-, -SO-, and -S0 ₂ -;

each X ₄ is independently selected from the group consisting of -CH ₂ - and -NH- ;

each X5 is independently selected from the group consisting of -CH- and -N- ;

each Y is independently selected from the group consisting of -0-, -S-, and -NH;

each Z is independently CO or S0 ₂ ; each a is independently 0 or 1; each c is independently 1 or 2; each d is independently 0, 1, or 2 ,- and each e is independently 0, 1, 2, or 3 ; provided that when

R ₂ is (f) , R ₆ is an α-ammo acid side chain residue, and

R ₇ is -H, then (aal) and (aa2) must be substituted with Q _χ ;

also provided that when

m is 1,

R ₆ is an α-ammo acid side chain residue,

X ₂ is -CH ₂ -,

X ₅ is -CH- ,

Ro is /R 10

-CO-N

\R ₁₀ , or -C0-R ₁₃ , when

R ₁₃ s:

-CH ₂ -0-CO-Ar ₁ , -CH ₂ -S-CO-Ar ₁ , -CH ₂ -0-Ar ₁ , -CH ₂ -S-Ar _lf or

then the ring of the R- (O) group must be substituted with Q _] _ or benzofused; and

provided that when g is 0, m is 1, T is -C0 ₂ H, X ₂ is 0,

R ₅ is benzyloxycarbonyl, and ring C is benzo, then R ₃ cannot be -C0-R ₁₃ when: R ₁₃ is -CH ₂ -0-Ar ₁ and Ar _;L is 1-phenyl-3-trifluoromethyl- pyrazole-5-yl wherein the phenyl is optionally substituted with a chlorine atom; or when

R ₁₃ is -CH -0-C0-Ar ₁ , where Ar^ is 2 , 6-dichlorophenyl .

Preferred compounds of embodiment A employ formula α, wherem R is (w) :

where the other substituents are as described

above .

Other preferred compounds of embodiment A employ formula α, wherein R _] _ is (y) :

wherein the other substituents are as described above.

More preferred compounds of embodiment A employ formula oc, wherein:

X _j , is -CH;

g is 0;

m is 0 or 1 and T is -CO-C0 ₂ H, or any bioisosteric replacement for -C0 ₂ H, or m is 1 and T is -C0 ₂ H;

R _] _ is selected from the group consisting of the following formulae, in which any ring may optionally be singly or multiply substituted at any carbon by Q- , at any nitrogen by R ₅ , or at any atom by =0, -OH, -C0 ₂ H, or halogen, and wherein (e) is optionally benzofused:

H

:h)

R20 ^is

(aal!

(aa2) y N-. .(Chyc

and c is 1;

ring C is benzo optionally substituted with

-C _x _ ₃ alkyl, -0-C ₁ _ ₃ alkyl, -Cl, -F or -CF ₃ ;

when R _] _ is (a) or (b) , R ₅ is preferably -H, and

when R _λ is (c) , (e) , (f} , (o) , (r) , (w) , (x) or (y) , R ₅ is preferably:

-C0-Ar _x

-S0 ₂ -Ar ₁ ,

-CO-NH _2;

-CO-NH-Ar _x

-CO-R ₉ ,

-CO-0-R _9f

-S0 ₂ -R ₉ , or -CO-NH-Rg,

R ₇ is -H and R is: -H,

-Rg, or -Ar _ι;

R ₉ is a C _1-6 straight or branched alkyl group optionally substituted with =0 and optionally substituted with -Ar ;

R ₁₀ is -H or a -C _1--3 straight or branched alkyl group;

Ar^ is phenyl, naphthyl, pyridyl, benzothiazolyl , thienyl, benzothienyl, benzoxazolyl, 2-indanyl, or indolyl optionally substituted with -0- ι_ ₃ alkyl, -NH- C _1--3 alkyl, -N- (C ₁ _ ₃ alkyl) ₂ , -Cl, -F, -CF ₃ , - χ- ₃ alkyl, or O

CH ₂ ;

\ / 0 Q _λ is R ₉ or - ⁽ CH ₂ ⁾ 0, 1, 2" ^τ l" ^(CH 2> 0, 1, 2" ^Ar l' wherein

T _χ is -0- or -S-;

each X is independently selected from the group consisting of =N- , and =CH- ;

each X is independently selected from the group consisting of -0- , -CH ₂ -, -NH- , -S-, -S0-, and -S0 ₂ -;

each X ₅ is independently selected from the group consisting of -CH- and -N- ;

X. is -CH- or -N-

provided that when R _λ is (o) , X ₂ is -CH ₂ -,

is -N-

then the ring of the R^_ (o) group must be substituted with Q ₁ or benzofused; and

Z is C=0

Most preferably, compounds of this more preferred embodiment are those wherein the R- _j _ group is

and c is 2; or

or

which is optionally benzofused, and c is 1 or 2;

provided that when R _j _ is (e4) ,

R5 is benzyloxycarbonyl , and c is 1,

then R ₃ cannot be -C0-R _] _ ₃ when R ₁₃ is -CH ₂ -0-Ar ₁ and

Ar^ is 1-phenyl-3-trifluoromethyl-pyrazole- 5-yl, wherem the phenyl is optionally substituted with a chlorine atom; or when

R ₁₃ is -CH ₂ -O-CO-Ar^, wherem Ar! is 2 , 6-dichlorophenyl , and when the 2-position of the scaffold ring is substituted with para-fluoro-phenyl ; and

also provided that when g is 0 , J is -H,

T is C0 ₂ H or -CO-NH-OH,

R5 is a protective group for the N atom of an ammo acid side chain residue, and each c is 1,

then R ₃ cannot be -CO-R ₁₃ when R ₁₃ is:

-CH ₂ -0-CO-Ar ₁ ,

-CH ₂ -S-CO-Ar ₁ ,

-CH ₂ -0-Ar ₁ , or

-CH ₂ -S-Ar ₁ .

The most preferred compounds of this embodiment are those where :

m is 1 ;

T is -CO H; and

R ₃ is -CO-R 13 ^•

Other most preferred compounds of this embodiment are those where :

Ri is :

wherein

optionally substituted with R5 or Q _j at X ₂ when X- is -NH-; and

ring C is benzo substituted with -C ₁ _ ₃ alkyl, -0-C _1--3 alkyl, -Cl, -F or -CF ₃ .

The ICE inhibitors of another embodiment (B) of this invention are those of formula (1) :

(1) R ₁ ^~ N-R ₂

H

wherein:

Ri is selected from the group consisting of the following formulae:

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R is :

m is 1 or 2 ;

R ₅ is selected from the group consisting of -C(O) -R ₁₀ , -C(0)0-R ₉ ,

^R 10

/

^■ C(O) -NI

\

^R 10' ■S(0) ₂ -R ₉ ,

•C(O) -CH ₂ -0-R ₉ ,

^■ C(0)C(0) -R _10|

Rg.

-H, and ^■ C(0)C(0) -OR ₁₀ ;

Rg is selected from the group consisting of -H and -CH ₃ ;

R ₈ is selected from the group consisting of: -C ⁽ O ⁾ -R ₁₀ .

-C(0)0-R ₉ ,

-C(0) -N(H) -R ₁₀ ,

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ , -C(O) -CH ₂ -OR ₁₀ ,

-C(0)C(0) -R ₁₀ ;

-C(O) -CH ₂ N(R ₁₀ ) (R ₁₀ ) ,

-C(O) -CH ₂ C(0) -0-R ₉ ,

-C(O) -CH ₂ C(0) -R ₉ , -H, and

-C(O) -C(O) -OR ₁₀ ;

each R ₉ is independently selected from the group consisting of -Ar ₃ and a -C^-g straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -C ₁ _ ₆ alkyl group is optionally unsaturated;

each R ₁₀ is independently selected from the group consisting of -H, -Ar ₃ , a C _ ₆ cycloalkyl group, and a -C _l - ₆ straight or branched alkyl group optionally substituted with Ar , wherem the -C^g alkyl group is optionally unsaturated;

R ₁₃ is selected from the group consisting of H, Ar ₃ , and a C^-g straight or branched alkyl group optionally substituted with Ar ₃ , -C0NH ₂ , -OR ₅ , -OH, -OR ₉ , or -C0 ₂ H;

each R ₅₁ is independently selected from the group consisting of R ₉ , -C(0)-R ₉ , -C (0) - (H) -R ₉ , or each R ₅₁ taken together forms a saturated 4-8 member carbocyclic ring or heterocyclic ring containing -0- , -S-, or -NH- ,-

each R ₂₁ is independently selected from the group consisting of -H or a -C ₁ _ ₆ straight or branched alkyl group;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 ₂ , =N- , and -NH-, said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _ι;

each Q^ is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN,

=0, -OH, -perfluoro C _1--3 alkyl, R ₅ , -0R ₅ , -NHR ₅ , 0R ₉ ,

-NHR ₉ , R ₉ , -C(O)-R ₁₀ , and 0

/ \

CH , \ / 0

provided that when -Ar ₃ is substituted with a Q-, group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferably, R ₅ is selected from the group consisting of: -C(O)-R ₁₀ , -C(0)0-R ₉ , and -C(0) -NH-R ₁₀ .

Alternatively, R ₅ is selected from the group consisting of : -S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ , -C(0) -C(O) -R ₁₀ ,

-Rg, and -C(0) -C(0) -OR ₁₀ .

More preferably:

m is 1;

R ₁₃ is H or a -C _1--4 straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, wherem the R ₉ is a -C ₁ _ ₄ branched or straight alkyl group, wherem Ar ₃ is morpholmyl or phenyl, wherem the phenyl is optionally substituted with Q^ ,

R ₂₁ is -H or -CH ₃ ;

R ₅₁ is a C ₁ _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherem Ar ₃ is phenyl, optionally substituted by -Q _± ,

Ar ₃ is phenyl, naphthyl, thienyl, quinolinyl, lsoqu olmyl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl , thienothienyl , l idazolyl, thiadiazolyl, benzo [b] thiophenyl , pyriαyl benzofuranyl , and indolyl;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, -NHRg, and O

/ \

CH ₂ ,

\ / 0

wherem each R ₉ and R ₁₀ ^are independently a -C _] __g straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q _] _ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar .

The ICE inhibitors of another embodiment (C) of this invention are those of formula ( IX) ^•

wherem:

m is 1 or 2 ;

R ₁ is selected from the group consisting of the following formulae:

ieio:

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R ₃ is selected from the group consisting of: -CN,

-C(0) -H,

-C(0) -CH ₂ -T ₁ -R ₁₁ , -C(0)-CH ₂ -F,

-C=N-0-R ₉ , and -CO-Ar ;

R ₅ is selected from the group consisting of: -C(0)0-R ₉ ,

^R 10 / -C(O) -N \

^R 10<

-S(0) ₂ -R , -C(O) -CH ₂ -0-R ₉ , -C(0)C(0) -R ₁₀ , -R _9#

-H, and -C(0)C(0) -OR _10f

X ₅ is -CH- or -N-;

each T^ is independently selected from the group consisting of -0-, -S-, -S(0) -, and -S(0) ₂ -;

R _g is selected from the group consisting of -H and -CH ₃ ;

Ro is selected from the group consistmg of :

-C(O) -R ₁₀ . -C(0)0-R ₉ , -C(O) -NH-R ₁₀ , -S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -OR ₁₀ , -C(0)C(0) -R ₁₀ , -C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) , -C(O) -CH ₂ C(0) -O-Rg, -C(O) -CH ₂ C(0) -R ₉ ,

-H, and -C(O) -C(O) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a -C^ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -C _] __g alkyl group is optionally unsaturated;

each RI _Q is independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _g cycloalkyl group, and a " - _l -6 straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -C _] __g alkyl group is optionally unsaturated;

each R^ is independently selected from the group consisting of: -Ar ₄ , - (CH _: ) ι_ ₃ -Ar ₄ ,

-H, and -C(O) -Ar ;

R^_ ₃ is selected from the group consisting of H, Ar , and a C _] __ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₉ , -0R ₃ , -OH, -OR ₉ , or -C0 ₂ H;

-0R ₁₃ is optionally -N(H)-OH;

each R ₂₁ is independently selected from the group consisting of -H or a -C^.g straight or branched alkyl group;

Ar ₂ is independently selected from the following group, which any ring may optionally be singly or multiply substituted by -Qi :

; i)

- where each Y is independently selected from the group consisting of 0 and S;

^a ach Ar ₃ is a cyclic group independently selected fro -he set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroato group selected from -O- , -S-, -SO-, S0 ₂ , =N- , and -NH- , -N(R ₅ ) -, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and

15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0- , -S-, -SO-, S0 ₂ , =N- , -NH- , -N(R ₅ )-, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Q is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN, =0, -OH, -perfluoro C _1--3 alkyl, R ₅ , -0R ₅ , -NHR ₅ , 0R ₉ , -NHRg, R _g , -C(O)-R ₁₀ , and

O

/ \ CH ₂ ;

\ / 0

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ with another -Ar ₃ .

Preferred compounds of this embodiment include, but are not limited to:

Preferred compounds of embodiment C employ formula (II) , wherein R _] _ is (ell) and the other substituents are as defined above.

Other preferred compounds of embodiment C employ formula (II) , wherein R _] _ is (e!2) and the other substituents are as defined above.

Other preferred compounds of embodiment C employ formula (II) wherein R^ is (yl) and the other substituents are as defined above.

Other preferred compounds of embodiment C employ formula (II) wherein R-^ is (y2) and the other substituents are as defined above.

Other preferred compounds of embodiment C of employ formula (II) wherein ^ is (z) and the other substituents are as defined above.

Other preferred compound of embodiment C employ formula (II) wherein R is (w2) and the other substituents are as defined above.

More preferably, is (w2) and

is 1 ;

ring C is benzo, pyrido, or thieno,-

R ₃ is selected from the group consisting of -C(O) -

H, -C(0) -Ar ₂ , and -C (0) CH ₂ -T _x -R ;

R5 is selected from the group consistmg of :

-C(O) -R ₁₀ , wherein R ₁₀ i- ^{s ~Ar} 3 > -C(0)0-R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ ; -C(0) C(0) -R ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

-Rg, wherein Rg is a C _1-2 alkyl group substituted with -Ar ₃ ; and

-C (0) C(0) -OR ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

T _± is 0 or S;

R ₆ is H;

R ₈ is selected from the group consistmg -C(O) -R _.0 , -C(0) -CH ₂ -OR ₁₀ , and -C (0) CH ₂ -N (R ₁₀ ) (R ₁₀ ) , wherein R ₁₀ is H, CH ₃ , or -CH _? CH ₃ ;

R _ι;L is selected from the group consisting of -Ar ₄ ,

- (CH ₂ ) ₁ _ ₃ -Ar ₄ , and -C(0 ⁾ -Ar ₄ ;

R ₁₃ is H or a -C ₁ _ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR _g , or -C0 ₂ H, wherein the Rg is a - ^_ branched or straight alkyl group, wherein Ar ₃ is morpholinyl or phenyl, wherein the phenyl is optionally substituted with Q ₁ ,•

Ar ₂ is (hh) ;

Y is 0;

Ar ₃ is phenyl, naphthyl, thienyl, qu olinyl, isoqu olinyl, thiazolyl, benzimidazolyl, thienothienyl, thiadiazolyl, benzotriazolyl, benzo [b] thiophenyl, benzofuranyl, and indolyl;

Ar ₄ is phenyl, tetrazolyl, naphthyl, pyridinyl , oxazolyl, pyrimidmyl, or indolyl;

each Q;L is independently selected from the group consistmg of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -Rg, -OR ₅ wherem R ₅ is

-C(O)-R ₁₀ , -ORg, -NHR ₉ , and

O / \

CH ₂ ,

\ / 0

wherein each Rg and R^g ^are independently a -C _] __ _g straight or branched alkyl group optionally substituted with Ar wherem Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q^ group which comprises one or more additional -Ar groups, said additional -Ar ₃ groups are not substituteα with another -Ar .

Preferred compounds of this embodiment include, but are not limited to:

605q ° o

^N~ χ °

⁶²⁸

Other preferred compounds of embodiment C employ formula (II) wherein R- _] _ is (elO) , X ₅ is CH, and the other substituents are as defined above.

More preferred compounds of embodiment C employ formula (II) wherein R^ is (elO) , X ₅ is CH, R ₃ is C0-Ar ₂ , and the other substituents are as defined above .

Other more preferred compounds of embodiment

C employ formula (II) wherein R^ is (elO) , X ₅ is CH, R3 is -C(O) -CH ₂ -T ₁ -R ₁₁ , R _χl is - (CH ₂ ) ι_ ₃ -Ar ₄ , and the other substituents are as defined above.

Other more preferred compounds of embodiment C employ formula (II) wherein R _] _ is (elO) and X ₅ is CH and

R ₃ is -C{0) -CH ₂ -T ₁ -R ₁₁ ;

T ₁ is O; and

R _n is -C(O) -Ar ₄ ,

and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(O) -R ₁₀ , -C(0)0-R ₉ , and -C(O) -NH-R ₁₀ .

Alternatively, m these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -Rg.

-S(O) ₂ -NH-R ₁₀ ,

- C ( 0 ) -C(O) -Rio,

-R ₉ , and

-C(O) -C(O) -OR ₁₀ .

Most preferably, m these more preferred compounds,

R _] _3 is H or a -C _] __ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -ORg, or -C0 ₂ H, wherein the Rg is a -C _] __ branched or straight alkyl group, wherein Ar is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q ₁ ;

R5 _] _ is a C ₁ _g straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl optionally substituted by -Q_;

Ar ₂ is (hh) ;

Ar ₃ is phenyl, naphthyl, thienyl, qumolmyl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl , benzimidazolyl , thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl benzofuranyl , and indolyl ,

Ar ₄ is phenyl, tetrazolyl, pyridmyl , oxazolyl , naphthyl, pyrimidmyl , or thienyl,

each Q _] _ is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -Rg, -OR ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, - HR ₉ , and

O

/ \

CH ₂ , \ / o

wherein each R ₉ and R ₁₀ are independently a -C _1--6 straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q ₁ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar .

Other more preferred compounds of embodiment

C employ formula (II) wherein R^ is (elO) , X ₅ is CH, R^ is -C(0)-H, and the other substituents are as defined above

More preferably, m these more preferred compounds, Re, is selected from the group consisting of -C(O) -R ₁₀ , -C(0)0-R ₉ , and -C(O) -NH-R ₁₀

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of -S(0) ₂ -R _q , -S(O) ₂ -NH-R ₁₀ ,

-C(0) -C(0) -R ₁₀ ,

-Rg, and

-C(O) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds,

m ls 1;

T ₁ is O or S;

R ₁₃ is H or a - ι_q straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -ORg, or -C0 ₂ H, wherein the Rg is a -C ₁ _ _i branched or straight alkyl group, wherein Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q ,

R ₅₁ is a Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl optionally substituted by -Q _] _;

Ar ₃ is phenyl, naphthyl, thienyl, quinolmyl, lsoqumol yl, pyrazolyl, thiazolyl, isoxazolyl, benzotπazolyl , benzimidazolyl , thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl benzofuranyl , and indolyl;

Ar ₄ is phenyl, tetrazolyl, pyrid yl , oxazolyl, naphthyl, pyrimid yl , or thienyl;

each Q_ι is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -Rg, -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -Rg, -0R ₅ where R ₅ is -C(O)-R ₁₀ , -ORg, -NHRg, and 0

/ \

CH ₂ ,

\ / 0

wherem each Rg and R ₁₀ ^are independently a -C _j __g straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q^ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ,

Other more preferred compounds of embodiment C employ formula (II) where R^ is (elO) and X ₅ is CH, R ₃ is -CO-C^-T^-R^, and R ₁₁ is -Ar ₄ , and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consistmg of: - C ( O ) -R ₁₀ , -C(0)0-R ₉ , and

-C(0) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of: -S (0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ , -C(0) -C(O)-R ₁₀ , -Rg, and -C(0)-C (0) -OR ₁₀ .

Most preferably, in these more preferred compounds,

m is 1;

R ₁₃ is H or a -C _] __ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -ORg, or -C0 ₂ H, wherem the R ₉ is a -C ₁ _ ₄ branched or straight alkyl group, where Ar ₃ is morpholmyl or phenyl, wherem the phenyl is optionally substituted with Q ₁₍ -

R ₂₁ is -H or -CH ₃ ;

R ₅₁ is a Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherem Ar ₃ is phenyl optionally substituted by -Qi;

Ar ₂ is (hh) ;

Ar ₃ is phenyl, naphthyl, thienyl, qumol yi, lsoqumol yl , pyrazolyl , thiazolyl, isoxazolyl, benzotriazolyl , benzimidazolyl, thienochienyl , imidazolyl, thiadiazolyl, benzo [b] thiopnenyl , pyridyl benzofuranyl, and indolyl;

Ar ₄ is phenyl, tetrazolyl, pyridmyl , oxazolyl , naphthyl, pyπmidmyl, or thienyl;

each Q^ is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -0R ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, - HR ₉ , and 0

/ \

CH ₂ ,

\ / 0

wherein each Rg and R ₁₀ ^are independently a -C _1--6 straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl ;

provided that when -Ar ₃ is substituted with a Q^ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Other preferred compounds of embodiment C employ formula (II) wherein R _] _ is (elO) , X ₅ is N, and the other substituents are as defined above.

More preferred compounds of embodiment C, employ formula (II) wherein R _! is (elO) , X ₅ is N, R ₃ is CO-Ar ₂ , and the other substituents are as defined above .

Other more preferred compounds of embodiment

C, employ formula (II) wherein R^ is (elO) , X ₅ is N, R ₃ is - C ( O ) - CK ₂ - ₁ -R _{1 1} , R _n is - (CH ₂ ) ₁ _ ₃ -Ar ₄ , and the other substituents are as defined above.

Other more preferred compounds of embodiment

C, employ formula (II) wherem R- _j^ is (elO) and X.. is N and:

R ₃ is - C ( 0) -CH ₂ -T ₁ -R ₁₁ ;

R^ is -C(0)-Ar ₄ , and the other substituents are as defined above.

More preferably, in these more preferred compounds, R5 is selected from the group consisting of: -C(O) -R ₁₀ , -C(0)0-Rg, and -C(0) -NH-R ₁₀ .

Alternatively, m these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ , -Rg, and

-C(O) -C(O) -OR 10

Most preferably, m these more preferred compounds, R ₅ is selected from the group consistmg of-

-S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ .

-R ₉ , and

-C(O) -C(O) -OR ₁₀ .

R ₁₃ is H or a - ₁ _ ₄ straight or branched alkyl group optionally substituted with -Ar-. -OH, -OR _o or -C0 ₂ H, wherem the R ₉ is a -C ₁ _ ₄ branched or straight alkyl group, wherem Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q

R _{2 1} i s - H or - CH ₃ ;

R ₅₁ is a C _1--6 straight or branched alkyl group optionally substituted with Ar ₃ , wherem Ar ₃ is phenyl, optionally substituted by -Qi;

Y is 0, and

Ar ₃ is phenyl, naphthyl, thienyl, qumol yl, isoqumolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl benzofuranyl , and indolyl;

Ar ₄ is phenyl, tetrazolyl, pyridmyl, oxazolyl, naphthyl, pyrimid yl, or thienyl;

each Q _j is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -Rg, -NH-R ₅ where R ₅ is -C(O) -R ₁₀ or -S(0) ₂ -R ₉ , -0R ₅ wherein R ₅ is

-C(O)-R ₁₀ , -ORg, -NHRg, and

O / \

CH ₂ ,

\ / O

wherem each Rg and R ₁₀ ^ar e independently a -C__ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl,

provided that when -Ar ₃ is substituted with a Q-^ group which comprises one or more additional -Ar ₃ groups, sa additional Ar ₃ groups are not substituted with anothp] -Ar ₃

Other more preferred compounds of embodiment C, employ formula (II) wherein R ₁ is (elO) , X ₅ is N, R ₃ is -C(0)-H, and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(0) -R ₁₀ , -C(0)0-R ₉ , and -C(0) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S ⁽ O ⁾ ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ , -Rg, and

-C(O) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds,

m is 1 ;

T _λ is O or S;

R ₁₃ is H or a -C ₁ _ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR _g , or -C0 ₂ H, where the R ₉ is a - C ₁ _ ₄ branched or straight alkyl group, wherem Ar ₃ is morpholinyl or phenyl, wherem the phenyl is optionally substituted with Q ₁ ;

R ₂₁ is -H or -CH ₃ ;

R ₅₁ is a C^_g straight or branched alkyl group optionally substituted with Ar ₃ , where Ar ₃ is phenyl, optionally substituted by -Q^;

Ar ₂ i s ( hh ) ;

Y i s O , and

Ar ₃ is phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl, pyrazolyl, thiazolyl, lsoxazolyl, benzotriazolyl, benzimidazolyl , thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl benzofuranyl, and indolyl;

Ar ₄ is phenyl, tetrazolyl, pyridinyl, oxazolyl , naphthyl, pyrimidmyl, or thienyl;

each Q _] _ is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ ^or -S(0) ₂ -R ₉ , -OR ₅ where R ₅ is -C(O)-R ₁₀ , -ORg, -NHR ₉ , and 0

/ \

CH ₂ ,

\ / O

wherem each Rg and R^ _Q ^are independently a -C _] __ _e straight or branched alkyl group optionally substituted with Ar ₃ wherem A ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q^ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Other more preferred compounds of embodiment C, employ formula (II) wherein R is (elO) , Xc, is N, R ₃ is -CO-CH ₂ -T ₁ -R ₁₁ , R _χl is -Ar ₄ , and the other substituents are as defined above.

More preferably, m these more preferred compounds, R ₅ is selected from the group consisting of:

-C(0) -R ₁₀ ,

-C(0)0-R ₉ , and -C(0) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ , -C(O) -C(0) -R ₁₀ ,

-Rg, and

-C(0) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds

m is 1;

R^ ₃ is H or a -C _] __ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, wherem the R ₉ is a -C ₁ _ branched or straight alkyl group, wherem Ar ₃ is morpholmyl or phenyl, wherem the phenyl is optionally substituted with Q _lr

R ₂₁ is -H or -CH ₃ ;

R^ _l is a C ₁ _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl optionally substituted by ~Q ;

Ar ₂ is (hh) ;

Y is O, and

i O -

Ar ₃ is phenyl, naphthyl, thienyl, qumolmyl, lsoqu olmyl, pyrazolyl, thiazolyl, isoxazolyl, benzotπazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl benzofuranyl, and indolyl;

Ar ₄ is phenyl, tetrazolyl, pyrid yl, oxazolyl, naphthyl, pyπmidmyl , or thienyl,

each Q_ι is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ where R ₅ is -C(O)-R ₁₀ , -OR ₉ , -NHR ₉ , and

O

/ \

CH ₂ , \ /

O

wherem each Rg and R ₁₀ ^are independently a -C ₁ __ ₆ straight or branched alkyl group optionally substituted with Ar ₃ where Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferred compounds of embodiment B include, but are not limited to

213e

Preferred compounds of embodiment C include, but are not limited to:

13 -

14 -

16 -

425

434

19 -

468

473

478

491

495

496

or

497

1009

1064

ci'V ° "hf

Cn

O o o oo o

00 o

00 oo oo ct. cn 4-.

o

1095 αo o A

Specific compounds of this invention also include, but are not limited to, those compounds whose structures comprise scaffolds 1-22:

wherein :

wherein

H

R ₁₃ is -CH ₃ , -CH ₂ CH ₃ , -CH ₂ CH ₂ CH ₃ , -CH (CH ₃ ) (CH ₃ ) . ^■ CH2CH2CH2CH3, -CH ₂ -CH(CH ₃ )CH ₃ , -C(CH ₃ ) ₃ , -CH ₂ Ph, or

A' O

, wnerein

R ₁₃ is -CH ₃ , -CH ₂ CH ₃ , -CH ₂ CH ₂ CH ₃ , -CH (CH ₃ ) (CH ₃ ) , H(CH ₃ )CH ₃ , -C(CH ₃ ) ₃ , -CH ₂ Ph,

each R ₅₁ is -CH ₃ , -CH ₂ CH ₃ , -CH ₂ CH ₂ CH ₃ , -CH(CH ₃ ) (CH ₃ ) , -CH ₂ CH ₂ CH ₂ CH ₃ , -CH ₂ -CH (CH ₃ ) CH ₃ , -C(CH ₃ ) ₃ -CH ₂ Ph, or taken together form a ethylenedioxy acetal or a propylenedioxy acetal ; or

wherein

R ₅₁ is -CH ₃ , -CH ₂ CH ₃ , -CH ₂ CH ₂ CH ₃ , -CH (CH ₃ ) (CH ₃ ) , -CH ₂ CH ₂ CH ₂ CH ₃ , -CH ₂ -CH{CH ₃ )CH ₃ , -C(CH ₃ ) ₃ , -CH ₂ Ph, -C(0) -CH ₃ or -C{0) -Ph;

R ₅ in each of the above compounds is the same as any one of the R ₅ moieties shown for any one of compounds 139, 214c, 214e, 404-413, 415-491, 493-501.

Specific compounds of this invention also include, but are not limited to, compounds comprising scaffolds 1-28, wherein R, R5 ₁ , and R ₅ are as defined above, and in which the -C(O)- of the R ₅ moiety of any one of compounds 214c, 214e, 404-413, 415-418, 422-426, 430- 456, 458-466, 468, 470-471, 473-491, 493, 495, 497-501 is replaced with -CH ₂ -, -C(0)C(0) -, or -CH ₂ C (0) C (O) - .

The ICE inhibitors of another embodiment (D) of this invention are those of formula (JT) :

(I) R ₁ -N-R ₂

H

wherein :

R]_ is selected from the group consisting of the following formulae :

- 121

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R is :

each R5 is independently selected from the group consisting of :

-C(O) -R ₁₀ , -C(0)0-R ₉ , -C(O) -N(R ₁₀ ) (R ₁₀ ) -S(O) 2-R9,

-S(O) ₂ -NH-R ₁₀ , ^■ C(0) -CH ₂ -0-R ₉ , ^■ C(0)C(0) -R ₁₀ ,

-R

-H,

-C(O) C(O) -OR ₁₀ , and ^■ CCO)C(O) -N(R ₉ ) (R ₁₀ )

X ₅ is -CH- or -N-;

Y ₂ is H ₂ or 0;

X ₇ is -N (R ₈ ) - or -0- ;

R ₆ is selected from the group consisting of -H and -CH ₃ ;

R ₈ is selected from the group consisting of:

-C(O)-R ₁₀ ,

-C(0)0-R ₉ , -C(O) -N(H) -R ₁₀ ,

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(0) -CH ₂ -OR ₁₀ ,

-C(0)C(0) -R ₁₀ ; -C(0) -CH ₂ N(R ₁₀ ) (R ₁₀ ) ,

-C(O) -CH ₂ C(0) -0-R ₉ ,

-C(0) -CH ₂ C(0) -R ₉ ,

-H, and

-C(O) -C(O) -OR ₁₀ ;

each R ₉ is independently selected from the group consisting of -Ar ₃ and a -C^.g straight or branched alkyl group optionally substituted with Ar ₃ , wherein

the -C _] __g alkyl group is optionally unsaturated;

each R ₁₀ i ^s independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _ ₆ cycloalkyl group, and a -C^g straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -C^g alkyl group is optionally unsaturated;

R ₁₃ is selected from the group consisting of H, Ar ₃ , and a C^. straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₂ , -OR ₅ , -OH, -OR ₉ , or -C0 ₂ H;

each R ₅₁ is independently selected from the group consisting of R ₉ , -C(0)-R ₉ , -C(O) -N(H) -R ₉ , or each R ₅₁ taken together forms a saturated 4-8 member carbocyclic ring or heterocyclic ring containing -0-, -S-, or -NH- ;

each R ₂₁ is independently selected from the group consisting of -H or a -Cι__ ₆ straight or branched alkyl group;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO-, S0 ₂ , =N , and -NH , said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _ι;

each Qi is independently selected from the group

consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN,

=0, -OH, -perfluoro C ₁ _ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , 0R _g ,

-N(R ₉ ) (R ₁₀ ) , Rg, -C(O) -R ₁₀ , and

0 / \

CH ₂ ,

\ / O

provided that when -Ar ₃ is substituted with a Q^ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferably, R5 is selected from the group consisting of: -C(O) -R ₁₀ , -C(O)0-Rg, and -C(0) -NH-R ₁₀ .

Alternatively, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(0) -R ₁₀ ,

-Rg, and -C(O) -C(0) -OR ₁₀ .

More preferably:

R ₁₃ is H or a - ₁ _ ^ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -0R ₉ , or -C0 ₂ H, wherein the Rg is a - _q branched or straight alkyl group, wherein Ar ₃ is morpholinyl or phenyl, wherein the phenyl is optionally substituted with Qi _;

R _{2 1} i s - H or - CH ₃ ,

R5 _j is a C ₁ _ _ξ> straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl, optionally substituted by -Qι_;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl, pyrazolyl , thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Qi ,

each Q _] _ is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , NH-R ₅ wherein R ₅ is -C(0)-R]_o ^or -S(0) ₂ -R ₉ , -OR ₅ wherein R ₅ is -C(O)-R ₁₀ , -OR ₉ , -N(R ₉ ) (R ₁₀ ) , and

0

/ \ CH ₂ ,

\ / O

wherein each R ₉ and R _] _ _Q ^are independently a -C^-g straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl,

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

The ICE inhibitors of another embodiment (E) of this invention are those of formula (II)

wherein:

m is 1 or 2 ;

R _] _ is selected from the group consisting of the following formulae:

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R ₃ is selected from the group consisting of -CN,

-C(O) -H,

-C(O) -CH ₂ -T _r R ₁₁₍ -C(O) -CH ₂ -F, -C=N-0-R ₉ , and -CO-Ar ₂ ;

each R5 is independently selected from the group consisting of : -C(O)-R ₁₀ ,

-C(0)0-R ₉ , -C(O) -N(R ₁₀ ) (R ₁₀ ) -S (0) -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C (0) -CH ₂ -0-R ₉ , -C(0)C(0) -R _{1 Q f}

-Rg,

-H, -C(0)C(0) -OR ₁₀ , and

-C(0)C(0) -N(R ₉ ) (Rio) ;

each T _j is independently selected from the group consisting of -O- , -S-, -S(O) -, and -S(0) ₂ -;

Rg is selected from the group consisting of -H and

-CH ₃ ;

Rg is selected from the group consisting of:

-C(O) -R ₁₀ , -C.O.O-Rg,

-C(O) -NH-R ₁₀ ,

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -OR ₁₀ , -C(0)C(0) -R ₁₀ ,

-C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) ,

-C(O) -CH ₂ C(0) -O-Rg,

-C(O) -CH ₂ C(0) -R ₉ ,

-H, and -C(O) -C(O) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a -C _] __g straight or branched alkyl group optionally substituted with Ar ₃ , wherein

the -C _] __g alkyl group is optionally unsaturated,

each R _} _ø is independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _g cycloalkyl group, and a -C ₁ _g straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -C _j _ alkyl group s optionally unsaturated;

each R- is independently selected from the group consisting of: -Ar ₄ , - (CH ₂ ) ι_ ₃ -Ar ₄ ,

-H, and -C(O) -Ar ₄ ;

R ₁₅ is selected from the group consisting of -OH, -OAr ₃ , -N(H)-OH, and a -OC^g straight or branched alkyl group optionally substituted with -Ar ₃ , -C0NH ₂ , -OR ₅ , -OH, -ORg, or -C0 ₂ H;

each R ₂ ι is independently selected from the group consisting of -H or a -C ₁ _g straight or branched alkyl group;

Ar ₂ is independently selected from the following group, in which any ring may optionally be singly or multiply substituted by -Q _] _ :

i n )

U ^Ύ wherein each Y is independently selected from the group consisting of 0 and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO-, S0 ₂ , =N- , and -NH-, -N(R ₅ )-, and -N(R ₉ ) - said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Qi,

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO , S0 ₂ , =N , -NH- , -N(R ₅ ) , and -N(Rg) - said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q^,

each Qi is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -NO-,, CN, =0, -OH, -perfluoro C ₁ _ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , OR _c ,, -N(Rq) <R ₁₀ ) , R ₉ , -C(O) -R ₁₀ , and

O

/ \ ( CH _.

\ / 0

provided that when -Ar ₃ is substituted with a Q _j group which comprises one or more additional -Ar groups, said additional -Ar ₃ groups are not substituted w th another -Ar ₃ .

Preferred compounds of embodiment E employ formula (II) , wherein R^ is (ell) and the other substituents are as defined above

Other preferred compounds of embodiment E employ formula (II) , wherein R _] _ is (el2) and the other substituents are as defined above.

Other preferred compounds of embodiment E employ formula (II) wherein R is (yl) and the other substituents are as defined above.

Other preferred compounds of embodiment E employ formula (II) wherein R- _j _ is (y2) and the other substituents are as defined above

Other preferred compounds of embodiment E of employ formula (II) wherein R is (z) and the other substituents are as defined above

Other preferred compound of embodiment E employ formula (II) wherein R _j is (w2) and the other substituents are as defined above

More preferably, R^ is (w2) and

m is 1 ;

ring C is benzo, pyrido, or thieno;

R ₃ is selected from the group consisting of -C(0) -H, -C(0)-Ar ₂ , and -C(0) CH ₂ -T ₁ -R ₁₁ ;

R ₅ is selected from the group consisting of :

-C(O)-R ₁₀ , wherein R ₁₀ is -Ar ₃ ; -C(0)0-R ₉ , wherein Rg is -CH ₂ -Ar ₃ ; -C(0) C(0) -R ₁₀ , wherein R ₁₀ is -Ar ₃ ; -Rg, wherein Rg is a C _j __ ₂ alkyl group substituted with -Ar ₃ ; and

-C(O) C(O) -OR ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

R ₆ is H;

R ₈ is selected from the group consisting -C(O) -R ₁₀ ,

-C(O) -CH ₂ -OR ₁₀ , and -C (0) CH ₂ -N (R ₁₀ ) (R ₁₀ ) , wherem R ₁₀ is H, CH ₃ , or -CH ₂ CH ₃ ;

R-^ l is selected from the group consisting of -Ar ₄ , - (CH ₂ ) ι-3"Ar ₄ , and -C(0) -Ar ₄ ;

R ₁₅ is -OH or -0C _1--4 straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -ORq, or -C0 H, wherein the Rg is a ₁ _ ₄ branched or straight alkyl group, wherein Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Qi ;

Y is 0,

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, qu olmyl, lsoqumolmyl, thiazolyl, benzimidazolyl , thienothienyl , thiadiazolyl, benzotπazolyl , benzo [b] thiophenyl, benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q^;

each Ar ₄ cyclic group is independently selected from the set consisting of phenyl, tetrazolyl , naphthyl, pyridinyl, oxazolyl, pyrimidinyl, or indolyl, said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R _g , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ ^or -S(0) ₂ -R ₉ , -0R ₅ wherein R ₅ is

-C(O)-R ₁₀ , -ORg, -N(Rg) (R ₁₀ ) , and

0 / \

CH ₂ , \ /

0

wherein each Rg and R _] _g are independently a -C ₁ __ _g straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar is phenyl,

provided that when -Ar ₃ is substituted with a Q _] _ group which comprises one or more additional -Ar-} groups, said additional -Ar ₃ groups are not substituted with another -Ar

Other preferred compounds of embodiment E employ formula (II) where R ₁ is (elO) , X ₅ is CH, and the other substituents are as defined above

More preferred compounds of embodiment E employ formula (II) wherein R^ is (elO) , X ₅ is CH, R ₃ is C0-Ar ₂ , and the other substituents are as defined above .

Other more preferred compounds of embodiment

E employ formula (II) wherein R ₁ is (elO) , X ₅ is CH, R ₃ is -C(0) -CH ₂ -T ₁ -R ₁₁ , R is - (CH ₂ ) ₁ _ ₃ -Ar ₄ , and the other substituents are as defined above.

Other more preferred compounds of embodiment E employ formula (II) wherein R _] _ is (elO) and X ₅ is CH and R ₃ is -C (O) -CH ₂ -T ₁ -R ₁₁ , ₁ is O, R _{l λ} is -C(0) -Ar ₄ , and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(0)-R ₁₀ ,

-C(0)0-Rg, and -C(0) -NH-R ₁₀ .

Alternatively, these more preferred compounds, R ₅ is selected from the group consisting of: -S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ , -C(O) -C(O) -R ₁₀ , -Ro, and -C(O) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds,

m is 1 ;

T _: is 0 or S;

_:5 is -OH or -OC ₁ _ ₄ straight or branched alkyl

group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, where the Rg is a -C _1--4 branched or straight alkyl group, wherein Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q ₁ ;

R ₂₁ is -H or -CH ₃ ;

Ar ₂ is (hh) ;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, qumolinyl, lsoqu olmyl, pyrazolyl , thiazolyl, isoxazolyl, benzotπazolyl, benzimidazolyl , thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl, benzofuranyl, and dolyl , and said cyclic group optionally being singly or multiply substituted by -Qτ_;

each Ar ₄ cyclic group is independently selected from the set consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, naphthyl, pyrimidinyl, or thienyl, said cyclic group being singly or multiply substituted by -Q _ι;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherem R ₅ is -C(O) -R ₁₀ or -S(0) ₂ -R _g , -OR ₅ wherem R ₅ is -C.O)-R ₁₀ , -ORg, -N(Rg) (R ₁₀ ) , and

O

/ \

CH ₂ ,

\ / 0

wherem each Rg and R ₁₀ are independently a -C- _j __ _c

straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q _] _ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Other more preferred compounds of embodiment E employ formula (II) wherein R ₁ is (elO) , X ₅ is CH, R ₃ is -C(0)-H, and the other substituents are as defined above .

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(0) -R ₁₀ , -C(0)0-R ₉ , and

-C(O) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of :

-S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ ,

-Rg, and

-C(0) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds,

m is 1 ;

R ₁₅ is -OH or -OC;ι__ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, wherein the Rg is a -C _] __ ₄ branched or straight alkyl group, wherein Ar ₃ is morpholmyl or phenyl, wherem the phenyl is optionally substituted with Q- ,■

R _{2 1} is - H or - CH ₃ ;

each Ar ₃ cyclic group is independently selected from the set consistmg of phenyl, naphthyl, thienyl, qumol yl, lsoqumol yl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzi idazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl , and indolyl, said cyclic group optionally bemg singly or multiply substituted by -Q _] _;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) -R ₉ , -OR ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and 0

/ \

CH ₂ ,

\ / 0

wherein each Rg and R ₁₀ ^ar e independently a -C _] __ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q _j group which comprises one or more additional -Ar ₃ groups, said additional -Ar groups are not substituted with another -Ar ₃ ,

Other more preferred compounds of embodiment E employ formula (II) wherem R ₁ is (elO) and X ₅ is CH, R ₃ is and R _{λ l} s Ai ₄ , and the other substituents are as defined above

More preferably, m these more preferred compounds, R ₅ is selected from the group consisting of

-C(0) -R ₁₀ , -C(0)0-Rg, and -C(O) -NH-R ₁₀ .

Alternatively, m these more preferred compounds, R ₅ is selected from the group consisting of: -S(0) ₂ -R ₉ , -S(0) ₂ -NH-R ₁₀ , -C(0) -C(0)-R ₁₀ , -Rg, and -C(O)-C(O)-OR ₁₀ .

Most preferably, in these more preferred compounds,

Υ ₁ IS 0 or S;

R ₁₅ is -OH or a -OC ₁ _ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, wherem the R ₉ is a -C _1--4 branched or straight alkyl group, wherem Ar ₃ is morpholmyl or phenyl, where the phenyl is optionally substituted with Q-^ ,

each Ar ₃ cyclic group is phenyl, naphthyl, thienyl, qumolmyl, lsoqumol yl , pyrazolyl , thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl, benzofuranyl , and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Ar ₄ cyclic group is independently selected

from the set consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, naphthyl, pyrimidinyl, or thienyl, said cyclic group optionally being singly or multiply substituted by -Q^;

each Q^ is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R is -C(O)-R ₁₀ ^or -S(0) ₂ -R ₉ , -0R ₅ wherein R ₅ is

-C(O)-R ₁₀ , -0R ₉ , -N(R ₉ ) (R ₁₀ ) , and

0 / \

CH ₂ ,

\ / O

wherein each R ₉ and R ₁₀ are independently a -C^- straignt or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q _j group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Other preferred compounds of embodiment E employ formula (II) wherein R _] _ is (elO) , X ₅ is N, and the other substituents are as defined above.

More preferred compounds of embodiment E, employ formula (II) wherein R^ is (elO) , ₅ is N, R ₃ is CO-Ar ₂ , and the other substituents are as defined above .

Other more preferred compounds of embodiment E, employ formula (II) wherein R^ is (elO) , X ₅ s N, R ₃ is -C(O) -CH ₂ -T ₁ -R ₁₁ , R _{λ l} is - (CH ₂ ) ₂ _ ₃ -Ar ₄ , and the other substituents are as defined above.

Other more preferred compounds of embodiment E, employ formula (II) wherein R ₁ is (elO) and X ₅ is N and:

R ₃ is -C(0) -CH ₂ -T _r R _n ;

T ₁ is 0; and

R _lχ is -C(0)-Ar ₄ , and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(O) -R ₁₀ , -C(0)0-R ₉ , and -C(O) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ ,

-Rg, and -C(O) -C(O) -OR ₁₀ .

Most preferably, in these more preferred compounds, m is 1;

T ₁ is O or S;

R ₁₅ is -OH or a -OC _1--4 straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -OR _g , or -C0 ₂ H, where the Rg is a -C ₁ _ ₄ branched or straight alkyl group, wherem Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q. ,•

R ₂₁ is -H or -CH ₃ ;

Ar ₂ i s ( hh ) ,

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, qu olmyl, lsoqu olmyl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl, benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q^;

each Ar ₄ cyclic group is independently selected from the set consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, naphthyl, pyrimidinyl, or thienyl, optionally being singly or multiply substituted by -Q^,

each Q _j is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R _g , -NH-R ₅ wherein R5 is -C(O)-R ₁₀ or -S(0) ₂ -Rg, -OR ₅ wherem R ₅ is -C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and 0

/ \

CH ₂ ,

\ / O

wherem each Rg and R ₁₀ are independently a -C _] __ _b straight or branched alkyl group optionally substituted with Ar ₃ wherem Ar ₃ is phenyl,

provided that when -Ar ₃ is substituted with a Q _} group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃

Other more preferred compounds of embodiment E, employ formula (II) wherein R± is (elO) , X ₅ is N, R ₃ is -C(0)-H, and the other substituents are as defined above .

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(0) -R ₁₀ , -C(0)0-R ₉ , and -C(0) -NH-R ₁₀ -

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of:

-Ξ(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -Rio, -Rg, and

-C(O) -C(O) -OR ₁₀ .

Most preferably, these more preferred compounds,

m is 1 ;

Rl5 is -OH or -OCι_ ₄ straight or branched alkyl group optionally substituted with -Ar -OH, -ORg, or -C0 ₂ H, wherem the R ₉ is a -C _1--4 branched or straight alkyl group, wherein Ar ₃ is morpholinyl or pnenyl , wherem the phenyl is optionally substituted with Q ₂ ,•

is -H or -CH-

each Ar cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, lsoqu olmyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl , and mdolyl, and said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Q is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ wherem R ₅ is -C(O)-R ₁₀ , -OR ₉ , -N(R ₉ ) (R ₁₀ ) , and

O

/ \ CH ₂ ,

\ / 0

wherem each R ₉ and R ₁₀ ^are independently a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃

Other more preferred compounds of embodiment E, employ formula (II) wherem R _j is (elO) , ₅ is N, R^ is -CO-CH ₂ -T ₁ -R ₁₁ , R _X1 is -Ar ₄ , and the other substituents are as defined above

More preferably, in these more preferred compounds, Re is selected from the group consisting of - C (O ) -R ₁₀ , -C(0)0-R ₉ , and

- C ( 0 ) -NH - R _{1 0} .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C(0) -C(0) -Rio,

-R ₉ , and

-C(0) -C(0) -OR ₁₀ .

Most preferably, in these more preferred compounds

m ls 1;

_λ s O or S;

R _l5 is -OH or -OCι_ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -ORg, or -C0 ₂ H, where the Rg is a -Cι_ ₄ branched or straight alkyl group, where Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q^ ,

R ₂₁ is -H or -CH ₃ ;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinol yl, isoqumol yl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl , pyridyl, benzofuranyl , and mdoly] , and said cyclic group optionally bemg singly or multiply substituted by -Q ,

each Ar ₄ cyclic group is independently selected from the set consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, naphthyl, pyrimidinyl, or thienyl,

said cyclic group being singly or multiply substituted by -Q _ι;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -0R ₅ wherem R ₅ is -C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and

0

/ \

CH ₂ , \ / o where each R ₉ and R ₁₀ are independently a -C _ _b straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q ₁ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

The ICE inhibitors of another embodiment (F) of this invention are those of formula (III) :

III) R _! -N-R ₂ H

wherein

R is selected from the group consisting of the following formulae:

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R is :

m is 1 or 2;

each R5 is independently selected from the group consisting of: -C(O) -R ₁₀ , -C(0)0-R ₉ , -C(O) -N(R ₁₀ ) (R ₁₀ ) -S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ -C(O) -CH ₂ -0-R ₉ ,

-C(0)C(0) -R 10,

-Rg, -H,

-C(0)C(0) -OR ₁₀ , and -C(0)C(0) -N(Rg) (R ₁₀ ) ;

X ₅ is CH or N;

Y ₂ is H ₂ or 0;

X ₇ is -N(R ₈ ) - or -0-;

R ₆ is selected from the group consisting of -H and "CH ₃ ;

R _g is selected from the group consisting of :

-C(O) -R ₁₀ ,

-C(0)0-R ₉ , -C(O)-N(H)-R ₁₀ ,

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -OR ₁₀ ,

-C(0)C(0) -Rio; -C(O) -CH ₂ N(Rι ₀ ) (R ₁₀ ) ,

-C(O) -CH ₂ C(0) -O-Rg,

-C(0) -CH ₂ C(0) -R ₉ ,

-H, and

-C(O) -C(O) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a -Cτ__ _b straight or branched alkyl group optionally substituted with Ar ₃ , where the -C _g alkyl group is optionally unsaturated;

each Rio is independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _g cycloalkyl group, and a -Cι_ _g straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -C . alkyl group is

optionally unsaturated;

Rl3 is selected from the group consisting of H, Ar ₃ , and a C ₁ _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₂ , -OR.., -OH, -ORg, or -C0 ₂ H;

each R ₂ is independently selected from the group consisting of -H or a -Cι_ ₆ straight or branched alkyl group;

each R ₅ ι is independently selected from the group consisting of Rg, -C(O) -Rg, -C (0) -N (H) -Rg, or each R ₅₁ taken together forms a saturated 4-8 member carbocyclic ring or heterocyclic ring containing -0- , -S-, or -NH-,

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO-, S0 ₂ , =N- , and -NH-, said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _ι;

each Qi is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN,

=0, -OH, -perfluoro _λ _ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₀ , 0R _q ,

-N(R _g ) (R ₁₀ ) , Rg, -C(O)-R ₁₀ , and 0 / \

CH , \ / ~ 0

provided that when -Ar ₃ is substituted with a Q- _j _ group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferred compounds of embodiment F employ formula (III) , wherein R^ is (w2) and the other substituents are as defined above.

Preferably, when R is (w2) .

m is 1;

ring C is benzo, pyrido, or thieno;

R ₅ is selected from the group consisting of: -C(0) -R Q, wherein Rio ^{1S ~Ar} ₃ , -C(0)0-R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ ;

-C (O) C (O) -R ₁₀ , wherem R ₁₀ is -Ar ₃ ; -Rg, wherem Rg is a C _ ₂ alkyl group substituted with -Ar ₃ ; and

-C(O) C(O) -OR ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

R ₆ i H;

Rg is selected from the group consisting -C(0) -R-,r, -C(0* -CH ₂ -OR ₁₀ , and -C (O) CH ₂ -N (R ₁₀ ) (R ₁₀ ) , wherem R _l is H, CH ₃ , or -CH ₂ CH ₃ ;

R ₁₃ is H or a Cι_ ₄ straight or branched alkyl group optionally substituted with Ar ₃ , -OH, -ORq, -C0 ₂ H, wherein the Rg is a Cι_ ₄ branched or straight chain alkyl group, where Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q- ,

Ar ₃ is phenyl, naphthyl, thienyl, qumolinyl, isoquinolinyl, thiazolyl, benzimidazolyl, thienothienyl, thiadiazolyl, benzotriazolyl, benzo [b] thiophenyl, benzofuranyl, and dolyl,

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherem R ₅ is -C(0) -R ₁₀ or -S(0) ₂ -R ₉ , -0R ₅ wherem R ₅ is -C(O)-R ₁₀ , -ORg, -NHRg, and O

/ \

CH ₂ ,

\ / 0

wherein each R _g and R^ _Q ^are independently a -C _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl,

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃

Other preferred compounds of embodiment F employ formula (III) , wherein R is (ell) and the other substituents are as defined above

Other preferred compounds of embodiment F employ formula (III) , wherein Ri is (el2) and the other substituents are as defined above

Other preferred compounds of embodiment F employ formula (III) , wherem Ri is (yl) and the other substituents are as defined above

Other preferred compounds of embodiment F employ formula (III) , wherein R is (y2) and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) , wherein Ri is (z) and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) , wherein Ri is (elO) and X5 is CH (also referred to herein as elO-B) , and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) , wherein R is (elO) and X5 is N, (also referred to herein as elO-A) and the other substituents are as defined above.

Preferably, when R _τ is (ell) , (el2) , (yl) , (y2) ,

(z) , (elO-A) , and (elO-B) , R ₅ is selected from the group consisting of: -C(O) -R ₁₀ , -C(0)0-R ₉ , and -C (O) -NH-R ₁₀ .

Alternatively, when Ri is (ell) , (el2) , (yl) , (y2) , (z) , (elO-A) , and (elO-B) , R ₅ is selected from the group consisting of: -S(0) ₂ -R ₉ , -S(O) ₂ -NH-Rι ₀ ,

-C(O) -C(O) -Rio, -Rg,

-C(O) -C(O) -OR ₁₀ , and -C(0)C(0) -N(R ) (R ₁₀ ) .

More preferably, R ₅ is R-C (O) -C (0) -R IC

Alternatively, R ₅ is -C (O) -C (O) -OR ₁₀ .

More preferably when R- _] _ is (ell) , (el2) , (yl) , (y2) , (z) , (elO-A) , and (elO-B) :

m is 1;

R ₂ ι is -H or -CH ₃ ;

R ₅₁ is a C _g straight or branched alkyl group optionally substituted with Ar ₃ , where the Ar ₃ cyclic group is phenyl, said cyclic group optionally being multiply or singly substituted by -Q ;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl , or mdolyl, and said cyclic group optionally bemg singly or multiply substituted by -Q^ ;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ wherem R ₅ is

-C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and 0

/ \

CH,,

\ / O

wherem each Rg and R ₀ are independently a -C _ ₆ straight or branched alkyl group optionally substituted with Ai ₃ , wherein the Ar ₃ cyclic group is phenyl, and said cyclic group optionally being singly or multiply substituted by -Q ;

provided that when -Ar ₃ is substituted with a -C^ group which comprises one or more additional -Ar groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

More preferably, these more preferred compounds, the Ar ₃ cyclic group is selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, lsoquinolmyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, benzofuranyl , and mdolyl, and said cyclic group optionally being singly or multiply substituted by -Q- _j _ .

Compounds in a preferred form of this embodiment F are those wherem:

R ₅ is -C(0) -RI _Q , wherein:

R _lO is Ar ₃ , wherem the Ar ₃ cyclic group is phenyl, said cyclic group optionally being singly or multiply substituted by:

-F,

-Cl,

-N(H)-R ₅ , wherem -R ₅ is -H or -C(O)-R ₁₀ , wherein R _O is a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherem the Ar ₃ cyclic group is phenyl, said cyclic group optionally being singly or multiply substituted by -Qi,

-N(Rg) (Rio) , wherem Rg and R-j_ ₀ ^ar e independently a -C _± _ ₄ straight or branched alkyl group, or -0-R , wherein R ₅ is H or a -C _1--4 straight or branched alkyl group.

More preferably the Ar ₃ cyclic group is phenyl optionally being singly or multiply substituted at the 3- or 5-position by -Cl or at the 4-posιtιon by -NH-R ₅ , -N(Rg) (R ₁₀ ) . or -O-R ₅ .

Other preferred compounds of embodiment F mclude those wherein R ₅ is -C(O)-R ₁₀ , wherem R ₁₀ is Ar ₃ and the Ar ₃ cyclic group is selected from the group consisting of indolyl, benzimidazolyl, thienyl, and benzo [b] hiophenyl, and said cyclic group optionally being singly or multiply substituted by -Q^ ;

Other preferred compounds of embodiment F include those wherein R ₅ is -C(O)-Rι ₀ , wherem R ₁₀ is Ar ₃ and the Ar ₃ cyclic group is selected from qumolyl and isoquinolyl, and said cyclic group optionally being singly or multiply substituted by -Qi .

Other preferred compounds of embodiment F are those wherein R ₅ is -C(O)-R ₁₀ , where Rι ₀ is Ar ₃ , wherein the Ar ₃ cyclic group is phenyl, substituted by

O / \

CH ₂

\ / 0

In another form of embodiment F the compounds are as described above, further provided that when:

m is 1 ; R _l is (elO) ; R ₁₅ is -OH; R-- is -H; and

Y ₂ is 0 and R ₃ is -C(0)-H, then R ₅ cannot be: -C(0) -RI _Q , wherem Rι ₀ is -Ar ₃ and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q _{l t} 4- (carboxymethoxy) phenyl, 2-fluorophenyl , 2-pyridyl, N- (4-methylpιperazmo) methylphenyl , or

-C(0) -ORg, wherem Rg is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q , ; and when

Y ₂ is O, R ₃ is -C (0) -CH ₂ -T ₁ -R ₁₁ , T _λ is 0, and R _n is Ar , wherein the Ar ₄ cyclic group is 5-(l- (4- chlorophenyl) -3-trifluoromethyl) pyrazolyl) , then R ₅ cannot be :

-C(0) -R _Q , wherein R _Q IS -Ar ₃ and the Ar ₃ cyclic group is 4- (dimethylam omethyl) phenyl , phenyl, 4- (carboxymethylthio) phenyl , 4- (carboxyethylthio) phenyl , 4- (carboxyethyl) phenyl , 4- (carboxypropyl) phenyl , 2- fluorophenyl , 2-pyrιdyl, N-(4- methylpiperazmo) methylphenyl , or

-C(0) -OR ₉ , wherein R ₉ is -CH ₂ -Ar ₃ and the Ar ₃ cyclic group is phenyl, and when Ru is Ar ₄ , where the Ar cyclic group is 5- (l-phenyl-3-trιfluoromethyl) pyrazolyl ) , then R ₅ cannot be :

-C(0) -0Rg, wherem R ₉ is -CH ₂ Ar ₃ , and the Ar ₃ cyclic group is phenyl;

and when Ru is Ar ₄ , wherem the Ar ₄ cyclic group is 5- (1- (2-pyrιdyl) -3-trifluoromethyl > pyrazolyl ) , then

R _D cannot be ^•

-C(0) -R _Q , wherem R ₁₀ is -Ai _j and the Ar ₃ cyclic group is 4- (dimethylammomethyl) phenyl , or -C(0) -0R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ , and the r^ cyclic group is phenyl, unsubstituted by -Q _{1 (} , and when

Y ₂ is 0, R ₃ is -C(O) -CH ₂ -T ₁ -R _il , T± is 0, and R _n is -C(0)-Ar ₄ , where the Ar ₄ cyclic group is 2,5-

dichlorophenyl, then R ₅ cannot be:

-C(O)-R ₁₀ , where R ₁₀ is -Ar ₃ and the Ar ₃ cyclic group is 4- (dimethyla inomethyl) phenyl , 4- (N- morpholino ethyl)phenyl, 4-(N- methylpiperazmo)methyl)phenyl , 4-(N-(2- methyl) imidazolylmethyl)phenyl, 5-benzιmιdazolyl , 5- benztriazolyl, N-carboethoxy-5-benztrιazolyl , N- carboethoxy-5-benzimidazolyl, or

-C(0)-OR ₉ , wherein R ₉ is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q ₁₍ ; and when

Y ₂ is H ₂ , R ₃ is -C(O) -CH ₂ -T ₁ -R ₁₁ , T _λ is O, and R _χι is

-C(0)-Ar ₄ , wherein the Ar ₄ cyclic group is 2,5- dichlorophenyl , then R ₅ cannot be : -C(0)-ORg, wherem R ₉ is -CH ₂ -Ar ₃ and the Ar ₃ cyclic group is phenyl.

In another form of embodiment F, preferred compounds are those wherem R _2i is -H.

Alternatively, preferred compounds are those wherein R ₂₁ is -CH3.

Preferred compounds of embodiment F employ formula (III) , wherein Ri is (w2) and the other substituents are as defined above.

More preferably, R is (w2) and

m 1s 1 ;

ring C is benzo, pyrido, or thieno;

R ₃ is selected from the group consisting of -C(0)-H, -C(0)-Ar ₂ , and -C(0)CH ₂ -T _r R _n ,

R ₅ is selected from the group consisting of: -C(0) -RI _Q , wherein R ₁₀ is -Ar ₃ ; -C(0)0-R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ ; -C(0) C(0) -R ₁₀ , where R ₁₀ is -Ar ₃ ; -Rg, wherein Rg is a Cι_ ₂ alkyl group substituted with -Ar ₃ ; and

-C(0) C (0) -OR ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

T ₁ is 0 or S;

R ₆ is H;

Rg is selected from the group consisting -C(O) -R ₀ , -C(0) -CH ₂ -OR ₁₀ , and -C (0) CH ₂ -N (R ₁₀ ) (R ₁₀ ) , wherein R ₁₀ is H, CH ₃ , or -CH ₂ CH ₃ ;

Ru is selected from the group consisting of -Ar ₄ , - (CH ₂ ) ι_ ₃ -Ar ₄ , and -C(0) -Ar ₄ ;

Rl5 is -OH or -0Cι_ ₄ straight or branched alkyl group optionally substituted with -Ar ₃ -OH, -0R ₉ , or -C0 ₂ H, wherein the R ₉ is a -C _] __ branched or straight alkyl group, wherein Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q ;

Ar ₂ is (hh) ;

Y is O;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinol yl, isoquinolinyl, thiazolyl, benzimidazolyl, thienothienyl , thiadiazolyl, benzotriazolyl, benzo [b] thiophenyl , benzofuranyl , and dolyl, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Ar ₄ cyclic group is independently selected from the set consisting of phenyl, tetrazolyl, naphthyl, pyridinyl, oxazolyl, pyrimidinyl, or mdolyl, said cyclic group optionally being singly or multiply substituted by -Q ;

each Q is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -Rg, -0R ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and O

/ \

CH ₂ ,

\ / 0

wherein each Rg and R ₁₀ are independently a -C _ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Other preferred compounds of embodiment F employ formula (III) , wherein R- _j _ is (ell) and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) , wherein R is (el2) and the othei substituents are as defined above

Other preferred compounds of embodiment F employ formula (III) wherem R is (yl) and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) wherein R ₁ is (y2) and the other substituents are as defined above.

Other preferred compounds of embodiment F of employ formula (III) wherein R is (z) and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) wherein R is (elO) , X ₅ is CH, and the other substituents are as defined above.

Other preferred compounds of embodiment F employ formula (III) wherein R is (elO) , X ₅ is N, and the other substituents are as defined above.

More preferably, in these more preferred compounds, R ₅ is selected from the group consisting of: -C(O)-R ₁₀ ,

-C(0)0-Rg, and

-C(0) -NH-R ₁₀ .

Alternatively, in these more preferred compounds, R ₅ is selected from the group consisting of: -S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -C(O) -R ₁₀ ,

-Rg,

-C(0) -C(O) -OR ₁₀ , and -C(0)C(0) -N(Rg) (RIQ) -

Most preferably, in these more preferred compounds,

m is 1 ;

R 3 s H or a -C _ ₄ straight or branched alkyl

group optionally substituted with -Ar ₃ -OH, -OR ₉ , or -C0 ₂ H, wherein the Rg is a -C _ ₄ branched or straight alkyl group, wherein Ar ₃ is morpholinyl or phenyl, wherein the phenyl is optionally substituted with Q ;

R ₂₁ is -H or -CH ₃ ;

R ₅₁ is a C _ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl, optionally substituted by -Q _] _;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Qi;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ where R ₅ is -C(O)-R ₁₀ , -OR ₉ , -N(R ₉ ) (R ₁₀ ) , and

O

/ \

CH ₂ , \ /

O

wherein each Rg and R-^ _Q are independently a -C-_g straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q-. group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted

with another -Ar ₃ .

Preferred compounds of embodiment (F) include, but are not limited to:

The ICE inhibitors of another embodiment (G) of this mvention are those of formula (XV.) :

where : H

m is 1 or 2;

R is selected from the group consistmg of the following formulae:

ring C is chosen from the group consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl;

R is selected from the group consisting of: -CN,

-C(0) -H, -C(O) -CH ₂ -T ₁ -R ₁₁ ,

-C(O) -CH ₂ -F, -C=N-0-R ₉ , and -C0-Ar ₂ ;

each R5 is independently selected from the group consisting of:

-C(O) -Rio,

-C(0)0-R ₉ ,

-C(0) -N(R ₁₀ ) (R ₁₀ )

-S(0) ₂ -R ₉ , -S (O) ₂ -NH-R _i0 ,

-C(0) -CH ₂ -0-R ₉ ,

-C(0)C(0) -Rio,

-Rg,

-H, -C(0)C(0) -OR ₁₀ , and

-C(0)C{0) -N(R ₉ ) (R ₁₀ ) ;

Y ₂ is H ₂ or O;

X ₇ is -N(R ₈ ) - or -O- ;

each T is independently selected from the group consisting of -0- , -S-, -S(0) -, and -S(0) ₂ -;

R _fi is selected from the group consisting of -H and

•CH.

Rg is selected from the group consisting of :

-C(0) -Rio,

-C(0)0-R ₉ , -C(O) -NH-R ₁₀ ,

-S(0) ₂ -R _g ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -ORι ₀ ,

-C(0)C(0) -R ₁₀ , -C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) ,

-C(O) -CH ₂ C(0) -O-Rg,

-C(O) -CH ₂ C(0) -R ₉ ,

-H, and

-C(O) -C(O) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a -C _g straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -C _ ₆ alkyl group is optionally unsaturated;

each R o is independently selected from the group consisting of -H, -Ar ₃ , a C3_g cycloalkyl group, and a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -C _g alkyl group is optionally unsaturated;

each Ru is independently selected from the group consisting of: -Ar ₄ , -H, and

- C ( 0 ) -Ar ₄ ;

R _] _ ₅ is selected from the group consisting of -OH, -OAr ₃ , -N(H)-OH, and -0C ₁ _ ₆ , wherein C _1--6 is a straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₂ , -0R ₅ , -OH, -ORg, or -C0 ₂ H;

each R ₂ ι is independently selected from the group consisting of -H or a -C _g straight or branched alkyl group;

Ar ₂ is independently selected from the following group, in which any ring may optionally be singly or multiply substituted by -Q or phenyl, optionally substituted by Qi :

wherein each Y is independently selected from the group consisting of 0 and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO-, S0 ₂ , =N- , and -NH- , -N(R ₅ )-, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or

multiply substituted by -Q ,

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0- , -S-, -SO-, S0 ₂ , =N- , -NH- , -N(R ₅ )-, and -N(R ₉ )- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Qi is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN,

=0, -OH, -perfluoro Cι_ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , OR ₉ ,

-N(R ₉ ) (R ₁₀ ) , Rg, -C(O)-R ₁₀ , and 0

/ \

CH ₂ , \ /

0

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ;

Preferred compounds of embodiment G employ formula (IV) , wherem Ri is (w2) and the other substituents are as defined above

Preferably, when R ₁ is (w2)

m is 1,

ring C is benzo, pyrido, or thieno;

R ₅ is selected from the group consisting of: -C(O)-R ₁₀ , wherein R ₀ is -Ar ₃ ; -C(0)0-R _g , wherein Rg is -CH ₂ -Ar ₃ ; -C(0) C(0) -R ₁₀ , wherein R ₁₀ is -Ar ₃ ;

-Rg, wherein Rg is a C _ ₂ alkyl group substituted with -Ar ₃ ; and

-C(0)C(0) -OR ₁₀ , wherein R ₁₀ is -CH ₂ Ar ₃ ;

R ₆ is H;

R ₈ is s ^e ected from the group consisting -C(O) -R ₁₀ , -C(O) -CH ₂ -0R_ _LJ , and -C (O) CH ₂ -N(R ₁₀ ) (R ₁₀ ) , wherein R ₁₀ is H, CH ₃ , or -CH ₂ CH ₃ ;

Rl3 is H or a Cι_ ₄ straight or branched alkyl group optionally substituted with Ar ₃ , -OH, -ORg, -C0 H, wherein the R ₉ is a C _ ₄ branched or straight chain alkyl group; wherein Ar ₃ is morpholmyl or phenyl, wherein the phenyl is optionally substituted with Q ;

Ar ₃ is phenyl, naphthyl, thienyl, quinol yl, isoquinolinyl , thiazolyl, benzimidazolyl, thienothienyl , thiadiazolyl, benzotriazolyl, benzo [b] thiophenyl , benzofuranyl , and indolyl;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NK-R ₅ wherein R ₅ is -C(O) -R ₀ or -S(0) ₂ -Rg, -OR ₅ wherem R ₅ is -C(O) -R ₁₀ , -ORg, -NHR ₉ , and

O

/ \ CH-,,

\ / O

wherem each Rg and R ₁₀ are independently a - C ₁ _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar .

Other preferred compounds of embodiment G employ formula (IV) wherein R is (elO-A) and the other substituents are as defined above.

Other preferred compounds of embodiment G employ formula (IV) wherein Rτ_ is (ell) and the other substituents are as defined above.

Other preferred compounds of embodiment G employ formula (IV) wherein R is (el2) and the other substituents are as defined above.

Other preferred compounds of embodiment G employ formula (IV) wherein R is (yl) and the other substituents are as defined above.

Other preferred compounds of embodiment G employ formula (IV) wherem R-^ is (y2) and the other substituents are as defined above.

Other preferred compounds of embodiment G employ formula (IV) wherem R _i is (z) and the other substituents are as defined above.

More preferred compounds of embodiment G are those wherem R ₃ is -CO-Ar ₂ .

Most preferably, when R ₃ is -CO-Ar , Y is 0

Other more preferred compounds are those wherein R ₃ is -C(0) -CH ₂ -T ₁ -R ₁₁ and R _n is - (CH ₂ ) ι_ ₃ -Ar ₄ .

Most preferably, when R ₃ is -C (0) -CH ₂ -T _i -R^ and R _π is - (CH ₂ ) _1--3 -Ar , T _χ is 0

Other more preferred compounds are those where R ₃ is -C(0) -CH ₂ -Tι-Rn, Ti is 0; and

Other more preferred compounds are those wherem

Other more preferred compounds are those wherein R ₃ is -CO-CH ₂ -Tι-Rn and R _n is -Ar ₄ .

More preferably, when R ₃ is -C0-CH -T -RJJ and

More preferably, when R-^, is (ell) , (el2) , (yl) , (y2) , (z) , (elO-A) , and (elO-B) , R ₅ is selected from the group consisting of -C(O) -R ₁₀ , -C(0)0-R ₉ , and

-C(O) -NH-R ₁₀

Alternatively, when R _x , is (ell) , (el2) , (yl) , (y2) , (z) , (elO-A) , and (elO-B) , R ₅ is selected from the group consisting of -S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ , -C(O) -C(0) -R ₁₀ , -Rg,

-C(0) -C(0) -OR ₁₀ , and -C(O) -C(0) -N(Rg) (R ₁₀ ) •

More preferably, R ₅ is -C (0) -C(0) -R ₁₀ .

Alternatively, R ₅ is -C (0) -C (0) -OR ₁₀ .

Most preferably, when R _λ is (ell) , (el2) , (yl) , (y2) , (z) , (elO-A) , and (elO-B) , :

m is 1;

R ₁ is -H or -CH ₃ ;

R ₅₁ is a C _ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the Ar3 cyclic group is phenyl, said cyclic group optionally being multiply or singly substituted by -Q ;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl , or indolyl, and said cyclic group optionally being singly or multiply substituted by -Q _i ;

each Q is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-Rι ₀ or -S(0) ₂ -R ₉ , -0R ₅ wherem Re, is

-C(O)-R ₁₀ , -0R ₉ , -N(R ₉ ) (R ₁₀ ) , and 0 / \

CH ₉ ,

\ / ^" O

wherein each R ₉ and R ₁₀ ^are independently a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the Ar ₃ cyclic group is phenyl, and said cyclic group optionally being singly or multiply substituted by -Un¬

provided that when -Ar is substituted with a -Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

More preferably, in these more preferred compounds, the Ar ₃ cyclic group is selected from the set consistmg of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl , imidazolyl, thiadiazolyl, benzo [b] thiophenyl, benzof ranyl , and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q -

Compounds in a preferred form of embodiment G are those wherein R ₂ ι is H and the other substituents are as defined above.

Compounds in another preferred form of embodiment G are those wherein R ₂₁ _ is CH ₃ and the other substituents are as defined above.

The ICE inhibitors of another embodiment (H) of this invention are those of formula (V) .-

- 181 -

wherein:

m is 1 or 2;

R ₃ is selected from the group consisting of: -CN,

-C(O) -H,

10 -C(O) -CH ₂ -Tι-Rn, - C i O ) -CH ₂ -F, -C=N-0-R ₉ , and -CO-Ar ₂ ;

each R5 is independently selected from the group consisting of :

- C i O ) -R ₁₀ ,

-C (O.O-Rg,

-C(O) -N(R ₁₀ ) (R ₁₀ )

-S(0) ₂ -Rg,

2C -S(O) ₂ -NH-R ₁₀ , -C (0) -CH ₂ -0-R ₉ , -C(0)C(0) -Rio,

-Rg,

-H, and ι c, -C(0)C(0^ -N(Rg) (R ₁₀ ) , and

-C (0)C(0) -OR 10'

Y ₂ is H ₂ or 0 ;

each Ti is independently selected from the group consisting of -0- , -S-, -S(0)-, and -S(0) ₂ - _;

R ₈ is selected from the group consisting of:

-C(O)-R ₁₀ ,

-C(O)0-R ₉ ,

-C(0) -NH-RiQ,

-S(0) ₂ -R ₉ , -S (O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -ORι ₀ ,

-C(0)C(0) -R ₁₀ ,

-C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) ,

-C(0) -CH ₂ C(0) -0-R ₉ , -C(O) -CH ₂ C(0) -Rg,

-H, and

-C(O) -C(O) -OR ₁₀ ;

each R _g is independently selected from the group consisting of -Ar ₃ and a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -Cι_ alkyl group is optionally unsaturated;

each R o is independently selected from the group consisting of -H, -Ar , a C ₃ _ ₆ cycloalkyl group, and a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -C _ alkyl group is optionally unsaturated;

each R _^ is independently selected from the group consisting of : -Ar ₄ , - (CH ₂ ) ι_ ₃ -Ar ₄ ,

-H, and -C(O) -Ar ₄ ;

R 5 is selected from the group consisting of -OH, -OAr , -N(H)-OH, and -OCι_ ₆ , wherein C _g is a straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₂ , -0R ₅ , -OH, -ORg, or -C0 ₂ H;

R ₂₁ is -CH ₃ ;

Ar ₂ is independently selected from the following group, in which any ring may optionally be singly or multiply substituted by -Q or phenyl, optionally substituted by Qi :

herein each Y is independently selected from the group consisting of O and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 ₂ , =N-, and -NH-, -N(R. -, and -N(R ₉ )- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ,

each Ar ₄ is a cyclic group independently selected

from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0- , -S-, -SO-, S0 ₂ , =N- , -NH- , -N(R ₅ )-, and -N(R ₉ )- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Qi is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN, =0, -OH, -perfluoro Cι_ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , OR _g , -N(R ₉ ) (R ₁₀ ) , R ₉ , -C(O)-R ₁₀ , and 0

/ \

CH ₂ ; \ / 0

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ;

Compounds of another form of embodiment (I) [form 1) are those of formula (V) :

wherein

m is 1 or 2 ,-

R i I S

R ₃ is selected from the group consisting of -CN,

-C{0) -H, -C(0) -CH ₂ -F, -C=N-0-R _g , and -CO-Ar ₂ ;

each R ₅ is -C(0)C(0)-OR 10

each T is independently selected from the group consisting of -0- , -S-, -S(0)-, and -S(0) ₂ -;

Rg is selected from the group consisting of : -C(0) -Rι ₀ , -C(0)O-R ₉ , -S(0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ , - C iO) -CH ₂ -ORι ₀ , -C(0)C(0) -R ₁₀ , -C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) , -C(O) -CH ₂ C(0) -O-Rg, -C(O) -CH ₂ C(0) -R ₉ , -H, and -C(O) -C(O) -OR ₁₀ ;

each R ₉ is independently selected from the group consisting of -Ar ₃ and a -C _g straight or branched alkyl group optionally substituted with Ar ₃ , wherem the - ι_g alkyl group is optionally unsaturated;

each RI _Q IS independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _g cycloalkyl group, and a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , where the -C _ ₆ alkyl group is optionally unsaturated;

each Rn is independently selected from the group consisting of ^•

-Ar ₄ ,

- (CH ₂ ) _1--3 -Ar ₄ ,

-H, and -C(0) -Ar ₄ ;

R _l5 is selected from the group consisting of -OH, -0Ar ₃ , -N(H)-0H, and -0Cι_ ₆ , wherein Cι_ ₆ is a straight or branched alkyl group optionally substituted with Ar ₃ , -C0NH ₂ , -0R ₅ , -OH, -0R ₉ , or -C0 ₂ H;

each R ₂ is independently selected from the group consisting of -H or a -Cι_g straight or branched alkyl group;

Ar ₂ is independently selected from the following group, in which any ring may optionally be singly or multiply substituted by -Qi or phenyl, optionally substituted by Q :

wherem each Y is independently selected from the group consisting of 0 and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 ₂ , =N- , and -NH- , -N(R ₅ ) -, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Qi;

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -O- , -S-, -SO , S0 ₂ , =N- , -NH- , -N(R5^-, and -N(Rg) - said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Qi is independently selected from the group

consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN, =0, -OH, -perfluoro C!_ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , 0R ₉ ,

-N(R ₉ ) (R ₁₀ ) , R ₉ , -C(O)-R ₁₀ , and 0

/ \ CH ₂ ;

\ /

0

provided that when -Ar is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ;

Alternatively, compounds of this form of embodiment I (form 2) are those wherein R ₁ is -CH ₃ .

Compounds of another form of embodiment (J) (form 1) are those of formula (V) :

wherein

m is 1 or 2;

Ri IS

R ₃ is selected from the group consistmg of: -CN, -C(O) -H,

-C(O) -CH ₂ -T!-Rιι, -C(O) -CH ₂ -F, -C=N-0-R ₉ , and -CO-Ar ₂ ;

each R5 is independently selected from the group consisting of:

-CiO) -R ₁₀ ,

-C(0)0-R ₉ ,

-CiO) -N(R ₁₀ ) (R ₁₀ ) -S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-CiO) -CH ₂ -0-R ₉ ,

-C(0)C(0) -R ₁₀ ,

-Rg, -H,

-C(0)C{0) -OR ₁₀ , and

-C(0)C(0) -N(Rg) (R ₁₀ ) ;

Y ₂ is H ₂ or O;

each Ti is independently selected from the group consisting of -0-, -S-, -S(O) -, and -S(0) ₂ - _;

Rg is selected from the group consisting of :

-C(O ⁾ -Rio,

-C(0)0-R ₉ , -C(O) -NH-R ₁₀ ,

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O) -CH ₂ -OR ₁₀ ,

-C(0)C(0) -R ₁₀ , -C(O) -CH ₂ -N(R ₁₀ ) (R ₁₀ ) ,

-C(O) -CK _: C(0) -0-Rg,

-C(O) -CH ₂ C(0) -R ₉ ,

-H,

-C(O) -C(O) -OR ₁₀ , and -C(O) -C(O) -N(Rg) (R ₁₀ ) ;

each R ₉ is independently selected from the group consisting of -Ar and a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -Cι_ alkyl group is optionally unsaturated,

each R o s independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _ ₆ cycloalkyl group, and a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -Cι_ ₆ alkyl group is optionally unsaturated,

each Ru is independently selected from the group consisting of. -Ar ₄ , - (CH ₂ ) _! _ ₃ -Ar ₄ ,

-H, and -C(0) -Ar ₄ ,

R ₅ is selected from the group consisting of -OH, -0Ar ₃ , -N(H)-OH, and -OC ₁ _ ₆ , wherem Cι_ ₆ is a straight or branched alkyl group optionally substituted with Ar ₃ , -C0NH ₂ , -OR ₅ , -OH, -ORg, or -C0 ₂ H;

each R ₂ ι is independently selected from the group consisting of -H or a -C _g straight or branched alkyl group,

Ar ₂ is independently selected from the following group, m which any ring may optionally be singly or multiply substituted by -Qi or phenyl, optionally substituted by Qi

. 11 ,

-O wherein each Y is independently selected from the 5 group consisting of 0 and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 0 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0- , -S-, -SO-, S0 ₂ , =N- , and -NH- , -N(R ₅ >-, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle 5 group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q. _\ ;

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 0 6, IC, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0- , -S-, -SO-, S0 ₂ , =N- , -NH- , 5 -N(R _j -, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q ;

C each Q is independently selected from the group

consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN, =0, -OH, -perfluoro C _! _ ₃ alkyl, R ₅ , -0R ₅ , -NHR ₅ , 0R ₉ ,

-N(R ₉ ) (R ₁₀ ) , Rg, -C(O)-R ₁₀ , and 0

/ \

CH 2

\ / 0

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ;

provided that when:

X ₅ is CH;

R _i5 is -OH;

Y ₂ is O and R ₃ is -C(0)-H, then R ₅ cannot be: -C(0) -R _Q , wherem R ₀ is -Ar ₃ and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q _] _, 4-

(carboxymethoxy) phenyl, 2-fluorophenyl, 2-pyridyl, N-

(4-methylpiperazino)methylphenyl, or

-C(0)-ORg, wherein Rg is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Qi, ; and when

Y ₂ is 0, R ₃ is -C(0) -CH ₂ -T ₁ -R ₁₁ , T _λ is 0, and R _ι: is Ar ₄ , wherem the Ar ₄ cyclic group is 5- (l-(4- chlorophenyl) -3-trifluoromethyl) pyrazolyl) , then R ₅ cannot be :

-C(0) -R Q, wherem R _^0 ^{1S ~} Ar ₃ ^an ^ the Ar ₃ cyclic group is 4 - (dimethylammomethyl)phenyl , phenyl, 4-

(carboxymethylthio) phenyl , 4 - (carboxyethylthio)phenyl , 4 (carboxyethyl) phenyl , 4- (carboxypropyl) phenyl , 2-

fluorophenyl, 2-pyridyl, N- (4- methylpiperazino) methylphenyl , or

-C(0)-ORg, wherein R ₉ is -CH ₂ -Ar ₃ and the Ar ₃ cyclic group is phenyl; and when Ru is Ar ₄ , wherein the Ar ₄ cyclic group is 5- (l-phenyl-3-trifluoromethyl) pyrazolyl) , then R ₅ cannot be :

-C(0)-ORg, wherein Rg is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl;

and when Rn is Ar ₄ , wherein the Ar ₄ cyclic group is 5- (1- (2-pyridyl) -3-trιfluoromethyl) pyrazolyl ) , then

R5 cannot be :

-C(0) -RI _Q , wherein Rι ₀ is -Ar ₃ and the Ar ₃ cyclic group is 4- (dimethylammomethyl) phenyl , or -C(0) -ORg, wherein R ₉ is -CH -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q^, ; ^an d when

Y ₂ is O, R ₃ is -C(0) -CH ₂ -T ₁ -R ₁₁ , T ₁ is O, and R _χι is -C(0)-Ar ₄ , wherein the Ar ₄ cyclic group is 2,5- dichlorophenyl , then R ₅ cannot be: -C(O) -R ₁₀ , wherein R ₁₀ is -Ar ₃ and the Ar cyclic group is 4- (dimethylammomethyl) phenyl , 4-(N- morpholinomethyl) phenyl, 4-(N- methylpiperazino)methyl)phenyl , 4- (N- (2- methyl) imidazolylmethyl) phenyl , 5-benzιmιdazolyl , 5- benztriazolyl, N-carboethoxy-5-benztrιazolyl , N- carboethoxy-5-benzimidazolyl , or

-C(0) -ORg, wherein Rg is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Q , , and when

Y ₂ is H ₂ , R ₃ is -C(O) -CH ₂ -T ₁ -Rn, T _x is 0, and R _n is

-C(0)-Ar ₄ , wherein the Ar ₄ cyclic group is 2,5- dichlorophenyl , then R ₅ cannot be:

-C(0) -0R ₉ , where R _g is -CH ₂ -Ar ₃ and the Ar ₃

cyclic group is phenyl .

Compounds of another form of embodiment J (form 2) are those wherein R ₂ is -CH ₃ .

Compounds of another form of embodiment J (form 3) are those wherein R ₅ is -C (0) -C (0) -OR ₁₀ .

Compounds of another form of embodiment J (form 4) are those wherein R ₅ is -C (0) -C(0) -OR _i0 and R ₂₁ is -CH ₃ .

Preferred compounds of embodiments H, I, and J employ formula (V) , wherein R is -CO-Ar ₂ .

More preferably, when R ₃ is -C0-Ar ₂ Y is 0.

Preferred compounds of embodiments H, I, and J employ formula (V) , wherein R ₃ is -C (0) -CH ₂ -T ₁ -R ₁ and R _lχ is - (CH ₂ ) ι- ₃ ~Ar ₄ .

More preferably, when R ₃ is -C(0) -CH ₂ -T ₁ -R ₁₁ and R _{± 1} is - (CH ₂ ) ι_ ₃ -Ar ₄ , ^r T ₁ is 0.

Preferred compounds of embodiments H, I, and J employ formula (V) , wherein R ₃ is -C (0) -CH ₂ -T ₁ -R ₁₁ , T _: is 0, and R^ is -C(0)-Ar ₄ .

Preferred compounds of embodiments H, I, and J employ formula (V) , wherein R ₃ is -C(0) -H.

Preferred compounds of embodiments H, I, and J employ formula (V) , wherein R ₃ is -C0-CH ₂ -T _: -R— and R _χ - is -Ar .

More preferably, when R ₃ is -C0-CH ₂ -Ti -R- and

Rn i s -Ar ₄ , T ₂ i s 0 or S .

More preferred compounds of embodiments H and J (forms 1 and 2) are those wherem R ₅ is selected from the group consisting of: -C(O)-R ₁₀ ,

-C(0)0-R ₉ , and -C (0) -NH-R ₁₀ .

Alternatively, more preferred compounds of embodiments H and J (forms 1 and 2) are those wherein R ₅ is selected from the group consisting of:

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(0) -C(0) -Rio,

-Rg, -C(0) -C(0) -OR ₁₀ , and

-C(0) -C(0) -N(R ) (R ₁₀ ) .

Most preferably, R ₅ is -C (0) -C (0) -R ₁₀ .

Alternatively, R ₅ is -C (0) -C (0) -OR ₁₀ .

More preferred compounds of embodiments H, I (form and J (forms 2 and 4) are those wherem:

is 1 ;

R _i5 is -OH or -0C _ ₄ straight or branched alkyl group optionally substituted with Ar ₃ , -OH, -ORg, -COoH, wherein the Rg is a Cι_ ₄ branched or straight chain alkyl group; wherem Ar ₃ is morpholmyl or phenyl, wherem the phenyl is optionally substituted with Q ₁ ;

Ar ₂ is ( hh) ;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, qumolinyl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl, and dolyl, and said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Ar ₄ cyclic group is independently selected from the group consisting of phenyl, tetrazolyl, pyridyl, oxazolyl, naphthyl, pyrimidinyl, and thienyl, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Q _i is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R ₉ , -NH-R ₅ wherein R ₅ is -C(O)-Rι ₀ or -S(0) ₂ -R ₉ , -0R ₅ wherein R ₅ is -C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and 0

CH ₂ ,

\ / O ,

wherein each Rg and R _Q are independently a -Cι_ _g straight or branched alkyl group optionally substituted with Ar ₃ wherem the Ar ₃ cyclic group is phenyl, and said cyclic group optionally being singly or multiply substituted by -Qι_;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted

with another -Ar ₃ .

More preferred compounds of embodiments I (form 1) , and J (form 3) are those wherein:

m is 1;

R ₂₁ is -H or -CH ₃ ;

R ₅₁ is a Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the Ar ₃ cyclic group is phenyl, said cyclic group optionally being multiply or singly substituted by -Qi;

each Ar ₃ cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl , pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl, benzofuranyl , or indolyl, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -Rg, -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S(0) ₂ -R ₉ , -OR ₅ wherein R ₅ is

-C(O)-R ₁₀ , -ORg, -N(R ₉ ) (R ₁₀ ) , and O

/ \

CHo,

\ / 0

wherein each Rg and R ₁₀ are independently a - C ₁ _ _f) straight or branched alkyl group optionally substituted with Ar ₃ , wherein the Ar ₃ cyclic group is phenyl, and said cyclic group optionally being singly or multiply substituted by -Qi;

provided that when -Ar ₃ is substituted with a -Q± group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferably, in these more preferred compounds the Ar ₃ cyclic group is selected from the set consisting of phenyl, naphthyl, thienyl, quinolinyl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q _i .

Preferred compounds of embodiments H, and J (forms l and 1) are those where :

R ₃ is -C(O) -CH ₂ -Tι-R _lι;

T ₁ is O; and

Ru is -C(0)-Ar ₄ , wherem the Ar ₄ cyclic group is selected from the set consisting of tetrazolyl, pyridyl, oxazolyl, pyrimidinyl, and thienyl, and said cyclic group optionally being singly or multiply substituted by -Q .

Preferred compounds of embodiments H, I, and J employ formula (V) , wherem R ₃ is C0-CH ₂ -T ₁ -R ₁₁ , R _χι is -Ar ₄ , wherem the Ar ₄ cyclic group is pyridyl, and said cyclic group optionally being singly or multiply substituted by -Q -

Preferred compounds of embodiment J (form 1 ) are those wherein:

R ₃ is -C{0) -H, and

R ₅ is -C(0)-R _i Q, wherein:

R O is Ar ₃ , wherein the Ar ₃ cyclic group is phenyl optionally being singly or multiply substituted by.

-F, -Cl,

-N(H)-R ₅ , wherem -R ₅ is -H or -C(O) -R ₁₀ , where R O is a -C _g straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl,

-N(Rg) (Rio) , wherein R ₉ and R ₁₀ are independently a ~ ^c ι- _< _ straight or branched alkyl group, or

-O-R5, wherein R ₅ is H or a -C _ ₄ straight or branched alkyl group.

More preferably, Ar ₃ is phenyl being optionally singly or multiply substituted at the 3- or 5-position by -Cl or at the 4-posιtιon by -NH-R ₅ , -N(R ₉ ) (R ₁₀ ) , or -O-R5

Other more preferred compounds of embodiment J (form 1) are those wherem.

R ₃ is -C(O) -H;

R5 is -C(0) -R _Q , wherem Rι ₀ is Ar ₃ and the Ar ₃ cyclic group is selected from the group consisting of is mdolyl, benzimidazolyl, thienyl, and benzo [b] thiophenyl , and said cyclic group optionally being singly or multiply substituted by -Qi,

Other more preferred compounds of embodiment J

(form 1) are those wherein.

R ₅ is -C(O) -R ₁₀ , wherem R ₀ is Ar ₃ and the Ari

cyclic group is selected from quinolyl and isoquinolyl, and said cyclic group optionally being singly or multiply substituted by ~Q .

Other more preferred compounds of embodiment J (form 1) are those wherein:

R ₃ is -C(O) -H;

R ₅ is -C(O)-R ₁₀ , wherein R ₁₀ is Ar ₃ and the Ar ₃ cyclic group is phenyl, substituted by

O

/ \ ( CH

\ / o

Preferred compounds of embodiment (J) include, but are not limited to:

2619

- 201 -

The ICE inhibitors of another embodiment (K) of this invention are those of formula:

( VI Rl-N-R ₂

H

where :

C is a ring chosen from the set consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, lmidazolc, cyclopentyl, and cyclohexyl; the ring optionally be q singly or multiply substituted by -Q _i , ^*

Ro is :

m is 1 or 2;

each R ₅ is independently selected from the group consisting of:

-C(0)-R ₁₀ , -C(0)0-R ₉ , -C(O)-N(R ₁₀ ) (Rio) -S (0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ , -C (0) -CH ₂ -0-R ₉ , -C(O)C(O)-R _10f

-R 9,

-H,

-C(O)C(O)-OR _10f and

-C(0)C(0)-N(R ₉ ) (R ₁₀ )

Rg is selected from the group consisting of ana

-CH-

Rg is selected from the group consisting of:

-C(0)-R ₁₀ , -C(0)0-R ₉ , -C(O)-N(H)-R ₁₀ , -S (0) ₂ -R ₉ , -S(O) ₂ -NH-R ₁₀ ,

-C(O)-CH ₂ -OR ₁₀ . -C(O)C(O)-R ₁₀ ; -C(O)-CH ₂ N(R ₁₀ ) (R ₁₀ ) , -C(0)-CH ₂ C(0)-0-R ₉ , -C(0) -CH ₂ C(0)-R ₉ ,

-H, and -C(0)-C(0) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the -Cι_ alkyl group is optionally unsaturated;

each R o is independently selected from the group consisting of -H, -Ar , a -C ₃ _g cycloalkyl group, and a -C _g straight or branched alkyl group optionally substituted with Ar , where the -Cι_ ₆ alkyl group is optionally unsaturated;

R ₃ is selected from the group consisting of H, Ar ₃ , and a -C _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , -C0NH ₂ , -0R ₅ , -OH, -OR _g , or -C0 ₂ H;

each R ₅ ι is independently selected from the group consisting of R ₉ , -C(0)-R ₉ , -C [0) - (H) -R ₉ , or each R ₅₁ taker, together forms a saturated 4-8 member carbocyclic ring or heterocyclic ring containing -0-, -S-, cr -NH-;

each R ₂ ι is independently selected from the group consisting of -H or a -C _] __g straight or branched alkyl group;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 , =N-, and -NH-, said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _ι;

each Q is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN,

=0, -OH, -perfluoro Cι_ ₃ alkyl, R ₅ , -OR ₅ , -NHR ₅ , -ORg, -N(R ₉ ) (R ₁₀ ) , -R _9/ -C(O)-R ₁₀ . and 0

/ \

CH ₂ , \ /

0

provided that when -Ar ₃ is substituted with a Q _i group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferred compounds of this embodiment are those wherein:

m is 1;

C is a ring chosen from the set consisting of benzo, pyrido, or thieno the ring optionally being singly or multiply substituted by halogen, -NH ₂ , -NH-R ₅ , -NH-Rg, -OR ₁₀ , or -R ₉ , wherein R ₉ is a straight or branched C _ alkyl group and R ₁₀ is H or a straight or branched Cι_ ₄ alkyl group;

^R e is H;

R _l 3 is H or a Cι_ ₄ straight or branched alkyl group optionally substituted with Ar ₃ , -OH, -ORg, -C0 ₂ H, wherem the R ₉ is a Cι_ ₄ branched or straight chain alkyl group; wherein Ar ₃ is morpholinyl or phenyl, wherein the phenyl is optionally substituted with Q± ;

R ₂₁ is -H or -CH ₃ ;

R5 is a Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl, optionally substituted by -Qχ;

each Ar cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, quinol yl, isoquinolinyl, pyrazolyl, thiazolyl, isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Q ,"

each Q is independent] y selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R _g , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S (0) ₂ -Rg, -0R ₅ wherein R ₅ is -C(O)-Rι ₀ , -ORg, -NHRg, and

0 / \

( CH ₂ ,

\ / 0

wherein each Rg and R ₁₀ are independently a -C _ ₆ straight or branched alkyl group optionally substituted with Ar ₃ wherein Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferably, in this preferred embodiment, R _x is (w2) and the other substituents are as defined above.

Compounds of this preferred embodiment include, but are not limited to:

More preferably, Rg selected frcir the

group consisting of: -C(0)-R ₁₀ , -C (0)0-R ₉ , -C(O)-CH ₂ -OR ₁₀ , and -C(0)-CH ₂ C(0)-R ₉ .

Most preferably, R ₈ is -C (0) -CH ₂ - ORio and R ₁₀ is -H or -CH ₃ .

Alternatively, in this preferred embodiment, R is (elO) and X ₅ is CH and the other substituents are as defined above.

Alternatively, this preferred embodiment, R _l is (elO) and X ₅ is N and the other substituents are as defined above.

Preferably, in any of the above compounds of embodiment (K) , R ₅ is -C(O)-R ₁₀ or -C (0) -C (0) -R ₁₀ and the other substituents are as defined above.

More preferably, R ₁₀ ^1S ~Ar ₃ and the other substituents are as defined above.

More preferably, in these more preferred compounds:

R ₅ is -C(O)-R ₁₀ and R ₁₀ is Ar ₃ , wherem the Ar ₃ cyclic group is phenyl optionally being singly or multiply substituted by: -R ₉ , wherem Rg is a Cι_ ₄ straight or branched alkyl group; -F, -Cl,

-N(H)-R ₅ , wherein -R ₅ is -H or -C(O)-R ₀ , wnerein R _l O is a -Cι_ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is pneny__, -N(Rg) (R Q) . where R ₉ and R ₁₀ are independently a -Cι_ ₄ straight or branched alkyl group, or

-O-R ₅ , wherein R ₅ is H or a -Cι_ ₄ straight or branched alkyl group.

Preferred compounds of this more preferred embodiment include, but are not limited to:

Most preferably, Ar ₃ is phenyl being singly or multiply substituted at the 3- or 5-posιtion by -Cl or at the 4-posιtιon by -NH-R ₅ , -N(Rg) (Rι ₀ ) , or -0-R ₅ .

Preferred compounds of this most preferred embodiment mclude, but are not limited to:

688a

Other preferred compounds of this most preferred embodiment include, but are not limited to:

2619

- 211

Alternatively, Ar ₃ is phenyl being singly or multiply substituted at the 3- or 5-posιtion oy -Rg, wherein Rg is a Cι_ straight or branched alkyl group; and at the 4-positιon by -O-R ₅ .

Preferred compounds cf this mcst preferred embodiment include, but are not limited to:

Other preferred compounds of this most preferred embodiment include, but are not

limited to

Alternatively, in this more preferred embodiment, R5 is -C(O)-Rι ₀ , where R _i0 is Ar ₃ and the Ar ₃ cyclic group is selected from the group consisting of is dolyl, benzimidazolyl, thienyl, quinolyl, isoquinolyl and benzo [b] thiophenyl, and said cyclic group optionally being singly or multiply substituted by -Q _x .

Most preferably, the Ar cyclic group is isoquinolyl.

Preferred compounds of this most preferred embodiment include, but are not limited to:

696a

Other preferred compounds of this most preferred embodiment include, but are not limited to:

412c

Alternatively, in this more preferred embodiment, R ₅ is -C(0)-R _Q . wherein Rι ₀ is Ar ₃ and the Ar ₃ cyclic group is phenyl, substituted by

0 / \ ( CH- \ /

0

Preferred compounds of this more preferred embodiment include, but are not limited to:

Other compounds of embodiment (K) mclude, but are not limited to:

213g

264a

Tne ICE inhibitors of another embodiment (L) of this invention are those of formula :

619

- 231 -

wherem:

R is selected from the group consisting of the following formulae:

C is a ring chosen from the set consisting of benzo, pyrido, thieno, pyrrolo, furano, thiazolo, isothiazolo, oxazolo, isoxazolo, pyrimido, imidazolo, cyclopentyl, and cyclohexyl, the ring optionally being singly or multiply substituted by -Qi;

R ₃ is selected from the group consisting of: -CN,

-C(0)-H,

-C(O) -CH ₂ -Tι-Rn, -C(0)-CH ₂ -F, -C=N-0-R ₉ , and -CO-Ar ₂ ;

each R ₅ is independently selected from the group consisting of:

-C(O) -R 10'

-C(0)0-Rq,

-S(0) ₂ -R ₉ ,

-S (O) ₂ -NH-R ₁₀ -C(O) -CH ₂ -0-R ₉ ,

-C (O)C(O) -R 10,

each T is independently selected from the group consisting of -0-, -S-, -S(O)-, and -S(0) ₂ -;

R is selected from the group consisting of -H and ~CH ₃ ;

Rg is selected from the group consisting of:

-C ⁽ O)-R ₁₀ ,

-C(0)0-R ₉ ,

-C(O)-NH-R ₁₀ , -S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(O)-CH ₂ -OR ₁₀ ,

-C(O)C(O)-R ₁₀ ,

-C(O)-CH ₂ -N(R ₁₀ ) (Rio) . -C(O) -CH ₂ C(0) -O-Rg,

-C(O) -CH ₂ C(0)-R ₉ ,

-H, and

-C(0)-C(0) -OR ₁₀ ;

each Rg is independently selected from the group consisting of -Ar ₃ and a - ι_ ₆ straignt or branched alkyl group optionally substituted with Ar ₃ , wherein the -Cι_g alkyl group _s optionally unsaturated;

each R _i o is independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _ ₆ cycloalkyl group, and a ^_c _l - ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherein the ^_ C _ ₆ alkyl group is optionally unsaturated;

each Ru is independently selected from the group consisting of: -Ar ₄ ,

- (CH ₂ ) ι_ ₃ -Ar ₄ , -H, and -C(0)-Ar ₄ ;

R _l5 is selected from the group consisting of -OH, -OAr ₃ , -N(H)-OH, and -OC _1--6 , wherein C _1--6 is a straight or branched alkyl group optionally substituted with Ar ₃ , -CONH ₂ , -OR ₅ , -OH, -OR ₉ , or -C0 ₂ H;

Ar ₂ is independently selected from the following group, in which any ring may optionally be singly or multiply substituted by -Q_ι or phenyl, optionally substituted by Qi :

wherein each Y is independently selected from the group consisting of 0 and S;

each Ar ₃ is a cyclic group independently selected from the set consisting of an aryl group which contains

6, 10, 12, or 14 carbon atoms and between 1 and 3 rings and an aromatic heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 , =N-, and -NH-, -N(R ₅ )-, and -N(R ₉ )- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Qi;

each Ar ₄ is a cyclic group independently selected from the set consisting of an aryl group which contains 6, 10, 12, or 14 carbon atoms and between 1 and 3 rings, and a heterocycle group containing between 5 and 15 ring atoms and between 1 and 3 rings, said heterocyclic group containing at least one heteroatom group selected from -0-, -S-, -SO-, S0 ₂ , =N-, -NH-, -N(R ₅ )-, and -N(Rg)- said heterocycle group optionally containing one or more double bonds, said heterocycle group optionally comprising one or more aromatic rings, and said cyclic group optionally being singly or multiply substituted by -Q _] _;

each Qi is independently selected from the group consisting of -NH ₂ , -C0 ₂ H, -Cl, -F, -Br, -I, -N0 ₂ , -CN, =0, -OH, -perfluoro C _1--3 alkyl, R _s , -0R ₅ , -NHR ₅ , -0R ₉ ,

-N(R ₉ ) (R ₁₀ , -R ₉ , -C(O)-R ₁₀ . and 0

/ \

CH ₂ ; \ / 0

provided that when -Ar ₃ is substituted with a Q ₁ group whicn comprises one or more additional -Ar ₃

groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferably,

C is a ring chosen from the set consisting of benzo, pyrido, and thieno, the ring optionally being singly or multiply substituted by halogen, -NH ₂ , -NH-R ₅ , or -NH-R ₉ , -ORi _Q , or -Rg, wherem R ₉ is a straight or branched -Cι_ ₄ alkyl group, and R ₁₀ is -H or a straight or branched -Cι_ alkyl group;

Ru is selected from the group consisting of -Ar ₄ , - (CH ₂ ) _1--3 -Ar ₄ , and -C(0)-Ar ₄ ;

Ar ₂ is (hh) ;

Y is O;

each Ar cyclic group is independently selected from the set consisting of phenyl, naphthyl, thienyl, qumol yl, isoquinolinyl, thiazolyl, benzimidazolyl, thienothienyl, thiadiazolyl, benzotriazolyl, benzo .b] thiophenyl, benzofuranyl, ano dolyl, and said cyclic group optionally being singly or multiply substituted by -Q ,"

each Ar ₄ cyclic group is independently selected from tne set consisting ot phenyl, tetrazolyl,

naphthyl, pyridinyl, oxazolyl, pyrimidinyl, or dolyl, and said cyclic group optionally being singly or multiply substituted by -Q ;

each Qi is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R _g , -NH-R ₅ wherein R ₅ is -C (0) -R ₁₀ or -S(0) ₂ -R ₉ , -0R ₅ wherem R ₅ is -C(O)-R ₁₀ , -ORg, -NHRg, and

0 / \

CH 2'

\ / 0

wherein each Rg and Rι ₀ are independently a -C ₁ _ ₆ straight or branched alkyl group optionally substituted with -Ar ₃ wherem Ar ₃ is phenyl;

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ .

Preferred compounds of this preferred embodiment include, but are not limited to:

711 ; and

More preferably, R ₃ is -C(0)-Ar ₂ and the other substituents are as described above.

Alternatively, R ₃ is -C(0)CH ₂ -T ₁ _R ₁₁ ;

Alternatively, R ₃ is -C(0)-H. Preferably, in any of the above compounds of embodiment (L) , R ₈ is selected from the group consisting of:

-C(O)-R ₁₀ , -C (O)O-Rg, -C(O)-CH ₂ -OR ₁₀ , and -C(O) -CH ₂ C(0) -R ₉ .

More preferably, R ₈ is -C (0) -CH ₂ -OR ₁₀ and R ₁₀ is -H or -CH ₃ .

Alternatively, ICE inhibitors of embodiment (L) of this invention are those of formula :

wnerein is 1;

Ri I:

R ₃ is selected from the group consisting of: -CN,

-C(0)-H,

-C(0)-CH ₂ -T ₁ -R ₁ ι, -C(0)-CH ₂ -F, -C=N-0-R ₉ , and - CO-Ar ₂ ;

each R ₅ is independently selected from the group consisting of:

-C(O)-R ₁₀ ,

-C(0)0-R ₉ ,

-C(O)-N(R ₁₀ ) (RI _Q )

-S(0) ₂ -R ₉ ,

-S(O) ₂ -NH-R ₁₀ ,

-C(0)-CH ₂ -0-R ₉ ,

-C(O)C(O)-R _10/

-R 9,

-H,

-C(0)C(0) -OR 10, and

-C(0)C(0)-N(R _Q ) (R ₁₀ )

each T is independently selected from the group consisting of -0- or -S-;

each Rg is independently selected from the group

619

241

consisting of -Ar ₃ and a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherem the -Cι_ ₆ alkyl group is optionally unsaturated;

each Rio is independently selected from the group consisting of -H, -Ar ₃ , a C ₃ _g cycloalkyl group, and a -Cι_g straight or branched alkyl group optionally suostituted with Ar ₃ , wherein the -C _g alkyl group is optionally unsaturated;

each Ru is independently selected from the group consisting of: -Ar ₄ ,

- (CH ₂ )ι_ ₃ -Ar ₄ , -H, and -C(0)-Ar ₄ ;

R 5 is selected from the group consisting of -OH,

-OAr ₃ , -N(H)-0H, and -0Cι_ ₆ , wherein Cι_ ₆ is a straight or branched alkyl group optionally substituted with -Ar ₃ , -CONH ₂ , -OR ₅ , -OH, -0R ₉ , or -C0 ₂ H;

Ar- 1S

wherein Y is 0;

each Ar ₃ is a cyclic group independently selected frc~ the set consisting of phenyl, napnthyl, thienyl, qu nolinyl, isoquinolinyl, pyrazolyl, thiazolyl,

isoxazolyl, benzotriazolyl, benzimidazolyl, thienothienyl, imidazolyl, thiadiazolyl, benzo [b] thiophenyl, pyridyl benzofuranyl, and indolyl, and said cyclic group optionally being singly or multiply substituted by -Qi;

each Ar ₄ is a cyclic group independently selected from the set consisting of phenyl, tetrazolyl, pyridinyl, oxazolyl, naphthyl, pyrimidinyl, and thienyl, and said cyclic group optionally being singly or multiply substituted by -Q _\ ;

each Q is independently selected from the group consisting of -NH ₂ , -Cl, -F, -Br, -OH, -R _g , -NH-R ₅ wherein R ₅ is -C(O)-R ₁₀ or -S (0) ₂ -R ₉ , -OR ₅ wherem R ₅ is

-C(O)-R ₁₀ , -ORg, -NHRg, and 0

/ \

CH ₂ , \ / 0

provided that when -Ar ₃ is substituted with a Q group which comprises one or more additional -Ar ₃ groups, said additional -Ar ₃ groups are not substituted with another -Ar ₃ ;

provided that when:

Y ₂ is 0 and R is -C(0)-H, tnen R ₅ cannot be: -C(0)-RIQ, wherein R ₁₀ is -Ar ₃ and the Ar _j cyclic

group is phenyl, unsubstituted by -Q _ 4-

(carboxymethoxy)phenyl, 2-fluorophenyl, 2-pyrιdyl, N-

(4-methylpιperazιno)methylphenyl, or

-C(0)-OR ₉ , where R ₉ is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Qi; and when

Y ₂ is 0, R ₃ is -C(0)-CH ₂ -T ₁ -R ₁₁ , T _x is 0, and R _n is Ar , where the Ar cyclic group is 5-(l-(4- chlorophenyl) -3-trιfluoromethyl)pyrazolyl) , then R ₅ cannot be: -H;

-C(0)-RI _Q / wherein R ₁₀ is -Ar ₃ and the Ar ₃ cyclic group is 4- (dimethylammomethyl) phenyl, phenyl, 4- (carboxymethylthio)phenyl, 4- (carboxyethylthio) phenyl, 4- (carboxyethyl) phenyl, 4- (carboxypropyl) phenyl, 2- fluorophenyl, 2-pyrιdyl, N-(4- methylpiperaz o)methylphenyl, or

-C(0)-0R ₉ , wherein Rg is isobutyl or -CH ₂ -Ar ₃ and the Ar ₃ cyclic group is phenyl; and when Ru is Ar ₄ , wherein the Ar ₄ cyclic group is 5- (l-phenyl-3-trιfluoromethyl) pyrazolyl or 5-(l-(4- chloro-2-pyridinyl) -3-trifluoromethyl ) pyrazolyl, then R ₅ cannot be:

-C(0)-OR ₉ , wherein Rg is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl;

and when Ru is Ar ₄ , wherein the Ar ₄ cyclic group is 5- (1- (2-pyπdyl) -3-trιfluorometryl) pyrazolyl , , then

R ₅ cannot be:

-C(O)-R _i0 , where R ₁₀ is -Ar ₃ and tne Ar cyclic group is 4- (dimethylammomethyl) phenyl, or -C(0)-0R ₉ , wherem R ₉ is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted oy -Q ₁ ; and when

Y ₂ is 0, R ₃ is -C(0)-CH ₂ -T ₁ -R ₁₁ , T _χ s 0, and R _lχ is -C(0)-Ar ₄ , wherein the Ar ₄ cyclic group is 2,5- dichlorophenyl, then R ₅ cannot be:

-C(O)-R ₁₀ / wherein R ₁₀ is -Ar ₃ and the Ar ₃ cyclic group is 4- (dimethylammomethyl)phenyl, 4- (N- morpholinomethyl)phenyl, 4- (N- methylpiperaz o)methyl)phenyl, 4- (N- (2- methyl) imidazolylmethyl)phenyl, 5-benzιmιdazolyi, 5- benztπazolyl, N-carboethoxy-5-benztπazolyl, N- carboethoxy-5-benzιmιdazolyl, or

-C(0)-0R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ , and the Ar ₃ cyclic group is phenyl, unsubstituted by -Qi, ; and when

Y ₂ is H ₂ , R ₃ is -C (O) -CH ₂ -T ₁ -Rι ₁ , 1 ₁ is 0, and R _n is -C(0)-Ar ₄ , wherein the Ar ₄ cyclic group is 2,5- dichlorophenyl, then R ₅ cannot be:

-C(0)-0R ₉ , wherein R ₉ is -CH ₂ -Ar ₃ and the Ar ₃ cyclic group is phenyl.

Preferably, in any of the above compounds of embodiment (L) , R ₃ is -C(0)-H and R ₅ is -C(O)-R ₁₀ or -C (0) -C (0) -Rio and the other substituents are as defined above.

More preferably R^ _Q ^χ s -Ar ₃ and the other substituents are as defined above.

More preferably m these more preferred compounds:

R ₅ is -C(0)-Rι ₀ and Rι ₀ s Ar ₃ , wherein the Ar ₃ cyclic group is phenyl optionally being singly cr multiply substituted by:

-Rg, wherein R ₉ is a Cι_ ₄ straight or brancπed alkyl group; -F, -Cl, -N(H)-R ₅ , where -R ₅ is -H or -C(O)-R ₁₀ ,

wherein R ₁₀ is a -Cι_ ₆ straight or branched alkyl group optionally substituted with Ar ₃ , wherein Ar ₃ is phenyl,

-N(Rg) (R o)/ wherein Rg and R ₁₀ are independently a -C _ ₄ straight or branched alkyl group, or

-O-R ₅ , wherein R ₅ is H or a -Cι_ ₄ straight or branched alkyl group.

Preferred compounds of this preferred embodiment include, but are not limited to:

CH

916

Most preferably, Ar ₃ is phenyl being singly or multiply substituted at the 3- or 5- position by -Cl or at the 4-posιtιon by -NH-R ₅ , -N(Rg) (R ₁₀ ) , or -0-R ₅ .

Preferred compounds of this most preferred embodiment include, but are not limited to:

669

; and

619

2 4 9 -

Other preferred compounds of this most preferred embodiment include, but are not limited to:

Alternatively, Ar ₃ is phenyl being singly or multiply substituted at the 3- or 5-posιtιon by -Rg, wherein R _g is a C _ ₄ straight or branched alkyl group; and at the 4-posιtion by -0-R ₅ .

Preferred compounds of this most preferred embodiment include, but are not limited to:

619

2 51

Another preferred compound of this most preferred embodiment includes, but is not limited to:

Alternatively, in this more preferred embodiment:

R ₅ is -C(0)-R Q, wherein R ₁₀ ^{is Ar} ₃ and the Ar ₃ cyclic group is selected from the group consisting of is indolyl, benzimidazolyl, thienyl, qu olyl, isoquinolyl and benzo [b] thiophenyl, and said cyclic group optionally being singly or multiply substituted by -Q ₁ .

Preferred compounds of this more preferred embodiment include, but are not limited to:

Most preferably, the Ar ₃ cyclic group is isoquinolyl, and said cyclic group optionally being singly or multiply substituted by -Q ₁ .

A preferred compound cf this most preferred embodiment includes, but is not limited

to:

Anctner preferred compound a t this most preferred embodimerτ. includes, but is not limited to:

Alternatively, this more preferred embodiment R ₅ is -C(O)-R ₁₀ / wherem R ₁₀ is -Ar ₃ and the Ar ₃ cyclic group is phenyl, substituted by

0 / \

( CH-

\ / O

A preferred compound of this more preferred embodiment includes, but is not limited to:

A preferred compound of this more preferred embodiment includes, but is not ..united to:

:55

Other compounds of embodiment (L) mclude, but are not limited to:

Other compounds of embodiment (K) include, but are not limited to:

Other compounds of embodiment ( ) include, but are not limited to:

98

6

26

The most preferred compounds of embodiments

(K) and (L) are those wherein the Ar ₃ cyclic group is isoquinolyl .

Compounds of this invention are described in co-pending United States Application Serial Nos. 08/575,641 and 08/598,332 the disclosures of which are herein incorporated by reference.

The compounds of this invention have a molecular weight of less than or equal to about 700 Daltons, and more preferably between about 400 and 600 Daltons. These preferred compounds may be readily acsorbed by the bloodstream of patients upon oral administration. This oral availability makes such compounds excellent agents for orally-admmistered treatment and prevention regimens against IL-1-, apoptosis-, IGIF- or IFN-γ mediated diseases.

It should be understood that the compounds of tr.is invention may exist in various equilibrium forms, depending on conditions including choice of solvent, pH, and others known to the practitioner skilled the art. All such forms of these compounds are expressly included the present invention. In particular, many

of the compounds of this invention, especially those which contain aldehyde or ketone groups in R ₃ and carboxylic acid groups in T, may take hemi-ketal (or he i-acetal) or hydrated orms. For example, compounds of embodiment (A) may take the forms depicted below: EQ1

Hemi-acetal Form

Depending on the choice of solvent and other conditions known to the practitioner skilled in the art, compounds of this invention may also take acyloxy ketal, acyloxy acetal, ketal or acetal form:

Acyloxy Ketal or Acyloxy Acetal Form Ketal or Acetal Form

In addition, it should be understood that the equilibrium forms of the compounds of th s invention may include tautomeric forms. All such forms of these compounds are expressly included in the present invention.

It should be understood that the compounαs of this invention may be modified by appropriate

functionalities to enhance selective biological properties. Such modifications are known in the art and mclude those which increase biological penetration mto a given biological system (e.g., blood, lymphatic system, central nervous system) , increase oral availability, increase solubility to allow administration by injection, alter metabolism and alter rate of excretion. In addition, the compounds may be altered to pro-drug form such that the desired compound is created in the body of the patient as the result of the action of metabolic or other biochemical processes on the pro-drug. Such pro-drug forms typically demonstrate little or no activity in m vi tro assays. Some examples of pro-drug forms include ketal, acetal, oxime, lmine, and hydrazone forms of compounds which contain ketone or aldehyde groups, especially where they occur m the R ₃ group of the compounds of this invention. Other examples of pro-drug forms include the hemi-ketal, hemi-acetal, acyloxy ketal, acyloxy acetal, ketal, and acetal forms that are described m EQ1 and EQ2.

ICE and TX Cleave and Thereby Activate Pro-IGIF

The ICE protease was identified previously rv virtue of its ability to process inactive pro-IL-lβ to mature active IL-lβ, a pro-inflammatory molecule, m vitro and n vivo . Here we show that ICE ano its close homologue TX (Caspase-4, C. Faucheu et al., EMBO, 14, p. 1914 (1995) ) can proteolytically cleave inactive pro-IGIF. This processmg step is required to convert pro-IGIF to its active mature form, IGIF. Cleavage of pro-IGIF by ICE, and presumably by TX, also fac____states the export of IGIF out of cells.

We first used transient co-expression of plasmids transfected mto Cos cells to determine whether any known members of the ICE/CED-3 protease family can process pro-IGIF to IGIF in cultured cells (Example 23) (Fig. 1A) .

Fig. 1A demonstrates that ICE cleaves pro-IGIF in Cos cells co-transfected with plasmids that express pro-IGIF in the presence of active ICE. Cos cells were transfected with an expression plasmid for pro-IGIF alone (lane 2) or m combination with the indicated expression plasmids encoding wild type or inactive mutants of ICE/CED-3 family of proteases (lanes 3-12) . Cell lysates were prepared and analyzed for the presence of IGIF protein by immunoblottmg with an anti-IGIF antiserum. Lane 1 contained lysates from mock transfected cells.

Co-expression of pro-IGIF with ICE or TX resulted in the cleavage of pro-IGIF into a polypeptide similar m size to the naturally-occurring 18-kDa mature IGIF. This processmg event is blocked by smgle point mutations that alter the catalytic cysteine residues and thus inactivate ICE and TX (Y. Gu et al., EMBO, 14, p. 1923 (1995) ) .

Co-expression with CPP32 (Caspase-3) , a protease involved in programmed cell death (T.

Fernandes-Alnemri et al . , J. B ol . Chem. , 269, p. 30761 (1994) ; D. W. Nicholson et al . , Nature, 376, p. 37 (19951), resulted in the cleavage of pro-IGIF mto a smaller polypeptide, while co-expression with CMH-1 (Caspase-7), a close homolog of CPP32 (J. A. Lippke et al., J . Biol. Chem.. 271, p. 1825 (1996) ) , failed to cleave pro-IGIF to any significant extent. Thus, ICE and TX appear to be capable of cleaving pro-IGIF into a

polypeptide similar size to the naturally-occurring 18-kDa IGIF.

We next examined the ability of these cysteine proteases to cleave pro-IGIF m vitro using a purified, recombinant (His) ₆ -tagged pro-IGIF as a substrate (Example 23) .

Fig. IB demonstrates that pro-IGIF is cleaved vitro by ICE. Purified recombinant (His) ^-tagged pro-IGIF (2 μg) was incubated with the indicated cysteine protease the presence or absence of ICE or CPP32 inhibitors as described in Example 23. The cleavage products were analyzed by SDS-PAGE and Coomassie Blue stam g.

ICE cleaved the 24 kDa pro-IGIF into two polypeptides of approximately 18-kDa and 6-kDa.

N-termmal ammo acid sequencing of the ICE cleavage products indicated that the 18-kDa polypeptide contains the same N-termmal am o acid residues (Asn-Phe-Gly-Arg-Leu) as the naturally occurring IGIF. This shows that ICE cleaves pro-IGIF at the autnentic processing site (Asp35-Asn36) (H. Okamura et al . , Infection and Immunity, 63, p. 3966 (1995) ; H. Okamura et al., Nature. 378, p. 88 (1995) ) . N-termmal ammo acid sequencing of the CPP32 cleavage products indicated that CPP32 cleaved pro-IGIF at Asp69-Ile70.

The cleavage by ICE of pro-IGIF is highly specific with a catalytic efficiency (^ _C a _t ^/K _M ^ °- - • ^{4 x} lcT M ^_1 s ^_1 ( = 0.6 ± 0.1 μM; k _{ca t} = c.. t ± 0.3 s ^_1 anc is inhibited by specific ICE inhibitors Αc-Tyr-Val-Ald-Asp-aldehyde) and Cbz-Val-Ala-Asp- 2 , ό-dichlorobenzoyl)oxy]methylketone, (N.A. Trornberry et al . , Nature, 356, p. 768 (1992) ; R. E. Dclle et al., J. Med. Chem.. 37, p. 563 (1994) .

Fig. IC demonstrates that ICE cleavage in vitro activates pro-IGIF. Uncleaved pro-IGIF, ICE- or CPP32-cleaved products of pro-IGIF, or recombinant mature IGIF (rIGIF) were each added to A.E7 cell cultures to a final concentration of 12 ng/ml or 120 ng/ml (see, Example 23) . Eighteen hours later, IFN-γ the cultural medium was quantified by ELISA. Whi Le the uncleaved pro-IGIF had no detectable IFN-γ inducing activity, ICE-cleaved pro-IGIF was active in inducing IFN-γ production m Thl cells.

Like ICE, the ICE homolog TX also cleaved pro-IGIF into similarly sized polypeptides . However, its catalytic efficiency was about two orders of magnitude lower than that shown for ICE. Consistent with the observations from the Cos cell experiments above, CPP32 cleaved pro-IGIF at a different site (Asp69-Ile70) and the resulting polypeptides had little IFN-γ inducing activity (Fig. IC) . CMH-1 and granzyme B each failed to cleave pro-IGIF to any significant extent.

Together, these results demonstrate that, both in Cos cells and vitro. ICE and TX are capable of processing the inactive pro-IGIF precursor at the authentic maturation site to generate a biologically active IGIF molecule.

Processing of Pro-IGIF bv ICE Facilitates Its Export

IGIF is produced by activated Kupffer cells and macrophages in vivo and is exported out of the cells upon stimulation by endotoxm (H. Okamura et a__., Infection and Immunity, 63, p. 3966 (1995) ; H. Okamura et al., Nature, 378, p. 88 (1995) . We used the Cos cell co-expression system (Example 23) to examine

whether the intracellular cleavage of pro-IGIF by ICE would facilitate the export of mature IGIF from the cell. Such is the case for pro-IL-lβ when it is cleaved by ICE mto active IL-lβ (N.A. Thornberry et al., Nature, 356, p. 768 (1992)) .

In Fig. 2A, Cos cells transfected with an expression plasmid for pro-IGIF alone (lanes 2 and 6) or m combination with an expression plasmid encoding wild type (lanes 3 and 7) or inactive mutant ICE (lanes

35 4 and 8) were metabolically labeled with S-methionme

(see, Example 24) . Cell lysates (left) and conditioned medium (right) were lmmunoprecipitated with an anti-IGIF antiserum. The lmmunoprecipitated proteins were analyzed by SDS-PAGE and fluorography (Fig. 2A) . An 18-kDa polypeptide corresponding in size to mature IGIF was detected in the conditioned medium of Cos cells co-expressmg pro-IGIF and ICE, while Cos cells co-expressmg pro-IGIF and an inactive ICE mutant (ICE-C285S), or pro-IGIF alone (-) exported only very low levels of pro-IGIF and no detectable mature IGIF. We estimate that about 10% of the mature IGIF was exported from co-transfected cells, while greater than 99% of pro-IGIF was retained within the cells.

We also measured the presence of IFN-γ inducing activity cell lysates and the conditioned medium of the above transfected ceils (see, Example 24) . IFN-γ inducing activity was detected both cell lysates and the conditioned medium of Cos cells co-expressmg pro-IGIF and ICE, but not in cells expressing either pro-IGIF or ICE alone (Fig. 2B, .

These results indicate that ICE cleavage of pro-IGIF facilitates the export of mature, active IGIF from cells .

Pro-IGIF is a Physiological Substrate of ICE In Vivo

To study the role of ICE in the proteolytic activation and export of IGIF under physiological conditions, we examined the processing of pro-IGIF and export of mature IGIF from lipopolysaccharide (LPS) -activated Kupffer cells harvested from Propiobacteriu acnes-elicited wild type and ICE deficient (ICE-/-) mice (Example 25) .

As shown Fig. 3A, Kupffer cells from ICE-/- mice are defective in the export of IGIF. Kupffer cell lysates of wild type and ICE-/- mice contained similar amounts of IGIF as determined by ELISA. IGIF, however, could be detected only in the conditioned medium of wild type but not of the ICE-/- cells. Thus, ICE-deficient (ICE-/-) mice synthesize pro-IGIF, but fail to export it as extracellular pro-or mature IGIF.

To determine whether ICE-deficient (ICE-/-) mice process intracellular pro-IGIF but fail to export IGIF, Kupffer cells from wild type and ICE-/- mice were metabolically labeled with "S-methionme and IGIF immunoprecipitat on experiments were performed on cell lysates and conditioned media as described Example 25. These experiments demonstrated that unprocessed pro-IGIF was present in both wild type and ICE-/-

Kupffer cells. However, the 18-kDa mature IGIF was present only the conditioned medium of wilo type ano not ICE-/- Kupffer cells (Fig. 3B) . This shows that active ICE is required m cells for the export of processed IGIF out of the cell.

In addition, conditioned medium from wild type but not from ICE-/- Kupffer cells contained IFN-γ inducing activity that was not attributed to the action

of IL-12 because it was insensitive to a neutralizing antι-IL-12 antibody. The absence of IGIF in the conditioned medium of ICE-/- Kupffer cells is consistent with the finding in Cos cells that the processing of pro-IGIF by ICE is required for the export of active IGIF.

Figs. 3C and 3D show that, vivo, ICE-/- mice have reduced serum levels of IGIF and IFN-γ, respectively. Wild type (ICE+/+) and ICE-/- mice (n=3) primed with heat- activated P. acnes were challenged with LPS (Example 26), and the levels of IGIF (Fig. 3C) and IFN-γ (Fig. 3D) m the sera of challenged mice were measured by ELISA three hours after LPS challenge (Example 25) . The sera of ICE-/- mice stimulated by

P. acnes and LPS contained reduced levels of IGIF (Fig. 3C) and no detectable IFN-γ inducing activity the presence of an antι-IL-12 antibody. The reduced serum levels of IGIF likely accounts for the significantly lower levels of IFN-γ in the sera of ICE-/- mice (Fig. 3D), because we have observed no significant difference in the production of IL-12 in ICE-/- mice under these conditions. Consistent with tnis interpretation is the finding that non-adherent splenocytes from wild type and ICE-/- mice produced similar amounts of IFN-γ when stimulated with recombinant active IGIF vitro. Thus the impaired croduction of IFN-γ is not due to any apparent defect m tne T cells of the ICE-/- mice. Taken together, these results estaolish a critical role for ICE in processing the IGIF precursor and in the export of active IGIF both m vitro and in

vi vo .

To examine in more detail the relationship between serum levels of IFN-γ and ICE activity vivo, a time course after challenge of wild type and ICE-deficient mice with LPS was performed (Example 26) (Fig. 4) .

Fig. 4 shows a time course increase of serum IFN-γ wild type mice, with sustained levels of ≥17 ng/ml occurring from 9-18 hrs after LPS challenge. As predicted by the experiments discussed above, serum IFN-γ levels were significantly lower in ICE-/- mice, with a maximum of 2 ng/ml achieved over the same time period, which is approximately 15% of the level observed in wild type mice (Fig. 4) . Animals were also observed for clinical signs of sepsis and body temperature was measured at 4-hour intervals in wild type and ICE-/- mice challenged with 30 mg/kg or 100 mg/kg LPS (ICE-/-only) . Results in Fig. 4 show that wild type mice experienced a significant decrease in body temperature (from 36°C to 26°C) within 12 hours of LPS challenge. Signs of clinical sepsis were evident and all animals expired within 24-28 hours.

In contrast, ICE-/- mice challenged with 30 mg/kg LPS experienced only a 3°-4°C decrease body temperature with minimal signs of distress and with no observed lethality. ICE-/- mice challenged with 100 mg/kg LPS experienced clinical symptoms, a decrease in body temperature, and mortality similar to wild type mice at the 30 mg/kg LPS dose.

The ICE Inhibitor Ac-YVAD-CHO is an Equipotent Inhibitor of IL-lβ and IFN-γ Production

Since the processing and secretion of biologically active IGIF is mediated by ICE, we compared the activity of a reversible ICE inhibitor

(Ac-YVAD-CHO) on IL-lβ and IFN-γ production in a peripheral blood mononuclear cell (PBMC) assay (Examples 27) . Results in Fig. 5 show a similar potency for the ability of the Ac-YVAD-CHO ICE inhibitor to decrease IL-lβ and IFN-γ production in human PBMCs, with an IC ₅₀ of 2.5 μM for each. Similar results were obtained in studies with wild type mouse splenccytes. These findings provide additional evidence that pro-IGIF is a physiological substrate for ICE and suggest that ICE inhibitors will be useful tools for controlling physiological levels of IGIF and IFN-γ.

In summary, we have found that ICE controls IGIF and IFN-γ levels in vivo and in vitro and that ICE inhibitors can decrease levels of IGIF and IFN-γ in human cells. These results have been described m co- pendmg United States Application Serial No. 08/712,878, the disclosure of which is herein incorporated by reference.

Compositions and Methods

The pharmaceutical compositions and metnods of this invention will be useful for controlling IL-1, IGIF and IFN-γ levels in vivo. The methods and compositions of this invention will tnus be useful for treating or reducing the advancement, severity of effects of IL-1, IGIF- and IFN-γ-mediated conditions.

The compounds of this invention are effective ligands for ICE. Accordingly, these compounds are capable of targeting and inhibiting events m IL-1-, apoptosis-, IGIF-, and IFN-γ-medιated diseases, and, thus, the ultimate activity of that protein m inflammatory diseases, autoimmune diseases, destructive bone, proliferative disorders, infectious diseases, and degenerative diseases. For example, the compounds of this invention inhibit the conversion of precursor IL- lβ to mature IL-lβ by inhibiting ICE. Because ICE is essential for the production of mature IL-1, inhibition of that enzyme effectively blocks initiation of IL-1- mediated physiological effects and symptoms, such as inflammation, by inhibiting the production of mature IL-1. Thus, by inhibiting IL-lβ precursor activity, the compounds of this invention effectively function as IL-1 inhibitors.

Similarly, compounds of this invention inhibit the conversion of precursor IGIF to mature IGIF. Thus, by inhibiting IGIF production, the compounds of this invention effectively function as inhibitors of IFN-γ production.

Accordingly, one embodiment of this invention provides a method for decreasing IGIF production in a subject comprising the step of administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of an ICE inhibitor and a pharmaceutically acceptable carrier.

Another embodiment of this invention provides a method for decreasing IFN-γ production in a subject comprising the step of administering to the subject a pharmaceutical composition comprising a therapeutically effective amount of an ICE inhibitor and a

pharmaceutically acceptable carrier.

In another embodiment, the methods of this invention comprise the step of administering to a subject a pharmaceutical composition comprising an inhibitor of an ICE-related protease that is capable of cleaving pro-IGIF to active IGIF, and a pharmaceutically acceptable carrier. One such ICE-related protease is TX, as described above. This mvention thus provides methods and pharmaceutical compositions for controlling IGIF and IFN-γ levels by administering a TX inhibitor.

Other ICE-related proteases capable of processing pro-IGIF into an active IGIF form may also be found. Thus it is envisioned that inhibitors of those enzymes may be identified by those of skill in the art and will also fall with the scope of this invention.

The compounds of this invention may be employed a conventional manner for the treatment of diseases which are mediated by IL-1, apoptosis, IGIF or

IFN-γ. Such methods of treatment, their oosage levels and requirements may be selected by those of ordinary skill in the art from available methods and techniques. For example, a compound of this invention may be combined with a pharmaceutically acceptable adjuvant for administration to a patient suffering from an

IL-1-, apoptosis-, IGIF- or IFN-γ-mediateo disease n a pharmaceutically acceptable manner and in an amount effective to lessen the severity of that disease. Alternatively, the compounds of this invention may be used in compositions and methods for treating or protecting individuals against IL-1-, apoptosis-, IGIF- or IFN-v-mediated diseases over

extended periods of time. The compounds may be employed in such compositions either alone or together with other compounds of this invention in a manner consistent with the conventional utilization of ICE inhibitors in pharmaceutical compositions. For example, a compound of this invention may be combmed with pharmaceutically acceptable adjuvants conventionally employed in vaccines and administered in prophylactically effective amounts to protect individuals over an extended period of time against IL-1-, apoptosis-, IGIF- or IFN-γ- mediated diseases. The compounds of this invention may also be co-administered with other ICE inhibitors to increase the effect of therapy or prophylaxis against various IL-1-, apoptosis, IGIF- or IFN-γ-mediated diseases.

In addition, the compounds of this mvention may be used m combination either conventional anti- mflammatory agents or with matrix metalloprotease inhibitors, lipoxygenase inhibitors and antagonists of cytokines other than IL-lβ.

The compounds of this invention can also be administered in combination with immunomodulators (e.g., bropirimine, anti-human alpha interferon antibody, IL-2, GM-CSF, methionme enkephal , interferon alpha, diethyldithiocarbamate, tumor necrosis factor, naltrexone and rEPO) or with prostagland s, to prevent or combat IL-1-medιated disease symptoms such as inflammation.

When the compounds of this invention are administered in combination therapies with other agents, they may be administered sequentially or concurrently to the patient. Alternatively, pharmaceutical or prophylactic compositions according

to this invention comprise a combination of an ICE inhibitor of this invention and another therapeutic or prophylactic agent.

Pharmaceutical compositions of this invention comprise any of the compounds of the present invention, and pharmaceutically acceptable salts thereof, with any pharmaceutically acceptable carrier, adjuvant or vehicle. Pharmaceutically acceptable carriers, adjuvants and vehicles that may be used the pharmaceutical compositions of this invention mclude, but are not limited to, ion exchangers, alumina, aluminum stearate, lecithin, self-emulsify g drug delivery systems (SEDDS) such as dα-tocopherol polyethyleneglycol 1000 succmate, or other similar polymeric delivery matrices, serum proteins, such as human serum albumin, buffer substances such as phosphates, glyc e, sorbic acid, potassium sorbate, partial glyceride mixtures of saturated vegetable fatty acids, water, salts or electrolytes, such as protamme sulfate, disodium hydrogen phosphate, potassium hydrogen phosphate, sodium chloride, z c salts, colloidal silica, magnesium trisilicate, polyvmyl pyrrolidone, cellulose-based substances, polyethylene glycol, sodium carboxymethylcellulose, polyacrylates, waxes, polyethylene-polyoxypropylene-block polymers, polyethylene glycol and wool fat. Cyclodextnns such as -, β- and γ-cyclodextrm, or chemically modified derivatives such as hydroxyalkylcyclodextnns, including 2-and 3-hydroxypropyl-β-cyclodextrmes, or other solubiliezed derivatives may also be advantageeously used to enhanve delivery of compounds of this invention.

The pharmaceutical compositions of th s invention may be administered orally, parenterally, oy

inhalation spray, topically, rectally, nasally, buccally, vagmally or via an implanted reservoir. We prefer oral administration. The pharmaceutical compositions of this invention may contain any conventional non-toxic pharmaceutically-acceptable carriers, adjuvants or vehicles. In some cases, the pH of the formulation may be adjusted with pharmaceutically acceptable acids, bases or buffers to enhance the stability of the formulated compounds or its delivery form. The term parenteral as used herein includes subcutaneous, mtracutaneous, intravenous, intramuscular, mtra-articular, mtrasynovial, trasternal, mtrathecal, tralesional ano mtracranial injection or infusion techniques. The pharmaceutical compositions may be in the form of a sterile injectable preparation, for example, as a sterile injectable aqueous or oleaginous suspension. This suspension may be formulated according to techniques known in the art using suitable dispersing or wetting agents (such as, for example, Tween 80) and suspending agents. The sterile injectable preparation may also be a sterile injectable solution or suspension in a non-toxic parenterally- acceptable diluent or solvent, for example, as a solution in 1, 3-butanedιol . Among the acceptable vehicles and solvents that may be employed are mannitol, water, Ringer's solution and isotonic sodium chloride solution. In addition, sterile, fixeo o__ls are conventionally employed as a solvent or suspending rredium. For this purpose, any bland fixed oil may be employed including synthetic mono- or diglycerioes . Fatty acids, such as oleic acid and its glyceride derivatives are useful in the preparation of mjectables, as are natural pharmaceutically-acceptah

oils, such as olive oil or castor oil, especially in their polyoxyethylated versions. These oil solutions or suspensions may also contain a long-chain alcohol diluent or dispersant such as Ph. Helv or a similar alcohol.

The pharmaceutical compositions of this invention may be orally administered in any orally acceptable dosage form including, but not limited to, capsules, tablets, and aqueous suspensions and solutions. In the case of tablets for oral use, carriers which are commonly used include lactose and corn starch. Lubricating agents, such as magnesium stearate, are also typically added. For oral administration in a capsule form, useful diluents mclude lactose and dried corn starch. When aqueous suspensions are administered orally, the active ingredient is combmed with emulsifying and suspending agents. If desired, certain sweetening and/or flavoring and/or coloring agents may be added. The pharmaceutical compositions of this invention may also be administered m the form of suppositories for rectal administration. These compositions can be prepared by mixing a compound of tnis mvention with a suitable non-irritating excipient which is solid at room temperature but liquid at the rectal temperature and therefore will melt in the rectum to release the active components . Such materials include, but are not limited to, cocoa butter, beeswax and polyethylene glycols. Topical administration of the pharmaceutica. compositions of thxs invention is especially useful when the desired treatment involves areas or organs readily accessible by topical application. For application topically to the skin, the pnarmace_t__ca_

composition should be formulated with a suitable ointment containing the active components suspended or dissolved in a carrier. Carriers for topical administration of the compounds of this invention include, but are not limited to, mineral oil, liquid petroleum, white petroleum, propylene glycol, polyoxy¬ ethylene polyoxypropylene compound, emulsifying wax and water. Alternatively, the pharmaceutical composition can be formulated with a suitable lotion or cream containing the active compound suspended or dissolved m a carrier. Suitable carriers include, but are not limited to, mineral oil, sorbitan monostearate, polysorbate 60, cetyl esters wax, cetearyl alcohol, 2-octyldodecanol, benzyl alcohol and water. Tne pharmaceutical compositions of this invention may also be topically applied to the lower intestinal tract by rectal suppository formulation or in a suitable enema formulation. Topically-administered transdermal patches are also included in this invention. The pharmaceutical compositions of this invention may be administered by nasal aerosol or inhalation. Such compositions are prepared according to techniques well-known the art of pharmaceutical formulation and may be prepared as solutions ir saline, employing benzyl alcohol or other suitable preservatives, absorption promoters to enhance oioavailability, fluorocarbons, and/or other solubili ing or dispersing agents known the art.

Dosage levels of between about 0.01 ar.c abou" 100 mg/kg body weight per day, preferably between about 1 and 50 mg/kg body weight per day of the active ingredient compound are useful m the preventicr and treatment of IL-1-, apoptosis, IGIF and IFN-γ-mediateα

diseases, including inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, degenerative diseases, necrotic diseases, osteoarthritis, acute pancreatitis, chronic pancreatitis, asthma, adult respiratory distress syndrome, glomeralonephritis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, insulin-dependent diabetes mellitus (Type I), autoimmune hemolytic anemia, autoimmune neutropema, thrombocytopenia, chronic active hepatitis, myasthenia gravis, inflammatory bowel disease, Crohn' s disease, psoriasis, graft vs. host disease, osteoporosis, multiple myeloma-related bone disorder, acute myelogenous leukemia, chronic myelogenous leukemia, metastatic melanoma, Kaposi's sarcoma, multiple myeloma sepsis, septic shock, Shigellosis, Alzheimer's disease, Parkinson's disease, cerebral ischemia, myocardial ischemia, spinal muscular atrophy, multiple sclerosis, AIDS-related encephalitis, HIV-related encephalitis, aging, alopecia, and neurological damage due to stroke. Typically, the pharmaceutical compositions of this invention will be administered from about 1 to 5 times per day or alternatively, as a continuous infusion. Such administration can be used as a chronic or acute therapy. The amount of active ingredient that may ce combined with the carrier materials to produce a s g e oosage form will vary depending upon the host treated and the particular mode of administration. A typical preparation will contain from about 5 to about 95 active compound (w/w) . Preferably, such preparations contain from about 20 ^c _o to about 80 active compound.

Upon improvement of a patient's condition, a

maintenance dose of a compound, composition or combination of this invention may be administered, if necessary. Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained when the symptoms have been alleviated to the desired level, treatment should cease. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence or disease symptoms.

As the skilled artisan will appreciate, lower or higher doses than those recited above may be required. Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, and the patient's disposition to the disease and the judgment of the treating physician.

The IL-1 mediated diseases which may be treated or prevented by the compounds of this invention mclude, but are not limited to, inflammatory diseases, autoimmune diseases, destructive bone disorders, proliferative disorders, infectious diseases, and degenerative diseases. The apoptosis-mediated diseases which may be treated or prevented by the compounds of this invention include degenerative diseases.

Inflammatory diseases which may be treated or prevented include, but are not limited to osteoarthritis, acute pancreatitis, chronic pancreatitis, asthma, and adult respiratory distress syndrome. Preferably the inflammatory disease is osteoarthritis or acute pancreatitis.

Autoimmune diseases which may be treated or prevented include, but are not limited to, glomeralonephritis, rheumatoid arthritis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, insulin- dependent diabetes mellitus (Type I) , autoimmune hemolytic anemia, autoimmune neutropenia, thrombocytopenia, chronic active hepatitis, myasthenia gravis, multiple sclerosis, inflammatory bowel disease, Crohn's disease, psoriasis, and graft vs. host disease. Preferably the autoimmune disease is rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, or psoriasis.

Destructive bone disorders which may be treated or prevented include, but are not limited to, osteoporosis and multiple myeloma-related bone disorder.

Proliferative diseases which may be treated or prevented include, but are not limited to, acute myelogenous leukemia, chronic myelogenous leukemia, metastatic melanoma, Kaposi's sarcoma, and multiple myeloma.

Infectious diseases which may be treated or prevented include, but are not limited to, sepsis, septic shock, and Shigellosis.

The IL-1-medιated degenerative or necrotic diseases which may be treated or prevented by the compounds of this invention include, but are net limited to, Alzheimer's disease, Parkinson's disease, cerebral ischemia, and myocardial ischemia.

Preferably, the degenerative disease is Alzheimer's disease .

The apoptosis-mediated degenerative diseases which may be treated or prevented by the compounds cf

this invention include, but are not limited to, Alzheimer's disease, Parkinson's disease, cerebral ischemia, myocardial ischemia, spinal muscular atrophy, multiple sclerosis, AIDS-related encephalitis, HIV- related encephalitis, aging, alopecia, and neurological damage due to stroke.

The methods of this invention may be used for treating, or reducing the advancement, severity or effects of an IGIF-or IFN-γ-mediated inflammatory, autoimmune, infectious, proliferative, destructive bone, necrotic, and degenerative conditions, including diseases, disorders or effects, wherem tne conditions are characterized by increased levels of IGIF or IFN-γ production. Examples of such inflammatory conditions mclude, but are not limited to, osteoarthritis, acute pancreatitis, chronic pancreatitis, asthma, rheumatoid arthritis, inflammatory bowel disease, Crohn's disease, ulcerative collitis, cerebral ischemia, myocardial ischemia and adult respiratory distress syndrome.

Preferably, the inflammatory condition __s rheumatoid arthritis, ulcerative collitis, Crohn's disease, hepatitis and adult respiratory distress syndrome . Examples of such infectious conditions include, but are not limited to, infectious hepatitis, sepsi septic shock and Shigellosis.

Examples of such autoimmune conditions include, but are not limited to, glomerulonephntis, systemic lupus erythematosus, scleroderma, chronic thyroiditis, Graves' disease, autoimmune gastritis, msulm-dependent diabetes mellitus (Type I), juvenile diabetes, autoimmune hemolytic anemia, autoimmune

neutropenia, thrombocytopema, myasthenia gravis, multiple sclerosis, psoriasis, lichenplanus, graft vs. host disease, acute dermatomyositis, eczema, primary cirrhosis, hepatitis, uveitis, Behcet's disease, acute dermatomyositis, atopic skin disease, pure red cell aplasia, aplastic anemia, amyotrophic lateral sclerosis and nephrotic syndrome.

Preferably the autoimmune condition is glomerulonephritis, insulin-dependent diabetes mellitus (Type I), juvenile diabetes, psoriasis, graft vs. host disease, including transplant rejection, and hepatitis.

Examples of such destructive bone disorders include, but are not limited to, osteoporosis and multiple myeloma-related bone disorder. Examples of such proliferative conditions include, but are not limited to, acute myelogenous leukemia, chronic myelogenous leukemia, metastatic melanoma, Kaposi's sarcoma, and multiple myeloma.

Examples of such neurodegenerative conditions include, but are not limited to, Alzheimer's disease, Parkinson's disease and Hunt gton's disease.

Although this invention focuses on the use of the compounds disclosed herein for preventing and treating IL-1, apoptosis, IGIF- and IFN-γ-mediated diseases, the compounds of this invention can also be used as inhibitory agents for other cysteine proteases.

The compounds of this invention are also useful as commercial reagents which effectively cmd tc ICE or other cysteine proteases. As commercial reagents, the compounds of this invention, and tneir derivatives, may be used to block proteolysis of _α target peptide in biochemical or cellular assays for ICE and ICE homologs or may be derivatize to bind to a

stable resin as a tethered substrate for affinity chromatography applications. These and other uses which characterize commercial cystine protease inhibitors will be evident to those of ordinary skill m the art .

Process of Preparing N-Acylammo Compounds

The ICE inhibitors of this invention may be synthesized using conventional techniques.

Advantageously, these compounds are conveniently synthesized from readily available starting materials.

The compounds of this invention are among the most readily synthesized ICE inhibitors known.

Previously described ICE inhibitors often contain four or more chiral centers and numerous peptide linkages. The relative ease with which the compounds of this invention can be synthesized represents an advantage the large scale production of these compounds.

For example, compounds of this invention may be prepared using the processes described herein. As can be appreciated by the skilled practitioner, these processes are not the only means by which the compounds described and claimed in this application may be synthesized. Further methods will be evident to those of ordinary skill in the art. Additionally, the various synthetic steps described herein may be performed in an alternate sequence or order to give the desired compounds.

This invention also provides a preferred method for preparing the compounds of tnis invention. Accordingly, in another embodiment (M) is provided a process for preparing an N-acylammo compound comprising the steps of: a) mixing a carboxylic acid with an N-

alloc-protected amino in the presence of an inert solvent, triphenylphoshine, a nucleophilic scavenger, and tetrakis-triphenyl phosphine palladium(O) at ambient temperature under an inert atmosphere; and b) adding to the step a) mixture, HOBT and

EDC; and optionally comprising the further step of: c) hydrolyzing the step b) mixture the presence of a solution comprising an acid and H20, wherein the step b) mixture is optionally concentrated, prior to hydrolyzing.

Preferably, the inert solvent is CH ₂ C1 ₂ / DMF, or a mixture of CH ₂ C1 ₂ and DMF.

Preferably, the nucleophilic scavenger is dimedone, morpholine, trimethylsilyl dimethylamine, or dimethyl barbituric acid. More preferably, the nucleophilic scavenger is trimethylsilyl dimethylamine or dimethyl barbituric acid.

Preferably, the solution comprises trifluoroacetic acid in about 1-90% by weight. More preferably, the solution comprises trifluoroacetic acid in about 20-50% by weight.

Alternatively, the solution comprises hydrochloric acid in about 0.1-30% by weight. More preferably, the solution comprises hydrochloric acid in about 0.1-30% by weight.

More preferably, m the abcve process, the inert solvent is CH ₂ Cl2, DMF, or a mixture of CH- _> Cln and DMF and the nucleophilic scavenger is dimedone, morpholine, trimethylsilyl dimethylamine, or dimethyl barbituric acid.

Most preferably, in the above process the inert solvent is CH ₂ C1 ₂ , DMF, or a mixture of CHiCli and DMF and the nucleophilic scavenger is trimethylsilyl dimethylamine or dimethyl barbituric acid.

Preferably, the N-acyclammo compound is represented by formula (VIII) :

R ₁ -N-R ₂

I

H

wherein:

Rl is as defined above in embodiment (A) ;

where R^^ is as defined above in embodiment (B) ;

Preferably, the N-alloc-protected amine is:

wherem R ₅₁ is as defined above

In preferred processes, the suostituents are as defined in embodiment (A) .

Alternatively, the N-acylammo compound is represented by formula (VIII), wherein R- _j _ is as def eα

above in embodiment (B) and R ₂ is as defined adove in embodiment (M) .

Preferably these alternative processes, the substituents are as defined above in embodiment (B) .

Alternatively, the N-acylammo compound is represented by formula (VIII), where R- _j _ is as defined above in embodiment (C) and R ₂ is as defined above in embodiment (M) . Preferably these alternative processes, the substituents are as defined above in embodiment (C) .

Alternatively, the N-acylammo compound is represented by formula (VIII), wherem R _} is as defined above m embodiment (D) and R ₂ is as defined above in embodiment (M) .

Preferably m these alternative processes, the substituents are as defined above in embodiment (D) . Alternatively, the N-acylammo compound is represented by formula (VIII), wherein R ₁ is as defined above embodiment (E) and R ₂ is as defined above in embodiment (M) .

Preferably m these alternative processes, the substituents are as oef ed above embodiment (E) .

Alternatively, the N-acylammo compound as represented by formula (VIII), wherein R _] _ is as defined aoove in embodiment (F) and R ₂ is cs def±ned above in embodiment (M) .

Preferably ιr these alternative processes, the substituents are as defined above m embodiment (F) .

Alternatively, the N-acylammo compound __s

represented by formula (VIII), wherem R-^ is as defined above in embodiment (G) and R ₂ is as defined above in embodiment (G) .

Preferably in these alternative processes, the substituents are as defined above in embodiment (G) .

Alternatively, the N-acylammo compound is represented by formula (VIII), wherem R^ is as defined above in embodiment (H) and R ₂ is as defined above embodiment (M) .

Preferably m these alternative processes, the substituents are as defined above in embodiment (H) .

Alternatively, the N-acylammo compound is represented by formula (VIII), wherem R is as defined above in embodiment (I) and R ₂ is as defined above in embodiment (M) .

Preferably m these alternative processes, the substituents are as defined above in embodiment (I) .

Alternatively, the N-acylammo compound is represented by formula (VIII) , where R ₁ is as defined above m embodiment (J) and R ₂ is as defined above in embodiment (M) . Preferably m these alternative processes, the substituents are as defined above embodiment (J) .

Alternatively, the N-acylam c compound is represented by formula (VIII), wherein R is as defined above in embodiment (K) and Ro is as defined above ir embodiment (M) .

Preferably these alternative processes, the substituents are as defined above in embodiment (K) .

Alternatively, the N-acylammo compound is represented by formula (VIII), wherein R _] _ is as defined above m embodiment (L) and R ₂ is as defined above in embodiment (M) . Preferably m these alternative processes, the substituents are as defined above embodiment (L) .

In order that this invention be more fully understood, the following examples are set forth. These examples are for the purpose of illustration only and are not to be construed as limiting the scope of the mvention in any way.

Example 1 Inhibition of ICE

We obtained inhibition constants (K..) and IC ₅₀ values for compounds of this invention using tne three methods described below:

1. Enzyme assay with UV-visible substrate

This assay is run using an Succmyl-Tyr-Val-

Ala-Asp-pNitroanilide substrate. Synthesis of analogous substrates is described by L. A. Reiter (Int. J. Peptide Protein Res. 13 _. , 87-96 (1994) , . The assay mixture contains:

65 μl buffer (lOmM Tris, 1 mM DTT, 0.1c CHAPS @pH 8.1) 10 μl ICE (50 nM final concentration to give a rate of ~lmOD/mιn) 5 μl DMSO/Inhibitor mixture

20 μl 400μM Substrate (80 μM final concentration) lOOμl total reaction volume

The visible ICE assay is run a 96-well microtiter plate. Buffer, ICE and DMSO (if inhibitor is present) are added to the wells the order listed. The components are left to mcubate at room temperature for 15 minutes starting at the time that all components are present in all wells. The microtiter plate reader is set to cubate at 37 °C. After the 15 minute incubation, substrate is added directly to the ^ells and the reaction is monitored by following the release of the chromophore (pNA) at 405 - 603 nm at 37 °c for 20 minutes. A lmear fit of the data is performed and tne rate is calculated m mOD/ m . DMSO is only present during experiments involving inhibitors, buffer is used to make up the volume to 100 μl m the other experiments .

2. Enzvme Assay with Fluorescent Substrate

This assay is run essentially according to Thornberry et al. (Nature 3_56: 768-774 (1992) ) , using substrate 12 referenced in that article. The substrate is: Acetyl-Tyr-Val-Ala-Asp-amino-4-methylcoumarm (AMC) . The following components are mixed:

65 μl buffer (lOmM Tris, ImM DTT, 0.1% CHAPS @pH8.1 )

10 μl ICE (2 - 10 nM final concentration)

5 μl DMSO/inhibitor solution 20 ul 150 μM Substrate (30 μM final) lOOμl total reaction volume

The assay is run in a 96 well microtiter plate. Buffer and ICE are added to the wells. The components are left to incubate at 37 °C for 15 minutes in a temperature-controlled wellplate. After the 15 minute incubation, the reaction is started by adding substrate directly to the wells and the reaction is monitored @37 °C for 30 minutes by following the release of the AMC fluorophore using an excitation wavelength for 380 nm and an emission wavelength of 460 nm. A linear fit of the data for each well is performed and a rate is determined fluorescence units per second.

For determination of enzyme inhibition constants (K^) or the mode of inhibition (competitive, uncompetitive or noncompetitive) , the rate data determined the enzyme assays at varying inhibitor concentrations are computer-fit to standard enzyme Kinetic equations (see I. H. Segel, Enzyme Kinetics. Wiley-Interscience, 1975) .

The determination of second crder rate constants for irreversible inhibitors was performed bv fitting the fluorescence vs time data to the progress equations of Morrison. Morrison, J.F., Mol . Ce. ] .

Biophys.. 2, pp. 347-368 (1985) . Thornberry et al . have published a description of these methods for measurement of rate constants of irreversible inhibitors of ICE. Thornberry, N.A., et al . Biochemistry. 33, pp. 3923-3940 (1994) . For compounds where no prior complex formation can be observed kinetically, the second order rate constants (k _ιnact ) are derived directly from the slope of the linear plots of k _obs vs. [I] . For compounds where prior complex formation to the enzyme can be detected, the hyperbolic plots of k _obs vs. [I] are fit to the equation for saturation kinetics to first generate K ₁ and k' . The second order rate constant k _inact is then given by ' Ki.

3. PBMC Cell assay

IL-lβ Assay with a Mixed Population of Human

Peripheral Blood Mononuclear Cells (PBMC) or Enriched Adherent Mononuclear Cells

Processing of pre-IL-lβ by ICE can be measured m cell culture using a variety of cell sources. Human PBMC obtamed from healthy donors provides a mixed population of lymphocyte subtypes and mononuclear cells that produce a spectrum of terleukins and cytokines in response to many classes of physiological stimulators. Adherent mononuclear cells from PBMC provides an enriched source of normal monocytes for selective studies of cytokine production by activated cells.

Experimental Procedure: An initial dilution series of test compound in DMSO or ethanol is prepared, with a subsequent dilution into RPMI-10" FBS media (containing 2 mM L-glutamme, 10 mM HEPES, 50 U and 50 ug/ml pen/strep)

respectively to yield drugs at 4x the final test concentration containing 0.4% DMSO or 0.4% ethanol. The final concentration of DMSO is 0.1% for all drug dilutions. A concentration titration which brackets the apparent K-_ for a test compound determined an ICE inhibition assay is generally used for the primary compound screen.

Generally 5-6 compound dilutions are tested and the cellular component of the assay is performed in duplicate, with duplicate ELISA determinations on each cell culture supernatant.

PBMC Isolation and IL-1 Assay: Buffy coat cells isolated from one pint human blood (yielding 40-45 ml final volume plasma plus cells) are diluted with media to 80 ml and LeukoPREP separation tubes (Becton Dickinson) are each overlaid with 10 ml of cell suspension. After 15 mm centrifugation at 1500-1800 xg, the plasma/media layer is aspirated and then the mononuclear cell layer is collected with a Pasteur pipette and transferred to a 15 ml conical centrifuge tube (Corning) . Media s added to bring the volume to 15 ml, gently mix the cells by inversion and centrifuge at 300 xg for 15 mm. Resuspend the PBMC pellet in a small volume of media, count cells and adjust to 6 x 10 cells/ml.

For the cellular assay, 1.0 ml cf the cell suspension is added to each well of a 24-well flat bottom tissue culture plate (Corning; , 0.5 m__ test compound dilution and 0.5 ml LPS solution (Sigma #L-3012; 20 ng/ml solution prepared in complete RPMI media; final LPS concentration 5 ng/ml) . The 0.5 ml additions of test compound and LPS are usually sufficient to mix the contents of the wells. Tnree control mixtures are run per experiment, w th either

LPS alone, solvent vehicle control, and/or additional media to adjust the final culture volume to 2.0 ml. The cell cultures are incubated for 16-18 hr at 37 °c the presence of 5% C0 ₂ . At the end of the incubation period, cells are harvested and transferred to 15 ml conical centrifuge tubes. After centrifugation for 10 mm at 200 xg, supernatants are harvested and transferred to 1.5 ml Eppendorf tubes. It may be noted that the cell pellet may be utilized for a biochemical evaluation cf pre-IL-lβ and/or mature IL-lβ content in cytosol extracts by western blotting or ELISA with pre-IL-lβ specific antisera.

Isolation of Adherent Mononuclear cells: PBMC are isolated and prepared as described above. Media (1.0 ml) is first added to wells followed by 0.5 ml of the PBMC suspension. After a one hour incubation, plates are gently shaken and nonadherent cells aspirated from each well. Wells are then gently washed three times with 1.0 ml of media and final resuspended m 1.0 ml media. The enricnment fcr

₅ adherent cells generally yields 2.5-3.0 x 10 cells per well. The addition of test compounds, LPS, cell incubation conditions and processing of supernatants proceeds as described above.

ELISA: We have used Quantik e kits (R&D Systems) for measurement of mature IL-lβ. Assays are performed according to the manufacturer's directions. Mature IL-lβ levels of about 1-3 ng/ml in both PBMC and adherent mononuclear cell positive controls are observed. ELISA assays are performed on 1:5, 1:10 and 1:20 dilutions of supernatants from LPS-positive

controls to select the optimal dilution for supernatants in the test panel.

The inhibitory potency of the compounds can be represented by an IC ₅₀ value, which is the concentration of inhibitor at which 50% of mature IL-lβ is detected m the supernatant as compared to the positive controls.

The skilled practitioner realizes that values obtamed in cell assays, such as those described herein, can depend on multiple factors, such as cell type, cell source, growth conditions and the like.

Example 2 Pharmacok etic Studies m the Mouse Peptidyl ICE inhibitors are cleared rapidly with clearance rates greater than 100 μ/mm/kg. Compounds with lower clearance rates have improved pharmacokmetic properties relative to peptidyl ICE inhibitors . We obtained the rate of clearance the mouse (μ/mm/kg) for several compounds of this invention using the method described below:

Sample Preparation and Dosing

Compounds were dissolved sterile TRIS solution (0.02M or 0.05M) at a concentration of 2.5mg/ml . Where necessary to ensure a complete solution, the sample was first dissolved in a mmimum or dimethyiacetamide (maximαm of 5 of total solutior volume) then diluted with t ^κ e TRIS solution. The drug solution was administered to CD-I mice (Charles River Laboratories - 26-31g) v__a the taι_.

vein at a dose volume of 10ml/kg giving a drug dose of 25mg/kg.

Mice were dosed in groups of 5 for each timepomt (generally from 2 minutes to 2 hours) then at the appropriate time the animals were anaesthetised with halothane and the blood collected mto individual heparinized tubes by jugular severance. The blood samples were cooled to 0 °C then the plasma separated and stored at -20 °C until assayed. Bioassay

Drug concentration in the plasma samples were determined by HPLC analysis with UV or MS (ESP) detection. Reverse phase chromatography was employed usmg a variety of bonded phases from Cl to C18 with eluents composed of aqueous buffer/acetonitπle mixtures run under isocratic conditions.

Quantitation was by external standard methods with calibration curves constructed by spiking plasma with drug solutions to give concentrations the range of 0.5 to 50μg/ml.

Prior to analysis the plasma samples were deprote ated by the addition of acetomtrile, methanol, tπchloroacetic acid or perchloric acid followed by centπfugation at 10,000g for 10 minutes. Sample volumes of 20μl to 50μl were injected for analysis .

Compound 21 e

Dosing and sampling

The drug was dissolved m sterile 0.02M Iris to give a 2.5mg/ml solution which was administered tc 11 groups of 5 male CD-I mice via the tail vein at a dose of 25mg/kg. At each of the following timepoints : 2, 5, 10, 15, 20, 30, 45, 60, 90 and 120 minutes a

group of animals was anaesthetised and the blood collected into heparinized tubes. After separation the plasma was stored at -20 °C until assayed.

Assay Aliquots of plasma (150μl) were treated with

5% perchloric acid (5μl) then mixed by vortexmg and allowed to stand for 90 minutes prior to centπfugation. The resulting supernatant was separated and 20μl was injected for HPLC analysis.

HPLC Conditions

Column 100 x 4.6mm Kromasil KR 100 5C4

Mobile Phase 0.1m Tris pH7.5 86% Acetonitrile 14%

Flowrate lml/mm Detection UV at 210nm

Retention Time 3.4 mins

The results of the analysis indicated a decrease m the mean plasma level of the drug from ~ 70μg/ml at 2 minutes to < 2μg/ml at 90 and 120 minutes.

Compound 217e

Dosing and sampling

The drug was dissolved sterile 0.02M Tris to give a 2.5mg/ml solution which was administered tc 11 groups of 5 male CD-I mice via the tail vein at a dose of 25mg/kg. At each of the following timepc ts: 2, 5, 10, 15, 2C, 30, 45, 60, 90 and 120 minutes a group of animals was anaesthetised and the blood collected mto heparinized tubes. After separation the plasma was stored at -20 °C until assayed.

Assay

Aliquots of plasma (lOOμl) were diluted with acetonitrile (lOOμl) then mixed by vortexmg for 20 seconds before centπfugation for 10 minutes. The resulting supernatant was separated and 20μl was injected for HPLC analysis.

HPLC Conditions

Column 150 x 4.6mm Zorbax SBC8

Mobile Phase 0.05M Phosphate 72% buffer ph7.1

Acetonitrile 28% Flowrate 1.4ml/mιn Detection UV at 210nm Retention Time 3.0 and 3.6 mins (diasteromers)

The results of the analysis indicated a decrease in mean plasma concentrations from ~ 55μg/ml at 2 minutes to < 0.2μg/ml at 60-120 minutes.

Example 3

Peptidyl ICE inhibitors are cleared rapidly with clearance rates greater than 80 ml/min/ g.

Compounds with lower clearance rates have improved pharmacokmetic properties relative to peptidyl ICE inhibitors .

We obtamed the rate of clearance m tne rat (ml/mm/kg) for several compounds of this ιnvent_on using the method described below:

In vi vo Rat Clearance Assay

Cannulations of the jugular and carotid vessels of rats under anesthesia were performed cne day prior to the pharmacokmetic study. M.J. Free, R.A.

Jaffee; 'Cannulation techniques for the collection blood and other bodily fluids'; in: Animal Models; p. 480-495; N.J. Alexander, Ed.; Academic Press;

(1978) . Drug (lOmg/mL) was administered via the jugular vein in a vehicle usually consisting of: propylene glycol/saline, containing lOOmM sodium bicarbonate in a 1:1 ratio. Animals were dosed with

10-20 mg drug/kg and blood samples were drawn at 0, 2,

5, 7, 10, 15, 20, 30, 60, and 90 minutes from an indwelling carotid catheter. The blood was centrifuged o to plasma and stored at -20 C until analysis. Pharmacokinetic analysis of data was performed by non¬ linear regression using standard software such as RStrip (MicroMath Software, UT) and/or Pcnonlin (SCI Software, NC) to obtain clearance values.

Analytical :

Rat plasma was extracted with an equal volume cf acetonitrile (containing 0.1% TFA) . Samples were then centrifuged at approximately 1,000 x g and the supernatant analyzed by gradient HPLC. A typical assay- procedure is described below.

200 μL of plasma was precipitated with 200 μL of 0.1% trifluoroacetic acid (TFA) in acetonitrile and 10 μL of a 50% aqueous zinc chloride solution, vortexed then centrifuged at -1000 x g and the supernatant collected and analyzed by HPLC.

HPLC procedure:

Cclumn: Zorbax SB-CN (4.6 x 15', mm) (5μ particle size) Cclumn temperature: 50 °C

Flow rate: 1.0 mL/min

Injection volume: 75 μL.

Mobile phase: A=0.1' TFA in water and 3=100- acetonitrile

Gradient employed: 100% A to 30% A in 15.5 mm

0% A at 16 min

100% A at 19.2 mm Wavelength: 214 nm A standard curve was run at 20, 10, 5, 2 and

1 μg/mL concentrations.

Example 4

Whole Blood Assay for IL-lβ Production

We obtained IC ₅₀ values for several compounds of this invention using the method described below:

Purpose:

The whole blood assay is a simple method for measuring the production of IL-lb (or other cytokines) and the activity of potential inhibitors. The complexity of this assay system, with its full complement of lymphoid and inflammatory cell types, spectrum of plasma proteins and red blood cells is an ideal m vitro representation of human in vivo physiologic conditions.

Materials:

Pyrogen-free syringes (~ 30 cc )

Pyrogen-free sterile vacuum tubes containing lyophilized Na ₂ EDTA (4.5 mg/10 ml tube)

Human whole blood sample (~ 30-50 cc) 1.5 ml eppendorf tubes

Test compound stock solutions '~ 25mM m DMSO or otner solvent)

Endotoxin-free sodium chloride solution (0.9 ^" ) and HBS

Lipopolysacchanoe (Sigma; Cat . # L-3012) stock solution at Img/ml in HBSS

IL-lβ ELISA Kit (R & D Systems; Cat # DLB50) TNF ELISA Kit (R & D Systems; Cat # DTA50) Water bath or incubator

Whole Blood Assay Experimental Procedure: Set incubator or water bath at 30 °C.

Aliquot 0.25ml of blood into 1.5 ml eppendorf tubes. Note: be sure to invert the whole blood sample tubes after every two aliquots. Differences in replicates may result if the cells sediment and are not uniformly suspended. Use of a positive displacement pipette will also minimize differences between replicate aliquots.

Prepare drug dilutions sterile pyrogen- free saline by serial dilution. A dilution series which brackets the apparent K _λ for a test compound determined in an ICE inhibition assay is generally used for the primary compound screen. For extremely hydrophobic compounds, we have prepared compound dilutions in fresh plasma obtamed from the same blood donor or m PBS-contain g 5% DMSO to enhance solubility.

Add 25 μl test compound dilution or vehicle control and gently mix the sample. Then add 5.0 μl LPS solution (250 ng/ml stocked prepared fresh: 5.0 ng/ml final concentration LPS), and mix again. Incubate tne tubes at 30 °C a water bath for 16-18 hr with occasional mixing. Alternatively, the tubes can be placed in a rotator set at 4 rpm for the same incubation period. This assay should be set up m duplicate or triplicate with the following controls: negative control- no LPS; positive control- no test inhibitor; vehicle control- the highest concentration of DMSO or compound solvent used m the experiment.

Additional saline is added to all control tubes to normalize volumes for both control and experimental whole blood test samples

After the incubation period, whole blood • samples are centrifuged for 10 minutes at - 2000 rpm m the microfuge, plasma is transferred to a fresh microfuge tube and centrifuged at 1000 x g to pellet residual platelets if necessary. Plasma samples may be stored frozen at -70 °C prior to assay for cytokine levels by ELISA.

ELISA:

We have used R & D Systems (614 McKinley Place N.E. Minneapolis, MN 55413) Quantikme kits for measurement of IL-lβ and TNF-α. The assays are performed according to the manufacturer's directions. We have observed IL-lβ levels of - 1-5 ng/ml positive controls among a range of individuals. A 1:200 dilution of plasma for all samples has been sufficient in our experiments for ELISA results to fall on the linear range of the ELISA standard curves. It may be necessary to optimize standard dilutions _f you observe differences in the whole blood assay. Nerad, J.L. et al . , J. Leukocyte Biol., 52, pp. 687-692 (1992) .

Example 5

Inhibition of ICE homologs

1. Isolation of ICE homologs

Expression of TX in insect cells using a baculovirus expression system. We have subcloned Tx cDNA 'Jauche et al . , supra 1995) mto a modified pVL1393 transfer

vector, co-transfected the resultant plasmid (pVL1393/TX) into insect cells with viral DNA and identified the recombinant baculovirus. After the generation of high titer recombinant virus stock, the medium was examined for TX activity using the visible ICE assay. Typically, infection of Spodoptera frugiperda (Sf9) insect cells at an MOI of 5 with recombinant virus stock resulted in a maximum expression after 48 hours of 4.7μg/ml . ICE was used as a standard in the assay.

Ammo terminal T7 tagged versions of ICE or TX were also expressed. Designed originally to assist the identification and purification of the recombinant proteins, the various constructs have also allowed examination of different levels of expression and of the relative levels of apoptosis experienced by the different homologs. Apoptosis m the infected S 9 cells (examined using a Trypan Blue exclusion assay) was increased in the lines expressing ICE or TX relative to cells infected with the viral DNA alone.

Expression and purification of N-termmally (Hιs) ₆ - tagged CPP32 in E. coll . A cDNA encoding a CPP32 (Fernandes-Alnemri et al, supra 1994) polypeptide starting at Ser (29) was PCR amplified with primers that add frame Xhol sites to both the 5' and 3' ends cf the cDNA and the resulting Xhol fragment ligated into a Xho I-cut pET-15b expression vector tc create an in frame fusion with (hιs) ₆ tag at the n-termmus of tne fusion protein. The predicted recombinant protein starts with the ammo acid sequence of

MGSSHHHHHHSSGLVPRGSHMLE, where LVPRGS represents a thrombm cleavage site, followed by CPP32 starting at

Ser (29) . E. coli BL21(DE3) carrying the plasmid were grown to log phase at 30 °C and were then induced with 0.8 mM IPTG. Cells were harvested two hours after IPTG addition. Lysates were prepared and soluble proteins were purified by Ni-agarose chromatography. All of the expressed CPP32 protein was the processed form. N- termmal sequencing analysis indicated that the processing occurred at the authentic site between Asp (175) and Ser (176) . Approximately 50 μg of CPP32 protein from 200 ml culture. As determined by active site t tration, the purified proteins were fully active. The protease preparation were also very active in vitro in cleaving PARP as well as the synthetic DEVD-AMC substrate (Nicholson et al, supra 1995) .

2. Inhibition of ICE homologs

The selectivity of a panel of reversible inhibitors for ICE homologs is depicted in Table 1. ICE enzyme assays were performed according to Wilson et al (supra 1994) using a YVAD-AMC substrate (Thornberry et al, supra 1992) . Assay of TX activity was performed using the

ICE substrate under identical conditions to ICE. Assay of CPP32 was performed usmg a DEVD-AMC substrate (Nicholson et al . , supra 1995) . In general, there is low selectivity between ICE and TX for a wide range of scaffolds. None of the synthetic ICE compounds tested are effective inhibitors of CPP32. Assay of the reversible compounds at the highest concentration (1 μM) revealed no inhibition.

Table 1

Compound K _x ICE (nM) K _± TX (nM) K CPP32 (nM)

7.0 ± 1.1 > 1000 55 ± 9 >1000 57 ± 13 > 1000 40 ± 7 > 1000

Second-order rate constants for inactivation of ICE and ICE homologs with selected irreversible inhibitors are presented below (Table 2) . The irreversible compounds studied are broad spectrum inhibitors of ICE and its homologs. Some selectivity, however, is observed with the irreversible compounds comparing inhibition of ICE and CPP32.

Table 2 Compound ^Λ ιnact (TX) _ιnact (ICE) (CPP32)

138 120,000 150, 000 550, 000

217d 475, 000 250, 000 150, 000

108a 100, 000 25, 000 nd

Example 6

Inhibition of apoptosis

Fas-Induced Apoptosis in U937 cells. Compounds were evaluated for their ability to block anti-Fas-mduced apopotosis. In a preliminary experiment using RT-PCR, we detected mRNA encoding ICE, TX, ICH-1, CPP32 and

CMH-1 in unstimulated U937 cells. We used this cel__ line for apoptosis studies. U937 cells were seeded in culture at 1 x 10 5 cells/ml and grown to ~5 x 106 cells/ml. For apoptosis experiments, 2 x 10 cells were plated in 24-well tissue culture plates 1 ml RPMI-1640-10% FBS and stimulated with 100 ng/ml anti- Fas antigen antibody (Medical and Biological Laboratories, Ltd.) . After a 24 hr incubation at 37 °C, the percentage of apoptotic cells was determined by FACS analysis using ApoTag reagents.

All compounds were tested initially at 20 μM and titrations were performed with active compounds to determine IC ₅₀ values. Inhibition of apoptosis (> 75% at 20 μM) was observed for 108a, 136, and 138. An IC ₅₀ of 0.8 μM was determined for 217e compared to no inhibition of anti-Fas-mduced apoptosis by 214e at 20 μM.

Example 7

In vi vo acute assay for efficacy as anti- flammatory aαent

LPS-Induced IL-lβ Production.

Efficacy of 214e and 217e was evaluated in CD1 mice (n=6 per condition) challenged with LPS (20 mg/kg IP) . The test compounds were prepared m olive oil : DMSO: ethanol (90:5:5) and administered oy I? injection one hour after LPS. Blood was collected seven hours after LPS challenge. Serum IL-lβ levels were measure by ELISA. Results in Fig. 6 show a dose dependent inhibition of IL-lβ secretion by 214e, with

19

- 33 1 - an ED ₅₀ of approximately 15 mg/kg. Similar results were obtamed in a second experiment. A significant inhibition of IL-lβ secretion was also observed in 2l7e treated mice (Fig. 7) . However, a clear dose response was not apparent .

Compounds 214e and 217e (50 mg/kg) were also administered by oral gavage to assess absorption. Results in Fig. 8 show that 214e, but not 217e when administered orally inhibited IL-lβ secretion, suggesting potential for oral efficacy of ICE inhibitors as anti-inflammatory agents.

The efficacy of analogs of 214e were also evaluated LPS challenged mice after IP administration (Fig. 9) and PO administration (Fig. 10) .

Table 3 % Inhibition of IL-β production by analogs of 214e in LPs-chellenged mice after PO and IP administration (50 mg/kg) .

Table 3

Table 4

Comparison of 214e Prodrugs for

Efficacy in LPS Challenged Mice:

Time Course Inhibition of IL-lβ Production

Time of Compound Administration (relative to time of LPS challenge, PO, 50 mg/kg

* Values obtamed in subsequent assays

Example 8

Measurement of blood levels of prodruσs of 214e.

Mice were administered a p.o. dose of compounds 302 and 304a (50 mg/kg) prepared in 0.5 % carboxymethylcellulose . Blood samples were collected at 1 and 7 hours after dosing. Serum was extracted by precipitation with an equal volume of acetonitrile containing 2 % formic acid followed by centrifugation. The supernatant was analyzed by liquid chromatography- mass spectrometry (ESI-MS) with a detection level of 0.03 to 3 μg/ml . Compounds 302 and 304a showed detectable blood levels when administered orally, 214e itself shows no blood levels above 0.10 μg/mL when administered orally. Compounds 302 and 304a are prodrugs of 214e and are metabolized to 214e in vivo (see Fig. 11) .

Example 9

We obtained the following data (see Tables 5 and 6) for compounds of this invention using the methods described in Examples 1-8. The structures of the compounds of Example 9 are shown in Example 10-17.

Table 5

! _rτ -_ ^■ C _nn e.ll Whole „. _Cle _t arance i UV- PBM,C„ h, uman Cl.M,earance ouse Rat, i.v.

Compound Visible avg. blood _τ

Ki (nM) IC50 IC50 1. v. ' ml/mm/kg (nM) (nM) ml/m /kσ

47b 27 1800 <600 47a 2600 5100 ³⁸

_79_ 135a 90 2800 5000 >100

489 2250 ^~ 15000 1700*

490 4.3 980 700

1000* 1900*

491 5 _25_00_ 493 25 1200 800 850*

609a >30000

609b 27 >20000

619 300

620_ 35 1000 19000

621_ ^η r 1300 >20000

622 rr 1300 >20000

623 _9_

624 300

619

339

Table 6

136 5.4x10 ^" 870 2800 93

* Values obtained upon reassay.

Example 10

Compound 139 was synthesized by a method similar to the method used to synthesize 47a.

Compounds 136 and 138 were synthesized by a method similar to the method used to synthesize 57b.

Compounds 135a, 135b, and 137 were synthesized by a method similar to the method used to synthesize 69a.

Compounds 813e, 814c, 814e, 817c, 817d, 817e, 820b, 823b, 823e, 826e, 827e, 830e, 832e, 835e, 838e, 846, 857, 865, 902, 904a, 907a, 907b, 1004-1013, 1015-

1045, 1046-1068, 1070-1091, and 1093-1099 were synthesized by methods similar to those used to synthesize compound 264 and the corresponding compounds in Examples 10 and 11. Compounds 47a, 47b, 108a, 108b, 125b, 213e,

214c, 217c, 217d, 217e, 220b, 223b, 223e, 226e, 227e, 230e, 232e, 235e, 238e, 246, 257, 264, 265, 280-287, 302, 304a, 307a, and 307b were synthesized as described below.

H. N- (N-Acetyl-tyrosmyl-valmvl-pipecolyl ) -3-ammo- 4-oxobutanoic acid. Step A. N- (N-tert-Butoxycarbonylpioecolyl) -4- amino-5-benzyloxy-2-oxotetrahvdrofuran.

Reaction of N-tert-butoxycarbonylpipecolic acid (460 mg, 2.0 mmol) and N-allyloxycarbonyl-4-ammo- 5-benzyloxy-2-oxotetrahydrofuran (530 mg, 1.82 mmol) was carried out by a method analogous to that reported by Chapman (Bioorg. & Med. Chem. Lett. 2, pp. 613-618, (1992) ) to give 654 mg of the title compound.

¹ H NMR (500 MHz, CDC1 ₃ (existing as rotamers)) δ 7.35 (m, 5H) , 6.88 (br. s, IH) , 4.9- 4.45(m, 4H) , 3.95+ (br. m, 2H) , 3.06 (m, IH) , 2.9 (m, IH) , 2.7 (br. m, IH) , 2.45 (m, IH) , 2.2 (m, IK) , 1.7- 1.5 (m, 3H) , 1.45 (two s, 9H) .

Step B. N-Pιpecolyl-4-amino-5-benzyioxy-2- oxotetrahydrofuran. N- (N-tert-Butoxycarbonylpιpecolyl) -4-ammo-5- benzyloxy-2-oxo-tetrahydrofuran (654 mg) was dissolved in 15 ml of 25" ₀ trifluoroacetic acid dichloromethane

and stirred at room temperature. The mixture was concentrated to give a gummy residue. The residue was dissolved in dichloromethane and washed with 10? sodium bicarbonate. The organic layer was dried over 5 anhydrous sodium sulfate, filtered, and concentrated to give 422 mg of the title compound as a beige solid.

¹ H NMR (500 MHz, CDC1 ₃ ) δ 7.38 ( , 5H) , 7.15 (d, IH), 5.55 (d, IH) , 4.95-4.8 (m, IH) , 4.78 (m, IH) , 4.65 (d, IH) , 4.45 (m, IH) , 3.2 (m, 0.5H), 3.05 (m, 0 0.5H), 2.95 (m, 0.5H) , 2.85 (m, 0.5H), 2.65 (m, IH) , 2.55-2.38(m, IH) , 1.95 (m, IH) , 1.8 (m, IH) , 1.6 (m, 2H) , 1.38 (m, 2H) .

Step C . N- (N-Acetyl- tyros inyl-val myl- pipecolyl) -4-amino-5-benzyloxy-2-oxo- 5 tetrahydrofuran.

N-Acetyl-tyrosinyl-valme (464 mg, 1.44 mmol) and N-Pipecolyl-4-ammo-5-benzyloxy-2- oxotetrahydrofuran (412 mg, 1.3 mmol) were dissolved in 5 ml each of dimethylformamide and dichloromethane and 0 cooled to 0°C. To the cooled solution was added 1-hydroxybenzotriazole (HOBT; 210 mg, 1.56 mmol) followed by the addition of 1- (3-dιmethylamιnopropyl) - 3-ethyl carbodiimide hydrochloride (EDC; 326 mg, 1.7 mmol, . After stirring for 18 hours, the mixture was ϋ diluted with ethyl acetate and washed with water, 10 sodium hydrogen sulfate, 10 ^" sodium bicarbonate, and water. The organic layer was concentrated to give a crude solid that was purified by flash chromatography (SiO) eluting with 94:6:1

(dichloromethane: isopropanol :pyπdine) to give 370 mg of the title compound.

^" " ^" H NMR (500 MHz, CD ₃ OD (existing as diastereomers as well as rotamers)) δ 7.35 (m, 5H) , 7.05 (m, 2H) , 6.68 (m, 2H) , 5.65 & 5.25 ( , IH) , 4.9- 3.95 (m, 8H) , 3.4-2.6 (m, 4H) , 2.5-2.1 (m, IH) , 1.98 i s , IH), 1.9 (s, IH), 1.85 (s, IH) , 1.8-1.6 <m, 2H), 1.55-1.3 (m, 4H) , 0.95-0.85 (m, 6H) .

Step D. N- .N-Acety.l-tvrosmvl-valmyI- pipecolyl) -3-amιno-4-oxobutanoιc acid.

To a solution of 100 mg of N- (N-Acetyl- tyrosinyl-valinyl-pipecolyl) -4-amιno-5-benzyloxy-2- oxotetrahydrofuran in 10 ml of methanol was added 60 mg of Pd(OH> ₂ on carbon and the mixture placed under an atmosphere of hydrogen via a balloon. The mixture was filtered through Celite and concentrated providing a white solid. This crude solid was dissolved in 2 ml of methanol and triturated with diethyl ether affording 26 mg of the title compound. ¹ H NMR (500 MHz, CD ₃ OD (existing as diastereomers as well as rotamers) ) δ 7.1 (m, 2H) , 6.7 (m, 2H), 5.2 (br. m, IH) , 4.8-3.6 (m, 6H) , 3.2-2.5 (m, 4H) , 2.5-2.1 (m, IH) , 1.95 (three s, 3H) , 1.9-1.3 (m, 6H) , 1.1-0.7 (m, 6H) .

K. N- ,N-Acetyl-tyrosinyl-valinyl- (4- benzyloxy)proliny11 -3-amino-4-oxobutanoic acid. Step A. N- (N-Allyloxycarbonyl-4- benzyloxyprolinyl) -3-amino-4-oxobu anoic acid tert-butyl ester semicarbazone.

The title compound was prepared by the reaction of N-allyloxycarbonyl-4-benzyloxyproline and 3-amino-4-oxobutanoic acid tert-butyl ester semicarbazone (T.L. Graybill et. al . , Abstracts of papers, 206th National Meeting of the American Chemical Society, Abstract MEDI-235. Chicago, IL. (1993) ) under similar peptide coupling conditions as reported above (compound H; Step C) .

¹ H NMR (500 MHz, CDC1 ₃ ) δ 9.05 (br. s, IH) , 7.85 (br. m, IH) , 7.4-7.2 (m, 5H) , 7.15 (br. s, IH) , 6.55 (br. s, IH) , 5.9 (m, IH) , 5.1-4.9 (br. m, 2H), 4.65-4.4 (m, 4H) , 4.2 (br. m, IH) , 3.75-3.5 (m, 2H) , 2.75-2.55 (m, 2H) , 2.5 (br. m, IH) , 2.25 (br. m, IH; 1.4 (s, 9H) .

Step B. N- (N-Acetyl-tyrosinyl-valmyl- (4- benzyloxyprolinyl) ) -3-amino-4oxobutanoιc acid tert-butyl ester semicarbazone.

The title compound was prepared by reaction of N-acetyl-tyrosinyl-valine and N- (N-allyloxycarbonyl - 4-benzyloxyproIinyl) -3-ammo-4-oxobutancιc acid :eπ- butyi ester semicarbazone by reaction conditions reported for compound H, step A.

^Η NMR (500MHz, CD ₃ OD) δ 7.35- ^' ' . 2 ( , 6H, , 7.C (d, 2H) , 6.65(d, 2H), 4.85 (m, IH) , 4.6-4.45 (m, 4H1 , 4.3 (br. m, IH), 4.15 (m, IH), 3.7 (m, IH) , 2.95 ( ,

IH) , 2.75-2.6 (m, 3H) , 2.35 (m, IH) , 2.1 (m, IK) , 1.9 (s, 3H) , 1.4 (s, 9H) , 0.95 (d, 3H) , 0.90 (s, 3H) .

Step C. N- (N-Acetyl-tyrosmyl-valmyl- (4- benzyloxyprol yl) ) -3-amιno-4oxobutanoιc ac d.

N- (N-Acetyl-tyrosmyl-valmyl- (4- benzyloxyprolmyl) ) -3-ammo-4-oxobutanoιc acid tert- butyl ester semicarbazone (270 mg) was dissolved into 10 ml of 25% trifluoroacetic acid in dichloromethane and stirred at room temperature for 3 hours. The mixture was concentrated to give a solid residue. The residue was dissolved into a 10 ml mixture of methanol : acetic acid: 37% formaldehyde (3:1:1) and stirred at room temperature for 1 hour. The mixture was concentrated and the resulting residue purified by flash chromatography (Sι0 ) eluting with αichloromethane/methanol/formic acid (100:5:0.5) to give 37 mg of the title compound.

¹ H NMR (500 MHz, CD ₃ OD (existing as a 1:1 mixture of diastereomers of the hemiacetal) ) δ ^.4-7.25 (m, 5H), 7.0 (d, 2H), 6.65 (d, 2H) , 4.65-4.05 (m, 7H), 3.75-3.4 (m, 2H) , 3.05-2.3 (m, 5H) , 2.2-1.95 (m, 2H) , 1.90 (s, 3H) , 1.0 (d, 3H), 0.95 (d, 3H) .

44 4

46 47

(a) X = O (b) X = H ₂

(1S,9S) t-Butyl 6,10-dioxo-octahydro-9- (3- phenylpropionylamino) -6H-pyridazino[1 ,2-a] [1,2]diazepine-1-carboxylate (44a) . To a solution of (IS, 9 ) t-butyl 9-amino-6, 10-dioxo-octahydro-6H- pyridazino [1, 2-a] [1, 2]dιazepine-1-carboxylate '690mg; 2.32mmol; GB 2128984) in dioxane (16ml) and water (4ml) at 0°C was added solid sodium bicarbonate (292mg; 3.48mmol) followed by dropwise addition of 3- phenylpropionyl chloride (470mg; 2.78mmol) . The mixture was stirred at room temperature for 2h then more sodium bicarbonate (200mg; 2.38mmol; and 3- pnenylpropionyl chloride (lOOmg; G.6mmoij were added. Tne mixture was stirred for a further 2h at room temperature, diluted with ethyl acetate (50ml) , washed with saturated sodium bicarbonate (2 x 25ml) then dried .MgSO^) and concentrated. The residue was purified bv flash chromatography (0-50-s ethyl acetate/chlorcform!

and finally crystallized by trituration with ether to afford 860mg (86%) of a white solid: mp . 137-138°C; [α] _D ²³ -95.1° (c 0.549, CH ₂ C1 ₂ ) ; IR (KBr) 3327, 1736, 1677, 1664, 1536, 1422, 1156; ¹ H NMR (CDC1 ₃ ) δ 7.24 (5H, m) , 6.50 (IH, d, J=7.5) , 5.24 (IH, m) , 4.90 (IH, m) , 4.60 (IH, m) , 3.44 (IH, m) , 2.93 (2H, m) , 2.84 (IH, m) , 2.64 (IH, m) , 2.54 (2H, m) , 2.26 (2H, ) , 1.70 (4H, ) , 1.70 (9H, s) . MS(FAB, m/z) : 430 (M ⁺ + 1), 374, 242, 105, 91.

(1S,9S) t-Butyl octahydro-10-oxo-9- (3- phenylpropionylamino) -6H-pyridazino- [1 ,2-a] [1 ,2]diazepine-l-carboxylate (44b), was prepared from (15, 9S) t-butyl 9-amιno-octahydro-l0-oxo-6H- pyridazino [ 1, 2-a] [ 1, 2] dιazepine-1-carboxylate (Attwood et al., J. Chem. Soc. Perkin 1. pp. 1011-19 (1986) ) as for 44a, to afford 810mg (81%) of a colorless oil: [ ] _D ²³ - 33.5° (c 0.545, CH ₂ C1 ₂ ) . IR (film) 3334, 2935, 1737, 1728, 1659, 1642; ¹ H NMR (CDC1 ₃ ) δ 7.24 (5H, m) , 6.75 (IH, d, J=6.7) , 5.27 (IH, m) , 4.92 (IH, m) , 3.39 (IH, m) , 3.03 (4H, m) , 2.55 (3H, m) , 2.33 (IH, m) , 2.17 (IH, m) , 1.80 (5H, m) , 1.47 (9H, s) , 1.39 (IH, m) . MS(F_AB, m/z) : 416 (M ⁺ + 1) , 360, 211, 143, 9 ^~ > .

( 1S , 9S) 6, 10-Dioxo-octahydro-9- (3- phenylpropionylamino) -6H-pyridazιno[1 ,2-a] [1 ,2]diazepine-l-carboxylιc acid (45a) . To a solution of (IS, 95) t-butyl 6, 10-dιoxo-octahydro-9- ( 3- phenylpropionylam o)-6H-pyrιdazιno[l,2-a] [ 1 , 2 ] dιazepιne-1-carboxylate (44a) (800mg; i.863mmol) m dry dichloromethane (5ml) at 0°C was added trifluoroacetic acid (5ml) . The solution was stirred at room temperature fcr 3h then concentrated. Dry

ether (10ml) was added to the residue then removed under vacuum. This process was repeated three times to afford a crystalline solid. The solid was triturated with ether and filtered to afford 590mg (85%) of a white crystalline solid: mp. 196-197.5°C; [α] _D ²³ -129.5° (c 0.2, CH ₃ OH) ; IR (KBr) 3237, 1729, 1688, 1660, 1633, 1574, 1432, 1285, 1205; ¹ H NMR (CD ₃ OD) δ 8.28 (IH, d, J=7.4) , 7.22 (5H, m) , 5.32 (IH, dd, J=5.9, 2.9) , 4.75 (IH, m) , 4.51 (IH, m) , 3.50 (IH, m) , 3.01 (IH, ) , 2.91 (2H, m) , 2.55 (2H, m) , 2.29 (3H, m) , 1.95 (2H, m), 1.71 (2H, m) . Anal. Calcd for C ₁₉ H2 ₃ N ₃ 0 ₅ : C, 61.12; H, 6.21; N, 11.25. Found: C, 60.80; H, 6.28; N, 10.97. MS (FAB, m/z) 374 (M ⁺ + 1), 242, 105, 91.

(IS,9S) Octahydro-10-oxo-9- (3-phenylpropionylamιno) -6H- pyridazino[1,2-a] - [1,2]diazepine-1-carboxylic acid

(45b), was prepared from (IS, 9S) t-butyl octahydro-10- oxo-9- (3-phenylpropionylamino) -6H- pyridazino [ 1, 2-a] [1, 2] diazepine-1-carboxylate (44b) by the method described for compound 45a to afford 657mg (96%) of 45b as a crystalline solid: mp. 198-202°C;

[α] _D ²³ -86.2° (c 0.5, CH ₃ 0H) ; IR (KBr) 3294, 2939, 1729, 1645, 1620, 1574, 1453, 1214; ^X H NMR (CD ₃ 0D) δ .92 (IH, d, J=7.9), 7.20 (5H, m) , 5.29 (IH, m) , 4.9C (IH, ir.) , 3.47 (IH, m) , 3.08 (2H, m) , 2.90 (2H, m) , 2.55 (3H, m) , 2.36 (IH, m) , 1.81 (5H, ) , 1.43 (2H, m) . M£(FAB, m/z) 360 (M ⁺ +1) , 211, 143, 91.

[3S, 2i?, S, (1S, 9S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran- 3-yl ) -6 , 10-dιoxo-octahydro-9- (3-phenylpropιonylarnιno) - 6H-pyridazino [ 1 , 2-a ] [ 1 , 2 ] diazepine-l -carboxamιde (46a) . To a solut ion o f ( I S, 9S) 6 , 10-dioxo-octahydro- 9- ' 3 - phenyl-propionyl ammo ) - 6H-pyrida z mo [ l , 2 - a ]

[ 1, 2] dιazepme-1-carboxylιc acid (45a) (662mg; 1.773πtmol) in dry dichloromethane (9ml) and dry dimethyl formamide (3ml) at room temperature was added bis (tnphenylphosphme)palladium chloride (30mg) and (3S, 2 R, S) -3-allyloxycarbonylammo-2-benzyloxy-5- oxotetrahydrofuran (Chapman, Bioorα. Med. Chem. Lett., 2, pp. 613-18 (1992) ) (568mg; 1.95 mol) followed by dropwise addition of tri-n-butyltin hydride (1.19g; 4.09mmol) . 1-Hydroxy-benzotriazole (479mg; 3.546mmol) was added to the mixture and the mixture was cooled to 0°C before addition of 1- (3-dιmethylammopropyl) -3- ethylcarbodnmide hydrochloride (408mg; 2.128mmol) . The mixture was stirred at room temperature for 3.25h then diluted with ethyl acetate (50ml), washed twice with dilute hydrochloric acid (20ml), twice with saturated sodium bicarbonate (20ml), once with brine then dried (MgS0 ₄ ) and concentrated. The resulting oil was purified by flash chromatography (0-100% ethyl acetate/chloroform) to afford 810mg (81%) of 46a as a mixture of anomers: p. 92-94°C; IR (KBr) 3311, 1791, 1659, 1651, 1536; ¹ H NMR(CDC1 ₃ ) δ 7.49, 6.56 (IH, 2d, J=6.7, 7.8), 7.29 (10H, m) , 6.37, 6.18 (IH, 2d, J=7.7,7.6) , 5.56, 5.34 (IH, d, s, J=5.2) , 5.08-4.47 (6H), 3.18-2.80 (5H) , 2.62-2.28 (5H) , 2.04-1.53 (5H) . MS(FAB, m/z), 563 (M ⁺ + 1) , 328, 149, 91.

[3S,2 ,S, (1S,9S) ] N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -octahydro-10-oxo-9- (3- phenylpropionylamino) -6H-pyrιdazιno[1 ,2-a]

[1 ,2]dιazepιne-1-carboxamιde (46b), was prepared from 45b by the method described for 46a to yield 790mg

(96') of a glass: m.p. 58-60°C; IR (KBr) 3316, 2940, 1 93, 1678, 1641, 1523, 1453, 1120; ¹ H NMR (CDC1 _3. ^δ

7.21 ;10H, m) 6.52, 6.42 (IH, 2d, J=7.2, .53,

5.44 (IH, d, s, J=5.2) , 5.35 (IH, m) , 4.6-4.9, 4.34 (4H, m) , 3.1-2.8 (6H, m) , 2.6-2.1 (7H) , 1.95-1.05 (5H)

MS(FAB, m/z), 549 (M + 1), 400, 310, 279, 91.

[3S(1S,9S)] 3-(6,10-Dioxo-octahydro-9-(3- phenylpropionylamino) -6H-pyridazino[1 ,2-a] [1 ,2]diazepine-l-carboxamido) -4-oxobutanoic acid (47a) .

A mixture of [35, 2.R.S, (IS, 9S) ] N- (2-benzyloxy-5- oxotetrahydrofuran-3-yl) -6, 10-dioxo-octahydro-9- (3- phe ylpropionylamino) -6H-pyridazino [1 , 2-a]

[1, 2 ] diazepine-1-carboxamide (46a) (205mg; 0.364mmol) , 10% palladium on carbon (200mg) and methanol (20ml) was stirred under hydrogen at atmospheric pressure for 5h. The mixture was filtered then concentrated to yield 154mg (90%) of a glass: mp. 116-118°C; [α] _D ²³ -140° (c 0.1, CH ₃ OH) ; IR (KBr) 3323 (br) , 1783, 1731, 1658, 1539, 1455, 1425; ¹ H NMR (CD ₃ OD) δ 7.21 (5H, m) , 5.17 (IH, m) , 4.73 (IH, ) , 4.50 (2H, m) , 4.23 (IH, m) , 3.38 (IH, m) , 3.06 (IH, m) , 2.91 (2H, m) , 2.73-2.18 (6H, ) and 2.01-1.59 (5H, m) . Anal. Calcd for C ₂₃ H ₂₇ N ₄ 0 ₇ + H _? 0 : C, 56.32; H, 6.16; N, 11.42. Found: C, 56.29; H, 6.11; N, 11.25. MS (FAB, m/z) 473 (M ⁺ + 1) , 176, 149, 105, 91.

[3S(1S,9S) ]3- (Octahydro-10-oxo-9- (3- phenylpropionylamino) -6H-pyridazino- [1 ,2-a]

[1 ,2]diazepine-l-carboxamido) -4-oxobutanoic acid (47b), was prepared from 46b by the method described fcr 47a. The residue was purified by flash chromatography (0-10 methanol/chloroform) to afford 65mg (52 ^' 1 of a glass; m.p. 87-90°C; [α] _D ²³ -167.0° (c 0.1, methanol) ; IR (KBr) 3329, 2936, 1786, 1727, 1637; ^X H NMR (CD ₃ OD) δ

7.23 (5H, m) , 5.29 (IH, m) , 4.83 (IH, m) , 4.59 (IH, cl, J=3.6), 4.29 (IH, m) , 3.3-3.0 (3H, m) , 2.91 (2H, m) , 2.70-2.34 (5H, m) , 2.19 (2H, m) , 1.75 (4H, m) , 1.36 (2H, m) . Anal. Calcd for C ₂₃ H ₃₀ N ₄ O ₆ + 0.5H ₂ O: C, 59. ^' 09; H, 6.68; N, 11.98. Found: C, 58.97; 6.68; N, 11.73. MS(FAB, m/z) 459 (M ⁺ + 1) , 310, 149, 105, 91.

55 56

Rl R ₂ R3

(a) Ph-CH 12 ₂ - ^-

(b) -CH -Ph H

t-Butyl N-2- (3-benzyloxycarbonylamιno-l ,2-dιhydro-2- oxo-1- pyridyl)acetyl-3-a ιno-5- (2 , 6-dichloro- benzoyloxy) -4-oxo-pentanoate (56a) . The acetic acid

(55a) (WO 93 21213) in THF (2ml) was stirred at room temperature and treated with 1-hydroxybenzotrιazole

(60mg, 0.448mmol) and dιmethylammopropyl-3- ethylcarbodnmide hydrochloride (47mg, 0.24όmmol . After 5 mms water (2 drops) was added and stirring continued tor 20 minutes. Bis (triphenylphosphme) palladium II chloride (6mg) was added followed by a solution of t-butyl 3- (allyloxycarbonylammo) -4-cxo-5-

(2, 6-dιchlorobenzoyl-oxy) pentanoate (WO 93 16710:

(103mg, 0.224mmol) in THF (1ml) . Tπbutyltm hydride

(0.09ml, 0.336mmol) was added dropwise over 1 hour at room temperature. The mixture was stirred for a further 3 hours and poured onto ethyl acetate, washed with IM HCl, aqueous NaHC0 ₃ , brine, dried over MgS0 ₄ and concentrated in vacuo . The residue was triturated with pentane and the supernatant discarded. The remaining solid was purified by flash chromatography (50% ethyl acetate/hexane) to afford the title compound

92mg (63%) as a colorless oil: _α] _D -29.6° (c 1.1, CH ₂ C1 ₂ ) ; IR (film) 3377, 3365, 3332, 3312, 1733, 1691, 1650, 1599, 1515, 1366, 1261, 1153, 1068, 747; ^~ H NMR (CDC1 ₃ ) δ 8.09 (IH, d, J = 6.8), 7.84 (IH, s), ^" ? .58 (IH, d, J = 8.3) , 7.33 (8H, m) , 7.02 (IH, dd, J = 6.9, 1.7), 6.33 (IH, t, J = 7.2), 5.20 (2H, s), 5.12 (2H, ) , 4.89 (IH, dt), 4.65 (2H, m) , 2.80 (2H, m) , 1.38 (9H, s) .

t-Butyl N-2-(6-benzyl-l,2-dιhydro-2-oxo-3-(3- phenylpropionyl)amino-1-pyridyl)acetyl-3-ammo-5- (2, 6- dichlorobenzyloxy) -4-oxo-pentanoate (56b), was prepared by the method described for (56a) which affordeα the title compound (66%) as a colorless oil: IR (film) 3364, 3313, 1738, 1688, 1648, 1600, 1566, 1514, 1433, 1369, 1254, 1152; ¹ H NMR (CDC1 ₃ ) δ 8.40 (IH, d, J 7.6) , 8.30 (IH, s), 7.28 (13H, m) , 6.20 (IH, d, J = 7.6, , 5.12 (2H, q) , 4.86 (IH, m) , 4.65 (2H, qi , 4.06 (2H, s , 3.07-2.61 (6H, m) , 1.39 (9H, s) .

56 57

R ¹ R ² RT

N-2 (3-Benzyloxycarbonylamino-l ,2-dihydro-2-oxo-l- pyridyl)acetyl-3-amino-5- (2 , 6-dichlorobenzoyloxy) -4- oxo-pentanoic acid (57a; Q_) . The ester 56a (210mg, 0.356mmol) in dichloromethane (0.5ml) was cooled to 0°C and treated with trifluoroacetic acid (0.5ml) , stirred and warmed to 20°C over 30 minutes. The solution was evaporated to dryness under reduced pressure, redissolved in dichloromethane and concentrated ix3) . The residue was triturated with ethyl acetate and diluted with ether to afford the title compound 162mg

(85%) as a colorless solid: m.p. 165-8°C

23 (decomposition) ; [ ] _D 38.8° (c 0.1, CH ₃ OH) ; IP (KBr)

3332, 3275, 1723, 1658, 1649, 1597, 1581, 1562, 1526, 1432, 1385, 1258, 1218, 1206; ^ NMR (d _e -DMSO) δ 8.96

(IH, d, J = 7.3) , 8.34 (IH, s) , 7.85 (IH, dd, = 7.j _; , 7.58 (3H, m) , 7.35 (5H, m) , 6.29 (IH, t, J = 7.3: , 5.26

(2H, ) , 5.15 (2H, s) , 4.69 (3H, m) , 2.75 (2H, rr.: . Anal. Calcd. C ₂₇ H ₂₃ N ₃ 0 ₉ C1 ₂ : C, 53.66; H, 3.84; , 6.95. Found: C, 53.36; H, 3.90; N, 6.81. M.S. (+ FAB, ; 604

(M ⁺ + 1) , 285, 241, 195, 173, 149, 91.

N-2- (6-Benzyl-1,2-dιhydro-2-oxo-3- (3-phenylpropιonyl) ammo-1-pyridyl)acetyl-3-amιno-5- (2, 6-dιchloro- benzoyloxy) -4-oxo-pentanoic acid (57b; P) , was prepared by the method described for 57a which afforded the title compound (78%) as colorless crystals: m.p. 116- 120°C (decomposition); [α] _D ²⁶ -41.1° (c 0.1, CH ₃ OH) ; IR (KBr) 3299, 1739, 1715, 1689, 1666, 1645, 1598, 1563, 1518, 1432, 1209, 1151; ¹ H NMR (d ₆ -DMSO) δ 9.24 (IH, s) , 8.88 (IH, d, J = 7.6), 8.18 (IH, d, J = 7.7), 7.60 (3H, m) , 7.26 (10H, m) , 6.06 (IH, d, J = 7.7), 5.23 (2K, ABq) , 4.69 (3H, m) , 3.93 (2H, s), 2.78 (6H, m) . Anal. Calcd. for C ₃ 5H ₃₁ N ₃ θ ₈ Cl2. H ₂ 0: C, 59.16; H, 4.66; N, 5.91. Found: C, 59.38; H, 4.53; N, 5.84. M.S. (+ FAB); 694, (Cl=35, 37) , (M ⁺ + 1) ; 692 (Cl=35, 35) , (M ⁺ + 1) .

(a) R ¹ = OCH ₃ , R ² = H

(b) R ¹ = H, R ² = OCH3

7-Methoxybenzoxazole (65a) . A mixture of 2-nιtro-6- methoxyphenol (2.62g, 15.5mmoI) (EP 333176) and 10 ^' Palladium on carbon (130mg) in ethanol (50.0ml; was stirred under an atmosphere of H-? for 75mm. The

mixture was filtered through Celite® then immeαiately treated with p-toluenesulphonic acid (32.0mg) and triethylorthoformate (6.45ml, 38.8mmol) then heated under reflux under an atmosphere of N ₂ . After 20h p- toluenesulphonic acid (30.0mg) and triethylorthoformate (6.45ml, 38.8mmol) were added. After a total of 44h heating, the reaction was allowed to cool and reduced m vacuo . The resulting residue was purified by flash chromatography (25:75 ethyl acetate/hexane) to give 1.97g (85%) of the title compound as a yellow solid: m.p. 28-31°C; IR (film) 1629, 1497, 1434, 1285, 1097; ¹ H NMR (CDC1 ₃ ) δ 8.09 (IH, s), 7.40 (IH, d, J = 8.0) , 7.28 (IH, t, J = 8.0), 6.89 (IH, ά, J = 8.0), 4.02 (3H, s) ; ¹³ C NMR (CDCI ₃ ) δ 152.84, 145.82, 142.50, 139.99, 125.75, 113.42, 108.80, 56.97. Anal. Calcd. for

C ₈ H ₇ N ₁ 0 ₂ . 0.1H ₂ O: C, 63.65; H, 4.81; N, 9.29. Found: C, 63.43, H, 4.88, N, 9.05. M.S. (+ FAB); 150 (M ⁺ + 1) .

4-Methoxybenzoxazole (65b) . To a suspension of 4- hydroxybenzoxazole (2.00g, 14.8mmol) (Musser et al . , J _^ _ Med. Chem.. 30, pp. 62-67 (1987) ) acetone (80.0ml) was added dried K C0 ₃ (2.25g, 16.3mn.ol) followed by lodomethane (1.38ml, 22.2mmol) . The reaction was heated under reflux under N ₂ for 4.5h, then filtered and reduced m vacuo to afford the crude product. The resulting residue was purified by flash chromatography (25:75 ethyl acetate/hexane) to give 2.0g (91-) cf tne title compound as a white crystalline solid: m.p. 2 - 74°C; IR (KBr) 3089, 1619, 1610, 1503, 1496, 1322, 1275, 1090, 1071, 780, 741; ^X H NMR (CDCl^ δ 8.02 (IH, s), 7.32 (IH, t, = 8.0) , 7.18 (IH, d, J- 8.0, , 6.8. (IH, d, J = 8.0) , 4.04 (3H, s> . Anal. Calcd. for

C ₈ H ₇ N0 ₂ : C, 64.42; H, 4.73; N, 9.39. Found: 64.40 _; H, 4.84; N, 9.31; m/z (El) 149 (M ⁺ + 1, 100%)

(3S, 4K,S) t-Butyl N- (allyloxycarbonyl) -3-amιno-4- hydroxy-4- (2- (7-methoxybenzoxazolyl) )butanoate (66a) . To a stirred solution of 7-methoxybenzoxazole 65a

(548.6mg, 3.68mmol) in anhydrous THF (18.5ml) at -78°C under N ₂ was added 1.56M n-butyl lithium in hexanes (2.47ml, 3.86mmol) dropwise, to produce a yellow colored solution. After stirring at -78°C for 20 mm, dry MgBr ₂ OEt ₂ (1.045g, 4.05mmol) was added as a solid. The resulting heterogeneous mixture was warmed to -45°C and stirred for 15mm. The reaction mixture was then recooled to -78 ^C C and a solution of (S) -Alloc-Asp ( t- Bu)H (946. mg, 3.68mmol) m THF (18.5ml) was added dropwise. The reaction was stirred at -78 ^C C for 30mm, warmed to 0°C and stirred for lh. The resulting homogeneous reaction was warmed to room temperature and stirred for 16h. The reaction was quenched with 5% sodium bicarbonate (3.5ml) then THF was removed m va c u o . The resulting aqueous residue was extracted with methylene chloride (x6) . The combmed extracts were washed with brine, dried (MgS0 ₄ ) , filtered and reduced m va c uo to give 1.8g of crude product. Flash chromatography (40:60 ethyl acetate/hexane) gave 1.21g (81%) of the title compound, an oil, as a mixture of diastereoisomers at C-4: IR (CH ₂ C1 ₂ ) 3425, 2983, 172! , 15C4, 1290, 1157, 1101; ¹ U NMR (CDC1 ₃ ) δ ⁷ .35-7.19 (2} m) , 6.39-6.81 (IH, m) , 6.00-5.57 (2H, m) , 5.32-5.05 (3H, in* , 4.68-4.35 (3H, ) , 4.01 (3H, s) , 2.86-2.59 (2H, m' , 1.45 (9H, s) , 1.41 (9H, s) ; ¹³ C NMR (CCCl ₃ ) δ 171.18, 171.09, 165.80, 165.30, 156.71, 156.6C, 145.6b, 142.7o, 142.71, 140.82, 140.72, 133.23, 125.81, 125.12 ,

118.41, 118.21, 113.07, 112.87, 108.95, 82.16, 70.28, 69.98, 66.52, 66.39, 57.03, 52.57, 52.29, 37.83, 36.86, 28.65. Anal. Calcd. for C ₂₀ H ₂₆ N ₂ O ₇ . 0.6H ₂ O: C, 57.57; H, 6.57; N, 6.72. Found: C, 57.49, H, 6.34, N, 6.60. M.S. (+ FAB) ; 407 (M ⁺ + 1) ; 351, 307, 154.

(3S, 41?, S) t-Butyl N- (allyloxycarbonyl) -3-amιno-4- hydroxy-4- (2-(4-methoxybenzoxazolyl) )butanoate (66b) , was prepared according to the method described for 66a which afforded 1.29g (26%, 68% based on recovered starting material) of the title compound as an oil and as a mixture of diastereoisomers at C- : IR (CH ₂ C1 ₂ ) 3400, 1725, 1625, 1505, 1369, 1354, 1281, 1263, 1226, 1158, 1092, 1048; ¹ H NMR (CDC1 ₃ ) δ 7.34-7.24 (IH, m) , 7.16 (IH, d, J = 8.2), 6.79 (IH, d, J = 7.9) , 6.00-5.50 (2H, m) , 5.30-5.05 (3H, m) , 4.70-4.35 (4H, m) , 4.02 (3H, s), 2.90-2.45 (2H, m) , 1.45-1.41 (9H, 2 x s) . Anal. Calcd. for C ₂₀ H ₂₆ N ₂ O ₇ . 0.4H ₂ O: C, 58.07; H, 6.53; N, 6.77. Found: C, 58.09; H, 6.41; N, 6.63. M.S. (+ FAB) ; 407 (M ⁺ + 1, 88%) ; 351 (100) .

(3S, 4R,S) t-Butyl N- (N-acetyl- (S) - (O-tert-butyl- tyrosinyl) - (S) -valinyl- (S) -alaninyl) -3-amino-4-hydroxy- 4- (2- (7-methoxybenzoxazolyl) )butanoate (67a) . To a stirred solution of the benzoxazole 66a (481.9mg, 1.19mmol) and Ac-Tyr ( ^t Bu) -Val-Ala-OH (586.3mg, 1.30mmol) in methylene chloride (3.5ml) and DMF 3.5ml was added bis (triphenylphosphme) palladium (II) cnloπde (18.0mg), followed by tributyltinhydride (0.80ml, 2.96mmoi) dropwise. Hydroxybenzotriazoie (320.4mg, 2.37mmol) was added and the mixture cooled to 0°C. l-Ethyl-3- [3- (dimethylamino ⁾ propyl] carbodiimide hyαrochioride (278.2mg, 1.42mmol) was added and the

mixture was allowed to warm to room temperature and stirred for 16.5h. The reaction was diluted with ethyl acetate and washed twice with IM sodium hydrogensulphate, twice with saturated sodium bicarbonate, water, and brine. The organic layer was dried (MgS0 ₄ ), filtered and reduced in vacuo to yield 2.0g of crude product. Flash chromatography (95:5 methylene chloride/methanol) gave 844. Omg (94%) of the title compound as a white solid: m.p. 205°C; IR (KBr) 3399, 3304, 2977, 1729, 1643, 1506, 1367, 1290, 1161; ¹ H NMR (d ₆ -DMS0) δ 8.24-7.78 (4H, m) , 7.43-7.32 (2H, m) , 7.23 (2H, d, J = 8.5), 7.16-7.07 (IH, m) , 6.93 (2H, d, J = 8.5) , 6.52, 6.40 (IH, 2 x d, J = 5.5, J= 5.0) , 5.03, 4.78-4.49, 4.45-4.16 (5H, brt, 2 x m) , 4.05, 4.04 (3H, 2 x s), 3.08-2.35 (14H, m) , 2.11-1.89 (IH, m) ,

1.83 (3H, s ) , 1.49-1.32, 1.15, 1.0-0.81 (27H, s, 2 x m, = 7.0) ; ¹³ C NMR (d ₆ -DMS0) δ 175.55, 175.18, 173.88, 173.75, 173.05, 169.23, 157.28, 148.55, 146.16, 143.21, 136.63, 133.55, 128.87, 127.17, 115.78, 111.92, 84.02, 81.50, 71.40, 61.15, 60.05, 57.79, 53.39, 51.62, 43.76, 40.52, 34.58, 32.52, 31.60, 26.35, 23.11, 22.71, 21.76. Anal. Calcd. for C ₃₉ H ₅₅ N ₅ O ₁₀ . 0.5H ₂ O: C, 61.40; H, 7.40; N, 9.18. Found: C, 61.43; H, 7.31; N, 9.07. M.S. (+ FAB); 754 (M ⁺ + 1) ; 698, 338, 267.

(3S, 4R,S) t-Butyl N- (N-acetyl- (S) - (O-tert-butyl- tyrosmyl) - (S) -valinyl- (S) -alaninyl) -3-amιno-4-hydroxy- 4- (2- (4-methoxybenzoxazolyl) )butanoate (67b), was prepared accordmg to the method described for 67a which afforded 1.05g (94-) of the title compound as a fine white powder: m.p. 210-213°C (dec) ; IR (KBr)

3284, 2977, 1736, 1691, 1632, 1536, 1505, 1452, 1392, 1367, 1258, 1236, 1161, 1091; ^X H NMR (d ₅ ~DMSO) δ 8.20-

7.75 (4H, m) , 7.40-7.10 (4H, m) , 7.00-6.80 (3H, m) , 6.45, 6.34 (IH, 2 x d, J = 5.3, J = 5.0), 5.00-4.10 (5H, m) , 4.00, 3.99 (3H, 2 x s), 3.00-2.25 (4H, m) , 1.95 (IH, ) , 1.78 (3H, s), 1.39-0.80 (27H, m) . Anal. Calcd. for C ₃ H ₅₅ N ₅ O ₁₀ . 0.5H ₂ O: C, 61.40; H, 7.40; N, 9.18. Found: C, 61.58; H, 7.38; N, 8.91. M.S. (+ FAB) ; 754 (M ⁺ + 1, 30%); 72 (100) .

(3S) t-Butyl N- (N-acetyl- (S) - (O-tert-butyl-tyrosinyl) - ( S) -valinyl- (S) -alaninyl) -3-amino-4- (2- (7- methoxybenzoxazolyl) ) -4-oxobutanoate (68a) . The Dess- Martin reagent (1.082g, 2.55mmol) (Ireland et al . , J. Orσ. Chem., 58, p. 2899 (1993) ; Dess et al., J. Orα. Chem. , 48, pp. 4155-4156 (1983) ) was added to a stirred suspension of the alcohol 67a (641. Omg, 0.85mmol) in methylene chloride (46.0ml) . The resulting mixture was stirred for lh before being partitioned between saturated sodium thiosulphate: saturated sodium bicarbonate (1:1, 86.0ml) and ethyl acetate (86.0ml) . The resultant organic phase was washed m turn with saturated sodium thiosulphate: saturated sodium bicarbonate (1:1), saturated sodium bicarbonate, and brine. The organic phase was dried (MgS0 ₄ ), filtered and reduced in vacuo to give 660. Omg of crude product. Flash chromatography (94:6 methylene chloride/methanol) gave 636. Omg (100%) of the title compound as a wnite solid: m.p. 209°C; [ ] _D ²⁴ -21.8° (c 0.16, methanol) ; IR (KBr) 3395, 3294, 2977, 1722, 1641, 1535, 1505, 1161; ¹ H NMR (CDC1 ₃ ) δ 8.43-8.16 (IH, m) , 7.97-7.62 (2H, m) , 7.49-7.14 (3H, ) , 7.08-6.95 (3H, m) , 6.89-6.73 ;2H, m) , 5.81-5.68 (IH, m) , 5.16-4.86 (2H, it.) , 4.53 ,1H, brt), 4.03 (3H, s), 3.16-2.84 (4H, m) , 2.11-1.84 (4H, m) , 1.46-1.14 (21H, m) , 0.92-0.78 (6H, m) ; ¹³ C NMR

(CDCI3) δ 186.28, 173.39, 171.90, 171.19, 171.03, 169.89, 156.43, 154.75, 146.32, 142.88, 140.98, 132.31, 130.54, 126.98, 124.73, 114.95, 111.42, 82.44, 78.71, 58.92, 57.20, 54.91, 53.47, 48.77, 39.43, 38.15, 32. ^_ '9, 29.44, 28.60, 23.55, 20.27, 19.70, 19.34. M.S. (+ FAB) ; 752 (M ⁺ + 1) ; 696, 336, 265.

(3S) t-Butyl N- (N-acetyl- (S) - (O) -tert-butyl-tyrosmyl) - (S) -valinyl- (S) -alaninyl) -3-amιno-4- (2- (4- methoxybenzoxazolyl) ) -4-oxobutanoate (68b), was prepared accordmg to the method described for the ketone 68a which afforded 420mg (55%) of the title compound as a white solid: m.p. 211-213°C (dec) ; [α] _D -23.9° (c 0.82, methanol) ; IR (KBr) 3277, 3075, 1723, 1690, 1632, 1530, 1506, 1392, 1366, 1269, 1234, 1160, 1094; ¹ H NMR (CDC1 ₃ ) δ 8.15 (IH, brs), 7.7 (2H, brs),

7.46 (IH, t, J = 8.3), 7.24 (2H, d, J = 8.3), 7.10 (IH, brs), 7.03 (2H, d, J = 8.3), 6.83 (3H, m) , 5.74 (IH, q, J = 6.9), 5.00 (2H, m) , 4.51 (IH, t, J = 7.0), 4.07 (3H, s), 3.20-2.95 (4H, m) , 2.00 (4H, m) , 1.42 (3H, d, J = 6.8), 1.35 (9H, s) , 1.23 (9H, s), 0.86 (6H, α, J = 6.7) . M.S. (+ FAB) ; 752 (M ⁺ + 1, 71) ; 72 (100) .

(3S) N- (N-Acetyl- (S) -tyrosmyl- (S) -valinyl- (S) - alaninyl) -3-amιno-4- (2- (7-methoxybenzoxazolyl) ) -4- oxobutanoate (69a; B) • A solution cf the ester 68a (600. Omg, O.δOmmol) in a 1:1 mixture of metnylene chloride and trifluoroacetic acid (65.0ml) was stirred for lh under a dry atmosphere of N . The solution was then reduced m vacuo, taken up ether and reα ceα again. This process was repeated six times to afford the crude product as an off white solid. Flash chromatography (gradient 95:5 to 80:20 methylene

cnloride/ ethanol) gave 420.8mg (83 ^% ) of tne title compound as a hygroscopic white solid. The product existed as a mixture of three isomers in CD ₃ OD, consisting of the keto form (c 50%), and its acycloxy keto form (two isomers at C-4, c 50%) : m.p. decomposes above 150°C; [α] _D ² -33.2° (c 0.17, methanol) ; IR (KBr) 3300, 1715, 1658, 1650, 1531, 1517, 1204; ^λ E NMR (CD ₃ OD) δ 7.46-7.19 (2H, m) , 7.16-6.91 (3H, m) , 6.70- 6.59 (2H, m) , 5.62-5.49 (IH, m) , 5.00-4.72 (IH, odscurred m) , 4.69-4.51 (IH, m) , 4.49-4.08 (2H, m) , 4.05-3.89 (3H, m) , 3.16-2.47 (4H, m) , 2.05-1.78 (4H, ) , 1.41-1.11, 1.05-0.70 (9H, 2 x m) . Anal . Calcd. for C ₃₁ H ₃₇ N ₅ O ₁₀ . 3H ₂ 0: C, 53.67; H, 6.25; N, 10.10. Found: C, 53.76; H, 5.56; N, 10.28. M.S. (+ F7ΛB) ; 640 (M ^* + 1) ; 435, 147.

(3S) t-Butyl N- (N-acetyl- (S) -tyrosmyl- ( S) -valinyl- (S) - alaninyl) -3-amιno-4- (2- (4-methoxybenzoxazolyl) ) -4- oxobutanoate (69b; S) , was prepared according to the method described for the acid 69a which afforded the hygroscopic title compound 252mg (96%) . The product existed as a mixture of three isomers in CD ₃ OD, consisting of the keto form, and its acycloxy ketal fcrm (two isomers at C-4) . The product existed as a single isomer in d-6 DMSO: m.p. 200-203°C (dec) ; [α. _D ²⁴ -38.0° (c 0.23, methanol) ; IR (KBr) 3289, 296b, 1 ^~ 18, 1713, 1658, 1634, 1548, 1517, 1506, 1461, 1453, 1393, 1369, 1268, 1228, 1174, 1092; ^L H NMR (d ₆ -DMSO) δ 9.20 (IH, brs), 8.71 (IH, d, J = 6.2;, 8.10 (2H, m) , 7.83 (IH, d, J = 8.7), 7.61 (IH, t, J = 8.2) , 7.46 (IH, α, J = 8.2), 7.08 (3H, m) , 6.65 (2H, d, = 8.3 , 5.53 (IH, q, J = 6.5) , 4.50 (IH, m) , 4.37 (IH, m) , 4.20 (IH, , 4.05 (3H, s), 3.09-2.77 (4H, m) , 1.94 (IH, m , 1.1q

(3H, s) , 1.23 (3H, d, J = 7.0), 0.82 (6H, m) . Anal. Calcd. for C ₃₁ H3 ₇ N ₅ O ₁₀ . 1.5H ₂ 0: C, 55.85; H, 6.05; N, 10.51. Found: C, 55.21; H, 5.69; N, 10.13. M.S.

+ FAB ) 64 0 (M + 1 , 22 ^ 1 07 ( 1 00 )

99 58

3 (S) - (Allyloxycarbonyl) -amιno-4- [ (2, 6-dιchloro- phenyl) -oxazol-2-yl] -4 (i?,S) -hydroxy-butyπc acid tert- butyl ester (99) . A solution of 5- (2, 6- Dichlorophenyl) oxazole (2.71g, 12.7mmol; prepared by a similar method described in Tet . Lett. 23, p. 2369 (1972) ) in tetrahydrofuran (65mL) was cooled to -78 °C under a nitrogen atmosphere. To this solution was added n-butyl lithium (1.5M solution m hexanes, 8.5mL, 13.3mmol) and stirred at -78 °C for 30mm. Magnesium bromide etherate (3.6g, 13.9mmol) was added and the solution was allowed to warm to -45 °C for 15mm. The reaction was cooled to -78 °C and aldehyde 58 (3.26g, 12.7mmol; Graybill et al . , Int. J. Protein Res., 44, pp. 173-182 (1993) ) tetrahydrofuran (65mL) was added dropwise. The reaction was stirred for 25mm., then allowed to warm to -40 °C and stirred for 3h, and then at room temperature for lh. The reaction was quenched with 5έ NaHC0 ₃ (12mL) and stirred for 3h. The tetrahydrofuran was removed m vacuo and the resulting residue was extracted with dichloromethane. The organic layer was washed with saturated sodium cnloride solution and dried over magnesium sulfate, filtered, and concentrated to yield 6.14g of the title compound.

Purification gave 4.79g (80%) of 99: H NMR (CDC1 ₃ ) δ 1.45(s, 9H) , 2.7-2.5 (m, 2H) , 2.8 (dd, IH) , 4.2, 4.4(2 x d, IH) , 4.7-4.5(m, 3H) , 5.35-5.1 (m, 2H) , 5.6, 5.7(2 x d, IH), 6.0-5.8(m, IH) , 7.2(d, IH) , 7.3 (m, IH) , 7.4 (m, 2H) .

104

103

105 106

a R = H b R = C0CH ₂ CH ₂ Ph c R = CH ₂ Ph

[2-0x0-3 (S) - (3-phenylpropionylamino) -2,3,4,5- tetrahydro-benzo[b] [1 ,4]dιazepιn-l-yl]acetic acid methyl ester (104a) . Anhydrous hydrogen chloride was bubbled into a solution of (3(S)-te_rt- b toxycarDonylamιno-2-oxo-2, 3, 4, 5-tetranydro-benzc n [1, 4 ] dιazepm-1-yl) acetic acid methyl ester (103, Ig, 2.86 mmol) in 25 ml of ethyl acetate for 2 minutes then stirred for 1 hour at room temperature. The reacticr was evaporated to give 2-oxo-3 (S) -amιno-2, 3, 4, 5-

tetrahydrobenzo [b] [1, 4]diazepin-1-yl acetic acid methyl ester hydrochloride as a white solid.

The hydrochloride salt and hydroc namic acid (0.47 g, 3.15 mmol) were dissolved into 20 ml of dimethylformamide and cooled to 0 °C.

Diisopropylethylamme (1 ml, 5.72 mmol) was added to the solution followed by the addition of N- hydroxybenzotπazole and 1- (3-dιmethylammopropyl) -3- ethylcarbodiimide hydrochloride. After stirring for 18 hours at room temperature, the mixture was diluted with 150 ml of ethyl acetate and washed with 10% sodium hydrogen sulfate, 10% sodium bicarbonate, and brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and evaporated to a crude solid that was purified by flash chromatography elutmg with 7:3 ethyl acetate/dichloromethane to afford 600 mg (55 ,)of the title compound as a white solid. H NMR (CDC1 ₃ ) δ 7.3-6.85 (9H,m), 6.55-6.0 (IH, d) , 4.88-4.82 (IH, m) , 4.72-4.65 (IH, d) , 4.28-4.22 (IH, m) , 3.95-3.9 (IH, m) , 3.78 (3H, s), 3.65 (IH, br. s), 3.28-3.2 (IH, m) , 2.95- 2.84 (2H, m) , 2.55-2.4 (2H, m) .

(3(5)- (3-Phenylpropionylamino) -2-oxo-2 ,3,4,5-tetra- hydrobenzo[b] [1 ,4]diazepιn-l-yl)acetic acid (105a) .

(3 (S) - (3-Phenylpropionylamino) -2-oxo-2, 3, 4, 5- tetrahydro-benzo [b] ( 1, 4] dιazepin-1-yl) acetic acid methyl ester (104a) was dissolved 90 methanol.

Lithium hydroxide hydrate was added to tne reaction ano the reaction was stirred at room temperature tor 4 h.

The reaction was evaporated in vacuo to give a wnite solid. This was dissolved in 20 ml of water and acidified to pH 5 and extracted with ethyl acetate tc afford 304 mg (88-) cf the title compound as a white

solid. H NMR (CDC1 ₃ ) δ 7.5-6.9 (11H, m) , 4.92-4.8 (IH, m) , 4.7-4.58 (IH, d) , 4.38-4.25 (IH, d) , 3.88-3.78 (IH, m) , 3.45-3.25 (IH, m) , 3.05-2.85 (2H, m) , 2.55-2.45 (2H, m) .

5 4-OXO-3 (S) -{2- [2-oxo-3 (S) - (3-phenylpropionylamino) - 2,3,4,5-tetrahydro-benzo [b] [1,4 ]dιazepιn-l- ylacetylamιno}butyπc acid (106a) . N- [ 1- (2-Benzyloxy- 5-oxotetrahydrofuran-3-ylcarbamoyl-methyl ) -2-oxo- 2,3,4, 5-tetrahydro-lH-benzo [b] [l,4]dιazepm-3-yl]-3- 0 phenylpropionamide was prepared from 105a by the procedure used to prepare compound H (stepAi to afford 390 mg (93%) of the product as diastereomers. H NMR (CD3OD) δ 7.58-7.22 (14H, m) , 5.78-5.73 (0.5 H, α) , 5.64 (0.5 H, s) , 5.0-4.72 (4H, m) , 4.54-4.42 (2H, m) , 3.82- 5 3.76 (0.5 H, m) , 3.68-3.62 (o.5 H, m) , 3.28-3.21 (0.5H, m) , 3.19-3.12 (0.5H, m) , 3.07-2.98 (2H, m) , 2.76-2.48 (4H, m) .

The resulting product was converted to 106a by tne method described to prepare compound H (StepD) tc 3 afford the title compound as a white solid (171, . H

NMR (CD ₃ OD) δ 7.54-6.98 (9H, m) , 5.58-5.44 (IH, rr , 4. «- 4.2 (4H, m) , 3.96-3.3 (2H, m) , 3.30-3.05 (IH, m, , 2.98- 2.25 (5H, m) .

[2-OXO-5- (3-phenylpropιonyl) -3 (S) - (3- 5 phenylpropionylamino) -2,3,4,5- tetrahydrobenzofbj [1 ,4 ]dιazepιn-l-yl ]acetic acid methyl ester (104b) . Anhydrous hydrogen cnloriαe was cuooled into a solution of ( 3 (S) - terr.-butoxycarDonylan.ir.o-2- oxo-2, 3, 4, 5-tetranydro-benzo [b] [l,4]dιazepιn-l- C yl) acetic acid methyl ester (103, lg, .86mmol _r 2

ml of ethyl acetate for 2 minutes then stirred for 1 hour at room temperature. The reaction was evaporated to give 2-OXO-3 (S) -ammo-2, 3, 4, 5- tetrahydrobenzo [b] [1, 4 ] dιazepιn-1-yl acetic aciα methyl ester hydrochloride as a white solid.

The hydrochloride salt was suspended into 20 ml of dichloromethane and cooled to 0 °C. Triethylamine (1.6 ml, 11.5 mmol) was added to the suspension followed by the dropwise addition of dihydrocmnamoyl chloπαe (0.9 ml, 6 mmol) . The mixture was warmed to room temperature and stirred for 18 hours. The mixture was diluted with 25 ml of dichloromethane and washed twice with 50 ml of water and once with 50 ml of brine. The organic layer was dried over anhydrous sodium sulfate, filtered, and evaporated to give a viscous, yellow OI that was purified by flash chromatography elut g with 1:1 ethyl acetate/dichloromethane to afford 1.35 g (92%) of the title product as a white solid. ¹ K NMR (CDC1 ₃ ) δ 7.45-7.02 (14 H, m) , 6.37-6.32 (IH, d. , 4.78- 4.72 (IH, m) , 4.52-4.3 (3H, m) , 3.82-3.77 (lH,m, , 3.74 (3H, s), 3.03-2.87 (4H, m) , 2.58-2.45 (2H, m) , 2.45- 2.35 (IH, m) , 2.25-2.16 (IH, m) .

[2-OXO-5- (3-phenylpropιonyl) -3- (3 (S) - phenylpropionylamino) -2,3,4,5- tetrahydrobenzo[b] [1 , ]dιazepιn-l-yl]acetιc acid (105b) . [2-OXO-5- (3-phenylpropιonyl) -3- (3- pnenylpropionyla ino) -2, 3,4,5- tetranydrobenzo [b] [ 1, 4]dιazepιn-1-yl ] acetic aciα methyl ester ,104b; 680 mg, 1.32 mmol) was hydrolyzed r; the procedure used to hydrolyze 105a to afford 645 mg (98 of the title compound as a white solid. H NMR CDCl^) δ 7.58 (IH, br. s), 7.5-7.42 (IH, ) , 7.35-6.9 ^c 14H,

) , 4.95-4.88 (IH, m) , 4.64-4.55 (IH, d) , 4.54-4.45 (IH, t) , 4.15-4.05 (IH, d) , 3.75 (IH, m) , 3.05-2.75 (4H, m) , 2.58-2.45 (2H, m) , 2.45-2.28 (IH, m) , 2.25-

2.14 (IH, m) .

2-Oxo-3 (S) -{2- [2-oxo-5-(3-phenylpropionyl) -3(S) -(3- phenyl-propionyl-amino) -2,3,4,5- tetrahydrobenzo[b] [1,4]diazepin-l-yl] acetylamino}butyric acid (106b) . [2-Oxo-5-(3- phenylpropionyl) -3- (3-phenylpropionylamino) -2, 3,4,5- tetrahydrobenzo [b] [1, 4]diazepin-1-yl ] acetic acid and 3- ammo-4-oxobutyric acid tert-butylester semicarbazone were coupled by the procedure used m the preparation of compound K (step A) to give 350 mg (85%) of a white solid. ¹ H NMR (CDC1 ₃ ) δ 9.05 (IH, br. s), 7.58-7.55 (lH,d), 7.5-7.35 (IH, m) , 7.35-6.95 (14 H, ) , 6.75-

6.72 (IH, d) , 6.25 (IH, br. s), 5.25 (IH, br. s), 4.95- 4.88 (IH, m) , 4.8-4.72 (IH, m) , 4.55-4.4 (2H, m. , 3.92- 3.88 (IH, d) , 3.73-3.68 (IH, m) , 2.95-2.8 (4H, m) , 2.8- 2.72 (IH, m) , 2.62-2.55 (IH, m) , 2.55-2.45 (2H, m) , 2.4-2.32 (IH, m) , 2.2-2.12 (IH, ) , 1.45 (9H, s) .

4-OXO-3- {2- [2-oxo-5- (3-phenylpropιonyl) -3- (3-phenyl- propionyl -amino) -2, 3, 4, 5- tetrahydrobenzo [b] [l,4]dιazepin-l-yl]-acetyl- aramo}butyπc acid tert-butyl ester semicarbazone was deprotected as described in the preparation of compound K (step C) to give 118 mg (47„) of the title compound as a white solid. ¹ H NMR (CD ₃ 0D) δ 7.48-6.95 (14 H, m, , 4.65-4.15 (6H, m) , 3.5-3.4 (IH, m) , 2.85-2.72 (4H, m) , 2.65-2.5 (IH, m) , 2.5-2.34 (3H, m) , 2.34-2.15 (2H, ) .

[5-Benzyl-2-oxo-3 (S) - (3-phenylpropionylamino) -2,3,4,5- tetrahydro-benzo [b] [1 , 4]dιazepin-l-yl ]acetic acid

methyl ester (104c) . [2-Oxo-3-(3- phenylpropionylam o) -2, 3, 4, 5-tetrahydrobenzo- [b] [1, 4 ] dιazepm-1-yl] acetic acid methyl ester (104a; 500 mg, 1.31 mmol), calcium carbonate (155 mg, 1.58 mmol), and benzyl bromide (170 μl, 1.44 mmol) were taken into 10 ml of dimethylformamide and heated to 80 °C for 8 hours. The mixture was diluted with 150 ml of ethyl acetate and washed 4 times with 50 ml of water. The organic layer was dried over anhydrous sodium sulfate, filtered, and evaporated to give a viscous, yellow oil that was purified by flash chromatography elutmg with dichloromethane/ethyl acetate (8:2) to give 460 mg (75%) of the title compound as a white solid. ^" " ^" H NMR (CDC1 ₃ ) δ 7.34-7.05 (14 H, m) , 6.32-6.28 (IH, d) , 4.84-4.76 (IH, d) , 4.76-4.70 (IH, m) , 4.43- 4.37 (IH, d) , 4.26-4.18 (IH, d) , 4.06-4.00 (IH, d) , 3.79 (3H, s), 3.45-3.37 (IH, m) , 3.02-2.95 (IH, m) , 2.90-2.82 (2H, m) , 2.5-2.34 ( 2H, m) .

[5-Benzyl-2-OXO-3 (S) - (3-phenylpropionylamino) -2,3,4,5- tetrahydro-benzo[b] [1,4]dιazepιn-l-yl ]acetic acid

(105c) was prepared by the hydrolysis of the ester (102σ) by the procedure reported in Example 105a to give 450 mg (98%) of the title compound as a white solid: ¹ H NMR (CD ₃ OD) δ 7.5-7.05 (14 H, m) , 6.4 (IH, br. s), 4.85-4.55 (2H,m), 4.5-4.21 (2H, m) , 4.12-3.92 (IH, d), 3.45-3.3 ( IH, m) , 3.1-2.8 (3H, ml, 2.55-2.28 ( 3H, m) .

3 (S) -{ 2- [5-Benzyl-2-oxo-3- (3 (S) -phenylpropionylamino) - 2,3,4,5-tetrahydrobenzo[b] [1,4]dιazepιn-1-yl] - acetylam o}-4-oxobutyrιc acid (106c) . [5-Benzyl-2-

oxo-3 (S) - (3-phenylpropιonylamino) -2,3,4, 5-tetranydro- Denzo [b [1, 4 ] dιazepιn-1-yl] acetic acid and 3 (S) -amιno-4- oxobutyπc acid tert-butylester semicarbazone were coupled by the procedure used the preparation of compound K (step A) and to afford 260 mg (85%) cf a white solid: ¹ H NMR (CD ₃ OD) δ 7.35-7.0 (15 H, m, , 4.94- 4.88 (IH, m) , 4.68-4.58 (IH, d) , 4.57-4.52 (IH, m) , 4.41-4.34 (IH, d) , 4.3-4.23 (IH, d) , 4.1-4.04 (IH, d), 3.18-3.11 (IH, ) , 3.09-2.98 (IH, m) , 2.78-2.72 (2H, t), 2.65-2.57 (IH, ) , 2.42-2.33 (3H, m) .

3 (S) - {2- [5-Benzyl-2-oxo-3 (S) - (3-phenylpropionylamino) - 2,3,4, 5-tetrahydrobenzo [b] [l,4]dιazepm-l-yl]- acetylammo}-4-oxobutyrιc acid tert-butyl ester semicarbazone was deprotected as described the preparation of compound K (step C) to give 168 mg (81%) of the title compound as a white solid. H NMR (CD ₃ OD) δ 7.37-7.0 (14H, m) , 4.75-4.62 (IH, m) , 4.6-4.45 (2H, m) , 4.4-4.21 (2H, m) , 4.15-3.95 (2H, m) , 3.15-3. C (2H, m) , 2.82-2.67 (2H, m) , 2.65-2.52 (IH, m) , 2.5-2.32 (3H, m)

105b ιo ₇

2,6-Dιchlorobenzoic acid 4-tert-butoxycarbonyl-2-oxo- 3 (S) -{2- [2-oxo-5- (3-phenylpropionyl) -3 (S) - (3- phenylpropionyla ino) -2,3,4,5-tetrahydro- benzofb] [1 ,4]diazepin-l-yl]acetyl-am o}butyl ester

5 (107a) . The resulting semicarbazone was prepared by the coupling of compound 105b and t-butyl 3- (allyloxycarbonylammo) -4-oxo-5- (2, 6-dιchlorobenzoyl- oxy)pentanoate (WO 93 16710) as described in compound 56a to give 256 mg (58%) of the title compound as a 0 white solid. ^λ U NMR (CDC1 ₃ ) δ 7.45-7.04 (17H, ) , 6.45- 6.34 (2H, m) , 5.28-5.21 (IH, m) , 5.1-5.0 (IK, ) , 4.95- 4.90 (IH, m) , 4.75-4.70 (IH, m) , 4.55-4.44 (IH, m) , 4.32-4.22 (IH, dd) , 3.99-3.85 (IH, dd) , 3.85-3.76 (IH, m) , 3.06-2.83 (5H, m) , 2.83-2.74 (IH, m) , 2.6-2.44 (2H, 5 m) , 2.43-2.33 (IH, m) , 2.24-2.15 (IH, m) , 1.45 (9H, s) .

2 ,6-Dichlorobenzoic acid 4-carboxy-2-oxo-3 (S) -{2- [2- oxo-5- (3-phenylpropionyl) -3 (S) - (3- phenylpropionylamino) -2,3,4,5- tetrahydrobenzo[b] [1,4 ]dιazepιn-l-yl]acetylamino]butyl 0 ester (108a) was prepared from 107a by the method described for compound 57a which afforded 156 mg (68' )

1 of the title compound as a white solid. "H NMR (CD ₃ 0D) δ 7.5-6.9 (17H, m) , 5.16-5.02 (IH, dd) , 4.88-4.71 (2H, m) , 4.62-4.44 (2H, m) , 4.42-4.28 (2H, m) , 4.27-4.18 5 (IH, m) , 3.47-3.41 (IH, ) , 2.90-2.60 (5H, m) , 2.46-2.4 (2H, m) , 2.39-2.18 (2H, m) .

4- (7-Methoxybenzoxazol-2-yl) -4-oxo-3 (S) - { 2 - [2-oxo-5- (3- phenylpropionyl) -3 (S) - (3-phenylpropιonylamιno) -2,3,4,5- tetrahydrobenzo[b] [1,4 ]dιazepm-l-yl] -acetylammo} C butyric acid (108b) was prepared by the method

described for compound 69a to give the title compound (50%) as a white solid. ¹ H NMR (CD ₃ OD) δ 7.41-6.88 (17H, m) , 5.6-5.55 (0.5H, t) , 5.48-5.43 (0.5H, t) , 4.64-4.45 (2H, m) , 4.45-4.30 (IH, m) , 3.93 (1.5H, s) ^' , 3.90 (1.5H, s), 3.47-3.34 (IH, m) , 3.10-2.85 (2H, m) , 2.84-2.63 (5H, m) , 2.6-2.4 (2H, m) , 2.3-2.1 (2H, m) .

122 123

t-Butyl (3S) N-(allyloxycarbonyl) -3-amιno-5- (2- chlorophenylmethylthio) -4-oxo-pentanoate (123) .

Potassium fluoride (273mg, 4.70mmol) and then 2- cniorophenylmethyl thiol (373mg, 2.35mmol) were added to a stirred solution of (3S) t-butyl N- (allyloxycarbonyl) -3-amιno-5-bromo-4-oxo-pentanoa e (122; 749mg, 2.14mmol; WO 93 16710) in dimethylformamide (20ml) . The mixture was stirred fo. 3.5h, quenched with water (50ml) and extracted witn ethyl acetate (2 x 50ml) . Tne combined organic extracts were washed with water (4 x 50ml) then cnne

(50ml) . They were dried (MgS0 ₄ ) and concentrated to afford an oil which was purified by flash chromatography (10-35% ethyl acetate/hexane) to afford

832 mg (91%) of a colourless solid: mp. 45-6 °C; [α] _D ⁰ 5 -19.0° (c 1.0, CH ₂ C1 ₂ ); IR (film) 3340, 2980, 2935, 1725, 1712, 1511, 1503, 1474, 1446, 1421, 1393, 1368, 1281, 1244, 1157, 1052, 1040, 995, 764, 739; ^λ NMR (CDC1 ₃ ) δ 7.36 (2H, m) , 7.21 (2H, m) , 5.91 (2H, m) , 5.27 (2H, m) , 4.76 (IH, m) , 4.59 (2H, d) , 3.78 (2H, s) , 3.36 0 (2H, m) , 2.91 (IH, dd) , 2.74 (IH, dd) , 1.43 (9H, s) . Anal. Calcd for C ₂₀ H ₂₆ ClNO ₅ S: C, 56.13; H, 6.12; N, 3.27; S, 7.49. Found: C, 56.08; H, 6.11; N, 3.26; S, 7.54. MS (C.I.) 430/28 (M ⁺ + 1, 3%) , 374/2 (100) .

t-Butyl (3S) 3(2(6-benzyl-l,2-dιhydro-2-oxo-3(3- 5 phenylpropionylamino) -1-pyridyl)acetylamιno-5- (2- chlorophenyl ethylthio) -4-oxopentanoate (124a) . 6-

Benzyl-1, 2-dιhydro-2-oxo-3- (3-phenylpropιonylamιno) - pyridyl acetic acid (52b; 300mg, 0.76mmol) in THF (7ml) was stirred with 1-hydroxybenzotrιazole (205mg, 0 1.52mmol) and 1- (3-dιmethylammopropy-3- ethylcarbodnmide hydrochloride) . After 3 mm, water (12 drops) was added and the mixture stirred 10mm then treated with t-butyl (3S) N- (allyloxycarbonyl ) -3-amιno- 5- (2-chlorophenylmethylthιo) -4-oxopentanoate (123) 5 (325mg, 0.76mmol), bis (triphenylphosphme) palladium II chloride (20mg) and tributylt hydride (0.6ml, 2.28mmol) . The mixture was stirred for 5h at room temperature, poured into ethyl acetate and washed with aqueous IM HCl (x2), aqueous sodium bicarbonate, brine, C dried (MgSO^) and concentrated. The residue was triturated with pentane and the supernatant discarded. Chromatography (silica gel, 50 ethyl acetate/hexane)

- afforded a colourless foam (439mg, 81%) : [α] _D ^"~ -18.3 ° (c 0.5, CH ₂ C1 ₂ ) ; IR (KBr) 3356, 3311, 1722, 1689, 1646, 1599, 1567, 1513, 1367, 1154; ^X H NMR (CDC1 ₃ ) δ 8.39 (IH, d) , 8.23 (IH, s), 7.24 (14H, m) , 6.16 (IH, d) , 4.95 (IH, m) , 4.63 (2H, m) , 4.02 (2H, s) , 3.74 (2H, s) ,

3.27 (2H, s) , 2.85 (6H, m) , 1.40 (9H, s) . Anal. Calcd for C ₃₉ H ₄₂ C1N ₃ 0 ₆ S: C, 65.39; H, 5.91; N, 5.87. Found: C, 65.51; H, 5.99; N,5.77.

t-Butyl [ 3S(IS, 9S) ] -3- (6, 10-dioxo-l ,2 , 3, 4 , 7 , 8 , 9, 10- octahydro) -9- (3-phenylpropιonylamιno) -6H- pyridazine[1 ,2-a] [1 ,2]diazep e-l-carboxamιdo-5- (2- chlorophenylmethylthio) -4-oxopentanoate (124b) was prepared by a similar method as 124a from the thioether 123 and 3S( IS, 95) -3- ( 6, 10-dιoxo-1 , 2, 3, 4, 7, 8, 9, 10- octahydro) -9- (3-phenylpropιonylammo) -6H- pyridazmo [1, 2-a] [ 1 , 2 ] dιazepme-1-carboxylic acid (45a) to afford 452mg (50%) of colourless foam: mp 55-7 °C; [α] _D ²² -94.0° (c 0.12, CH ₂ C1 ₂ ) ; IR (KBr) 3288, 2934, 1741, 1722, 1686, 1666, 1644, 1523, 1433, 1260, 1225, 1146, 757; ¹ H NMR (CDC1 ₃ ) δ 7.35 (3H, m) , 7.20 (7H, m) , 6.46 (IH, d) , 5.21 (IH, m) , 4.97 (2H, m) , 4.56 (IH, m) , 3.75 (2H, s) , 3.25 (3H, m) , 2.93 (5H, m) , 2.71 (IH, dd) , 2.55 (2H, m) , 2.30 (IH, m) , 1.92 (3H, m) , 1.66 (2H, m) , 1.42 (9H, s) . Anal. Calcd for C ₅ H ₄₃ CI-I ₄ 0 ₇ S . 0.25H ₂ O: C, 59.73; H, 6.23; Cl, 5.04; N, 7.96; Ξ,

4.56. Found: C, 59.73; H, 6.19; 31, 5.10; N, ^' 9 ; S, 4.58. MS (-FAB) 697 (M-l, 100) .

(3S) 3(2 (6-Benzyl-l,2-dιhydro-2-oxo-3-(3- phenylpropionylamino) -1-pyridyl) acetylamιno-5- (2- chlorophenylmethylthio) -4-oxopentanoιc acid (125a) .

t-Butyl-3 (2 (6-benzyl-l, 2-dihydro-2-oxo-3- (3- phenylpropionylamino) -1-pyridyl) acetyl-ammo-5- (2- chlorophenylmethylthio) -4-oxopentanoate (124a) (400mg, 0.56mmol) in dichloromethane (3ml) at 0 °C was treated with trifluoroacetic acid (3ml) and stirred at 0 °C for lh and room temperature for 0.5h. The solution was concentrated then redissolved in dichloromethane and reconcentrated. This procedure was repeated three times. The residue was stirred in ether for Ihr and filtered to yield a colourless solid (364mg, 99%) : mp. 165-7 °C; [α] _D ²² -27.7 ° (c 0.2, CH ₂ Cl ₂ ) ; IR (KBr) 3289, 1712, 1682, 1657, 1645, 1593, 1562, 1527, 1497, 1416, 1203, 1182; ^X H NMR (CDC1 ₃ ) d 8.47 (IH, d) , 8.21 (IH, s) , 7.70 (IH, d), 7.22 (14H, ) , 6.24 (IH, d) , 5.03 (IH, m) , 4.65 (2H, m) , 4.06 (2H, s) , 3.69 (2H, m) , 3.23 (2H, m) , 2.88 (6H, ) .

[3S(IS,9S) ] -3- (6, 10-dioxo-l ,2,3,4,7,8,9, 10-octahydro) - 9- (3-phenylpropionyl-amino) -6H- pyridazine[1 ,2-a] [1 ,2]diazepine-l-carboxamido-5- (2- chlorophenyl-methylthio) -4-oxopentanoιc acid (125b) , was prepared by a similar method as 125a from the t- butyl ester 124b to afford 362mg (93%) of colourless powder: mp 76-80 °C; [ ] _D ²¹ -134 ° (c 0.10, MeOH) ; IR (KBr) 3309, 2935, 1725, 1658, 1528, 1445, 1417, 127", 1219, 1175; ¹ H NMR (D ₆ -DMSO) δ 8.80 (IH, d) , 8.19 (IH, c 7.31 (9H, m) , 5.09 (IH, m) , 4.74 (IH, m) , 4.63 (IH, m) , 4.35 (IH, m) , 3.76 (2H, m) , 3.28 (3H, ) , 2.80 (5H, ) , 2.52 (4H, m) , 2.16 (2H, m) , 1.90 (3H, ) . Anal. Calcc for C ₃₁ H ₃₅ C1 ₂ N ₄ 0 ₇ S . 0.25H ₂ O: C, 57.49; H, 5.53; N, 8.65; S, 4.95. Found: C, 57.35; H, 5.43; N, 8.45; S, 4.83. MS (-FAB) 641 (M-l, 100) .

81 201

2-Chlorophenylmethyliodide. A mixture of 2- chlorophenylmethylbromide (4g, 19.47mmol) and Nal (14g, 97.33mmol) in acetone (40ml) was stirred under reflux for 1 hour. The reaction mixture was cooled, filtered and concentrated in vacuo . The residue was triturated with hexane and filtered. The solution was concentrated in vacuo, and the resulting oil purified by flash chromatography (silica, hexane) to afford the ttiittllee ccoommppoouunndd ((44..6677gg,, 6633%%)) as an oil: ¹ H NMR (CDC1 ₃ ) δ 7.34 (4H, m) , 4.54 (2H, s]

(3S) t-Butyl N- (allyloxycarbonyl) -3-amino-5- (2- chlorophenylmethyloxy) -4-oxopentanoate (201) . (3S) t-

Butyl N- (allyloxycarbonyl) -3-amino-5-hydroxy-4- oxopentanoate (81, Chapman, et al . , Bioorα. & Med. Chem. Lett.. 2, pp. 613-618 (1992) 0.144g, 0.5mmol) and 2-chlorophenylmethyliodιde (0.569g, 1.5mmol) CH Cl- (4ml) were stirred vigorously with silver oxide (0.231g, Immol) and heated at 38 °C for 40 hours. The reaction mixture was cooled, filtered and the filtrate evaporated. The residue was purified by flash chromatography (silica, 0-20 - ethylacetate in hexane) to afford the product as a colourless cil (0.138g, 67%) : [ ] _D ²⁴ +3.9 ° (c 1.3, CH ₂ C1 ₂ ) ; ^~ H NMR (CDCI ₃ ) δ 7.37 (4H, m) , 5.88 (2H, m) , 5.26 (2H, ) , 4.69 (2H, s) , 4.57 (3H, m) , 4.50 (IH, d^ , 4.35 (IH, d) , 3.03 (IH, dd) , 2.76 (IH, dd) , 1.42 (9H, s) .

202 203 204

5,7-Dιchlorobenzoxazole (203) . A solution of 2,4- dιchloro-6-nιtrophenol (202, 40g containing 20% moisture) in EtOAc (500ml) was dried using MgS0 ₄ , filtered and the filter cake washed with a little EtOAc. Platinum on carbon (5% sulphided - 2g) was added and the mixture hydrogenated until uptake of H ceased. Tπethyl orthoformate (160ml) and p-toluene sulphonic acid (160mg) were added and the mixture refluxed for 4h. After cooling and removal of spent catalyst by filtration the solution was washed with sat. NaHC0 ₃ solution, water and brine, dried with MgS0 ₄ and evaporated to dryness. Trituration with hexane gave a solid which was collected by filtration, washed with hexane and dried to give the title compound (25.5g, 88%) as a crystalline solid: mp 98-99 °C; IP (KBr) 3119, 1610, 1590, 1510, 1452, 1393, 1296, 1067, 850; ^X H NMR (CDC1 ₃ ) δ 8.16 (IH, s), 7.69 (IH, d, J = 1.9), 7.42 (IH, d, J = 1.9) ; Anal . Calcd for C ₇ H ₃ C1 ₂ NC- C, 44.72; H, 1.61; N, 7.45; Cl, 37.70. Found: C, 44.84; H, 1.69; N, 7.31; Cl, 37.71.

(3S,4i?S) t-Butyl N- (allyloxycarbonyl) -3-amιno-4- hydroxy-4- (5, 7-dιchlorobenzoxazol-2-yl)butanoate (204)

Magnesium bromide was prepared by reaction of Mg (7.45g, 0.30mole) in THF (516ml) with l ₂ (50mg) and 1 , 2-dιbromoethane (26.3ml, 57.3g, 0.30mole) at reflux for 2h and then cooling to -40 °C. To the above was

added rapidly via cannula a solution of 2-Iιthιo-5, 7- dichlorobenzoxazole at 70 °C (prepared from 5,7- dichlorobenzoxazole (203, 28.9g, 0.154mole) and butyl lithium (100ml 1.52M hexane) THF (150ml) at - 70 °C) . The mixture was stirred at -40 °C for In and then cooled to -70 °C before adding a solution of (3S) t-butyl N- (allyloxycarbonyl) -3-amιno-4-oxo-butanoate (Chapman, et al., Bioorσ. & Med. Chem. Lett., 2, pp. 613-618 (1992) ) (20.3g, 0.078mole) in THF (160ml) at less than -60 °C. The reaction was allowed to warm to ambient temperature and was stirred for 16h before quenching with ammonium chloride solution and extracting with 1:1 hexane : ethylacetate 600ml. The organic solution was washed with water and brme, dried with MgS0 ₄ and evaporated to a syrup (52.9g) . Flash chromatography (Sι0 250g -11 aliquots of 1:1 hexane: CH ₂ C1 ₂ x2, CH ₂ C1 ₂ , 5% EtOAc in CH ₂ C1 ₂ , 10% EtOAc CH ₂ C1 ₂ , 20% EtOAc in CH ₂ C1 ₂ ) gave impure product 24.6g which on further chromatography (Sι0 ₂ 1:1 hexane : ether) give the title compound as a golden-brown glass (22.7g,

64%) ; IR (film) 3343, 2980, 1723, 1712, 1520, 1456,

1398, 1369, 1254, 1158, 993; ^X H NMR (CDC1 ₃ ) δ 7.6 ' (IH, ) , 7.37 (IH, m) , 5.72 (IH, m) , 5.64 (0.5H, d) , 5.10

(2.5H, m) , 4.7-4.3 (4H, m) , 2.9-2.6 (2H, m) , 1.46 and 1.42 (9H combined, 2 x s) . MS ES ⁺ Da/e 445 (M + 1) ⁺ Cl

+

35 62' 447 (M + 1) Cl 37 40 ^' 389 100

206a 206b

208a 207a 208b 207b

(2S) -N-Allyloxycarbonyl-5- (1 ,1-dimethylethyl)glutamate

(205a) . To a mixture of THF (200ml) and water (100ml) containing NaHC0 ₃ (16.6g, 0.2mol) was added glutaric acid t-butyl ester (lOg, 49.2mmol) and then dropwise over 20 minutes allyl chloroformate (6.8ml, 64mmol) . The mixture was stirred for 2 hours, extracted with EtOAc, washed with a sat. hydrogenocarbonate solution, water and a sat. salt solution, dried and evaporated to

20 an oil 205a (9.5g, 67.2%) ; [α] _D (c 1 MeOH)

¹ H NMR (D ₆ -DMSO) δ 6.10 (IH, d) , 5.96-5.88 (IH, ) ,

5.31-5.12 (2H, m) , 4.45 (2H, m) , 3.90-3.84 (IH, -) ,

2.18 (2H, m) , 1.85-1.76 (2H, m) , 1.36 (9H, s) .

(2R) -N-Allyloxycarbonyl-5- (1 , 1-dimethylethyl)glutamate

(205b) , was prepared by an analogous method to 205a to afford a colourless oil (6.27g, 88%) : [α] _D 20 +16 ° (c

0.095, MeOH) ; IR (KBr) 3678, 3332, 3088, 2980, 2937,

1724, 1530, 1453, 1393, 1370, 1331, 1255, 1155, 1056,

995, 935, 845, 778, 757, 636, 583; ^X H NMR (CDC1 ₃ ' δ

9.24 (IH, broad s) , 5.94-5.79 (IH, ) , 5.58 (IH, d) , 5.33-5.17 (2H, m) , 4.55 (2H, d) , 4.38-4.31 (IH, m) , 2.41-1.95 (4H, m) , 1.42 (9H, s); Anal. Calcd for C ₁₃ H ₂₁ N0 ₆ : C, 54.35; H, 7.37; N, 4.88. Found: C, 54.4; H, 7.5; N, 4.8.

(4S) t-Butyl N-allyloxycarbonyl-4-amino-5- hydroxypentanoate (206a) . To a solution of 205a (3.6g, 12.5mmol) in THF (100ml) at 0 °C was added N-methyl morpholine (1.5ml, 13mmol) followed by isobutyl chloroformate, (1.1ml, 13mmol) . After 15 minutes, this mixture was added to a suspension of NaBH ₄ (0.95g, 25mmol) in THF (100ml) and MeOH (25ml) at -78 °C. After 2 hours at -70 °C, the mixture was quenched with acetic acid, diluted with EtOAc, washed with a sat. hydrogenocarbonate solution 3 times, water and a sat. solution of salt, dried and evaporated. Flash chromatography (2% MeOH in CH ₂ C1 ₂ ) afforded 206a as a colourless oil (2.4g, 70%) : [α] _D ² ° -10 ° (c 3.88, CH ₂ C1 ₂ ) ; ¹ H NMR (CDC1 ₃ ) δ 5.84 (IH, m) , 5.34-5.17 (3H, m) , 4.56-4.53 (2H, m) , 3.68-3.59 (2H, m) , 2.98 (IH, m, , 2.40-2.30 (2H, t), 1.84-1.78 (2H, m) , 1.43 (9H, s) ; Anal. Calcd for C ₁₃ H ₂₃ N0 ₅ : C, 57.13; H, 8.48; N, 5.12. Found: C, 57.1; H, 8.6; N, 6.0

(4R) t-Butyl N-allyloxycarbonyl-4-amιno-5- hydroxypentanoate (206b), was prepared by an analogous method to 206a which afforded the title compound as a light yellow oil (3.42g, 57%) : [ ] _D ² ° +14 (c 0.166, MeOH) ; IR (KBr) 3341, 3083, 2976, 2936, 288C, 1724,

1533, 1454, 1419, 1369, 1332, 1251, 1156, 1062, 997, 933, 846, 777, 647; ¹ H NMR (CDC1 ₃ ) δ 5.98-5.81 (IH, 1 5.35-5.10 (3H, m) , 4.55 (2H, d) , 3.70-3.56 (3K, ) ,

2.50-2.47 (IH, broad s), 2.37-2.30 (2H, m) , 1.89-1.74 (2H, m) , 1.44 (9H, s) ; Anal. Calcd for C ₁₃ H ₂₃ N0 ₅ : C, 57.13; H, 8.48; N, 5.12. Found: C, 56.9; H, 8.6; N, 5.6

(4S) t-Butyl N-Allyloxycarbonyl-4-amιno-5-oxopentanoate

(207a) . To a solution of DMSO (1.51g, 19.3mmol) in CH ₂ C1 ₂ (25ml) at -70 °C was added oxalyl chloride

(1.34g, 19.3mmol) . After 10 minutes at -70 °C, a solution of (206a) (2.4g, 8.8mmol) in CH ₂ C1 ₂ (10ml) was added dropwise and the mixture stirred for 15 minutes at -70 °C. Dusopropylethylamine (3.4g, 26.3mmolj was added and the mixture stirred at -25 °C for 15 minutes then diluting with EtOAc (50ml) washed with a solution of sodium hydrogen sulfate 2M, concentrated to give an oil which was used immediately without purification: ^l H NMR (CDC1 ₃ ) δ 9.5 (IH, s), 6.0-5.5 (2H, m) , 5.5-5.1

(2H, ) , 4.5 (2H, m) , 4.2 (IH, m) , 2.4-2.10 (2H, m) , 2.05 (2H, m) , 1.36 (9H, s) .

(4J ) t-Butyl N-Allyloxycarbonyl-4-amιno-5-oxopentanoate (207b) , was prepared by an analogous method to 207a which afforded an oil (2.95g, 96%) which was used

20 without further purification in the next step: [α]n

+21 ° (c 0.942, MeOH) ; ¹ H NMR (CDCI ₃ ) δ 9.58 (IH, s),

6.05-5.80 (IH, m) , 5.57 (IH, broad s), 5.35-5.16 (2H, m) , 4.56 (2H, d) , 4.34-4.24 (IH, m) , 2.38-2.16 (3h, ml ,

1.96-1.73 (IH, m) , 1.43 (9H, s) .

(4S) t-Butyl N-Allyloxycarbonyl-4-amιno-5-oxopentanoate semicarbazone (208a) . To a solution of 207a (2.39g, 8.8mmol), in MeOH (20ml) was added sodium acetate (0.72g, 8.8mmol) ano se icarbazide '0.98g, 8.8mmc__)

stirred overnight, concentrated and diluted with CH ₂ C1 ₂ (100ml) , washed with water, dried and concentrated.

Flash chromatography (2% MeOH in CH ₂ C1 ₂ ) afforded 208a (2.10g, 73%) as an oil: [α] _D ² ° -21 (c 2.55 °, CH ₂ C1 ₂ ) ; ¹ H NMR (CDC1 ₃ ) δ 9.98 (IH, s), 7.27 (IH, d) , 5.8 (IH, m) , 5.5 (IH, d) , 5.35-5.19 (2H, m) , 4.58 (2H, m) , 4.14 (IH, m) , 2.37 (2H, t) , 2.09 (IH, m) , 2.0-1.75 (2H, m) ;

Anal. Calcd for C ₁₄ H2 _{4 4} 0 ₅ : C, 51.21; H, 7.37; N,

17.06. Found: C, 50.2; H, 7.3; N, 16.1

(4JR) t-Butyl N-Allyloxycarbonyl-4-amino-5-oxopentanoate semicarbazone (208b) , was prepared by an analogous method to 208a which afforded a glassy oil (2.37g, 66%) : [ ] _D ² ° +30 (c 0.26, CHC1 ₃ ) ; IR (KBr) 3476, 3360, 2979, 2923, 1700, 1586, 1527, 1427, 1394, 1369, 1338, 1253, 1156, 1060, 997, 929, 846, 775; ¹ H NMR (CDC1 ₃ ) δ 9.87 (IH, s), 7.09 (IH, d) , 6.05-5.75 (3H, m) , 5.58 (IH, d) , 5.32-5.16 (2H, m) , 4.54 (2H, d) , 4.35 (IH, m) , 2.32-2.26 (2H, m) , 2.15-1.55 (2H, ) , 1.41 (9H, s) ; Anal. Calcd for C ₁₄ H ₂₄ N ₄ 0 ₅ : C, 51.21; H, 7.37; N, 17.06. Found: C, 51.0; H, 7.5; N, 16.7.

211 (b) R ¹ = MeS0 ₂ 212 !b) P ¹ = MeSO _: (c) R ¹ = MeCO ;c) R ¹ = MeCO

1 1

(d) R ^{^} = PhCH ₂ OCO :d) R = PhCH ₂ 0CO

(e) R ¹ = PhCO (e) R ¹ = PhCC

1 1

(f) R = Fmoc (f) R = Fmoc

(1S,9S) t-Butyl 6, 10-dioxo-9-methylsulphonylamino- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazιno- [1 ,2-a] [l,2]diazepine-l-carboxylate (211b) . A solution of t-butyl 9-amιno-6, 10-dioxo-l, 2, 3, 4, 7, 8, 9, 10- octahydro-6H-pyridazιno [1, 2-a] [ 1, 2 ] diazepιne-1- carboxylate (GB 2,128,984; 831mg, 2.79mmol) and dusopropylethylamine (1.22ml, 6.99mmol, 2.5 equiv) m CH ₂ C1 ₂ (10ml) under dry nitrogen was treated with methanesulphonyl chloride (237μl, 3.07mmol 1.1 equiv) The mixture was stirred for lh, diluted with EtOAc (75ml) and washed with saturated NaHC0 ₃ (50ml) and saturated aqueous sodium chloride (30ml) , dried (MgS0 ₄ ) and concentrated. Flash chromatography (10-35% EtOAc in CH ₂ C1 ₂ ) afforded 211b (806mg, 77%) as a colourless solid: mp 68-70 °C; [ ] _D ²³ -109 (c 1.09, CH ₂ C1 ₂ , ; IR (KBr) 3270, 2980, 2939, 1735, 1677, 1458, 1447, 1418, 1396, 1370, 1328, 1272, 1252, 1232, 1222, 1156, 1131, 991; ¹ H NMR (CDC1 ₃ ) δ 6.15 (IH, d) , 5.31 (IH, m) , 4.65-4.11 (2H, m) , 3.47 (IH, m) 2.99 (3H, s) , 2.89 (IH, m) , 2.72-2.51 (2H, ) , 2.34 (IH, m) , 2.26 (IH, m, , 2.05-1.62 (4H, m) , 1.47 (9H, s) ; Anal . Calcd for C ₁₅ H ₂₃ N ₃ 0 ₆ S: C, 47.97; H, 6.71; N, 11.19; S, 8.54. Found: C, 48.28; H, 6.68; N, 10.86; S, 8.28. M3 (+ FAB) 376 (M ⁺ + 1, 66%), 320 (100) .

(1S,9S) t-Butyl 9-acetylamιno-6, 10-dιoxo-

1,2,3, ,7,8,9,10-octahydro-6H-pyridazino [1,2-a] - [1 ,2]dιazepιne-l-carboxylate (211c) . Acetic anr.y ride (307mg, 3.01mmol) was added to a stirred mixture of t- butyl 9-amino-6, 10-dιoxo-l, 2, 3, 4, 7, 8, 9, 10-octahyoro-6H- pyridazino [ 1 , 2-a] [ 1 , 2 ] dιazepine-1-carboxyiate (GB 2, 128,984; 813.7mg, 2.74mmol) , dusopropylethylamine (884mg, 6.84mmol) and CH-.C1-

(20ml) . The mixture was kept for lh then diluted with EtOAc, washed with NaHC0 ₃ solution then brme, dried (MgS0 ) and concentrated to yield a colourless oil. The product was purified by flash chromatography (0.5- 8% MeOH/CH ₂ Cl ₂ ) to afford 211c (804mg, 71%) of

23 colourless powder: mp 162-3 °C; [α] _D -109 (c 1.03,

CH ₂ C1 ₂ ) ; IR(KBr) 3358, 2974, 1733, 1693, 1668, 1528,

1462, 1431, 1406, 1371, 1278, 1271, 1250, 1233, 1217,

1154, 1124; δ ^X H NMR (CDC1 ₃ ) d 6.32 (IH, d) , 5.29-5.25 (IH, m) , 4.98-4.85 (IH, m) , 4.68-4.58 (IH, m) , 3.55- 3.39 (IH, ) , 2.91-2.66 (2H, m) , 2.39-2.18 (2H, m) , 2.03 (3H, s), 1.88-1.64 (4H, m) , 1.47 (9H, s) ; Anal. Calcd for C ₁₆ H ₂₅ N ₃ 0 ₅ : C, 56.62; H, 7.43; N, 12.38. Founo: C, 56.62; H, 7.43; N, 12.36; MS (+ FAB) 340 (M ⁺ + 1, 40%) , 284 (100) .

(1S,9S) t-Butyl 9- (benzyloxycarbonylamino) -6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyrιdazιno[l ,2-a] [1,2] dιazepιne-1-carboxylate (211d) . Benzyl chloroformate (1.07g) was added dropwise to a stirred ice cold mixture of the (IS, 9S) t-butyl 9-amιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazιno [1, 2-a] [1, 2]dιazepme-l-carboxylate (GB 2,123,984; 1.55g, 5.21mmol), NaHC0 ₃ (0.66g, 7.82mmol) , dioxan (32ml) and water (8ml) . The mixture was kept at 5 °C for 15mm then for 2h at room temperature. The mixture was diluted with EtOAc (50ml) , washed twice with sat. NaHC0 solution, dried (MgS0 ₄ ) and concentrated. The oily residue was purified by flash chromatography to afford 211d (1.98g, of a colourless oil α D

56.4 (c 1.0, CH ₂ C1 ₂ ; IRfthin film) 33; 2979, 2946,

17: 1677, 1528, 1456, 1422, 1370, 1340, 1272, 1245,

1156, 1122, 1056, 916, 734, 699; H NMR (CDC1 ₃ ) δ 7.29

(5H, ) , 5.81-5.72 (IH, m) , 5.26-5.20 (IH, m) , 5.05 (2H, s), 4.69-4.51 (2H, m) , 3.48-3.36 (IH, ) , 2.81- 2.51 (2H, m) , 2.34-2.19 (2H, m) , 1.90-1.54 (4H, m) , 1.41 (9H, s) ; Anal. Calcd for C ₂₂ H _2g N ₃ 0 ₆ »H ₂ 0: C, 58.79; H, 6.92; N, 9.35. Found: C, 59.10; H, 6.57; N, 9.25; MS (ES +) 454 (M ⁺ +Na, 87%) , 432 (M ⁺ +l, 100) .

(1S,9S) t-Butyl 9-benzoylamιno-6, 10-dιoxo-

1,2,3,4 ,7,8,9,10-octahydro-6H-pyπdazιno[l,2-aJ [1,2] - dιazepιne-1-carboxylate (211e) . A solution of benzoyl chloride (1.61g, 11.47mmol) m CH ₂ C1 ₂ (15ml) was added dropwise to a stirred ice cold mixture of (IS, 95) t- butyl 9-amino-6, 10-dιoxo-l, 2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1, 2-a] [1,2] dιazepme-1-carboxylate (GB 2,128,984; 3.1g, 10.43mmol) , dry CH ₂ C1 ₂ (20ml) and dusopropylethylamine (4.54ml, 26.06mmol) . The mixture was kept cold for lh then left at room temperature for 0.5h . The mixture was diluted with CH ₂ C1 ₂ , washed twice with brme, dried (MgS0 ₄ ) and concentrated. The residue was purified by flash chromatography (0-5 _o methai 1 CH ₂ C1 ₂ ) to afford 211e (4.0g, 96 ) of a

30 colouness glass: mp 74-76 °C; [α] _D -75.0 ° (c 0.12,

CH ₂ C1 ₂ ) . IR (KBr) 3350, 2979, 2938, 1736, 1677, 1662,

1536, 1422, 1276, 1250, 1155; ^X H NMR (CDC1 ₃ ) δ 8.72

(2H, m) , 7.53-7.40 (3H, m) , 7.07 (IH, d, J = 7.2* , 5.30 (lh, dd, J = 3.0, 5.8) , 5.12 (IH, ) , 4.66 (IH, m) ,

3.51 (IH, m) , 2.90 (2H, m) , 2.38 (IH, dd, J 13.2, 6.8 ,

2.25 (IH, m) , 1.9 (2H, m) , 1.70 (IH, si' . Anal. Calco for C ₂₁ H ₂₇ N ₃ 0 ₅ 0.5H ₂ O: C, 61.45; H, 6.88; N, 10.24.

Found C, 61.69; H, o.71; N, 10.18.

(1S,9S) t-Butyl 6, 10-dιoxo-9- (fluoren-9-ylmethyloxy- carbonylamino) -1,2,3,4,7,8,9, 10-octahydro-6H-

pyridazino [1 ,2-a] [1 ,2 ] -diazepine-1-carboxylate (211f) , was prepared in a similar manner to 211e, except 9- fluorenylmethylchloroformate was used instead of benzoylchloride to give a white glassy solid 211f (2.14g, 89%) : mp 190-192 °C; [ ] _D ²⁵ -81.5 ° (c Cl, CH ₂ C1 ₂ ) . IR (KBr) 3335, 2977, 1731, 1678, 1450, 1421, 1246, 1156, 742; ^X H NMR (CDC1 ₃ ) δ 7.60 (2H, m) , 7.57 (2H, m) , 7.50-7.26 (4H, m) , 5.60 (IH, d, J = 7.8) , 5.28 (IH, m) , 4.67 (2H, m) , 4.38 (2H, m) , 4.23 (IH, m) , 3.59-3.41 (IH, m) , 2.92-2.65 (2H, m) , 2.41-2.21 (2H, ) , 1.95-1.58 (4H, m) , 1.47 (9H, s) . MS (ES ^~ , m/z! 520 (M ⁺ + 1, 97%) , 179 (100%) .

(IS, 9S) 6, 10-Dioxo-9-methysulphonylamino- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazino- [1 ,2-a] [1 ,2]diazepine-l-carboxylic acid (212b), was synthesized by the same method as compound 212e .635mg,

85%) as a colourless powder: mp 209-12 °C; [a] _c ²⁴ -132 (c 0.12, MeOH) ; IR (KBr) 3308, 2940, 1717, 1707, 1699,

1619, 1469, 1456, 1442, 1417, 1391, 1348, 1339, 1330, 1310, 1271, 1247, 1222, 1175, 1152, 1133, 993, 976; ¹ K

NMR (CD ₃ OD) δ 5.35 (IH, m) , 4.58-4.48 (IH, m) , 4.46-4.36 (IH, m) , 3.60-3.42 (IH, m) , 3.01-2.87 (IH, m) , 2.95 (3H, s) , 2.55-2.39 (IH, m) , 2.32-2.2C (2H, m) , 2.09-

1.89 (2H, m) , 1.78-1.62 (2H, m) ; Anal. Calcd for C ₁₁ H ₁₇ N ₃ 0 ₆ S: C, 41.37; H, 5.37; N, 13.16; S, 10.04.

Found: C, 41.59; H, 5.32; N, 12.75; 5, 9.76; MS,ΞS -1.

Accurate Mass calculated for CllH ₁₈ N ₃ 0 _tl S (MH ⁺ ) :

320.0916. Found: 320.0943.

(1S,9S) 9-Acetylamino-6,10-dioxo-l,2,3, ,7,8,9, 10- octahydro-6H-pyrιdazιno [1 ,2-a] [1 ,2 ]dιazepιne-1- carboxylic acid (212c) , was prepared from 211e t e same

method as compound 212e as a white glassy solid (595mg, 77%) : mp >250 °C; [α] _D ²⁴ -153 (c 0.10, MeOH) ; IR (KBr) 3280, 2942, 1742, 1697, 1675, 1650, 1616, 1548, 1470, 1443, 1281, 1249, 1202, 1187, 1171; ¹ E NMR (CD ₃ OD) δ 5.35-5.31 (IH, m) , 4.81-4.71 (IH, m) , 4.61-4.46 (IH, m) , 3.59-3.44 (2H, m) , 3.11-2.94 (IH, m) , 2.58-2.39 (IH, m) , 2.36-2.19 (2H, m) , 2.11-1.83 (3H, ) , 1.99 (3H, s) , 1.78-1.56 (2H, m) ; Anal. Calcd for C ₁₂ H ₁₇ N ₃ 0 ₅ : C, 50.88; H, 6.05; N, 14.83. Found: C, 50.82; H, 6.02; N, 14.58; MS (ES -) 282 (M-l, 100%) : Accurate

Mass calculated for C ₁₂ H ₁₈ N ₃ 0 ₅ (MH ⁺ ) : 284.1246. Found: 284.1258.

(IS, 9S) 9-Benzyloxycarbonylamino-6, 10-dioxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazino- [1 ,2-a] [1 ,2]diazepine-l-carboxylic acid (212d) , was prepared from 211d by the same method as compound 212e as colourless crystals (170mg, 97%) : mp 60-100 °C; [ ] _D ²² -103 (c 0.10, MeOH) ; IR (KBr) 3341, 2947, 1728, 1675, 1531, 1456, 1422, 1339, 1272, 1248, 1221, 1174, 1122, 1056, 982, 699; ¹ H NMR (CDC1 ₃ ) δ 7.35 (5H, s) , 5.65 (IH, d) , 5.48-5.40 (IH, m) , 5.10 (2H, s), 4.76- 4.57 (2H, m) , 3.49-3.30 (2H, m) , 2.92-2.59 (2H, m) , 2.40-2.27 (2H, m) , 1.97-1.67 (4H, m) ; MS (ES -) 374

(M - 1, 100%) . Accurate mass calculated for C ₁₈ H ₂₂ N ₃ C 6 (MH ⁺ ) : 376.1509. Found: 376.1483. Accurate mass calculated for C ₁₈ H ₂₁ N ₃ 0 ₆ Na (MNa ^τ ) : 398.1328. Found:

398.1315

(1S,9S) 9-Benzoylamιno-6, 10-dιoxo-l ,2 ,3 ,4 ,7,8, 9,10- octahydro-6H-pyridazino [1 ,2-a] [1,2] -diazepine-1- carboxylic acid (212e) . TFA (20ml) was added to an ice cold stirred solution of the t-butyl ester 211e <4.15g,

10.34mmol) m dry CH ₂ C1 ₂ (20ml) . The mixture was kept cold for 1.5h then left for 2.5h at rt, concentrated. TFA was removed by repeated concentrations of CH ₂ Cl ₂ \ether and ether solutions of the residue. Finally trituration of the residue with ether afforded 212e 3.05g (85%) of a white glassy solid: mp 118- 126 °C; [α] _D ²⁴ -70.5 ° (c 0.1, CH ₂ C1 ₂ ) . IR (KBr) 3361, 2943, 1737, 1659, 1537, 1426, 1220, 1174; ^X H NMR (CDC1 ₃ ) δ 7.80 (2H, m) , 7.54-7.33 (4H, m) , 8.83 (brs), 5.44 (IH, m) , 5.26-5.13 (IH, m) , 4.66 (IH, m) , 3.59- 3.41 (IH, m) , 2.97, 2.76 (2H, 2m), 2.36 (2H, m) , 1.98 (2H, m) , 1.75 (2H, m) . MS (ES ^_ , m/z) 344 (M - 1, 100*, .

(1S,9S) 6,10-Dιoxo-9(fluoren-9- ylmethyloxycarbonylamino) -1,2,3,4,7,8,9, 10-octahydro- 6H-pyridazιno[1,2-a] [1,2] -dιazepιne-1-carboxylic acid

(212f) , was prepared from 211f in 96% yield by the same method as for 212e: mp 120-126 °C; [α] _D ²⁵ -72.5 °

(c 0.1, CH ₂ C1 ₂ ) . IR (KBr) 3406, 2950, 1725, 1670, 1526, 1449, 1421, 1272, 1248, 1223, 1175, 761, 741; ^λ U NMR (CDCI ₃ ) δ 7.76 (2H, m) , 7.62-7.26 (4H, m) , 6.0 ^~ ?, 5.76 (2H, brs, d, d, J = 2.9), 5.46, 5.36 (IH, 2m), 4.79-4.54 (2H, m) , 4.77 (2H, m) , 4.21 (IH, m) , 3.41

(IH, m) , 2.89 (IH, m) , 2.69 (IH, m) , 2.35 (2H, m) , 1.98, 1.73 (4H, 2m) . MS(ES ^_ , m/z) 462 (M ⁺ - 1, 50 \ , 240 (100%) .

(213) (c) R ¹ = MeCO (214) (c) R ¹ = MeCO

(e) R ¹ = PhCO (e) R ¹ = PhCO

[2i?S,3S(lS, 9S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -9- (acetylamino) -6,10-dιoxo-l,2,3,4 ,7,8,9, 10- octahydro-6H-pyridazino[1 ,2-a] [1 ,2]dιazepιne-1- carboxamide (213c) , was synthesized from 212c by the same method as compound 213e to afford a mixture of diastereomers (193mg, 36%) as colourless crystals: IF. (KBr) 3272, 1799, 1701, 1682, 1650, 1555, 1424, 1412, 1278, 1258, 1221, 1122, 937; ¹ H NMR (CDC1 ₃ ) δ 7.41-7.28 (5H, m) , 6.52 (0.5H, d) , 6.38 (0.5H, d) , 6.22 (0.5H, d) , 5.57 (0.5H, d) , 5.36 (0.5H, s) 5.10-5.05 (IH, m) , 5.00-4.45 (5.5H, m) , 3.19-2.84 (3H, m) , 2.72-2.56 (IH, m) , 2.51-2.25 (2H, m) , 2.02 (3H, s) , 1.98-1.70 (3H, m) , 1.66-1.56 (3H, ) ; Anal. Calcd for C ₂₃ H ₂₈ N ₄ 0 ₇ : C,

58.47; H, 5.97; N, 11.86. Found: C, 58.37; H, 6.09; N, 11.47. MS (ES -) 471 (M-l, 100%) . Accurate mass calculated for C ₂₃ H ₂₉ N ₄ 0 ₇ (MH ⁺ ) : 473.2036. Found: 473.2012. Accurate mass calculated for C ₂₃ H ₂₈ N ₄ 0 Na (Mna ⁺ ) : 495.1856. Found: 495.1853.

[IS, 9S {2RS, 3S) ] 9-Benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-N- (2-benzyloxy-5- oxotetrahydrofuran-3-yl) -6H-pyridazino[1,2-a] [1,2]- dιazepιne-1-carboxamide (213e) . Tributyltm hydride (2.2ml, 8.18mmol) was added dropwise to a solution of

acid 212e (1.95g, 5.6mmol), (3S, 2RS) 3- allyloxycarbonylammo-2-benzyloxy-5-oxotetrahydrcfuran (Chapman, Bioorσ. & Med. Chem. Lett., 2, pp. 615-618 (1992) ; 1.80g, β.lβmmol) and (Ph ₃ P) ₂ PdCl ₂ (50mg) m dry CH ₂ C1 ₂ (36ml), with stirring, under dry nitrogen. After 5 min 1-hydroxybenzotriazole (1.51g, 11.2mmol 6.72ιr_mol) was added followed after cooling (ιce/H ₂ 0) by ethyldimethylaminopropyl carbodii ide hydrochloride (1.29g, 6.72mmol) . After 5 mins the cooling bath was removed and the mixture was kept at room temperature for 4h, diluted with EtOAc, washed with IM HCl, br e, sat. aq. NaHC0 ₃ ^anc ' brine, dried (MgS0 ₄ ) and concentrated. Flash chromatography (silica gel, 0-90? EtOAc in CH ₂ C1 ₂ ) gave the product as a white solid (2.34g, 78%) : IR (KBr) 3499, 1792, 1658, 1536, 1421, 1279, 1257, 1123, 977, 699; ^X H NMR (CDC1 ₃ ) δ 7.81 (2H, m) , 7.54-7.34 (8H, m) , 7.1, 6.97, 6.89, 6.48 (2H, m, d, J 7.7, d, J = 7.5, d, J = 7.6), 5.57, 5.28 (IH, d, J = 5.2, s), 5.23-5.07 (2H, m) , 4.93-4.42, 3.22-2.70, 2.51- 2.26, 2.08-1.69, 1.22 (15H, 5m) . Anal. Calcd for

C ₂₈ H ₃₀ N ₄ O ₇ 0.5H ₂ O: C, 61.87; H, 5.75; N, 10.32. Found C, 62.02; H, 5.65; N, 10.25.

[3S(1S,9S) ] 3- (9-Acetylamιno-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyndazmo- [1 ,2-a] [1,2]dιazepιne-l-carboxamιdo) -4-oxobutanoιc acid

(214c), was synthesized from 213c by a method similar to the method used to synthesize 214e from 213e to provide colourless crystals (140mg, 99 ^J ) : mp 90- 180 °C; [ ] _D ²² -114 (c 0.10, MeOH) ; IR (KBr) 3334, 3070, 2946, 1787, 1658, 1543, 1422, 1277, 1258; ¹ H NMR :d ⁶ - DMSO) δ 8.66 (IH, ) , 8.18 (IH, d) , 6.76 (IH, s; , 5.08 (IH, m) , 4.68 (IH, m) , 4.30 (IH, m) , 2.92-2.70 (2H, m, ,

2.27-2.06 (3H, ) , 1.95-1.72 (4H, m) , 1.85 (3H, s 1.58 (2H, m) ; MS (ES -) 381 M-l, 100%) ; Accurate mass calculated for C ₁₆ H ₂₃ N ₄ 0 ₇ (MH ^+' 383.1567. Found: 383.1548.

[3S(1S,9S)] 3- (9-Benzoylamιno-6, 10-dιoxo-

1,2,3,4 ,7,8,9,10-octahydro-6H-pyπdazιno[l,2-a] [1,2] - dιazepιne-1-carboxamιdo) -4-oxobutanoιc acid (214e) . A mixture of 213e (2.29g, 4.28mmol), 10% palladium on carbon (1.8g) and MeOH (160ml) was stirred under H ₂ at atmospheric pressure for 6.3h. After filtering and concentrating the hydrogenation was repeated with fresh catalyst (1.8g) for 5h. After filtering and concentrating the residue was triturated with diethyl ether, filtered and washed well with ether to give 214e as a white solid (1.67g, 88%) : mp 143-147 °C; [αa] _D ²³ - 125 ° (c 0.2, CH ₃ 0H) . IR (KBr) 3391, 1657, 1651, 1538, 1421, 1280, 1258; ¹ H NMR (CD ₃ 0D) δ 7.90 (2H, m) , 7.63- 7.46 (3H, m) , 5.25 (IH, m) , 5.08-4.85 (IH, m) , 4.68- 4.53 (2H, m) , 4.33-4.24 (IH, m) , 3.62-3.44, 3.22-3.11, 2.75-2.21, 2.15-1.92, 1.73-1.66 (11H, 5m) . Ana... Calcd for C ₂₁ H ₂₄ N ₄ 0 ₇ H ₂ 0: C, 54.54; H, 5.67; N, 12.11. Found C, 54.48; H, 5.63; N, 11.92.

619

- 393 -

(215) (216)

(c) = MeCO (217)

(d) R = PhCH ₂ OCO

(e) = PhCO

[3S,4RS(1S,9S) ] t-Butyl 3- [9-acetylamino-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazino- [1 ,2-a] [1,2]diazepine-l-carboxamido) -5- (2 , 6- dichlorobenzoyloxy) -4-hydroxypentanoate (215c), was synthesized from 214c by the same method as compound 215e, to afford a mixture of diastereomers as a white glassy solid (398mg, 84%) : IR (KBrj 3338, 2977, 173b, 1658, 1562, 1541, 1433, 1368, 1277, 115C; ^∑ H NMR (CDC1 ₃ ) δ 7.36-7.32 (3H, m) , 6.91 (IH, d) , 6.30 (IH, d) , 5.15-5.09 (IH, m) 5.01-4.88 (IH, m) , 4.61-4.44 (2H, m) , 4.37-4.08 (3H, m) , 3.32-3.18 (IH, m) , 3.04-2.89 (IH, m) , 2.82-2.51 (4H, m) , 2.39-2.29 (IH, m) , 2.08- 1.64 (4H, m) 2.02 (3H, s) ; Anal. Calcd for

C ₂₈ H ₃₄ N ₄ C1 ₂ 0 ₉ : C, 52.26; H, 5.64; N, 8.71. Found: C, 52.44; H, 5.87; N, 8.16. MS (ES -) 645/3/1 (M-l, 26-), 189 (81), 134 (100) . Accurate mass calculated for C ₂₈ H ₃₇ N ₄ C1 ₂ 0 ₉ (MH ⁺ ) : 643.1938. Found: 643.1924. 5 Accurate mass calculated for C ₂₈ H ₃₆ N ₄ Cl ₂ OgNa (MNa ) 665.1757. Found: 665.1756.

[3S,4RS(1S,9S) ] t-Butyl 3- (9-benzyloxycarbonylamιno- 6, 10-dιoxo-l,2,3,4,7,8,9,10-octahydro-6H- pyπdazιno[l,2-a] [1,2]dιazepιne-l-carboxamιdo) -5- (2,6- 0 dichlorobenzyloxy) -4-hydroxypentanoate (215d) , was synthesized from 214d by the same method as compound 215e to afford a mixture of diastereomers (657mg, 70.; as a glassy white solid: IR (KBr) 3420, 3361, 2975, 2931, 1716, 1658, 1529, 1434, 1367, 1348, 1250, 1157, 5 1083, 1055; ^: H NMR (CDC1 ₃ ) δ 7.32 (8H, m) , 7.14 (IH, d) , 5.81 (IH, d) , 5.15 (IH, m) , 5.07 (2H, s), 4.74-4.65

(IH, m) , 4.58-4.22 (4H, m) , 4.15-4.06 (IH, m) , 3.72

(IH, m) , 3.32-3.21 (IH, m) , 3.04-2.94 (IH, ) , 2.69- 2.52 (3H, m) , 2.33-2.27 (IH, m) , 1.95-1.59 (4H, m) , 0 1.28 (9H, s) ; Anal. Calcd for C ₃₄ H ₄₀ N ₄ Cl ₂ O ₁₀ • 0 • 5 H ₂ 0:

C, 54.70; H, 5.54; N, 7.50. Found: C, 54.98; H, 5.59; N, 7.24. MS (ES -) 737/5/3 (M-l, 22%), 193/1/89

(100) . Accurate mass calculated for C ₃₄ H ₄₁ N ₄ C1 ₂ 0 ₁₀

(MH ⁺ ) 735.2120. Found: 735.2181.

5 [3S,4JRS(1S, 9S) ] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazmo- [1 ,2-a] [1,2]dιazepιne-l-carboxamιdo) -5- (2 , 6- dichlorobenzyloxy) -4-hydroxypentanoate (215e) ,

Tributylt hydride (4.6ml; 11.4mmol) was added ^ dropwise to a stirred mixture of (3S, A RS) t-Butyl (N- allyioxycarbonyl ) -3-amιno-5- (2, 6-oιchlorobenzoyloxy) -4-

hydroxypentanoate (prepared by a method similar to the method described m Revesz et al . , Tetrahedron. Lett.. 35, pp. 9693-9696 (1994) ) (2.64g; 5.7mmol), (Ph ₃ P) ₂ PdCl _; (5Omg), CH ₂ C1 ₂ (100ml) and DMF (20ml) at room temperature. The mixture was stirred for a further 10mm was then 1-hydroxybenzotrιazole (1.54g, 11.4mmol)was added. The mixture was cooled to G C then ethyldimethylammopropyl carbodiimide hydrochloride (1.31g; 6.84mmol) added. The mixture was kept at this temperature for 15mm then at room temperature for 17h. The mixture was diluted witn EtOAc (300ml) , washed with IM HCl (2x100ml), sat. aq. NaHC0 ₃ (3x100ml) and brme (2x100ml), dried (MgS0 ₄ ) anc concentrated. The residue was purified by flash chromatography (2-5% (MeOH/CH ₂ Cl ₂ ) to afford 3.24g (81%) of 215e as a glassy solid: mp 106-110 °C; IR (KBr) 3354, 1737, 1659, 1531, 1433, 1276, 1150; ¹ H NMR (CDC1 ₃ ) δ 7.80 (2H, dd, J = 7.9 and 1.5), 7.75-7.26 (6H, m) , 7.14-6.76 (2H, m) , 5.30-5.02 (2H, m) , 4.63- 4.11 (5H, m) , 3.44-3.26 (2H, m) , 3.10-2.30 (5H, m) , 2.10-1.60 (5H, m) , 1.44 (9H, s) ; Anal. Calcd for C ₃₃ H ₃₈ C1 ₂ N ₄ 0 ₉ . 0.75H ₂ O: C, 55.12; H, 5.54; N, ^.79; Cl, 9.86. Found: C, 55.04; H, 5.34; N, 7.80; Cl, 10.24. MS (ES +) 709/7/5 (M + 1), 378 (59), 324 (64) , 322 (100) .

[3S(1S,9SH t-Butyl 3- (9-acetylammo-6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyrιdazιno[l ,2-a] [1,2]- diazepine-1-carboxamido) -5- (2 , 6-dιchlorobenzoyloxy) -4- oxopentanoate (216c) , was synthesized from 215c cy the same method as compound 216e as a glassy wnite solid (300mg, 83^) : mp 80-125 °C; _c.j _n ²³ -89.1 ( _C 1.08, CH ₂ C1 ₂ ); IR (KBr) 3356, 2979, 2935, 1740, 1659, 1532,

1434, 1369, 1276, 1260, 1151; ^X H NMR (CDC1 ₃ ) δ 7.39- 7.32 (3H, m) , 7.13 (IH, d) , 6.34 (IH, d), 5.22-5.17 (IH, m) , 5.11 (IH, d) , 5.04 (IH, d) , 4.99-4.88 (2H, n) , 4.64-4.52 (IH, m) , 3.29-3.11 (IH, m) , 3.05-2.67 (4H, m) , 2.39-2.29 (IH, m) , 2.02 (3H, s), 1.98-1.75 (4H, m) , 1.46 (9H, s); Anal. Calcd for C ₂₈ H ₃₄ N ₄ Cl ₂ O _g : C, 52.42; H, 5.34; N, 8.73. Found: C, 52.53; H, 5.70; N, 7.85. MS (ES -) 643/41/39 (M-l, 100%) . Accurate mass calculated for C ₂₈ H ₃₅ N ₄ C1 ₂ 0 ₉ (MH ⁺ ) : 641.1781. Found: 641.1735. Accurate mass calculated for C ₂₈ H ₃₄ N ₄ Cl 0 ₉ Na (Mna ⁺ ) : 663.1601. Found: 663.1542.

[3S(1S,9S)] t-Butyl 3- (9-benzyloxycarbonylam o-6, 10- dιoxo-1 ,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazιno- [1 ,2-a] [1 ,2]dιazepιne-1-carboxaπudo) -5- (2, 6- dichlorobenzoyloxy) -4-oxopentanoate (216d) , was synthesized from 215d by the same method as compound 216e to afford 216d as a white glassy solid (688mg, 68%) : mp 90-170 °C; [α] _D ²⁵ -83.4 (c 1.01, CH ₂ C1 ₂ ) ; IR (KBr) 3338, 2933, 1736, 1670, 1525, 1433, 1417, 1368, 1258, 1151, 1056, 1031; ¹ H NMR (CDC1 ₃ ) δ 7.33 (8H, m) , 7.18 (IH, d) , 5.65 (IH, d) , 5.19 (IH, m) , 5.09 (2H, s, , 4.98-4.86 (IH, m) , 4.82-4.49 (2H, d) , 3.30-3.07 (IH, m) , 3.05-2.59 (4H, m) , 2.42-2.27 (IH, m) , 2.18-1.59 (5H, m) , 1.42 (9H, s) ; MS (ES-) 737/5/3 (M, 13 , 185 (100) .

[3S(1S,9S)] t-Butyl 3- (9-benzoylamιno-6 , 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazιno-

[1,2-a] [1,2]dιazepme-1-carboxamιdo) -5- (2, 6- dichlorobenzoyloxy) -4-oxopentanoate (216e) . Dess- Martin reagent (3.82g; 9.0mmol) was added to a stirred solution of the alcohol 215e (3.17g; 4.5mmol; m

CH C1 ₂ (100ml) . The mixture was sirred for lh, diluted with EtOAc (300ml), then washed with a 1:1 mixture of sat. Na ₂ S 0 ₃ and sat. NaHC0 ₃ (100ml) followed by br e (100ml) . The mixture was dried (MgS0 ₄ ) then concentrated. The residue was purified by flash chromatography to afford 2.2g (70%) of 216e as a colourless solid: mp 102-107 °C; [ ] _D ³² -82.5 (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3374, 2937, 1739, 1661, 1525, 1433, 1275, 1260, 1152; ¹ H NMR (CDC1 ₃ ) δ 7.85-7.78 (2H, m) , 7.57-7.32 (6H, m) , 7.09 (IH, d, J = 7.9) , 7.01 (IH, d, J 7.3), 5.25-5.16 (IH, m) , 5.16-5.05 (IH, m) , 5.15 (IH, d), 5.03 (IH, d), 4.99-4.90 (IH, m) , 4.68-4.54 (IH, ) , 3.31-3.17 (IH, m) , 3.17-2.72 (4H, m) , 2.45-2.35 (IH, ) , 2.30-1.66 (5H, m) , 1.44 (9H, s) ; Anal. Calcd for C ₃₃ H ₃₆ C1 ₂ N ₄ 0 ₉ . 0.5H ₂ O: C, 55.62; H, 5.23; N, 7.86; Cl, 9.95. Found: C, 55.79; H, 5.15; N, 7.80; Cl 9.81. MS (ES +) 729/7/5 (M + Na), 707/5/3 (M + 1), 163 (100%) .

[3S(1S,9S) ] 3- (9-Acetylam o-6,10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyridazino- [1,2-a] [1,2]diazepιne-l-carboxamido) -5- (2, 6- dichlorobenzoyloxy) -4-oxopentanoic acid (217c), was synthesized from 216c by the same method as compound 217e as a glassy white solid (166mg, 66%) : mp 85-175 °C; [ ] _D ²⁵ -156 (c 0.13, MeOH) ; IR (KBr) 3373, 2929, 1742, 1659, 1562, 1533, 1433, 1412, 1274, 1266, 1223, 1197, 1145, 1138; ¹ H NMR (CD ₃ CD) δ 7.38 (3H, s. , 5.14-5.03 (IH, m) , 4.49-4.32 (2H, m) , 3.50-3.27 (IH, m , 3.11-2.92 (IH, m) , 2.84-2.62 (2H, m) , 2.46-2.11 (2H, m) , 2.05-1.46 (5H, m) , 1.92 (3H, s) ; Anal. Calco for C ₂₄ H ₂₆ N ₄ C1 ₂ 0 ₉ .H ₂ 0: C, 47.77; H, 4.68; N, 9.29.

Found: C, 47.75; N, 4.59; N, 9.07. MS (ES +) 627/5/3 (M-K, 21%), 611/9/7 (M+Na, 87), 589/7/5 (M ^* -1, ^" 71 j ,

266 (100) ; Accurate mass calculated for C ₂₄ H ₂₇ N ₄ C1 ₂ 0 ₉ (MH ⁺ ) : 585.1155. Found: 585.1134.

[3S(1S,9S) ] 3- (9-Benzyloxycarbonylamino-6,10-dioxo- 1,2,3, ,7,8,9, 10-octahydro-6H-pyridazino[l,2-a] [1,2] - diazepine-1-carboxamido) -5- (2,6-dichlorobenzoyloxy) -4- oxopentanoic acid (217d) , was synthesized from 216d by the same method as compound 217e to afford 217d as a white glassy solid (31Omg, 96%) : mp 85-110 °C; [ ] _D ²⁴ -85.9 (c 0.13, MeOH) ; IR (KBr) 3351, 2945, 1738, 1669, 1524, 1433, 1258, 1147, 1057; ^X H NMR (CD ₃ 0D) δ 7.56 (4H, m) , 7.45 (5H, m) , 5.32 (2H, m) , 5.20 (2H, s), 4.76-4.48 (3H, m) , 3.65-3.38 (3H, m) , 3.27-3.09 (2H, m) , 3.03-2.89 (2H, m) , 2.65-2.24 (3H, m) , 2.19-1.62 (5H, m) ; MS (ES -) 679/7/5 (M-l, 100%) ; Accurate mass calculated for C ₃₀ H ₃₁ N ₄ Cl ₂ O ₁₀ (MH ⁺ ) : 677.1417. Found: 677.1430.

[3S(1S,9S) ] 3- (9-Benzoylamino-6,10-dioxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazιno[l,2-a] [1,2]- diazepine-1-carboxamido) -5- (2,6-dichlorobenzoyloxy) -4- oxopentanoic acid (217e) , TFA (25ml) was added dropwise to an ice cold stirred solution of the ester 216e (2.11g, 3.0mmol) . The mixture was stirred at 0 °C for 20min then at room temperature for lh. The mixture was evaporated to dryness then coevaporated with ether three times. Addition of dry ether (50 ml) and filtration afforded 1.9g (98?) of 217e as a colourless solid: mp 126-130 °C; [ ] _D ³ ° -122.0 (c 0.1, MeOH) ; IP (KBr) 3322, 1740, 1658, 1651, 1532, 1433, 1277, 1150; ¹ H NMR (D ₆ -DMSO) δ 8.87 (IH, d, J = 7.4), 8.61 (IH, d, J = 7.8), 7.92-7.86 (2H, ) , 7.65-7.43 (6H, ) , 5.25- 5.12 (3H, m) , 4.94-4.60 (2H, m) , 4.44-4.22 (IH, m) ,

619

- 399 -

3.43-3.10 (IH, m) , 3.00-2.52 (3H, m) , 2.45-2.10 (3H, m) , 2.10-1.75 (2H, m) , 1.75-1.50 (2H, m) ; Anal. Calcd for C ₂₉ H ₂₈ C1 ₂ N ₄ 0 ₉ . 1H ₂ 0: C, 52.34; H, 4.54; N, 8.42; Cl, 10.66. Found: C, 52.02; H, 4.36; N, 8.12; Cl, ^• 10.36. MS (ES -) 649/7/5 (M - 1), 411 (100%) .

220b

[3S,4_RS(1S,9S) ] t-Butyl 4- [5- (2 , 6-dichlorophenyl) - oxazol-2-yl] -3- (6, 10-dioxo-9-methylsulphonylamιno- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazιno-

[1 ,2-a] [1,2]dιazepιne-1-carboxamιdo) -4-hydroxybutanoate

(218b) , was prepared from the acid 212b and 99 m an analogous way to compound 215e to afford a mixture cf diastereomers (865mg, 80%) as a colourless solic: IP (KBr) 3296, 2974, 1723, 1659, 1544, 1518, 1430, 1394, 1370, 1328, 1273, 1256, 1156, 1134; ^X H NMR (CDC1 ₃ , δ 7.45-7.28 (4H, m) , 7.26-7.15 (2H, m) , 5.26-5.1' (2H, m) , 4.80-4.6 ^{^} (IH, m) , 4.59-4.42 (2H, ) , 3.32-3.17 (IH, m) , 2. ^Q 6 (3H, 2xs), 2.93-2.79 (IH, m) , 2.71-2.53

(4H, m) , 2.38-2.28 (IH, m) , 2.07-1.81 (4H, m) ; Anal. Calcd for C ₂₈ H3 ₅ N ₅ C1 ₂ 0 ₉ S . 0.5 H ₂ 0: C, 48.21; H, 5.20; N, 10.03. Found: C, 48.35; H, 5.26; N, 9.48. MS (ES +) 714/2/0 (M + Na, 25%) , 692/90/88 (M ⁺ + 1, 51) , 636/4/2 (38) , 246 (100) . Accurate mass calculated for C ₂₈ H ₃₆ N ₅ C1 ₂ 0 ₉ S (MH ⁺ ) : 688.1611. Found: 688.1615.

[3S(1S, 9S) ] t-Butyl 4- [5- (2 , 6-dichlorophenyl) -oxazol-2- yl] -3- (6, 10-dιoxo-9-methylsulphonylamιno- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazιno [1 ,2-a] [1 ,2]di azepιne-1-carboxamιdo) -4-oxobutanoate (219b) , was prepared from 218b in an analogous way to compound 216e as an off-white powder (675mg, 81%) : mp 100-200 °C; [c.] _D ²⁴ -84.9 (c 1.01, CH ₂ C1 ₂ ) ; IR (KBr) 3336, 2978, 2936, 1719, 1674, 1510, 1433, 1421, 1369, 1329, 1274, 1257, 1155, 991, 789; ¹ H NMR (CDCl ₃ ) δ 7.47-7.38 (4H, m) , 7.24 (IH, d) , 5.61-5.53 (IH, ) , 5.48 (IH, d) , 5.38-5.30 (IH, m) , 4.67-4.45 (2H, m) , 3.48-3.18 (2H, m) , 3.04-2.90 (2H, m) , 2.97 (3H, s), 2.69-2.54 (IH, m. , 2.42-2.32 (IH, m) , 2.22-2.15 (IH, m) , 2.07-1.93 (3H, m) , 1.71-1.65 (2H, m) , 1.38 (9H, s) ; Anal . Calcd for C ₂₈ H ₃₃ N ₃ C1 ₂ 0 ₉ S: C, 48.98; H, 4.84; N, 10.20; S, 4.67. Founo: C, 48.73; H, 4.95; N, 9.65; S, 4.54. MS (ES +) 692/90/88 (M ⁺ + 1, 100%), 636/4/2 (71) . Accurate mass calculated for C ₂₈ H ₃₄ N ₅ C1 ₂ 0 ₉ S (MH ⁺ ) : 686.1454. Found: 686.1474.

[3S(1S,9S) ] 4-[5-(2,6-Dιchlorophenyl)oxazol-2-yl]-3- (6 , 10-dιoxo-9-methylsulphonylamιno-l ,2,3,4,7,8,9,10- octahydro-6H-pyrιdazιno [1 ,2-a] [1 ,2]dιazepιne-l- carboxamido) -4-oxobutanoιc acid (220b), was prepared from 219b in an analogous way to compound 217e as a pale cream powder (396mg, 87 ) : mp 100-200 °C; _ι Cχ _τ X

129 (c o.i: MeOH) IR (KBr) 3310, 3153, 1713, 1667,

1557, 1510, 1432, 1421, 1329, 1273, 1258, 1221, 1193, 1153, 1134, 992, 789; ^X H NMR (d ⁶ DMSO) δ 7.88 (IH, s), 7.81-7.60 (4H, m) , 5.49-5.28 (IH, m) , 5.24-5.14 (IH, m) , 4.46-4.22 (2H, ) , 3.30-3.03 (2H, m) , 2.97-2.76 (3H, m) , 2.96 (3H, s), 2.46-2.24 (IH, m) , 2.16-2.05 (IH, m) , 2.03-1.78 (3H, m) , 1.68-1.46 (2H, m) ; MS (ES-) 632/30/28 (M - 1, 68%) , 149/7/5 (100) . Accurate mass calculated for C ₂ H ₂₆ N ₅ C1 ₂ 0 ₉ S (MH 630.0828. Found: 630.0852.

223b R-, = MeS0 ₂ 223e R- = PhCO

[3S,4i?S(lS,9S) ] t-Butyl 4- (5 , 7-dιchlorobenzoxazol-2- yl) -3- (6, 10-dioxo-9-methylsulphonylamιno- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazmo-

[1,2-a] [1 ,2]diazepine-l-carboxamido) -4-hydroxybutanoate

(221b), was prepared from the acid 212b and (3S, 4 RS) t- butyl N- (allyloxycarbonyl) -3-amino-4-hydroxy-4- (5, 7- dichlorobenzoxazol-2-yl) butanoate (204) by an analogous 5 method as that used for compound 215e to afford a mixture of diastereomers (460mg, 70%) as a glass: IR (film) 3325, 1725, 1664, 1453, 1399, 1373, 1327, 1274, 1256, 1155; ¹ H NMR (CDC1 ₃ ) δ 7.57 (IH, m) , 7.36 (2H, m) , 6.06 (IH, t), 5.29 (2H, m) , 4.79 (IH, m) , 4.47 (IH, 0 m) , 3.23 (IH, m) , 2.97 and 2.94(3H combined, 2 x s), 2.9-2.4 (4H, m) , 2.30 (IH, m) , 1.96 (4H, m) , 1.41 and 1.37 (9H combined, 2 x s) . MS ES Da/e 660 (M - 1) ^" Cl ^"'5 100%, 662 (M - 1) ^~ Cl ³⁷ .

[3S,4.RS(1S,9S) ] t-Butyl 3- (9-benzoylamino-6, 10-dιoxo- 5 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazino-

[1 ,2-a] [1 ,2]diazepine-l-carboxamido) -4- (5,7- dichlorobenzoxazol-2-yl) -4-hydroxybutanoate (221e) , was prepared from the acid (212e) and (3S, ARS) t-butyl N- (allyloxycarbonyl) -3-ammo-4-hydroxy-4- (5, 7- 0 dichlorobenzoxazol-2-yl) butanoate (204) by an analogous method as that used for compound 215e to afford a mixture of diastereomers (613mg, 87") as a glass: IR (film) 3328, 1729, 1660, 1534, 1454, 1422, 1399, 1276, 1254, 1155; ^X H NMR (CDC1 ₃ ) δ 7.80 (2H, d) , 7.60-7.35 5 (5H, m) , 7.05 (2H, m) , 5.13 (3H, m), 4.74 (IH, m; , 4. (IH, m) , 3.25 (IH, m) , 3.1-2.6 (5H, m) , 2.33 (IH, m) , 2.1-1.5 (5H, m) , 1.43 and 1.41 (9H combined, 2 κ s) . MS ES ⁺ Da/e 688 (M + 1)' Cl ³⁵ 55%, 690 (M + 1) ⁺ Cl ³⁷

C [3S(1S,9S) ] t-Butyl 4- (5,7-dichlorobenzoxazol-2-yl) -3- (6,10-dιoxo-9-methylsulphonylamιno-l ,2,3,4,7,8,9, 10-

octahydro-6H-pyrιdazmo[l ,2-a] [1 ,2]dιazepιne-l- carboxamido) -4-oxobutanoate (222b) , was prepared from 221b by an analogous method as that used for compound 216e to afford a colourless glass (371mg, 86%) : [α] _D -81.0 (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3324, 2979, 2936, 1726, 1664, 1394, 1370, 1328, 1155, 991; ^X H NMR (CDC1 ₃ ) δ 7.78 (IH, d) , 7.57 (2H, m) , 5.87 (IH, d) , 5.69 (IH, m) , 5.47 (IH, m) , 4.55 (2H, ) , 3.24 (2H, m) , 3.0 (5H, m + s), 2.59 (IH, m) , 2.39 (IH, m) , 2.2 - 1.7 (4H, m) , 1.65 (IH, m) , 1.40 (9H, s) .

[3S(1S,9S)] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyπdazιno- [1,2-a] [1,2]dιazepιne-l-carboxamιdo) -4- (5,7- dιchlorobenzoxazol-2-yl) -4-oxobutanoate (222e) , was prepared from 221e by an analogous method as that used for compound 216e to afford a colourless glass (480mg, 84%) : [ ] _D ²⁵ -86.4 ° (c 0.1 CH ₂ C1 ₂ ) ; IR (KBr) 3337, 2978, 2938, 1728, 1657, 1534, 1456, 1422, 1395, 1370, 1277, 1250, 1154; ¹ H NMR (CDC1 ₃ ) δ 7.80 (3H, m) , 7.50 (4H, m) , 7.20 (IH, d) , 7.02 (IH, d) , 5.60 (IH, m,, 5.2P (IH, m) , 5.15 (IH, ) , 4.11 (IH, m) , 3.34 (2H, IT) , 2.96 (3H, ) , 2.40 (IH, m) , 2.20 (IH, ) , 1.92 (2H, m , 1.67 (2H, m) , 1.38 (9H, s) . MS ES ^" Da/e 684 (M - 1; ^" Cl ³⁵ 47%, 686 (M - 1) ^~ Cl ³⁷ 32%.

[3S(1S,9S)] 4-(5,7-Dιchlorobenzoxazol-2-yl) -3- (6,10- dιoxo-9-methylsulphonylamιno-l ,2,3,4,7,8,9, 10- octahydro-6H-pyrιdazmo[l ,2-a] [1 ,2]d azepιne-l- carboxamido) -4-oxobutanoιc acid (223b), was prepared from 222b by an analogous method a? that used for compound 217e to afford an off-white solid (257mg,

78%) : [ ] _D ²⁵ -105.7 ° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr 3321

1723, 1663, 1407, 1325, 1151, 992; ^λ U NMR (D ₆ -DMSO) δ

8.96 (IH, d), 8.18 (IH, d) , 7.96 (IH, d) , 5.50 (IH, m) ,

5.15 (IH, m) , 4.30 (2H, m) , 3.06 (2H, m) , 2.87 (5H, m + s), 2.29 (IH, m) , 1.99 (4H, m) , 1.56 (2H, m) .

[3S(1S,9S) ] 3-(9-Benzoylamino-6,10-dioxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyridazino-

[1,2-a] [1,2]diazepine-l-carboxamido) -4- (5,7- dichlorobenzoxazol-2-yl) -4-oxobutanoic acid (223e) , was prepared from 222e by an analogous method as that used for compound 217e to afford a pale cream solid (3ilmg,

78%; mp 167-180 °C; [α] _D 23 -88.6 ° (c 0.1 CH ₂ C1 _; IR

(KBr) 3331, 1724, 1658, 1534, 1458, 1421, 1279, 1256, 991; ¹ H NMR (CDC1 ₃ ) δ 7.77 (4H, m) , 7.4 (5H, m) , 5.57 (IH, bs), 5.33 (IH, bs), 5.47 (IH, q) , 4.56 (IH, bd) , 3.60 (2H, m) , 3.20 (3H, m) , 2.76 (IH, ) , 2.36 (IH, dd) 2.0 (3H, m) , 1.66 (IH, m) MS ES Da/e 621 (M

35 37

Cl 7%, 630 (M 1) Cl 2.3% 584 100%

224e R- PhCO, X =- S 226e Rτ_ = PhCO, X

225e Ri PhCO, X = 0 227e R _x = PhCO, X

[3S(1S,9S) ] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo-

1,2,3,4,7,8,9, 10-octahydro-6H-pyr daz no[l ,2-a] [1,2]- diazepine-1-carboxamido) -5- (2-chlorophenyl)methylthio- 4-oxopentanoate (224e) . 1-Hydroxybenzotrιazole :0.23g,

1.71mmol) and ethyl dimethylammopropyl carbodiimide hydrochloride was added to a stirred solution of the acid 212e (0.295g, 0.853mmol) in THF (5ml) . After 5mm water (0.5ml) was added followed, after a further 7mm, by the addition of a solution of (3S) t-butyl-3- allyloxycarbonylammo-5- (2-chloro-phenyl)methylthιo-4- oxopentanoate (123, 0.478g, 1.02mmol) and (PPh ₃ ) ₂ PdCl ₂ (20mg) THF (2ml) . Tπbutyltm hydride (0.65ml, 2.33mmol) was added dropwise during 20mm. The mixture was kept for 4.5h then diluted with EtOAc, washed with IM HCl, br e, sat. aq. NaHC0 ₃ and then brme again. The mixture was dried (MgS0 ) and concentrated. The residue was triturated several times with hexane, which was decanted and discarded, then purified by flash chromatography (10-100% EtOAc in CH ₂ C1 ₂ ) to afford 0.2g (35%) of a white glassy solid: mp 70-72 °C; [ ] _D ²⁶ - 82.5 ° (c 0.02, CH ₂ C1 ₂ ) . IR (KBr) 3404, 1726, 1660, 1534, 1524, 1422, 1277, 1254, 1154; ^λ NMR (CDC1 ₃ ) δ 7.83-7.78 (2H, m) , 7.7, 7.75-7.32, 7.26-7.20 (7H, 3m) , 7.12 (IH, d, J = 8.2), 7.01 (IH, d, J = 7.3) , 5.23-5.08 (2H, m) , 5.03-4.94 (IH, m) , 4.62 (IH, dt, J = 14.5) , 3.78 (2H, m) , 3.38-3.29 (IH, m) , 3.26 (2H, s) , 3.06- 2.82 (4H, m) , 2.71 (IH, dd, J = 17.2, 4.5) , 2.39 (IH, dd, J = 13.2, 6.5) , 2.15-1.83, 1.73-1.63 (5H, m) , 1.45 (9H, s) . Anal. Calcd for C3 ₃ H ₃₉ ClN ₄ 0τS : C, 59.05; H, 5.86; N, 8.35. Found: C, 59.00; H, 5.80; N, 7.92.

[ 3RS, (1S,9S)] t-Butyl 3- (9-benzoylammo-6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyrιdazmo[l ,2-a] [1,2] - dιazepιne-1-carboxamιdo) -5- (2-chlorophenylmethyloxy) -4- oxopentanoate (225e) , was prepared frorr acid 212e anc ι3S) t-butyl N- (allyloxycarbonyl) -3-amιno-5- (2- chloropnenylmethyloxy) -4-oxopentanoate (201) using a

method similar to that used for compound 224e, to afford 40mg (23%) of a glassy solid: ¹ H NMR (CDC1 ₃ ) δ 7.83-7.73 (2H, m) , 7.67-7.10 (9H, m) , 5.23-5.09 (2H, ) , 4.59 (IH, m) , 4.45-4.22 (2H, m) , 3.7-3.19, 3.08- 2.72, 2.71-2.47, 2.05-1.85, 1.72-1.61, 1.45-1.26 (20H, 6m) .

[3S(1S,9S) ] 3- (9-Benzoylamino-6, 10-dioxo-

1,2,3, ,7,8,9,10-octahydro-6H-pyridazino[l,2-a] [1,2] - diazepine-1-carboxamido) -5- (2-chlorophenyl)methylthio- 4-oxopentanoic acid (226e) , was prepared from 224e by an analogous method as that used for compound 217e which afforded 0.22g (81%) of an off-white solid: mp 95-100 °C; [α] _D ²³ -95.6 ° (c 0.2, CH ₂ C1 ₂ ) . IR (KBr) 3393, 1720, 1658, 1529, 1422, 1279; ^X H NMR (D ₆ -DMS0) δ 8.80 (IH, d, J = 7.5), 7.89 (2H, m) , 7.7 (IH, d, J = 7.7), 7.56-7.28 (7H, m) , 5.10 (IH, m) , 4.87-4.73 (2H, m) , 4.39 (IH, m) , 3.77 (2H, m) , 3.44, 3.35 (2H, +H ₂ 0, 2m), 2.97-2.56, 2.2, 1.92, 1.61 (11H, 4m) . Anal. Calcd for C ₂₉ H ₃₁ C1N ₄ 0 ₇ S 0.5H ₂ O: C, 55.02; H, 5.10; N, 8.85. Found: C, 55.00; H, 5.09; N, 8.71.

[ 3RS, (1S,9S)] 3-Benzoylamino-6,10-dioxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyridazino[1,2-a] [1,2]- diazepine-1-carboxamido) -5- (2-chlorophenylmethyloxy) -4- oxopentanoic acid (227e) , was prepared from 225e by an analogous method as that used for compound 217e. The product was further purified by flash cnromatography (0-5?- MeOH/CH ₂ Cl ₂ ) to afford 19mg (81.) of a glassy solid: ¹ H NMR (CDC1 ₃ ) δ 7.79 (2H, m) , 7.66-7.18 (9H, m) , 5.30-5.10 (2H, m) , 4.85 (IH, ) , 4.65 (2H, i, 4.53 (IH, m) , 4.28 (2H, m) , 3.28, 3.01, 2.72, 2.33, 1.94, 1.60 (11H, 6m) . MS (ES ^~ , m/z) 597 (M ⁺ - 1, 100' ) .

[3JS,4RS(1S,9S) ] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyridazino-

[1,2-a] [1,2] -diazepine-1-carboxamido) -5- luoro-4-

(228e) . 1-Hydroxybenzotriazole (0.23g, 1.68mmol _; followed by ethyldimethylammopropyl carbodiimide hydrochloride (0.21g, 1.09mmol) were added to a stirred solution of the acid 212e (0.29g, 0.84mmol) CH ₂ CI~

(3ml) at rt . The mixture was kept for lOmin then a solution of ( 3RSARS) t-butyl 3-ammo-5-fIuoro-4- hydroxypentanoate (Revesz, L. et al . Tetrahedron Lett., 52, pp. 9693-9696 (1994) ; 0.29g, 1.40mmol) in CH ₂ C1 ₂

(3ml) was added followed by 4-dιmethylamιnopyrid ne

(lOmg) . The solution was stirred for 17h, diluted with EtOAc, washed with IM HCl, brine, sat. aq. NaHC0 ₃ and brine again, dried (MgS0 ₄ ) and concentrated. The residue was purified by flash chromatography (50-100% EtOAc/CH ₂ Cl ₂ and 5% MeOH/EtOAc) to afford 0.25g (565=) of a white glassy solid: IR (KBr) 3343, 1726, 1658, 1536, 1426, 1279, 1257, 1157; ^λ E NMR (CDC1 ₃ ) δ 7.84- 7.79 (2H, m) , 7.57-7.40 (3H, m) , 7.05-6.92, 6.73 (2H, 2m) , 5.17-5.04 (2H, m) , 4.56, 4.35-4.21, 4.04 (5H, 3m) , 3.36, 3.09-2.34, 2.00 (11H, 3m), 1.46 (9H, s) . Anal. Calcd for C ₂₆ H ₃₅ FN ₄ 0 ₇ 0.5H ₂ O: C, 57.45; H, 6.65; N, 10.31. Found: C, 57.64; H, 6.56; N, 10.15.

[3_ S,4.RS(1S,9S) ] t-Butyl 3- (9-benzoylamino-6, 10-dioxo- 1,2,3,4 ,7,8,9, 10-oσtahydro-6H-pyridazιno- [1,2-a] [1 ,2] -diazepιne-1-carboxamido) -5-fluoro-4- oxypentanoate (229e) was prepared from 228c by an analogous method to that used for compound 216e. After purification by flash chromatography (30-50% EtOAc/CH ₂ Cl ₂ ) the product was obtained as a white glassy solid (0.194g, 89%) : IR (KBr) 3376, 1728, 1659, 1529, 1424, 1279, 1256, 1156.

[ 3RS, (1S,9S)] 3- (9-Benzoylamιno-6,10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyrιdazιno[l ,2-a] [1,2]- diazepme-1-carboxamido) -5-fluoro-4-oxopentanoic acid (230e) , was prepared from 229e by an analogous method to that used for compound 217e to afford 230e as a white glassy solid (100?) : mp 105-125 °C; [α] _D ²³

-91.4 ° (c 0.72, CH ₃ OH) . IR (KBr) 3336, 1789, 1 ⁷ 37, 1659, 1535, 1426, 1279, 1258, 1186; H NMR (CD ₃ 05) δ 7.71-7.68 (2H, m) , 7.37-7.23 (3H, m , 5.02, 4.88-4.63,

4.37-4.0 (6H, 3m) , 3.30, 2.97, 2.68-2.60, 2.37-1.54

(11H, 4m) MS (ES m/z) 475 (M 1, 100%)

(231e) (232e)

[3S(1S, 9S) ] -Methyl 9- (benzoylammo) -3- [6,10-dιoxo- 5 1,2,3,4,7,8,9,10-octahydro-6H-pyrιdazmo-

[1,2-a] [1,2]dιazepιne-l-carboxamιdo] -3-cyanopropanoate

(231e) . N-Fluorenylmethyloxy-carbonyl-3-amιno-3- cyanopropionic acid methyl ester (EP0547699A1, 385mg, l.lm ol) was treated with 17ml of diethylamine. After 0 1.5h stirring at room temperature the solution was concentrated. The residue was chromatographed on silica gel (3% methanol in CH ₂ C1 ₂ ) and gave the free amine as a pale yellow oil. To a solution of this oil and hydroxybenzotπazole (297mg, 2.19mmol) m DMF 5 (5ml) , was added at 0 °C ethyldimethylammopropyl carbodnmide (232mg, 1.21mmol, 1.1 equiv) followed by (IS, 95) 9- (benzoylammo) - [6, 10-dιoxo-l, 2,3,4,7,8,9,1 - octahydro-6H-pyrιdaz o [1,2-a] [l,2]αιazepme-l- carboxylic acid (212e) . After stirring at 0 °C for 5 <_ mm and then at room temperature overnight, the mixture was diluted with CH ₂ C1 ₂ (50ml) and the resulting solution washed successively with IM HCl (2 x 30mi) , H ₂ 0 (30ml), 10 ^» . NaHC0 ₃ (2 x 30ml) and sat. aq. NaCl, dried (MgS0 ₄ ) and concentrated. Purification by flash

chromatography on silica gel (3% methanol in CH ₂ C1 ₂ ) afforded the compound 231e (404mg, 83%) as a solid: [α] _D ² ° -121 ° (c 0.14, CH ₂ C1 ₂ ); ¹ H NMR (CDC1 ₃ ) δ 7.40- 7.83 (5H, m) , 7.38 (IH, d) , 6.96 (IH, d) , 5.27-5.07 (2H, m) , 4.66-4.50 (IH, m) , 3.79 (3H, s), 3.23-2.73 (6H, m) , 2.47-2.33 (IH, m) , 2.15-1.82 (4H, m) ; Anal. Calcd for C ₂₂ H ₂₅ N ₅ 0 ₆ : C, 58.0; H, 5.53; N, 15.38. Found: C, 57.6; H, 5.6; N, 15.0.

[3S(1S,9S) ] 9- (Benzoylammo) -3- [6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyπdazιno-

[1 ,2-a] [1 ,2]dιazepιne-l-carboxamιdo] -3-cyanopropanoιc acid (232e) . A solution of methyl ester 231e (400mg,

0.88mmol) m methanol (30ml) and water (30ml) was cooled at 0 °C and treated with dusopropylethylamine. The solution was stirred at 0 °C for lOmin and then at room temperature overnight. The heterogeneous mixture was concentrated and the solid obtained was chromatographed on silica gel (5% methanol/1% formic acid in CH ₂ C1 ₂ ) affording the free acid 232e (170mg, 44%) as a white solid: mp 155 °C (dec) ; [α] _D ² ° -117 ° (c 0.1, MeOH); IR (KBr) 3343, 3061, 2955, 1733, 1656, 1577, 1533, 1490, 1421, 1342, 1279, 1256, 1222, 1185, 708; ¹ H NMR (D ⁴ -MeOH) δ 7.88-7.28 (5H, m) , 5.20-5.03 (IH, ), 4.98-4.84 (2H, m) , 4.75-4.53 (IH, m) , 4.51- 4.34 (IH, m) , 3.45-3.22 (IH, ) , 3.14-2.94 (IH, ) , 3.14-2.94 (IH, m) , 2.88-2.61 (2H, ) , 2.53-1.50 (8H, m) ; Anal. Calcd for C ₂₁ H ₂₃ N ₅ 0 ₆ . 1.5H ₂ 0: C, 53.84; H, 5.59; N, 14.95; 0, 25.61. Found: C, 54.3; H, 5.4; N,

CO,-.-Bu C C0 ₂ -/-Bu

236 . X 23 7eR =

C0 ₂ H

238eR =

[4S, (1S,9S)] t-Butyl 4- [9- (benzoylammo) -6 , 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazmo- [1 ,2-a] [1,2] diazepine-1-carboxamιdo] -5 -oxopentanoate semicarbazone (233e) . A solution cf (IS, 9S) 6,1C- dioxo-1, 2, 3, 4, ⁷ , 8, 9, 10-octahydro-9- (benzoylammo -6H- pyridaz o [ 1, 2-a] [ 1 , 2 ] diazepine-l-carboxylic acio (212e) (345mg, l.Ommolj, (4S) t-butyl N-

(allyloxycarbonyl) -4-ammo-5-oxopentanoate semicarbazone (208a) (361mg, l.lmmol, 1.1 equιv _; and (Ph ₃ P) ₂ PdCl ₂ (20mg) CH ₂ C1 ₂ (5ml), was treated dropwise with n-Bu ₃ SnH (0.621ml, 2.3mmol, 2.1 equiv) . The resulting orange brown solution was stirred at

25 °C for 10mm and then 1-hydroxybenzotrιazole (297mg, 2.2mmol, 2 equiv) was added. The mixture was cooled to 0 °C and ethyldimethylam opropyl carbodiimide (253mg, 1.3mmol, 1.2 equiv) added. After stirring at 0 °C for 10mm and then at room temperature overnight, the mixture was diluted with EtOAc (50ml) and the resulting solution washed successively with IM HCl (3 x 25ml), 10% NaHC0 ₃ (3 x 25ml) and sat. aq. NaCl, dried (MgS0 ₄ ) and concentrated. Flash chromatography on silica gel (2-10% methanol in CH ₂ C1 ₂ ) afforded compound 233e

(280mg, 49%) as a tan solid: [α] _D ² ° -95 (c 0.09, MeOH); IR (KBr) 3477, 3333, 2968, 2932, 1633, 1580, 1535, 1423, 1378, 1335, 1259, 1156, 1085, 709; ¹ U NMR (CDC1 ₃ ) δ 9.32 (IH, s), 7.83-7.39 (6H, m) , 7.11-7.09 (IH, m) , 6.30-5.30 (2H, brs), 5.17-5.05 (2H, m) , 4.62-4.33 (2H, m) , 3.30-3.15 (IH, m) , 3.13-2.65 (2H, m) , 2.46-2.19 (3H, m) , 2.15-1.54 (8H, m) , 1.42 (9H, s) .

[41?, (1S,9S)] t-Butyl 4- [9- (benzoylammo) -6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyrιdazmo- [1,2-a] [1 ,2]dιazepιne-l-carboxamιdo] -5-oxopentanoate semicarbazone (236e) , was prepared by an analogous method to that used for 233e usmg J3) t-butyl N- allyioxycarbonyl-4-amιno-5-oxo-pentanoate semicaroazone

(208b, 435mg, 1.33mmol) . The product was obtained as foam (542mg, 711) : [α] _D ² ° -99 ° (c 0.19, CHCl ₃ > ; IR (KBr) 347J, 3331, 3065, 2932, 2872, 1660, 1580, 1533, 1488, 1423, 1370, 1337, 1278, 1254, 1223, 1155, 1080,

1024, 983, 925, 877, 846, 801, 770, 705; ¹ H NMR (CDC1 ₃ ) δ 9.42 (IH, s), 7.81 (2H, d) , 7.51-7.40 (4H, m) , 7.06 (IH, d) , 6.50-5.50 (2H, broad s), 5.25-5.00 (2H, ) , 4.60-4.45 (2H, m) , 3.15-2.85 (2H, m) , 2.75-2.35 (IH, m) , 2.30-1.23 (11H, m) , 1.42 (9H, s) .

[4S, (1S,9S)] t-Butyl 4-[9-(benzoylammo) -6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyπdazιno- [1,2-a] [1,2]dιazepιne-l-carboxamιdo] -5-oxopentanoate (234e) . A solution of semicarbazone 233e (390mg, 0.68mmol) in methanol (10ml) was cooled at 0 °C and then treated with a 38% aq. solution of formaldehyde (2ml) and IM HCl (2ml) . The reaction mixture was then stirred overnight at room temperature. The solution was concentrated to remove the methanol. The aq. solution was extracted with EtOAc (30ml) . The organic solution was successively washed with 10% NaHC0 ₃ (30ml) and sat. aq. NaCl (30ml), dried (MgS0 ₄ ) and concentrated. Purification by flash chromatography on silica gel (2-5% methanol CH ₂ C1 ₂ ) afforded 234e (179mg, 51%) as a white foam: [α] _D ² ° -101 ° (c 0.064, MeOH) ; IR (KBr) 3346, 2976, 2934, 1730, 1657, 1535, 1456, 1425, 1278, 1255, 1156, 708; ^" " ^" H NMR (CDCI ₃ ) δ 9.56 (IH, s), 7.88-7.38 (5H, m) , 7.01 and 6.92 (2H, 2d), 5.27-5.08 (2H, m) , 4.69-4.46 (IH, m) , 3.50-3.27 (2H, m) , 3.15-2.73 (2H, m) , 2.46-1.83 (10H, ) , 1.45 (9H, s) .

[ AR, (1S,9S)] t-Butyl 4- [9- (benzoylam o) -6, 10-d oxo-

1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazmo-

[1 ,2-a] [1 ,2]dιazepιne-l-carboxamιdo] -5-oxopentanoate (237e) , was prepared from 236e by an analogous method to 234e to afford a white foam (390mg, 85 ^" ) : [α] _D ² °

-113 ° (c 0.242, CHC1 ₃ ) ; IR (KBr) 3352, 3065, 2974, 1729, 1657, 1536, 1489, 1454, 1423, 1369, 1338, 1278, 1255, 1223, 1156, 1078, 1026, 981, 846, 709.

[4S, (1S,9S)] 4- [9- (Benzoylammo) -6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyπdazιno-

[1 ,2-a] [1,2]dιazepιne-1-carboxamιdo] -5-oxopentanoιc acid (235e) . A solution of t-butyl ester 234e (179mg, 0.35mmol) in dry CH ₂ C1 ₂ (3ml) was cooled to 0 °C and treated with trifluoroacetic acid (2ml) . The resulting solution was stirred at 0 °C for 30mm and then at room temperature for 2h. The solution was concentrated, the residue taken up in dry CH ₂ C1 ₂ (5ml) and the mixture again concentrated. This process was repeated once again with more CH ₂ C1 ₂ (5ml) . The residue obtamed was crystallized m diethyl ether. The precipitate was collected and purified on silica gel column (5% methanol m CH ₂ C1 ₂ ) which afforded compound 235e as a white solid (lllmg, 70%) : mp 142 °C (dec) ; [ ] _D ²⁰ -85.5 (c 0.062, MeOH); IR (KBr) 3409, 3075, 2952, 1651, 1541, 1424, 1280, 1198, 1136, 717; ¹ H NMR (D ₆ -DMSO) δ 9.40 (IH, s), 8.62 (2H, ) , 7.96-7.38 (5H, m) , 5.19-5.02 (IH, m) , 4.98-4.79 (IH, m) , 4.48-4.19 (IH, m) , 3.51- 3.11 (2H, m) , 3.04-2.90 (2H, m) , 2.38-1.46 (10H, m) .

[4R, (1S,9S)] 4- [9- (Benzoylammo) -6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyrιdazιno-

[1 ,2-a] [1,2]dιazepme-1-carboxamιdo] -5-oxopentanoιc acid (238e) , was prepared from 237e by an analogous route to 235e which afforded a beige foam (190mg, 60 j :

20

.a],, ~ ⁷⁸ (c 0.145, MeOH) ; IR (KBr) 3400, 3070, 2925, 2855, 1653, 1576, 1541, 1490, 144\ 1427, 1342, 1280, 1258, 1205, 1189, 1137, 1075, 1023, 983, 930,

878, 843, 801, 777, 722; ¹ R NMR (D ₆ -DMSO) δ 9.40 (IH, s), 8.72-8.60 (2H, m) , 7.89 (2H, d) , 7.56-7.44 (3H, m) , 5.17 (IH, ) , 4.90-4.83 (IH, m) , 4.46-4.36 (IH, m) , 4.20-4.15 (IH, m) , 3.40-3.30 (IH, m) , 2.98-2.90 (2H, m) , 2.50-1.60 (10H, ) .

(246) (245)

(1S,9S) t-Butyl 9-benzoylamino-octahydro-10-oxo-6H- pyridazino[1 ,2-a] [1 ,2]diazepine-l-carboxylate (243) , was prepared from (1S,9S) t-butyl 9-amino-octahydro-l0- oxo-6H-pyridazino [1,2-a] [1,2] diazepine-1-carboxylate (Attwood, et al. J. Chem. Soc, Per.kin 1, pp. 1011-19

1986) ), by the method described for 211e, to afford

°5

2.03g (86%) of a colourless foam: [α.D ^■ 15.9 ° (z 0.5, CH ₂ C1 ₂ ) ; IR (KBr) 3400, 2976, 2937, 1740, 1644, 1537, 1448, 1425, 1367, 1154; ¹ bl NMR (CDC1 ₃ ) δ 7.88- 7.82 (2H, m) , 7.60-7.38 (4H, m) , 5.48 (IH, m) , 4.98 (IH, m) , 3.45 (IH, m) , 3.22-2.96 (2H, m) , 2.64 (IK, m) , 2.43-2.27 (2H, m) , 1.95 (2H, m) , 1.82-1.36 (4H, m) , 1.50 (9H, s) ; Anal. Calcd for C ₂₁ H _2g N ₃ 0 ₄

64.35; H, 7.59; N, 10.72. Found: C, 64.57; H, 7.43; N, 10.62. MS (ES +, m/z) 388 (100%, M ⁺ + 1) .

(IS, 9S) 9-Benzoylamino-octahydro-10-oxo-6H- pyridazino[1,2-a] [1 ,2]diazepine-1-carboxylic acid (244) , was prepared from (IS, 95) t-butyl 9- benzoylamino-octahydro-10-oxo-6H-pyridazino-

[1, 2-a] [1, 2]diazepine-l-carboxylate (243) , by the method described for 212e, to afford 1.52g (89%) of a white powder: mp. 166-169 °C (dec) ; [α] _D ²⁵ -56.4 ° (c 0.5, CH ₃ 0H) ; IR (KBr) 3361, 2963, 2851, 1737, 1663,

1620, 1534, 1195, 1179; ^X H NMR (D ₆ -DMSO) δ 12.93 (IH, brs), 8.44 (IH, d, J = 8.4), 7.93 (2H, m) , 7.54 (3H, m) , 5.46 (IH, m) , 4.87 (IH, ) , 3.12 (2H, m) , 2.64 (IH, m) , 2.64 (IH, m) , 2.27 (IH, m) , 1.98-1.68 (7H, m) , 1.40 (IH, m) ; Anal. Calcd for C ₁₇ H ₂₁ N ₃ 0 ₄ . 0.25H ₂ O: C, 60.79; H, 6.45; N, 12.51. Found: C, 61.07; H, 6.35; N, 12.55. MS (ES+, m/z) 332 (58%, M ⁺ + 1), 211 (100) .

[3S,2RS(1S,9S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -9-benzoylamino-octahydro-10-oxo-6H- pyridazino[1 ,2-a] [1 ,2]diazepine-l-carboxamide (245) , was prepared from (IS, 9S) 9-benzoylamino-octahydro-10- oxo-6H-pyridazino [1,2-a] [1,2] -diazepine-1-carboxylic acid (244), by the method described for 213e, to afford 601mg (76%) of a colourless foam: IR (KBr) 3401, 2945, 1794, 1685, 1638, 1521, 1451, 1120; ^∑ H NMR (CDCI ₃ ) δ 7.87-7.77 (2H, m) , 7.57-7.14 (10H, m) , 5.59-5.47 (2H, m) , 4.97-4.32 (4H, m) , 3.27-1.35 (14H, m) ; Anal. Calcd for C ₂₃ H ₃₂ N ₄ 0 ₆ . 0.5H ₂ O: C, 63.50; H, 6.28; N, 10.58. Found: C, 63.48; H, 6.14; N, 10.52. MS (ES -, m/z) 521 (100 ^' -, M ⁺ + 1) .

[3S(1S,9S) ] 3- (9-Benzoylammo-octahydro-10-oxo-6H- pyrιdazιno[l,2-a] [1 ,2]dιazepιne-l-carboxamιde-4- oxobutanoic acid (246) , was prepared from [3S, 2RS (IS, 9S) ]N- (2-benzyloxy-5-oxotetrahydrofuran-3-yl) -9- benzoy1ammo-octahydro-10-OXO-6H- pyπdazmo [1, 2-a] [1, 2] dιazepιne-1-carboxamιoe (245), by the method described for 214e, to afford 396mg (84c) of a white powder: mp. 110-115 °C; [α] _D ²⁶ -126.3 ° (c 0.2, CH ₃ OH) ; IR (KBr) 3345, 2943, 1787, 1730, 1635, 1578, 1528, 1488, 1450, 1429; ¹ H NMR (CD ₃ OD) δ 7.88 (2H, m) , 7.48 (3H, m) , 5.55 (IH, m) , 4.91 (IH, m) , 4.56 (IH, m) , 4.29 (IH, ) , 3,41-3.05 (3H, ) , 2.76-2.41 (3H, m) , 2.28-2.01 (3H, m) , 1.86-1.65 (4H, m) , 1.36 (IH, m) ; Anal. Calcd for C ₂₁ H ₂₆ N ₄ 0 ₆ . 1.25H ₂ 0: C, 55.68; H, 6.34; N, 12.37. Found: C, 55.68; H, 6.1 ; N, 12.16. MS (ES -, m/z) 429 (100%, M ⁺ - 1) .

(248) (247)

(249) (250)

[ (3S(2R, 5S) ]-2,6-Dι-tert-butyl-4-methoxyphenyl-3-[5-

(2 ,5-dιhydro-3,6-dιmethoxy-2- (1- methylethyl)pyrazιnyl) ]butanoate (247) . n-Butyllithium

( 1.6M m hexane) (22.3ml, 35.7mmol) was added dropwise over 20mm to a solution of (2R) - (- -2, 5-dιhydro-3, 6- dιmethoxy-2- ( 1-methylethyl) pyrazme (5.8ml, 6.0g, 32.4mmol) in THF (250ml) cooled to -75 °C at a rate such that the temperature was maintained oelow - ^" "2 °C. The reaction mixture was stirred for lh at -75 °C ano a solution of 2, 6-dι-t-butyl-4-methoxyphenyl-2-butenoate

(Suzuck et al. Liebigs Ann. Chem. pp. 51-61 (1992) )

(9.9g, 32.5mmol) in THF (60ml) was added over 30 minutes maintaining the temperature below -72 °C during the addition. The reaction mixture was kept at -75 °C for 1.5h and a solution of glacial acetic acid (6ml) in THF (25ml) was added at -75 °C and the solution warmed to room temperature. The solution was poured onto 10% NH ₄ C1 (300ml) and extracted with diethyl ether (3 x 250ml) . The combined organic phases were washed with brine (2 x 200ml), dried over Na ₂ S0 ₄ and evaporated to dryness under reduced pressure. The residual oil was purified by flash chromatography on silica gel (20% heptane in CH ₂ C1 ₂ ) which afforded the title compound as a light yellow oil (13.5g, 85%) : [ ] _D ² ° -64 ° (c 0.22, MeOH); IR (KBr) 2962, 2873, 2840, 1757, 1697, 1593, 1460, 1433, 1366, 1306, 1269, 1236, 1187, 1157, 1126, 1063, 1038, 1011, 970, 924, 892, 867, 846, 831, 797, 773, 754; ^X H NMR (CDC1 ₃ ) δ 6.85 (2H, s), 4.21 (IH, t, J = 3.5), 3.98 (IH, t, J = 3.5), 3.79 (3H, s), 3.71 (3H, s), 3.69 (3H, s), 3.15 (IH, dd, 17.8, 7.9) , 2.86-2.81 (IH, m) , 2.58 (IH, dd, J = 17.8, 5.9) , 2.28- 2.19 (IH, ) , 1.33 (18H, s), 1.02 (3H, d, = 6.8) , 0.70 (6H, dd, J = 13, 6.8) .

(2S,3S) -5-[2,6-Di-t-butyl-4-methoxyphenyl]l-methyl-3- methylglutamate (248) . A solution of [ 3S i 2R, 55) 1-2,6- di-t-butyl-4-methoxyphenyl-3- [5- (2, 5-dihydro-3, 6- dιmethoxy-2- ( 1-methylethyl)pyrazinyl) ] butanoate (247)

(22.4g, 45.8mmol) in acetonitrile (300ml) and C .25N HCl

(366ml, 2 equiv) was stirred at room temperature under nitrogen atmosphere for 4 days. The acetonitrile was evaporated under reduced pressure and diethylether

(250ml) was added to the aq. phase. The pH of the aq. phase was adjusted to pH8-9 with concentrated ammonia

solution (32%) and the phases separated. The aq. phase was extracted with diethylether (2 x 250ml) . The combined organic phases were dried over Na ₂ S0 ₄ and evaporated to dryness under reduced pressure. The residual oil was purified by flash chromatography on silica gel (2% methanol m CH Cl ₂ ) which afforded the required product as a light yellow oil (8.2g, 45%) : [α] _D ² ° +20 ° (c 0.26, MeOH) ; IR(KBr) 3394, 3332, 3003, 2962, 2915, 2877, 2838, 1738, 1697, 1593, 1453, 1430, 1419, 1398, 1367, 1304, 1273, 1251, 1221, 1203, 1183, 1126, 1063, 1025, 996, 932, 891, 866, 847, 800, 772, 745; ¹ H NMR (CDC1 ₃ ) δ 6.85 (2H, s) , 3.79 (3H, s) , 3.7_j (3H, s), 3.72-3.69 (IH, m) , 3.05-2.85 (IH, m) , 2.67- 2.50 (2H, m) , 1.32 (18H, s), 0.93 (3H, d, J = 7) ; Anal. Calcd for C ₂₂ H ₃₅ N0 ₅ : C, 67.15; H, 8.96; N, 3.56. Found: C, 67.20; H, 9.20; N, 3.70.

(2S,3S) -5- [2, 6-Dι-t-butyl-4-methoxyphenyl]3- methy1glutamate (249) . A solution of (2S, 3S) -5- [2, 6- di-t-butyl- -methoxyphenyl] 3-methylglutamate (248) (8.0g, 20.3mmol) in 5N HCl (200ml) was heated at reflux for 2h. The reaction mixture was evaporated to dryness under reduced pressure. The residue was dissolved in cyclohexane (x4) and evaporated to dryness (x4) whι< afforded a white solid (7.9g, 93%) : mp 230 °C; [ ] _D ' 20 +22 ° (c 0.27, MeOH); IR (KBr) 3423, 2964, 1755, 1593,

1514, 1456, 1421, 1371, 1303, 1259, 1201, 1179, 1138, 1106, 1060, 966, 926, 861, 790, 710; ¹ }l NMR (MeOD) 5 6.76 (2H, s) , 4.02 (IH, d, J = 3.7) , 3.67 (3H, s) ,

3.05-2.85 (IH, IT ) , 2.80-2.55 (2H, ) , 1.22 (18H, s, , 1.09 (3H, d, J = 6.3) ; ¹³ C NMR (MeOD) δ 174.5, 171.4, 158.6, 145.2, 143.1, 113.2, 58.3, 56.3, 39.8, 36.9,

32.5, 16.6; Anal. Calcd for C ₂₁ H ₃₄ C1N0 ₅ : C, 60.64; H, 8.24; N, 3.37. Found: C, 60.80; H, 8.40; N, 3.40.

(2S,3S) -5- [2 , 6-Di-t-butyl-4-methoxyphenyl]3-methyl-2- phthalimido-1,5-pentanedioate (250) , Diisopropylethylamine (4.1ml, 3.04g, 23.5mmol, 1.25 equiv) and phthalic anhydride (3.5g, 23.6mmol, 1.25 equiv) were added to a solution of (2S, 3S) -5- [2, 6-dι-t- butyl-4-methoxyphenyl] 3-methylglutamate (249) (7.8g, 18.6mmol) in toluene (300ml) . and the resulting mixture was heated at reflux for 3 hours. After cooling to room temperature, the reaction mixture was evaporated to dryness and the resulting oil purified by flash chromatography on silica gel (2% methanol in CH-.C1- which afforded the required product as a white foam (8.35g, 87%) : [α] _D ² ° -20 ° (c 1.04, MeOH) ; IR (KBr) 3480, 2968, 2880, 1753, 1721, 1594, 1462, 1422, 1388, 1303, 1263, 1216, 1183, 1148, 1062, 1003, 933, 899, 755, 723; ¹ H NMR (CDC1 ₃ ) δ 7.92-7.87 (2H, m) , 7.78-7.73 (2H, m) , 6.84 (2H, s), 4.95 (IH, d) , 3.78 (3H, s; , 3.30-3.05 (2H, m) , 2.85-2.65 (IH, m , 1.30 (18H, s) , 1.13 (3H, d! .

(250)

(252)

(257) (256)

1- (2 , 6-dι-t-Butyl-4-methoxy) -phenyl-5- (1- benzyloxycarbonyl-3-t-butoxycarbonyl-hexahydro- pyrιdazιn-2-yl) -3-methyl-4-phthalιmιdopentan-l , 5-dιoate

(251) . A solution of the ammo acid (250) (1.2g, 2.35mmol) dry diethylether (10ml) was treated with phosphorus pentachloride (0.52g, 2.5mmol) at room temperature for 2h. The mixture was concentrated and treated several times with toluene and again evaporated to dryness. The resulting acid chloride was dissolved in dry THF (5ml) and CH ₂ C1 ₂ (5ml) and cooled to 0 °C. t-Butyl-1- (be zyloxycarbonyl ) -hexahydro-3-pyπdaz e- carooxylate (0.753g, 2.35mmol, 1 equiv) and N- ethylmorphol e (3ml) were added to the solution. The reaction mixture was stirred for 30mm at 0 °C and then overnight at room temperature. The mixture was evaporated and the resulting residue taken up with CH ₂ C1 ₂ (30ml) . The solution was washed with IM HCl, water, 10% NaHC0 ₃ , dried (MgS0 ) and evaporated. The resulting white foam was purified on silica gel (0-2 ^L methanol in CH ₂ C1 ₂ ) which afforded the required compound 251 as a pale yellow glassy solid (740mg, 39%) : [α] _D ² ° -22 (c 0.42, MeOH) ; IR (KBr) 3441, 296o, 1725, 1693, 1386, 1255, 1221, 1186, 1154, 1123, 1063, 724; ¹ H NMR (CDC1 ₃ ) δ 7.94-7.89 (4H, m) , 7.56-7.28 (5H, m ¹ , 6.84 (2H, 2s) , 5.29-5.20 (2H, AB) , 4.91-4.81 (IH, m) , 4.05-3.88 (IH, m) , 3.78 (3H, s) , 3.75-3.80 (IH, m* , 3.28-2.95 (2H, m) , 2.23-1.51 (6H, m) , 1.45 (9H, s , 1.31 (9H, s) , 1.28 (9H, s) , 1.27 (3H, d) .

(IS, 8S, 9S) t-Butyl 6, 10-dιoxo-8-methyl- 1,2,3,4,7,8,9, 10-octahydro-9-phthalιmιdo-6H- pyridazmo[1 ,2-a] [1 ,2]dιazepιn-1-carboxylate (254) . A solution of the protected acid (251) '715mg, 0.893mmol )

m acetonitrile was treated with Cerium (IV) ammonium nitrate (1.8g, 3.3mmol, 3.7 equiv) water (3ml) for 4h at room temperature. Mannitol (600mg, 3.3mmol, 3.7 equiv) was added and the mixture was stirred for lh. Diethylether (50ml) and water (30ml) were added to the mixture. After decantation, the aq. phase was extracted with diethylether (4 x 50ml) . The combmed organic phase was washed with water, dried (MgS0 ₄ ) and concentrated. Chromatography on silica gel (10% methanol m CH ₂ C1 ₂ ) afforded 5- (l-benzyloxycarbonyl-3- t-butoxycarbonyl-hexahydropyπdazm-2-yl) carbonyl-3- methyl-4-phthalιmιdopentanoιc acid (252) (360mg, 64" • [α] _D ²⁰ -49.2 c 0.118, MeOH) . This product was used without further purification (360mg, 0.609mmol), and was hydrogenated methanol (30ml) usmg 10% Pd/carbon (36mg) for 3h. The reaction mixture was filtered and the resulting solution concentrated to afford the amine

(253) as a foam (270mg, 96%) [α] _D ²⁰ -56.1 (c 0.18 MeOH) . The amme (253) was dissolved in dry THF (10ml; and phosphorous pentachloride (305mg, 1.47mmol, 2.5 equivj was added. The mixture was then cooled to -5 °C and N- ethylmorpholme was added under nitrogen. The reaction mixture was stirred overnight at room temperature. The mixture was concentrated and the residue taken up with CH ₂ C1 ₂ (20ml) , cold H ₂ 0 (20ml), IM HCl (20ml . After decantation, the aq. phase was reextracted with CH-.C1-. (2 x 20ml) . The combined organic phase was washed witn IC NaHC0 ₃ and water, dried (MgS0 ₄ ) and concentrated. The resulting oil was purified on silica gel (1 methanol in CH C1 ₂ ) affording the bicyclic compound

(254) as a solid (65mg, 25%) : iα] _D ² ° ^{~ ι η} < ^c C.208, MeOH); IR (KBr) 3471, 3434, 2975, 2928, 1767, 172,3, 1443, 1389, 1284, 1243, 1151, 1112, 720; ¹ U NMP (CDC1.

δ 7.94-7.69 (4H, m) , 5.34-5.27 (IH, m) , 4.89-4.66 (2H, m) , 3.94-3.64 (2H, m) , 3.02-2.84 (IH, m) , 2.34-2.19 (2H, m), 1.94-1.61 (3H, m) , 1.47 (9H, s), 1.14 (3H, d) ; Anal. Calcd for C ₂₃ H ₂₇ N ₃ 0 ₆ : C, 62.57; H, 6.17; N, 9.52. Found: C, 62.60; H, 6.40; N, 9.10.

(IS, 8S, 9S) t-Butyl-9-benzoylamino-6, 10-dioxo-8- methyl-1 ,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazino- [1,2-a] [l,2]diazepine-l-carboxylate (255) . A solution of the bicyclic compound (254) (70mg, 0.16mmol) in ethanol was treated with hydrazine hydrate (0.02ml, 4mmol, 2.5 equiv) . After 5h stirring at room temperature, the mixture was concentrated and the resulting residue taken up in toluene and reevaporated. The residue was treated with 2M acetic acid (2ml) for 16h. The resulting precipitate was filtered and washed with 2M acetic acid (10ml) . The filtrate was basified with solid NaHC0 ₃ and then extracted with EtOAc. The organic solution was washed with water, dried (MgS0 ₄ ) and concentrated. Purification by flash chromatography on silica gel (2% methanol CH ₂ C1 ₂ ) afforded the free amine as a foam (50mg, 100%) . The amine (50mg, O.lβmmol) was dissolved in dioxane (1ml) and water (0.25ml) and treated with NaHC0 ₃ (0.034g, 0.04mmol) followed by benzoylchloride (0.047ml, 0.40mmol, 2.8 equiv) . The mixture was stirred overnight at room temperature, then diluted with EtOAc (15ml) . The organic solution was washed with 10 NaHC0 ₃ ano sat. aq. NaCl, dried (MgS0 ₄ ) and concentrated. Purification by flash chromatography on silica gel (2'- methanol CH ₂ Ci ₂ ) afforded the benzamide 255 as a foam (67mg,

100%) : ^: H NMR (CDCl ₃ ) δ 7.89-7.39 (SH, m) , 6.79 (IH, d), 5.32-5.20 (IH, m) , 4.98-4.82 (IH, m) , 4.75-4.64

(IH, m) , 3.84-3.65 (IH, m) , 3.09-2.89 (IH, m) , 2.45- 2.18 (2H, ) , 2.00-1.61 (4H, m) , 1.48 (9H, s) , 1.28 (3H, d) .

[3S(1S, 8S, 9S) ] 3- (9-benzoylamino-6,10-dιoxo-8-methyl- 1,2,3,4,7,8,9,10-octahydro-6H-pyndazino-

[1,2-a] [1 ,2]diazepine-l-carboxamido) -4-oxobutanoιc acid

(257) . A solution of t-butyl ester 255 (67mg, 0.16nmol) in CH ₂ C1 ₂ (1ml) was treated at 0 °C with trifluoroacetic acid (1ml) . The resulting solution was stirred at 0 °C for 15mm and then at room temperature for In. The solution was concentrated, the residue taken up in dry CH ₂ Cl (2 x 2ml) and the mixture again concentrated (x2) . The residue was crystallized from diethylether. Filtration of the precipitate affordeci the free acid of 255 as a grey solid (40mg, 70%) . A solution of acid (40mg, O.llmmol), N-allyloxycarbony - 4-amιno-5-benzyloxy-2-oxotetrahydrofuran (Chapman, Biocrα. & Med. Chem. Lett., 2, pp. 615-18 (1992) ; 39mg, 0.13mmol, 1.2equiv) and (Ph ₃ P) ₂ PdCl ₂ (3mg) in a mixture of cry CH ₂ C1 ₂ (1ml) and dry DMF (0.2ml) was treated dropwise with n-Bu ₃ SnH (0.089ml, 0.33mmol, 3 equivj . The resulting solution was stirred at 25 °C for 10mm and men 1-hydroxybenzotrιazole (36mg, 0.266mmoi, 2.4 equiv) was added. The mixture was cooled to 0 °C anc ethyldimethylammopropyl carbodiimide (31mg, C.lδmmol, 1.5equιv) was added. After stirring at 0 °C for lOmir. and then at room temperature overnight, the mixture wa ^r; diluted with EtOAc (20ml) and the resulting solution washed successively with IM HCl (2 x 5ml) , 10 NaHCOi [2 x 5ml) and sat. aq. NaCl (5ml) , dried (MgSC ₄ , and concentrated. Flash chromatography on silica gel (2 methanol CH ₂ Cl ₂ j afforded a mixture of

diastereoisomers (256) as a grey solid (50mg, 82%) . This product (256) was used without further purification (50mg, 0.091mmol) and was hydrogenated methanol (5ml) using 10% Pd/carbon (30mg) for 24h. The reaction mixture was filtered and the resulting solution concentrated. Flash chromatography on silica gel (2-20% methanol in CH ₂ C1 ₂ ) afforded compound 257 (9mg, 21%) as a white solid: ¹ H NMR (D -MeOH) δ 7.88- 7.29 (5H, m) , 5.18-4.99 (IH, m) , 4.59-4.35 (3H, m) , 4.26-4.11 (IH, m) , 3.65-3.41 (2H, m) , 3.18-2.91 (IH, ) , 2.62-1.47 (8H, m) , 1.29-1.00 (3H, 2d) (mixture of acetal and hemiacetal) . MS (ES -) 457.

PhCO H

(259)

(262) (263)

(265) (264)

Benzyl 3- (N'-benzoylhydrazmo)propanoate (259) .

Benzylacrylate (1.13ml, 7.34mmol) was added to a stirred suspension of benzoylhydrazme (285) (l.Og, ^"7 .34mmol) m isopropanol (28ml) . The mixture was

refluxed for 20h, cooled to room temperature then concentrated. The residue was purified by flash chromatography (20% EtOAc in CH ₂ C1 ₂ ) to afford 259 (1.098g, 50%) as an oil which crystallized on standing: mp 65 °C; IR (KBr) 3283, 1723, 1644, 1316, 1201, 1156; ¹ H NMR (CDC1 ₃ ) δ 8.32-8.18 (IH, m) , 7.81-7.70 (2H, m) , 7.57-7.23 (8H, m) , 5.36-4.92 (IH, brm) , 5.11 (2H, s) , 3.26 (2H, t, J = 6.5), 2.59 (2H, t, J = 6.5) ; ¹³ C NMR (CDCI3) δ 172.12, 167.27, 135.65, 132.54, 131.66, 128.45, 128.10, 128.06, 126.84, 66.31, 47.33, 33.31;

Anal. Calcd for C ₁₇ H ₁₈ N ₂ 0 ₃ : C, 68.44; H, 6.08; N, 9.39. Found: C, 68.42; H, 6.10; N, 9.38. MS (ES +) 321 (M - Na, 38%) , 299 (M ⁺ + 1, 100) .

(3S)-1-Benzyl 3-t-butyl 2- (N'-benzoyl-N- (2- benzyloxycarbonylethyl)hydrazinocarbonyl)hexahydro- pyridazine-1,3-dicarboxylate (260) . A solution of (3S) -1-benzyl 3-t-butyl hexahydropyridazine-1, 3- dicarboxylate (Hassall et al. J. Chem. Soc. Perk 1. pp. 1451-1454 (1979)) (925.3mg, 2.89mmol) and dusopropylethylamine (0.70ml, 4. Ommol ) in a 1.93M toluene solution of phosgene (17.96ml, 34.7mmol) was stirred at room temperature for 45mm, then concentrated to leave a yellow solid. To this solid was added toluene (18ml), hydrazide (259) (861.6mg, 2.89mmol) and diisopropylethylamme (0.70ml, 4.Cmmol) . The mixture was stirred at room temperature for 2.75r_, then concentrated. The resulting residue was taken up in EtOAc, washed twice with IM HCl, brine, then dried (MgS0 ₄ ), filtered and concentrated to afford 2.15g cf crude material. Flash chromatography ( 0' EtOAc hexane) afforded 1.65g (89%) of the title compound as a white foam: mp 40 °C; [α] _D 24 -55.78 ° (c 0.40, CH-C1 -. ' ;

IR (KBr) 3436, 2930, 1733, 1689, 1455, 1412' 1367, 1258, 1156, 697; ¹ H NMR (CDC1 ₃ ) δ 8.54-8.23 (0.5H, m) , 7.97-7.09 (15.5H), 5.16-4.80 (4H, m) , 4.66-4.32 (IH, m) , 4.24-3.55 (3.3H, m) , 3.50-3.26 (0.4H, m) , 3.19-2.49 (2.3H, m) , 2.11-1.43 (6H, ) , 1.32-1.05 (7H, m) ; Anal. Calcd for C ₃₅ H ₄₀ N ₄ O ₈ • 0.5H ₂ 0: C, 64.31; H, 6.32; N, 8.57. Found: C, 64.18; H, 6.27; N, 8.56. MS (ES +) 662 (M + Na, 84%), 645 (M ⁺ + 1, 100), 384 (77) .

(6S) -3- (N'benzoyl-N- (6-t-butoxycarbonylhexa- hydropyridazine-1-carbonyl)hydrazmo)propanoic acid

(261) . A solution of 260 (1.59g, 2.47mmol) m MeOH (142ml) was treated with 10% Palladium on carbon (230. Omg) and stirred under an atmosphere of H ₂ for 1.5h. The mixture was filtered and the solvent evaporated to afford 1.04g (100%) of a white foam. This was used in the next step without further purification: mp <40 °C; [α] _D ²⁶ +1.6 ° (c 0.26, CH,C1 ₂ ); IR (KBr) 3422, 2977, 2986, 1728, 1677, 1486, 1445, 1396, 1369, 1309, 1228, 1155, 916, 716; ¹ H NMR (CDCI ₃ ) δ 10.0-9.7 (IH, brm), 7.86 (2H, d, J = 7.5) ,

7.62-7.38 (3H, m) , 7.3-5.6 (2H, brm), 4.57 (IH, brd, J = 4.0), 4.05-3.77 (2H, m) , 3.00-2.82 (IH, m) , 2.80-2.43 (3H, m) , 2.20-2.03 (IH, m) , 2.00-1.47 (IH, m) , 1.62- 1.14 (11H, m) ; ¹³ C NMR (CDCI ₃ ) δ 175.00, 171.17, 167.62, 160.68, 132.39, 131.77, 128.67, 127.38, 82.27, 54.38, 48.04, 46.35, 33.62, 28.02, 25. όb, 21.61. MS (ΞS +, 443 (M + Na, 68c), 421 (M + 1) , 100) , 365 (50; , 131 (61) .

(4S) t-Butyl 7-benzamιdo-6, 10-dιoxo-l ,2 , 3 , 4 ,7,8, 9, 10- octahydro-6H-pyrιdazmo [ 1 , 2-a] [1 ,2 , 4 ] trιazepιne-4- carboxylate (262) . To a solution of ammo acid 261

(1.012g, 2.41mmol) dry THF (26ml) at 0 °C was added N-ethylmorpholine (597μl, 4.69mmol), followed oy PC1 ₅ (651.3mg, 3.12mmol) . The reaction was stirred at 0 °C for 2h, then allowed to warm to rt and stirred for a 5 further 15.5h. The mixture was concentrated and the resulting residue taken up in EtOAc, washed twice with IM HCl, sat. NaHC0 ₃ , brine, then dried (MgS0 ₄ ), filtered and concentrated. Flash chromatography (20% EtOAc in CH ₂ C1 ₂ ) gave 727.3mg (75%) of the title 0 compound as a white foam: [ ] _D +51.0 ° (c 0.20,

CH ₂ C1 ₂ ) ; IR (KBr) 3436, 2979, 1733, 1670, 1483, 1437, 1420, 1299, 1243, 1156; ^X H NMR (CDC1 ₃ ) δ 8.70 (IH, si, 7.78 (2H, d, J = 7.0), 7.57-7.32 (3H, m) , 5.08 (IH, dd, J = 2.5, 5.5), 4.59-4.43 (IH, m) , 4.08-3.69 (3H, m) , 5 3.07-2.84 (IH, m) , 2.57-2.35 (IH, m) , 2.34-2.14 (IH, m) , 2.07-1.43 (3H, m) , 1.48 (9H, s) ; ¹³ C NMR (CDC1 ₃ ) δ 172.41, 169.04, 166.35, 158.35, 132.24, 132.03, 128.61, 127.31, 82.77, 55.41, 54.07, 41.57, 32.21, 28.04, 24.97, 20.37; .Anal. Calcd for C ₂₀ H ₂₆ N ₄ O ₅ : C, 59.69; H, 0 6.51; N, 13.92. Found: C, 59.53; H, 6.53; N, 13.84. MS (ES +) 425 (M + Na, 71%), 403 (M ⁺ + 1, 100), 145 (41) .

(4S) -7-Benzamido-6,10-dιoxo-l,2,3,4 ,7,8,9, 10-octahydro- 6H-pyπdazιno[1 ,2-a] [1,2,4 ] trιazepιne-4-carboxylic Acid 5 (263) . A solution of ester 262 (720. Omg, 1.80mmol) m a 1:1 mixture of CH ₂ C1 ₂ and TFA (150ml) was stirred for 1.3h under a dry atmosphere. The solution was then reduced m vacuo, taken up in Et 0 and reduced again. This process was repeated six times to afford the crude C product as an off-white solid. The product was purified by flash chromatography (5* MeOH in CH ₉ Cl- to afford 520. Omg (83%) of the title compound as a white

foam: [α] _D ²⁵ +59.5 ° (c 1.82, CH ₂ C1 ₂ ) ; IR (KBr) 3435, 3266, 2956, 1732, 1664, 1524, 1486, 1440, 1302; ¹ H NMR (CDC1 ₃ ) δ 9.13 (IH, s), 7.77 (2H, d, J = 7.5), 7.57- 7.32 (3H, m) , 5.27-5.16 (IH, m) , 4.62-4.43 (IH, m) , 4.09-2.70 (3H, m) , 3.14-2.89 (IH, m) , 2.59-2.43 (IH, m) , 2.38-2.20 (IH, m) , 2.14-1.89 (IH, m) , 1.82-1.59 (2H, m) ; ¹³ C NMR (CDCI ₃ ) δ 173.65, 172.28, 166.44, 158.42, 132.44, 131.31, 128.61, 127.39, 54.83, 54.01, 42.11, 31.79, 24.42, 20.29; MS (ES -) 345 (M - H ⁺ , 100%) , 161 (45) .

[2i?S,3S(4S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) -

6,lO-dioxo-1,2,3,4 ,7,8,9,10-octahydro-6H- pyridazino[1 ,2-a] [1,2,4]triazepine-4-carboxamide (264) .

To a solution of acid 263 (300. Omg, 0.87mmol) and (2R5, 35) -3-allyloxycarbonylamino-2-benzyloxy-5- oxotetrahydrofuran (Chapman, Bioorα. & Med. Chem. Lett. 2, pp. 615-18 (1992)) (277.6mg, 0.95mmol) in dry CH ₂ C1 ₂ (2.5ml) and dry DMF (2.5ml) at rt was added bis (triphenylphosph e) palladium chloride (13. Omg) , followed by tri-n-butyltin hydride (466. Oμl, 1.73mmol) . The reaction was stirred for 5mm, then 1- hydroxybenzotriazole (234. Img, 1.73mmol) was added and the mixture was cooled to 0 °C before addition of l-(3- dimethylaminopropyl) -3-ethylcarbodιιmιde hydrochloride (204.5mg, 1.04mmol) . The mixture was allowed to warm to rt and stirred for 16.5h. The mixture was diluted with EtOAc, washed with IM NaHS0 ₄ twice with sat. NaHC0 ₃ , then H ₂ 0 and brine. The organic layer was dried (MgS0 ₄ ), filtered and concentrated. The residue was purified by flash chromatography (5 MeOH in

CH ₂ C1 ) to afford 358.3mg (77 ^" ) of the title compound as a white solid: IR (KBr) 3435, 1791, 1665, 1526,

1421, 1285; ¹ H NMR (CDC1 ₃ ) δ 8.76 and 8.49 (IH, 2 x s) , 7.92-7.73 (2H, m) , 7.62-7.24 (8.5H, m) , 6.86 (0.5H, d, J = 8.0), 5.53 and 5.33 (IH, d, J = 5.5, s), 4.95-4.34 (5H, m) , 4.04-3.54 (3H, m) , 3.03-2.64 (2H, m) , 2.49- 2.14 (2H, m) , 2.11-1.46 (4H, m) ; MS (ES +) 558 (M + Na, 100%), 536 (M ⁺ + 1, 78), 404 (58) .

[3S(4S) ]3-(7-Benzamιdo-6,10-dιoxo-l,2,3,4,7,8,9,10- octahydro-6H-pyrιdazιno[1,2-a] [1,2,4] trιazepιne-4- carboxamido) -4-oxobutanoιc acid (265) . A mixture of 264 (350. Omg, 0.65mmol), 10% palladium on carbon (350mg) and methanol (36ml) was stirred under an atmosphere of H for 6.5h. The mixture was filtered and the solvent evaporated. Et ₂ 0 was added and the solvent removed again. This process was repeated four times to reveal 283mg (97%) of the title compound, as a white crystalline solid: mp decarboxylates above 140 °C; [α] _D ²⁶ +33.5 ° (c 0.18, MeOH), IR (KBr) 3428, 1663, 1528, 1487, 1437, 1288; ¹ H NMR (D ₆ -DMSO) δ 10.56 (IH, s), 8.71-8.57 (IH, m) , 7.88-7.81 (2H, m) , 7.65- 7.46 (3H, m) , 4.97-4.85 (IH, m) , 4.38-4.0 (3H, m, ,

3.88-3.52 (3H, ) , 2.91-2.71 (2H, m. , 2.50-2.38 (IH, m) , 2.35-2.21 (IH, m) , 2.10-1.94 (IH, m) , 1.93-1.49 (3H, m) ; ¹³ C NMR (D ₆ -DMSO) δ 173.66, 172.49, 169.97, 169.89, 164.96, 157.62, 132.35, 131.85, 128.39, 127.32, 53.81, 52.69, 40.90, 33.17, 31.60, 24.40, 24.13, 19.24; MS (ES -) .

(268) (267 )

(2S) 3-Benzyloxycarbonylamino-2-phthailmidopropionic acid (266) . A solution of (2S) 3- benzy1oxycarbonylammo-2-tert- butoxycarbonylammopropionic acid dicyclohexylamme salt (3g, 5.8mmol) m dichloromethane (200ml) was washed four times with IM HCl solution, dried (MgS0 ₄ y and concentrated. The resulting oil was dissolved dry dichloromethane (35ml), cooled to 0 °C and treated with trifluoroacetic acid (35ml) . This solution was stirred at 0 °C for 1.5h then evaporated to dryness. Dichloromethane (50ml) was added to the residue then removed under vacuum. This process repeated six times to afford a white solid. The white solid was suspended in tcuene (50ml) , treated with powdered phthalic annycride (940mg, 6.35mmol) and refluxed for 18h. The resulting solution was concentrated to afford an 01_. which was purified by flash cnromatography 2-1C methanol/dichloromethane) to afford 266, 2.01g '94 ) as a white powder: IR (KBr) 3600-2500br, 1776, 1714,

1530, 1469, 1455, 1392, 1263, 1131, 722; H NMR (CDCl ₃ ; δ 7.83 (2H, m) , 7.72 (2H, m) , 7.29 (5H, m) , 5.41 (IH, m) , 5.03 (2H, s) , 3.90 (2H, m) ; MS (ES-), 367 (M - 1) .

[3S (,2S) ] t-Butyl 1-benzyloxycarbonyl-2- (3- benzyloxycarbonylamιno-2- phthalιmιdopropιonyl)pyrιdazιne-3-carboxylate (267) . A suspension of the acid 266 (1.32g, 3.58mmol) in dry ether (37ml) was treated with phosphorus pentachloride (1.04g, 5mmol) and stirred at room temperature for 2h. The solution was filtered to remove unreacted phosphorus pentachloride then evaporated to dryness. Tne residue was treated with dry toluene (25ml) then evaporated to dryness. This process was repeated several times. The resulting oil was dissolved in dry dichloromethane (25ml), cooled to 0 °C and treated with a solution of (35) t-butyl 1- benzyloxycarbonylpyrιdaz e-3-carboxylate (1.15g, 3.58mmol) in dry dichloromethane (2ml) followed by 5 ^L aqueous sodium bicarbonate solution (25ml) . The mixture was stirred rapidly at room temperature for 20 then diluted with ethyl acetate (100ml) and acidified to pH2 with IM HCl. The organic phase was washed twice with dilute HCl solution then brme, dried (MgS0 ₄ ) and concentrated. The resulting oil was purified by flash cnromatography (2-20 etnyl acetate/dichloromethane tnen 10-20- methanol/dich orometnane, to afford '267t, 1.25g (52") as a white powder: IR (KBr) 3367, 2955, 1 ^{^} 22, 1517, 1455, 1387, 1369, 1251, 1153, 721; ¹ HENMR (CDC1 ₃ ) δ 7.81 (2H, m) , 7.74 (2H, m) , 7.63 (IH, brs), 7.31 (1CH, ) , 5.46-4.76 (5H, m) , 4.07-3.54 (4H, ; , 2.4 (IH, m) , 2.0-1.6 (3H, m) , 1.40 OH, s) ; MS (ES+), 6 ^{^} 1 (M + 1) , 693 (M + Na .

(1S,9S) t-Butyl 1,2,3,4 ,7,8,9, 10-octahydro-10-oxo-9- phthalimido-6H-pyridazino[1,2-a] [1,2,4] triazepιne-1- carboxylate (268) . A solution of ester 267 (50nag, 0.074mmol) in methanol (15ml) was treated with 10% palladium on carbon (50mg) and hydrogenated at room temperature and atmospheric pressure for 24h. The mixture was evacuated thoroughly to remove hydrogen then treated with 37% aqueous formaldehyde (18mg, 0.22mmol) and stirred under nitrogen for 2h. The mixture was filtered, evaporated to dryness and the product purified by flash chromatography (4-100* ethyl acetate/dichloromethane) to afford 268 14.5mg (48%) as an oil: ¹ U NMR (CDC1 ₃ ) δ 7.85 (2H, m) , 7.71 (2H, m) , 5.78 (IH, dd, J = 10, 5), 4.99 (IH, dd, J = 6.1, 1.5) , 4.07 (IH, d, J = 10.6), 3.49 (IH, dd, J = 14, 5) , 3.39 (IH, d, J = 10.3), 3.24 (IH, dd, J = 14, 10.2), 3.17 (2H, m) , 2.39 (IH, m) , 1.84-1.46 (3H), 1.51 (9H, s) ; MS (ES+), 415 (M + 1), 437 (M + Na) .

Compounds 280-283 were prepared from 212b by a method similar to the method used to prepare 226e.

Compounds 284-287 were prepared by a method similar to the method used to prepare 217e.

280-287

compound F^

287 ^r

(3S) 3-Allyloxycarbonylamino-4-oxobutyπc acid tert- butyl ester O- (2 , 6-dichlorophenylmethyl) oxime (306a) was prepared by a similar procedure as 208a except that 2, 6-dιchlorophenylmethoxyamme (prepared by a similar method as 306b) was used instead of semicarbaziαe to give 870mg (quant.) as a clear oil.

(3S) 3-Allyloxycarbonylamιno-4-oxobutyπc acid tert- butyl ester O- (2- (phenyl)ethyl)oxi e (306b) was prepared oy a similar procedure as 208a except chat _

(phenyl) ethoxyamme (US 5 346 911) was used instead of semicarbazide to give 395mg (quant.) as a clear oil.

[3S(1S, 9S) 3- (9-Benzoylammo-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazιno- [1,2-a] [1 ,2]dιazapιne-l-carboxamιdo) -am o]-4- oxobutanoicacid t-butyl ester, 0-(2,6- dicniorophenylmethyl)oxime (307a) was prepared by a procedure similar to 233e except 306a was used instead of 207a to give 23 mg(23%) of 307a as a white solid.

[3S(1S,9S) 3- (9-Benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyπdazιno- [1 ,2-a] [1,2]diazapine-l-carboxamιdo) -amino] -4- oxobutanoic acid t-butyl ester, 0-(2- (phenyl)ethyl)oxime (307b) was prepared by a procedure similar to 233e except 306b was used instead of 207a to give 43 mg(48%) of 307b as a white solid.

[3S(1S, 9S) 3- (9-Benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyπdazιno- [1,2-a] [1,2]dιazapιne-l-carboxamιdo) -amino] -4- oxobutanoic acid, O- (2 , 6-dιchlorophenylmethyl) oxime

(308a) was prepared by from 307a a procedure similar to the preparation of 235e from 234e to give 15.2 g (74 ) as white solid: ¹ H NMR(CD ₃ 0D) δ 0.9(m), 1.3(s), 1.7(m), 1.8(m) , 2.0 (m), 2.1-2.2(m) , 2.3(dd) , 2.4- 2.5(m) , 2.6(m), 2.7-2.8(m) , 3.1(m) , 3.3(m) , 3.4-3.5(m), 4.5(m), 4.9(m), 5.1(m), 5.3(d), 5.4 (s> , 6.8(d) , 7.2- ^'7 .5{π.) , 7.8 (dd) , 8.4 (dd) .

[3S(1S,9S) 3- (9-Benzoylammo-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazιno- [1,2-a] [1,2]diazapιne-l-carboxamido) -amino] -4- oxobutanoic acid, O- (2- (phenyl) ethyl)oxime (308b) was prepared by from 307b a procedure similar to the preparation of 235e from 234e to give 25.2 mg (68%) as white solid: ¹ H NMR(CD ₃ 0D) δ 1.2(m), 1.6-1.7(m), 2.0- 2. Km), 2.2(m), 2.3 (m) , 2.5(m), 2.6-2.7(dd), 2.9(t) , 3.0(t), 3. l(m), 3.3-3.5(m), 4.2(t) , 4.25(m), 4.5 (m) , 5.2(t), 5.3(t), 6.7(d), 7.1-7.2(m), 7.35(dd) , 7.4(m) , 7.5 (m) , 7.8 (dd) , 8.3 (dd) .

(302 ) (303a) R=CH 3

( 304a) R=CH ₃

[3S(1S,9S) 3- (9-Benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιazιno- [1,2-a] [1,2]dιazapιne-l-carboxamιdo) -am o] -4- oxobutanoic acid tert-butyl ester (302) . Step A: 301 was prepared by procedure similar :o 605a (Step A) , except 212e was used instead of 603a to give 540 mg (34%) to give a white solid.

Step B: 302. A solution of 301 (50.7 mg; 0.091 mmol) in 2.8 ml of MeOH/HOAc/37% aq. formaldehyde (5:1:1) was stirred at rt for 5.5 h. and the reaction was concentrated to 0.7 ml m vacuo . The residue was dissolved m 3 ml of CH ₃ CN and concentrated to 0.7 ml (3x), dissolved in toluene and concentrated to 0.7 ml m vacuo (2x) , and concentrated to dryness. Chromatography (flash, Sι0 , 5% ιsopropanol/CH ₂ Cl ₂ ) gave 302 (45.5 mg, 78%) as a white solid: ¹ H NMR(DMS0-d ₆ ) δ 1.0-1.15(11., 2H) , 1.4(s, 9H) , 1.65 ( , 2H), 1.9-2.1 (m, 2H) , 2.15-2.4 (m, 3H) , 2.55 (m, IH), 2.7-3.0(m, 2K) , 4.3- 4.6(m, 2H), 4.9(m, IH) , 5.2 (m, IH) , 7.4-7.6 (m, 2H) , 7.8-8.0 (m, 2H) , 8.6 (m, IH) , 8.8(m,lH) , 9.4 (s, IH) .

[1S,9S (2RS,3S)] 9-Benzoylamιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-N- (2-methoxy-5-oxo- tetrahydro-furan-3-yl) -6H-pyrιdazιno [1 ,2-a] [1,2] dιazapιne-1-carboxamide. (304a) . Step A: A solution of 302 (90 mg; 0.18 mmol) m lo r. of MeOH was treated with tnmethylorthofor ate '1ml ¹ and p-tolαene sulfonic acid hydrate mg; 0.C26 mmcl and the reaction was stirred for 20 h. The reaction was treated with 3 ml of aq. sat. NaHC0 ₃ and concentrated m va cuo . The residue was taken uo

EtOAc and washed with dilute aq. NaHC0 ₃ , dried over MgS0 ₄ and concentrated m vacuo to give 80 mg of 303a. Step B: 303a was dissolved in 2 ml of TFA and stirred at rt for 15 mm. The reaction was dissolved in CH ₂ C1 _? and concentrated m vacuo (3x) . Chromatography (flash, Sι0 ₂ , 1% to 3% MeOH/CH ₂ Cl ₂ gave 43 mg (64%) of 304a a s a white solid: ¹ H NMR(CDC1 ₃ ) δ 1.55-1.8(m, 2H) , 1.9- 2.15(m, 4H) , 2.25-2.5 (m, 2H) , 2.7-3.3(m, 4H) , 3.45, 3.6(s, s, 3H) , 4.4, 4.75(2m, IH) , 4.6 (m, IH) , 4.95, 5.4(t,d, IH) , 5.1-5.2(m, IH) , 6.45, 7.05(2d, IH) , 6.95(m, IH) , 7.45(m, 2H) , 7.5(m, IH) , 7.85 (m, 2H) .

Example 11 Compounds 214e, 404-413, 415-445, 446-468, 470-491, and 493-499 were synthesized as described in Example 11 and Table 7.

Λ>

Step A. Synthesis of 401. TentaGel S" NH ₂ resin (0.16 mmol/g, 10.0 g) was placed in a sintered glass funnel and washed with DMF (3 x 50 mL) , 10% (v/v) DIEA in DMF (2 x 50 mL) and finally with DMF (4 x 50 mL) . Sufficient DMF was added to the resin to obtain a slurry followed by 400 (1.42 g, 2.4 mmol, prepared from (3S) -3- (fluorenylmethyloxycarbonyl) -4-oxobutryιc acid t-butyl ester according to A.M. Murphy et . al . J. Am. Chem. Soc, 114, 3156-3157 (1992) ), 1- hydroxybenzotriazole hydrate (HOBT«H ₂ 0; 0.367 g, 2.4 mmol) , O-benzotriazol-1-yl-Λ, N, N, N' -tetramethyluroniu hexafluorophosphate (HBTU; 0.91 g, 2.4 mmol), and DIEA (0.55 mL, 3.2 mmol) . The reaction mixture was agitated overnight at rt using a wrist arm shaker. The resin was isolated on a sintered glass funnel by suction filtration and washed with DMF (3 x 50 mL) . Unreacted amine groups were then capped by reacting the resin with 20% (v/v) Ac ₂ 0/DMF (2 x 25 L) directly the funnel (10 min/wash) . The resin was washed with DMF (3 x 50 mL) and CH ₂ Cl ₂ (3 x 50 mL) prior to drying overnight in vacuo to yield 401 (11.0 g, quantitative yield) .

Step B. Synthesis of 402. Resin 401 (6.0 g, 0.16 mmol/g, 0.96 mmol) was swelled in a sintered glass funnel by washing with DMF (3 x 25 mL) . The Fmoc protecting group was then cleaved with 25- (v/v) piperidine/DMF (25 L) for 10 mm (intermittent stirring) and then for 20 mm with fresh piperid e reagent (25 ml) . The resin was then washed with DMF (3 x 25 ml), followed by W-methypyrrolidone (2 x 25 mL ¹ . After transferring the resin to a 100 mL flask, N- methypyrrolidone was added to obtain a slurry followed

by 212f (0.725 g, 1.57 mmol) , HOBT-H ₂ 0 (0.25 g, 1.6 mmol), HBTU (0.61 g, 1.6 mmol) and DIEA (0.84 mL, 4.8 mmol) . The reaction mixture was agitated overnight at rt using a wrist arm shaker. The resin work-up and capping with 20% (v/v) Ac ₂ 0 in DMF were performed as described for 401 to yield 402 (6.21 g, quantitative yield) .

Step C. Synthesis of 403. This compound was prepared from resin 402 (0.24 g, 0.038 mmol) using an Advanced ChemTech 396 Multiple Peptide synthesizer.

The automated cycles consisted of a resin wash with DMF (3 x 1 mL) , deprotection with 25% (v/v) piperidine in DMF (1 L) for 3 min followed by fresh reagent (1 mL) for 10 min to yield resin 403. The resin was washed with DMF (3 x 1 mL) and W-methypyrrolidone (3 x 1 L) .

Step D. Method 1. [3S(1S, 9S) ] -3- (6, 10-Dioxo- 1,2,3,4,7,8,9,10-octahydro-9- (thiophene-3- carbonylamino) -6H-pyridazιne[1,2-a] [1 ,2Idiazepine-l- carboxamido) -4-oxobutanoic acid (409) . Resin 403 was acylated with a solution of 0.4M thiophene-3-carboxylιc ac d and 0.4M HOBT in Λ-methypyrrolιdone (1 mL), a solution of 0.4M HBTU in N-methylpyrrolidone (0.5 mL) and a solution of 1.6M DIEA in N-methypyrrolidone (0.35 mL) and the reaction was shaken for 2 hr at rt . The acylation step was repeated. Finally, the res was washed with DMF (3 x 1 mL) , CH ₂ C1 ₂ (3 x 1 mL) and dried i n vacuo . I e aldehyde was cleaved from the resm and globally deprotected by treatment with 95 TFA/5 H-.C (v/v, 1.5 ml' for 30 mm at rt. After washing tne resin with cleavage reagent (1 mL) , tne combined filtrates were added to cold 1:1 Et 0:pentane (12 mL;

and the resulting precipitate was isolated by centrifugation and decantation. The resulting pellet was dissolved m 10% CH ₃ CN/9O& H ₂ O/0.1% TFA (15 mL) and lyophilized to obtain crude 409 as a white powder. The compound was purified by semi-prep RP-HPLC with a Rainin Microsorb™ C18 column (5 μ, 21.4 x 250 mm) eluting with a linear CH ₃ CN gradient (5% - 45%) containing 0.1% TFA (v/v) over 45 mm at 12 mL/mm. Fractions containing the desired product were pooleα and lyophilized to provide 409 (10.8 mg, 63%) .

Step D. Method 1A. Synthesis of 418. Following a similar procedure as method 1, res 403 was acylated with 4- (1-fluorenylmethoxycarbonylamino) benzoic acid and repeated. The Fmoc group was removed as described m Step C and the free amine was acetylated with 20% (v/v) Ac ₂ 0 in DMF (1 mL) and 1.6M DIEA in N- methyipyrrolidone (0.35 mL) for 2 hr at rt. The acetylation step was repeated. Cleavage of the aldehyde from the resin gave 418 (3.2 mg) .

Step D. Method IB. Synthesis of 447. Following a similar procedure as method 1A, resin 403 was acylated with 0.4M 4-(l- fluorenylmethoxycarbonylamino) benzoic acid. The acylation step was repeated once. The Fmoc group was removed as before and the free amme was reacteα with IM methanesulfonyl chloride in CH ₂ C1 ₂ (0.5 mL) and IM pyrid e in CH C1 (0.60 mL) for 4 nr at rt . Cleavage of the aldehyde from the resm gave 447 (10.0 mg) .

Step D. Method 2. Synthesis of 214e. Following a similar procedure as method 1, resm 403 was acylated

with 0.5M benzoyl chloride in W-methypyrrolidone (1 mL) and 1.6M DIEA in iV-methypyrrolidone (0.35 mL) for 2 hr at rt. The acylation step was repeated. Cleavage of the aldehyde from the resm gave 214e (5.1 mg, 30*> .

Step D. Method 3. Synthesis of 427. Following a similar procedure as method 1, resm 403 was reacted with 1. OM benzenesulfonyl chloride m CH ₂ C1 ₂ (0.5 mL) and IM pyrid e m CH ₂ C1 ₂ (0.60 mL) for 4 hr at rt . The reaction was repeated. Cleavage of the aldehyde from the resin gave 427 (7.2 mg, 40%) .

Step D. Method 4. Synthesis of 420. Following a similar procedure as method 1, resm 403 was reacted with 0.5M methylisocyanate m N-methypyrrolidone (1 L) and 1.6M DIEA m N-methypyrrol idone (0.35 mL) for 2 hr at rt. The reaction was repeated. Cleavage of the aldehyde from the resm gave 420 (8.3 mg, 55%) .

Step D. Method 5. Synthesis of 445. Following a similar procedure at method 1, resm 403 was acylated with 0.27M ιmιdazole-2-carboxylιc acid (1 mL) 2 : 1 DMF:H ₂ 0 (with 1 eq. DIEA) and IM l-(3- dimethylammopropyl) -3-ethylcarbod ιmιde hydrochloride (EDC) in 2 : 1 _V-methypyrrolidone/H ₂ 0 (0.35 mL) for 3 hr at rt . Cleavage of the aldehyde from the res αave 445 (9.5 mg) .

Analytical HPLC methods:

1) Waters DeltaPak C18, 300A (5μ, 3.9 x 150 mm . Linear CH ₃ CN gradient (5 ^" - 45- containing 0.1 TFA (v/v) over 14 mm at 1 mL/min.

(2) Waters DeltaPak C18, 300A (5μ, 3.9 x 150 mm) . Lmear CH ₃ CN gradient (0% - 25%) containing 0.1 '■ TFA (v/v) over 14 min at 1 mL/min.

(3) Waters DeltaPak C18, 300A (5μ, 3.9 x 150 mm) . Isocratic elution with 0.1% TFA/water (v/v) at 1 mL/min.

(4) Waters DeltaPak C18, 300A (5μ, 3.9 x 150 mm) . Linear CH ₃ CN gradient (0% - 30%) containing 0.1% TFA (v/v) over 14 min at 1 mL/min.

(5) Waters DeltaPak C18, 300A (5μ, 3.9 x 150 mm) . Linear CH ₃ CN gradient (0% - 35%) containing 0.1% TFA (v/v) over 14 min at 1 mL/min.

Table 7

Example 12 Compounds 605a-j, 605m-q, 605s, 605t, and

605v were synthesized as described below.

(3S) -2-OXO-3-tert-butoxycarbonylamιno-2 ,3,4,5- tetrahγdro-lH-1,5-benzodιazepme-l-acetιc acid methyl ester (600a/103) .

Step A. (2S) -2- ert-Butoxycarbonylamιno-3- (2- nitrophenyl-amino) -propionic acid. (2S)-2-ter£- Butoxycarbonylammo-3-amιnopropιonιc acid (10 g, 49 mmol), 2-fluoromtrobenzene (5.7 ml, 54 mmol) , and NaHC0 ₃ (8.25 g, 98 mmol) was taken into 130 ml cf DMF

and heated at 80 °C for 18 h. The reaction was evaporated m vacuo to give a viscous orange residue that was dissolved in 300 ml of H ₂ 0 and extracted with Et ₂ 0 (3 x 150 ml) . The aq. solution was acidified to pH 5 with 10% NaHS0 ₄ and extracted with EtOAc (3 x 250 ml) . The combined extracts were dried over anhydrous Na ₂ S0_ _] , filtered, and evaporated to give 12.64 g (83%) of the title compound as an orange amorphous solid: H NMR (CD ₃ OD) δ 8.15-8.10 (lH,d), 7.54-7.48 (lH,t) , 7.13- 7.08 (IH, d) , 6.73-6.65 (IH, t), 4.45-4.35 (IH, m) , 3.9-3.8 (IH, dd) , 3.65-3.55 (IH, dd) , 1.45 (9H, s) .

Step B. (2S) -2-tert-Butoxycarbonγlammo-3- (2- aminophenyl-amino) -propiomc acid. A mixture of (2S)- 2-tert-Butoxycarbonylammo-3- (2- itrophenylammo)propiomc acid (12.65 g, 40.5 mmol) and 0.5 g of 10% Pd/C in 100 ml of MeOH under hydrogen at 1 atmosphere was stirred for 4 h. The solution was filtered through Celite 545 and the filtrate evaporated m vacuo to afford the 11.95 g of the title compounα quantitative yield as a dark brown solid that was used without purification: ¹ H NMR (CD ₃ OD) δ 6.75-6.70 (3H,m) , 6.65-6.58 (IH, m) , 4.35-4.3 IH, m) , 3.6-3.38 (2H, m) , 1.45 (9H, s) .

Step C. (3S) -2-OXO-3- ert-Butoxycarbonylamιno-1 ,3,4,5- tetrahydro-lH-1 ,5-benzodιazepιne. l-(3-

Oimethylammopropyl) -3-ethylcarbodιrmιde hydrochloride (8.54 g, 44.5 mmol) was added to a cooled (0 °C) solution of (2S) -2-tert-butoxycarbonylamιno-3- (2- srmophenylammo) propiomc acid (11.95 g, 40.5 mmol) in 113 ml of DMF and stirred for 18 h. The reaction was poured mto 700 ml of EtOAc and washed four times with

100 ml of H ₂ 0. The organic layer was dried over anhydrous Na ₂ Sθ ₄ , filtered, and evaporated to give a brown solid that was purified by flash chromatography eluting with 3:7 EtOAc/hexane to give 8 g (71%) of the title compound: ¹ H NMR (CDC1 ₃ ) δ 7.78 (IH, s), 7.02- 6.95 (IH, m) , 6.88-6.82 (IH, m) , 6.82-6.78 (IH, m) , 6.75-6.70 (IH, m) , 5.8-5.7 (IH, d) , 4.55-4.45 (IH, ), 3.95 (IH, s), 3.9-3.82 (IH, m) , 3.48-3.40 (lH,m) , 1.45 (9H,s) .

Step D. (3S) -2-Oxo-3-tert-butoxycarbonylamιno-2,3,4 ,5- tetrahγdro-lH-1 ,5-benzodιazepιne-l-acetιc acid methyl ester (600a/103) . A 1.0 M solution of lithium bis (trimethylsilyl) amide (3.4 ml, 3.4 mmol) m THF was added dropwise to a -78 °C solution of (3S) -2-oxo-3- tert-butoxycarbonylammo-2, 3, 4, 5-tetrahydro-lH-l, 5- benzodiazepme (0.94 g, 3.38 mmol) in 20 ml of anhydrous THF and stirred for 30 mm. Methyl bromoacetate (o.44 ml, 4 mmol) was aαded dropwise to the reaction mixture then warmed to RT . The reaction was diluted with 100 ml of EtOAc and washed with 0.3N KHS0 ₄ (50 ml), H ₂ 0 (2 x 50 ml) , and br e. The combmed organics were dried over anhydrous Na ₂ S0 ₄ , filtered, and evaporated to afforded a gum that was purified by flash chromatography elut g with 3:7 EtOAc/Hex. to give 0.98 g (83%) of the title compound as a white solid. ¹ H NMR (CDC1 ₃ ) δ 7.15-7.07 (2h, m) , 6.98-6.94 (IH, m) , 6.88-6.84 (IH, d), 5.62-5.55 (_ ., d) , 4.71-4.65 (IH, d) , 4.65-4.6 (IH, m) , 4.33-4.2^ (14, d) , 3.96-3.90 (IH, m) , 3.78 (3H, s), 3.44-3.37 (lh, m , 1.4 (9H, s) .

(3S) -2-Oxo-3-tert-butoxycarbonylamιno-2,3,4 ,5- tetrahydro-lH-1 ,5-benzodιazepιne-l-acetic acid benzyl ester (600b) . Prepared by a similar method described for the preparation of 600a/103 (Step D) , except benzyl bromoacetate was used instead of methyl bromoacetate to give 600b in quantitative yield.

(3S) -2-Oxo3-tert-butoxγcarbonylamιno-2,3,4,5- tetrahydro-7, 9-dιmethyl-lH-l ,5-benzodιazepιne-l-acetic acid benzyl ester (600c) . Step A. (25) -2-tert-Butoxycarbonylammo-3- (2-nιtro-

3, 5-dιmethylphenylammo) -propiomc acid. Prepared by a method similar as described for 600a/103 (Step A) , except 2-fluoro-4, 6-dιmethyl-nιtrobenzene was used instead of 2-fluoronitrobenzene to give the desired compound 93% yield.

Step B. (2S) -2-te_rt-Butoxycarbonylamιno-3- (2-amιno- 3,5-dιmethylphenyl-amιno) -propiomc acid. (25) -2- tert- Butoxycarbonylammo-3- (2-nιtro-3, 5-dιmethylphenyl- am o) propiomc acid was converted to the title compound in quantitive yield as described in the prepartation of 600a/103 (Step B) .

Step C. 2-Oxo- (3S) -3-tert-butoxycarbonylamιno-2 ,3,4,5- tetrahydro-7 , -dιmethyl-lH-l ,5-benzodιazepιne. A 0 °C solution of (25) -2-tert-butoxycarbonyiamιno-3- ι2-ammc- 3, 5-dιmetnylphenyl-ammo) -propiomc acid (763 mg, 2.3 mmol) and N-methylmorpholme (483 mg, 4. 8 mmol in 6f ml of anhydrous THF was treated dropwise with isobutylchloroformate (352 mg, 2.5 mmol^ . The reaction was stirred for 2 h at 0 °C, at RT for lh ana poured over EtOAc. The mixture was washed with aq. 5 NaHS^ ₄ ,

sat. aq. NaHC0 ₃ , and sat. aq. NaCl, dried over NaS0 ₄ , and concentrated in vacuo. Chromatography (flash, Sι0 ₂ , 10% to 25% to 50 % EtOAc/CH ₂ Cl ₂ ) gave 490 mg (68,) of the desired product.

Step D. (3S) -2-Oxo-3-tert-butoxycarbonylamιno-2,3,4 , 5- tetrahydro-7 , 9-dιmethyl-lH-l , 5-benzodιazepιne-l -acetic acid benzyl ester (600c) . (2S) -2-tert- Butoxycarbonylammo-3- (2-ammo-3, 5-dιmethylphenyl- ammo) -propiomc acid was converted to 600c, 75% by a similar method for the preparation of 600b.

(3S) -2-Oxo-3-benzoylammo-5- (3 -phenylpropionyl) - 2 ,3, ,5-tetrahydro-lH-l ,5-benzo dιazepme-1-acetιc acid methyl ester (602a) . Step A. Anhydrous HCl was bubbled into a solution of

(35) -2-OXO-3- ert-butoxycarbonylammo-2 , 3,4,5- tetrahydro-lH-1, 5-benzodιazepme-l-acetιc ac_α methyl ester (600a/103, 4.0 g, 11.4 mmol) in 20 ml of CH ₂ Ci ₂ for 20 mm then stirred for 1 h at RT . The reaction

was evaporated to give (35) -2-oxo-3-ammo-2, 3, 4, 5- tetrahydro-lfi-1, 5-benzodιazepme-l-acetιc acid methyl ester hydrochloride as a white solid.

Step B. The white solid was dissolved m 70 ml of DMF and benzoic acid (1.5 g, 12.3 mmol) was added. The reaction was cooled in a ιce/H ₂ 0 bath and treated with 1- (3-dιmethylammopropyl) -3-ethylcarbodιιmιde hydrochloride (2.4 g, 12.5 mmol), 1- hydroxybenzotπazole (1.7 g, 12.6 mmol) and dusopropylethylamine (3.0g, 23.2 mmol) . The reaction was stirred for 18 h at RT under nitrogen atmosphere and poured onto H ₂ 0. The aq. mixture was extracted with EtOAc (2x) . The combmed organic layers were washed with aq. 0.5 N NaHS0 _/ H ₂ 0, sat. aq. NaHC0 ₃ , H ₂ 0 and sat. aq. NaCl, dried over MgS0 ₄ and concentrated i n vacuo . Chromatography (flash, Sι0 ₂ , 10% to 30% EtOAc/CH ₂ Cl ₂ ) gave 3.4 g (85%) of (35^ -2-oxo-3- (benzoylammo) -2, 3, 4, 5-tetrahydro-lJ-l, 5- benzodιazepme-1-acetιc aciα methyl ester as a white solid.

Step C. Method A. (3S) -2-Oxo-3-benzoylamιno-5- (3- phenylpropionyl) -2,3,4 ,5-tetrahydro-lH-l ,5- benzodιazepme-1-acetic acid methyl ester (602a) . A solution of (35) -2-OXO-3- (benzoylammo) -2, 3, 4, 5- tetrahydro-lH-1, 5-benzodιazepme-1-acetιc acid meth\ __ e;s: ter (200 mg, 0.57 mmol) in CH Cl ₂ (l0 ml) was treateo w;ι. th triethylam e (119 mg, 1.13 mmol and 3- pnenylpropionyl chloride (114 mg, 0.6& mmol) . The reaction was stirred at RT for 30 mm and diluted witn CHoClo. The solution was washed with aq. 10 HCl sat. aq. NaHC0 ₃ and sat. aq. NaCl, αried over Na- _> SO _d ana

concentrated m vacuo to give 240 mg (87%) of 602a as a white foam.

Step C. Method B. (3S) -2-Oxo-3-benzoylammo-5- acetoacetyl-2,3,4,5-tetrahydro-lH-l ,5-benzodiazepιne-l- acetic acid benzyl ester (602g) . A 0 °C solution of (35) -2-OXO-3- (benzoylamino) -2, 3, 4, 5-tetrahydro-lH-l, 5- benzodιazepine-1-acetic acid benzyl ester (600b) (465 mg, 1.10 mmol) in CH ₂ C1 ₂ (5 ml) was treated with acetoacetic acid in 1 ml of CH ₂ C1 followed by slow addition of 1- (3-dimethylammopropyl) -3- ethylcarbodiimide hydrochloride (431 mg, 2.2 mmol) in 2 ml of CH ₂ C1 ₂ under N ₂ atmosphere. After 15 min the reaction was poured onto EtOAc, washed with aq. 5 % NaHS0 ₄ , dried over Na ₂ S0 ₄ and concentrated in vacuo . Chromatography (flash, Si0 ₂ , 0% to 10% to 25% MeOH/CH ₂ Cl ₂ ) gave 580 mg of (35) -2-oxo-3- (benzoyla ino) -5-acetoacetyl-2, 3, 4, 5-tetrahydro-l#-l, 5- benzodiazepιne-1-acetιc acid benzyl ester as a white solid.

Step C. Method C. (3S) -2-Oxo-3-benzoylamιno-5- methoxycarbonyl-2,3,4,5-tetrahγdro-lH-l ,5-benzo diazepine-1-acetic acid benzyl ester (6O23) . A vigorously-stirred, 0 °C solution of (35) -2-oxo-3- (benzoylammo) -2, 3, 4, 5-tetrahydro-ltf-l, 5- benzodiazepme-1-acetιc acid benzyl ester (600b^ (461 mg, 1.07 mmol) m THF (5 ml) and sat. aq. NaHC0 ₃ (2.5 ml) was treated with a THF solution (0.35 ml) of methyl chlorofor ate (151 mg, 1.6 mmol) and the reaction was stirred for 45 mm at RT . The reaction was poured onto CH ₂ C1 ₂ and washed with H ₂ 0, dried over Na ₂ S0 ₄ and concentrated i n vacuo . Chromatography

(flash, Si0 ₂ , 0% to 10% Me0H/CH ₂ Cl ₂ ) gave 525 mg of 602j as a white solid.

Step C. Method D. (3S) -2-Oxo-3-benzoylamino-5- benzylaminocarbonyl-2,3, ,5-tetrahydro-lH-l,5- benzodiazepιne-1-acetic acid methyl ester (602p) . A solution of 600a/103 (400 mg, l.lmmol) and benzylisocyanate (166 mg, 1.2mmol) in 10 ml of CH ₂ C1 ₂ and 10 ml of DMF and heated at 80 °C for 3 days. The reaction was cooled to RT poured onto H 0 and extracted with EtOAc (2x) . The combined organic layers were washed with H ₂ 0 (4x) and sat. aq. NaCl, dried over MgS0 and concentrated in vacuo . Chromatography (flash, Si0 ₂ , 50% to 80% EtOAc/hexane) gave 440 mg (80%) of 602p as a white solid.

Step C. Method E . (3S) 2-Oxo-3-benzylamino-5- (3- phenylpropionyl) -2,3,4 ,5-tetrahydro-lH-l ,5- benzodiazepme-1-acetic acid methyl ester (602v) . A solution of (3S) 2-oxo-3-amino-5- (3-phenylpropιonyl ) - 2,3,4, 5-tetrahydro-lH-l, 5-benzodιazepme-l-acetιc acid methyl ester hydrochloride (560 mg, 1.34 mmol), benzaldehyde (146 mg, 1.34 mmol) and sodium acetate (220 mg, 2.68 mmol) in methanol (20 ml) was treated with 4A sieves (2 g) and NaCNBH ₃ (168 mg, 2.68 mmol) . The reaction was stirred for 2.5 h, acidified with 10 aq. HCl to pH 2 and washed with Et 0 (2x^5 ml) . The organic layers were concentrated i n va cuo to give an oil. Chromatography (flash, Si0 ₂ , 0 to 35- EtOAc/CH ₂ Cl ₂ ' gave 250 mg (40%) of 602v as a clear oil.

Step D. Method A. (35) -2-Oxo-3-benzoylammo-5- (3- phenylpropionyl) -2,3,4,5-tetrahydro-lH-l ,5-

benzodiazepιne-1-acetic acid (603a) . (35) -2-Oxo-3- benzoylammo-5- (3-phenylpropionyl) -2, 3, 4, 5-tetrahydro- 1H- 1, 5-benzo dιazepme-1-acetic acid methyl ester (602a; 1.25 g, 2.57 mmol) was dissolved in 11 ml of THF, MeOH and H ₂ 0 (5:5:1) and treated with LιOH«H ₂ 0 (42 mg, 0.62 mmol) stirred at RT for 64 h. The reaction was concentrated i n vacuo, diluted with H ₂ 0 and acidified with aq. IN HCl to give 230 mg of 603a as a white solid.

Step D. Method B. (3S) 2-Oxo-3-benzoylamιno-5-acetyl- 2,3,4,5-tetrahydro-lH-l,5-benzodιazepιne-l-acetιc acid

(603d) . A mixture of (35) -2-oxo-3- (benzoylammo) -5- acetyl-2, 3, 4, 5-tetrahydro-l/f-l, 5-benzodιazepme-1- acetic acid benzyl ester (602d; 510 mg, 1.08 mmol) and 5% Pd/C (250 mg) in MeOH (10 ml) stirred under H ₂ (1 atm) for 0.5h. The reaction was filtered and concentrated i n vacuo 410 mg of 603d as a white solid.

The compounds of Table 8 were prepared as described in Table 9, using the methods of Example 12.

Table 8

Table 9

603

The compounds of Table 10 were prepared as described Table 11 using the methods of Example 12

Table 10

The compounds of Table 12 were prepared by the methods described below.

Table 12

(3S) -3 - [ (3S) -2-Oxo-3-benzoylammo-5 - ( 3- phenylpropionyl) -2,3,4,5-tetrahydro-lH-l,5- benzodιazepm-1-acetylammo]4-oxo-butyrιc acid (605a) .

Step A. (3 ) -3- ( 1-Fluorenylmethyloxycarbonylamino) -4- oxobutyric acid tert-butyl ester semicarbazone (210 mg, 0.45 mol, Prepared in a similar manner to the benzyloxycarbonyl analog in Graybill et al . , Int. J.

Protein Res. , 44, pp. 173-82 (1994) .) was dissolved 10 ml of DMF and 2 ml of diethylamine and stirred for 2 h. The reaction was concentrated i va cuo to give (35) -3-ammo-4-oxobutyrιc acid tert-butyl ester semicarbazone. The 0 °C solution of tne above residue and 603a (200 mg, 0.42mmol) in 5 ml of DMF and 5 ml cf

CH ₂ C1 ₂ was treated with 1-hydroxybenzctrιazole (5 ^7 mg, 0.42mmol) and I- (3-dιmethylammopropyl) -3- ethylcarbodnmide hydrochloride (98 mg, 0.51 mmo__) . Tne reaction was stirred at RT for 18 h, poured onto

EtOAc (75 ml) and washed with aq. 0.3 N KHS0 ₄ , sat. aq. NaHC0 ₃ and sat. aq. NaCl, dried over NaSO^ and concentrated m vacuo. Chromatography (flash, Sι0 , 0~ to 4% MeOH/0.1% NH ₄ 0H/CH ₂ C1 ₂ ) to give 240 mg (83%) of c. 604a.

Step B. 604a was stirred with 10 ml of 33% TFA/H ₂ 0 for 4 h and concentrated m vacuo. The residue was dissolved m 7 ml of MeOH/acetic acid/37% aq. formaldehyde (5:1:1) and stirred for 18 h. Chromatography (Reverse Phase C18, 4.4mm ID x 25 cm,

15% to 70% CH ₃ CN/0.1% TFA/H ₂ 0) gave 32 mg (16%) cf 605a as a white solid: H NMR (CD ₃ 0D, existing as diastereomers of the hemiacetal) δ 7.85-7.78 (2H, d) , 7.5-7.32 (6H, m) , 7.32-7.28 (IH, m) , 7.18-6.98 (5H, m) , 4.92-4.85 (2H, m) , 4.5-4.32 (2H, m) , 4.31-4.20 (2H, m) , 3.7-3.6 (IH, m) , 2.90-2.75 (2H, m) , 2.65-2.5 (IH, m) , 2.48-2.25 (3H, m) .

The following compounds were prepared by a similar method:

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-phenylacetyl- 2,3,4 , 5-tetrahydro-lH-l , 5-benzodιazepιn-l- acetyla o] 4-oxo-butyrιc acid (605b) . 148 mg (33 ) as a white solid: ¹ H NMR(CD ₃ OD) δ 7.9-6.9 (IT, 16H , 4.9 (s, 2H), 4.5 (m, IH) , 4.4 (m, 2H) , 3.75 (s, 1UA 3.1 (dd, IH) , 3.45 (dd, IH) , 2.7 (m, IH) , 2. ^c ( , IH) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-benzoyl-2 ,3,4,5- tetrahydro-lH-1 , 5-benzodιazepιn-l-acetylammo ] 4 -oxo- butyπc acid (605c) . 319 mg (56°) as a wnite solid: ¹ H NMR(CD ₃ 0D) δ 7.9-6.9 (m, 16H) , 5.1 ( , IH) , 4.9 (dd,

IH), 4.7 (m, IH), 4.6 (dd, IH) , 4.4 (m, 2H) , 4.05 (m, IH) , 2.7 (m, IH) , 2.5 (m, IH) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5-acetyl-2,3,4 ,5- tetrahydro-lH-1,5-benzodiazepin-l-acetylamino]4-oxo- butyric acid (605d) . 190 mg (38%) as a white solid: ^X H NMR(CD ₃ 0D) δ 1.9(d, H) , 2.4 (m, IH) , 2.65(m, IH), 3.7 (m, IH) , 4.25 (m, IH) , 4.45(m, 2H) , 4.8-5.05(m, 3H) , 7.3-7.7 (m, 7H) , 7.9(d, 2H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5-methoxyacetyl- 2,3,4,5-tetrahydro-lH-l ,5-benzodiazepm-l- acetyla ino]4-oxo-butyric acid (605e) . 250 mg (78%)

¹ U NMR (CD ₃ OD) δ 1.87 (bs), 1.95 (s, 2H) , 2.1 (bs), 2.4 (m, 2H) , 2.65 (m, 2H) , 3.59 (bs), 3.75 (bs), 3.87 (bs) , 4.19 (m) , 4.37 (m) , 4.50-4.78 (bm) , 4.92 (m) , 5.27 (bs), 7.41-7.58 (m, 7H) , and 7.87 ppm (d, 2H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5- (3-methylbutyryl) - 2,3,4,5-tetrahydro-lH-l,5-benzodiazepιn-l- acetylamino]4-oxo-butyric acid (605f) . 210.5 mg (46-) as a white solid: ¹ H NMR(CD ₃ 0D) δ 7.9-7.4 (m, 9H) , 5.1 ( , IH) , 4.9 (m, IH) , 4.6 (dd, IH) , 4.4 (m, 2H), 4.1

(d, IH), 3.8 (m, IH) , 3.5 (q, IH) , 2.7 (m, IH) , 2.5 (m, IH) , 2.0 (m, 3H), 1.2 (t, IH) , 0.9 (d, 3H) , 0.8 (d, 3H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-acetoacetyl- 2,3,4, 5-tetrahydro-lH-l , 5-benzodiazepm-l- acetylamino] 4-oxo-butyric acid (605g) . 81 mg (19 ) as a white solid: ^" " ^" H NMR(CD ₃ OD) δ 7.9-7.3 ( , 11H) , 4.9- 4.8 (m, 2H) , 4.6-4.4 ( , 3H) , 4.3 (m, IH) , 3.75 (q,

IH), 3.55 (d, IH) , 2.7 (m, IH) , 2.5 (m, IH) , 2.05 (s, 3H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5-methyloxalyl- 2,3,4 ,5-tetrahydro-lH-l , 5-benzodιazepm-l- acetylam o] 4 -oxo-butyric acid (605h) . 227 mg (54-) of a white solid: ^λ H NMR(CD ₃ 0D) δ 2.5 (m, IH), 2.7 (m, IH) , 3.55(s, 3H), 3.8-4.0(m, 2H) , 4.4 (m, IH) , 4.6-4.8 (m, 2H) , 4.95(d, IH) , 5.1 (m, IH) , 7.3-7.7 (m, 7H) , 7.9(d, 2H) , 8.6(d, IH) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-acetylcarbonyl- 2,3,4, 5-tetrahydro-lH-l , 5-benzodιazepm-l- acetylammo] 4-oxo-butyrιc acid (605ι) . 150 mg (37-,) as a white solid: ¹ H NMR(CD ₃ 0D) δ 7.9-7.3 (m, 12H) , 5.1 (m, IH) , 4.65 (t, IH) , 4.55 (dd, IH) , 4.35 (m, IH) , 4.1 (d, IH) , 3.9 (q, IH) , 3.45 (q, IH) , 2.7 (m, IH) , 2.5 (m, IH) , 2.25 (s, 3H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-methoxycarbonyl- 2,3,4 ,5-tetrahydro-lH-l , 5-benzodιazepιn-l- acetyla ino] 4-oxo-butyrιc acid (605"j) . 234 mg (44 ^~ ) as a white solid: ^" " ^" H NMR(CD ₃ OD) δ 7.9-7.4 (m, 12H) , 5.0 (m, IH), 4.8-4.5 (m, 3H) , 4.4 ( , IH) , 4.3 (t, IH) , 3.9-3.75 (m, 2H) , 3.6 (s, 3H) , 2.7 (m, IH), 2.5 (m, IH) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-methanesulfonyl- 2,3,4, 5-tetrahydro-lH-l , 5-benzodιazepιn-l- acetyla ino] 4-oxo-butyrιc acid (605m) . 64.5 mg (34 ) as a white solid: H NMR (DMSO-dg, exisitng as diastereomers of the hemiacetal & open form of tne aldehyde) δ 9.48 (0.2H, s), 8.85-8.72 (IH, m , 8.65-

8.60 (0.8 H, d) , 8.30-8.26 (0.2 H, d) , 7.95-7.88 (2H,d), 7.6-7.45 (6H, m) , 7.44-7.38 (IH, m) , 5.78-5.75 (0.2H, d) , 5.48 (0.6H, s), 4.85-4.70 (2H, m) , 4.62-4.54 (IH, d) , 4.50-4.40 (2H, m) , 4.25-4.14 (IH, m) , 3.9-3.85 (IH, m) , 3.16 (3H, s), 3.05-2.3 (2, m) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-(naphthlene-2- carbonyl) -2,3,4, 5-tetrahydro-lH-l , 5-benzodιazepιn-l- acetylamιno]4-oxo-butyπc acid (605n) . 103 mg (17%) as a white solid: ¹ H NMR (CD ₃ OD) δ 1.9(s, 3H) , 2.5 ( , IH) , 2.65(m, IH) , 3.75 (m, IH) , 4.3(m,lH) , 4.5-4.7 (m, 3H) , 4.85-5. l(m, 2H), 7.3-7.65 (m, 6H) , 7.85-8.05(m, 4H) , 8.45 {s, IH) .

(3S) -3- [ (35) -2-Oxo-3-benzoylammo-5-acetyl-2,3,4 ,5- tetrahydro-7,9-dimethyl-1H-1 ,5-benzodιazepιn-l- acetylam o]4-oxo-butyric acid (605o) . 42 mg (12%) as a white solid: H NMR (CD ₃ 0D, existing as diastereomers of the hemiacetal) δ 7.85-7.74 (2H, m) , 7.5-7.44 (IH, m) , 7.43-7.35 (4H, m) , 5.6-5.05 (2H, m _. , 4.82-4.42 (2H, m) , 4.40-3.95 (2H, m) , 3.6-3.5 'IH, m) , 2.7-2.38 (2H, m) , 2.32 (3H, s), 2.27 (3H, s), 1.92 (3H,s) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5- benzylamιnocarbonyl-2 ,3,4, 5-tetrahydro-lH-l , 5-benzo dιazepιn-1 -acetylammo] 4-oxo-butyrιc acid (605p) . Ic5 mg (37%) as a white solid: ¹ H NMR (CD ₃ 0D) δ 2.45 (m, IH ⁾ , 2.7 (m, IH), 3.8 ( , IH) , 4.15-4.5(m, 4H) , 4.5- 4.75 (m, 2H) , 4.8-5.0(m, 2H) , 7.1-7.7(m, 12H) , K9(d, 2Hj .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5- [ (3J , S) 3- tetrahydrofuranylmethyoxycarbonyl] -2 ,3,4 ,5-tetrahydro- 1H-1 ,5-benzodiazepin-l-acetylamino]4-oxo-butyric acid

(605q) . 210 mg (66%) ¹ H NMR (CD ₃ 0D) δ 1.95 (s, 2H) , 2.4 (m, 2H) , 2.65 ( , 2H) , 3.29 (s, 3H) , 3.78 (m) , 3.87 (bs), 4.0 (d, IH) , 4.32 (m) , 4.50-4.15 (m) , 4.95 (m) , 5.27 (bs), 7.45-7.65 (m, 7H), and 7.89 ppm (d, 2H) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5- (4-pyridylacetyl) - 2,3, ,5-tetrahydro-lH-l,5-benzodiazepin-l- acetylamino]4-oxo-butyric acid (605s) . 128 mg H9q as a white solid: ¹ H NMR(CD ₃ 0D) δ 8.5-7.4 ( , 13H) , 5.0 (m, IH), 4.7 (m, IH) , 4.5 (m, 2H) , 4.45-4.4 ( , 3H) , 3.8-3.7 (m, 2H) , 2.7 (m, IH) , 2.5 (m, IH) .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamino-5- (3- methylphenylacetyl) -2,3,4 ,5-tetrahydro-lH-l,5- benzodiazepin-1-acetylamino]4-oxo-butyric acid (605t) .

132 mg (24%) as a white solid: ¹ H NMR(CD ₃ 0D) δ 7.8-6.7 ( , 13H), 4.9 (t, IH) , 4.75 (dd, IH) , 4.2 (dd, IH) , 4.1 (m, 2H), 3.8 (dd, IH) , 3.6 (q, IH) , 3.45 (dd, IH) , 3.3 (dd, IH), 2.6 (m, IH) , 2.3 (m, IH) , 2.15 (s, 3H) .

(3S) 3- [ (3S) 2-Oxo-3-benzylamιno-5- (3-phenylpropionyl) - 2,3,4,5-tetrahydro-lH-l ,5-benzodiazepin-l- acetylamino]4-oxo-butyric acid trifluoroacetic acid salt (605v) . 88 mg (28%) as a white solid: ¹ H NMR (CD ₃ OD) δ 7.63-7.51 (2H, m) , 7.5-7.35 (7H, m) , 7.25- ^" '. Id (3H,m), 7.1-7.02 (2H, m) , 5.04-4.96 (IH, m) , 4.^5-4.57 (2H, in), 4.38-4.: ^" (2H,m), 4.24-4.12 (2H, m) , 4.10-4.0? (IH, d) , 4.88-4.- (IH, m) , 2.90-2.80 (2H, m) , 2.78- 2.63 (lH,m), 2.55-2.35 (2H, m) , 2.34-2.22 (IH, m; .

609

The compounds of Table 13 are described oelow.

Table 13

(3S) -3- [ (3S) -2-OXO-3- (3-phenylpropιonylammo) -5- (3- phenylpropionyl) -2,3,4 ,5-tetrahydro-lH-l,5- benzodιazepιn-1-acetylamιno]-4- (5,7-dιchlorobenzoxazol- 2-yl) -4-oxo-butyric acid (609a) .

Step A. A solution of 204 (223 mg, 0.5 mmol) and 603r (300mg; 0.36 mmol) m 4 ml of DMF and 4 ml of CH ₂ C1 ₂ was treated with (Ph ₃ P) ₂ PdCl ₂ (10 mg) , 1- hydroxybenzotπazle (135 mg, 1.0 mmol) and l-(3- dimethylammopropyl) -3-ethylcarbodιιmιde hydrochloride (115 mg, 0.6 mmol) . Tπ-n-butyl t hydride (219 mg, 0.75 mmol) was added dropwise to the reaction and stirred for 18 h. The reaction was poured onto EtOAc and washed with aq. 10% aHSθ , sat. aq. NaHC0 ₃ and sat. aq. NaCl, dried over Na ₂ S0 ₄ and concentrated m vacuo . Chromatography (flash, Sι0 ₂ , 0% to 50%

EtOAc/hexane) gave 360 mg (86%) of 607a as a foam.

Step B. A solution of 607a (360 mg) in 5 ml of CH ₂ C1 ₂ was added dropwise to a suspension of 1, 1, 1-trιacetoxy- 1, 1-dιhydro-l, 2-benzιodιoxol-3 (IH) -one (362 mg, 0.85 mmol) in 20 ml of CH ₂ C1 ₂ . The reaction was stirred for 4.5 h, diluted with CH ₂ C1 ₂ and washed with a 1:1 mixture of sat. aq. NaHC0 ₃ /sat. aq. Na ₂ S ₂ 0 ₃ , sat. aq. NaHC0 ₃ (2x) and sat. aq. NaCl, dried over Na ₉ S0 ₄ and concentrated m vacuo . Chromatography (f__ash, Sι0 ₂ , 20-5 EtOAc/CH ₂ Cl ₂ ) gave 340 mg (95 ) of the ketone 608a.

Step C. 608a (300 mg, 0.36 mmol) was dissolved in 25 ml of 2 b°, TFA/CH ₂ C1 ₂ and stirred at RT for 5 h and concentrated m vacuo . Chromatography (flash, Sι0 , 0 to 5% MeOH/CH ₂ Cl ₂ ) gave 118 mg (42 ) of 609a as a white solid: ¹ H NMR (CD ₃ 0D) δ 7.62-6.65 (16H, m) , 4.85-4.7

(IH, m) , 4.68-4.42 (2H, m) , 4.40-4.15 (2H, ) , 3.48- 3.28 (IH, m) , 3.0-2.9 (IH, m) , 2.9-2.6 (4H, m) , 2.55- 2.18 (3H, m) , 2.16-1.96 (2H, m) .

(3S) -3-[ (3S) -2-Oxo-3-benzoylamιno-5-acetyl-2,3,4 ,5- tetrahydro-lH-1 ,5-benzodiazepιn-l-acetylammo] -4- (5,7- dichlorobenzoxazol-2-yl) -4-oxo-butyric acid (609b) was prepared from 603d in a similar manner as 609a to give 287 mg (43% overall yield) as white solid: H NMR(DMS0-d ₆ ) δ 1.6(s, 3H) , 2.7-3. l(m, 2H) , 3.45 ( , IH) , 4.4 (t, IH) , 4.7 (m, 2H) , .95 (m, IH) , 5.2, 5.4(2s, IH) , 7.2-7.65(m, 8H) , 7.9(d, 2H) , 8.8(t, IH) , 8.9,9.1 (2s, IH) , 12.6 (br, IH) .

603 Step A

611

612

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5-methanesulfonyl- 2,3,4,5-tetrahydro-lH-l ,5-benzodiazepine-l- acetylamino] -5- (2,6-dichlorobenzoyloxy) -4-oxo-pentanoic acid (612) was prepared by a method similar as 607a (Steps A and C only) using 603m (150 mg, 0.36 mmol)

instead of 603r and (35) -3- (allyloxycarbonylammo) -4- oxo-5- (2, 6-dichlorobenzoyl-oxy) pentanoic acid t-butyl ester (110; 160 mg, 0.36 mmol, WO 93/16710) instead of 606a to give 612 (56%) as a white solid: ¹ H NMR (CDC1 ₃ ) 7.85-7.10 (12H, m) , 5.4-4.65 (4H, m) , 4.6-4.15 (4H, m) , 3.10-2.72 (5H, s & m) .

Example 13 Compounds 619-635 were synthesized as described in Example 13 and Table 14.

Syntheses of 619-635.

Step A. Synthesis of 614. TentaGel S® NH ₂ resm (0.16 mmol/g, 10.0 g) was placed m a sintered glass funnel and washed with dimethylformamide (3 X 50 L) , 10% (v/v) dusopropylethylamine (DIEA) dimethylformamide (2 X 50 mL) and finally with dimethylformamide (4 X 50 mL) . Sufficient dimethylformamide was added to the resm to obtain a slurry followed by 400 (1.42 g, 2.4 mmol, prepared from (3S) 3- (fluorenylmethyloxycarbonyl) -4-oxobutryιc acid t-butyl ester according to A.M. Murphy et . al. J. Am. Chem. Soc, 114, 3156-3157 (1992) ) , 1- hydroxybenzotπazole hydrate (HOBT ^* H ₂ 0; 0.367 g, 2.4 mmol) , O-benzotπazole-N,N,N,N' -tetramethyluronium hexafluorophosphate (HBTU; 0.91 g, 2.4 mmol), and DIEA (0.55 mL, 3.2 mmol) . The reaction mixture was agitated overnight at room temperature using a wrist arm shaker. The res was isolated on a sintered glass funnel by suction filtration and washed with dimethylformamide (3 X 50 mL) . Unreacted amme groups were then capped by reacting the resm with 20% (v/v) acetic anhydride/dimethylformamide (2 X 25 mL) directly in the funnel (10 mm/wash) . The resm was washed with dimethylformamide (3 X 50 mL) and dichloromethane (3 X 50 L) prior to drying overnight i n vacuo to yιe__α 614 (11.0 g, quantitative yield) .

Step B. Synthesis of 616. Resm 614 (3.0 g, 0.16 mmol/g, 0.48 mmol) was swelled a sintered glass funnel by washing with dimethylformamide (3 X 15 mL, . The Fmoc protecting group was then cleaved with 25 ^"

(v/v) piperidme/dimethylformamide (15 mL) for 1% mm

(intermittent stirring) and then for 20 mm with fresh piperidme reagent (15 ml) . The resm was then washed with dimethylformamide (3 X 15 ml), followed by N- methypyrrolidone (2 X 15 mL) . After transferring the resm to a 100 mL flask, N-methypyrrolidone was added to obtain a slurry followed by 603u (0.736 g, 0.72 mmol, , H0BT ^" H ₂ 0 (0.112 g, 0.73 mmol), HBTU (0.27 g, 0.73 mmol) and DIEA (0.26 mL, 1.5 mmol) . The reaction mixture was agitated overnight at room temperature using a wrist arm shaker. The resm work-up and capping with 20% (v/v) acetic anhydride m dimethylformamide were performed as αescribed for 614 to yield 616 (3.13 g, quantitative yield) .

Step C. Synthesis of 617. This compound was prepared from resm 616 (0.24 g, 0.038 mmol) using ar Aαvanced ChemTech 396 Multiple Peptide synthesizer. Tne automated cycles consisted of a resm wash with dimetnylformamide (3 X 1 mL) , deprotection with 25 ^J (v/v ¹ piperidme in dimethylformamide (1 mL) for 3 mm followed by fresh reagent (1 mL) for 10 mm to yield res 617. The resm was washed with dimethylformamide (3 X 1 L) and N-methypyrrolidone (3 X 1 mL) .

Step D. Method 1. (624) . Resm 617 was acylateα with a solution of 0.4M thιophene-3-carboxylic acid ana . M HOBT in N-methypyrrolidone (1 mL) , a solαtion of 0. M HBTU N-methylpyrrolidone (0.5 mL; and a sc-Jtion of 1.6M DIEA N-methypyrrolidone (0.35 mL, ar.α tre reaction was shaken for 2 hr at room terperature. The acylation step was repeated. F_nal__y, the resm was washed with dimethylformamide (1 X 1 rl , dichloromethane (3 X 1 mL) and dried i n vacuo .

The aldehyde was cleaved from the resin and globally deprotected by treatment with 95% TFA/ 5% H20 (v/v, 1.5 mL) for 30 min at room temperature. After washing the resin with cleavage reagent (1 L) , the combined filtrates were added to cold 1:1 ether:pentane (12 mL) and the resulting precipitate was isolated by centrifugation and decantation. The resulting pellet was dissolved in 10% acetonιtrile/90% H20/O.l% TFA (15 mL) and lyophilized to obtain crude 624 as a white powder. The compound was purified by semi-prep RP-HPLC with a Rainin Microsorb™ C18 column (5 u, 21.4 X 250 mm) elutmg with a linear acetonitrile gradient (5% - 45%) containing 0.1% TFA (v/v) over 45 min at 12 mL/min. Fractions containing the desired product were pooled and lyophilized to provide 624 (10.0 mg, 54%) .

Step D. Method 1A. Synthesis of 627. Following a similar procedure as method 1, resin 617 was acylated with 4- (1-fluorenylmethoxycarbonylamino)benzoic acid and repeated. The Fmoc group was removed as described in Step C and the free amine was acetylated with 20 -

(v/v) acetic anhydride in dimethylformamide (1 mL) and 1.6M DIEA in N-methylpyrrolidone (0.35 mL) for 2 hr at room temperature. The acetylation step was repeated. Cleavage of the aldehyde from the resm gave 627 (4.2 mg, 20%) .

Step D. Method 2. Synthesis of 632. Following a similar procedure as method 1, resm 617 was acylated with 0.5M cinnamoyl chloride in N-methypyrro idone (1 mL) and 1.6M DIEA in N-methypyrrolidone (0.35 mL) for 2 hr at room temperature. The acylation step was

repeated. Cleavage of the aldehyde from the resin gave 632 (11.1 mg, 58%) .

Step D. Method 3. Synthesis of 629. Following a similar procedure as method 1, resm 617 was reacted with 1. OM benzenesulfonyl chloride in dichloromethane (0.5 mL) and IM pyridme in dichloromethane (0.60 L) for 4 hr at room temperature. The reaction was repeated. Cleavage of the aldehyde from the resm 629 (4.7 mg, 24%) .

Analytical HPLC methods:

(1) Waters DeltaPak C18, 300A (5u, 3.9 X 150 mm) . Linear acetonitrile gradient (5% - 45%) containing 0.11 TFA (v/v) over 14 mm at 1 mL/min.

Table 14

Example 14 Compounds 1605a-;], 1605m, 1605n, 1605p, 1605t, and 1605v were synthesized as described below.

StepC Step D

(3S) N- (2-OXO-3- ert-butoxγcarbonylammo-2 ,3,4,5- tetrahydro-lH-pyπdo [3 , 4-b] [1 , 4-dιazepιne (1600) .

Step A. (2S) 2-tert-Butoxγcarbonylamιno-3- (3- nιtropyπdιn-2-ylamιno)propiomc acid was prepared by a similar method as (2S) 2-tert-butoxycarbonylammo- 3- (2-nιtrophenyl-ammo) propiomc acid Step A of tne synthesis of 600a/103, except tnat 3-chloro-3- nitro pyridme was used instead of 2-

fluoromtrobenzene, to give 4.05 g (64%) of a yellow solid.

Step B. (2S) 2-tert-Butoxycarbonylamino-3- (3- amιnopyπdιn-2-ylamιno)propiomc acid was prepared by 5 a similar method to (2S) 2-tert-Butoxycarbonylammo- 3- (2-ammophenylamιno) -propiomc acid in Step B of the synthesis of 600a/103 to give 3.68 g (quant.) as a dark solid.

Step C. (2S) 2-tert-Butoxycarbonylammo-3- (3- 0 amιnopyrιdιn-2-ylamιno)propiomc acid methyl ester. A solution of (2S) 2-tert-Butoxycarbonylamιno-3- (3- ammopyrιdm-2-ylammo) -propiomc acid (360 mg, 1.21 mmol) and MeOH (59 mg, 1.82 mmol) m anhydrous CH ₂ C1 ₂ (20 ml) was treated with 4-dιmethylamιnopyπdme 5 (DMAP, 163 mg, 1.33 mmol) and l-(3- dimethylam opropyl) -3-ethylcarbodiimide hydrochloride (280 mg, 1.45 mmol) . The reaction was stirred for 18 h, diluted with EtOAc (150ml), washed with water (2x), sat. aq. NaHC0 ₃ , and sat. aq. NaCl, 0 dried over Na ₂ S0 ₄ and concentrated m vacuo .

Chromatography (flash, Sι0 ₂ , 0 to 5- MeOH/CH ₂ Cl _: ) gave 250 mg (67%) of the title compound as a light tan solid.

Step D. (3S) N- (2-OXO-3- ert-butoxycarbonylamino- ^C 2,3,4,5-tetrahydro-lH- pyrido[3,4-b] [1 ,4-dιazepme (1600) . A solution of (2S) 2-tert- bjtoxycarbonylammo-3- (3-ammopyrιdm-2- la inc prop ionic acid methyl ester (70 mg, 0.225 molj and 25 sodium methoxide/MeOH (130 μl, 0.56 mmol) C anhydrous MeOH (4 ml) was heated at 60°C for 16 h.

The reaction was concentrated in vacuo, the residue dissolved in 2 ml of H ₂ 0 and extracted with EtOAc (3x) . The combmed extracts were dried over Na ₂ SU4 and concentrated in vacuo . Chromatography (flash, Sι0 ₂ , 0 to 3% Me0H/CH ₂ Cl ₂ ) gave 7.5 mg (3%) of 1600 as a light tan solid: ^" " ^" H NMR (CD ₃ OD) δ 7.96-7.92 (IH, d) , 7.75-7.65 (IH, br. s), 7.14-7.08 (IH, d) , 6.73-6.65 (IH, m) , 5.83-5.75 (IH, br. s) , 5.4-5.25 (IH, br. s), 4.6-4.5 (lH,m), 3.95-3.84 (IH, m) , 3.55- 3.48 (IH, m) , 1.4 (9H, s)

Step E. 1601 is prepared from 1600 following the method in Step D for the preparation 600a/103.

1601 1602

1603

Synthesis of 1603. 1603 is prepared from 1601 following the methods for the synthesis of 603 from 600.

1603 1604

Step B

O

1605

Synthesis of 1605. 1605 is prepared from 1603 by methods described for the synthesis of 605 from 603.

Table 15

Example 15 Compounds 1610-1621 are prepared from 1600 by methods similar to the methods used to prepare compounds 619-635 from 600a/103 and 600b.

wherein for compounds 1610-1621,

1621 cr-

Example 16 Compounds comprising scaffolds (ell) , (yl) , (y2) , (z), and (el2) may be synthesized as described below.

Synthesis of Scaffold R _x , wherein R _j^ is (ell) and wherein Y ₂ is =0.

OjCI-fePh

BocNH-NH

269

Synthesis of Scaffold R _χ , wherein R _χ is (yl) and wherein Y ₂ is =0.

267

X = Cl or 1-imidazole

270

Synthesis of Scaffold R _χ , wherein R _x is (y2) and wherein Y is H ₂ and X ₇ is O.

273

Synthesis of Scaffold R _χ , wherein Rη_ is (y2) and wherein Y ₂ is =0 and X~ is NH.

271

Synthesis of Scaffold R _x , wherein R^ is (y2) and wherein Y ₂ is H ₂ and X ₇ is NH.

272

Synthesis of Scaffold R _χ , wherein Ri is (z) and wherein Y ₂ is O.

X = NHCbz X = OCH ₂ Ph

271

Synthesis of Scaffold R ₁ , wherein R is (el2) and wherein Y ₂ is =0.

t-BuONH ₂

276

277

Example 17 The preparation of compounds 2001, 2002, 2100a-e, and 2201 is described below.

1999 2000

2002

2001

(IS, 9S) 9-Benzoylformylamιno-6, 10-dιoxo- 1 ,2,3,4,7,8,9,10-octahydro-6H-pyπdazιno[l,2-a] -[1,2] dιazepιne-1-carboxylic acid (2000) . To a solution of t-butyl 9-ammo-6, 10-dιoxo-l, 2, 3, 4, 7, 8, 9, 10- octahydro-6H-pyrιdazmo [ 1,2-a] (1, 2] dιazeρme-1- carboxylate (GB 2,128,984; 340 mg, 1.15 mmol) CH C1 ₂ was added benzoylformic acid (260 mg, 1.7 mmol), HOBT (230 mg, 1.7 mmol) and EDC (340 mg, 1.7 mmol) . The resulting mixture was stirred at amcient temperature for 16 hours, poured into IN HCl ano extracted with CH ₂ C1 ₂ . The organic extracts were

further washed with saturated NaHC0 ₃ , dried over MgS0 ₄ and concentrated to afford 1999 as a pale yellow solid. The solid was dissolved in CH ₂ C1 ₂ (25 ml) and TFA (25 ml) and stirred overnight and concentrated in vacuo to give 560 mg of 2000 as an

[ 1S, 9S(2RS, 3S) ] 9-Benzoylformylamino-6,10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-N- (2 (R, S) -benzyloxy-5- oxotetrahydrofuran-3-yl) -6H-pyπdazιno[1,2-a] [1,2]- dιazepιne-1-carboxamide (2001), was synthesized from 2000 by methods similar to compound 213e to afford 410 mg (63%) of 2001 as a white solid: ^l U NMR (CDC1 ₃ ; mixture of diastereomers) δ 8.25 (IH, d) , 8.23 (IH, d), 7.78 (IH, dd) , 7.65 (IH, bm) , 7.50 (2H, m) , 7.40-7.25 (4H, m) , 6.55 (IH, d) , 5.57 (IH, d) ,

5.10 (IH, t), 5.05-4.95 (2H, m) , 4.90, (IH, d) , 4.80 (IH, d) , 4.72 (IH, bm) , 4.65 (IH, ) , 4.55 (IH, m) , 4.45 (IH, t), 3.25 (IH, m) , 3.15 (IH, m) , 3.00 <2H, bm) , 2,90 (IH, dd), 2.70 (IH, m) , 2.47 (IH, dd) , 2.45 (IH, m) , 2.35 (IH, m) , 2.00-1.75 (4H, m) , 1.60 (IH, bm) .

[3S(1S,9S) ] 3- (9-Benzoylformylamino-6,10-dioxo- 1,2,3,4,7,8,9,10-octahydro-6H-pyrιdaz no[1,2-a] [1,2]- dιazepιne-1-carboxamιdo) -4-oxobutanoic acid (2002) . Compound 2001 (58.6 mg, 0.10 mmol) was treated with 15 ml of TFA/MeCN/water (1:2:3) and stirred at room temperature for 6.5 h. The reaction was extracteα with ether. The aqueous layer was concentrateα with azeotropic removal of the water using MeCN. The product was suspended m CH ₂ C1 ₂ , concentrated vacuo and precipitated with ether to give 46.8 mg

(99%) of 2002 as a white solid: lH _τ NMR (CD ₃ 0D) δ 9.05 (0.25H, d) , 8.15 (IH, d) , 7.68 (IH, t) , 7.64 (0.25H, d) , 7.55 (3H, t), 7.35 (0.5H, m) , 5.22 (IH, t), 4.90 (IH, m) , 4.58 (IH, dd) , 4.50 (IH, m) , 4.28 (IH, bm) , 3.45 (IH, ) , 3.10 (IH, bt) , 2.68 (IH, ddd) , 2.60-2.45 (2H, m) , 2.30 (IH, dd) , 2.15-2.05 (2H, m) , 1.90 (2H, bm) , 1.68 (IH, bm) .

[1S,9S(2J?S,3S) ] 9-Benzoylamιno-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-N- (2-ιsopropoxy-5-oxo- tetrahydro-furan-3-yl) -6H-pyπdazιno-

[1 ,2-a] [1, 2 ]dιazep ne-l -carboxamide (2100a) . A solution of 214e (101 mg, 0.23 mmol) in isopropanol (10 ml) was stirred at room temperature with a catalytic amount of p-toluenesulfonic acid (10 mg) . After 75 minutes, the reaction mixture was poured mto saturated NaHC0 ₃ and extracted with CH ₂ C1 ₂ Tne combined extracts were dried over Na ₂ S0 ₄ and

concentrated. Flash chromatography (Sι0 ₂ , CH ₂ C1 ₂ to EtOAc) afforded 56 mg (51 ) of 2100a as a white solid: H NMR (CDC1 ; mixture of diastereomers) δ 7.9-7.8 (2H,m), 7.6-7.5 (IH, m) , 7.5-7.4 (2H, m) , 7.1 (0.5H, d) , 6.9 (0.5H, d) , 6.4 (0.5H,d), 5.6 (0.5H, d), 5.3 (0,5H, s), 5.2-5.1 (IH, ) , 4.95 (0.5H, m) , 4.75-4.5 (1.5H, m) , 4.35 (0.5H, t), 4.1 (0.5H, m) , 3.98 (0.5H, m) , 3.3-2.75 (4H, m) , 2.5-2.4 (2H,m), 2.25 (IH, m) , 2.1-1.9 (3H,m) 1.75-1.55 (2H,m) .

[ 3S ( 1S, 9S) ] 3- (9-Benzoylformylamιno-6,10-dιoxo-

1,2,3,4,7,8,9, 10-octahydro-6H-pyπdazιno[1,2-a] [1,2] - dιazepιne-1-carboxamido) - ,4-dιethoxy-butyrιc acid, ethyl ester (2100b) . A solution of 214e (16 mg,

0.036 mmol) ethanol (2 ml) was stirred at room temperature with a catalytic amount of p- toluenesulfonic acid (2 mg) . After 5 days, the reaction mixture was poured into saturated NaHC0 ₃ and extracted with CH ₂ C1 ₂ _ The combmed extracts were dried over Na S0 ₄ and concentrateα. Flash chromatography (Sι0 ₂ , CH ₂ Cl ₂ :Et0Ac 95:5 v/v) afforded 16 mg (81%) of 2100b as a white solid: ¹ H NMR (CDC1 ₃ ) d 7.85-7.74 (2H,m), 7.55-7.38 (3H,m), 7.04- 6.95 (lH,d), 6.61-6.48 (lH,d), 5.15-5.08 (lH,m), 4.63-4.53 (lH,m), 4.52-4.45 (lH,m) , 4.42-4.35 (lH,m) , 4.15-4.05 (2H,m), 3.74-3.60 (2H,m), 3.57-3.42 '2H,m), 3.39-3.28 (lH,m), 3.03-2.93 (lH,m) , 2.92-2.82 1H, , 2.65-2.52 (2H,m), 2.42-2.25 (lH,m) , 2.20-1.88 4H,m, , 1.76-1.50 (2H,m), 1.35-1.10 (9H,m) .

[3S(1S,9S) ] 3- (9-Benzoylformylamιno-6,10-dιoxo- l,2,3,4,7,8,9,10-octahydro-6H-pyrιdazmo[l,2-a] [1,2]- dιazepme-1-carboxamιdo) -4 ,4-dιmethoxy-butyrιc acid

methyl ester (2100c) . A solution of 214e (165 mg, 0.37 mmol) in methanol (5 ml) was stirred at room temperature with a catalytic amount of p- toluenesulfonic acid (17.5 mg) . After 4 days, the reaction mixture was diluted with EtOAc and washed with 10% NaHC0 ₃ (3x) and brine. The combmed extracts were dried over Na ₂ S0 ₄ and concentrated. Flash chromatography (Si0 ₂ , EtOAc) afforded 127 mg (68%) of 2100c as a white solid: ¹ H NMR (CDC1 ₃ ) δ 7.82 (2H, d) , 7.55-7.50 (IH, m) , 7.47-7.43 (2H, m) , 7.02 (IH, d) , 6.53 (IH, d) , 5.20-5.10 (IH, m) , 4.56- 4.50 (IH, m) , 4.45-4.50 (IH each, two m) , 3.69 (3H, s), 3.41 (3H, s), 3.43 (3H, s), 3.35-3.25 (IH, m) , 3.06-2.98 (IH, m) , 2.94-2.83 (IH, m) , 2.65-2.53 (2H, m) , 2.35-2.32 (IH, m) , 2.15-2.07 (lH,m), 2.00-1.89 (3H, m) , 1.75-1.56 (2H, m) .

[3S(1S,9S) ] 3- (9-Benzoylformylamino-6,10-dιoxo- 1,2,3,4,7,8, 9,10-octahydro-6H-pyridazmo[l,2-a] [1,2] - diazepιne-1-carboxamido) -4 ,4-diisopropoxy-butyrιc acid, isopropyl ester (2100d) . A solution of 214e

(53 mg, 0.12 mmol) in isopropanol (5 ml) was stirred at 50 °C with a catalytic amount of p-toluenesulfonic acid (5 mg) . After 3 days the reaction mixture was poured into saturated NaHC0 ₃ and extracted with CH ₂ C1 ₂ _ The combined extracts were dried over Na ₂ S0 ₄ and concentrateα. Flash chromatography (Sι0 ₂ , CH ₂ Cl ₂ :EtOAc (4:1 to 1:1 v/v) ) afforded 49 mg (68 i of 2100d as a white solid: ¹ H NMR (CDC1 ₃ ) δ 7.85 (2H, d) , 7.50-7.43 (IH, ) , 7.41-7.35 (2H, ), 7.02 (IH, d), 6.47 (IH, d) , 5.13-5.07 (IH, m) 5.00-4.9

(IH, m) , 4.61-4.55 (2H, m) , 4.37-4.30 (IH, m) , 3.80-

3.70 (IH, m) , 3.90-3.80 (IH, m) , 3.42-3.35 (IH, m) ,

3.03-2.93 (IH, m) , 2.91-2.81 (IH, m) , 2.62-2.5C (2H, m) , 2.38-2.33 (IH, m) , 2.12-2.06 (lH,m) , 1.97-1.81 (3H, ) , 1.70-1.60 (2H, m) , 1.28-1.05 (18H,m) .

2100e

[1S,9S(2RS,3S) ] 9-Benzoylammo-6,10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-N- (2-ethoxy-5-oxo- tetrahydro-furan-3-yl) -6H-pyπdazιno[1 ,2-a] [1,2]- dιazepme-1-carboxamιde (2100e) , was synthesized from 302 via methods used to synthesize 304a to afford 2100e, except ethanol and triethylorthoformate were used instead of methanol and trimethylorthoformate. Chromatography (Sι0 ₂ , 5% ethanol/CH ₂ Cl ₂ ) afforded 92 mg (68s) of a white solid: ¹ H NMR (CDC1 ₃ ; mixture of diastereomers) δ 7.90-7.80 (2H, m) , 7.60-7.50 (IH, m) , 7.50-7.40 (2H, m) , 7.30 (0.5H, d) , 7.00 (0.5H, d) , 6.50 (0.5H, d) , 5.50 (0.5H, d) , 5.20-5.10 (1.5H, m) , 4.95 (0.5H, m) , 4.75-4.65 (0.5H, m) , 4.65-4.50 (IH, m) , 4.38 (0.05H, t), 4.00-3.90 (0.5H, ) , 3.85- 3.75 (0.5H, m) , 3.75-3.65 (0.5H, m) , 3.65-3.55 (C.5H, m) , 3.30-2.70 (4H, m) , 2.50-2.35 (2H, m 5.30 CH, α. , 2.15-1.90 (3H, m) , 1.80-1.60 (2H, m> , 1.25-1.20 (3H, two t)

600b

2201

(3S) -3- [ (3S) -2-OXO-3- (1-naphthoyl)amιno-5- methoxyacetyl-2 ,3,4,5-tetrahydro-lH-l ,5- benzodiazepine-1-acetylammo]4-oxo-butyric acid

(2201) was synthesized from 600b by the methods used to synthesize 605b to afford 2201: ^λ H NMR (CDC1 ₃ ) δ 8.30-8.22 (lH,m), 8.05-7.98 (IH, d) , 7.96-7.83 (lH,m), 7.77-7.68 (lH,m), 7.67-7.40 (7H,m), 5.12-5.02 (lH,m), 4.98-4.41 (5H,m), 4.38-4.24 (lH,m), 4.07-4.00 (lH,d), 3.92-3.80 (2H,m), 3.32 (3H,s), 2.75-2.60 (lH,m) , 2.58-2.35 (lH,m) .

Example 18 We obtained the following data for selected compounds of this invention using the methods described herein (Table 16, see Example 7; Tables 17 and 18, see Examples 1-4) . The structures and preparations of compounds of this invention are described in Examples 28-31.

Table 16 Comparison of Prodrugs for Efficacy in

LPS Challenged Mice: Inhibition of IL-lβ Production. The percent inhibition of IL-lβ production after treatment with a compound of the invention is shown as a function of time after LPS challenge ("-" indicates that no value was obtained at that relative time) .

Time of Compound Administration relative to time of LPS challen e, PO, 50 mg/kg)

10

15

20

25

30

35

Table 17 Data for selected compounds of this invention obtained using the methods described in Examples 1-4.

We obtamed the following data for selected compounds of this mvention (Table 18) using the methods described herein (see Examples 1-4) . The structures and preparations of compounds of this invention are described in Examples 28-31.

Table 18

Example 19

In v vo acute assay for efficacy as anti- flammatory aσent

Results the Table 19 show that 412f, 412d and 696a inhibit IL-lβ production in LPS-challenged mice after oral admmstration using ethanol/PEG/water,

β-cyclodextnn, labrosol/water or cremophor/water as vehicles. The compound was dosed at time of LPS challenge. The protocol is described in Example 7.

Table 19 Inhibition (%) of IL-lβ production in LPS- challenged mice.

Example 20 Mouse Carrageenan Peritoneal Inflammation

Inflammation was induced m mice with an intraperitoneal (IP) infection of 10 mg carrageenan m 0.5 ml of saline (Griswold et al . , Inflammation, 13, pp. 727-739 (1989) ) . Drugs are administered by oral gavage ethanol/PEG/water, β-cyclodextrm, labrosol/water or cremophor/water vehicle. The mice are sacrificed at 4 hours post carrageenan administration, then injected IP with 2 ml of saline containing 5U/ml heparm. After gentle massage of the peritoneum, a small incision is made, the contents collected and volume recorded. Samples are kept on ice until centrifuged (130 x g, 8 mms at 4 °C) to remove cellular material, and the resultant supernatant stored at -20 °C. IL-lβ levels in the peritoneal fluid are determined by ELISA.

Results in the Table 20 show prodrug 412f inhibits IL-lβ production in carrageenan-challenged mice after oral admmstration of drug. Compound 214e

did not inhibit IL-lβ production when dosed orally at 50 mg/kg.

Table 20 Inhibition (%) of IL-lβ production by 412f and 412d in carrageenan-challenged mice.

Example 21 Type II Collaαen-induced Arthritis

Type II collagen-induced arthritis was established in male DBA/lJ mice at described Wooley and Geiger (Wooley, P.H., Methods Enzvmoloαy, 162, pp. 361-373 (1988) and Geiger, T., Clinical and Experimental Rheumatology, 11, pp. 515-522 (1993) ) . Chick sternum Type II collagen (4 mg/kg in 10 mM acetic acid) was emulsified with an equal volume of Freund' s complete adjuvant (FCA) by repeated passages (400) between two 10 ml glass syringes with a gauge 16 double-hub needle. Mice were immunized by intradermal injection (50 μl; lOOμl CII per mouse) of collagen emulsion 21 days later at the contra-lateral siαe of the tail base. Drugs were administered twice a day (10, 25 and 50 mg/kg) by oral gavage app oximately 7 n apart. Vehicles used included ethanol/PEG/water, β- cyclodextr , labrosol/water or cremophor/water. Drug treatments were initiated within 2 h of the CII cooster

immunization. Inflammation was scored on a 1 to 4 scale of increasing severity on the two front paws and the scores are added to give the final score.

Results m the Figs. 12, 13 and 14 show prodrugs 412f, 412d and 696a inhibit inflammation ιr collagen-induced arthritits in mice after oral admmstration. Compound 214e did not inhibit inflammation when dosed (50 mg/kg) once a day by oral gavage.

Example 22

In vi vo bioavailab lity determination

The drugs (10-100 mg/kg) were dosed orally to rats (10 mL/kg) in ethanol/PEG/water, β-cyclodextrm, labrosol/water or cremophor/water. Blood samples were drawn from the carotid artery at 0.25, 0.50, 1, 1.5, 2, 3, 4, 6, and 8 hours after dosing, centrifuged to plasma and stored at -70°C until analysis. Aldehyde concentrations were determined using an enzymatic assay. Pharmacokmetic analysis of data was performed by non-linear regression using RStrip (MicroMath Software, UT) . Drug availability values were determined as follows: (AUC of drug after oral prodrug αosing/AUC of drug after i.v. dosing of drug) x (dose i.v. /dose p.o.) xl00 . Results in Table 21 show that proαrugs 412f,

412d and 696a give significant blood levels of αrug and have good drug availability when dosed orally. Blood levels of 214e were not detected when it was αosed orally.

Table 21 Oral Bioavailability of 412f, 412d, 696a and 214e in Rat.

Example 23 ICE cleaves and activates pro-IGIF

ICE and ICE homoloσ expression plasmids

A 0.6 kb cDNA encoding full length murme pro-IGIF (H. Okamura et al . , Nature, 378, p. 88 (1995) was ligated into the mammalian expression vector pCDLSR (Y. Takebe et al . , Mol. Cell Biol.. 8, p. 466 (1988) ) .

Generally, plasmids (3 μg) encoding active ICE (above), or the three ICE-related enzymes TX, CPP32, and CMH-1 in the pCDLSRα expression vector (C. Faucheu et al . , EMBO. 14, p. 1914 (1995) ; Y. Gu et ai . EMBQ. 14, p. 1923 (1995) ; J. A. Lippke et al . , J. Biol Chem.. 271, p. 1825 (1996) ), were transfected into subconfluent monolayers of Cos cells in 35-mm dishes using the DEAE-dextran method (Y. Gu et al . , EMBO J.. 14, p. 1923 (1995) ) . Twenty-four hours later, cells were lysed and the lysates subjected to SDS-PAGE and immunoblottmg using an antiserum specific for IGIF (K Okamura et al., Nature. 378, p. 88 (1995) .

Polymerase chain reaction was used to introduce Nde I sites at the 5' and 3' ends of the murine pro-IGIF cDNA using the following primers: GGAATTCCATATGGCTGCCATGTCAGAAGAC (forward and GGTTAACCATATGCTAACTTTGATGTAAGTTAGTGAG (reverse) . Tne

resulting Ndel fragment was ligated mto E. coli expression vector pET-15B (Novagen) at the Ndel site to create a plasmid that directs the synthesis of a polypeptide of 213 ammo acids consisting of a 21- residue peptide (MGSSHHHHHHSSGLVPRGSHM. where LVPRGS represents a thrombm cleavage site) fused in-frame to the N-termmus of pro-IGIF at Ala2, as confirmed by DNA sequencing of the plasmid and by N-termmal sequencing of the expressed proteins. E. coli strain BL21 (DE3) carrying the plasmid was induced with 0.8 mM lsopropyl- 1-thιo-β-D-galactopyranosιde for 1.5 hours at 37°C, harvested, and lysed by microfluidization (Microfluidic, Watertown, MA) Buffer A (20 mM sodium phosphate, pH 7.0, 300 mM NaCl, 2 mM dithiothreitol, 10% glycerol, 1 mM phenylmethylsulfonyl fluoride, and 2.5 μg/ml leupeptm) . Lysates were cleared by centrifugation at 100,000 x g for 30 mm. (His) 6- tagged pro-IGIF protein was then purified from the supernatant by Ni-NTA-agarose (Qiagen) chromatography under conditions recommended by the manufacturer.

In Vitro pro-IGIF Cleavage Reactions

In vitro cleavage reactions (30 μl) contained 2 μg of purified pro-IGIF and various concentrations of the purified proteases in a buffer containing 20 mM Hepes, pH 7.2, 0.1"? Triton X-100, 2 mM DTT, 1 mM PMSF and 2.5 μg/ml leupeptm and were incubated for 1 hou at 37 ^C C. Conditions for cleavage by granzyme B were as αescribed previously (Y. Gu et al., J. B ol . Chem. , 2^_., p. 10816 (1996) ) . Cleavage products were analy:eα by SDS-PAGE on 16 _t gels and Coomassie Blue sta mg, and were sub ecteα to N-termmal ammo acid sequencing

using an ABI automated peptide sequencer under conditions recommended by the manufacturer.

Kinetic Parameters of IGIF Cleavage bv ICE

The kinetic parameters (k _cat /K _M , K _M , and k _cat ) for IGIF cleavage by ICE were determined as follows. ³⁵ S-methιonme-labeled pro-IGIF (3000 cpm, prepared by m vi tro transcription and translation using, tne TNT T7-coupled reticulocyte lysate system (Promega) and pro-IGIF cDNA a pSP73 vector as template) were incubated reaction mixtures of 60 μl containing 0.1 to 1 nM recombinant ICE and 190 nM to 12 μM of unlabeled pro-IGIF for 8-10 mm at 37°C. Cleavage product concentrations were determined by SDS-PAGE and Phospholmager analyses. The kinetic parameters were calculated by nonlinear regression fitting of the rate vs. concentration data to the Michaelis-Menten equation using the program Enzfitter (Biosoft) .

IFN-v Induction Assays

A.E7 Thl cells (H. Quill and R. H. Schwartz, J. Immunol., 138, p. 3704 (1987) ) (1.3 x 10 ⁵ cells in 0.15 ml Click's medium supplemented with 10% FBS, 50 μM 2-mercaptoethanol and 50 units/ml IL-2) 96-well plates were treated with IGIF for 18-20 hours and the culture supernatant were assayed for IFN-γ by ELISA (Endogen, Cambridge, MA) .

Example 24 Processmg of pro-IGIF bv ICE In Cos Cel-ε Cos cells were transfected with various expression plasmid combinations as described Example 23. Transfected Cos cells (3.5 x 10 cells in a 35-mm dish) were labeled for 7 hours with 1 ml of metr. onme-

free DMEM containing 2.5% normal DMEM, 13 dialyzed

_{35 35} fetal bovine serum and 300 μCi/ml S-methionme ( S-

Express Protein Labeling-Mix, New England Nuclear) .

Cell lysates (prepared in 20 mM Hepes, pH 7.2, 150 mM NaCl, 0.1% Triton X-100, 5 mM N-ethylmaleimide, 1 mM

PMSF, 2.5 μg/ml leupeptine) or conditioned medium were lmmunoprecipitated with an antilGIF antibody that recognizes both the precursor and the mature forms of

IGIF (H. Okamura et al . , Nature. 378, p. 88 (1995) ) . lmmunoprecipitated proteins were analyzed by SDS-PAGE (polyacrylamide gel electrophoresis) and fluorography (Fig. 2A) .

We also measured the presence of IFN-γ inducing activity m the cell lysates and the conditioned media of transfected cells (Fig. 2B) .

Transfected Cos cells (3.5 x 10 cells in a 35-mm dish) were grown in 1 ml medium for 18 hours. Media was harvested and used at 1:10 final dilution m the IFN-γ induction assay (Example 23) . Cos cell pellets from the same transfection were lysed m 100 μl of 20 mM

Hepes, pH 7.0, by freeze-thawmg 3 times. Lysates were cleared by centrifugation as described above and were used at a 1:10 dilution m the assay.

Example 25 IGIF is a physiological substrate of ICE

Wild type (ICE+/+) and ICE-/- mice were pr meα with heat-mactivated P. acnes , and Kupffer cells were isolated from these mice 7 days after priming and were then challenged with 1 μg/ml LPS for 3 hours. The amounts of IGIF the conditioneα media were measured by ELISA.

Wild type or ICE-deficient mice were injected mtraperitoneally with heat-killed p. acnes as described (H. Okamura et al . , Infection and Immunity, 63, p. 3966 (1995) ) . Kupffer cells were prepared seven days later accordmg to Tsutsui et al. (H. Tsutsui et al . , Hepato-Gastroenterol . , 39, p. 553 (1992) ) except a nycodenz gradient was used instead cf metrizamide. For each experiment, Kupffer cells from 2-3 animals were pooled and cultured in RPMI 1640 supplemented with 10% fetal calf serum and 1 μg/ml LPS. Cell lysates and conditioned medium were prepared 3 hours later.

Kupffer cells from wild type and ICE-/- mice were metabolically labeled with S-methionine as for Cos cells (described above in Example 24) except that methionine-free RPMI 1640 was used place of DMEM. IGIF immunoprecipitation experiments were performed on cell lysates and conditioned media and immunoprecipitates were analyzed by SDS-PAGE and fluorography as described in Example 23. See Fig. 3.

Example 26

Induction of IFN-v Production In Vivo LPS mixed with 0.5% carboxymethyl cellulose in PBS, pH 7.4, was administered to mice by intraperitoneal injection (30 mg/kg LPS) in a dose volume of 10 ml/kg. Blood was collected every 3 h for 24 h from groups of three ICE-deficient or wild type mice. Serum IFN-γ levels were determined by ELISA (Endogen) .

E ampl 27 IGIF and IFN-γ Inhibition Assays Inhibition of IGIF processmg by ICE inhibitors was measured in ICE inhibition assays as described herein (see Example 1 and Table 22) .

Human PBMC Assays Human buffy coat cells were obtamed from blood donors and peripheral blood mononuclear cells (PBMC) were isolated by centrifugation in LeukoPrep tubes (Becton-Dickmson, Lincoln Park, NJ) . PBMC were added (3 x 10 /well) to 24 well Corning tissue culture plates and after 1 hr incubation at 37°c, non-adherent cells were removed by gently washing. Adherent mononuclear cells were stimulated with LPS (1 μg/ml) with or without ICE inhibitor in 2 ml RPMI-1640-10%

FBS. After 16-18 hr incubation at 37°C, IGIF and IF -γ were quantitated in culture supernatants by ELISA.

For example, we obtamed the following data for compound 412 of this mvention usmg the methods described herein. The structure of compound 412 is shown below.

Table 22

gxampi 8

Compounds of this invention may be prepared via various methods. The following illustrates a preferred method:

To a solution of A (1.1 equivalent) in CH ₂ C1 ₂ (or DMF, or CH ₂ C1 ₂ :DMF (1:1)) is added triphenylphosphme (0-0.5 equivalent), a nucleophilic scavenger (2-50 equivalents) and tetrakis- triphenylphosphme palladιum(O) (0.05-0.1 equivalent at ambient temperature under inert atmosphere (nitrogen or argon) . After 10 minutes, the above reaction mixture is optionally concentrated, then a solution of acid A-I or A-II in CH ₂ C1 ₂ (or DMF, or CH ₂ C1 ₂ :DMF (1-1 is added followed by addition of HOBT (1.1 equivalent! and EDC (1.1 equivalent) . The resulting reaction mixture is allowed to stir at ambient temperature 1 hour-48 hours to provide coupled products C-I or C-II.

Various nucleophilic scavengers may ce used m the above process. Merzouk and Guibe, Tetranedror Letters, 33, pp. 477-480 (1992) ; Guibe and Balavome, Journal of Organic Chemistry, 52, pp. 4984-4993

(1987) ) . Preferred nucleophilic scavengers that may be used mclude: dimedone, morpholine, trimethylsilyl dimethylamine and dimethyl barbituric acid. More preferred nuclophilic scavengers are trimethylsilyl dimethylamine (2-5 equivalents) and dimethyl barbituric (5-50 equivalents) . When the nucleophilic scavenger is trimethylsilyl dimethylamine, the above reaction mixture must be concentrated prior to addition of A-I or A-II. Other compounds of this mvention may be prepared by hydrolyzing compounds represented by C-I and C-II to compounds represented by H-I and H-II as described in the following scheme:

Tne hydrolysis may be carried out under various conditions, provided that the conditions include an acid and H ₂ 0. Acids that may be used include p- toluensulfonic, methanesulfonic acid, sulfuric, cerchloric, trifluoroacetic, and hydrochloric. For example, trifluoroacetic acid (1-90 by weight; or

hydrochloric acid (0.1-30% by weight) in CH ₃ CN/H ₂ 0 (1-90% H ₂ 0 by weight) at between 0-50 °C may be used.

Example 29 Compounds 213f, 213g, 213h, 213ι, 213j, 213k, 2131, 213m, 214f, 214g, 214h, 214ι, 214j, 214k, 2141, 214m, 550f, 550g, 550h, 550ι, 550], 550k, 5501 and 550m were prepared as follows.

213f-m,R ¹ = Bn 214f-m 550f-m, R ¹ = Et

[ I S, 9S {2RS , 3S) ] 9- [ (4-Dimethyla mobenzoyl)amino] -6, 10- dιoxo-1,2 ,3,4,7,8,9, 10-octahydro-N- (2-Benzyloxy-5- σxotetrahydrofuran-3-yl) -6H- pyridazmo[1 ,2-a] [1 ,2]dιazepιne-l-carboxamide (213f) , was synthesized from 212f by the methods used to

prepare 213e from 212e to afford 504 mg of 213f as a yellow solid, ¹ H NMR (CD ₃ 0D) δ 1.10(br. , 0.25H) , 1.30(br. m, 2H) , 1.50(br. , IH) , 1.65(br. m, 1.5H) , 1.80(br. m, 0.25H), 1.90(br. m, 0.25H), 1.95(br. rn,- 0.5H), 2.05(br. m, 0.25H), 2.15(m, IH) , 2.3 (m, IH) , 2.5(br. m, IH) , 2.6(dd, IH) , 2.8 (m, IH) , 3.1(br. s, 3H), 3.15(br. m, IH) , 3.32(br. s, 3H) , 3.5(m, IH) , 4.5(br. m, IH) , 4.62(d, 0.25H), 4.72(m, 3H) , 4.95(m, IH) , 5.1(br. t, 0.25H), 5.15(br. t, 0.75H), 5.7(d, IH) , 6.75(d, 2H), 7.35(br. s, 5H) , 7.75(d, 2H) .

[IS, 9S (2RS , 3S) ] 9-[ (3-Dimethylaminobenzoyl)amino] -6,10- dιoxo-1 ,2,3,4,7,8,9, 10-octahydro-N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyπdazino[1 ,2-a] [1,2]dιazepιne-l-carboxamide (213g) , was synthesized from 212g by the methods used to prepare 213e from 212e to afford 400 mg of 213g, ¹ H NMR (CD ₃ 0D) δ 1.5(br. m, IH) , 1.65(br. m, 2H) , 1.70(br. m, 0.25H), 1.90(br. m, IH) , 1.95(br. , IH) , 2.05(br. m, 0.25H), 2.10 (m, IH) , 2.3 (m, IH) , 2.5(m, 2H), 2.59(d, IH) , 2.6(d, IH) , 2.78(d, IH) , 2.8(d, IH), 2.93(br. s, 4H) , 3.05(br. m, IH) , 3.15(br. m, 0.25H), 3.3(br. s, 3H), 3.5(m, 2H) , 4.5(br. m, 2H) , 4.65(d, IH) , 4.7 (br. , 2H) , 4.95(br. m, IH) , 5.15(br. t, 0.25H), 5.2(br. t, 0.75H), 5.2(d, IH), 6.95(d, IH) , 7.15(d, IH), 7.25(br. s, IH), 7.3(br. t, 2H) , 7.45(br. s, 6H) .

[1S,9S(2RS,3S) ] 9-[ (3-Chloro-4-ammobenzoyl)am o] -6,10- dιoxo-1,2,3,4 ,7,8, 9, 10-octahydro-N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazino[1,2-a] [1,2]dιazepme-1-carboxamide (213h) , was synthesized from 212h by the methods used to

prepare 213e from 212e to afford 296 mg of 213h, ^" " ^" H NMR (CDC1 ₃ ) δ 1.55-1.68 (m, IH) , 1.7-2.05 (m, 3H) , 2.3-2.5 (m, 2H), 2.65-2.8 (m, IH) , 2.85-2.93(m, IH) , 2.95-3.25(m, 3H), 4.44-4.65 (m, 2H) , 4.68-4.82(m, IH) , 4.9-4.95(d, IH) , 5.05-5.18 ( , 2H) , 5.28(s, 0.5H), 5.55-5.58(d, 0.5H), 6.52-6.58(d, 0.5H), 6.7-6.76 (m, 2H) , 6.82- 6.85(d, 0.5H), 7.3-7.4(m, 5H) , 7.52-7.58(m, IH) , 7.75(s, 0.5H) , 7.8 (s, 0.5H) .

[1S,9S(2RS,3S) ] 9-[ (4-Methoxybenzoyl) am o] -6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyrιdazιno[l,2-a] [1,2]dιazepιne-1-carboxamide (213ι), was synthesized from 212i by the methods used to prepare 213e from 212e to afford 1.1 g of 213ι, ¹ H NMR (CDCI ₃ ) δ 1.55-2.05(m, 6H) , 2.26-2.5(m, 2H) , 2.68- 2.82 (m, IH), 2.85-2.92(m, IH) , 2.95-3.25(m, 2H) , 3.82(s, 1.5H), 3.85(s, 1.5H), 4.4-4.65(m, 2H) , 4.7- 4.78 (m, IH) , 4.88-4.95(m, IH) , 5.05-5.23(m, IH) , 5.28(s, 0.5H), 5.55-5.58(d, 0.5H), 6.6-6.65(m, IH) , 6.8-6.8 (m, IH) , 6.9-6.95(m, 3H) , 7.3-7.45(m, 4H, , 7.78-7.85 (m, 2H) .

[1S,9S(2.RS,3S) ]9-[ (3,5-Dιchlorobenzoyl)amino] -6,10- dιoxo-1,2,3,4 ,7,8, 9, 10-octahydro-N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazino[1 ,2-a] [1 ,2]dιazepιne-1-carboxamide (213"j), was synthesized from 212} by the methods used to prepare 213e from 212e to afford 367 mq of 213j, ^~ H NMP (CDCI ₃ ) δ 1.55-2.05(m, 12H) , 2.25(d, IH) , 2.35 m, IH , 2.48(m, 2H), 2.75(m, 2H) , 2.9 (m, IH), 2.95-3.25 r, 5H) , 4.45(t, IH ⁾ , 4.5-4.6 (m, 4H), 4.7 ( , IH) , 4.75(α, IH) ,

4.88(m, IH), 5.05(m, 2H) , 5.15(q, IH) , 5.3(s, IH) , 5.58(d, IH) , 6.5(d, IH) , 6.9(d, IH) , 7.05(d, IH) , 7.25- 7.35(m, 5H), 7.6(s, 2H) , 7.7(s, 2H) .

[1S,9S(2J?S,3S) ]9-[ (3,5-Dιchloro-4- hydroxybenzoyl)ammo] -6, 10-dιoxo-l ,2,3,4,7,8,9, 10- octahydro-N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) -6H- pyπdazino[l ,2-a] [1,2]dιazepιne-l-carboxamιde (213k), was synthesized from 212k by the methods used to prepare 213e from 212e to afford 593 mg of 213k, ¹ H NMR (CD ₃ 0D) δ 1.5(m, IH), 1.6-1.7 (m, 2H) , 1.75-1.95 (m, H) , 2.15(m, 2H) , 2.3 (m, IH) , 2.6 (m, IH) , 2.7 (m, IH) , 3.05(m, 2H) , 3.15(m, IH) , 3.5(m, 2H) , 4.45(m, 2H) , 4.65(d, IH) , 4.7 (m, IH) , .95 ( , IH) , 5.15(m, IH) , 5.4(s, IH) , 5.7(d, IH) , 7.3 (m, 5H) , 7.85(s, 2H) .

[IS,9S(2.RS,3S) ] 9- [ (3-Chloro-4-acetamιdobenzoyl) ammo] - 6,10-dioxo-1,2,3,4,7,8,9,10-octahydro-N- (2-Benzyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyrιdazmo[l,2-a] [1,2]dιazepιne-l-carboxamιde (2131), was synthesized from 2121 by the methods used to prepare 213e from 212e to afford 133 mg of 2131, ^λ NMR

(CDCI ₃ ) δ 1.55-1.7(m, IH) , 1.75-2.05(m, 3H) , 2.25(s, 1.5H), 2.27(s, 1.5H), 2.3-2.48(m, 2H) , 2.7-2.83 (m, IH), 2.85-2.94 (dd, IH) , 2.95-3.25(m, 2H) , 4.42-4.65(m, 2H), 4.68-4.85(m, IH) , 4.88-4.95(m, IH) , 5.05-5.18(m, 2H) , 5.32(s, 0.5H), 5.55-5.6(d, 0.5H), 6.48-6.55(d, IH),

6.88-6.92(d, IH), 7.0-7.04(d, 0.5H) , 7.15-7.2(d, 0.5H) , 7.3-7.4 (m, 4H) , 7.64-7.78 (m, 2H), 7.88-7.94 (m, IH) , 8.45-8.56 (m, IH) .

[1S,9S(2RS,3S) ]9-[ (3,5-Dιchloro-4- ethoxybenzoyl)amino] -6, 10-dιoxo-l ,2,3,4,7,8,9,10-

octahydro-N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) -6H- pyridazino[l,2-a] [1 ,2]diazepine-1-carboxamide (213m), was synthesized from 212m by the methods used to prepare 213e from 212e to afford 991 mg of 213m, ¹ H NMR (CDC1 ₃ ) δ 1.5-2.15 (m, 5H) , 2.2-2.55 (m, 3H) , 2.6-3.3 ( , 4H) , 3.95(2s, 3H) , 4.45-4.7(m, 2H) , 4.7-4.85(m, IH) , 4.8504.95(m, IH) , 5.05-5.25(m, IH) , 5.3(s, 0.5H), 5.6(d, 0.5H), 6.55(d, 0.5H), 6.85(d, 0.5H) , 7.0(d, 0.5H), 7.25-7.6(m, 5.5H), 7.75(s, IH) , 7.85(s, IH) .

[1S,9S(2ES,3S) ] 9- [ (4-Dimethylaminobenzoyl)amino] -6, 10- dioxo-1 ,2,3,4,7,8,9, 10-octahydro-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazinofl ,2-a] [1 ,2]dιazepine-l-carboxamide (550f) , was synthesized from 212f by the methods used to prepare 213e from 212e to afford 420 mg of 550f as an off white solid, ¹ H NMR (CDC1 ₃ ) δ 1.2-1.25(br. t, 3H) , 1.35(m, IH) , 1.55(br. m, IH) , 1.88-2.02 (br . m, 4H) , 2.3(d, IH), 2.35(m, IH) , 2.45 (m, IH) , 2.55-2.75(m, 3H) , 3.0(s, 6H) , 3.25(m, IH) , 3.55(m, IH) , 3.65(m, IH) , 3.75(m, IH) , 3.9(m, IH) , 4.3(t, IH), .55 (m, 2H) ,

4.68(br. m, IH) , 3.9 (m, IH) , 4.3(t, IH) , 4.55 (m, 2H) , 4.68(br. m, IH) , 4.95(br. m, IH) , 5.1(br. , 2H) , 5.45(d, IH), 6.5(m, 2H) , 7.7 (m, 2H) .

[IS, 9S(2i?S,3S) ] 9- [ (3-Chloro-4-ammobenzoyl) amino] -6, 10- dιoxo-1,2,3,4 ,7,8, 9,10-octahydro-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazino[1,2-a] [1,2]diazepme-1-carboxamide (550h) , was synthesized from 212h by the methods used to prepare 213e from 212e to afford 195 mg of 550h as a white solid, ^X H NMR (DMS0-d ₆ ) δ 1.1-1.18 (2t, 3H) , 1. -

1.7(m, 2H) , 1.88-2.05(m, 2H) , 2.1-2.35 (m, 3H) , 2.48- 2.56(m, IH) , 2.75-2.8(m, 0.75H), 2.88-3.08(m, 1.25H) , 3.25-3.4(m, IH) , 3.55-3.8 (π., 2H) , 4.35-4.45(m, IH) , 4.55-4.62(m, IH) , 4.8-4.88(m, IH) , 4.98-5.03(m, 0.25H) , 5.1-5.13 (m, 0.75H) , 5.33(s, 0.25H), 5.58-5.6(d, 0.75H) , 5.9-6.0(br. s, 2H) , 6.8-6.85(d, IH) , 7.58-7.62(d, IH) , 7.82(s, IH) , 8.22-8.28(d, IH) , 8.48-8.52(d, 0.75H) , 8.72-8.76(d, 0.25H) .

[1S,9S(2RS,3S) ] 9- [ (4-Methoxybenzoyl)am o] -6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -6H- pyridaz o[1 ,2-a] [1,2]dιazepme-l-carboxamide (550ι) , was synthesized from 212ι by the methods used to prepare 213e from 212e to afford 135 mg of 550ι, ¹ H NMR (CDC1 ₃ ) δ 1.18-1.28 (2t, 3H), 1.6-1.75(m, 1.5H), 1.9- 2.1(m, 3.5H), 2.22-2.3(d, 0.5H), 2.38-2.47(m, 1.5H) , 2.7-2.8(m, 0.5H), 2.8-2.93 (m, IH) , 2.94-3.15 (m, 1.5H1 , 3.15-3.28(m, IH) , 3.55-3.62(q, 0.5H), 3.62-3.73(q, 0.5H), 3.78-3.88(q, 0.5H), 3.88(s, 3H) , 3.9-3.95(q, 0.5H) , 4.33-4.4(m, 0.5H), 4.5-4.55(m, IH) , 4.68-4.76(m, 0.5H) , 4.9-4.95 (m, 0.5H), 5.1-5.2(m, 1.5H), 5.18(s, 0.5H), 5.48-5.52(d, 0.5H), 6.48-6.55(d, 0.5H), 6.85- 6.9(m, IH) , 6.9-6.95 (m, 2H), 7.34-7.38(d, 0.5H) , 7.78- 7.85(m, 2H) .

[lS,9S(2i?S,3S) ] 9- [ (3,5-Dιchloro-4- hydroxybenzoyl)am o] -6, 10-dιoxo-l ,2,3,4,7,8,9, 10- octahydro-N- (2-ethoxy-5-oxotetrahydrofuran-3-yl) -6H- pyridazmo[1 ,2-a] [1 ,2]dιazepιne-1-carboxamide (550k), was synthesized from 212k by the methods used to prepare 213e from 212e to afford 174 mg cf 550k as a white solid, ² H NMR (DMS0-d ₆ ) δ 1.15(2t, 3H) , 1.6-

1.75(m, 2H), 1.9-2.05 (m, 2H) , 2.1-2.4(m, 5H) , 2.5- 2.55 (m, IH) , 2.7-2.8(m, 0.5H) , 2.85-3.0(m, IH) , 3.0- 3.1 (m, 0.5H) , 3.55-3.7 ( , IH) , 3.7-3.8(m, IH) , 4.2(t, 0.5H), 4.35-4.45(m, 0.5H) , 4.55-4.65(m, 0.5H) , 4.8- 4.9 (m, 0.5H) , 5.05(t, 0.5H) , 5.15(t, 0.5H), 5.35(s,

0.5H) , 5.6(d, 0.5H), 7.95(s, 2H) , 8.5(d, 0.5H) , 8.65(d, IH), 8.75(d, 0.5H) , 10.9(br. s, IH) .

[IS,9S(2_S,3S) ] 9- [ (3-Chloro-4-acetamidobenzoyl)amino] - 6, 10-dioxo-l ,2,3,4,7,8,9,10-octahydro-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazino[1 ,2-a] [1,2]diazepme-l-carboxamide (5501), was synthesized from 2121 by the methods used to prepare 213e from 212e to afford 151 mg of 5501, ¹ H NMR (CDC1 ₃ ) δ 1.2-1.28(2t, 3H) , 1.6-1.72 (m, 1.5H), 1.88- 2.15(m, 3.5H), 2.22-2.28(m, 0.5H), 2.28(s, 3H) , 2.38- 2.48(m, 1.5H), 2.66-2.92(m, 1.5H), 2.95-3.14(m, 1.5H) , 3.2-3.34(m, IH) , 3.56-3.63(q, 0.5H), 3.63-3.72(q, 0.5H), 3.8-3.85(q, 0.5H), 3.9-3.95(q, 0.5H), 4.32- 4.38 (m, 0.5H), .5-4.62 (m, IH) , 4.68-4.75(m, 0.5H) , 4.88-4.92(m, 0.5H), 5.08-5.2(m, 1.5H), 5.18(s, 0.5H) ,

5.46-5.5(d, 0.5H), 6.5-6.55(d, 0.SH), 6.98-7.05(m, IH) , 7.42-7.48(d, 0.5H), 7.63-7.78(m, 2.5H), 7.9-7.94(d, 0.5H) , 8.44-8.52 (m, IH) .

[1S,9S(2£S,3S) ]9-[ (3,5-Dichloro-4- methoxybenzoyl)ammo] -6, 10-dιoxo-l ,2,3,4,7,8,9,10- octahydro-N- (2-ethoxy-5-oxotetrahydrofuran-3-yl) -6H- pyπdazino[1 ,2-a] [1 ,2]diazepιne-l-carboxamide (550m), was synthesized from 212m by the methods used to prepare 213e from 212e to afford 301 mg of 550m as a white solid, ^λ ti NMR (CDC1 ₃ ) δ 1.2-1.35(2t, 3H), 1.5-

1.8 (m, 2H) , 1.9-2.15(5H) , 2.25(d, 0.5H) , 2.4-2.5 (m, 2H) , 2.65-2.8 (m, 0.5H), 2..8-3.0 (m, 0.5H) , 3.0-3.2(m, IH), 3.2-3.35(m, 0.5H), 3.55-3.65(m, 0.5H), 3.65- 3.75(m, 0.5H), 3.8-3.9(m, 0.5H) , 3.9-4.0 (m, 0.5H), 4.4- 4.45(m, 0.5H), 4.55-4.65(m, 0.5H) , 4.7-4.8 (m, 0.5H) , 4.85-4.95(m, 0.5H), 5.05-5.2 (m, 0.5H) , 5.2(s, 0.5H), 5.5(d, 0.5H), 6.5(d, 0.5H), 6.9(d, 0.5H) , 6.95(d, 0.5H), 7.35(d, 0.5H), 7.75(s, IH) , 7.85(s, IH) .

[3S(1S,9S) ]3-(9-(3,5-Dichlorobenzoyl)ammo-6,10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-6H- pyπdazino[1 ,2-a] [1 ,2]dιazepine-l-carboxamιdo) -4- oxobutanoic acid (214j), was synthesized from 213j by the method used to prepare 2002 from 2001 to afford 62 mg of 214j as a white solid, ^" " ^" H NMR (CD ₃ 0D) δ 0.9 (t, IH), 1.3(br. s, IH) , 1.7(br. m, IH) , 1.9(br. , IH) ,

2.1 (br. s, IH) , 2.25(q, IH) , 2.35 (m, IH) , 2.48 (m, 2H) , 2.65(t, IH) , 3.15(br. t, IH) , 3.5(br. m, IH) , 4.3(br. s, IH) , 4.55 (m, 2H) , 4.95(t, IH) , 5.25(br. s, IH) , 7.6(br. s, IH) , 7.85(br. s, IH) .

[3S(1S,9S) ]3- (9-(3,5-Dichloro-4-hydroxybenzoyl)amιno- 6, 10-dioxo-l,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1,2]dιazepιne-l-carboxamιdo) -4- oxobutanoic acid (214k) , was synthesized from 213k by the method used to prepare 2002 from 2001 to afford 80 mg of 214k as a white solid, ¹ H NMR (CD ₃ 0D) δ 1.6-1. ^~ m, IH) , 1.8-2.0(m, 2H) , 2.0-2.1 (m, 2H) , 2.15-2.25 (m, IH;, 2.3-2.4(m, IH), 2.4-2.55 ( , 2H), 2.6-2.75 (m, IH) , 3.05- 3.2(m, IH) , 3.4-3.6(m, 2H), 4.2-4.3 (m, IH) , 4. 5- . (m, IH) , 4.8-5.0(m, IH) , 5.1-5.2(m, IH) , 7.85(s, 2H) .

[3S (IS, 9S) ] 3- (9- (3-Chloro-4-acetamιdobenzoyl) am o- 6,10-dιoxo-l,2,3,4 ,7,8, 9, 10-octahydro-6H- pyπdazino [1,2-a] [1 ,2 ]dιazepιne-l-carboxamιdo) -4- oxobutanoic acid (2141), was synthesized from 2131 by tne method used to prepare 2002 from 2001 to afford 91 mg of 2141 as a white solid, ¹ H NMR (DMS0-d ₆ ) δ 1.65(br , 6H), 1.9(br. m, 6H) , 2.15(s, 3H) , 2.3 (m, 3H) , 2.6- 2.85(m, 3H) , 2.9 (m, 2H) , 3.0(m, IH) , 4.15(br. q, IH) , 4. (m, 3H) , 5.0 (m, IH) , 5.15(m, IH) , 5.45(s, IH) , 7.8(d, 2H), 7.95(d, IH) , 8.05(s, IH) , 8.65(m, 2H), 9.65 (s, IH) .

[3S(1S, 9S) ]3- (9- (3,5-Dιchlorobenzoyl) ammo-6, 10-dιoxo-

1,2,3,4 ,7,8,9,10-octahydro-6H- pyridaz o[1,2-a] [1 ,2]dιazepme-l-carboxamιdo) -4- oxobutanoic acid (214m), was synthesized from 213m by the method used to prepare 2002 from 2001 to afford 105 mg of 214m as a white solid, ^X H NMR (CD ₃ 0D) δ 1.6- 1.75(m, IH) , 1.85-1.95(m, IH) , 2.0-2.1 (m, 2H) , 2.15- 2.25(m, IH), 2.3-2.4(m, IH) , 2.45-2.55(m, 2H) , 2.65- 2.75(m, IH) , 3.4-3.55(m, 2H) , 3.95(s, 3H), 4.2-4.3(m, IH), 4.45-4.6(m, IH) , 4.9-5.0(m, IH) , 5.15-5.2(m, IH), 7.9 (s, 2H) .

Compounds 308c and 308d were prepared as follows .

[3S(1S,9S) 3- (9- (4-Methoxybenzoyl)amιno-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazino[1,2-a] [1 ,2]dιazep e-l-carboxamιdo) -am o] - 4-oxobutanoic acid, O-methyl oxime (308c) , was synthesized from 212e via the methods used to prepare 308b from 212e to afford 266 mg of 308c ^" " ^" H NMR (CDC1 ₃ ) δ 1.6-1.7 (m, IH), 1.88-1.98 (m, 3H) , 2.02-2.15 (m, IH) , 2.3-2.4(m, IH), 2.65-2.95(m, 3H) , 3.04-3.09(m, IH), 3.12-3.25(m, IH) , 3.84(s, 3H) , 3.86(s, 3H) , 4.5-4.58 (m, IH), 4.88-4.95(m, IH) , 5.1-5.25(m, 2H) , 6.86-6.9(d, 2H) , 7.15-7.25 (m, 2H) , 7.36-7.4(m, IH), 7.75-7.8(d, 2H) .

[3S(1S,9S) 3- (9- (4-Methoxybenzoyl)amιno-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1 ,2]dιazepιne-l-carboxamιdo) -am o] - 4-oxobutanoιc acid, O-benzyl oxime (308d) , was synthesized from 212e via the methods used to prepare 308b from 212e to afford 270 mg of 308d, ¹ H NMR fCDCl ₃ δ 1.55-1.65(m, IH) , 1.8-2.1 (m, 4H) , 2.3-2.4(m, IH. , 2.65-2.88(m, 3H), 2.9-3.3 (m, 3H) , 4.5-4.58(m, IH,,

4.88-4.95{m, IH) , 5.05(s, 2H) , 5.1-5.2 ( , IH), 6.82-

6.95(m, 2H) , 7.02-7.15 (m, 2H) , 7.28(m, 5H) , 7.45 ( , IH) , 7.72 (d, 2H) .

Compounds 2100f, 2100g, 2100h, 2100i and 2100j were prepared as described below.

AllocN ~Xθ

H

2101b

(3S,2RS) 3-Allyloxycarbonylamino-2- (4-chlorobenzyl)oxy- 5-oxotetrahydrofuran (2101a), was synthesized from allyloxycarbonylamino-β- ert-butyl aspartate by the methods employed by Chapman (Bioorα. & Med. Chem. Lett. , 2, pp.615-618 (1992)) to prepare (3S,2RS) 3- allyloxycarbonylamino-2-benzyloxy-5-oxotetrahydrof ran

using 4-chlorobenzyl alcohol instead of benzyl alcohol to afford 1.84 g of 2101a as a crystalline solid.

[1S,9S(2RS,3S) ] 9-Benzoylamιno-6,10-dιoxo- 1,2,3,4,7,8,9, 10-oσtahydro-N- (2- (4-chlorobenzyl)oxy-5- oxotetrahydrofuran-3-yl) -6H- pyπdazιno[l,2-a] [1,2]dιazepιne-l-carboxamide (2100f) , was synthesized from 212e by the methods used to prepare 213e from 212e using 2101a to afford 380 mg of 2100f, ¹ H NMR (CDC1 ₃ ) δ 1.8-2.0(m, 10H), 2.30(d, IH), 2.31-2.5 ( , 3H) , 2.7-2.9(m, 3H) , 3.05(m, 2H) , 3.1- 3.2(m, 4H) , 4.45(q, IH) , 4.5-4.6(m, 3H) , 4.7(d, 2H), 4.85(d, IH) , 4.9(t, IH) , 5.2(t, IH) , 5.15(m, 2H), 5.25(s, IH) , 5.55(d, IH) , 6.5(d, IH) , 6.9(d, IH) , 6.95(d, IH), 7.25(m, 3H) , 7.35(t, 2H) , 7.45(m, 2H) , .55(iH) , 7.8 (m, 3H) .

(3S,2_S) 3-Allyloxycarbonylamιno-2-anti-ιsopropoxy-5- oxotetrahydro uran (2101b) , was synthesized from (3 , 2RS) 3-allyloxycarbonylammo-2-benzyloxy-5- oxotetrahydrofuran via the method used to prepare 2100d from 214e using H ₂ S0 ₄ instead of pTSA to afford 2101b.

[1S,9S(2KS,3S) ] 9-Benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9,10-octahydro-N- (2-antι-ιsopropoxy-5- oxotetrahydrofuran-3-yl) -6H- pyπdazιno[l,2-a] [1,2]dιazepιne-1-carboxamide (2100g) , was synthesized from 212e by the methods used to prepare 213e from 212e using 2101b to afford 31 mg of 2100g, ^X H NMR (CDC1 ₃ ) δ 1.19 (d), 1.94 (br s) , 2.00-^.12 (m) , 2.24 (d), 2,42 (dd) , 2.71-2.83 (m. , 3.02 (dd), 3.12-3.27 (overlapping m) , 3.93 (m) , 4.32-4.37 ( , ) ,

4.52-4.63 (m) , 4.90-4.95 (m) , 5.12-5.20 (m) , 5.28 (si , 6.93 (d) , 7.10 (d), 7.41-7.50 (m) , 7.51-7.58 (m) , 7,84 (d) .

[IS, 9S(2_RS,3RS) ] 9-Benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-N- (2-acetoxy-5- oxotetrahydrofuran-3-yl) -6H- pyridazino[1,2-a] [1 ,2]diazepιne-l-carboxamιde (2100h) .

A solution of 214e (287 mg, 0.65 mmol) in pyridme (5 L) was treated with Ac ₂ 0 (0.4 mL, 3.62 mmol) . After 6 hours, the reaction mixture was poured mto 5% NaHS0 ₄ and extracted 3 times with EtOAc. The combmed organics were washed with brine, dried over Na ₂ Sθ ₄ and concentrated m vacuo . Chromatography (Sι0 ₂ , EtOAc) afforded 119 mg of 2100h, ¹ HNMR (CDC1 ₃ , mixture of four diastereoisomers) δ 1.80-2.05 (m) , 2.12(s), 2.13(s) , 2.19(s), 2.22(d), 2.67-2.75 (m) , 2.80-2.95 (m) , 3.00- 3.20 (m), 3.21-3.33 (m) , 3.50-3.95 ( four discrete multiplets), 4.19(m), 4.55(m), 4.57-4.65 ( ) , 4.69(nυ, .85- .95(m) , 5.04(m) , 5.10(s), 5.10-2.22 ( ) , 6.46(d) , 6.03(s), 6.50(d), 6.58(d) , 6.75(d), 6.95- .05 (m) , 7.22 (m), 7.30(m), 7.71(d), 7.75-7.83 (m) .

[3S(1S, 9S) ] 3- (9-Benzoylamιno-6, 10-dιoxo-

1,2,3,4 ,7,8,9, 10-octahydro-6H- pyπdazino[1 ,2-a] [1 ,2]diazepine-l-carboxamιdo) -4- oxobutanoic acid ethyl ester (2100ι) . To a solution of 2100b (1.5 g, 2.7 mmol) CH ₃ CN (10 mL) was adαed IN HCl at ambient temperature. After 6 hours solid NaHC0 ₃ was added and the product extracted with EtOAc, dried over MgSO^ and concentrated in va cuo . Chromatography

(Sι0 ₂ , 30-100% CH ₂ C1 ₂ in EtOAc) afforded 123 mg of 2100ι, ¹ H NMR (CDC1 ₃ ) δ 1.25(t, 3H) , 1.6-1.8(m, IH) , 1.9-2.2(m, 5H) , 2.4-2.5 ( , IH) , 2.75-2.9(m, 2H) , 3.0- 3.1 ( , 2H), 3.2-3.25(m, IH) , 4.05-4.2 (m, IH) , 4.5- 4.7(m, IH), 5.1-5.25(m, IH) , 7.0-7.2 (m, 2H) , 7.4- 7.45(m, 2H), 7.5(t, IH) , 7.8(t, 2H) , 9.5(s, IH) .

[3S(1S,9S) ]3- (9-Benzoylamιno-6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1,2-a] [1,2]dιazepme-l-carboxamιdo) -4- acetoxy-3-butenoιc acid ethyl ester (2100j), was synthesized from 2100ι via the method used to prepare

2100h from 214e to afford 347 mg of 2100^, ^λ H NMR (CDC1 ₃ ) δ 1.3(t, 3H), 1.6-1.8 (m, 2H) , 1.9-2.25(m, 4H) , 2.25(s, 3H) , 2.3-2.45(m, IH) , 2.8-3.0(m, IH) , 3.0- 3.25 (m, 2H) , 3. -3.45 (m, 2H) , 4.1-4.2 ( , 2H) , 4.55- 4.7 (m, IH), 5.1-5.25 (m, IH) , 6.8(s, IH) , 7.0-7.1(m, 2H), 7.5(t, IH), 7.8(t, 2H) , 9.5(s, IH) .

Compounds 500 and 501 are described in Table 23. These compounds were prepared by methods similar to the methods used to prepare compounds 404-449 (see, Example 11) .

Table 23

The compounds described below (213m, 213n, 213o, 213p, 213q, 213r, 213s, 213t, 213u, 213v, 213w, 213x, and 214w) , were prepared by methods similar to the methods used to prepare compounds 213b-f.

Compounds 419, 415, 450, 456, 475, 404, 486, 487, 417, 408 and 418 may also be prepared as describeα below.

213m-x 214w, 404, 408, 415

417, 418, 419, 450,

456, 475, 486, 487

[1S,9S(2J?S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dioxo-9- (3,4-methylenedioxybenzoylamino) - 1,2,3,4,7,8,9,10-octahydro-6H- pyridazιno[l,2-a] [1 ,2]diazepine-l-carboxamide (213n) , was isolated as a mixture of diastereomers (syn: anti isomer ratio 6:4) (1.43g, 82 ^c c) as a white solid: mp. 206-10°C; IR (KBr) 3288, 1787, 1680, 1657, 1651, 1619, 1548, 1440, 1256, 1135; ¹ H NMR (D ₆ -DMS0) δ 8.75 ,0.4H, d) , 8.55 (0.6H, d), 8.45 and 8.43 (IH, 2 x d) , .50 (IH, d), 7.42 (IH, s), 7.40-7.27 (5H, m) , 7.01 CH, d) , 6.11 (2H, s), 5.67 (0.6H, d) , 5.43 (0.4H, s), 5.10-5.00 (IH, m) , 4.90-4.59 (3.5H, m) , 4.45-4.25 (1.5H, rr.. ,

3.47-3.20 (IH, m) , 3.20-2.70 (2H, m) , 2.65-2.35 'IH, m), 2.35-2.00 (3H, m) , 2.00-1.75 (2H, m. , 1.65-1.40 (2H, m) . Anal. Calcd for C ₂₉ H ₃₀ N ₄ O ₉ : C, 60.20; H, 5.23; N, 9.68. Found: C, 60.08; H, 5.32; N, 9.50. MS (ES~ι

580 (M ⁺ + 2, 35%), 579 (M ⁺ + 1, 100) , 404 (5) , 367 (5) , 236 (7) , 107 (5) .

[1S,9S(2RS,3S) ]9-[ (3-Acetamido)benzamido] -N- (2- benzyloxy-5-oxotetrahydrofuran-3-yl) -6, 10-dιoxo- l,2,3,4,7,8,9,10-octahydro-6H- pyridazinofl ,2-a] [1 ,2]dιazepιne-l-carboxamide (213o) , anti-isomer as a white foamy solid (0.73g, 69%) : mp. 135-40°C; [α] _D ²¹ -37.3° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3452, 3310, 1790, 1664, 1659, 1650, 1549, 1425, 1258, 1121; ^: H NMR (D ₆ -DMS0) δ 10.11 (IH, s) , 8.77 (IH, d) , 8.57 (IH, d) , 8.01 (IH, s), 7.76 (IH, d) , 7.55 (IH, d) , 7.45-7.25 (6H, ) , 5.43 (IH, s), 5.08-5.00 (IH, m) , 4.95-4.73 (IH, m) , 4.76 and 4.68 (2H, dd) , 3.40-3.20 (IH, m) , 3.09 (IH, dd) , 3.02-2.75 (IH, m) , 2.45-2.06 (4H, m) , 2.06 (3H, s) , 2.00-1.75 (2H, m) , 1.70-1.40

(2H, m) . Anal. Calcd for C ₃₀ H ₃₃ N ₅ O ₈ • 0.75H ₂ 0: C, 59.54; H, 5.75; N, 11.57. Found: C, 59.40; H, 5.62; N, 11.50. MS (ES ⁺ ) 593 (M ⁺ + 2, 33%) , 592 (M ⁺ + 1, 100) , 574 A ) , 487 (7) , 475 (6) , 385 (9) , 373 (26) , 318 (14) , 296 (11) , 266 (10) , 221 (22) .

[IS, 9S(2J?S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (4-hydroxybenzoyl) amino- 1,2,3,4 , 7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2]dιazepιne-l-carboxamide (213p) ,

20 was isolated as a foam (1.2g, 11 ) : [α] _D -115° (c

0.20, CH ₂ C1 ₂ ) ; IR (KBr) 3368, 2946, 1794, 1654, 1609, 1540, 1505, 1421, 1277, 1175, 1119, 980; ¹ H NMP (Dg- DMSO) δ 10.1 (IH, s) , 8.80 (0.5H, d, J = 6.6) , 3.60 A . bW , d, J = 7.2), 8.40-8.36 (IH, 2d) , 7.82 (2H, d, J = 8.0) , 7.41 (5H, bs) , 6.86 (2H, d, J 8.6) , 5.72 (0.5H,

d, J = 5.0) , 5.49 (0.5H, bs) , 5.13-5.0 ^"7 (IH, m) , 4.95- 4.65 (2.5H, m) , 4.49-4.38 (2.5H, m) , 3.49-3.30 (2H, m) , 3.21, 2.79 (2H, m) , 2.40-1.41 (7H, m) . MS (ES ⁺ ) 551.

[IS,9S(2RS,3S) ]N- (2-Benzyloxy-5-oxotetrahydrofuran-3- 5 yl) -6,10-dioxo-9- (indol-2-oylamino) -1,2,3,4,7,8, 9,10- octahydro-6H-pyridazino[l,2-a] [1 ,2]dιazepιne-l- carboxamide (213q) , was isolated as a white glassy solid (80%) : mp. 145-149°C; [α] _D ²³ -56.0° (c 0.05, CH ₂ C1 ₂ ) ; IR (KBr) 3399-3319, 1791, 1657, 1543, 1420, 0 1253, 1119; ¹ H NMR (CDC1 ₃ ) δ9.54 (IH, s) , 7.65 (IH, d, J = 7.9), 7.51 (IH, d, J = 6.9), 7.44-7.25 (7H, m) , 7.18-7.06 (3H, m) , 5.30-5.20 (IH, m) , 5.27 (IH, s), 4.84 (IH, m) , 4.79 (IH, d, J = 11.4), 4.56 (IH, d, J = 11.3), 4.47 (2H, m) , 3.28 (IH, ) , 3.10-2.97 (2H, m) , 5 2.71 (IH, m) , 2.47-2.37 (IH, m) , 2.26 (IH, d, J = 17.9), 2.09 (IH, m) , 1.83, 1.70, 1.51 (4H, 3m) .

[1S,9S(2RS,3S) ] N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dioxo-l,2,3,4 ,7,8, 9,10-octahydro-9- (2- toluoyla ino) -6H-pyridazino[1,2-a] [1,2]dιazepme-1- 0 carboxamide (213r) , was isolated as a mixture of diastereomers (syn:anti isomer ratio 55:45) as a white foamy solid (1.46g, 89%) : mp. 106-10°C; IR (KBr) 3306, 2947, 1791, 1659, 1650, 1535, 1421, 1256, 1122; ^λ H NMR

(D ₆ -DMSO) δ 8.76 (0.45H, d) , 8.56 (0.55H, d) , 8.49 and 5 8.47 (IH, 2 x d) , 7.41-7.19 (9H, m) , 5.67 (0.55H, d),

5.43 (0.45H, s) , 5.11-5.02 (IH, m) , 4.86-4.55 (3.5H, ) , 4.45-4.25 (1.5H, m) , 3.40-3.20 {IH, ) , 3.20-2.70

(2H, m) , 2.65-2.40 (IH, m) , 2.34 (3H, s) , 2.30-1.70

(5H, m) , 1.65-1.40 (2H, m) . Anal. Calcd for C ₂₉ H ₃₂ N ₄ 0-.: C C, 62.66; H, 5.95; N, 10.08. Found: C, 62.91; H, 6.00;

N, 9.70. MS (ES ⁺ ) 550 (M ⁺ + 2, 43%), 549 (M ⁺ - 1, 100) 374 (3) , 280 (4) , 279 (20) , 118 (5) .

[IS, 9S(2_RS,3S) ]N- (2-Benzyloxy-5-oxotetrahydrofuran-3~ yl) -6,10-dioxo-l,2,3,4 ,7,8, 9,10-octahydro-9-[4- (phenylacetamido)benzamido]-6H- pyridazinofl,2-a] [1,2]diazepin-1-carboxamide (213s), was isolated as the anti-isomer as a white foamy solid (0.64g, 77%) : mp. 137-41°C; [α] _D ²¹ -48.2° (c 0.05, CH ₃ 0H) ; IR (KBr) 3477, 3314, 1791, 1659, 1599, 1529, 1499, 1406, 1256, 1122; ¹ H NMR (Dg-DMSO) δ 10.45 (IH, s), 8.76 (IH, d), 8.50 (IH, d) , 7.86 (2H, d) , 7.69 (2H, d) , 7.41-7.20 (10H, m) , 5.43 (IH, s), 5.08-4.98 (IH, m) , 4.90-4.73 (IH, m) , 4.76 and 4.68 (2H, dd) , 3.67 (2H, s), 3.40-3.20 (IH, ) , 3.09 (IH, dd) , 3.02-2.75 (IH, m) , 2.39 (IH, dd) , 2.30-2.00 (3H, m) , 2.00-1.75 (2H, m) , 1.70-1.40 (2H, m) . Anal. Calcd for C ₃₆ H ₃₇ N ₅ O ₈ '0.5H ₂ O: C, 63.90; H, 5.66; N, 10.35. Found: C, 63.68; H, 5.67; N, 10.24. MS (ES ⁺ ) 669 (M ⁺ ~ 2 , 40%), 668 (M ⁺ + 1, 100), 640 (12) , 435 (18) , 425 (23) , 403 (33), 328 (17), 302, (32), 274 (22), 197 (16>, 138 (17) .

[1S,9S(2RS,3S) ]N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dioxo-9- [4- (3-methylbutan-l- oylamino)benzamido] -1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2]diazepιne-l-carboxamide (213t) , was isolated as a white foamy solid (0.63g, 80-., : mp. 159-64°C; [α] _D ²¹ -37.0° (c 0.05, CH ₃ OH) ; IR (KBr, 3463,

3321, 1790, 1680, 1658, 1650, 1644, 1595, 1525, 15 ~ι0u _. ,

1408, 1251, 1113, 933; ^X H NMR (D ₆ -DMSO) δ 10.13 IH, s) , 8.76 (IH, d) , 8.48 (IH, d) , 7.85 (2H, d) , 7.66 '2H, dj ,

7.40-7.25 (5H, m) , 5.43 (IH, s), 5.08-4.95 (IH, m) , 4.92-4.73 (IH, m) , 4.76 and 4.68 (2H, dd) , 3.40-3.20 (IH, m) , 3.09 (IH, dd) , 3.02-2.75 (IH, m) , 2.39 (IH, dd) , 2.35-2.00 (6H, m) , 2.00-1.75 (2H, m) , 1.70-1.40 (2H, m) , 0.93 (6H, d) . Anal. Calcd for

C ₃₃ H ₃₉ N ₅ 0 ₈ O.5H ₂ 0: C, 61.67; H, 6.27; N, 10.90. Found: C, 61.49; H, 6.24; N, 10.86. MS (ES ⁺ ) 635 (M ⁺ + 2, 39%) , 634 (M+ + 1, 100), 484 (10) , 427 (9) , 274 (18) , 268 (37) , 204 (19) , 117 (13) .

[1S,9S(2KS,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dioxo-l,2,3,4 , 7 ,8 , 9, 10-octahydro-9- (3,4,5- trimethoxybenzoylamino) -6H- pyridazino [1 ,2-a] [1 ,2]diazepine-l-carboxamide (213u) , was isolated as a white solid (81%) : mp. 120-132°C; IR (KBr) 3361-3334, 1792, 1659, 1585, 1536, 1499, 1457,

1416, 1340, 1236, 1126, 989; ¹ H MR (CDCl ₃ ) δ 7.39-7.29 (6H, m) , 7.12 (IH, s), 7.03 (IH, s) , 6.92, 6.83, 6.48 (approx 3H, 3d, J = 8.1, 7.5, 8.1) , 5.57 (d, J = 5.3) , 5.27 (IH, s) , 5.23-5.06, 4.91-4.71, 4.64-4.43, (6H, 3m) , 3.92, 3.91, 3.89, 3.88 (9H, 4s) , 3.32-2.70, 2.52- 2.08, 1.91, 1.63 (IH, 4m) .

[lS,9S(2i?S,3S) ] N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dιoxo-9-(naphth-l-oylamino) -1,2,3,4,7,8,9,10- octahydro-6H-pyridazino[l ,2-a] [1,2 ]dιazepιne-1- carboxamide (213v) , was isolated as a wnite solid

(78 ^" ) : mp. 121-7°C; IR (KBr) 3534-3331, 1791, 1659, 1528, 1420, 1256, 1122; ^ NMR (CDC1 ₃ ) δ 8.34-8.29 (IH, ) , 7.98-7.87 (2H, m) , 7.68-7.45 (4H, m) , 7.34-7.24 (5H, m) , 7.04 (d, J = 6.8) , 6.78 (d, J = 7.8) , 6.6c id, J = 7.7) , 6.48 (2H, d, J = 7.5)5.5o (d, J - 5.4, , 5.15

(IH, s) , 5.30-5.14, 5.0, 4.89 (d, J = 11.2), 4.71-4.41 (6H), 3.18-2.80, 2.50-2.27, 2.08-1.60 (11H, 3m) .

[1S,9S(2.RS,3S) ] N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dioxo-9- (4-hydroxy-3,5-dιmethylbenzoyl) amino- 1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazιno[l,2-a] [1 ,2]dιazepιne-1-carboxamide (213w) , was isolated as a mixture of diastereoisomers (65/35) as a white solid (0.9g, 65%) : mp. 110-115°C (decomp.) ; IR (KBr) 3409, 2945, 1792, 1658, 1606, 1534, 1486, 1420, 1330, 1276, 1209, 1122, 980, 960; ^∑ H NMR (CDC1 ₃ ) δ 7.66 (0.35H, d, J = 6.9), 7.46-7.20 (7H, m) , 6.93 (0.35H, d, J = 7.7) , 6.85 (0.65H, d, J = 7.6) , 6.73 (0.65H, d, J = 7.6), 5.96 (0.35H, bs) , 5.85 (0.65H, bs) , 5.56 (0.65H, d, J = 5.2), 5.28 (0.35H, bs) , 5.20- 4.98 (2H, m) , 4.96-4.40 (4H, ) , 3.28-2.55 (3H, ) , 2.53-2.32 (IH, m) , 2.23 (6H, 2s) , 2.03-1.40 (7H, m) . MS (ES ^~ ) 577, (ES ⁺ ) 579.

[IS, 9S(2RS,3S) ] 9- [4- (Acetylammo)benzoylam o] -N- (2- benzyloxy-5-oxo-tetrahydrofuran-3-yl) -6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazino[1 ,2-a] [1 ,2]dιazepιne-l-carboxιmιde (213x) , was isolated as a colourless poweder (691mg, 861) : mp . 150-70°C; [α] _D ²² -10.1° (c 0.10, Me ₂ CO) ; IR (KBr) 3313, 1791, 1679, 1654, 1597, 1528, 1501, 1457, 1407, 1371, 1315, 1255, 1184, 1122, 933; ¹ H NMR (dfa-DMSO) δ 8.75 (IH, α\ 8.47 (IH, d) , 7.84 (2H, d) , 7.66 (2H, d) , 7.35 (5H, ιr. , 5.43 (IH, s) , 5.06-5.00 (IH, m) , 4.90-4.64 (3H, m) , 4.46-4.26 (2H, m) , 3.16-2.86 (2H, m) , 2.45-2.05 (5H, IT , 2.07 (3H, s) , 2.00-1.84 (2H, m) , 1.68-1.56 (2H, n) ; Anal. Calcd for C ₃₀ H ₃₃ N ₅ O ₈ ^« H ₂ 0: C, 59.11; H, 5A9; N,

11.49. Found: C, 59.38; H, 5.66; N, 11.31; M.S. (ES ^" 614 (100%) , 592 (M ⁺ +1.66) .

[3S(1S,9S) ] 3-[6,10-Dioxo-9-(3,4- methylenedioxybenzoylamino) -1,2,3,4,7,8,9, 10-octahydro- 6H-pyridazino[1,2-a] [1,2]diazepine-l-carboxamido] -4- oxobutanoic acid (415) , was prepared by a similar method as compound 214e to afford a white solid (297mg, 84%) : mp. 158-62°C; [α] _D ²⁴ -109.5° (c 0.1, CH ₃ OH) ; IR (KBr) 3700-2500 (br) , 1783,1659, 1650, 1538, 1486, 1439, 1257, 1037; ^ NMR (CD ₃ OD) δ 7.48 (IH, dd) , 7.35

(IH, d) , 6.88 (IH, d) , 6.03 (2H, s), 5.25-5.15 (IH, m, , 5.02-4.90 (IH, m) , 4.63-4.45 (2H, m) , 4.30-4.20 (IH, m) , 3.57-3.30 (IH, m) , 3.20-3.05 (IH, m) , 2.75-2.10 (5H, m) , 2.10-1.60 (4H, ) . MS (ES ⁺ ) 488 (M+, 251), 487 (M ^* - 1, 100), 443 (8), 387 (3), 315 (5) , 150 (6), 127 (5) , 113 (8) . Accurate mass calculated for ^C ₂ 2 ^H 25 ^N ₄ ° ₉ (MH ⁺ ) : 489.1621. Found 489.1648.

[3S(1S,9S) ] 3-{9-[ (3-Acetamido)benzamido] -6,10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1,2]dιazepιne-l-carboxamιdo}-4- oxobutanoic acid (450), was prepared by a similar method as compound 214e to afford a white foamy solid (378mg, 94%) : mp. 175-9°C; [α] _D ²² -91.7° ( _c 0.1, CH ₃ OH; ; IR (KBr) 3700-2500 (br), 3319, 1659, 1590, 1553, 142 ^-7 , 1260; ¹ H NMR (CD ₃ OD) δ 8.01 (IH, d) , 7.74 (IH, dd) , 7.5o (IH, d) , 7.45-7.35 (IH, m) , 5.25-5.15 (IH, m) , 5.05- 4.90 (IH, m) , 4.60-4.45 (2H, m) , 4.30-4.20 (IH, ) , 3.55-3.30 (IH, m) , 3.20-3.00 (IH, m) , 2.75-2.20 (5H, m) , 2.14 (3H, s), 2.20-1.60 (4H) . Anal. Calcd for ^C ₂₃ ^H ₂₇ ^N ₅ ° ₈ * ¹ - ^5H ₂ ^{0: c} > 52.27; H, 5.72; N, 13.25. Found:

C, 52.31; H, 5.86; N, 12.85. MS (ES ) 501 (M+, 26% 500 (M ⁺ - 1, 100), 328 (2), 149 (3), 113 (3) .

[3S(1S,9S) ] 3- [4- (Hydroxybenzoyl)ammo-6, 10-dιoxo—

1 ,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1 ,2]diazepιne-l-carboxamιdo] -4- oxobutanoic acid (456) , was prepared by a similar method as compound 214e to afford a white solid (0.73g, 72%) : mp. >260°C; _α] _D ²⁰ -66° (c 0.34, MeOH) ; IR (KBr) 3401, 2946, 1651, 1609, 1584, 1506, 1426, 1277, 1257, 1177; ^X H NMR (D ₆ -DMSO) δ 10.2 (IH, very bs), 9.17 (IH, bs), 8.65 (IH, s), 8.37 (IH, d, J 5.4), 7.81 (2H, d, J = 8.2), 6.87 (2H, d, J = 8.4), 5.24 (IH, m) , 4.92-4.86

(IH, m) , 4.41-4.32 (2H, m) , 3.68-3.21 (3H, m) , 3.12- 2.79 (IH, m) , 2.50-1.42 (7H, m) . MS (ES ⁺ ) 459.

[3S(1S,9S)] 3-[6,10-Dιoxo-9-(ιndol-2-oylamιno)- 1,2,3,4 ,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]dιazepme-1-carboxamιdo] -4- oxobutanoic acid (475) , was prepared by a similar method to that described for compound 214e to afford a white solid (79%) : mp. 150°C (softens) 190-210°C;

[α] _D ²³ -97.5° (c 0.1, CH ₃ 0H) ; IR (KBr) 3319, 1658, 1650, 1549, 1421, 1256; ¹ H NMR (CD ₃ OD) δ7.61 (IH, d, J = 8.0, , 7.43 (IH, d, J = 8.1), 7.21 (2H, m) , 7.05 (IH, m>, 5.21 (IH, m) , 5.07-4.77 (IH, m) , 4.54 (2H, ) , 4.23 (IH, rr, , 3.46 (IH, m) , 3.14 (IH, πυ , 2.66-1.71 (9H, m) . MS (EiX , m/z) , 482 (M ⁺ - 1, 100 _o ) .

[3S(1S, 9S) ] 3- [6 , 10-Dιoxo-l ,2,3,4,7,8 , 9, 10-octahydro-9- (2-toluoylammo) -6H-pyπdazιno [1,2-a] [1 ,2 ] diazepine-l- carboxamido] -4-oxobutanoιc acid (404), was prepared by

a similar method as compound 214e to afford a white solid (0.79g, 86%) : mp. 156-9°C; [α] _D ²⁵ -119.7° (c 0.1, CH ₃ OH) ; IR (KBr) 3700-2500 (br), 3387, 3309, 2956, 1785, 1659, 1650, 1535, 1422, 1278; H NMR (CD ₃ OD) δ 7.46-7.15 (4H, m) , 5.25-5.15 (IH, m) , 5.02-4.90 (IH, m) , 4.58-4.45 (2H, m) , 4.30-4.20 (IH, m) , 3.55-3.30 (IH, m) , 3.20-3.05 (IH, m) , 2.80-2.20 (4H, m) , 2.41 (3H, s), 2.20-1.60 (5H, m) . MS (ES ⁺ ) 458 (M+, 27%) , 457 (M ⁺ - 1, 100), 413 (13) , 339 (8) , 285 (5) , 134 (6) , 127 (11) . Accurate mass calculated for C ₂ H ₂₇ N ₄ 0 ₇ (MH ⁺ ) : 459.1880. Found 459.1854.

[3S(1S,9S) ] 3-{6,10-Dioxo-l,2,3,4,7,8,9,10-octahydro-9- [4- (phenylacetamido)benzamido] -6H- pyrιdazino[l ,2-a] [1,2] diazepine-l-carboxamido}-4-oxobutanoic acid (486), was prepared by a similar method as compound 214e to afford a white solid (325mg, 89%) : mp. 165-9°C; [α] _D ²² -69.1° (c 0.1, CH ₃ 0H) ; IR (KBr) 3700-2500 (br), 3318, 1658, 1599, 1530, 1505, 1407, 1258; ^X H NMR (CD ₃ OD) δ 7.85 (2H, d) , 7.69 (2H, d) , 7.38-7.20 (5H, m) , 5.25-5.15 (IK, m; , 5.05-4.90 (IH, m) , 4.57-4.45 (2H, m) , 4.30-4.20 (IH, m) , 3.70 (2H, s), 3.55-3.30 (IH, m) , 3.20-3.00 (IH, m) , 2.75-1.60 (9H, m) . Anal. Calcd for C ₂₉ H ₃₁ N ₅ 0 ₈ • 1.5H ₂ 0 : C, 57.61; H, 5.67; N, 11.58. Found: C, 57.81; H, 5.74; N, 11.47. MS (ES ⁺ ) 577 (M+, 33 ), 576 (M ⁺ - 1, I O C "' , 502 (2) .

[3S(1S,9S) ] 3-{6,10-Dιoxo-9-[4-(3-methylbutan-l- oylamino)benzamido] -1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1 ,2]dιazepιne-l-carboxamιdo} -4- oxobutanoic acid (487) , was prepared by a similar

method as compound 214e to afford a white foamy solid (335mg, 93%) : mp. 176-80°C; [α] _D ²² -88.0° (cO.l, CH ₃ OH) ; IR (KBr) 3700-2500 (br), 3321, 2960, 1781, 1660, 1597, 1529, 1407, 1258, 1187; ¹ H NMR (CD ₃ OD) δ 7.86 (2H, di, 7.69 (2H, d) , 5.25-5.15 (IH, m) , 5.05-4.90 (IH, m) , 4.60-4.45 (2H, m) , 4.30-4.20 (IH, m) , 3.57-3.30 (IH, m) , 3.20-3.00 (IH, m) , 2.75-1.60 (12H, m) , 1.00 (6H, d) . Anal. Calcd for C ₂₆ H ₃₃ N ₅ 0 ₈ «H ₂ 0: C, 55.61; H, 6.28; N, 12.45. Found: C, 56.00; H, 6.37; N, 12.15. MS (ES ⁺ ) 543 (M+, 31%), 542 (M ⁺ - 1, 100), 498 (2), 468 (3) .

[3S(1S,9S) ] 3- [6, 10-Dιoxo-l,2,3,4 ,7,8, 9,10-octahydro-9- (3,4,5-trimethoxybenzoylamino) -6H- pyridazino [1 ,2-a] [1,2]diazepine-l-carboxamido] -4- oxobutanoic acid (417) , was prepared by a similar method to that described for compound 214e to afford a white solid (0.63g, 92%) : mp. 145-155°C (approx., not sharp); [α] _D ²⁷ -114.6° (c 0.11, CH ₃ OH) ; IR (KBr) 3327, 1658, 1586, 1548, 1501, 1416, 1341, 1238, 1126; ^X H NMR (CD ₃ OD) δ7.22 (2H, s), 5.21 (IH, m) , 5.00 (IH, ) , 4.56, 4.49 (2H, 2m), 4.25 (IH, m) , 3.88 (6H, s) , 3.80 (3H, s), 3.55-3.43 (IH, m) , 3.12 (IH, m) , 2.71-1.70 (9H, m) . Anal. Calcd for C ₂₄ H ₃₀ N ₄ O ₁₀ «2H ₂ O: C, 50.52; H, 6.01; N, 9.82. Found: C, 50.49; H, 6.05; N, 9.68. MS (ES ⁺ , m/z) 533 (M ⁺ - 1, 100?) .

[3S(1S, 9S) ] 3- [6, 10-Dioxo-9- (naphth-1-oylammo) - 1,2,3,4,7,8,9,10-octahydro-6H- pyridazino [1,2-a] [1 ,2]dιazepme-l-carboxamido] -4- oxobutanoic acid (408), was prepared by a similar method to that described for compound 214e to afforα a

white solid (73%) : mp. 157-165°C (not sharp) ; [α] _D ^" - 140.5° (c 0.1, CH ₃ 0H) ; IR (KBr) 3325, 1658, 1531, 1420, 1278, 1257; ² H MR (CD ₃ 0D) δ 8.33-8.28 (IH, ) , 8.01- 7.78 (2H, m) , 7.71 (IH, d, J = 6.0) , 7.59-7.52 (3H, m) , 5.27 (IH, m) , 5.12-5.03 (IH, m) , 4.55 (2H, m) , 4.25 (IH, m) , 3.64-3.43 (IH, m) , 3.24-3.12 (IH, m) , 2.80- 1.67 (9H, m) . Anal. Calcd for C ₂₅ H ₂₆ N ₄ 0 ₇ »2H ₂ 0: C, 56.60; H, 5.70; N, 10.56. Found: C, 56.70; H, 5.80; N, 10.33. MS (ES ⁺ , m/z), 493 (M ⁺ - 1, 100%) .

[3S(1S,9S)] 3-[6,10-Dιoxo-4-(hydroxy-3,5- dιmethylbenzoyl)amιno-l,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1,2]diazepιne-l-carboxamιdo] -4- oxobutanoic acid (214w) , was prepared by a similar method as compound 214e to afford 210mg (62%) of a white solid: mp. >260°C; [α] _D ² ° -93° (c 0.20, MeOH) ; IR (KBr) 3401, 2948, 1651, 1604, 1559, 1486, 1421, 1325, 1276, 1210; ¹ H NMR (D ₆ -DMSO) δ 9.39 (IH, bs) , 8.29 (IH, d, J = 5.9), 7.55 (2H, s), 6.64 (IH, d, J = 6.1), 5.79 (IH, s), 5.25-5.21 (IH, m) , 1.90-1.82 (IH, m) , 4.41- 3.69 (2H, m) , 3.47-3.20 (3H, m) , 2.97-2.91 (IH, ) , 2.23 (6H, s) , 2.25-1.60 (7H, m) .

[1S,9S(2 S,3S) ] N-(2-Ethoxy-5-oxotetrahydrofuran-3-yl) - 6, 10-dιoxo-9- (isoqumolin-l-oylammo) -1,2,3,4,7,8,9, 10-

octahydro-6-H-pyridazino[1,2-a] [1,2]dιazepιne-l- carboxamide (550q) , was synthesized via methods used to prepare 213e to afford 550q.

[1S,9S(2J?S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dιoxo-9- (ιsoquιnolιn-1-oylamιno) - 1,2,3,4,7,8,9, 10-octahydro-6-H- pyridazino[1,2-a] [1,2]dιazepιne-l-carboxamide (213y) , was synthesized via methods used to prepare 213e to afford 213y.

°O Ό-

[1S,9S(2S,3S) ] N- (2-Phenethoxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (ιsoqumolιn-1-oylammo) - 1,2,3,4 ,7,8,9,10-octahydro-6-H-pyrιdazmo[l ,2-a] [1,2] dιazepιne-1-carboxamide, (412a) was synthesizeα via methods used to prepare 550q usinq 513a-l to afford 412a.

[IS, 9S(2JR,3S) ] N- (2-Phenethoxy-5-oxotetrahydrof uran-3- yl) -6, 10-dιoxo-9- (ιsoqumolιn-1-oylamιno) - 1,2,3,4,7,8,9, 10-octahydro-6-H-pyrιdazιno [1,2-a] [1,2] dιazepιne-1 -carboxamide, (412b) was synthesized via

methods used to prepare 550q using 513a-2 to afford 412b.

[1S,5S(2S,3S ] N- (2-Cyclopentoxy-5-oxotetrahydrofuran- 3-yl) -6, 10-dιoxo-9- (ιsoquιnolιn-1-oylamιno) - 1,2,3,4,7,8,9, 10-octahydro-6-H- pyrιdazιno[l,2-a] [1 ,2]dιazepιne-l-carboxamide, (412c) was synthesized via methods used to prepare 550q using 513b-l to afford 412c.

[IS, 9S(2£,3S) ] N- (2-Cyclopentoxy-5-oxotetrahydrofuran- 3-yl) -6,10-dιoxo-9- (ιsoquιnolιn-1-oylammo) - 1,2,3,4,7,8,9, 10-octahydro-6-H- pyridazino[1 ,2-a] [1 ,2]dιazepme-l-carboxamide, (412d) was synthesized via methods used to prepare 550q using 513b-2 to afford 412d: ¹ H NMR (CDC1 ₃ ) δ 9.5 (IH, d) , 8.9 (IH, d) , 8.5 (IH, d) , 7.9-7.8 (2H, m) , 7.8-7.65

(2H, m) , 6.55 (IH, d) , 5.55 (IH, d) , 5.25-5.1 (2H, m) , 4.75-4.65 (IH, m) , 4.65-4.6 (IH, m) , 4.4-4.3 (IH, ) , 3.25-3.15 (IH, m) , 3.15-3.05 (IH, m) , 2.95-2.8 (2H, ir1 , 2.55-2.4 (2H, m) , 2.15-1.5 (14H, m) .

[lS,SSf2S,3S ] N-(2-Ethoxy-5-oxotetrahydrofuran-3-yl) - 6, 10-dιoxo-9- (ιsoquιnol n-1-oγla ιno) -1,2,3,4,7,8,9,10- octahydro-6-H-pyrιdazιno [1 , 2-a] [1,2] dιazepιne-1- carboxamide, (412e) was synthesized via methoαs used to prepare 550q using 513f-l to afford 412e.

[1S,9S(2R,3S) ] N- (2-Ethoxy-5-oxotetrahydrofuran-3-yl ) - 6, 10-dιoxo-9- (isoqumolin-l-oylammo) -1,2,3,4,7,8,9,10- octahydro-6-H-pyπdazmo[l ,2-a] [1,2] dιazepme-1-

carboxamide, (412f) was synthesized via methods used to prepare 550q using 513f-2 to afford 412f.

Compounds 410 and 412 were prepared via methods used to prepare 605 from 604.

502y, 502z 410, 412

[3S(1S,9S) ] 3-[ (6,10-Dioxo-l,2,3,4,7,8,9,10-octahydro- 6H-pyridazino[1,2-a] [1,2]diazepine-9- (thιophene-3-yl- carbonylamino) -1-carboxamido] -4-oxobutanoic acid (410), was purified by flash chromatography (5-251 methanol m o chloromethane) to give 296mg (94 ) of a colourless solid: mp. 90-200°C; IR (KBr) 3338, 3096, 2950, 1787, 1 26, 1657, 1546, 1420, 1279, 1258, 1125, 1092, 984,

933; ¹ H NMR (CD ₃ OD) 58.41 (IH, d) , 8.13 (IH, d) , 7.54- 7.41 (3H, m) , 7.20 (IH, d) , 5.19-5.11 (IH, m) , 4.54- 4.30 (IH, m) , 3.27 (IH, m) , 3.18-3.03 (IH, m) , 2.81- 2.64 (2H, m) , 2.56-1.59 (7H, m) . Anal. Calcd for C ₁₉ H ₂₂ N ₄ 0 ₇ S'2.5H ₂ 0: C, 46.05; H, 5.49; N, 11.31. Found: C, 46.36; H, 5.25; N, 11.10. MS (ES ⁺ ) 449 (M - 1, 80%) , 113 (100) . Accurate mass calculated for C _ιg H ₂₃ N ₄ 0 ₇ S (MH ⁺ ) : 451.1287. Found: 451.1295.

[3S(1S,9S) ] 3- [6, 10-Dioxo-9-(isoquinolin-1-oylamino) - 1,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1 ,2]dιazepιne-l-carboxamιdo] -4- oxobutanoic acid (412) was prepared by a similar method to that described for compound 605 to afford a white glassy solid (69%) : mp. 138-141°C; [α] _D ²³ -105.5° (c 0.5, CH ₂ C1 ₂ ); IR (KBr) 3375, 1787, 1659, 1515, 1421,

1278, 1256; ¹ H NMR (CDC1 ₃ ) δ 9.32 (IH, m) , 8.79 (IH, m) , 8.47 (IH, m) , 7.86-7.64 (4H, m) , 5.31, 5.18, 4.59, 4.3 ^" ? (4 or 5H, m) , 3.55-2.76, 2.49-2.39, 2.05, 1.65 (11H, 4m) . Anal. Calcd for C ₂₄ H ₂₅ N ₅ 0 ₇ •1.5H ₂ 0: C, 55.17; H, 5.40; N, 13.40. Found: C, 54.87; H, 5.22; N, 13.15. MS (ES ⁺ , m/z) 494 (M ⁺ - 1, 100%) .

[3S(1S,9S)] t-Butyl 3- [6, 10-dιoxo-l ,2,3,4 ,7 ,8, 9, 10- octahydro-9- (thιophene-3-yl) -6H- pyπdazmo[1 ,2-a] [1,2]dιazepιne-carbonylamιno) -1- carboxamido]-4-oxobutanoate semicarbazone (502y) , was synthesized via methods used to prepare 604 from 603 to 3 afford a pale cream powder: mp. 120-180 C; [α] _D

109° (c 0.18, CH ₂ C1 ₂ ) ; IR (KBr) 3478, 3327, 1670, 1582, 1543, 1421, 1279, 1257, 1155; ^X H NMR (CDC1 ₃ , CD ₃ OD) δ 8.04 (IH, m) , 7.49 (IH, m) , 7.38 (IH, m) , 7.17 (IK, m) ,

5.17-5.01 (2H, m) , 4.86 (IH, m) , 4.61-4.50 (IH, m) , 3.45-3.29 (2H, m) , 3.21-3.03 (IH, m) , 2.79-2.54 (3H, ) , 2.43-2.33 (IH, m) , 2.11-1.66 (5H, m) , 1.44 (9H, s! Anal. Calcd for C ₂₄ H ₃₃ N ₇ 0 ₇ S'H ₂ 0: C, 49.56; H, 6.07; N,

16.86; S, 5.51 Found: C, 49.51; H, 5.93; N, 16.31; S, 5.17. MS (ES ⁺ ) 586 (100%), 564 (M ⁺ + 1, 1.59) Accurate mass calculated for C ₂₄ H ₃₄ N ₇ 0 ₇ S (MH ) 564.2240. Found: 564.2267.

[3S(1S,9S>] t-Butyl 3- [6, 10-dιoxo-9- (ιsoquιnol -1- oylam o) -1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazιno[l ,2-a] [1,2]dιazepιne-l-carboxamιdo]-4- oxobutanoate semicarbazone (502z) , was prepared by a similar method to that described for compound 604 to afford a pale yellow solid (90%) : mp. 142-145°C; [ ] _D ²⁴ -136.5° (c 0.06, CH ₂ C1 ₂ ) ; ¹ H NMR (CDC1 ₃ ) δ 9. 1-9.46 ( IH, m) , 9.11 (IH, s), 8.83 (IH, d, J = 7.8) , 8.53 (IH, d, J = 5.5), 7.89-7.83 (2H, m) , 7.77-7.65 (2H, m) , 7.5o (IH, d, J = 7.2), 7.18 (IH, d, J = 2.7), 5.26-5.12 (2H, m) , 4.87 (IH, m) , 4.59 (IH, m) , 3.25-3.12 (2H, m) , 2.95- 2.76 (2H, m) , 2.59-2.38, 2.18-1.94, 1.70 (5H, 3m) , 1.44 (9H, s) .

10

[1S,9S(2S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (methylenedioxybenzoylamino) - 1,2,3,4,7,8,9,10-octahydro-6-H-pyrιdazιno[1,2-a] [1,2] dιazepιne-1-carboxamide, (415a) was synthesized via methods used to prepare 550q to afford 415a.

[1S,9S(2_RS,3S) ] N-(2-Ethoxy-5-oxotetrahydrofuran-3-yl) - 6,10-dιoxo-9- (methylenedioxy benzoylamino) - 1,2,3,4,7,8, 9,10-octahydro-6-H-pyπdazιno[l,2-a] [1,2] dιazepιne-1-carboxamιde, (415b) was synthesized via methods used to prepare 550q to afford 415b.

[IS,9S(2_R,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dιoxo-9- (methylenedioxy benzoylammo) - 1,2,3,4,7,8,9,10-octahydro-6-H-pyrιdazιno[1,2-a] [1,2] dιazepιne-1-carboxamιde, (415c) was synthesized via methods used to prepare 550q to afford 415c.

[1S,9S(2RS,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (3,5-dιmethyl-4-hydroxybenzoylamιno) - 1,2,3,4,7,8,9, 10-octahydro-6-H- pyridazino[1,2-a] [1,2]dιazepιne-l-carboxamide, (214w ") was synthesized via methods used to prepare 550q to afford 214w-l.

[IS, 9S (2R, 3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6,10-dιoxo-9- (3 ,5-dιmethyl-4-hydroxybenzoylamιno) ^■

1 , 2 , 3 , 4 , 7 , 8 , 9 , 10-octahydro-6-H- pyrιdazιno[l ,2-a] [1 ,2]diazepιne-1-carboxamide, (214w-2) was synthesized via methods used to prepare 550q to afford 214w-2.

[1S,9S(2S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (3,5-dιmethyl-4-hydroxybenzoylamιno) - 1,2,3,4 ,7,8,9,10-octahydro-6-H- pyπdazmo[1,2-a] [1,2]dιazepιne-l-carboxamide, (214w-3) was synthesized via methods used to prepare 550q to afford 214w-3.

[IS, 9S(2_R,3S) ] N- (2-Phenethoxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (3,5-dιmethyl-4-hydroxybenzoylamιno) - 1,2,3,4 ,7,8,9,10-octahydro-6-H- pyridaz o[1,2-a] [1 ,2]dιazepιne-l-carboxamιde, (214w-4) was synthesized via methods used to prepare 550q to afford 214 -4.

[1S,9S(2S,3S) ] N- (2-Phenethoxy-5-oxotetrahydrofuran-3- yl) -6,10-dιoxo-9- (3,5-dιmethyl-4-hydroxybenzoylammo) - l,2,3,4,7,8,9,10-octahydro-6-H- pyridazino[1,2-a] [1 ,2]dιazepιne-1-carboxamide, (214w-5) was synthesized via methods used to prepare 550q to afford 214w-5.

[IS, 9S(2i?,3S) ] N- (2-Cyclopentoxy-5-oxotetrahydrofuran- 3-yl) -6,10-dιoxo-9- (3,5-dιmethyl-4- hydroxybenzoylamino) -1,2,3,4,7,8,9, 10-octahydro-6-H- pyridazino[1 ,2-a] [1,2]dιazepιne-1-carboxamide, (214w-6) was synthesized via methods used to prepare 550q to afford 214w-6.

[IS, 9S(2S,3S) ] N- (2-Cyclopentoxy-5-oxotetrahydrofuran- 3-yl) -6,10-dιoxo-9-(3,5-dιmethyl-4- hydroxybenzoylamino) -1,2,3,4,7,8,9, 10-octahydro-6-H- pyridaz o [1 ,2-a] [1 ,2]dιazepιne-l -carboxamide, (214w-7) was synthesized via methods used to prepare 550q to afford 214w-7.

[lS,9S(2i?,3S) ] N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (ιsoqumolιn-1-oylamιno) - 1,2,3,4,7,8,9, 10-octahydro-6-H-pyπdazιno[l ,2-a] [1,2] diazepme-l- carboxamide, (412g) was synthesizeα via methods used to prepare 550q to afford 412g.

[1S,9S(2S,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3- yl) -6, 10-dιoxo-9- (ιsoquιnolιn-1-oylammo) - 1,2,3,4,7,8,9, 10-octahydro-6-H-pyπdazιno[l,2-a] [1 ,2J dιazepιne-1-carboxamιde, (412h) was synthesized via methods used to prepare 550q to afford 412h.

415 214w

[3S(1S,9S) ]3- (9- (4 ,5-Methylenedιoxybenzoyl) ammo-6, 10- dιoxo-1,2,3,4 ,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1 ,2]dιazepιne-1-carboxamιdo) -4- oxobutanoic acid (415) , was synthesized by the metnoα used to prepare 2002 from 2001 to afford 415.

[3S(1S, 9S) ]3- (9- (3,5-Dιchloro-4-hydroxybenzoyl)amino- 6, 10-dιoxo-l,2,3,4,7,8,9,10-octahydro-6H- pyπdazinofl ,2-a] [1,2]diazepme-l-carboxamido) -4- oxobutanoic acid (214w) , was synthesized by the method used to prepare 2002 from 2001 to afford 214w.

2100.C-O

[1S,9S(2RS,3S) ] 9-Benzoylamιno-6,10- dioxo—1 ,2,3,4,7,8,9,10-octahydro-N- (2-phenethyloxy-5- oxotetrahydrofuran-3-yl) -6H- pyπdazιno[l ,2-a] [1 ,2]dιazepιne-l-carboxamide (2100k),

5 was prepared by a similar method as compound 213e to afford a mixture of diastereoisomers (75/25) as a white solid (258mg, 83%) : mp. 101°C; [α] _D ²⁵ -96° (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3328, 2935, 2978, 1732, 1669, 1603, 1483, 1450, 1414, 1237, 1155, 1082, 989, 755; ¹ H NMR 0 (CDC1 ₃ ) δ 7.84-7.80 (2H, m) , 7.54-7.17 (8H, m) , ^ .06-6.99 (IH, m) , 6.25 (IH, d, J = 7.9H), 5.41 (0.75H, d, J = 5.4H), 5.31 (0.25H, bs), 5.23-5.09 (IH, m) , 4.93-4.87 (IH, m) , 4.68-4.51 (2H, ) , 4.40-4.33 (0.25H, m) , 4.24- 4.14 (0.75H, m) , 3.95-3.70 (IH, m) , 3.30-3.13 (IH, m) , 5 3.14-2.78 (5H, ) , 2.47-2.21 (2H, m) , 2.05-1.50 (5H, m) . Anal. Calcd for C ₂₉ H ₃₂ N ₄ 0 ₇ •0.5H ₂ 0: C, 62.47; H, 5.97; N, 10.05. Found: C, 62.17; H, 5.83; N, 9.97. MS (ΞS ⁺ ) 549.

[IS, 9S(2RS,3S) ] 9-Benzamιdo-N- (2-cyclopentyloxy-5-oxo- C tetrahydrofuran-3-yl) -6, 10-dιoxo-l ,2 ,3,4 ,7,8, 9, 10- octahydro-6H-pyrιdazιno[1,2-a] [1 ,2]dιazepme-l- carboxamide (21001), was prepared by a similar method as 213e, (74°o) as a colourless solid: mp. 172-80°C; [α] _D ²³ -91.5° (c 0.1, CH ₂ C1 ₂ ); IR (KBr) 3290, 1792, 5 1677, 1657, 1642, 1544, 1425, 1280, 1259, 1124, 9 ; KM? (CDCl ₃ ) δ7.80 (2H, m) , 7.46 (3.5H, m) , 7.00 (IK, d, J = 6.7), 6.48 (0.5H, d, J = 7.9), 5.55 (0.5H, d, J - 5.3) , 5.19 (2H, s + m) , 4.93 (0.5H, m) , 4.62 (1.5H, rr) , 4.34 (IH, m) , 4.18 (0.5H, m) , 3.28-2.70 (4H, m, , 2.49- 0 2.29 (2H, m) , 205-1.48 (15H, m) .

[1S,9S(2J?,3S) ] 9-Benzamido-6,10-dιoxo- -[2- (2- mdanyloxy) -5-oxo-tetrahydrofuran-3-yl] - 1,2,3,4,7,8,9, 10-octahydro-6H- pyrιdazino[l,2-a] [1,2]dιazepιne-l-carboxamide (2100m), was prepared by a similar method as 213e, (76?,) as a colourless solid: mp. ~140°C, remelts 187-9°C; [α]n" 96.9° (c 0.11, CH ₂ C1 ₂ ); IR (KBr) 3507, 3308, 3251, 1772, 1660, 1641, 1566, 1545, 1457, 1424, 1346, 1326, 1302, 1275, 1258, 1136, 1085, 1018, 981; ^λ NMR (CDC1 ₃ ) δ 7.78 (2H, m) , 7.53 (3H, m) , 7.19 (4H, m) , 6.91 (IH, d, J = 7.4), 6.27 (IH, d, J = 7.6), 5.66 (IH, d, J = 5.3), 5.10 (IH, ) , 4.96 (IH, m) , 4.75 (2H, m) , 4.52 (IH, m) , 3.08 (3H, ) , 3.03-2.71 (5H, m) , 2.48-2.31 (2H, ) , 1.90-1.40 (4H, m) , 1.22 (IH, m) .

[1S,9S(2S,3S) ] 9-Benzoylamιno-N- (2-benzyloxy-5- oxotetrahydrofuran-3-γl) -6,10-dιoxo—1 ,2,3,4,7,8,9, 10- octahydro-6H-pyridaz o[1,2-a] [1,2]dιazepme-l- carboxamide (2100n) , was prepared by a similar method to that described for compound 213e to afford a white glassy solid (76?) : mp. 112-5°C; [α] _D ²³ -62.0° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3305, 1789, 1677, 1665, 1535, 1422, 1279, 1256, 1119, 942, 700; ¹ ti NMR (CDCl ₃ ) δ7.84 (2H, m) , 7.58-7.27 (9H, m) , 6.99 (IH, d, J - 7.8), 5.23 (IH, s), 5.23-5.11 (IH, m) , 4.89 (IH, ) , 4.76 (IH, d, J = 11.3) , 4.55 (IH, d, J = 11.4), 4.5B-4.43 (2H, m) , 3.3υ- 2.96, 2.81-2.69, 2.46-2.37, 2.16-1.66 (10H, 4m), 2.27 CH, d, J = 17.8) . Anal. Calcd for C ₂₈ H ₃₀ N ₄ O ₇ •0.5H ₂ 0: C, 61.87; H, 5.75; N, 10.32. Found: C, 61.88; H, 5.70; N, 10.33. MS (ES ⁺ , m/z) 535 (M ⁺ + 1, 100' ; .

[1S,9S(2J?,3S) ] 9-Benzoylamιno-N- (2-benzyloxy-5- oxotetrahydrofuran-3-yl) -6, 10-dιoxo—1 ,2,3,4,7,8,9,10- octahydro-6H-pyridazino[1,2-a] [1,2]dιazepine-l- carboxamide (2100o) , (containing about 7% of ( 2 S) ) , was prepared by a similar method to that described for compound 213e to afford a white glassy solid (81 ) : mp . 115-7°C; [α] _D ²³ -121.8° (c 0.11, CH ₂ C1 ₂ ) ; IR (KBr) 3326, 1792, 1659, 1535, 1421, 1278, 1257, 1124, 978; X NMR (CDCl ₃ ) δ7.82 (2H, m) , 7.58-7.24 (8H, ) , 6.90 (IH, d, J = 7.3), 6.49 (IH, d, J = 7.7), 5.57 (IH, d, J = 5.5), 5.11 (2H, m) , 4.91 (IH, d, J = 11.4), 4.57 (IH, d, J = 11.1), 4.81-4.68 (IH, m) , 4.65-4.54 (IH, ) , 3.18-2.71 2.52-2.30, 2.05-1.62 (11H, 3m) . Anal. Calcd for C ₂₈ H ₃ oN ₄ 0 ₇ O.5H ₂ 0: C, 61.87; H, 5.75; N, 10.32. Found: C, 61.70; H, 5.71; N, 10.15. MS (ES ⁺ , m/z) 535 (M ⁺ + 1, 94.3%) , 557 (100%) .

550n

[IS, 9S(2i?S,3S) ] 9- (3-Acetamιdo)benzoylamιno-6, 10-dιoxo- N- (2-ethoxy-5-oxo-tetrahydrofuran-3-yl) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazmo[1 ,2-a] [1 ,2]dιazepιne-l-carboxamide (550n) , was prepared by a similar method as compound 213e to

afford a mixture of diastereoisomers (65/35) as a tan powder (390mg, 28%) : mp. 139-145°C; [α] _D ²³ -104° (c 0.2, MeOH) ; IR (KBr) 3318, 2405, 2369, 1792, 1660, 1591, 1549, 1484, 1422, 1257, 1117; ^X H NMR (D ₆ -DMSO) δ 10.1 (IH, s), 8.80 (0.65H, d, J = 6.6), 8.58 (0.35H, d, J = 6.6) , 8.59 (IH, d, J = 7.0), 8.06 (IH, bs) , 7.83- 7.79 (IH, m) , 7.61-7.57 (IH, m) , 7.47-7.39 (IH, m) , 5.61 (0.35H, d, J = 5.0), 5.37 (0.65H, bs) , 5.17-5.14 (0.35H, m) , 5.08-5.06 (0.65H, m) , 4.92-4.86 (IH, m) , 4.67-4.61 (0.35H, m) , 4.47-4.41 (0.65H, m) , 4.28-4.11 (IH, 2m), 3.80-3.59 (2H, m) , 3.23-2.75 (3H, m) , 2.61- 1.48 (7H, m) , 2.10 (3H, s), 1.25 and 1.17 (3H, 2t, J = 5.8) . MS (ES ⁺ ) 528.

550o

[IS, 9S(2RS,3S) ] 6, 10-Dioxo-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -9- (2-indoloylamino) -

1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1 ,2]diazepine-l-carboxamide (550o) , was synthesized by a similar method as compound 213e tc afford a colourless solid (1.071g, 80, ) : mp . 155-70°C; [α] _D ²² -75.8° (c 0.26, CH ₂ C1 ₂ ) ; IR (KBr) 3314, 2941, 1791, 1658, 1545, 1420, 1341, 1312, 1252, 1181, lllδ, 939, 749; Ii NMR (CDCl ₃ ) δ9.45 (0.5H, s), 9.34 '1.5H, s) , 7.68-7.62 (IH, m) , 7.49-7.39 (2H, m) , 7.33-7.26

(IH, m) , 7.18-7.03 (3H, m) , 5.49 (0.5H, d) , 5.30 (0.5 H, s) , 5.26-5.13 (IH, m) , 4.90-4.83 (0.5H, m) , 4.76- 4.49 (IH, m) , 4.42-4.35 (0.5H, m) , 3.97-3.74 (IH, m) , 3.72-3.53 (IH, m) , 3.35-2.64 (4H, m) , 2.50-2.37 (IK, m) , 2.20-1.82 (5H, m) , 1.69-1.50 (2H, m) , 1.30-1.19

(3H, m) .

550p

[1S,9S(2KS,3S) ] 6,10-Dιoxo-N-(2-ethoxy-5- oxotetrahydrofuran-3-yl) -9- (4-hydroxybenzoyl)amino- 1,2,3,4 ,7,8,9,10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2]diazepine-l-carboxamιde (550p) , was prepared by a similar method as compound 213e to afford a mixture of diastereoisomers as a white foam (620mg, 47%) : [α] _D ²⁴ -75° (c 0.16, CH ₂ C1 ₂ ) ; IR (KBr) 3401, 2937, 1791, 1657, 1609, 1539, 1505, 1423, 1277,

1177, 1118; ^ NMR (CDC1 ₃ ) δ 8.07-8.05 (IH, ml , 7.67 (2H, d, J = 7.9) , 7.38-7.29 (2H, m) , 6.80 (2H, d, J = 8.5), 5.49 (0.5H, d, J = 4.6), 5.23 (0.5H, bs), 5.24-5.20 (IH, m) , 5.12-5.08 (IH, m) , 4.68-4.29 (2H, ) , 3.92- 3.45 (3H, m) , 3.32-2.30 (2H, m) , 2.80-1.56 (11H, m) , 1.21 (3H, t, J = 7. OH) .

503a-e

286, 505b-e

[3S,4R(1S,9S) ] t-Butyl 3- (6, 10-dιoxo-9- methanesulphonylamιno-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1,2-a] [1,2]dιazepιne-1-carboxamιdo) -4- hydroxy-5- (1-naphthoyloxy)pentanoate (503a), was prepared from 212b and i 3 S, 4R) t-butyl (N- allyloxycarbonyl) -3-ammo-4-hydroxy-5- ( 1- naphthoyloxy) pentanoate by the method described for (213e) to afford 533mg (81%) of an off-white foam: [ ] _D ²² -81.4° (c 0.5, CH ₂ C1 ₂ ) ; IR(KBr) 3342, 2976, r?19,

1664, 1328, 1278, 1246, 1153, 1137. ¹ H NMR (CDC1 ₃ ) δ 8.86 (IH, d, J = 8.4) , 8.21 (IH, dd, J = 1.3, 7.3) , 8.03 (IH, d, J = 8.1) , 7.88 (IH, d, J = 8.6) , 7.66-7.45 (3H, m) , 7.23 (IH, d, J = 8.6), 5.96 (IH, d, J = 9.2) , 5.30 (IH, m) , 4.59-4.33 (5H, m) , 4.24 (IH, m) , 3.96 (IH, brd) , 3.29 (IH, m) , 2.95 (IH, m) , 2.93 (3H, s) , 2.69-2.50 (3H, m) , 2.36 (IH, m) , 1.96 (4H, ) , 1.62 (IH, m) , 1.41 (9H, s) . Anal. Calcd for

^C 31 ^H 40 ^N 4 ^O 10 ^S, °- ^25H 2 ^{O : C} ' 55.97; H, 6.14; N, 8.42. Found: C, 55.90; H, 6.11; N, 8.23. M.S. (ES ^T ) 683 (M+Na, 100°.) , 661 (M+1,39) , 605 (78) .

[3S(1S,9S)] t-Butyl 3- (6, 10-dιoxo-9- methanesulphonylamιno-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyπdazino[1,2-a] [1 ,2]dιazepιne-l-carboxamιdo) -5- (1- naphthoyloxy) -4-oxopentanoate (504a), was synthesized from 503a via method used to prepare 216e from 215e tc afford 446mg (911) of a colourless foam: 21

_L α -111.6'

(c 0.5, CH ₂ C1 ₂ ) ; IR (KBr) 3319, 2978, 2936, 1723, 1670, 1413, 1370, 1329, 1278, 1246, 1153. ^λ NMR (CDC1 ₃ ) δ 8.87 (IH, d, J = 8.9), 8.29 (IH, d, J = 7.2) , 8.06 (IH, d, J = 8.3), 7.90 (IH, d, J = 8.2) , 7.66-7.48 (3H, m) , 7.37 (IH, d, J = 8.1), 5.61 (IH, d, J = 9.0) , 5.31 (IH, m) , 5.22 (IH, AB, J = 16.9), 5.09 (IH, AB, J = 16.92) , 4.99 (IH, m) , 4.65-4.43 (2H, m) , 3.28 (IH, m) , 2.96 (3H, s), 2.86 (2H, m) , 2.59 (IH, m) 2.38 (IH, dd, J = 6.8, 13.2), 2.21-1.70 (6H, m) , 1.45 (9H, s) . Anal. Calcd for C ₃₁ H ₃₈ N ₄ O ₁₀ S• 0.25H ₂ 0. C, 56.14; H, 5.85; N, 8.45. Found: C, 56.11; H, 5.83; N, 8.29. M.S. (ES ⁺ ) 657 (M-l, 100%) .

[3S(1S,9S) ] 3- (6, 10-Dioxo-9-methanesulphonylamino- 1,2,3,4 ,7,8,9,10-octahydro-6H- pyridazino[1 ,2-a] [1,2]diazepine-l-carboxamido) -5- (1- naphthoyloxy) -4-oxopentanoic acid (286), was prepared from 504a by the method described for 217 to afford 356mg (93%) of a white powder: mp 120-123°C; [α]n 23

121° (c 0.194, CH ₂ C1 ₂ ) ; IR (KBr) 3314, 2937, 1722, 1663, 1412, 1328, 1278, 1245, 1195, 1132. ¹ H NMR (d6-

DMSO) δl2.63 (IH, brs), 8.94 (IH, d, J = 7.4) , 8.78 (IH, d, J = 8.6), 8.26 (2H, m) , 8.11 (IH, d, J = 8.0), 7.77- 7.62 (4H, m) , 5.28 (2H, s), 5.21 (IH, m) , 4.82 (IH, m) , 4.44-4.29 (2H, m) , 3.31 (IH, m) , 2.98 (3H, s) , 2.98- 2.86 (2H, m) , 2.72 (IH, dd, J = 7.3, 16.9) , 2.40 (IH, m) , 2.24-1.84 (4H, m) , 1.69 (2H, m! . Anal. Calcd for C ₂₇ H ₃₀ N ₄ O ₁₀ S ^« H ₂ O : C, 52.25; H, 5.20; N, 9.03. Found: C, 52.11; H, 4.97; N, 8.89. M.S. (ES ⁺ ) 601 (M-l, 1001) .

[3S,4RS(1S,9S) ] t-Butyl 3- [6, 10-dιoxo-l ,2 , 3,4 , 7 , 8, 9, 10- octahydro-6H-pyridazino[l ,2-a] [1 ,2]dιazepme-9-

(methanesulphonylammo) -1-carboxamιdo] -4-hydroxy-5- (5- methyl-3-phenylιsoxazoyloxy)pentanoate (503b) , was synthesized by a similar method as compound 213e, to afford an off-white powder (67Img, 88%) : mp . 90-120 C; IR (KBr) 3345, 2977, 1727, 1664, 1532, 1450, 1423,

1369, 1323, 1310, 1276, 1257, 1154, 1101, 990, 766; ¹ H NMR (CDC1 ₃ ) δ 7.61-7.55 (2H, m) , 7.51-7.42 (3H, m) , 6.86 (IH, d), 5.69 (IH, d) , 5.21 (IH, m) , 4.64-4.38 (2H, m) , 4.15-4.05 (3H, m) , 3.84 (IH, s) , 3.31-3.14 (2H, m) , 2.97-2.87 (IH, m) , 2.94 (3H, s), 2.76 (3H, s) , 2.64- 2.48 (3H, m) , 2.39-2.29 (IH, m) , 2.04-1.61 (5H, m) . Anal. Calcd for C ₃₁ H ₄₁ N ₅ 0 ₁₁ S'H ₂ 0: C, 52.46; H, 6.11; N, 9.87; S, 4.52. Found: C, 52.34; H, 5.92; N, 9.56; S, 4.44. MS (ES ⁺ ) 714 (47%), 692 (M ⁺ + 1, 84) , 636 (100) .

[3S(1S,9S)] t-Butyl 3- [6, 10-dιoxo-9-

(methanesulphonylamino) -1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1,2-a] [1,23dιazepme-l-carboxamιdo] -5- (5- methyl-3-phenylisoxazoyloxy) -4-oxopentanoate (504b) , was synthesized by a similar method as compound 216b to afford a colourless powder (60Img, 93%) : mp . 75-115°C; [α] _D ²³ -104° (c 0.26, CH ₂ C1 ₂ ) ; IR (KBr) 3324, 2977, 2935, 1730, 1670, 1525, 1452, 1422, 1369, 1317, 1276, 1256, 1222, 1155, 1107, 990, 766; ¹ H NMR (CDC1 ₃ ) δ 7.68- 7.61 (2H, m) , 7.47-7.38 (3H, m) , 7.32-7.24 QH, m> , 5.56 (IH, d) , 5.36-5.24 (IH, m) , 5.04 (IH, α^ , 4.88 (IH, d) , 4.86-4.77 (IH, m) , 4.64-4.39 (2H, ) , 3.32- 3.17 (IH, m) , 2.97-2.85 (IH, m) , 2.93 (3H, s) , 2.76 (3H, s) , 2.80-2.71 (IH, m) , 2.65-2.49 (IH, m) , 2.41- 2.30 (IH, m) , 2.12-1.61 (6H, m) , 1.4 ^" (9H, s) . Anal. Calcd for C ₃₁ H ₃₉ N ₅ 0 ₁₁ S ^« H ₂ 0: C, 52.61; ri, 5.84; N, 9.90; S, 4.53. Found: C, 52.94; H, 5.69; N, 9.^2; S, 4.51.

MS (ES ⁺ ) 712 (31%), 707 (100), 690 (M ⁺ + 1, 41) , 634

(55) .

[3S(1S, 9S) ] 3- [6, 10-Dιoxo—9- (methanesulphonylamino) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1 ,2]dιazepιne-l-carboxamιdo] -5- (5- methyl-3-phenylιsoxazoyloxy) -4-oxopentanoic acid (505b) , was synthesized by a similar method as compound 217 to afford a colourless powder (499mg, 96%) : mp . 95- 145°C; [α] _D ²² -137° (c 0.12, MeOH) ; IR (KBr) 3323, 2936, 1732, 1665, 1529, 1452, 1421, 1312, 1275, 1256,

1221, 1183, 1153, 1135, 1101, 990; ¹ H MR (CD ₃ 0D) δ 7.67- 7.56 (2H, m) , 7.49-7.38 (4H, m) , 5.23-5.12 (IH, m) , 5.02 (IH, d) , 4.79-4.73 (IH, m) , 4.52-4.34 (3H, m) , 3.48-3.25 (2H, m) , 3.03-2.85 (2H, m) , 2.94 (3H, s) , 2.74 (3H, s), 2.79-2.66 (IH, m) , 2.52-2.38 (IH, m) ,

2.29-2.14 (IH, m) , 2.04-1.70 (4H, m) . Anal. Calcd for C ₂₇ H ₃₁ N ₅ 0 ₁₁ S ^« H ₂ 0: C, 49.77; H, 5.18; N, 10.75; S, 4.92. Found: C, 49.83; H, 5.01; N, 10.27; S, 4.84. MS (ES ⁺ ) 746 (42%) , 632 (M - 1, 100) , 386 (60) . Accurate mass calculated for C ₂₇ H ₃₂ N ₅ 0 ₁₁ S (MH ⁺ ) : 634.1819. Found: 634.1807.

[3S,4RS(1S,9S) ] t-Butyl 3- [6, 10-dιoxo-9- (methanesulphonylamino) -1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazmo [1,2-a] [1 ,2]diazepme-1-carboxamido] -4- hydroxy-5- (2-phenoxybenzoyloxy)pentanoate (503c), wa^ synthesized by a similar method as compound 213e to afford a colourless solid (446mg, 84 j : IR (KBr) 334-, 2976, 2935, 1727, 1664, 1603, 1535, 1483, 1451, 1416, 1395, 1369, 1328, 1297, 1277, 1237, 1155, 1135, 1070, 990, 755; ^X H NMR (CDC1 ₃ ) δ 7.98- .89 (IH, m) , ^.55-7.4o

(IH, m) , 7.39-7.18 (3H, m) , 7.14-7.07 (IH, m) , 7.00- 6.90 (3H, m) , 6.75 (IH, d) , 5.57-5.50 (IH, m) , 5.21- 5.09 (IH, m) , 4.64-4.42 (2H, m) , 4.36-4.12 (3H, m) , 3.95-3.87 (IH, m) , 3.39-3.18 (IH, m) , 3.00-2.82 (IH, m) , 2.95 (3H, s), 2.69-2.48 (3H, m) , 2.42-2.28 (IH, m) , 2.07-1.62 (6H, m) , 1.42 (9H, s) . Anal. Calcd for C ₃₃ H ₄₂ N ₄ 0 ₁₁ S-H ₂ 0: C, 54.99; H, 6.15; N, 7.77; S, 4.45. Found: C, 54.95; H, 5.95; N, 7.34; S, 4.20. MS (ES ⁺ ) 725 (26%) , 720 (47), 703 (M ⁺ + 1, 34) , 433 (100) , 403 (89) .

[3S(1S, 9S) ] t-Butyl 3- [6, 10-dioxo-9-

(methanesulphonylamino) -1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-l-carboxamido] - -oxo-5- (2-phenoxybenzoyloxy) pentanoate (504c) , was synthesized by a similar method as compound 216e to

22 afford a colourless powder: mp . 85-100°C; [αJ _D -91.3°

(c 0.52, CH ₂ C1 ₂ ) ; IR (KBr) 3328, 2978, 2935, 1732,

1669, 1603, 1524, 1483, 1450, 1396, 1369, 1296, 1276,

1237, 1155, 1132, 1082, 989, 755; ^λ H NMR (CDC1 ₃ ) δ 8.03- 7.98 (IH, m) , 7.52-7.44 (IH, ) , 7.37-7.07 (5H, m) , 7.01-6.92 (3H, m) , 5.52 (IH, d) , 5.28-5.20 (IH, m) , 5.06-4.84 (3H, m) , 4.64-4.39 (2H, m) , 3.32-3.14 (IH, m) , 2.99-2.88 (IH, m) , 2.94 (3H, s) , 2.65-2.45 (2H, mi , 2.39-2.29 (IH, m) , 2.12-1.58 (6H, m) , 1.40 (9H, s) . Anal. Calcd for C ₃₃ H ₄₀ N ₄ 0 ₁₁ S : C, 56.56; H, 5.75; N,

8.00; S, 4.58. Found: C, 56.37; H, 5.84; N, 7.69; S, 4.37. MS (ES ⁺ ) 723 (30%), 718 (100) , 701 (M ⁺ + 1, 23) , 645 (59) .

[3S(1S, 9S) ] 3- [6 , 10-Dioxo—9- (methanesulphonylam o) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1,2]dιazepine-l-carboxamιdo] -4-oxo-5-

(2-phenoxybenzoyloxy)pentanoic acid (505c), was synthesized by a similar method as compound 217 to afford a colourless foam (252mg, 72%) : mp. 90-125°C; [α] _D ²³ -133° (c 0.11, MeOH); IR (KBr) 3314, 2938, 1792, 1734, 1663, 1604, 1535, 1483, 1448, 1415, 1250, 1132, 756; ¹ H NMR (D ₆ -DMSO) δ 8.81-8.76 (IH, m) , 7.92 (IH, d) , 7.68-7.54 (2H, m) , 7.41-7.25 (3H, m) , 7.16- 6.91 (4H, m) , 5.13-4.98 (2H, ) , 4.72-4.63 (IH, m) , 4.37-4.21 (2H, m) , 2.92 (3H, s), 2.90-2.60 (3H, m) , 2.35-2.26 (IH, m) , 2.17-2.05 (2H, m) , 1.99-1.80 (2H, m) , 1.61-1.50 (IH, m) .Anal. Calcd for C ₂₉ H ₃₂ N ₄ O ₁₁ S'0.5H ₂ O: C, 53.29; H, 5.09; N, 8.57; S, 4.90. Found: C, 53.57; H, 5.18; N, 8.32; S, 4.75. MS (ES ⁺ ) 643 (M - 1, 100%) .

[3S,4JRS(1S,9S) ] t-Butyl 3- [6, 10-dιoxo-9-

(methanesulphonylam no)—1,2,3,4,7,8,9, 10-octahydro-6H- pyrιdazmo[l ,2-a] [1,2]dιazepιne-l-carboxamιdo] -4- hydroxy-5- (3-phenoxybenzoyloxy) pentanoate (503d), was synthesized by a similar method as compound 213e to afford a colourless solid (563mg, 90"; : IR (KBr) 3349, 2978, 2935, 1724, 1664, 1583, 1536, 1489, 1443, 1370, 1327, 1271, 1226, 1189, 1155, 1073, 990, 755; ^X H NMR

(CDCl ₃ ) δ7.77 (IH, d) , 7.67 (IH, m) , 7.45-7.10 (6H, m) , 7.00 (2H, d) , 5.93-5.80 (IH, ) , 5.36-5.30 (IH, m) , 4.63-4.24 (5H, m) , 4.15-4.09 (IH, m) , 3.37-3.22 (IH, m) , 2.98-2.74 (IH, m) , 2.94 (3H, s) , 2.70-2.47 (3H, ml , 2.40-2.30 (IH, m) , 2.15-1.60 (5H, ) , 1.42 (9H, s) . Anal. Calcd for C ₃₃ H ₄₂ N ₄ 0 ₁₁ S ^• H ₂ 0: C, 54.99; H, 6.15; N, 7.77; S, 4.45. Found: C, 54.60; H, 5.88; N, 7.49; S, 4.50. MS (ES ⁺ ) 725 (19%), 720 (91) , 703 (M ⁺ + 1, 74) , 647 (76) , 629 (100) , 433 (78) .

[3S(1S,9S)] t-Butyl 3- [6, 10-dioxo-9-

(methanesulphonylamino)—1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[l ,2-a] [1,2]diazepine-l-carboxamido] -4-oxo-5- (3-phenoxybenzoyloxy) pentanoate (504d) , was synthesized by a similar method as compound 216e to afford a colourless powder (466mg, 85%) : mp. 75-100°C; [ ] _D ²² -99.3° (c 0.60, CH ₂ C1 ₂ ) ; IR (KBr) 3335, 2978, 2937, 1728, 1669, 1584, 1525, 1487, 1444, 1416, 1369, 1328, 1272, 1227, 1188, 1155, 989, 754; ¹ H NMR (CDC1 ₃ ) δ 7.82-7.77 (IH, m) , 7.66-7.65 (IH, m) , 7.46-7.32 (4H, m) , 7.26-7.10 (2H, m) , 7.04-6.98 (2H, m) , 5.68 (IH, d) , 5.37-5.31 (IH, m) , 5.11 (IH, d) , 5.02-4.88 (2H, m) , 4.66-4.42 (2H, m) , 3.3—3.17 (IH, m) , 2.98-2.89 (IH, m) , 2.96 (3H, s), 2.84-2.78 (IH, m) , 2.72-2.47 (IH, m), 2.42-2.32 (IH, ) , 2.14-1.58 (6H, m) , 1.43 (9H. s) . Anal. Calcd for C ₃₃ H ₄₀ N ₄ O _ι:L S: C, 56.56; H, 5.75; N, 8.00. Found: C, 56.36; H, 5.82; N, 7.71. MS (ES ⁺ ) 723 (56%), 718 (90), 701 (M ⁺ + 1, 36), 645 (100) .

[3S(1S,9S) ] 3- [6,10-Dioxo—9- (methanesulphonylamino) - 1,2,3,4,7,8,9,10-octahydro-6H- pyπdazino[1,2-a] [1 ,2]diazepine-l-carboxamido] -4-oxo-5- (3-phenoxybenzoyloxy)pentanoic acid (505d) , was synthesized by a similar method as compound 217 to afford a colourless foam (353mg, 73'-) : mp. 80-115°C; [ ] _D ²³ -138° (c 0.11, MeOH) ; IR (KBr) 3327, 2937, 1728, 1666, 1584, 1529, 1487, 1443, 1413, 1328, 1273, 1227, 1189, 1155, 1134, 989, 754; ^λ E NMR (D ₆ -DMSO) δ 3.82 (IH, d) , 7.76-7.72 (IH, m) , 7.61-7.53 (2K, m) , .48- 7.32 (4H, m) , 7.24-7.17 (IH, m) , 7.11-7.06 (2H, m) , 5.14-5.06 (3H, ) , 4.73-4.64 (IH, m) , 4.38-4.24 (2H, ) , 2.92 (3H, s), 2.89-2.61 (3H, m) , 2.38-2.27 (IH, it; ,

2.19-2.06 (2H, m) , 2.02-1.79 (3H, m) , 1.63-1.52 (IH, m) . Anal. Calcd for C ₂₉ H ₃₂ N ₄ 0 ₁₁ S•0.5H ₂ 0: C, 53.29; H, 5.09; N, 8.57; S, 4.90. Found: C, 53.24; H, 5.14; N, 8.34; S, 4.86. MS (ES ⁺ ) 643 (M - 1, 100%), 385 (62) .

[3S,4R(1S,9S) ] t-Butyl 5- (3-chlorothιen-2-oyloxy) -3- (6, 10-dioxo—9-methanesulphonylamino-l,2,3,4,7,8,9,10- octahydro-6H-pyridazino[1,2-a] [1,2]diazepine-l- carboxamido) -4-hydroxypentanoate (503e) , was prepared by a similar method to that described for compound 213e, to afford an off white solid (70%) : mp. 100-

103°C; [α] _D ²⁵ -84.0° (c 0.05, CH ₂ C1 ₂ ); IR (KBr) 3459- 3359, 1722, 1664, 1514, 1368, 1328, 1278, 1247, 1155; X NMR (CDCl ₃ ) δ7.52 (IH, m) , 7.06-6.99 (2H, m) , 5.69 (IH, d, J - 9.0), 5.23 (IH, ) , 4.61-4.16 (6H, m; , 3.36-3.19 (IH, m) , 2.96 (3H, s), 2.67-2.49, 2.42-2.32, 2.06-1.89, 1.69 (10H, 4m), 1.43 (9H, s) .

[3S(1S,9S)] t-Butyl 5- (3-chlorothιen-2-oyloxy) -3- (6, 10- dioxo—9-methanesulphonylamino-1 ,2,3,4,7,8,9,10- octahydro-6H-pyridazino[1,2-a] [1,2]dιazepιne-1- carboxamido) -4-oxopentanoate (504e) , was prepared by a similar method to that described for compound 216e, tc afford a white solid (98%) : mp. 91-98°C; [α] _D ²⁵ - 112.5°C (c 0.06, CH ₂ C1 ₂ ); IR (KBr) 3453-3364, 1727, 1668, 1513, 1420, 1368, 1245, 1155; ! NMR (CDC1-, ) δ 7.54 (IH, d, J = 5.3), 7.18 (IH, d, J = 7.18 , 7.05 IH, α, J = 5.4), 5.42 (IH, d, J = 8.9), 5.25 (IH, ) , 5.02 (2H, m) , 4.96-4.87 (IH, m) , 4.65-4.42 (2H, m) , 3.34- 3.17 (IH, m) , 2.97-2.93 (IH, m) , 2.97 (3H, s) , 2.87- 2.78, 2. ⁷ 3-2.50, 2.38-2.32, 2.13-1.88, 1.69-1.6C (9H, 5m) , 1.44 (9H, s) .

[3S(1S, 9S) ] 5- (3-Chlorothιen-2-oyloxy) -3- (6, 10-dιoxo-9- methanesulphonylammo-1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepme-l-carboxamido) -4- oxopentanoic acid (505e) . A solution of 217 (0.33g, 0.51rruτιol) in dry dichloromethane (3ml) was cooled

(ice/water) with protection from moisture. Trifluoroacetic acid (2ml) was added with stirring. The solution was kept at room temperature for 2h after removal of the cooling bath, then concentrated in vacuo. The residue was evaporated three times from dichloromethane, triturated with diethyl ether and filtered. The solid was purified by flash chromatography (silica gel, 0-6 _c methanol m dichloromethane) to give the product as a white glass/ solid (0.296g, 98%) : mp 110-122°C; [ ] _O ²² -163.5° (c 0.1, CH ₃ OH) ; IR (KBr) 3514-3337, 1726, 1664, 1513, 1420, 1245, 1152, 1134, 990; ¹ H NMR (CD ₃ OD) δ7.79 (IH, d, J = 5.2) , 7.12 (IH, d, J = 5.2) , 5.20 (IH, m) , 5.02- 4.72 (2H, m, masked by H ₂ 0) , 4.59-4.32 (3H, ) , 3.48- 3.29, 3.08-2.75, 2.50-2.41, 2.31-2.22, 2.08-1.89, l .^. - 1.63 (11H, 6m) , 2.95 (3H, s) .

506a-c,g 507a-c,g

[3S(1S,9S)] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo- 1,2,3,4 ,7,8,9,10-oσtahydro-6H- pyπdazιno[l,2-a] [1,2]diazepine-l-carboxamido) -5-dιazo- -oxopentanoate (506a) . A solution of 212e (32Img, 0.929mmol) and (35) t-butyl 3-ammo-5-dιazo-4- oxopentanoate (198mg, 0.929mmol) in dichloromethane (3ml) was cooled to 0° and N,N-diisopropylethylamme (0.16ml, 1.86mmol) and [2- (lH-benzotπazol-1-yl) - 1, 1, 3, 3-tetramethyl-uronιum tetrafluoroborate (328mg, 1.02mmol) were added. The solution was stirred overnight at room temperature, diluted with ethyl acetate and washed with IM NaHS0 ₄ (x2 , aqueous NaHC0 ₃ (x2), brme, dried over magnesium sulphate and evaporated. Chromatography on silica gel elut g with ethyl acetate gave 506a (425mg, 85 ^" ) as a colourless foam: [α] _D ²³ -124.9° (c 0.2, CH ₂ Cl ₂ ) ; I? (KBr) 3332, 2111, 1728, 1658, 1532, 1421, 1392, 1367, 1279, 1256, 1155; ^ NMR (CDCl ₃ ) δ7.82 (2H, m) , 7.49 (3H, mj , 7.28 (IH, d, J = 9.3), 7.05 (IH, d, J = 7.3), 5.06 (IH, s > , 5.18 (2K, m) , 4.78 (IH, ) , 4.62 (IH, m>, 3.29 (IH, ml , 3.08-2.79 (3H, m) , 2.58 (IH, dd, J = 16.8, 5.6), 2.20-

1.85 (4H, m) , 1.70 (IH, m) , 1.45 (9H, s) . MS (ES ⁺ ) 539.58 (M - 1, 97.9%) 529.59 (100) .

[3S(1S,9S)] t-Butyl 5-dιazo-3- [6, 10-dιoxo- (9- methanesulphonamido) -1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1,2-a] [1 ,2]dιazepιne-l-carboxamido] -4- oxopentanoate (506b) , was prepared by a similar method as compound 506a. 74% as yellow orange solid: p. 75°C (decomp.) ; [α] _D ² ° -92.0° (c 0.036, CH ₂ Cl ₂ ) ; IR (KBr) 3438, 2904, 2113, 1728, 1669, 1523, 1368, 1328, 1155; ¹ H NMR (CDC1 ₃ ) δ7.48 (IH, d, J = 8.1), 5.83-5.68 (IH, m, ) , 5.55-5.50 (IH, m) , 5.43-5.14 (IH, m) , 4.83-4.45 (3H, m) , 3.40-3.19 (IH, m) , 2.98 (3H, s), 2.92-2.30 (4H, m) , 2.24-1.70 (6H, m) , 1.43 (9H, s) .

[3S(1S,9S>] t-Butyl 5-dιazo-3- [6,10-dιoxo- (9- methoxycarbonyl)amino-1 ,2,3,4,7,8,9,10-octahydro-6H- pyridaz o[1,2-a] [1 ,2]dιazepιne-l-carboxamido] -4- oxopentanoate (506c) , was prepared by a similar method as compound 506a to afford a pale yellow foam (405mg, 82%) : [α] _D ² ° -144° (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3339, 2978, 2958, 2112, 1728, 1674, 1530, 1459, 1415, 1367, 1274, 1252, 1154, 1063; ¹ H NMR (CDCl ₃ ) δ 7.23 (IH, d, J = 8.2), 5.51-5.31 (2H, m) , 5.21-5.16 (IH, m) , 4.77-4.55 (3H, m) , 3.68 (3H, s), 3.35-3.18 (IH, m) , 3.04-2.51 (4H, m) , 2.40-2.30 (IH, m) , 2.09-1.66 (5H, m) , 1.45 (9H, s) . MS (ES ⁺ ) 493.

[3S(1S,9S)] t-Butyl 3- (9-acetylam o-6,10-dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H- pyπdazino[1 ,2-a] [1 ,2]dιazepιne-l-carboxamιdo) -5-dιazo- -oxopentanoate (506g) , was prepared by a similar

method as compound 506a. 81%: [α] _D ²⁸ -146.7° (c 0.4, CH ₂ C1 ₂ ); IR (KBr) 3438, 2904, 2113, 1728, 1669, 1523, 1368, 1328, 1155; ¹ H NMR (CDCl ₃ ) δ7.32 (IH, d) , 6.43 (IH, d) , 5.50 (IH, s), 5.22 (IH, m) , 4.94 (IH, m) , 4.77 (IH, ) , 4.60 (IH, m) , 3.24 (IH, m) , 3.03-2.52 (4H, m) , 2.36 (IH, m) , 2.10-1.64 (5H, m) , 2.02 (3H, s), 1.45 (9H, s) . Anal. Calcd for C ₂₁ H ₂₀ N ₆ O : C, 52.69; H, 6.32; N, 17.05. Found: C, 52.51; H, 6.27; N, 17.36. MS (ES ⁺ ) 477 (M ⁺ - 1, 100%) .

[3S(1S,9S)] t-Butyl 5-bromo-3- (9-be zoylamino-6, 10- dioxo-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-l-carboxamido) -4- oxopentanσate (507a) . 506a (3.0g, 5.55mmol) in dry dichloromethane (40ml) was cooled to 0° and 30% hydrobromic acid in acetic acid (1.1ml, 5.55mmol) was added dropwise over 4min. The mixture was stirred at 0° for 9min and quenched with aqueous sodium bicarbonate. The product was extracted into ethyl acetate, washed with aqueous sodium bicarbonate, brme, dried (MgS0 ₄ ) and evaporated to give 2.97g (92%) of a colourless foam: [α] _D ²³ -82.3° (c 0.23, CH ₂ Cl ₂ ) ; IR (KBr) 3333, 1726, 1659, 1530, 1458, 1447, 1422, 1395, 1368, 1279, 1256, 1222, 1155, 728; X NMR (CDC1 ₃ ) δ .81 (2H, m) , 7.50 (3H, m) , 7.11 (IH, d, J = 8.0) , 7.C1 (IH, d, J - 7.4), 5.20 (2H, m) , 5.00 (IH, m), 4.06 (2K, s) , 3.28 (IH, m) , 3.20-2.70 (4H, m) , 2.42 (IH, m) , 2.10- 1.85 (4H, m) , 1.72 (IH, m) , 1.44 (9H, s) . Anal. Calcd for C ₂₆ H ₃₃ N ₄ 0 ₇ BrO.7H ₂ 0: C, 51.53; H, 5.72 N, 9.24. Found: C, 51.55; H, 5.52; N, 9.09. MS (ES ⁺ ) 595, 593 (M ⁺ + 1) .

[3S(1S,9S)] t-Butyl 5-bromo-3- (6, 10-dioxo-9- methanesulphonamido-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[l ,2-a] [1 ,2]diazepine-l-carboxamido) -4- oxopentanoate (507b) , was prepared by a similar method as compound 507a. (68%) as an orange foam: [α] _D 20

135° (c 0.053, CH ₂ C1 ₂ ) ; IR (KBr) 3429, 2944, 2935, 1723, 1670, 1458, 1408, 1327, 1225, 1154, 991; ¹ H NMR

(CDCl ₃ ) δ7.38 (IH, d, J = 8.2), 5.69 (IH, d, J = 9.3), 5,43-5.34 (IH, m) , 5.07-4.97 (IH, m) , 4.70-4.42 (2H, m) , 4.12 (2H, s) , 3.35-3.17 (IH, m) , 3.10-2.69 (4H, ), 2.98 (3H, s), 2.43-2.33 (IH, m) , 2.15-1.65 (5H, m) ,

1.43 (9H, s) . Anal. Calcd for C ₂₀ H ₃₁ BrN ₄ O ₈ S : C, 42.33; H, 5.51; N, 9.87. Found: C, 42.69; H, 5.52; N, 9.97.

[3S(1S,9S)] t-Butyl 5-bromo-3- (6,10-dioxo-9- (methoxycarbonyl)amino-1,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-l-carboxamido) -4- oxopentanoate (507c) , was prepared by a similar method as compound 507a to afford a pale yellow foam (320mg, 78%) : [ ] _D ² ° -107° (c 0.2, CH ₂ Cl ₂ ) ; IR (KBr) 3401, 2956, 1726, 1670, 1528, 1452, 1415, 1395, 1368, 1276, 1251, 1155, 1064; ¹ H NMR (CDCl ₃ ) δ 7.07 (IH, d, J = 7.6), 5.47 (IH, d, J = 8.1), 5.21-5.16 (IH, m) , 5.03- 4.94 (IH, m) , 4.75-4.56 (2H, m) , 4.06 (2H, s), 3.69 (3H, s), 3.31-3.13 (IH, m) , 3.03-2.92 (2H, m) , 2.81- 2.58 (2H, ) , 2.41-2.31 (IH, m) , 2.10-1.66 (5H, m. ,

1.44 (9H, s) .

[3S(1S,9S)] t-Butyl 3- (9-acetylamιno-6, 10- dιoxo-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-l-carboxamido] -5-bromo- -oxopentanoate (507g) , was prepared by a similar

method as compound 507a to afford a pale yellow foam (84%) : [α] _D ²² -109.6° (c 0.1, CH ₂ Cl ₂ ) ; IR (KBr) 3324, 1727, 1659, 1535, 1458, 1444, 1423, 1369, 1279, 1256, 1223, 1155; ¹ H NMR (CDC1 ₃ ) δ 7.12 (IH, d, J = 7.8), 6.33 (IH, d, J = 7.5), 5.19 (IH, m, ) , 4.97 (2H, m) , 4.58 (IH, m) , 4.06 (2H, s), 3.20 (IH, m) , 3.05-2.69 (4H, m) , 2.35 (IH, m) , 2.14-1.68 (5H, m) , 2.03 (3H, s), 1.44 (9H, s) . Anal. Calcd for C ₂₁ H ₃₁ BrN ₄ 0 ₇ •0.3H ₂ 0: C, 46.99; H, 5.93; N, 10.44. Found: C, 46.97; H, 5.90; N, 10.35.

508a, b 284, 285

[3S(1S,9S)] t-Butyl 5- (2,6-dιchlorobenzoyloxy) -3- [6, 10- dioxo—9- (methoxycarbonyl)amιno-1,2,3,4,7,8,9,10- octahydro-6H-pyrιdaz o[1,2-a] [1 ,2Idiazepine-l- carboxamido] -4-oxobutanoate (508a) . To a solution of

506c (547mg, Immol) m DMF (4ml) was added potassium fluoride (145mg, 2.5mmol, 2.5 equiv) . After 10mm stirring at room temperature, 2, 6-dιchlorobenzoιc acid (229mg, 1.2mmol, 1.2 equiv) was added. After 3h reaction at room temperature, ethyl acetate (30ml; was added. The solution was washed with a saturated solution of sodium bicarbonate (30ml) , brme, dried over MgS0 ₄ and concentrated in vacuo to afford 590mg

(90%) of a pale yellow foam: [α] _D ²² -85° (c 0.20, CH ₂ C1 ₂ ) ; IR (KBr) 3400, 2956, 1737, 1675, 1528, 1434,

1414, 1368, 1344, 1272, 1197, 1152, 1061; ^X H NMR

(CDC1 ₃ ) δ7.36-7.33 (3H, m) , 7.04 (IH, d, J = 8.0) , 5.46 (IH, d, J = 7.8), 5.19-5.16 (IH, m) , 5.08 (2H, AB), 4.97 - 4.55 (IH, m) , 4.69-4.55 (2H, m) , 3.68 (3H, s) , 3.30-3.10 (IH, m) , 3.01-2.50 (4H, m) , 2.40-2.33 (IH, m) , 2.15-1.60 (5H, m) , 1.44 (9H, s) . Anal. Calcd for C ₂₈ H ₃₄ Cl ₂ N ₄ O ₁₀ : C, 51.15; H, 5.21; N, 8.52. Found: C, 51.35; H, 5.32; N, 8.56.

[3S(1S,9S) ] 5-(2,6-Dιchlorobenzoyloxy) -3- [6, 10-dιoxo-9- (methoxycarbonyl)amιno-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-1-carboxamido] -4- oxopentanoic acid (284), was synthesized from 508a via method used to prepare 505 from 504 which afforded 330mg (65%) of a white solid: mp. 115°C (decomp.) ; _α] _D ² ° -107° (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3340, 2954, 173b, 1664, 1530, 1434, 1272, 1198, 1148, 1060; ^l H NMR (Dg- DMSO) δ 8.91 (IH, d, J = 7.2H), 7.67-7.63 (3H, m) , 7.54 (IH, d, J = 8.0), 5.24 (2H, s), 5.20-5.15 (IH, ), 4.79-4.70 (IH, m) , 4.46-4.37 (2H, m) , 3.58 (3H, s), 3.33-3.20 (IH, m) , 2.94-2.55 (4H, m) , 2.30-1.60 (6H,

m) . Anal. Calcd for C ₂₄ H ₂₆ C ₁₂ N ₄ O ₁₀ ^« H 0: C, 46.54; H, 4.56; N, 9.05. Found: C, 46.36; H, 4.14; N, 8.88.

[3S(1S,9S)] t-Butyl 5- (2 , 6-dimethylbenzoyloxy) -3- [6, 10- dioxo—9- (methoxycarbonyl)amino-1,2,3,4 ,7,8,9, 10- octahydro-6H-pyridazino [1 ,2-a] [1 ,2]diazepine-l- carboxamido] -4-oxopentanoate (508b), was synthesized by a similar method as compound 508a to afford a pale yellow foam (460mg, 82%) : [α] _D ²² -115° (c 0.20, CH ₂ C1 ₂ ) ; IR (KBr) 3413, 2960, 1729, 1675, 1528, 1514, 1461, 1421, 1368, 1265, 1116, 1096; ¹ H NMR (CDCl ₃ ) δ 7.27-7.03 (4H, m) , 5.48 (IH, d, J = 8.2) , 5.20-5.14 (IH, ) , 5.04 (2H, AB), 4.93-4.86 (IH, m) , 4.80-4.56 (2H, m) , 3.77 (3H, s), 3.32-3.15 (IH, m) , 3.00-2.56 (4H, m) , 2.37 (6H, s), 2.19-1.77 (5H, m) , 1.45 (9H, s) , 2.41-2.25 (IH, m) . MS (ES ⁺ ) 617.

[3S(1S,9S) ] 5-(2,6-Dimethylbenzoyloxy)3-[6,10-dioxo-9- (methoxycarbonyl) amino-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1,2-a] [1 ,2]diazepine-l-carboxamido] -4- oxopentanoic acid (285), was synthesized by a similar method as compound 284 to afford a white solid (303mg, 78%) : mp. 110°C (decomp.) ; [α] _D ²⁰ -128° (c 0.10, CH ₂ C1 ₂ ) ; IR (KBr) 3339, 2958, 1731, 1666, 1529, 1420, 1266, 1248, 1115, 1070; ^X H NMR (Dg-DMSO) δ 8.90 (IH, d, J = 7.4), 7.54 (IH, d, J = 7.9), 7.36-7.28 (IH, rr.. , 7.17-7.14 (2H, m), 5.19-5.15 (3H, m) , 4.84-4.74 IH, m) , 4.45-4.37 (2H, m) , 3.59 (3H, s) , 3.45-3.25 (IH, m) , 2.95-2.64 (4H, m) , 2.35 (6H, s) , 2.30-1.60 (6H, rr.; . Anal. Calcd for C ₂₆ H ₃₂ N ₄ O ₁₀ 'H ₂ O: C, 53.98; H, 5.92; N, 9.68. Found: C, 53.50; H, 5.52; N, 9.49. MS ( EfX ) 559.

509a-d 510a, 280, 283, 510d

[3S(1S, 9S) ] 3- (9-Benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazmo[1,2-a] [1,2]diazepme-l-carboxamido) -5- (2- mercaptothiazole) -4-oxopentanoic acid (510a) . A solution of 506a (2.27g, 4.2mmol) in dry dichloromethane (50ml) was treated with 30 hydrobrom:

acid in acetic acid (1.84ml, 9.2mmol, 2.2equιv) at 0°C, under nitrogen. After 10mm stirring at 0°C the reaction was complete and a white solid crystalliseα m the medium. The solid was filtered and washed with ethylacetate and diethylether to afford 2.20g (100%) of [35(15, 95) ] 5-bromo-3- (9-benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazmo [1,2-a] [1,2] dιazepιne-1-carboxamido) -4- oxopentanoic acid which was used without further purification: ¹ H NMR (D ₆ -DMS0) δ 8.87 (IH, d, J = 7.3), 8.63 (IH, d, J = 7.6), 7.91-7.87 (2H, m) , 7.60-7.44 (3H, m) , 6.92 (IH, bs), 5.14-5.09 (IH, m) , 4.92-4.65 (2H, m) , 4.43 (2H, AB) , 4.41-4.35 (IH, ) , 3.33-3.22 (IH, ) , 2.98-2.90 (IH, m) , 2.89-2.57 (2H, m) , 2.35- 2.15 (3H, m) , 1.99-1.91 (2H, m) , 1.75-1.60 (2H, m) . A solution of the bro oketone (535mg, lmmol) in dry DMF (10ml) was treated with potassium fluoride (150mg, 2.5mmol, 2.5 equiv), under nitrogen. After 5mm stirring at room temperature, 2-mercaptothιazole (140mg, 1.2mmol, 1.2equιv) was added. After overnight reaction ethylacetate (150ml) was added and the organic solution was washed with brine, dried over magnesium sulphate and reduced m vacuo. The residue was crystallised in diethyl ether, filtered and purified on silica gel using a gradient of MeOH (Or to 5") in dichloromethane. Evaporation affordeα 344mg (60 ) of a white solid: mp. 90-95°C (decomp.) ; [ a ] _D ² ° -82° (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3328, 2941, 1745, 1659, 1535, 1422, 1276, 1255, 1223, 1072; ¹ H NMR (D ₆ -DMSO) δ 8.92 (IH, d, J = 7.6), 8.68 (IH, d, J = 7.6), 7.98-7.90 (2H, m) , 7.75-7.67 (IH, m) , 7.64-7.50 (4H, ro, , 5.22-5.18 ilH, m) , 4.95-4.74 (2H, m) , 4.58-4.38 (311, m) , 3.52-3.19 (IH, m) , 3.05-2.65 (4H, ) , 2.40-1.50 (6H, m , . Anal.

Calcd for C ₂₅ H ₂₇ N ₅ 0 ₄ S ₂ ^« H ₂ 0: C, 50.75; H, 4.94 N, 11.84. Found: C, 51.34; H, 4.70; N, 11.58. MS (ES ⁴ ) 572.

[3S(1S,9S)] t-Butyl 3- (9-benzoylamιno-6, 10-dιoxo- 1 ,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2]dιazepιne-1-carboxamido) -4-oxo-5- (l-phenyl-lH-tetrazole-5-thιo) pentanoate (509b) . 507a

(lOOmg, 0.17mmol) m dry dimethylformamide (1.5ml) was treated with l-phenyl-lH-tetrazole-5-thιol (33mg, 0.187mmol) and potassium fluoride (15mg, 0.34mmol) . The mixture was stirred at room temperature for 2h, diluted with ethyl acetate, washed with aqueous sodium bicarbonate (x2), br e, dried (MgS0 ₄ ) and evaporated. The product was purified by flash chromatography on silica gel elutmg with ethyl acetate to give 103mg (88%) as a colourless foam: [α] _D 23 -92.2° (c 0.1,

CH ₂ C1 ₂ ) ; IR (KBr) 3334, 1726, 1660, 1528, 1501, 1417, 1394, 1368, 1279, 1253, 1155; ^" NMR (CDCl ₃ ) δ7.82 (2H, m) , 7.60-7.40 (8H, m) , 7.39 (IH, d, J = 8.1), 7.05 (IH, d, J = 7.3), 5.26 (IH, m) , 5.15 (IH, m) , 4.99 (IH, m) , 4.60 (2H, m) , 4.30 (IH, d, J = 17.2H), 3.32 (IH, m) , 3.10-2.75 (4H, m) , 2.40 (IH, m) , 2.24 (IH, m) , 1.90 (3H, m) , 1.75 (IH, m) , 1.44 (9H, s) . MS (ES ⁺ ) 691.47 (M ⁺ + 1) .

[3S(1S, 9S) ] 3- (9-Benzoylammo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1 ,2]dιazepιne-l-carboxamido) -4-oxo- 5 (l-phenyl-lH-tetrazole-5-thιo) pentanoic acid (280) , was synthesized via method used to prepare 505 from 504. 509b (98mg, 0.142mmol) m dichloromethane (lml ¹ was cooled to 0° and trifluoroacetic acid (1ml) was added. The mixture was stirred at 0° for 15mm and a:

room temperature for 30mm before evaporation under reduced pressure. The residue was triturated with dry toluene and evaporated. Chromatography on silica gel eluting with 10% methanol in dichloromethane gave a colourless glass which was crystallised from dichloromethane/diethyl ether to give 62mg (69%) of colourless solid: mp. 145°C (decomp. ) ; [α] _D 22 -80.9° (c

0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3400, 1727, 1658, 1530, 1501, 1460, 1445, 1416, 1280, 1254; ¹ H NMR (CDCl ₃ ) δ8.00 (IH, m) , 7.79 (2H, d, J = 6.7), 7.58-7.30 (9H, m) , 5.25 (2H, ) , 4.94 (IH, m) , 4.53 (2H, m) , 4.35 (IH, m) , 3.35 (IH, m) , 3.01 (3H, m) , 2.73 (IH, ) , 2.38 (IH, m) , 1.98 (4H, m) , 1.64 (IH, m) . Anal. Calcd for C ₂₉ H ₃₀ N ₈ O ₇ S•0.2TFA: C, 53.71; H, 4.63 N, 17.04. Found: C, 53.97; H, 4.92; N, 16.77. MS (ES ⁺ ) 633.55 (M ⁺ - 1) .

[3S(1S,9S)] t-Butyl 3- [9-benzoylamιno-6, 10- dιoxo-1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepme-l-carboxamido] -4-oxo-5-

(3-pyridyloxy)pentanoate (509c) , was prepared by a similar method as compound 509b to afford a colourless glass (34%) : [α] _D ²² -77.1° (c 0.25, CH ₂ Cl ₂ ) ; IR (film) 3311, 1724, 1658, 1603, 1578, 1536, 1488, 1458, 1426, 1368, 1340, 1279, 1256, 1231, 1155, 707; ^X H NMR (CDC1 ₃ ) δ 8.29 (2H, ) , 7.84 (2H, m) , 7.48 (4H, m) , 7.22 (3H, m) , 5.20 (2H, m) , 4.90 (2H, m) , 4.58 (IH, ) , 3.29 .IH, m) , 3.20-2.70 (4H, m) , 2.38 (2H, m) , 1.96 (4H, ) , 1.68 (IH, m) , 1.42 (9H, s) . MS (ES ⁺ ) 608.54 (M + 1) .

[3S(1S,9S) ] 3-[9-Benzoylamιno-6,10- dιoxo-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1 ,2 ] diazepme-l -carboxamido] -4-oxo-5-

(3-pyridyloxy)pentanoic acid (283), was prepared by a similar method as compound 280 to afford a colourless foam (100%) : mp. ~125°C; [α] _D ¹⁹ -84.1° (c 0.1, 20% MeOH/CH ₂ Cl ₂ ) ; IR (KBr) 3401, 1736, 1663, 1538, 1489, 1459, 1425, 1281, 1258, 1200, 1134; ¹ H NMR (CD ₃ 0D/CDC1 ₃ ) δ 8.38 (2H, m) , 7.84-7.40 (8H, m) , 5.16 (4H, m) , 4.80 (IH, m) , 4.56 (IH, m) , 3.50 (IH, m) , 3.12 (2H, m) , 2.82 (2H, m) , 2.37 (IH, m) , 2.10-1.65 (5H, m) . Anal. Calcd for C ₂₇ H ₂ 9N ₅ 0 ₈ O.4H ₂ 0: C, 51.77; H, 4.61; N, 10.41. Found: C, 52.19; H, 4.93; N, 9.99.

[3S(1S,9S)] t-Butyl 3- [6, 10-dιoxo-l,2 ,3,4 , 7 , 8, 9, 10- octahydro-9- (phenycarbonylamino) -6H- pyrιdazιno[l,2-a] [1,2]dιazepιne-l-carboxamido] -4-oxo-5- {2- [4 (3H) -pyπmidone] }pentanoate (509d) , was synthesized by a similar method as compound 509b to afford a colourless solid (49.6mg, 82%) : ¹ H NMR (CDC1 ₃ ) δ 8.02 (IH, s), 7.95-7.86 (IH, m) , 7.84-7.76 (2H, m) , 7.62-7.35 (4H, m) , 7.22-7.07 (IH, m) , 6.43 (IH, d) , 5.26-5.08 (2H, m) , 5.03-4.72 (3H, m) , 4.66-4.50 (IH, m) , 3.43-3.19 (IH, m) , 3.15-2.97 (IH, m) , 2.86-2.72 (3H, m) , 2.48-2.31 (IH, m) , 2.18-1.60 (6H, ) , 1.43 (9H, s) .

[3S(1S, 9S) ] 3- [6,10-Dιoxo-l ,2,3,4,7,8,9, 10-octahydro-9- (phenycarbonylammo) -6H- pyridazino[1 ,2-a] [1 ,2]dιazepιne-l-carboxamido] - -oxo-5- {2- [4 (3H) -pyπmidone] Jpentanoic acid (510d) , was synthesized by a similar metnod as compound 280 to afford a colourless solid (23.7mg, 57 ) ; mp. 140-80°C, IR (KBr) 3391, 2945, 1733, 1664, 1530, 1422, 1363, 12 7, 1259, 1204; ¹ H NMR (CD,3D) δ 8.23 (IH, s - , .9a

(IH, d), 7.87 (2H, d) , 7.54-7.42 (3H, ) , 6.48 (IH, d) , 5.22-5.15 (IH, m) , 4.57-4.46 (IH, m) , 3.62-3.41 (IH, m) , 3.22-3.13 (IH, m) , 3.02-2.81 (2H, m) , 2.70-1.80

(6H, ) . Anal. Calcd for C ₂₆ H ₂₈ N ₆ 0 ₈ • 1.5H ₂ 0: C, 54.30; H, 5.35; N, 14.61. Found: C, 54.14; H, 5.35; N, 13.04.

MS (ES 551 (M - 1, 100% Accurate mass calculated for C ₂₆ H ₂₉ N ₆ 0 ₈ (MH ⁺ ) 553.2047. Found: 553.2080.

504f-h 505f, 280b, 283b

[3S(1S,9S)] 5-(3-Chloro-2-oxy-4H- pyrido[1 ,2-a]pyrιmιdm-4-one) -3- [6, 10-dιoxo—9-

(methylsulphonyl)amino-l ,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepιne-l-carboxamido] -4- oxopentanoic acid (505f) , was prepared by a similar method as compound 508a usmg 507b and 3-chloro-2- hydroxy-4H-pyrido [1, 2-a]pyrimidin-4-one and directly followed by the hydrolysis of 504f with trifluoroacetic to afford a tan powder (65mg, 30%) : [a] _D ²⁰ -128° (c 0.10, MeOH); IR (KBr) 3414, 2928, 1667, 1527, 2459, 1407, 1328, 1274, 1153, 1134; ¹ H NMR (MeOD) δ 9.35 (IH, d, J = 6.6H), 8.34 (IH, t, J = 7.2H), 7.99-7.95 (IH, m) , 7.76-7.69 (IH, m) , 5.85-5.45 (3H, m) , 5.30-5.21 (IH, m) , 4.93-4.66 (2H, m) , 3.81-3.65 (IH, ) , 3.66 (3H, m) , 3.45-2.52 (4H, m) , 2.52-1.71 (6H, m) . D.J. Hlasta et al., J. Med. Chem. 1995, 38, 4687-4692.

[35(15,95)] t-Butyl 3- (6, 10-dioxo-9- methanesulphonamido-1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1,2-a] [1,2]dιazepine-l-carboxamido) -4-oxo- 5 (l-phenyl-lH-tetrazole-5-thio)pentanoate (504g) , was prepared by a similar method as compound 509b, (83%) as a colourless foam: [α] _D ²³ -112.7° (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3312, 1726, 1668, 1501, 1413, 1395, 1369, 1328, 1276, 1254, 1155; ^" NMR (CDCl ₃ ) δ7.59 (5H, m) , 7.48 (IH, d, J - 8.0), 5.68 (IH, d, J - 9.0), 5.37 (IH, m) , 4.95 (IH, ) , 4.62-4.31 (4H, m) , 3.36 (IH, m) , 2.98 (3H, s), 2.88 (4H, m) , 2.66 (IH, ) , 2.42 (2H, m , 1.98 (IH, m) , 1.75 (IH, m) , 1.43 (9H,s) .

[3S(1S,9S) ] 3- (6, 10-Dιoxo-9-methanesulphonamιdo- 1,2,3,4,7 ,8,9,10-octahydro-6H- pyridaz o[1,2-a] [1,2]diazepme-l-carboxamido) -4-oxo- 5 (l-phenyl-lH-tetrazole-5-thιo)pentanoic acid (280b),

was prepared by a similar method as compound 280, (100%) as a colourless foam: mp. 120-5°C; [α] _D 25

112.4° i c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3328, 1730, 1664,

1529, 1501, 1410, 1328, 1277, 1219, 1153, 1134, 991; ¹ H NMR (CDCl ₃ ) δ8.07 (IH, d, J = 7.8), 7.58 (5H, s), 6.41

(IH, d, J = 9.5), 5.32 (IH, m) , 5.04 (IH, m) , 4.70 (IH, d, J = 17.5), 4.60 (3H, m) , 3.50-2.9 (3H, m) , 2.98 (3H, s), 2.45 (2H, m) , 2.06 (4H, ) , 1.68 (IH, m) .

[35(15,95)] t-Butyl 3- (6,10-dioxo-9- methanesulphonamido-1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[l ,2-a] [1 ,2]diazepine-l-carboxamido) -4-oxo- 5 (3-pyridyloxy)pentanoate (504h) , was prepared by a similar method as compound 509b (24%) as a colourless foam: [α] _D ²³ -101.0° (c 0.2, CH ₂ Cl ₂ ); IR (KBr) 3330, 1727, 1669, 1425, 1396, 1369, 1328, 1276, 1256, 1231, 1155, 1137, 991; ^X H NMR (CDCl ₃ ) δ8.28 (2H, br d, J = 9.4), 7.71 (IH, d, J = 7.9), 7.22 (2H, s), 6.03 (IH, d, J = 9.4), 5.36 (IH, m) , 4.95 (2H, ) , 4.52 (2H, ) , 3.29 (IH, m) , 3.07 (3H, s), 3.23-2.75 (3H, m) , 2.66- 2.35 (2H, m) , 2.30-1.60 (5H, m) , 1.42 (9H, s) .

[3S(1S,9S) ] 3- (6, 10-Dioxo-9-methanesulphonamido- 1,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1 ,2]diazepine-l-carboxamido) -4-oxo- 5 (3-pyridyloxy)pentanoic acid (283b), was prepared by a similar method as compound 280, (100-/ as a colourless foam: mp. 120-5°C ; [α] _D ²⁵ -85.2° (c 0.1, 10* CH ₃ 0H/CH ₂ C1 ₂ ) ; IR (KBr) 3337, 1738, 1667, 1560, 1457, 1424, 1326, 1317, 1278, 1258, 1200, 1189, 1150, 1133, 991; ¹ H NMR (CDCI3/CD ₃ OD) δ 8.35 (2H, m) , 7.54 (2H, m, ,

5.32 (2H, m) , 4.83 (2H, m) , 4.45 (2H, ) , 3.43-2.77 (4H, m) , 2.97 (3H, s) , 2.42 (2H, m) , 2.05-1.72 (5H, m) .

511c, 280c, 283c

[3S(1S,9S)] t-Butyl 3- [6, 10-dιoxo-9-

(methoxycarbonyl)amιno-1 ,2,3,4,7,8,9, 10-octahydro-6H- pyπdazmo[1,2-a] [1,2]dιazepιne-l-carboxamido) -5- (2- mercaptopyrimidine) -4-oxo-pentanoate (508c), was prepared by a similar method as compound 509b to afforα

544mg (97%) of a pale yellow foam: !0 -86° (c 0.19,

CH- ^, C1^ ; IR (KBr) 3426, 294 ^" ?, 1725, 1669, 1551, 1418,

1383, 1253, 1155, 1064; ^X H NMR (CDCl ₃ ) δ 8.49 (2H, d, J = 4.8), 7.13 (IH, d, J = 7.9) , 7.03-6.98 (IH, m) , 5.47 (IH, d, J = 7.9) , 5.23-5.19 (IH, m) , 5.09-5.01 (IH, m) , 4.84-4.51 (2H, m) , 4.04 (2H, AB), 3.69 (3H, s), 3.38- 5 3.19 (IH, m) , 3.06-2.64 (4H, m) , 2.40-1.76 (6H, m) ,

1.43 (9H, s) . Anal. Calcd for C ₂₅ H ₃₄ N ₆ 0 ₈ S: C, 51.89; H, 5.92; N, 14.52. Found: C, 51.49; H, 6.04; N, 13.87. MS (ES ⁺ ) 579.

[3S(1S,9S) ] 3- [6, lO-Dιoxo-9- (methoxycarbonyl) -ammo- 0 1,2,3,4,7,8,9, 10-octahydro-6H- pyrιdazιno[l,2-a] [1 ,2]dιazepme-l-carboxamido] -5- (2- mercaptopyπmidine) -4-oxopentanoic acid (511c), was prepared by a similar method as compound 280 to afford

370mg (79%) of a white powder: mp. 105°C (dec) ; [α] _D "" ^~ 5 -94° (c 0.20, CH ₂ C1 ₂ ) ; IR (KBr) 3316, 3057, 2957, 1724, 1664, 1252, 1416, 1384, 1254, 1189, 1063; ^X H NMR (Dg- DMSO) δ8.85 (IH, d, J = 7.8) , 8.62 (2H, d, J = 4.7) , 7.53 (IH, d, J - 8.0), 7.28-7.23 (IH, m) , 5.21-5.17

(IH, m) , 4.87-4.79 (IH, m) , 4.47-4.35 (2H, m) , 4.23 0 (2H, AB), 3.58 (3H, s), 3.30-3.21 (IH, m) , 2.95-2.50

(4H, m) , 2.35-1.60 (6H, m) . Anal. Calcd for C ₂₁ H ₂₆ N ₆ 0 ₈ S*H ₂ 0: C, 46.66; H, 5.22; N, 15.55. Found: C, 46.66; H, 5.13; N, 15.07. MS (ES ⁺ ) 523, (ES ⁺ ) 521.

[3S(15,9S)] t-Butyl 3- [6, 10-dιoxo-9- 5 (methoxycarbonylammo) -1,2,3,4,7,8,9, 10-octahydro—6H- pyridazino[1,2-a] [1,2]d azepme-l-carboxamido] -4-oxo-5- [5- (1-phenyltetrazolyl) -thio]pentanoate (508d) , was synthesized by a similar method as compounα 509b tc afford a colourless solid (269mg, 87 ) : mp. 80-110°C; " [α] _D ²³ -108° (c 0.60 CH ₂ C1 ₂ ); IR (KBr) 3315, 2977, 172",

1688, 1527, 1501, 1458, 1418, 1368, 1279, 1250, 1155, 1064; ¹ H NMR (CDCl ₃ ) δ7.70 (IH, d) , 7.63-7.53 (5H, m) , 5.84 (IH, d) , 5.34-5.27 (IH, m) , 5.05-4.92 (IH, m) , 4.78-4.54 (3H, m) , 4.38 (IH, d) , 3.66 (3H, s), 3.37- 3.19 (IH, ) , 3.07-2.94 (IH, m) , 2.91-2.82 (2H, m) , 2.71-2.56 (IH, m) , 2.40-2.30 (IH, m) , 2.19-2.13 (IH, ), 2.08-1.68 (4H, m) , 1.42 (9H, s) . MS (ES ⁺ ) 667 (31%), 645 (M ⁺ + 1, 100), 589 (62) .

[3S(1S,9S) ] 3-[6,lO-Dιoxo-9- (methoxycarbonylamino) - l,2,3,4,7,8,9,10-octahydrc—6H- pyridazino[1,2-a] [1,2]dιazepine-l-carboxamido] -4-oxo-5- [5- (1-phenyltetrazolyl) -thio]pentanoic acid (280c), was synthesized by a similar method as compound 280 to afford a pale cream solid (203mg, 88%) : mp. 105-130°C; [α] _D ²² -235° (c 0.11 MeOH) ; IR (KBr) 3342, 2951, 1727, 1667, 1529, 1501, 1459, 1416, 1276, 1252, 1225, 1192, 1062; ¹ H NMR (D ₆ -DMSO) δ 8.89 (IH, d) , 7.69 (5H, s), 7.50 (IH, d) , 5.18-5.11 (IH, m) , 4.79-4.69 (IH, m) , 4.57 (2H, s) , 4.42-4.32 (IH, m) , 3.54 (3H, s), 2.92- 2.63 (3H, m) , 2.21-1.82 (5H, m) , 1.65-1.57 (IH, m) . MS (ES ⁺ ) 587 (M - 1, 100%) .

[35(15,95)] t-Butyl 3-[6,10-dioxo-9-

(methoxycarbonylammo) -1,2,3,4,7,8,9,10-octahydro—6H- pyridaz o[1,2-a] [1,2]diazepιne-l-carboxamido] -4-oxσ-5- (3-pyridιnyloxy) pentanoate (508e) , was synthesized Py a similar method as compound 509b to afford a pale orange solid (199mg, 25 ^c : mp. 80-120°C; [ ] _D ²³ -89° 'c 0.51 CH ₂ C1 ₂ ) ; IR (KBr) 3333, 2978, 1726, 1669, 1578, 1536, 1478, 1426, 1368, 1277, 1253, 1232, 1155, 1064; ^X H NMR (CDC1 ₃ ) δ 8.41-8.18 (2H, m) , 7.81 (IH, d) , ".26-

7.20 (2H, s), 5.91 (IH, d) , 5.24-5.16 (IH, m) , 5.07-

4.86 (3H, m) , 4.81-4.51 (2H, m) , 3.67 (3H, s) , 3.34-

3.16 (IH, m) , 3.10-2.81 (3H, m) , 2.72-2.54 (IH, ) ,

2.41-2.31 (IH, m) , 2.07-1.62 (5H, m) , 1.47 ( 9H sj . MS (ES ⁺ ) 562 (M ⁺ + 1, 100%) , 506 (38) .

[3S(1S,9S) ] 3-[6, lO-Dιoxo-9- (methoxycarbonylam o) -

1,2,3,4,7,8,9, 10-octahydro—6H- pyridazino[1,2-a] [1,2]dιazepιne-l-carboxamιdo] -4-oxo-5-

(3-pyridinyloxy)pentanoic acid (283c), was synthesized by a similar method as compound 280 to afford an off- white powder (167mg, 98%) : mp. 90-105°C; [αj _D ²² -106°

(c 0.11 MeOH) ; IR (KBr) 3325, 3070, 2956, 1669, 1544, 1423, 1256, 1199, 1133, 1062; ¹ H NMR (D ₆ -DMSO) δ 8.95

(IH, d) , 8.45-8.20 (2H, m) , 7.53-7.45 (3H, m) , 5.19- 5.08 (3H, ) , 4.70-4.62 (IH, m) , 4.41-4.30 (2H, m) , 3.53 (3H, s), 2.92-2.68 (3H, m) , 2.22-2.06 (2H, m) , 1.95-1.82 (2H, m) , 1.63-1.53 (IH, m . MS (ES ⁺ ) 506 (M ⁺ + 1, 100%) .

512a, 512b 280d, 283d

[3S(1S,9S)] t-Butyl 3- (9-acetamιdo-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridaz o [1,2-a] [1 ,2]diazepine-l-carboxamido) -4-oxo-5- (l-phenyl-lH-tetrazole-5-thio)pentanoate (512a), was prepared by a similar method as compound 509b, to

23 afford (83%) as a colourless foam: [α] ^■ 129.6° (c

0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3323, 1726, 1664, 1531, 1501, 1444, 1415, 1394, 1369, 1279, 1254, 1156; ¹ H NMR

(CDCl ₃ ) δ7.59 (5H, s), 7.37 (IH, d, J = 7.9) , 6.38 (IH, d, J = 7.4) , 5.27 (IH, m) , 4.98 (2H, m) , 4.58 (2H, d + m 4.28 (IH, d, J = 17.2) , 3.28 (IH, m) , 3.10-2.65

(4H, m) , 2.31 (2H, m) , 2.03 (3H, s) , 2.10-1.72 (4H, m , 1.48 (9H, s) .

[3S(1S, 9S) ] 3- (9-Acetamιdo-6, 10-dιoxo-l ,2 ,3,4,7,8,9,10- octahydro-6H-pyπdazmo [1 ,2-a] [1 ,2]dιazepme-l- carboxa ido) -4-oxo-5- (l-phenyl-lH-tetrazole-5- thio)pentanoic acid (280d) , was prepared by a similar method as compound 280, to afford (77- ) as a colourless fcam: [α] ^■ 93.3° (c 0.1, CH-.C1 IP (KBr) 3316,

1728, 1659, 1531, 1501, 1415, 1341, 1278, 1253, 1222, 1185; ^X H NMR (CDC1 ₃ ) 68.05 (IH, d, J = 7.9) , 7.57 (5H, br s), 5.30 (IH, m) , 5.01 (2H, m) , 4.70-4.10 (4H, m) , 3.40-2.85 (4H, m) , 2.62 (IH, m) , 2.33 (IH, m) , 2.27- 1.65 (5H, m) , 2.01 (3H, s) .

[3S(1S,9S)] t-Butyl 3- (9-acetamιdo-6, 10-dιoxo- 1,2,3, ,7,8,9,10-octahydro-6H- pyridazino[1,2-a] [1,2]diazepine-l-carboxamido) -4-oxo-5- (3-pyridyloxy)pentanoate (512b), was prepared by a similar method as compound 509b, to afford (9%) as a colourless foam: IR (KBr) 3333, 1727, 1661, 1542, 1427,

1369, 1279, 1257, 1232, 1156; ¹ H NMR (CDCl ₃ ) δ8.30 (2H, m) , 7.20 (3H, m) , 6.45 (IH, d, J = 7.4), 5.17 (IH, m) , 4.91 (3H, m) , 4.55 (IH, m) , 3.27 (IH, m) , 3.14-2.70 (4H, m) , 2.41 (IH, m) , 2.04 (3H, s), 2.10-1.65 (6H, m) , 1.44 (9H, s) .

[3S(1S, 9S) ] 3- (9-Acetamido-6, 10-dιoxo-l ,2,3,4,7,8,9,10- octahydro-6H-pyridazιno[1,2-a] [1,2]dιazepme-l- carboxamido) -4-oxo-5- (3-pyridyloxy)pentanoic acid (283d) , was prepared by a similar method as compound 280. (100%) as a colourless foam: [α] _D ²² -106.0° (c 0.2, 10% CH ₃ 0H/CH ₂ C1 ₂ ) ; IR (KBr) 3312, 1735, 1664, 1549, 1426, 1279, 1258, 1200, 1135; ¹ H NMR (CDCl ₃ ) δ8.27 (2H, m), 7.46 (2H, m) , 5.09 (IH, m) , 4.79 (3H, m) , 4.4" (IH, ml, 3.40 (IH, m) , 3.30-2.70 (3H, m) , 2.54 (IH, m _/ , 2.3 (IH, m) , 1.98 (3H, s) , 2.05-1.65 (4H, m) .

245b 246b

[lS,9i?(2i?S,3S) ] 9-Benzoylamιno-N- (2-benzyloxy-5- oxotetrahydrofuran-3-yl) -1,2,3,4,7,8,9, 10-octahydro-lO- oxo-6H-pyπdazino[l,2-a] [1,2]diazepine-l-carboxamide

(245b), was prepared from ( 1 S, 9R) 9-Benzoylammo- 1,2, 3, , 7, 8, 9, 10-octahydro-10-oxo-6H- pyridazino [1, 2-a] [1, 2] diazepine-1-carboxylιc acid by the method described for 245 to afford 416mg (85%) of a colourless foam (-1:1 mixture of diastereoisomers) : IR

(KBr) 3392, 3302, 2942, 1792, 1642, 1529, 1520, 1454, 1119; ¹ H NMR (CDCl ₃ ) δ7.79 (2H, m) , 7.51-7.09 (10H, m) , 5.52 (0.5H, d, J = 5.3), 5.51 (0.5H, s), 5.36 (IH, m) , 4.84 (IH, m) , 4.74-4.59 (1.5H, m) , 4.51 (IH, m) , 4.38

(0.5H, m) , 3.22-2.83 (5H, m) , 2.51 (IH, m) , 2.25 (2H, m) , 2.01-1.46 (6H, m) . Anal . Calcd for C ₂₈ H ₃₂ N ₄ 0 ₆ O.75H ₂ 0: C, 62.97; H, 6.32; N, 10.49. Founα:

C, 63.10; H, 6.16; N, 10.21 MS (ES (M + 100%) .

[3S(lS,9i?) ] 3- (9-Benzoylammo-l,2,3,4 ,7,8,9,10- octahydro-10-oxo-6H-pyrιdazmo[1 ,2-a] [1 ,2]dιazepιne-1 carboxamido) -4-oxobutanoic acid (246b), was prepared from 245b by the method described for 246 to afforα

24

104mg (33%) of a white powder: mp. 115-119°C; [α] _D 19.8° (c 0.2 MeOH); IR (KBr) 3293, 2944, 1786, 1639, 1578, 1537, 1489, 1450, 1329, 1162, 1124; ¹ H NMR

(CD ₃ 0D) 67.85 (2H, d, J = 7.0), 7.49 (3H, m) , 5.49 (IH, m), 4.55 (IH, m) , 4.30 (2H, m) , 3.40 (IH, m) , 3.19-2.89

(3H, m) , 2.63 (2H, m) , 2.16-1.81 (5H, m) , 1.60 (3H, m) . Anal. Calcd for C ₂₁ H ₂₆ N ₄ 0 ₆ ^« H ₂ 0: C, 56.24; H, 6.29; N, 12.49. Found: C, 56.54; H, 6.05; N, 12.29. MS (ES ⁺ ) 429 (M - 1, 100%) .

Compounds 513a-j were prepared as described below.

513a-f

513g

513h

513ι

513-j

(2RS, 3S) 3- (Allyloxycarbonyl) ammo-2- (2-phenethyloxy) - 5-oxotetrahydrofuran (513a), was prepared by a similar method as compound 513d/e to afford a mixture of diastereoisomers (670mg, 50%) as an oil: IR (KBr) 3331, 2946, 1790, 1723, 1713, 1531, 1329, 1257, 1164, 1120, 1060, 977, 937, 701; 31 NMR (CDC1 ₃ ) δ 7.3 -7.18 (5H, m) , 5.99-5.83 (IH, m) , 5.41-5.34 (2H, m) , 5.28-5.18 (2H,

m) , 4.59-4.56 (2H, m) , 4.32-3.96 (2H, m) , 3.85-3.73 (IH, m) , 3.02-2.76 (3H, m) , 2.49-2.34 (IH, ) .

(22?S,3S) 3- (Allyloxycarbonyl)amino-2-cyclopentyloxy-5- oxotetrahydrofuran (513b) , was prepared as 513d/e to afford 8g (51%) of a mixture of diastereoisomers as a clear oil: [α] _D ² ° -13° (c 0.25, CH ₂ C1 ₂ ) ; IR (KBr) 3325, 2959, 2875, 1790, 1723, 1535, 1420, 1328, 1257, 1120, 1049, 973, 937; ¹ H NMR (CDC1 ₃ ) δ 6.02-5.80 (IH, m) , 5.53- 5.46 (2H, m) , 5.37-5.21 (2H, m) , 4.58 (2H, d, J = 5.5), 4.50-4.46 (0.5H, ) , 4.34-4.25 (IH, m) , 4.19-4.12

(0.5H, m) , 3.06-2.77 (IH, m) , 2.53-2.35 (IH, m) , 1.85- 1.50 (8H, m) . Anal. Calcd for C ₁₃ H ₁₉ N0 ₅ : C, 57.98; H, 7.11; N, 5.20. Found: C, 56.62; H, 7.22; N, 4.95. MS

(ES ⁺ ) 270.

(2J?,3S) 3-Allyloxycarbonylamino-2- (ιndan-2-yloxy) -5- oxotetrahydrofuran (513c) , was synthesized by a similar method as compound 513d/e to afford a smgle isomer (20%) as a pale yellow oil: [α] _D ²⁴ -63.1° (c 0.2, CH ₂ C1 ₂ ) ; IR (film) 3338, 2948, 1791, 1723, 1529, 1421, 1330, 1253, 1122, 984, 929, 746; ¹ H NMR (CDC1 ₃ ) 67.20

(4H, m), 5.87 (IH, m) , 5.61 (IH, d, J = 5.4), 5.33-5.10 (2H, m) , 4.70 (IH, m) , 4.56 (3H, m) , 3.33-3.19 (2H, m) , 3.10-2.94 (2H, m) , 2.81 (IH, dd, J = 8.3, 17.3), 2.43 (IH, dd, J = 10.5, 17.3) .

(2R, 3S) 3-Allyloxycarbonylamιno-2-benzyloxy-5- oxotetrahydro-furan (513d) and (2S,3S) 3- Allyloxycarbonylamino-2-benzyloxy-5-oxo-tetrahydrofuran

(513d/e) , were prepared [via method described by Chapman Biorα. & Med. Chem. Lett., 2, pp. 615-618

(1992) ] . Following work-up by extraction with ethylacetate and washing with NaHC0 ₃ , the product was dried (MgS0 ₄ ), filtered and evaporated to yield an oil which contained product and benzyl alcohol . Hexane (200ml) (200ml hexane for every 56g of

AllocAsp (C0 ₂ tBu) CH ₂ OH used) was added and the mixture stirred and cooled overnight. This afforded an oily solid. The liquors were decanted and retained for chromatography. The oily residue was dissolved in ethyl acetate and evaporated to afford an oil which was crystallised from 10% ethyl acetate in hexane (-500ml) . The solid was filtered to afford 513d (12.2g, 19 ^" : mp. 108-110°C; [α] _D ²⁴ +75.72° (c 0.25, CH ₂ Cl ₂ ) ; IR (KBr) 3361, 1778, 1720, 1517, 1262, 1236, 1222, 1135, 1121, 944, 930, 760; ² H NMR (CDCl ₃ ) δ7.38 (5H, m) , 5.90 (IH, ) , 5.50 (IH, s), 5.37 (0.5H, m) , 5.26 (2.5H, m) , 4.87 (IH, ABq) , 4.63 (3H, m) , 4.31 (IH, m) , 3.07 (IH, dd) , 2.46 (IH, dd) . Anal. Calcd for C ₁₅ H ₁₇ N0 ₅ : C, 61.85; H, 5.88; N, 4.81. Found: C, 61.85; H, 5.89; N, 4.80.

The liquors were combined and evaporated to yield an oil (~200g) containing benzyl alcohol. Hexane/ethyl acetate (9:1, 100ml) was added and the product purified by chromatography eluting with 10% ethyl acetate in hexane to remove the excess benzyl alcohol, and then dichloromethane/hexane (1:1 containing 10% ethyl acetate) . This afforded 513e containing some 513d (20.5g, 32%) : mp. 45-48°C; _. o.] _n ²⁴ -71.26° (c 0.25, CH ₂ C1 ₂ ) ; IR (KBr) 3332, 1804, 1691, 1536, 1279, 1252, 1125,976. ² H NMR (CDCl ₃ ) δ7.38 (5H, m) , 5.91 (IH, m) , 5.54 (IH, d, J - 5.2), 5.38 (3H, m _. ; 4.90 (IH, ABq) ; 4.60 (4H, ) , 2.86 (IH, dd) ; 2.52 (IH,

dd) . Anal. Calcd for C ₁₅ H ₁₇ N0 ₅ '0.1H ₂ 0 C, 61.47; K, 5.91; N, 4.78. Found: C, 61.42; H, 5.88; N, 4.81.

(2JS,3i?) 3- (Allyloxycarbonylammo) -2-ethoxy-5- oxotetrahydrofuran (513f) , was synthesized by a similar method as 513d/e to afford a colourless oil (152mg, 79%) : IR (film) 3334, 2983, 2941, 1783, 1727, 1713, 1547, 1529, 1422, 1378, 1331, 1313, 1164, 1122, 1060, 938; ^λ E NMR (CDC1 ₃ ) 66.09-5.82 (2H, ) , 5.50-5.18 (3H, m) , 4.64-4.54 (2H, m) , 4.27-4.16 (IH, m) , 3.95-3.78 (IH, m) , 3.73-3.56 (IH, m) , 3.05-2.77 (IH, m) , 2.56- 2.37 (IH, m) , 1.35-1.17 (4H, m) . Anal. Calcd for C ₁₀ H ₁₅ NO ₅ : C, 52.40; H, 6.60; N, 6.11. Found: C, 52.16; H, 6.62; N, 5.99. MS (ES ⁺ ) 229 (M ⁺ + 1, 100%) .

(3S,4i?S) t-Butyl 3- (allyloxycarbonylammo) -4-hydroxy-5- (2-phenoxybenzoyloxy)pentanoate (513g) . 4-

Dimethylammo-pyπdme (76. Omg, 622mmol) was added to a solution of 2-phenoxybenzoyl chloride (579mg, 2.49mmo_) and 517 (600mg, 2.07mmol) pyridme (10ml) . The mixture was stirred at room temperature for 18h before adding brme (25ml) and extracting with ethyl acetate (30ml, 20ml) . The combmed organic extracts were washed with IM hydrochloric acid (3 x 25ml) , saturated aqueous sodium hydrogen carbonate (2 x 25ml) and brine (25ml) , dried (MgSO, _} ) and concentrated. The pale orange oil was purified by flash column chromatography (1-10- acetone in dichloromethane) to afford 447mg (44 ) of colourless oil: IR (film) 3375, 2980, 1721, 1712, 1602, 1579, 1514, 1484, 1451, 1368, 1294, 1250,

1234, 1161, 1137, 1081, 754; X NMR (CDC1 ₃ ) δ 7.98-7.93 (IH, m) , 7.50-7.41 (IH, m) , .35-7.25 (2H, m) , ^~7 .22- 7.03 (3H, m) , 6.95 (3H, d) , 5.95-5.76 (IH, m) , 5.57

(IH, d) , 5.30-5.13 (2H, m) , 4.51 (2H, d) , 4.25 (2H, d) , 4.18-4.04 (IH, m) , 3.88 (IH, m) , 3.50 (IH, m) , 2.51 (2H, m) , 1.41 (9H, s) . MS (ES ⁺ ) 508 (57%) , 503 (76), 486 (M ⁺ + 1, 45), 468 (27), 412 (100) . Accurate mass calculated for C ₂₆ H ₃₂ N0 ₈ (MH ⁺ ) : 486.2128. Found: 486.2158.

(3S,4R) t-Butyl (N-allyloxycarbonyl) -3-amino-4-hydroxy- 5- (1-naphthoyloxy)pentanoate (513h) , was prepared from

( 3S, 4R) t-butyl (N-allyloxycarbonyl) -3-amino-4, 5- dihydroxypentanoate by the method described for 513g tc afford 562mg (85%) of a colourless oil: IR(film) 3418, 2980, 1722, 1711, 1512, 1368, 1278, 1245, 1198, 1157,

1139; ¹ H NMR (CDCl ₃ ) δ8.90 (IH, d, J = 8.6), 8.21 (IH, dd, J - 1.2, 7.3), 8.04 (IH, d, J = 8.2), 7.89 (IH, dd, J = 1.5, 7.9), 7.67-7.46 (3H, m) , 5.88 (IH, m) , 5.49

(IH, d, J = 9.0) , 5.35-5.18 (2H, m) , 4.57-4.46 (4H, m) , 4.19 (2H, m) , 2.67 (2H, m) , 1.40 (9H, s) . Anal. Calcd for C ₂ H ₂₉ N0 ₇ : C, 65.00; H, 6.59; N, 3.16. Found: C, 6 644..7744;; HH,, 66..5566;; NN,, 33..0099 M.S (ES ⁺ ) 466 (M+Na, 100: 444 (M+l, 39), 388 (44)

(3S,4i?S) t-Butyl 3- (allyloxycarbonylammo) -4-hydroxy-5- (3-henoxybenzoyloxy)pentanoate (513i) , was synthesized by a similar method as compound 513g to afford a colourless oil (569mg, 85%) : IR (film) 3400, 1723, 1712, 1584, 1528, 1489, 1443, 1367, 1276, 1232, 1190,

1161, 1098, 1074, 995, 755; ^! H NMR (CDC1 ₃ ) δ 8.65-8.59 (IH, d), 7.84-7.66 (2H, m) , 7.45-711 (5H, m) , 7.05-6.97 (2H, m) , 6.00-5.78 (IH, m) , 5.54-5.14 (2H, ) , 4.62- 4.52 (2H, ) , 4.42-4.32 (2H, m) , 4.08-4.22 (2H, m) , 2.78-2.47 (2H, m) , 1.44 (9H, s) . MS (ES ⁺ ) 508 (100. ),

486 (M + 1, 33. Accurate mass calculated for C ₂₆ H ₃ N0 ₈ (MH ⁺ ) : 486.2128. Found: 486.2121.

(3S,4I?S) t-Butyl 3- (allyloxycarbonylamino) -4-hydroxy-5- (5-methyl-3-phenylisoxazoloyloxy)pentanoate (513"j), was synthesized by a similar method as compound 513g to afford a pale orange oil (905mg, 91%) : IR (film) 3418, 3383, 2980, 1722, 1711, 1601, 1517, 1450, 1424, 1368,

1308, 1252, 1154, 1100, 994, 767, 698; ¹ H NMR (CDC1 ₃ ) δ 7.62-7.55 (2H, m) , 7.51-7.42 (3H, m) , 5.98-5.76 (IH, m) , 5.33-5.18 (2H, m) , 4.53 (2H, d) , 4.18 (2H, d) , 3.91 (IH, m) , 3.80 (IH, m) , 2.76 (3H, s), 2.50 (2H, m) , 1.43 (9H, s) . Anal. Calcd for C ₂₄ H ₃₀ N ₂ 0 ₈ •0.5H ₂ 0: C, 59.62; H, 6.46; N, 5.79. Found: C, 59.46; H, 6.24; N, 5.72. MS

(ES 497 (100%: 475 (M + 1, 15) 419 (48

(3S,4R) t-Butyl 3-benzylamιno-4 ,5-

(dimethylmethylenedioxy) -pentanoate (514), was prepared by the method described in H. Matsunaga, et al .

Tetrahedron Letters 24, pp. 3009-3012 (1983) as a pure

?3 diastereomer (60%) as an oil: [α] _D ^" -36.9° (c 0.5, dichloromethane) ; IR (film) 2982, 2934, 1726, 1455, 1369, 1257, 1214, 1157, 1068; ¹ H NMR (CDC1 ₃ ) 67.31 (5H, m) , 4.10 (IH, q, J = 6.0), 4.05-3.75 (4H, ) , 3.10 (IH, q, J = 6.0), 2.40 (2H, m) , 1.42 (9H, s), 1.40 (3H, s), 1.34 (3H, s) .

(3S,4J) t-Butyl 3- (allyloxycarbonylammo) -4 ,5- (dimethylmethylenedioxy)pentanoate (516) . 514 (3.02g, 9.00mmol) and 10% palladium on carbon (300mg) m ethanol (30ml) were stirred under hydrogen for 2h. The suspension was filtered through celite and a 0.45mm membrane and the filtrate concentrated to give a colourless oil 515 (2.106g, 95%) which was used without purification. The oil (1.93g, 7.88mmol) was dissolved in water (10ml) and 1,4-dioxan and sodium hydrogen carbonate added (695mg, 8.27mmol) . The mixture was cooled to 0°C and allyl chloroformate (1.04g, 919ml, 8.66mmol) added dropwise. After 3h the mixture was extracted with ether (2 x 50ml) . The combined ether extracts were washed with water (2 x 25ml) and br e (25ml), dried (MgSO^) and concentrated to give a colourless oil. Flash column chromatography (10-35 ethylacetate in hexane) afforded a colourless solid (2.69g, 95%) : mp. 64-5°C; [α] _D ²³ -21° (c 1.00, CH ₂ C1 ₂ , ; IR (KEr) 3329, 1735, 1702; ¹ H NMR (CDCi ₃ . δ 6.0C- .82 (IH, m), 5.36-5.14 (2H, m) , 542 (IH, s), 4.56 (In, d) , 4.40-4.08 (2K, m) , 4.03 (IH, m) 3.70 (IH, m) , 2.52 ( m) , 1.44 ,12H, 2 x s), 1.33 (3H, s) ; Anal. Calcd for C ₁₆ H ₂₇ N0 ₆ : C, 58.34; H, 8.26; N, 4.25. Founα : C, 58.12; H, 8.16; N, 4.19; MS (+FAB) 320 (M ⁺ +l, 41-) , (70) , 216 (100) .

(35,4_ ) t-Butyl 3- (allyloxycarbonylammo) 4 ,5-dihydroxy pentanoate (517) . A solution 516 (2.44g, 7.41mmol) in 80% aqueous acetic acid (25ml) was stirred at room temperature for 24h then concentrated and azeotroped with toluene (2 x 25ml) . The residue was treated with brine (25ml) and extracted with ethylacetate (2 x 25ml) . The organic fractions were dried (MgSO^) and concentrated to afford a colourless oil. Flash chromatography (20-80% ethyl acetate in dichloromethane) gave a colourless solid (1.99g, 90%) : mp. 74-5°C; [α] _D ²⁵ -1.3° (c 1.0, CH ₂ C1 ₂ ) ; IR (KBr) 1723, 1691; ¹ H NMR (CDC1 ₃ ) 66.02-5.78 (2H, m) , 5.35-5.16 (2H, m) , 4.55 (2H, d) , 4.16-4.04 (2H, m) , 2.76 (2H, s), 3.56 (2H, m) , 2.56 (2H, m) , 1.43 (9H, s. ; Anal. Calcd for C ₁₃ H ₂₃ N0 ₆ : C, 53.97; H, 8.01; N, 4.84. Found : C, 53.79; H, 7.88; N, 4.81; MS(+FAB) 290 (M ⁺ +l, 44%), 234 (100) .

Example 30 Compounds 1105-1125 were prepared as follows. Physical data for these compounds is listed in Table 24.

Table 24

αo

Step A. Synthesis of 401. TentaGel S?. NH ₂ res (0.25 mmol/g, 5.25 g) was placed a sintered glass shaker vessel and washed with dimethyiacetamide (3 X 15 L 1. Compound 400 (1.36 g, 2.3 mmol) was

dissolved in DMA (10 mL) and O-benzotriazole-N, ,N, N' - tetramethyluronium hexafluorophosphate (HBTU; 0.88 g, 2.3 mmol), and DIEA (0.8 mL, 4.6 mmol) were added. The solution was transferred to the resin and a further -5 mL DMA added. The reaction mixture was agitated for 1.5 h at room temperature using a wrist arm shaker. The resin was filtered and washed with dimethyiacetamide (4 X 15 mL) .

Step B. Synthesis of 1102. Resm 401 was deprotected with 20% (v/v) piperidine/dimethylacetamide (15 mL) for 10 min (shaking) and then for 10 m with fresh piperidine reagent (15 ml) . The resin was then washed with dimethyiacetamide (6 X 15 ml), followed by N-methypyrrolidone (2 X 25 mL) . Compound 1101 (0.979 g, 2.11 mmol) was dissolved in dimethyiacetamide (8 mL) . HBTU (0.81 g, 2.1 mmol) and DIEA (0.75 L, 4.3 mmol) were added and the solution added to the resin, followed by dimethyiacetamide (4 mL) . The reaction mixture was agitated for 2 h at room temperature using a wrist arm shaker. The resin work-up was performed as described for 401 to yield 1102.

Step C. Synthesis of 1103. This compound was prepared from resin 1102 (0.040 mmol) using an Advanced ChemTech 396 Multiple Peptide synthesizer. The automated cycles consisted of a resin wash with dimethylformamide (2 X 1 mL) , deprotection with 25 (v/v) piperidme m dimethylformamide (1 mL) for 3 mm followed by fresh reagent (1 mL) for 10 min to yield resm 1103. The resm was washed with

dimethylformamide (3 X 1 mL) and N-methypyrrolidone (3 X 1 mL) .

Resm 1103 was acylated with a solution of 0.4M carboxylic acid and 0. M HOBT N- methypyrrolidone (0.5 mL) , a solution of 0.4M HBTU in N-methylpyrrolidone (0.5 mL) and a solution of 1.6M DIEA in N-methypyrrolidone (0.25 mL) and the reaction was shaken for 2 hr at room temperature . The acylation step was repeated. Finally, the resm was washed with N-methylpyrrolidone (1 X 1 mL) , dimethylformamide (4 X 1 mL) , dichloromethane (5 X 1 mL) and dried m vacuo . The aldehyde was cleaved from the resm and globally deprotected by treatment with 95% TFA/ 5% H ₂ 0 (v/v, 1.5 mL) for 30 mm at room temperature. After washing the resin with cleavage reagent (1 mL) , the combined filtrates were added to cold 1:1 ether:hexane (10 mL) and the resulting precipitate was isolated by centrifugation and decantation. The resulting pellet was dissolved in 10% acetonιtrιle/90% H ₂ O/0.1% TFA (5 mL) and lyophilized to obtain crude 1105-1125 as a white powder. The compound was purified by semi- preparative RP-HPLC with a Ramm Microsorb ^"1 C18 column

(5 μ, 21.4 X 250 mm) elutmg with a lmear acetonitrile gradient (8% - 48%) containing 0.1% TFA (v/v) over 30 mm at 12 itiL/πun. Fractions containing the desired product were pooled and lyophilized to provide 1105- 1125 (10.8 mg, 63*) .

Analytical HPLC methods

(1) Waters DeltaPak C18, 300A (5μ, 3.9 X 150 mm) . Lmear acetonitrile gradient (0% - 25%) containing 0.1 TFA (v/v) over 14 min at 1 mL/min.

(2) Waters DeltaPak C18, 300A (5μ, 3.9 X 150 mm) .

Linear acetonitrile gradient (5% - 45%) containing 0.1 TFA (v/v) over 14 min at 1 mL/min.

261b

518

262b

Benzyl 3- (N'-t-butyloxycarbonylhydrazmo)propionate

(259b) , was synthesized via method used to prepare 259 from 258 to afford a waxy solid (87g, 51 ) : p 54-55°C; IR (film) 3324, 2978, 1732, 1713, 1455, 1367, 1277,

1254, 1171; ¹ H NMR (CDCl ₃ ) δ7.35 (5H, m) , 6.15 (IH, bsy , 5.13 (2H, s), 3.15 (2H, t, J = 6.5) , 2.54 (2H, t, J = 6.5), 1.45 (9H, s) . Anal. Calcd for C ₁₅ H ₂₂ N ₂ 0 ₃ : C, 61.21; H, 7.53; N, 9.52. Found: C, 61.29; H, 7.51; N, 9.51. MS (ES ⁺ ) 295 (M ⁺ + 1) .

(3S) 1-Benzyl 3-t-butyl 2- (N-2-benzyloxycarbonylethyl- NI-2-butoxycarbonylhydrazino) carbonyl hexahydropyridazine dicarboxylate (260b) , was synthesized via method used to prepare 260 from 259 to afford a gum (81g) which was used the next step without purification. Analytical data for a pure sample: IR (film) 3318, 2976, 1733, 1451, 1412, 1393,

1366, 1256, 1161; ¹ H NMR (CDCl ₃ ) δ7.34 (10H, m) , 6.68 (0.5H, bs), 5.11 (4H, m) , 4.63 (0.5H, bs), 4.14 (IH, m) , 3.53 (2H, m) , 3.08 (IH, m) , 2.63 (2H, m) , 2.10-1.60 (4H, ) , 1.60-1.35 (19H, m + 2 x s) .

(3S) t-Butyl 2-(N' -t-butoxycarbonyl-N-2- carboxyethylhydrazino) -carbonylhexahydropyridazme 3- carboxylate (261b) , was synthesized via method used to prepare 261 from 260 to give a gum which was purified by flash chromatography (1:1 ethyl acetate/dichloromethane) to give the title compound 261b (36. Og, 79.4% over 2 stages) : IR (film) 326 ^~ , 2979, 2937, 1728, 1668, 1394, 1369, 1245, 1159; ^" H NMP (CDCl ₃ ) δ7.6 (IH, bs), 6.8 (IH, vbs), 4.47 (IH, bs; , 3.73 (2K, bs), 2.98 (IH, bs) , 2.66 (3H, m) , 2.04 (IH, bs) , 1.84 (IH, ) , 1.6-1.2 (21H, m + s) .

(4S) t-Butyl 7 -t-butoxycarbonylammo-6 , 10-dιoxo- 1 , 2 , 3 , 4 , 7 , 8 , 9 , 10-octahydro-6H-

pyridazino [1 ,2-a] [1,2,4] trιazepme-4-carboxylate

(262b) , was synthesized via method used to prepare 262 from 261 to give the title compound 262b, (18.6g, 54%) as an oil: [α] _n ² ° +47.7° (c 0.236, CH ₂ C1 ₂ ) ; IR (film) 3291, 2978, 1738, 1727, 1690, 1678, 1439, 1243, 1164; ¹ H NMR (CDC1 ₃ ) 66.59 (IH, s), 5.06 (IH, m) , 4.47 (IH, m) , 3.85 (3H, m) , 2.82 (IH, m) , 2.37 (IH, m) , 2.22 (IH, m) , 1.92 (IH, m) , 1.63 (2H, m) , 1.48 and 1.46 (18H, 2 x s) . MS (ES ⁺ ) 399 (M ⁺ + 1) .

(A S) t-Butyl 7-amιno-6, 10-dιoxo-l ,2 ,3,4 , 7 , 8, 9, 10- octahydro-6H-pyπdazιno [1 ,2-a] [1,2,4] trιazepme-4- carboxylate (518) . Compound 262b (2.43g, 6.1mmol) was dissolved in IM hydrogen chloride in ethyl acetate (30ml) and stirred at room temperature for 20h. Solid sodium bicarbonate (4g, 46.5mmol) and water 20ml were added and the mixture stirred for 5mm before separating and extracting the aqueous portion with ethyl acetate. The combmed organic solution was washed with water, saturated salt, dried (MgSO, _} ) and concentrated. Purification by flash chromatography (50 ³ ; ethyl acetate m dichloromethane - 100% ethyl acetate) gave the pure product 518 (1.08g, 59s) as an unstable oil: [α] _D ² ° +82° (c 0.55, CH ₂ C1 ₂ ) ; IR (film) 3331, 2977, 1731, 1680, 1664, 1439, 1420, 1315, 1158; ¹ H NMR (CDCI3) 65.08 (IH, m) , 4.48 (IH, mi , 3.80 ₍ 2H, Abq , 3.70 (2H, bs, exch with D ₂ 0) , 3.53 (IH, m) , 2.75

(IH, m) , 2.30 <2H, m) , 1.88 (IH, m) , 1.71 (2H, m) , 1.4"

(9H, si .

(3S) Methyl l-benzyloxγcarbonyl-hexahydropyrιdazιne-3- carboxylate (520) . 519 (9.4g, 35.6mmol) was suspended methanol (230ml) and cooled to 0°C in an ice bath. Thionyl chloride (3ml, 4.89g, 41.1mmol) was added dropwise over 30mm and the mixture stirred at ambient temperature for 48h. The solvent was removed in vacuo at 30°C and the oily residue dissolved ethyl acetate (500ml) . The organic solution was wasned with saturated sodium bicarbonate, water and br e, dried

(MgS0 ₄ ) and concentrated to give 520 (7.84g, 79 ) as an oil: [ ] _D ²² -25.9° (c 0.615, CH ₂ C1 ₂ ) ; IR (filmj 2953, 1739, 1703, 1694, 1440, 1403, 1357, 1261, 1241, 1174;

^L H NMR (CDC1 ₃ ) 67.36 (5H, s) , 5.18 (2H, s) , 4.00 (IH,

bd) , 3.73 (3H, s), 3.55 (IH, dd) , 3.12 (IH, t) , 2.06 (IH, ) , 1.73 (3H, m) . Anal. Calcd for

C ₁₄ H ₁₇ N ₂ O *0.25H ₂ O: C, 59.46; H, 6.59; N, 9.91. Found: C, 59.44; H, 6.46; N, 10.09.

(3S) 1-Benzyl 3-methyl 2- (N-2-benzyloxycarbonylethyl- Nl-t-butoxycarbonylhydrazmo) carbonyl hexahydropyπdazine dicarboxylate (521) . Usmg a similar method to that described for 260 above, 521 was prepared, 96% as a crude oil: [α] _D 22 -22.16° (c 0.25, CH ₂ C1 ₂ ); IR (film) 3316, 2976, 2953, 1738, 1726, 1714, 1690, 1367, 1260, 1167; ¹ H NMR (CDC1 ₃ ) 67.25 (10H, m) , 6.82 (IH, bs), 5.10 (4H, m) , 4.80 (IH, bs), 4.3-3.4 (6H, m) , 3.10 (IH, m) , 2.59 (2H, m) , 1.95 (2H, m) , 1.44 (10H, m + s) .

(3S) Methyl 2-( N'-t-butoxycarbonyl-N-2- carboxyethy1hydrazmo) -carbonyl hexahydropyridazme 3- carboxylate (522) . Using a similar method to that described for 261 above, 522 was prepared, 92t as a white solid: mp. 146-148°C (deco p) ; [α] _D ²² +27.8° (c 0.25, CH ₂ C1 ₂ ) ; IR (KBr) 3346, 1740, 1710, 1626, 1497,

1290, 1250, 1206, 1179, 1159; ^ NMR (CDCl ₃ ) δ7.60 (IH, bs), 7.5-5.5 (IH, vbs) , 4.64 (IH, bs), 3.76 (5H, m + s), 3.00 (IH, m) , 2.70 (3H, ) , 2.16 (IH, m) , 1.92 (lh, m) , 1.56 (IH, m) , 1.46 (11H, m + s) . Anal. Calcd for C ₁₅ H ₂₆ N ₄ 0 ₇ : C, 48.12; H, 7.00; N, 14.96. Found: C, 48.21; H, 6.96; N, 14.86. MS (ES ⁺ ) 373 (M ^~ - 1) .

(AS) Methyl 7-t-butoxycarbonylammo-6, 10-dιoxo-

1,2,3,4,7,8,9,10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2, ] trιazepιne-4-carboxylate (523) .

522 (7.15g, 19.1mmol) was dissolved in dichloromethane (100ml ) , containing dimethylformamide (0.5ml), and cooled to 0°C. Thionyl chloride (1.6ml, 2.61g, 22mmol) and N-ethyl morpholine (4.86ml, 440mg, 38.2mmol) were added and the mixture stirred for 2h. The organic mixture was washed with 2M sodium bisulphate (50ml), saturated sodium bicarbonate (50ml) and brme (50ml) , dried (MgS0 ₄ ) and concentrated. The residues were triturated with ether to give 523 as a white solid (5.73g, 84%) : mp. 186-188°C (deco p) ;

[α] _D ²² +65.3° (c 0.25, CH ₂ C1 ₂ ) ; IR (KBr) 3298, 2978, 1750, 1720, 1682, 1658, 1455, 1423, 1369, 1316, 1241, 1212, 1160; ^"" H NMR (CDC1 ₃ ) 66.56 (IH, s) , 5.17 (IH, dd) , 4.48 (IH, bd) , 3.81 (3H, m) , 3.75 (3H, s), 2.83 (IH, dt), 2.40 (IH, m) , 2.28 (IH, m) , 1.95 (IH, m) , 1.67 (IH, m) , 1.47 (9H, s) . Anal. Calcd for

C ₁₅ H ₂₄ N ₄ 0 ₆ *1/6H ₂ 0: C, 50.13; H, 6.82; N, 15.59. Found: C, 50.12; H, 6.71; N, 15.58. MS (ES ⁺ ) 357 (M ⁺ - 1, 46%) , 301 (100%) .

(4S) Methyl 7-amιno-6, 10-dιoxo-l ,2 ,3, ,7,8, 9, 10- octahydro-6H-pyrιdazιno[1,2-a] [1,2,4] tπazepme-4- carboxylate (524), was synthesized from 523 via method used to prepare 518.

Compounds 262a- were synthesized via methods used to prepare 211b-f.

262 263

262a-k 263a-k

(AS) t-Butyl 6,10-dιoxo-7- (2-naphthyl) sulfonamide-

1,2,3,4,7,8,9,10-octahydro-6H- pyridazinofl ,2-a] [1,2,4] triazepme-4-carboxylate

(262a) . 443mg (91%) of the title compound was obtamed: mp. 56-7°C; 25

OM D +76° (c 0.15, CH ₂ C1 ₂ ) ; IR

(KBr) 3429, 2979, 1734, 1675, 1418, 1369, 1339, 1323, 1244, 1164, 665; ^X H NMR (CDC1 ₃ ) 68.45 (IH, s) , 8.00-7.59 (7H, m) , 4.69-4.65 (IH, m) , 4.25-4.12 (IH, m) , 4.10- 3.99 (IH, m) , 3.73-3.55 (2H, ) , 2.40-2.30 (IH, m) , 1.99-1.91 (IH, m) , 1.82-1.62 (2H, m) , 1.48-1.46 (2H, m) , 1.37 (9H, s) . Anal . Calcd for C ₂₃ H ₂₈ N ₄ 0 ₆ S»H ₂ 0: C, 54.53; H, 5.97; N, 11.06. Found: C, 54.60; H, 5.^3; N, 10.95. MS (ES ⁺ ) 489.

(4S) t-Butyl 6, 10-dιoxo-7- (3-methoxyphenylureιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2,4]trιazepιne-4-carboxylate

(262c), 120mg (80 ) of colourless foam was obtained:

[α] _D ²² +22.6° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3316, 1732, 1671, 1609, 1551, 1495, 1455, 1432, 1316, 1288, 1245, 1218, 1158, 1122, 1023; ¹ H NMR (CDC1 ₃ ) 67.16 (4H, m) , 6.79 (IH, m) 6.60 (IH, m) , 5.11 (IH, ) , 4.59 (IH, m) , 3.89 (2H, m) , 3.77 (3H, s), 3.72 (2H, m) , 2.85 (IH, m)

(A S) t-Butyl 6,10-dioxo-7- (2-methoxyphenylureιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H-pyridazino

[1,2-a] [1,2,4]triazepιne-4-carboxylate (262d) , (81%)

22 was obtained as colourless foam: _o.] _D +3.7° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3468, 3446, 3269, 1734, 1698, 1667, 1609, 1555, 1490, 1461, 1433, 1423, 1296, 1246, 1215, 1173, 1157, 1028, 756; ^"" H NMR (CDCl ₃ ) 68.23 (IH, m) , 7.95 (IH, s), 6.95 (4H, ) , 5.15 (IH, m) , 4.60 (IH, m) , 3.98-3.65 (4H, m) , 3.89 (3H, s), 2.90 (IH, m) , 2.48 (IH, m) , 2.25 (IH, m) , 2.05-1.65 (2H, m) , 1.48 (9H, s) .

(AS) t-Butyl 6,10-dioxo-l,2,3,4 ,7,8, 9, lO-octahydro-T- phenylacetylamino-βH- pyridazino[1,2-a] [1,2,4] triazepine-4-carboxylate

(262e) , was obtained as a white foamy solid (155mg, 53%) : mp. 53-7°C; [α] _D ²² +57.4° (c 0.1, CH ₂ C1 ₂ ) ; IR

(KBr) 3271, 2978, 1733, 1680, 1437, 1314, 1245, 1156; ¹ H NMR (CDC1 ₃ ) 67.46 (IH, s), 7.42-7.20 (5H, m) , 5.03 (IH, dd), 4.52-4.40 (IH, m) , 3.96-3.70 (2H, m) , 3.70- 3.49 (IH, m) , 3.63 (2H, s), 2.92-2.75 (IH, ) , 2.43- 2.33 (IH, m) , 2.33-2.15 (IH, m) , 2.00-1.50 (3H, ! , 1.45 (9H, s) . Anal. Calcd for C ₂₁ H ₂₈ N ₄ 0 ₅ •0.25H ₂ 0: C,

59.91; H, 6.82; N, 13.31 Found: C, 60.19; H, 6.30; N, 1 133..3300.. MMSS ((EESS ⁺⁺ )) 418 (M~ + 2, 25%) , 417 (M ⁺ + 1, 100), 362 (9), 361 (45)

(A S) t-Butyl 6,10-dioxo-l,2,3,4 ,7,8, 9,lO-octahydro^- tS-phenylureido) -6H-pyridazmo[1,2-a] [1,2,4] triazepme- 4-carboxylate (262 ) , was obtained as a white solid (273mg, 93%) : mp. 102-6°C; (α] _D ²² +7.5° (c 0.07, CH ₂ C1 ₂ ) ; IR (KBr) 3320, 2979, 1731, 1676, 1669, 1601, 1549, 1444, 1314, 1240, 1156; ¹ H NMR (CDC1 ₃ ) δ 7.37-7.20 (6H, m) , 7.08-6.98 (IH, m) , 5.12 (IH, dd) , 4.64-4.55 (IH, m) , 4.02-3.78 (2H, ) , 3.75-3.65 (IH, m) , 2.94- 2.75 (IH, m) , 2.57-2.35 (IH, m) , 2.35-2.20 (IH, m) , 2.00-1.50 (3H, m) , 1.48 (9H, s) . Anal. Calcd for

C ₂₀ H ₂₇ N ₅ O ₅ «0.4H ₂ O: C, 56.56; H, 6.60; N, 16.49. Found: C, 56.89; H, 6.58; N, 16.07. MS (ES ⁺ ) 419 (M ⁺ + 2, 24%), 418 (M ⁺ + 1, 100), 363 (15), 362 (81) , 242 (10) .

(4S) t-Butyl 6, 10-dioxo-7- (ιndole-2-carboxamido) - 1,2,3,4,7,8,9,10-octahydro-6H-pyridazιno

[1,2-a] [1,2,4]triazepιne-4-carboxylate (262g) , (13g) was obtained as a white solid (298mg, 70%) : mp. 138- 43°C; [α] _D ²³ +69.8° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3282, 2978, 1733, 1664, 1536, 1421, 1310, 1156, 748; ¹ H NMR (CDC1 ₃ ) 69.67 (IH, s), 9.53 (IH, s) , 7.50 (IH, d) , 7.30- 7.15 (2H, m) , 7.10-7.00 (IH, m) , 6.93 (IH, s) , 5.16- 5.12 (IH, m) , 4.60-4.50 (IH, m) , 4.05-3.85 (2H, m) , 3.85-3.70 (IH, m) , 3.05-2.90 (IH, m) , 2.55-2.35 (IH, m) , 2.35-2.20 (IH, m) , 2.00-1.85 (IH, m) , 1.85-1.50 (2H, m) , 1.47 (9H, s) . Anal. Calcd for

C ₂₂ H ₂₇ N ₅ O ₅ '0.45H ₂ O: C, 58.77; H, 6.26; N, 15.58. Found: C, 59.14; H, 6.24; N, 15.18. MS (ES ⁺ ) 433 (M ⁺ + 2, 26%), 442 (M ⁺ + 1, 100), 387 (17), 386 (79), 285 (20) , 229 (85), 211 (26) , 185 (15), 183 (57), 139 (9) .

(4S) t-Butyl 7- [ (4-acetamιdo) benzamido] -6, 10-dιoxo- 1,2,3,4,7,8, 9,10-octahydro-6H-pyπdazmo[l,2-a] [1,2,4] - trιazepιne-4-carboxylate (262h) , was obtained as a white solid (325mg, 73%) : mp. 209-12°C; [α] _D ²⁴ +62.4° 5 (c 0.2, CH ₂ C1 ₂ ) ; IR (KBr) 3513, 3269, 2980, 1731, 1680, 1653, 1599, 1531, 1314, 1158; ¹ H NMR (CDCl ₃ ) δ9.40 (IH, s) , 8.75 (IH, s) , 7.72 (2H, d) , 7.47 (2H, d) , 5.15-5.05

(IH, m) , 4.55-4.45 (IH, m) , 4.05-3.70 (3H, m) , 3.00- 2.80 (IH, m) , 2.45-2.35 (IH, m) , 2.30-2.15 (IH, m) , 0 2.10 (3H, s) , 2.00-1.80 (IH, m) , 1.80-1.50 (2H, m) ,

1.48 (9H, s) . Anal. Calcd for C ₂₂ H ₂₉ N ₅ 0 ₆ : C, 57.51; H,

6.36; N, 15.24. Found: C, 57.41; H, 6.38; N, 15.12. MS (ES ⁺ ) 461 (M ⁺ + 2, 26%), 460 (M ⁺ + 1, 100) , 405 (] 404 (55), 354 (7), 285 (23), 229 (52), 183 (22) .

5 (AS) t-Butyl 6, 10-dιoxo—7- (4-methoxybenzoylammo) - octahydro-6H-pyπdazιno[1,2-a] [1,2,4] tπazepine- carboxylate (262ι), was obtained as a white glassy solid (76%) : mp. 85-9°C; [α] _D ²⁵ +66.4° (c 0.11, CH ₂ C1 ₂ ); IR (KBr) 1732, 1668, 1607, 1502, 1440, 1312, 0 1295, 1258, 1176, 1157, 1025; ¹ H NMR (CDC1 ₃ ) δ 8.25 (13, s) , 7.77 (2H, m) , 6.90 (2H, m) , 5.11-5.07 (IH, m) , 4.55-4.48 (IH, m) , 4.01-3.91 (2H, m) , 3.86-3.78 (IH, m) , 3.85 (3H, s), 2.98 (IH, m) , 2.46-2.40 (IH, m) , 2.26-2.20 (IH, ) , 2.05-1.80 (IH, m) , 1.70-1.64 (2H, 5 m) , 1.48 (9H, s) .

(AS) t-Butyl 6,10-dιoxo-l ,2,3,4 ,7,8,9, 10-octahydro-7- phenylsulphonylammo-6H- pyridazino[1 ,2-a] [1,2,4] trιazepιne-4-carboxylate (2623), ^was obtained as a white crystalline solid C (79,) : mp. 182-3°C (dec) ; ( j _D ²² +92.1° (c 0.4, CH-.C1-.) ;

IR (KBr) 3283, 1732, 1684, 1448, 1430, 1404, 1369, 1338, 1306, 1285, 1242, 1169, 1091, 692; ¹ H NMR (CDCl ₃ ! 67.89 (2H, d, J = 7.4), 7.76 (IH, s), 7.64-7.49 (3H, m) , 4.83 (IH, m) , 4.35 (IH, brd, J = 13.0) , 4.00 (IH, m) , 3.74-3.63 (2H, m) , 2.39-2.26 (2H, m) , 2.06 (IH, m) , 1.50-1.41 (10H, ) . Anal. Calcd for C ₁₉ H ₂₆ SN ₄ 0 ₆ : C,

2.04; H, 5.98 N, 12.78. Found: C, 52.11; H, 5.95; N,

12.71. MS (ES ⁺ ) 437 (M ⁺ - 1, 100%

(3S) t-Butyl (7- (4-benzyloxyphenyl) carbonylamino-6, 10- dioxo-1 ,2,3,4 ,7,8,9,10-octahydro-6H-pyridazιno

[1,2-a] [1,2,4] triazepine-4-carboxylate (262k), (83°) was obtamed: [α] _D ²² +42.3°. (c 0.11, CH ₂ C1 ₂ ) ;.IR (KBr) 3287, 2997, 2935, 1735, 1681, 1606, 1501, 1296, 1248, 1173,1155. ¹ H NMR (CDCl ₃ ) δ 9.23 (IH, s) , 7.73 (2H, d) , 7.38 (5H, m) , 6.85 (2H, d) , 5.08 (IH, m) , 5.02 (2H, s) , 4.48 (IH, bd) , 4.15-3.65 (3H, m) , 2.96 (IH, m) , 2.45- 2.10 (2H, m) , 1.88 (IH, m) , 1.63 (2H, m) , 1.48 (9H, s) . M.S. (ES ⁺ 509 (M ⁺ +l) .

Compounds 263a-k were synthesized via methods used to prepare 212b-f.

(A S) 6, 10-Dioxo-7- (2-naphthalenesulfonyl) amino- 1,2,3,4,7,8,9,10-octahydro-6H- pyridaz o[1,2-a] [1 ,2,4] triazepιne- -carboxylic acid (263a), 348mg (94o) obtained as a white foamy solid: mp. [ ] _D ²¹ +171° (c 0.056, CH ₂ C1 ₂ ) ; IR (KBr; 3426, 3233, 2953, 1734, 1663, 1481, 1415, 1340, 1214, 1167, 1132, 1075, 668; ¹ H NMR (CDCl ₃ ) δ 8.44 (IH, s) , 8.00-7.60 (7H, m) , 4.85-4.83 (IH, m) , 4.25-4.00 (IH, m) , 4.07-3.90 (IH, m) , 3.70-3.46 (2H, m) , 2.38-2.30 (IH, m) , 2.12-

2.01 (IH, m) , 1.91-1.83 (IH, m) , 1.46-1.26 (IH, m) , 1.13-1.06 (IH, m) , 0.90-0.77 (IH, m) . MS (ES ⁺ ) 431.

(AS) 1- (Benzo[b] thιophene-2-carbonyl)amιno-6, 10-dιoxo- 1,2,3,4 , 7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1 ,2 ,4 ] triazepme-4-carboxylic acid

(263b) . 200mg (100%) was obtained as a white solid: mp. 155°C; [α] _D ² ° +13° (c 0.07, CH ₂ C1 ₂ ) ; IR (KBr) 3431, 2935, 1734, 1663, 1531, 1435, 1292, 1177; ¹ H NMR (CDC1 ₃ ) 69.73 (IH, bs) , 7.73-7.27 (5H, ) , 5.35-5.25 (IH, m) , 4.56-4.48 (IH, m) , 4.05-3.65 (3H, m) , 3.12- 3.00 (IH, m) , 2.50-2.45 (IH, m) , 2.30-2.20 (IH, m) , 2.10-2.00 (IH, m) , 1.75-1.61 (2H, m) . MS (ES ⁺ ) 401.

(4S) 6, lO-Dιoxo-7- (3-methoxyphenylureιdo) - 1,2,3,4 ,7,8,9,10-octahydro-6H- pyridazino[l ,2-a] [1 ,2 ,4] trιazepιne-4-carboxylic acid

(263c), 216mg, (100+%) obtamed as a colourless foam: [α] _D ²³ 32.5° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3326, 1730, 1661, 1610, 1555, 1495, 1431, 1314, 1288, 1217, 1175, 1161; ¹ H NMR (CDCl ₃ ) δ7.87 (IH, s) , 7.58 (IH, s) , 7.19 (2H, m) , 6.82 (IH, m) , 6.62 (IH, m) , 5.21 (IH, m) , 4.55 (IH, m) , 3.76 (3H, s) , 4.0-3.65 (4H, ) , 2.85 (IH, ) , 2.35 (2H, m) , 1.75 (IH, m) , 1.71 (2H, m) .

(AS) 6, lO-Dιoxo-7- (2-methoxyphenylureιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2,4] trιazepine- -carboxylic acid

° (263d), (100+1) obtamed as colourless foam: [α_

+11.7° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3394, 3325, 1666,

1603, 1543, 1490, 1463, 1438, 1329, 1311, 1292, 1249,

1214, 1176, 1119, 1024, 752; HI NMR (CDC1 ₃ ) 68.15 (IH,

m) , 7.97 (2H, m) , 7.15-6.84 (3H, m) , 5.29 (IH, m) , 4.62 (IH, m) , 4.04-3.65 (4H, m) , 3.89 (3H, s), 2.92 (IH, m) , 2.50 (IH, m) , 2.30 (IH, m) , 2.10-1.75 (2H, m) .

(AS) 6,10-Dioxo-1,2,3,4 ,7,8, 9,10-octahydro-7- phenylacetyl-amino-6H- pyridazino[l,2-a] [1,2,4] triazepine- -carboxylic acid

(263e) , obtained as a white foamy solid (117mg, 98%) : mp. 109-14°C; [α] _D ²⁴ +82.6° (c 0.06, CH ₂ C1 ₂ ) ; IR (KBr) 3700-2250 (br) , 3437, 3274, 2959, 1733, 1664, 1481, 1437, 1310, 1177; ^X H NMR (CDCl ₃ ) δ7.99 (IH, s) , 7.40- 7.15 (5H, m) , 5.15-5.10 (IH, m) , 5.25-4.70 (IH, bs) , 4.50-4.35 (IH, m) , 3.95-3.50 (3H, ) , 3.61 (2H, s), 2.93-2.78 (IH, m) , 2.40-2.20 (2H, m) , 2.10-1.80 (IH, m) , 1.80-1.60 (2H, m) . Anal. Calcd for C ₁₇ H ₂₀ N ₄ O ₅ • 1H ₂ 0: C, 53.96; H, 5.86; N, 14.81. Found: C, 54.12; H, 5.50; N, 14.68. MS (ES ⁺ ) 360 (M+, 21%), 359 (M ⁺ - 1, 100), 196 (14) , 182 (14) , 111 (7) .

(4S) 6, 10-Dioxo-l ,2,3,4,7,8, 9,10-octahydro-7- (3- phenylureido) -6H-pyridazino[1,2-a] [1,2,4] triazepine-4- carboxylic acid (263f) , obtained as a white foamy solid (199mg, 92%) : mp. 149-52°C; [α] _D ²⁴ +92.0° (c 0.01, CH ₃ OH) ; IR (KBr) 3700-2300 (br) , 3319, 2956, 1726, 1664, 1600, 1548, 1500, 1444, 1313, 1238, 755; ¹ H NMR

(D ₆ -DMS0) δ 8.90 (IH, s), 8.24 (IH, s), 7.42 (2H, d) , 7.30-7.20 (2H, m) , 7.00-6.90 (IH, m!, 4.98-4.92 (IH, m) , 4.32-4.22 (IH, m) , 3.80-3.55 (3H, m) , 2.85-2.70

(IH, m) , 2.30-2.20 (IH, m) , 2.20-2.00 (IH, m) , 1.90- 1.35 (3H, m) . Anal. Calcd for C ₁₆ H ₁₉ N ₅ 0 ₅ • 0.75H ₂ 0: C, 51.26; H, 5.51; N, 18.68. Found: C, 51.11; H, 3.23; N,

18.42. MS (ES 361 (M+, 20%) 360 (M 1, 100;, 241 (11), 240 (89), 196 (15), 175 129), 111 12) .

(AS) 6,lO-Dιoxo-7- (ιndole-2-carboxamιdo) - 1,2,3,4 ,7,8,9,10-octahydro-6H- pyrιdazιno[l ,2-a] [1 ,2,4] trιazepme-4-carboxylic acid

(263g) , was obtamed as a white solid (259mg, 92 )mp. 248-51°C; [α] _D ²⁴ +94.0° (c 0.01, CH ₃ OH) ; IR (KBr) 370C- 2300 (br) 3341, 2956, 1738, 1668, 1651, 1529, 1425, 1311, 1259, 751; ¹ H NMR (D ₆ -DMSO) δ 13.29 (IH, bs) , 11.72 (IH, s), 10.64 (IH, s), 7.65 (IH, d) , 7.45 (IH, d) , 7.26-7.15 (IH, m) , 7.17 (IH, s), 7.10-7.00 (IH, m) , 5.05-4.95 (IH, m) , 4.40-4.25 (IH, m) , 3.90-3.50 (3H, m) , 2.88-2.75 (IH, ) , 2.38-2.20 (IH, m) , 2.20-2.00 (IH, ) , 1.90-1.35 (3H) . Anal. Calcd for C ₁₈ H _ιg N ₅ O ₅ '0.5H ₂ O: C, 53.59; H, 5.25; N, 17.35. Found

+ .

C, 53.66; H, 4.88; N, 17.11. MS (ES ) 385 (M+, 23%),

38844 ((MM ⁺⁺ -- 11,, 110000)) ,, 229988 ((66)) ,, 225533 (8) , 227 (10) , 199 23) , 196 (10), 173 (9) , 126 (21!

(AS) 7- [ ( 4 -Ace tami do) benzamido ] -6 , 10-dιoxo- 1,2,3,4 , 7,8,9, 10-octahydro-6H- pyπdazino [1 ,2-a] [1 ,2 ,4 ] trιazepιne-4 -carboxylic acid (263h) , was obtained as a white solid (282mg, 99 ) : mp . 210-5°C; [ ] _D ²⁴ +74.5° (c 0.01, CH ₃ OH) ; IR (KBr) 3700- 2330 (br) 3444, 3316, 2960, 1664, 1599, 1531, 1439, 1331, 1184; ¹ H NMR (D ₆ -DMSO) δ 13.30 (IH, bsj , 10.50 (IH, sA 10.25 (IH, s) , 7.80 (2H, d) , 7.68 (2H, d) , 5.00-4.90 (IH, m) , 4.35-4.25 (IH, m) , 3.90-3.40 (3H, m. , 2.88-2.70 (IH, m) , 2.35-2.25 (IH, m) , 2.25-1.95 (IH, m), 2.08 (3H, s) , 1.95-1.35 (3H, m) . MS (ES ^T , 403

(M+, 10%), 402 (M ⁺ - 1, 100), 358 (10) , 247 (10), 227 (16) , 219 (51) , 198 (12) , 184 (17) .

(4S) 6,10-Dιoxo—7- (4-methoxybenzoylamino) -octahydro-6H- pyrιdazιno[l ,2-a] [1,2,4]triazep e-carboxylic acid (263ι) , was obtained as a white glassy solid (approx 100%) used without purification: ¹ H NMR (CDC1 ₃ ) 69.23 (IH, s), 7.72 (2H, d, J = 8.8), 6.81 (2H, d, J = 8.9), 5.22 (IH, m) , 4.51 (IH, m) , 3.97-3.72 (2H, m) , 3.81 (3H, s) , 3.03 (IH, m) , 2.51-2.46 (IH, ) , 2.31-2.25 (IH, m) , 2.03 (IH, m) , 1.72 (2H, m) .

(AS) 6, 10-Dιoxo-l,2,3,4,7,8,9,10-octahydro-7- phenylsulphonylammo-6H- pyridazino[1,2-a] [1,2 ,4]tπazepιne-4-carboxylιc acid

(2633), was obtamed as a white solid (100%) : mp. 73- 83°C (dec) ; [α] _D ²² +104.7° (c 0.3, CH ₂ C1 ₂ ) ; IR (KBr) 3600-2500 (br), 3208, 1734, 1666, 1481, 1448, 1416, 1338, 1311, 1214, 1171, 1091, 729, 689; ¹ H NMR (CDC1 ₃ ) 6 7.87 (3H, m) , 7.70-7.50 (3H, m) , 7.16 (IH, brs) , 4.99 (IH, m) , 4.37 (IH, brd, J = 12.8), 3.92 (IH, m) , 3.67 (2H, ) , 2.36 (2H, m) , 2.13 (IH, brd, J = 12.2), 1.56 (3H, m) . Anal. Calcd for C ₁₅ H ₁₈ SN ₄ 0 ₆ *0.25CF ₃ C0 ₂ H: C, 45.31; H, 4.48 N, 13.64. Found: C, 45.48; H, 4.71; N, 13.43. MS (ES ⁺ ) 383 (MH ⁺ , 100%) . Accurate mass calculated for C ₁₅ H ₁₉ SN ₄ 0 _b (MH ⁺ ) : 383.1025. Found: 383.1007.

(4S) 7- (4-Benzyloxyphenyl) carbonylamino-6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridaz o[1 ,2-a] [1,2,4] trιazepme- -carboxylic acid (263k), (100c) obtamed: mp. 130-142°C; IR (KBri 32^2,

2945, 1738, 1650, 1611, 1501, 1445, 1309, 1255, 1171; ^X H NMR (CDC1 ₃ ) 69.35 (IH, s), 7.74 (2H, d) , 7.38 (5H, m) , 6.85 (2H, d) , 5.40 (IH, bs), 5.19 (IH, s), 5.02 (2H, s), 4.49 (IH, d) , 3.92 (2H, m) , 3.68 (IH, m) , 2.99 (IH, bs), 2.43 (IH, bs) , 2.22 (IH, bs), 1.99 (IH, bs) , 1.68 (2H, bs) .

5251 2631

(A S) Methyl 6 , 10-dιoxo-7- (3 , 4 - methylenedioxybenzoylamino) -1,2,3,4,7,8,9, 10-octahydro- 6H-pyridazmo[1,2-a] [1,2,4] tπazepιne-4-carboxylate

(5251) , was synthesized via method used to prepare 211 to afford a white crystalline solid (3.35g, 83%) : mp. 214-5°C; [α] _D ² ° +75.2° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3272, 2955, 1747, 1664, 1610, 1485, 1443, 1265, 1040; ^X H NMR (CDCI ₃ ) 6 8.66 (IH, s), 7.32 (IH, dd) , 7.23 (IH, d) , 6.76 (IH, d) , 6.02 (2H, s), 5.20 (IH, dd) , 4.55-4.45 (IH, m) , 4.03-3.70 (3H, m) , 3.78 (3H, s) , 3.05-2.88 (IH, m) , 2.47-2.35 (IH, m) , 2.35-2.20 (IH, m) , 2.10- 1.90 (IH, ) , 1.85-1.50 (2H, m) . Anal. Calcd for C ₁₈ H ₂₀ N ₄ O ₇ '0.5H ₂ O: C, 52.87; H, 5.06; N, 13.70. Found: C, 52.84; H, 5.00; N, 13.66. MS (ES ⁺ ) 406 (M ⁺ + 2, 20%), 405 (M ⁺ + 1, 100), 391 (10), 162 (6) , 148 (3), 105 (2) .

(AS) 6,lO-Dιoxo-7- (3,4-methylenedioxybenzoylammo) - 1,2,3,4,7,8,9, 10-octahydro-6H-

pyridazino[1,2-a] [1 ,2,4] trιazepme-4-carboxylιc acid

(2631) . A suspension of 5251 (3.32g, 8.2mmol) in tetrahydrofuran (60ml) was treated with a solution of LιOH*H ₂ 0 (0.69g, 16.4mmol, 2.0 equiv) m water (20ml) . The resulting mixture was stirred for lh, concentrated and the residue dissolved in water (50ml) . The solution was acidified using 2M. NaHS0 ₄ and the product extracted with EtOAc (100ml and 50ml portions) . The combmed extract was washed once with br e (2 x 50mlj , dried (MgS0 ₄ ) and concentrated to afford 2631 as a white crystalline solid (2.87g, 90*) : mp. 154-8°C; [α] _D ² ° +85.6° (c 0.01, CH ₃ 0H) ; IR (KBr) 3700-2300 (br) , 3248, 2942, 1733, 1681, 1658, 1648, 1536, 1486, 1440, 1297, 1255, 1037; ¹ H NMR (D ₆ -DMSO) δ 13.23 (IH, bs) , 10.45 (IH, s), 7.45 (IH, d) , 7.35 (IH, s), 7.03 (IH, d) , 6.12 (2H, s), 5.00-4.93 (IH, m) , 4.35-4.25 (IH, m) , 3.90-3.40 (3H, m) , 2.95-2.70 (IH, m) , 2.40-2.25 (IH, m) , 2.15-2.00 (IH, m) , 1.91-1.40 (3H, m) . Anal. Calcd for C ₁₇ H ₁₈ N ₄ O ₇ ^« 0.8H ₂ O: C, 50.45; H, 4.88; N, 13.84. Found: C, 50.80; H, 4.95; N, 13.36. MS (ES ⁺ ) 390 (M ⁺ , 19%), 389 (M ⁺ - 1, 100), 345 (9), 204 (31), 182 (27), 111 (12) .

264a, c-1 265a, c, d, f 1015, 1018, 1027, 1052, 1056, 1075, 1095

[4S(2S,3S) ] N- (2-Benzyloxy-5-oxo-tetrahydrofuran-3-yl) - 6, 10-dioxo-7- (2-naphthalenesulfonyl) amino- 1,2,3,4 , 7,8,9, 10-octahydro-6H- pyridazino[l ,2-a] [1,2,4] triazepine-4-carboxamide

(264a), was synthesized by a similar method as compound 213e to afford a white solid (240mg, 82%) : IR (KBr) 3380, 3066, 2947, 1789, 1750, 1691, 1454, 1417, 1368, 1298, 1262, 1235, 1193, 1118, 756, 696; H NMR (Dg- DMSO) 6 8.59 (IH, d, J = 6.8) , 8.48 (IH, s) , 8.25-8.09 (3H, m) , 7.85-7.75 (3H, m) , 7.36 (5H, m) , 5.39 (IH, m) , 4.21 (2H, AB, J = 14.2) , 4.53-4.49 (IH, m) , 4.25-4.10 (2H, m) , 3.65-3.44 (3H, m) , 3.13-2.99 (IH, m), 2.43- 2.16 (IH, ) , 1.72-0.72 (7H, m) . Anal. Calcd for

C ₃₀ H ₃₁ N ₅ O ₈ S: C, 57.96; H, 5.03; N, 11.27. Found: C,

+.

57.21 H, 5.14; N, 10.4: MS (ES 622

[ A S (2 S, 3S) ] N- (2-Benzyloxy-5-oxo-tetrahydrofuran-3-yl) - 6, 10-dioxo—7- (3-methoxyphenylureido) -1,2,3,4,7,8,9, 10- octahydro-6H-pyridazino[l,2-a] [1,2,4] triazepine-1- carboxamide (264c) , was prepared by a similar method as

213e, (551) as a colourless foam: mp . 135-40°C; _l αj _D "' ^'' +51.6° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3314, 1790, 1664,

1608, 1543, 1496, 1455, 1428, 1325, 1287, 1250, 1218, 1160, 1118; ¹ H NMR (CDC1 ₃ ) 68.00 (IH, d, J = 7.1), 7.66

(IH, s) , 7.55 (IH, s) , 7.28 (5H, ) , 7.14 (2H, m) , 6.87

(IH, d, J = 7.4) , 6.59 (IH, m) , 5.42 (IH, s) , 4.66 (5H,

5 m) , 3.90-3.65 (4H, m) , 3.73 (3H, s) , 2.98 (2H, ) , 2.38 (2H, m) , 2.01-1.65 (3H, m) .

[ A S (2S _r 3S) ] N- (2-Benzyloxy-5-oxo-tetrahydrofuran-3-yl) - 6, 10-dioxo-7- (2-methoxyphenylureιdo) -1,2,3,4,7,8,9,10- octahydro-6H-pyridazιno [1,2-a] [1,2,4] trιazepιne-1- 0 carboxamide (264d) , was prepared by a similar methoα as 213e, (72%) as colourless foam: [α] _D ²² +21.4° (c 0.1, CH ₂ C1 ₂ ); IR (KBr) 3302, 1791, 1689, 1678, 1664, 1602, 1536, 1489, 1461, 1437, 1420, 1249, 1119, 1023, 942,

751; ¹ H NMR (CDC1 ₃ ) 68.07 (IH, d, J = 7.7) , 7.82 (IH, 5 s) , 7.68 (IH, d, J = 6.7), 7.49 (IH, s) , 7.34 (5H, m) , 6.96 (3H, m) , 5.47 (IH, s) , 4.82 (2H, d + m, J = 11.5) , 4.63 (IH, d, J = 11.5) , 4.49 (2H, m) , 3.85 (4H, s + m) , 3.68 (2H, ) , 3.01 (2H, m) , 2.46 (2H, m) , 1.95 '3H, ) , 1.57 (IH, m) .

0 [ A S (2RS, 3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) - 6, 10-dιoxo-l ,2,3,4,7,8,9, 10-octahydro-7- phenylacetylamιno-6H- pyridaz o [1 ,2-a] [1 ,2 , 4 ] trιazepme- -carboxamide (264e) was synthesized via a similar method as used tc prepare ^C 213e to afford a mixture of diastereomers (Syn:antι isomer ratio 9:1) as a white glassy solid (128mg, 78' ) : mp. 1C3-8°C; IR (KBr) 3419, 3302, 1793, 1664, 1535, 1421, 1327, 1256, 1123, 973; ^λ H NMR (D ₆ -DMSO) δ 1C.20 (0.9H, s) , 9.35 (0.1H, s) , 8.74 (0.1H, d) , 8.49 (0.9H, C d' , 7.36-7.15 (10H, m) , 5.67 (0.9H, d) , 5.44 (0.1H, sj ,

4.85-4.75 (IH, m) , 4.74-4.60 (IH, m) , 4.77 and 4.63 (2H, dd), 4.30-4.10 (IH, m) , 3.80-3.40 (3H, m) , 3.43 (2H, s) , 3.10-2.40 (3H, m) , 2.25-2.15 (IH, m) , 2.00- 1.35 (4H, m) . Anal. Calcd for C ₂₈ H ₃₁ N ₅ 0 ₇ •0.5H ₂ 0: C, ^" 60.21; H, 5.77; N, 12.53. Found: C, 60.38; H, 5.83; N, 12.13. MS (ES ⁺ ) 551 (M ⁺ + 2, 33%), 550 (M ⁺ + 1, 100) , 480 (7) , 343 (8) , 279 (4) .

[ A S (2RS, 3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) - 6,10-dioxo-l,2,3,4,7,8,9,10-octahydro-7-(3- phenylureido) -6H-pyridaz o[1 ,2-a] [1,2,4] tπazepιne-4- carboxamide (264f) , was prepared by a similar method as compound 213e to afford the pure syn-isomer as a white foamy solid (225mg, 82%) : mp. 130-5°C; [α. _D ^{24 +} 10.8° (c 0.1, CH ₂ C1 ₂ ) ; IR (KBr) 3316, 1791, 1688, 1676, 1664, 1601, 1536, 1445, 1314, 1242, 973; ¹ H NMR (Dg-DMSO) δ 8.84 (IH, s), 8.49 (IH, d) , 8.19 (IH, s), 7.45-7.18 (9H, m) , 7.00-6.90 (IH, m) , 5.68 (IH, d) , 4.90-4.81 (IH, m) , 4.75-4.60 (IH, m) , 4.78 and 4.63 (2H, dd) , 4.30-4.20 (IH, m) , 3.75-3.55 (3H, m) , 2.85-2.55 (3H, m) , 2.25-2.15 (IH, m) , 2.00-1.35 (4H, m) . Anal. Calcd for C ₂₇ H ₃₀ N ₆ O ₇ ^« 0.5H ₂ O: C, 57.95; H, 5.58; N, 15.02. Found: C, 58.12; H, 5.64; N, 14.81. MS (ES ⁺ ) 552 (M ⁺ - 2, 30%) , 551 (M ⁺ + 1, 100), 362 (19), 299 (10), 279 (4) .

[ A S (2S, 3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) - 6, 10-dιoxo-7- (ιndole-2-carboxamιdo) -1,2,3,4,7,8,9, 10- octahydro-6H-pyridazino[1,2-a] [1,2,4] trιazepme-4- carboxamide (264g) , was prepared by a similar method as compound 213e to afford the pure anti-isomer as a ruto solid (284mg, 80 } : mp. 148-53°C; [α] _D ²⁴ - 2.0" 'c 0.1,

CH ₂ C1 ₂ ) ; IR (KBr) 3404, 3295, 1789, 1660, 1536, 1421, 1310, 1260, 1122, 749; ¹ H NMR (Dg-DMSO) 6 11.72 (IH, s) , 10.58 (IH, s), 8.73 (IH, d) , 7.65 (IH, d) , 7.58-7.27 (6H, m) , 7.27-7.10 (IH, m) , 7.17 (IH, s) , 7.10-7.00 (IH, m) , 5.46 (IH, s), 4.90-4.85 (IH, ) , 4.77 and 4.68 (2H, dd) , 4.35-4.25 (2H, ) , 3.95-3.55 (3H, m) , 3.09 (IH, dd) , 2.95-2.80 (IH, m) , 2.47-2.25 (2H, m) , 2.10- 1.35 (4H, m) . MS (ES ⁺ ) 574 (M+, 35%) , 573 (M ⁺ - 1, 100) , 384 (16) , 383 (69) , 341 (23) , 327 (12), 267 (13) , 200 (22) .

[AS(2RS,3S) ] 7- [ (4-Acetamιdo)benzamιdo] -N- (2-benzyloxy- 5-oxotetrahydrofuran-3-yl) -6, 10-dιoxo-l ,2,3,4,7,8,9,10- octahydro-6H-pyrιdazmo [1,2-a] [1,2,4] trιazepιne-4- carboxamide (264h) , was prepared by a similar method as compound 213e to afford a mixture of diastereomers (Syn:antι isomer ratio 9:1) as a white soliα (276mg, 70%) : mp. 147-52°C; IR (KBr) 3444, 3304, 1793, 1665, 1602, 1531, 1505, 1423, 1294, 1264, 1181, 1123, 966; ^X H NMR (Dg-DMSO) δ 10.41 (IH, s) , 10.22 (IH, s) , 8.71 (0.1H, d), 8.48 (0.9H, d) , 7.78 (2H, d) , 7.67 (2H, d) , 7.35-7.30 (5H, m) , 5.68 (0.9H, d) , 5.45 (0.1H, s), 4.88-4.80 (IH, m) , 4.75-4.60 (IH, m) , 4.77 and 4.63 (2H, dd) , 4.30-4.20 (IH, m) , 3.90-3.50 (3H, m) , 3.10- 2.50 (3H, m) , 2.35-2.20 (IH, m) , 2.07 (3H, s), 2.05- 1.35 (4H, m) . Anal. Calcd for C ₂₉ H ₃₂ N ₆ 0 ₈ • 1H ₂ 0 : C,

57.04; H, 5.61; N, 13.76. Found: C, 56.79; H, 5.50; N, 13.53. MS (ES ^T ) 594 (M ⁺ + 2, 34%), 593 (M ⁺ + 1, 100) , 38 ^" (8) , 386 ,38) , 358 (8) , 162 (19) .

[AS(2RS,3S) ] N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) - 6 , 10-dιoxo— 7- (4-methoxybenzoylamιno) -octahydro-6H- pyridazino [1,2-a] [1,2,4] trιazepme-4 -carboxamide

(264ι) , was prepared by a similar method to that described for compound 213e to afford a white solid

(70%) : mp. 116-118°C; IR (KBr) 3315, 2951, 1793, 1664, 1607, 1502, 1258, 1177; ^∑ H NMR (CDC1 ₃ ) 68.07 (IH, s) , 7.77 (2H, d, J = 8.6), 7.35 (5H, m) , 6.94 (2H, d, J = 8.5), 6.74 (IH), 4.89 (IH, d, J = 11.1) , 4.74 (IH, m) , 4.60 (IH, d, J = 11.0), 4.48, 4.41 (IH, 2m) , 3.86 (3H, s), 3.79, 3.71-3.53 (3H, 2m), 2.87 (2H, m) , 2.44 (IH, m) , 2.18, 1.91, 1.68 (5H, 3m) .

[4S(2S,3S)] N-(2-Benzyloxy-5-oxotetrahydrofuran-3- yl) 6, lO-dιoxo-1,2,3,4 ,7,8, 9, 10-oσtahydro-7- phenylsulphonylamιno-6H- pyridaz o[1,2-a] [1,2,4]trιazepme-4-carboxamide

(2643), ^wa s synthesized by a similar method as compound 213e to afford a foam (88%) : [ ] _D ²⁴ +74.2° (c 0.36,

CH ₂ C1 ₂ ) ; IR (KBr) 3332, 3235, 1793, 1664, 1537, 1448, 1416, 1337, 1169, 118, 1092, 940, 690; ¹ H NMR (CDC1 ₃ ) δ 7.99 (IH, s), 7.88 (2H, d, J = 6.8), 7.64-7.48 '3H, m) , 7.34 (5H, s), 7.13 (IH, d, J = 6.9;, 5.39 (IH, s) , 4.81 (2H, m) , 4.62 (IH, d, J = 11.5), 4.48 (IH, m) , 4.33

(IH, ) , 3.85 (IH, m) , 3.59 (2H, m) , 3.03 (IH, cd, J =- 7.6, 18.2), 2.49-2.28 (3H, m) , 1.94-1.40 (4H, m, . Anal. Calcd for C ₂₆ H ₂₉ SN ₅ 0 ₈ : C, 54.63; H, 5.11 K , 12.25. Found: C, 54.42; H,5.28; N, 11.62. MS (ES ⁺ ) 5^2 (MH ⁺ , 100%) . Accurate mass calculated for C ₂₆ H ₃₀ SN ₅ Oc (MH ⁺ ) : 572.1815. Found: 572.1802.

[ AS (2RS, 3S) ] 7- (4-Benzyloxyphenyl) carbonylamino-N- (2- benzyloxy-5-oxotetrahydrofuran-3-yl) -6, 10-dιoxo- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2 ,4] trιazepme- -carboxamide

(264k), was prepared by the method used for 213e (96 ) : IR (KBr) 3294, 2946, 1793, 1658, 1606, 1535, 1501, 1248, 1174, 1119. ¹ H NMR (CDC1 ₃ ) 68.91 (IH, s) , 7.85 (3H, m) , 7.4 (10H, m) , 7.02 (2H, d) , 5.35 (IH, s) , 5.10 (2H, s), 4.8-4.3 (5H, m) , 4.00 (IH, bs) , 3.78 (2H, m) , 2.90 (2H, m) , 2.5-1.5 (6H, m) .

[AS (2RS, 3S) J N- (2-Benzyloxy-5-oxotetrahydrofuran-3-yl) - 6, 10-dιoxo-7- (3,4-methylenedioxybenzoylammo) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino[1 ,2-a] [1 ,2,4 ] trιazepιne-4-carboxamide

(2641) , was prepared by a similar methoα as compound 213e to afford a mixture of diastereomers (syn: anti isomer ratio 1:1) as a white solid (1.72g, 1*-; : mp. 148-60°C; IR (KBr) 3314, 1780, 1677, 1658, 1651, 1550, 1485, 1439, 1258, 1132, 1038, 943; ^X H NMR (D ₆ -DMSO) 6 10.39 (IH, s), 8.71 (0.5H, d) , 8.49 (0.5H, d) , 7.44 (IH, d), 7.42-7.30 (6H, m) , 7.03 (IH, d) , 6.12 (2H, ≤) , 5.68 (0.5H, d) , 5.45 (0.5H, s), 4.90-4.82 (IH, ) , 4.82-4.58 (2.5H, m) , 4.40-4.10 (1.5H, m) , 3.90-3.65 (2H, m) , 3.65-3.43 (IH, m) , 3.09 (0.5H, dd) , 2.90-2.55 (1.5H, m) , 2.45-2.10 (2H, m) , 2.10-1.35 ,4H, mj . Anal. Calcd for C ₂₈ H ₂₉ N ₅ 0 ₉ • 0.2H ₂ 0: C, 57.67; H, 5.08; N,

12.01. Found: C, 58.01; H, 5.33; N, 11.51. MS ;ES 1 +

581 (M + 2, 33%) , 580 (M+, 100) , 374 9. 373 345 (12) , 261 (4) , 239 (7) , 149 (9, .

[3S(4S) ] 3- [6, lO-Dιoxo-7- (2-naphthalenesulfonyl) a ino- 1,2,3,4,7,8,9, 10-octahydro-6H- pyridazino [1 ,2-a] [1,2,4] trιazepιne- -carboxamido] -4- oxobutanoic acid (265a), was prepared by a similar method as compound 265 to afford a wnite so i (37mg,

17%) : mp. 126-30°C (dec) ; [ ] _D ² ° +30° (c 0.05, MeOH) ; IR (KBr) 3371, 2935, 1785, 1663, 1538, 1418, 1339, 1164, 669; ¹ H NMR (CD ₃ OD) 68.44 (IH, s), 8.06-7.50 (7H, m) , 7.22 (IH, d, J = 8.4), 4.58-4.57 (IH, m) , 4.46-4.42 (IH, m) , 4.16-4.09 (2H, m) , 3.85-3.50 (3H, m) , 2.84- 2.78 (IH, m) , 2.64-2.51 (IH, m) , 2.44-2.15 (2H, m) , 1.81-0.89 (4H, m) . Anal. Calcd for C ₂₃ H ₂₅ N ₅ 0 ₈ S ^« H ₂ 0: C, 50.27; H, 4.95; N, 12.74. Found: C, 50.33; H, 5.04; N, 12.60. MS (ES ⁺ ) 530.

[ 3S (A S) ] 3- [6, 10-Dιoxo—7- (3-methoxyphenylureιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H- pyπdazino[1,2-a] [1,2,4] trιazepme-4-carboxamido] -4- oxobutanoic acid (265c) , was prepared by a similar method as 265, (90%) as a colourless solid: mp. ~150°C (decomp.) ; _α] _D ²³ +94.8° (c 0.1, 20% MeOH/CH ₂ Cl ₂ ) ; IR (KBr) 3330, 1780, 1660, 1610, 1550, 1495, 1428, 1326, 1287, 1251, 1223, 1160; ^X H NMR (CD ₃ OD) 67.16 (2H, m) , 6.89 (IH, d, J = 7.8), 4.58 (IH, m) , 4.37 (2H, ) , 3.76 (6H, s + m) , 2.95 (IH, m) , 2.67 (IH, m) , 2.33 (IH, m) , 2.20-1.85 (3H, m) , 1.66 (IH, ) .

[3S(4S) ] 3- [6,10-Dιoxo-7- (2-methoxyphenylureιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H-pyrιdazmo [1,2-a] [1,2,4]- trιazepιne-4-carboxamido] - -oxobutanoic acid (265d) , was prepared by a similar method as 265, (85°) as a colourless soliα: mp. ~176-85°C; _α] _D ²³ +11.0° (c 0.1, MeOH) ; IR (KBr) 3392, 3328, 1784w, 1665, 1603, 1537, 1490, 1462, 1437, 1337, 1290, 1290, 1217, 1177, 1119,

1023; ² H NMR (CD ₃ OD) 68.02 (2H, ) , 6.95 (4H, m) , 5.0 ^r > (IH, m) , 4.60 (2H, ) , 3.92 (4H, s + m) , 3.00 (2H, π.1 , 2.68 (IH, m) , 2.39 (IH, m) , 2.00 (4H, m) , 1.69 (IH, r .

[3S(4S) ] 3-(6,10-Dιoxo-l,2,3,4,7,8,9,10-octahydro-7- phenylacetylamino-6H- pyπdazino[1,2-a] [1,2,4]tπazepine-4-carboxamido) -4- oxobutanoic acid (1095), was prepared by a similar 5 method as compound 265 to afford a white solid (84mg, 90%) : mp. 180-6°C; [α] _D ²² +22.3° (c 0.065, CH ₃ OH) ; IR

(KBr) 3700-2300 (br) , 3287, 1664, 1536, 1425, 1261, 1181; ¹ H NMR (CD ₃ 0D) 6 7.35-7.20 (5H, m) , 5.00-4.90 (IH, m) , 4.60-4.50 (IH, m) , 4.50-4.10 (2H, m) , 3.90-3.50 0 (3H, m) , 3.54 (2H, s) , 3.00-2.80 (IH, m) , 2.80-2.40

(2H, m) , 2.35-2.20 (IH, m) , 2.20-1.50 (4H, m) . MS (ES 459 (M+ 24%), 458 (M ⁺ - 1, 100), 358 (27) , 175 (9) , 149 (7) , 137 (12) . Accurate mass calculated for C ₂₁ H ₂ gN ₅ 0 ₇ (MH ⁺ ) : 460.1832. found: 460.1840.

5 [35(45)] 3-[6,10-Dιoxo-l,2,3,4,7,8,9,10-octahydro-7-(3- phenylureido) -6H-pyridazino[1 ,2-a] [1,2,4] trιazepme-4- carboxamido] -4-oxobutanoic acid (265f) , was prepared oy a similar method as compound 265 to afford a white foamy solid (130mg, 88%) : mp. 157-62°C; [ ] _D ²⁴ +41.7° 0 (c 0.1, CH3OH) ; IR (KBr) 3700-2300 (br) , 3325, 1782, 1663, 1547, 1443, 1315, 1242, 1181; ² H NMR (CD3OD) δ 7.40 (2H, dd), 7.35-7.20 (2H, m) , 7.06-6.95 (IK, m) , 5.05-4.95 (IH, m) , 4.64-4.54 (IH, m) , 4.50-4.35 (IH, m) , 4.35-4.15 (IH, m) , 3.90-3.69 (3H, m) , 3.00-2.85 5 (IH, m) , 2.80-2.45 (3H, m) , 3.40-1.50 (4H, m. . MS (ES', 460 (M+, 24 ^[ ), 459 (M ⁺ - 1, 100) , 341 (9, , 340 '54) , 296 (6) , 239 (9) .

[35(45) ] 3- [6, lO-Dιoxo-7- (ιndole-2-carboxamιdo) - 1,2,3,4,7,8,9, 10-octahydro-6H- C pyridazino [1,2-a] [1,2,4] trιazepιne- -carboxamido] -4-

oxobutanoic acid (1075), was prepared by a similar method as compound 265 to afford a white solid (184mg, 83%) : mp. 210-5°C; [α] _D ²⁴ +43.9° (c 0.1, CH ₃ OH) ; IR (KBr) 3700-2300 (br), 3309, 1660, 1537, 1423, 1311, 1262, 1184; ¹ H NMR (CD ₃ OD) 6 7.61 (IH, d) , 7.45 (IH, d) , 7.28-7.15 (IH, m) , 7.15-7.00 (IH, m) , 7.13 (IK, s), 5.12-4.96 (IH, m) , 4.62-4.55 (IH, m) , 4.50-4.25 (2H, m) , 4.00-3.69 (3H, m) , 3.05-2.90 (IH, m) , 2.80-2.30 (3H, m) , 2.25-1.50 (4H, m) . MS (ES ⁺ ) 484 (M+, 26%), 483 (M ⁺ - 1, 100), 383 (25), 245 (12), 208 (11) , 200 (21) , 174 (31) , 137 (18) .

[35(45)] 3-{7-[ (4-Acetamido)benzamido] -6, 10-Dιoxo- 1,2,3,4 ,7,8,9,10-octahydro-6H-pyridazino[l ,2-a] [1,2,4] - triazepine-4-carboxamido}-4-oxobutanoic acid (1018), was prepared by a similar method as compound 265 to afford a white solid (177mg, 82%) : mp. 235-40°C; [α] _D ²³ +27.3° (c 0.1, CH ₃ 0H) ; IR (KBr) 3700-2300 (br) , 3311, 2957, 1662, 1599, 1531, 1318, 1266, 1182; ¹ H NMR

(CD ₃ OD) 6 7.83 (2H, d) , 7.69 (2H, d), 5.10-4.95 (IH, m) , 4.64-4.55 (IH, m) , 4.50-4.35 (IH, m) , 4.32-4.22 (IH, m) , 4.00-3.65 (3H, m) , 3.05-2.90 (IH, ) , 2.80-2.30 (3H, m) , 2.15 (3H, s), 2.15-1.50 (4H, m) . Anal. Calcd for C ₂₂ H ₂₆ N ₆ 0 ₈ *1.5H ₂ 0: C, 49.90; H, 5.52; N, 15.87. Found: C, 50.21; H, 5.41; N, 15.49. MS (ES ⁺ ) 532 (M+, 28%), 501 (M ⁺ - 1, 100), 401 (8) , 218 (4) , 119 (2) , 118 (5) , 113 (16) .

[35(45)] 3-[6, 10-Dioxo—7- (4-methoxybenzoyl mino) - octahydro-6H-pyridazino[l,2-a] [1,2,4] trιazepιne-4- carboxamido] -4-oxobutanoic acid (1052), was synmesizeα via method used to prepare 265 to afford a white solid

20

(0.194g, 100%) : mp . 138-142°C; [α] +36.3° (c 0.19,

CH ₃ OH) ; IR (KBr) 3434-2962, 1782, 1660, 1607, 1537, 1504, 1441, 1424, 1313, 1293, 1258, 1177; ¹ H NMR

(CD ₃ OD) 67.11 (2H, d, J = 8.8), 6.90 (2H, d, J = 8.9) , 4.48 (IH, m) , 4.34, 4.28 (IH, 2m) , 4.15 (IH, m) , 3.75 (3H, s) , 3.75, 3.70 (3H, m) , 2.88, 2.49, 2.28, 2.23, 2.00, 1.86, 1.79, 1.58 (8H, m) .

[3S(4S) ] 3-(6,10-Dioxo-l,2,3,4,7,8,9,10-octahydro-7- phenylsulphonylamino-6H- pyridazino[1 ,2-a] [1,2, ] trιazepine- -carboxamido) -4- oxobutanoic acid (1027) , was synthesized by a similar method as compound 265 to afford a white foam (88%) :

[α] _D ²⁴ +22.6° (c 0.17, MeOH) ; IR (KBr) 3349, 1789, 1663, 1537, 1448, 1337, 1169, 1092, 690; ¹ H NMR (CD ₃ OD) 67.82 (2H, d, J = 7.8) , 7.57 (3H, m) , 4.74 (IH, m) , 4.47 (IH, m) , 4.24-4.10 (2H, m) , 3.72-3.47 (4H, m) , 2.62-2.48 (3H, m) , 2.20 (IH, m) , 1.94-1.35 (3H, m) . MS

(ES ⁺ ) 480 (M ⁺ - 1, 100%) . Accurate mass calculated for C ₁₉ H ₂ _ ₎ SN ₅ 0 ₈ (MH ⁺ ) : 482.1346. Found: 482.1325.

[3S(45)] 3- [6, 10-Dioxo-7- (4-hydroxybenzoylamιno) - 1,2,3,4 ,7,8,9, 10-octahydro-6H- pyridaz o[1,2-a] [1,2,4]triazepine- -carboxamido] -4- oxobutanoic acid (1056) , was prepared by the method used for 265 (95%) : mp. >300°C; IR (KBr) 3392, 1660, 1610, 1507, 1442, 1280, 1171, 1149, 1133. ^l H NMR

(CD ₃ OD) 67.74 (2H, d J = 8.7), 6.84 (2H, d J = 8.7) 4.58

CH, ) , 4.41 (IH, bd, J = 12.6), 4.28 (IH, m) , 3.85

<3H, m), 2.98 (IH, m) , 2.8-2.3 (3H, m) , 2.3-1.6 (4H, m; .

[3S(45)] 3-[6,10-Dioxo-7-(3,4- methylenedioxybenzoylamino) -1,2,3,4,7,8,9, 10-octahydro- 6H-pyridazino[1 ,2-a] [1,2,4] trιazepme- -carboxamido] -4- oxobutanoic acid (1015) , was prepared by a similar method as used for 265 to afford a white solid (142mg, 58%) : mp. 170-5°C; [α] _D ²⁵ +32.7° (c 0.1, CH ₃ OH) ; IR (KBr) 3700-2500 (br), 3325, 2969, 1784, 1662, 1485, 1440, 1292, 1258, 1037; ¹ H NMR (CD ₃ 0D) 67.45 (IH, dd) , 7.32 (IH, d), 6.90 (IH, d) , 6.05 (2H, s) , 5.10-4.90 (IH, ) , 4.62-4.54 (IH, m) , 4.45-4.35 (IH, m) , 4.33- 4.22 (IH, m) , 3.95-3.65 (3H, m) , 3.05-2.90 (IH, m) , 2.80-2.30 (3H, m) , 2.20-1.50 (4H, m) .

526 1053

[35(45)] t-Butyl 3- [7- (benzo[b] thιophene-2- carbonyl)amino-6, 10-dioxo-l ,2,3,4,7,8,9, 10-octahydro- 6H-pyrιdazino[l ,2-a] [1,2,4] triazepine] -4-oxobutanoate semicarbazone (526) , was prepared by a similar method

20 as used for 502 to afford a glassy solid: [α] _D +34°

(c 0.13, CH ₂ C1 ₂ ) ; IR (KBr) 3437, 2929, 1670, 1530, 1428, 1288, 1156; ¹ H NMR (CDCl ₃ > δ l0.0 (IH, bs), 9.74 (IH, bs), 7.93 (IH, s), 7.80-7.60 (2H, m) , 7.40-7.18 (3H, ) , 6.15-5.30 (2H, bs), 5.00-4.85 (2H, m) , 4.50- 4.25 (IH, m) , 3.95-3.75 (3H, m) , 3.12-2.78 (2H, m) , 2.73-1.60 (7H, m) , 1.36 (9H, s) . Anal. Calcd for

C ₂₇ H ₃ N ₈ 0 ₇ S: C, 52.76; H, 5.58; N, 18.23. Found: C, 52.25; H, 5.74; N, 16.30. MS (ES ⁺ ) 615.

[3S( S) ] 3-[7- (Benzo[b] thιophene-2-carbonyl)amino-6, 10- dιoxo-1,2 ,3,4,7,8, 9,10-octahydro-6H- pyridazino[1,2-a] [1,2 ,4]trιazepιne-4-carboxamido] -4- oxobutanoic acid (1053) , was prepared by a similar method as used for 214 to afford a white solid (106mg, 73%) : [α] _D ² ° +22° (c 0.10, MeOH); IR (KBr) 3428, 2944, 1733, 1652, 1532, 1433, 1337, 1288, 1186; ^λ H NMR (CD ₃ 0D) 67.95 (IH, s), 7.90-7.85 (2H, m) , 7.43-7.35 (2H, m) , 4.98 (IH, m) , 4.65-4.52 (IH, m) , 4.40-4.20 (2H, m) ,

3.85-3.70 (3H, ) , 3.30-3.25 (3H, m) , 3.03-2.85 (IH, m.1)) ,, 22..7700--22..3311 ((33HH,, mm)) ,, 22..1100--11..5555 (4H, m) MS :ES ⁺ ) ;00 las methyl acetal of the aldehyde;

528

[4S(2R5,35) ] 6,10-Dιoxo-N- (2-ethoxy-5- oxotetrahydrofuran-3-yl) -7- (3,4- methylenedioxybenzoylammo) -1,2,3,4,7,8,9, 10-octahydro- 6H-pyrιdazιno[1,2-a] [1,2,4]trιazepme- -carboxamide

(528) , was prepared by a similar method as compound 213e to afford a mixture of diastereomers (Syn: anti isomer ratio 1:1) as a creamy white foamy solid 1.05g,

58%) : mp. 124-32°C; IR (KBr) 3312, 2979, 1790, 1664, 1610, 1532, 1485, 1285, 1120, 1037, 932; ¹ H NMR (Dg- DMSO) 6 10.39 (IH, s), 8.71 (0.5H, d) , 8.43 (0.5H, d) , 7.45 (IH, d) , 7.36 (IH, s), 7.04 (IH, d), 6.12 (2H, s), 5.58 (0.5H, d) , 5.34 (0.5H, s), 4.95-4.85 (IH, m) , 4.70-4.52 (0.5H, m) , 4.35-4.10 (1.5H, m) , 3.95-3.50 (5H, m) , 3.03 (0.5H, dd) , 2.90-2.55 (1.5H, m) , 2.46- 2.20 (2H, m) , 2.10-2.40 (4H, m) , 1.16-1.13 (3H, 2 x t) . Anal. Calcd for C ₂₃ H ₂₇ N ₅ 0 ₉ '0.6H ₂ 0: C, 52.29; H, 5.38; N, 13.26. Found: C, 52.53; H, 5.35; N, 12.78. MS (ES ⁺ ) 519 (M ⁺ + 2, 27%), 518 (M ⁺ + 1, 100) , 472 (7) , 374 (12) , 373 (53) , 345 (14) , 149 (12) .

Example 31 Compounds 640, 642, 645, 650, 653, 655, 656, 662, 668, 669, 670, 671, 677, 678, 681, 682, 683, 684, 686, 688a, 688b, 6891, 689b, 690a, 690b, 691a, 691b, 695a, 695b, 695c, 692a, 692b, 693 and 694 were prepared as follows.

(3S) -2-Oxo-3-amino-5-methoxyacetyl-2,3,4 ,5-tetrahydro- lH-l ,5-benzodιazepine-l-acetιc acid methyl ester (638), was synthesized from 600a by methods similar to those used for making 602m from 600a to afford 2.4g of 638 as a white solid.

(35) -2-0x0-3- (2-naphthylmethylene) mιno-5- methoxyacetyl-2,3,4,5-tetrahydro-lH-l ,5-benzodιazepme- 1-acetιc acid methyl ester (639) . To a solution of 638 (630 mg, 1.76 mmol) and 2-naphthylmethyl bromide (428 mg, 1.94 mmol) in CH ₃ CN was added K ₂ C0 ₃ (608 mg, 4.4 mmol) . The resulting mixture was stirred at ambient temperature. After 18 hours, the reaction mixture was diluted with CH ₂ C1 ₂ , washed with water then brme, dried over Na ₂ S0 ₄ then concentrated in vacuo. Flash chromatography (Sι0 ₂ , 0 to 20% EtOAc/CH ₂ Cl ₂ ) afforded 450mg of 639.

(35) -3- [ (35) -2-0XO-3- (2-naphthylmethylene)amιno-5- methoxyacetyl-2 ,3,4,5-tetrahydro-lH-l ,5-benzodιazepιne- 1-acetylammo]4-oxo-butyric acid (640), was synthesized by methods used to make 605v from 602v to afford 205 mg of 640 as a white solid, ¹ H NMR (CDC1 ₃ ) 6 2.4-2.55 (m, IH) , 2.65-2.8 (m, IH) , 3.2(s, 3H) , 3.72-3.78(m, IH), 3.85-4.0(m, 2H) , 4.22-4.28(d, IH), 4.26-4.5(m, 4H) , 4.58-4.75(m, IH) , 4.78-4.85(m, IH) , 5.0-5.08(t, IH) , ".35-7.65 (m, 7H), 7.85-8.02 (m, 4H) .

(3S) -3- [ (35) -2-Oxo-3-benzoylformylammo-5- methoxyacetyl-2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne- 1-acetylam o]4-oxo-butyric acid (642), was synthesized from 638 by similar methods used to make 605m to afford 5 213 mg of 642, ¹ H NMR (CD ₃ 0D) 6 2.5 (m, IH), 2.68(ddd, IH) , 3.25(s, 2H), 3.3(s, 3H) , 3.78 (m, 2H) , 4.0(d, IH), 4.3(m, IH) , 4.6(m, 2H) , 4.85(br. s, 2H) , 7.08-7.22(m, 2H) , 7.35(m, IH) , 7.4-7.65(m, 4H) , 7.7(dd, IH) , 8.1(dd, IH) .

643

IC 2-Acetamido-acetyl chloride (643) . To a suspension cf N-acetyl glyc e (200 mg, 1.7 mmol) CH ₂ C1- (2.5 mLs , containing DMF (0.005 mLs) was added oxalyl chloride

(0.450 mLs, 5.1 mmol) . After stirring 30 minutes at ambient temperature, the mixture was concentrated to afford 643 as a crude product.

(35) -2-OXO-3- (1-naphthoyl) amιno-5- (2-acetamιdo) acetyl- 2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne-l-acetιc acid benzyl ester (644), was synthesized from 600b by methods used to make 602d from 600b using 643 to afford 112 mg of 644.

(35) -3- [ (35) -2-OXO-3- (1-naphthoyl)amιno-5- (2- acetamido)acetyl-2 ,3,4,5-tetrahydro-lH-l,5- benzodιazepme-1-acetylammo]4-oxo-butyric acid (645), was synthesized from 644 by methods used to make 605d from 602d to afford 43 mg of 645 as a white solid, h

NMR (CD ₃ 0D) δ 1.95(s, 3H) , 2. ( , IH), 2.65(m, IH) , 3.4(s, IH) , 3.55(m, IH) , 3.85(m, IH) , 4.05(d, IH),

4.3 ( , IH), 4.4-4.6(m, 2H) , 5.0 (m, IH) , 7.4-7.7 (m, 6F) ,

7.85-8.0 (m, 2H) .

Fmoc Fmoc

A^. OH - y a

646

2- (N-Methyl, N-fluorenylmethoxycarbonyl)aminoacetyl chloride (646) , was prepared from N-Fmoc-sarcosme by method used to make 643 to afford 646 as a crude product .

(35) -2-OXO-3- (l-naphthoyl)amino-5- [2- (N-methyl , N- fluorenylmethoxycarbonyl) amino]acetyl-2,3,4,5- tetrahydro-lH-1 ,5-benzodiazepine-l-acetic acid benzyl ester (647), was synthesized from 600b by ethcαs used to synthesize 602d from 600b, using 646 to afford 481 mg of 647.

(35) -3- [ (35) -2-Oxo-3-(l-naphthoyl)amιno-5- [2- (N-methyl, N-fluorenylmethoxycarbonyl)amino]acetyl-2 ,3,4,5- tetrahydro-lH-1 ,5-benzodiazepιne-l-acetylammo] -oxo- butyric acid tert-butyl ester semicarbazone (648) , was

synthesized from 647 by methods used to prepare 604d from 602d to afford 409 mg of 648.

(3S) -3- [ (35) -2-OXO-3- (1-naphthoyl) ammo-5- (2-methyl am o) acetyl-2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne- 1-acetylammo]4-oxo-butyric acid tert-butyl ester semicarbazone (649) .

A solution of 648 (409 mg, 0.465 mmol) MeCN:Et ₂ NH (4:1, v/v) was stirred at ambient temperature. After 45 minutes, the reaction mixture was concentrated i n vacuo. Flash chromatography (Sι0 ₂ , 5% to 20^ MeOH CH ₂ C1 ₂ ) afforded 241 mg of 649.

(3S) -3-[ (35) -2-OXO-3- (1-naphthoyl)ammo-5- (2-methyl amino) acetyl-2,3,4,5-tetrahydro-lH-l,5-benzodιazepine- 1-acetylamino]4-oxo-butyric acid (650), was synthesized from 649 by methods used to prepare 605d from 604 to afford 179 mg of 650 as a white solid, ¹ H NMR (CD ₃ 0D) δ 2. -2.6 (m, 2H) , 2.7(s, 3H) , 3.5(q, IH) , 3.8 (m, 2H) , 4.2-4. (m, 2H) , 4.3-4.45 (m, IH) , 5.0-5.1 (m, 2H) , 7.4- 7.7 (m, 6H) , 7.85-7.9(m, 2H) , 8.2 (m, IH) .

(35) -2-OXO-3- (1-naphthoyl)amιno-5-formyl-2 ,3,4,5- tetrahydro-lH-1 ,5-benzodιazepme-l-acetic acid benzyl ester (652) , was synthesized from 600b by methods similar to those used to rrιaκe 602n from 600b, using th.e

reagent obtamed from reacting DMF with 3 equiv. of ooxxaallyyll cchhlloorriicde in a CH ₂ C1 ₂ solution as R X, to afford 404 mg of 652

(3S) -3- [ (35) -2-OXO-3- (1-naphthoyl) amιno-5-formyl- 2,3,4,5-tetrahydro-lH-l,5-benzodιazepιne-l- acetylammo]4-oxo-butyric acid (653), was synthesized from 652 by methods used to prepare 605d from 602d to afford 84 mg of 653 as a white solid, ¹ H NMR (CD ₃ 0D) 6 2.3 ( , IH), 2.55(dd, IH) , 3.75(br. s, IH) , 4.25-4.6(m 5H) , 5.15(m, IH) , 7.2-7.45 (m, 6H), 7.8-7.9(dd, 3H), 8.1 (s, IH) , 8.2 (m, 2H) .

656

(3S) -2-OXO-3- (3,5-dιchloro-4-hydroxybenzoyl)amιno-5- acetyl-2,3,4,5-tetrahydro-lH-l , 5-benzodιazepme-l- acetic acid (654), was synthesized from 600b using methods similar to those used for preparing 603d from 600b to afford 775 mg of 654.

(35) -2-0x0-3-(3,5-dιchloro-4-hydroxybenzoyl)amιno-5- acetyl-N-[ (2i?5,35) -benzyloxy-5-oxo-tetrahydrofuran-3- yl] -2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne-l- acetamide (655), was synthesized from 654 using the method used to prepare 213e to afford 304 mg of 655, H NMR (CD ₃ 0D) δ 2.4(d, IH) , 2.6-2.75(m, 2H) , 3.0 (m, lHi , 3.45 (ra, IH), 3.8(d, IH) , 4.0(t, 2H) , 4.4 (m, 2H) , 4.5- 4.55(m, 2H) , 7.2-7.45(m, 4H) , 7.85(s, 2H) .

(35) -3- [ (35) -2-OXO-3- (3,5-dichloro, 4- hydroxybenzoyl)amιno-5-acetyl-2 ,3, ,5-tetrahydro-lH- 1,5-benzodiazepme-l-acetylam o] -oxo-butyric acid (656), was synthesized from 655 using a method similar to that used to prepare 2002 from 2001 to afford 136 mg of 656 as a white solid, ¹ H NMR (CD ₃ 0D) δ 1.85 (s, 3H) , 2.5(m, IH), 2.65 (m, IH) , 3.7 (m, IH) , .3 (m, IH) , 4.55(m, 2H) , 7.4-7.6(m, 4H) , 7.85(s, 2H) .

O O

HO. Fmoc

-OBn °^ , Fmoc FmocO II

OBn OH -— ^" ^Cl

657 658 659

2- (Fluorenylmethoxycarbonyl)hydroxyacetic acid benzyl ester (657) . To a solution of benzyl glycolate (6.0 g, 36.1 mmol) m CH ₂ C1 ₂ , cooled via ice-water bath, was added luorenylmethoxy chloroformate (14 g, 1.5 equiv. ι then dusopropylethylamine (9 mLs, 1.5 equiv.) . After 1 hour, reaction mixture was poured mto a saturated aqueaous solution of ammonium chloride ana extracted with CH ₂ C1 ₂ , dried over Na ₂ Sθ then concentrated m vacuo . The product was triturated from MeOH to obtain 2.2 g of 657 as a first crop of white solid.

2- (Fluorenylmethoxycarbonate) acetic acid (658) . To a solution of 657 (2.2 g, 5.93 mmol) in tetrahydrofuran was added 5% Pd/C (220 mg) . The resulting suspension was vigorously stirred under hydrogen atmosphere. After 90 mm, the reaction mixture was filterred through Celite. The filtrate was poured into saturated aqueous NaHC0 ₃ and washed twice with EtOAc. The aqueous layer was then acidified and the product extracted twice with CH ₂ C1 ₂ , dried over Na ₂ S0 ₄ and concentrated m vacuo to afford 1.46 g f88~) of 658 as a white solid.

2- (Fluorenylmethoxycarbonate) acetyl chloride (659), was prepared from 658 by the method used to prepare 643 to afford 659 as a crude product.

(35) -3- [ (35) -2-Oxo-3- (3,5-dιchloro-4- hydroxybenzoyl) amιno-5- (2- fluorenylmethoxycarbonate)acetyl-2,3,4,5-tetrahydro-lH- 1 ,5-benzodιazepιne-l-acetylammo]4-oxo-butyric acid tert-butyl ester semicarbazone (660), was syntnesizec

from 600b, using 659, by methods used to prepare 604d from 600b to afford 453 mg of 660.

(35) -3- [ (35) -2-OXO-3- (3,5-dιchloro-4- hydroxybenzoyl)amιno-5- (2-hydroxy)acetyl-2,3,4,5- tetrahydro-lH-1 ,5-benzodιazepιne-l-acetylammo]4-oxo- butyπc acid tert-butyl ester semicarbazone (661) . A solution of 660 (423 mg) m MeOH:Et ₂ NH (1:1, v/v) was stirred at ambient temperature. After 10 minutes, the reaction mixture was concentrated m vacuo to a small volume. Precipitation by tne addition of ether afforded 230 mg of 661.

(35) -3- [ (3S) -2-OXO-3- (3,5-dιchloro-4- hydroxybenzoyl)amιno-5- (2-hydroxy) acetyl-2,3,4,5- tetrahydro-lH-1 ,5-benzodιazepιne-l-acetylamιno]4-oxo- butyric acid (662) , was synthesized from 661 by the methods used to prepare 605d from 604 to afford 37 mg of 662 as a white solid, ¹ H NMR (CD ₃ OD) δ 2.45(m, IH) , 2. (m, IH) , 3.75 (m, IH) , 3.9(d, IH) , 4.15(d, IH) , 4.35(m, IH) , 4.5(t, 2H) , 4.7(dd, IH) , 7.4-7.6 (m, 4H), 7.85 (s, 2H) .

663 664 665

668

2- (Tnisopropylsilyloxy)acetic acid benzyl ester (663) .

To a solution of benzyl glycolate (46.91g, 0.282 mol) and diisopropylethylamine (74 mLs, 0.423 mol) in CH ₂ C1 ₂ , cooled via water bath, was added a solution of TIPSOTf (95 g, 0.31 mol) in CH ₂ C1 ₂ . The resulting mixture was allowed to warm to ambient temperature then poured into water, washed twice with 10% aqueous NaHS0 ₄ , dried over Na ₂ S0 ₄ and concentrated i n vacuo . Flash chromatography (Si0 ₂ , 0 to 5% EtOAc in hexanes) afforded 71.6 g of 663.

2- (Tnisopropylsilyloxy)acetic acid (664) . To a solution of 663 (0.4 g, 1.2 mmol) in EtOAc was added 10% Pd/C (33 mg) . The resulting suspension was stirred under hydrogen atmosphere. After 15 hours, the reaction mixture was filterred through Celite and the filtrate concentrated in vacuo to afford 0.29 g of an oil. To a solution of this oil 1,4-dιoxane was added NaHC0 ₃ (0.5M, 2.4 mLs) . The resulting solution was concentrated i n vacuo from toluene to afforα 664 as a waxy solid.

2- (Triisopropylsilyloxy) acetyl chloride (665), was synthesized from 664 by a method similar that used to prepare 643 to afford 665 as a crude product .

(3S) -3- [ (3S) -2-Oxo-3-benzoylamιno-5- (2- trnsopropylsilyloxy)acetyl-2,3,4 ,5-tetrahydro-lH-l,5- benzodιazepme-1-acetylamino]4-oxo-butyrιc acid tert- butyl ester semicarbazone (666), was synthesizeα from

600b, using 665, by methods used to prepare 604d from 600b to afford 131 mg of 666.

(35) -3- [ (35) -2-Oxo-3-benzoylammo-5- (2-hydroxy)acetyl- 2,3,4,5-tetrahydro-lH-l,5-benzodιazepιne-l- acetyla mo]4-oxo-butyric acid tert-butyl ester semicarbazone (667) . To a solution of 666 (131 mg, 0.17 mmol) in tetrahydrofuran, cooled via ice-water bath, was added tetrabutylammonium fluoride (IM, 0.190 mL) . After 2 hours the reaction mixture was poured mto water, extracted twice with EtOAc, dried over MgS0 ₄ and concentrated m vacuo to afford 63 mg of 667 as a wh.te solid.

(35) -3- [ (3S) -2-Oxo-3-benzoylamιno-5- (2-hydroxy) acetyl- 2,3,4 ,5-tetrahydro-lH-l,5-benzodιazepme-l- acetylamino]4-oxo-butyric acid (668), was synthesized from 667 by the methods used to prepare 605d from 604d to afford 48 mg of 668 as a white solid, ¹ H NMR (CD ₃ OD) 6 2.45(m, IH), 2.67(dddd, IH) , 3.78(d, IH) , 3.85(br. m, IH) , 4.05(d, IH) , 4.28(m, IH) , 4.5 (m, 2H), 4.65 (m, IH) , 4.95(br. s, 2H) , 7.4-7.5(m, 4H) , 7.52-7.65(m, 3H) , 7.88 (d, 2H) .

(35) -3- [ (35) -2-OXO-3- (3,5-dιchloro-4- methoxybenzoyl)ammo-5-acetyl-2,3,4,5-tetrahydro-lH- 1 ,5-benzodιazepme-l-acetylamιno]4-oxo-butyrιc acid

(669) , was synthesized from 600b by the methoαs used tc prepare 605d from 600b to afford 63 mg cf 669 as a

l _r white solid, H NMR (CD ₃ OD) δ 1.9(s, 3H) , 2.4-2.7(m, 2H) , 3.6-3.7 (m, 2H) , 3.9(s, 3H) , 4.2-4.4 (m, 2H) , 4.4- 4.6(m, 3H) , 7.4-7.8(m, 4H) , 7.9(s, 2H) .

(35) -2-0x0-3-(3,5-dimethyl-4-hydroxybenzoyl)ammo-5- acetyl-N- [ (2.R5,3S) -benzyloxy-5-oxo-tetrahydrofuran-3- yl] -2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne-l- aceta ide (670) , was synthesized from 600b by the methods used to prepare 655 from 600b to afford 218 mg of 670 as a white solid, ¹ H NMR (CD ₃ 0D) δ 1.7, 1.75(2s, 3H) , 2.15, 2.2(2s, 6H) , 2.4-2.5 (m, IH), 2.6-2.75 (m, IH) , 3.65-3.75(m, 2H), 4.2-4.3(m, 2H) , 4.45-4.6(m, 3H) , 7.35-7.6 (m, 4H) , 7.5 (s, 2H) .

(35) -3- [ (3S) -2-OXO-3- (3,5-dιmethyl- - hydroxybenzoyl)amιno-5-acetyl-2,3,4,5-tetrahydro-lH- 1 , 5-benzodiazepine-l-acetylamino]4-oxo-butyrιc acid

(671), was synthesized from 670 by the methods used tc prepare 2002 from 2001 to afford 253 mg of 671 as a white solid, H NMR (CD ₃ 0D) 6 1.9 (s, 3H) , 25 (s, 6H) ,

2.4-2.5(m, IH) , 2.6-2.75 (m, IH) , 3.65-3.75(m, 2H) , 4.2- 4.3 (m, 2H) , 4.45-4.6(m, 3H) , 7.35-7.6(m, 4H) , 7.5(s, 2H) .

(3S) -2-OXO-3- ert-butoxycarbonylamιno-5- (2- triisopropylsilyloxy)acetyl-2,3,4,5-tetrahydro-lH-l ,5- benzodiazepine-1-acetic acid benzylester (672) , was synthesized from 600b by method 1 used to prepare 602n from 600b using 665 to afford 1.08 g of 672.

(3S) -2-Oxo-3-amιno-5- (2-triιsopropylsιlyloxy) acetyl- 2,3,4 ,5-tetrahydro-lH-l,5-benzodιazepιne-l-acetic acid benzylester (673) . To a solution of 672 (1.08 g, 1.69 mmol) in CH ₂ Cl ₂ was added 2, 6-lutadιne (0.8 mL) then TMSOTf (1 L, 5.1 mmol) . After 1 hour, the reaction mixture was poured into NaHC0 ₃ and extracted with CH C1 ₂ , dried over MgS0 ₄ and concentrated i n vacuo to a small volume that was used directly for the next reaction.

(35) -2-OXO-3- (1,6-dιmethoxybenzoyl formyl)amino-5- (2- triisopropylsilyloxy)acetyl-2,3,4 ,5-tetrahydro-lH-l ,5- benzodiazepιne-1-acetic acid benzylester (674), was synthesized from 673 by the method used to prepare 602b to afford 0.91 g of 674.

(35) -2-0x0-3- (1 ,6-dιmethoxybenzoyl formyl)amιno-5- (2- triisopropylsilyloxy)acetyl-2,3,4,5-tetrahydro-lH-l ,5- benzodiazepme-1-acetic acid (675) . A solution of 674 (0.365 g, 0.5 mmol) MeOH was stirred with IN NaOH (1.2 mL, 1.2 mmol) . After 16 hours the reaction mixture was concentrated m vacuo then dissolveα m water and washed twice with ether. The aqueous layer was acidified with IN HCl and the product extracted with EtOAc, dried over MgS0 ₄ and concnetrated i n va cuc to afford 337 mg of 675 as a solid.

(35) -2-0x0-3- (1 ,6-dιmethoxybenzoylformyl)ammo-5- (2- trusopropylsilyloxy)acetyl-N- [ (2.RS,3S) -benzyloxy-5- oxo-tetrahydrofuran-3-yl] -2,3,4 ,5-tetrahydro-lH-l ,5- benzodιazepιne-1-acetamιde (676), was synthesized fr ^' cm 675 by the method used to prepare 213e to afford 166 mg of 676 as a white solid.

(3S) -2-OXO-3- (1, 6-dιmethoxybenzoylformyl)amιno-5- (2- hydroxy)acetyl-N-[ (2.R5,3S) -benzyloxy-5-oxo- tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-lH-l,5- benzodιazepιne-1-acetamιde (677) . A solution of TBAF (6 mL, 3 mmol) in HOAc (0.46 mL, 8 mmol) was added to 676 (0.213 g, 0.256 mmol) . After 16 hours the reaction mixture was poured mto EtOAc and washed twice with NaHCθ3, ^once with brme then dried over MgS0 ₄ and concnetrated in vacuo to afford 139 mg of 677 as a solid, ^X H NMR (CDC1 ₃ ) δ 2.4 (d, IH) , 2.5(dd, IH) , 2.8 (dd, IH), 2.92(dd, IH) , 3.15(m, 2H) , 3.55-3.65 (m, 2H) , 3.72(s, 6H) , 3.92 (m, IH) , 4.05(m, IH) , 4.3 (m, IH) , 4.42(d, IH) , 4.6(dd, IH) , 4.65-4.8 (m, 2H) , 4.88'd, IH) , 5.55(d, IH) , 6.55(m, 2H) , 6.75(d, IH) , 7.25-7.55 (m, 8H) , 7.75 (m, 2H) .

(3S) -3- [ (35) -2-OXO-3- (3,5-dimethoxybenzoylformyl) amino- 5- (2-hydroxy)acetyl-2,3,4,5-tetrahydro-lH-l ,5- benzodιazepιne-1-acetylamιno]4-oxo-butyrιc acid (678) , was synthesized by the method used to prepare 667 from 666 to afford 54 mg of 678 as a white solid, H NMR 'CD ₃ 0D) δ 2.45 (m, IH) , 2.7(m, IH) , 3.5 (m, 2H) , 3.^5(bι . s, 6H), 4.05(d, IH) , 4.3(m, IH) , 4.51-4.6(m, 2bl 1 , 4.8(br. , 2H) , 6.7(d, 2H) , 7.4-7.5(br. m, 3H. , 7.6- ^~ .65 (br. m, 2H) .

(35) -2-Oxo-3-benzoylformylamιno-5- (2-hydroxy)acetyl-N- (2RS,35) -benzyloxy-5-oxo-tetrahydrofuran-3-yl]-2,3,4 ,5- tetrahydro-lH-1 ,5-benzodiazepine-l-acetamιde (680), was synthesized from 600b by the methods used to prepare 677 from 600b to afford 140 mg of 680 as a white solid,

^! H NMR (CDC1 ₃ ) δ 2.31(d, IH) , 2.4(dd, 2H) , 2.75(dd, 2H), 2.85(dd, IH) , 3.36(br. s, IH) , 3.45(br. s, IH), 3.6(br. t, 2H) , 3.82(br. m, 2H) , 3.95(br. d, 2H) , 4.35(m, 2H), 4.42(d, IH), 4.55(m, IH) , 4.70(d, IH) , 4.82(br. s, 2H) , 5.5(d, IH) , 6.91(d, IH) , 7.25(br. m, 5H), 7.35-7.46 (br . m, 3H) , 7.5-7.6 (m, 2H) , 8.15(br. d, 2H) .

(35) -3- [ (35) -2-Oxo-3-benzoylformylamιno-5- (2- hydroxy)acetyl-2 ,3,4,5-tetrahydro-lH-l , 5- benzodιazepιne-1-acetylamιno]4-oxo-butyrιc acid (681), was synthesized from 680 by the method used to prepare 678 from 677 to afford 45 mg of 681 as a grey solid, "H NMR (CD ₃ OD) δ 2.5(m, IH), 2.7(dt, IH) , 3.65-3.85 (br . , 3H) , 4.05(m, IH), 4.3(m, IH), 4.5-4.7(br. m, 3H),

4.85(br. s, 2H) 7.3(br m, 2H), 7.4-7.7 (m, 5H) 8.15 (d, 2H) .

(3S) -2-Oxo-3-benzoylamιno-5- (2-acetoxy)acetyl-N- [ (2i?5,35) -benzyloxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepme-l-acetamιde

(682) , was synthesized from 600b by the methods used to prepare 655 from 600b to afford 495 mg of 682 as a white solid, ¹ H NMR (CDC1 ₃ ) 6 2.00(s, 3H) , 2.05(s, 3Hj , 2.47(d, IH), 2.58(dd, IH) , 2.85(dd, IH) , 2.89(dc, IH) , 3.9(m, 2H), 4.05-4.15 (m, 2H) , 4.19(dd, IH), 4.45(m, 2H) , 4.55-5.05(m, 8H) , 5.55(d, IH) , 6.85(d, IH) , 7.15(d, IH), 7.25-7.55(m, 10H), 7.75(d, 2H) .

(35) -3- [ (35) -2-Oxo-3-benzoylammo-5- (2-acetoxy) acetyl- 2,3,4,5-tetrahydro-lH-l ,5-benzodiazepιne-l- acetyla ino]4-oxo-butyric acid (683), was synthesizeα from 682 by the method used to prepare 2002 fror 2001 to afford 82 mg of 683 as a white soliα, ^X H NMR CD ₃ OO, δ 2.1 (s, 3H), 2.5 (m, IH) , 2.68 (m, IH) , 3.8 (m, IK , 4.29(dd, IH) , 4.31 (m, IH) , 4.45(d, IH), 4.55(d, IH) , 4.6(d, IH) , 4.72(d, IH) , 4.95(br. s, 2H) , 7.45( r. , 2H) , 7.52-7.65(br. m, 5H) , 7.88(d, 2H) .

684

(35) -3- [ (35) -2-OXO-3- (3,5-dimethyl-4- methoxybenzoyl) aιmino-5-acetyl-2,3,4 ,5-tetrahydro-lH- 1 ,5-benzodiazepine-l-acetylamino]4-oxo-butyric acid

(684), was synthesized from 600b by the method used to prepare 605d from 600b to afford 72 mg of 684 as a white solid, ¹ H NMR (CD ₃ 0D) 6 1.9(s, 3H) , 2.25(s, 6H), 2.45 (m, IH), 2.6 (m, IH) , 3.3(s, IH) , 3.7(s, 3H) , 4.25(m, IH) , 4. 5-4.6 (m, 3H) , 7.4(br. s, 2H) , 7.55(br. d, 4H) .

(35) -2-OXO-3- (3-chloro-4-aminobenzoyl) ammo-5- (2- triisopropylsilyloxy) acetyl-N- [ (2RS ,35) -benzyloxy-5- oxo-tetrahydrofuran-3-yl] -2,3, ,5-tetrahydro-lH-l ,5-

benzodιazepιne-1-acetamιde (685) , was synthesized from 600b by the methods used to prepare 676 from 600b to afford 165 mg of 685.

(35) -3- [ (35) -2-0x0-3- (3-chloro-4-amιnobenzoyl)ammo-5- (2-tπιsopropylsιlyloxy)acetyl-2,3,4,5-tetrahydro-lH- 1 ,5-benzodιazepιne-l-acetylamιno]4-oxo-butyric acid

(686) . To a solution of 685 (165 mg, 0.21 mmol) in THF was added a solution of TBAF (IM, 0.21 L) . The product was isolated by filtration after precipitation from reaction mixture. Reverse phase chromatography (10% to 80% MeCN in water/ 0.1% TFA) afforded 25 mg of 686 as a white solid, ¹ H NMR (CD ₃ OD) 6 2.37-2.42 (m) , 2.59-2.70 (m) , 3.60-3.89 (m) , 4.01 (d) , 4.20-4.31 (m) , 4.42-4.70 (m) , 4.80-5.05 m 6.79 (d) 7.32-7.6; (m) 7.81

(35) -2-OXO-3- (3,5-dιchloro-4-hydroxybenzoyl)ammo-5- methoxyacetyl-2,3,4,5-tetrahydro-lH-l ,5-benzodιazepme- 1-acetιc acid (687a), was synthesized from 600b using methods similar to those used for preparing 654 from 600b to afford 1.6 g of 687a.

(3S) -2-0x0-3- (3,5-dimethyl-4-hydroxybenzoyl)amιno-5- methoxyacetyl-2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne- 1-acetιc acid (687b) , was synthesized from 600b using methods similar to those used for preparing 654 from 600b to afford 1.1 g of 687b.

(35) -2-0x0-3- (3,5-dιchloro-4-hydroxybenzoyl)amιno-5- methoxyacetyl-N- [ (2 5,35) -benzyloxy-5-oxo- tetrahydrofuran-3-yl]-2,3,4 ,5-tetrahydro-lH-l ,5- benzodιazepιne-1-acetamιde (688a) . To a solution of ( 3S, 2R, S) -3-allyloxycarbonylamιno-2-benzyloxy-5- oxotetrahydrofuran (Chapman, Biorg. Med. Chem. Lett., 2, pp. 613-618 (1992)) (1.13 g, 1.2 equiv) CH ₂ C1 ₂ was added triphenylphosph e (423 mg, 0.5 equiv) , dimethylbarbituric acid (1.26 g, 2.5 equiv), and tetrakistriphenylphosphme palladium (0) (373 mg, 0.1 equiv) . After 5 minutes the reaction mixture was cooled via ice-bath then added a solution of 687a m DMF (1.6 g, 1 equiv) , HOBT (480 mg, 1.1 equiv) , ana EDC (681 mg, 1.1 equiv) . The resulting mixture was alioweα tc st_r at ambient temperature. After 6 hours tne reaction mixture was poured mto NaHS0 ₄ and extracted twice with EtOAc. The organic layer was washed with NaHC0 ₃ , brme, dried over Na ₂ S0 ₄ and concentrateα n vacuo . Chromatography (Sι0 ₂ , 20° to 100 EtOAc in CH ₂ C1 ₂ ) afforded 880mg of 688a as an off-white soliα, "

NMR (CD3OD) δ 2.55(dd, IH) , 2.7 (dd, IH) , 3.0 (m, IH) ,

3.6(m, IH) , 3.75(d, IH) , 3.9-4.0(m, 2H) , 4.3-4.45 (m,

3H) , 4.5-4.6(m, 3H) , 4.7 (m, 2H) , 5.35(s, IH) , 5.55(d, IH), 7.1-7.5(11., 4H) , 7.85(s, 2H) .

(35) -2-0x0-3-(3,5-dιmethyl-4-hydroxybenzoyl)ammo-5- methoxyacetyl-N- [ (2.R5,35) -benzyloxy-5-oxo- tetrahydrofuran-3-yl]-2,3,4,5-tetrahydro-lH-l ,5- benzodιazepιne-1-acetamιde (688b), was synthesized from 687b by the method used to prepare 688a from 687a to afford 960 mg of 688b as an off-white solid, ¹ R NMR

(CD ₃ OD) δ 2.6(dd, IH) , 2.7 (dd, IH) , 3.0(dd, IH), 3.2(s, 3H), 3.7 (m, 3H) , 3.9 (m, 2H) , 4.4-4.5(m, 2H) , .6 (m, 3H) , 5.35(s, IH), 5.55(d, IH) , 7.25 (m, 2H) , 7.4-7.5(m, 4H) .

(3S)-3-[ (3S) -2-OXO-3- (3,5-dιchloro-4- hydroxybenzoyl)amιno-5-methoxyacetyl-2,3,4,5- tetrahydro-lH-1,5-benzodιazepιne-l-acetylammo] 4-oxo- butyric acid (689a) , was synthesized from 688a oy the method used to prepare 2002 from 2001 to afford 184 mg of 689a as a white solid, ¹ H NMR (CD ₃ 0D) 6 2.45 (rc, IH) , 2.6(m IH), 3.3(s, 3H) , 3.7-3.85(m, 2H) , 4.0(d, IH) , 4.3 (m, IH), 4.5-4.6 ( , 3H) , 7.3-7.6(m, 4H) , 7.85(s, 2H) .

(3S) -3- [ (3S) -2-OXO-3- (3,5-dιmethyl-4- hydroxybenzoyl)amιno-5-methoxyacetyl-2 ,3,4,5- tetrahydro-lH-1 ,5-benzodιazepme-l-acetylammo]4-oxo- butyric acid (689b) , was synthesized from 688b oy the method used to prepare 2002 from 2001 to afford 412 mg of 689b as a white solid, ^X H NMR (CD ₃ 0D) δ 2.5 (rr, IH) ,

2.7(m, IH) , 3.3(s, 3H) 3.7-3.85(m, 2H) 4.05(dd, IH; 4.3 ( , IH) , 4.6(m, 2H) 7.45-7.4(m, 2H) 7.5(s, 2H) , 7.55 (m, 2H) .

(35) -2-OXO-3- (3 , 5 -dimethyl -4 -hydroxybenzoyl) ami no -5- hydroxyacetyl-N- [ (2J 5,35) -benzyloxy-5-oxo- tetrahydrofuran-3-yl ] -2 , 3 , 4 , 5-tetrahydro-lH-l , 5- benzodιazepιne-1-acetamιde (690a), was synthesized from

600b via methods used to prepare 676 from 600b, 688a from 687a, then 677 from 676 to afford 863 mg cf 690a as a white solid, ¹ H NMR (CD ₃ 0D) δ 2.2(s, 6H) , 2.45(α, 0.5H) , 2.6-2.9(m, IH) , 3.05(dd, 0.5H) , 3.65-3.85(m, 2H) , 3.95-4.1 (m, IH), 4.35-5.0 (m, 7H) , 5.35(s, I.SH ¹ , 5.65(d, 0.5H), 7.2-7.4 (m, 4H) , 7.4-7.7 (m, 7H) .

(35) -2-OXO-3- (4 -hydroxybenzoyl) ammo-5-hydroxyacetyl-N- [ (2RS, 35) -benzyloxy-5-oxo-tetrahydrofuran-3-yl ] -

2,3,4 ,5-tetrahydro-lH-l , 5-benzodιazepιne-l-acetamιde (690b) , was synthesized from 600b via methods used to prepare 677 from 600b to afford 200 mg of 690b, ^{^} H NMR

(CD3OD) δ 2.49(d, IH), 2.65(d, IH) , 2.66(d, IH) , 2.85(d, IH), 2.87(d, IH) , 3.05(dd, IH) , 3.35(br. s, IH) , 3.72(br. s, 2H) , 4.01 (m, 2H) , 4.45(br. m, IH) , 4.6 (m, IH) , 4.7 (m, IH) , .8 (m, IH) , 4.95(br. s, 2H) , 5.65(d, IH) , 6.8(d, 2H), 7.2-7.35(br. m, 3H) , 7.45(m, 2H) , 7.75 (d, 2H) .

(35) -3-[ (35) -2-OXO-3- (3,5-dimethyl-4- hydroxybenzoyl)amιno-5-hydroxyacetyl-2 ,3,4,5- tetrahydro-lH-1 ,5-benzodιazepιne-l-acetylammo]4-oxo- butyric acid (691a), was synthesized from 690a by the method used to prepare 2002 from 2001 to afford 560 mg of 691a as a white solid, X NMR (CD ₃ OD) 6 2.15(s, 6H) , 2.45(m, IH) , 2.65 (m, IH) , 3.55 (m, IH) , 3.7(d, IH) , 4.0(d, IH) , 4.25(m, IH) , 4.5-4.6 (m, 3H) , 7.3-7.5 (m, 6H) .

(35) -3- [ (3S) -2-OXO-3- (4-hydroxybenzoyl)amιno-5- hydroxyacetyl-2,3,4,5-tetrahydro-lH-l,5-benzodιazepιne- 1-acetylammo]4-oxo-butyric acid (691b), was synthesized from 690b by the method used to prepare 2002 from 2001 to afford 410 mg of 691b as a white solid, ¹ H NMR (CD ₃ OD) δ 2.5 (m, IH) , 2.65(m, IH), 3.75 (m, IH) , 3.8(d, IH) , 4.05(d, IH) , 4.25(m, IH) , 4.5 (m, IH), 4.6(m, IH) , 4.95(br. s, 2H) , 6.8(d, 2H) , 7.45 (1x1, 2H) , 7.6(m, 2H) , 7.75 (d, 2H) .

(3S) -2-Oxo-3-benzoylammo-5-hydroxyacetyl-N- [ (2RS , 3S) - benzyloxy-5-oxo-tetrahydrofuran-3-yl] -2 ,3,4 ,5- tetrahydro-lH-1,5-benzodiazepιne-l-acetamιde (695a) , was synthesized from 600b via methods used to prepare

677 from 600b to afford 75 mg of 695a, ¹ H NMR (CD ₃ 0D) 6 2.2(s, 6H), 2.45(m, IH) , 2.6 (m, IH) , 3.65 ( , IH) , 3 . I b i d, IH) , 4.0(d, IH) , 4.28 (m, IH) , 4.5 (m, 3H) , 7.4- 7.6 (m, 6H) .

(35) -2-OXO-3- (4-acetamιdobenzoγl)ammo-5-hydroxyacetyl- N- [ (2_ 5,35) -benzyloxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepme-l-acetamιde

(695b) , was synthesized from 600b via methods used to prepare 677 from 600b to afford 880 mg of 695b, ^~ H NMR

(CDCI ₃ ) δ 2.1(s, 3K , 2.25-2.5(m, 2H) , 2.8-2.92(m, 0.5H), 3.15-3.2(m, 3.5H), 3.45-3.6(m, 2H|, 3.75-3.95 im, 2H) , 4.15-4.25(m, IK , 4.35-4.6(m, 2H) , 4.6- .88 (m, 3H) , 5.22(s, 0.25H), 5.33(s, 0.25H), 5.52-5.58(d, 0.5H) , 7.15-7.45(m, 9.5H), 7.5-7.75 (m, 5H), 8.3-8.35(m, 0.5H) , 9.08-9.18 (m, IH) .

(35) -2RS-OXO-3- (3,5-dimethyl-4-hydroxybenzoyl) amino-5- hydroxyacetyl-N- (2-benzyloxy-5-oxo-tetrahydrofuran-3- yl) -2,3,4 ,5-tetrahydro-lH-l ,5-benzodiazepine-l- acetamide (695c), was synthesized from 600b via methods used to prepare 677 from 600b to afford 840 mg cf 695c,

¹ H NMR(CDC1 ₃ ) 6 2.23(s, 3H) , 2.26(s, 3H) , 2.45-2.62(m, IH) , 2.8-2.9(dd, 0.5H), 2.9-3.05(dd, 0.5H) , 3.45- 3.63(m, IH), 3.64(s, 1.5H) , 3.68(s, 1.5H), 3.78-4.05 (m, 2H), 4.2-4.33(m, IH) , 4.4-4.63 (m, 2H) , 4.65-4.94 (m, 2H) , 4.95-5.1 (m, IH) , 5.45(s, 0.5H), 5.5-5.6(d, 0.5H), 6.9-6.95(d, IH) , 7.25-7.7(m, 12H) .

(35) -2-0x0-3- (3,5-dichloro4-hydroxybenzoyl)amino-5- hydroxyacetyl-N- [ (2.R5,3S) -benzyloxy-5-oxo- tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-lH-l ,5- benzodiazepine-1-acetamide (692a), was synthesized from 600b via methods used to prepare 661 from 600b, excluding steps used to make 604d from 603d, using instead the method to prepare 688a from 687a to afford 854 mg of 692a , ¹ H NMR (CD ₃ 0D) δ 2.45(d, IH) , 2.6 (m, IH) , 2.7 (m, IH) , 3.0 (m, IH) , 3.5-3.7(m, 4H) , 4.0(q,

2H) , 4.45 (m, 3H) , 4.55 (m, 4H) , 5.35(s, IH) , 5.6(d, IH) , 7.2-7.5(m, 9H) , 7.85(s, 2H) .

(3S) -2-OXO-3- (3,5-dιmethyl-4-hydroxybenzoyl) amιno-5- hydroxyacetyl-N- [ (2RS, 3S) -ethoxy-5-oxo-tetrahydrofuran- 3-yl] -2,3,4,5-tetrahydro-lH-l,5-benzodιazepιne-l- aceta ide (692b) , was synthesized from 600b via methods used to prepare 661 from 600b, excluding steps used to make 604d from 603d, usmg instead the method to prepare 688a from 687a to afford 207 mg of 692b , ¹ H NMR (CD ₃ 0D) 6 1.05(t, 3H) , 1.15(t, 3H) , 2.45(d, IH) , 2.55(m, IH), 2.7 (m, IH) , 3.55 ( , 2H) , 3.6-3.75 (m, 5H) , 4.0(dd, 2H), 4.3(d, IH) , 4.4-4.7 (m, 5H), 5.25(s, IH) , 5.5(d, IH), 7.25-7.6(m, 4H), 7.85(s, 2H) .

( 3S) -2 -Oxo-3 -benzoylamιno-5 -acetyl -N- [ (2i?5 , 35) - benzyloxy-5-oxo-tetrahydrofuran-3-yl] -2,3,4 ,5- tetrahydro-lH-1 ,5-benzodιazepιne-l-acetamide (693), wa; synthesized from 600b via methods used to prepare 688a from 600b to afford 30 mg of 693 , X NMR (CD ₃ 0 ; δ 1.7(s, 3H), 1.8(s, 3H) , 2.51(d, IH), 2.6(ιr, IH), 2.85(m, IH) , 3.0(m, IH) , 3.75(br. d, 2H) , 4.0-4.1 (dd, 2H), 4.5-5.0(m, 6H) , 5.45(s, IH) , 5.55(s, IH), -\15- .85 (m, 14H) .

(35) -3- [ (3S) -2-OXO-3- (3,5-dimethyl-4- methoxybenzoyl)amino-5-hydroxyacetyl-2,3,4,5- tetrahydro-lH-1,5-benzodiazepιne-l-acetylamιno]4-oxo- butyric acid (694), was synthesized from 691c by the method used to prepare 2002 from 2001 to afford 380 mg of 694 as a white solid, ¹ H NMR (CD ₃ 0D) δ 2.25 (s, 6H) , 2.45(m, IH), 2.65(m, IH) , 3.65(m, 5H) , 4.0(d, IH) , 4.28(πι, IH), 4.55(d, 2H) , 4.95 (m, IH) , 7.4-7.6 (m, 6H) .

Compounds 700-711 were prepared by methods similar to the methods used to prepare compounds 619- 635 (see, Example 13) . Physical data for compounds 700-711 is listed in Table 25.

Compounds 910-915 and 918-921 were prepared as described below. Physical data for these compounds is listed m Table 26.

Table 25

I

Table 26

- f

Step A. Synthesis of 401. TentaGel S® NH ₂ resm (0.25 mmol/g, 6.8 g) was placed in a glass shaker vessel and washed with dimethyiacetamide (3 X 20 mL) . To a solution of 400 (1.70 g, 2.9 mmol, prepared from (3S) 3- (fluorenylmethyloxycarbonyl) -4-oxobutryιc acid t-butyl ester accordmg to A.M. Murphy et. al. J. Am. Chem. Soc. 114, 3156-3157 (1992)) in dimethyiacetamide (15 mL) was added O-benzotriazole-N,N,N,N' - tetramethyluronium hexafluorophosphate (HBTU; 1.09 g, 2.9 mmol), and DIEA (1.0 mL, 5.7 mmol) . The solution was added to the resm, followed by dimethyiacetamide

(5 mL) . The reaction mixture was agitated for 3 h at room temperature using a wrist arm shaker. The resm was isolated by suction filtration and washed with dimethyiacetamide (6 X 20 mL) . A sample of resm (7.4 mg) was thoroughly washed with 50% methanol in dichloromethane and dried under suction. Deprotection of the Fmoc group usmg 20% piperidme m dimethyiacetamide (10.0 mL) and UV analysis of the solution revealed a substitution of 0.19 mmol g ^± .

Step B. Synthesis of 903. Resm 401 was deprotected with 20% (v/v) piperidine/dimethylacetamide (20 mL) for 10 mm (shaking) and then for 10 mm with fresh piperidme reagent (20 ml) . The resm was then washed with dimethyiacetamide (6 X 20 ml . A solutior of 902 (1.52 g, 2.81 mmol) was treated with HBTU (1.07 g, 2.83 mmol) and DIEA (1.0 mL, 5.7 mmol, and transferred to the resm, followed by dimethylacetamice (5 mL) . The reaction mixture was agitated for 2.5 h at room temperature using a wrist arm shaker. The resm was isolated by suction filtration and wasned with

dimethyiacetamide (4 X 20 mL) and dichloromethane (4 X 20 mL) , and dried under nitrogen purge. Resin substitution was performed as described for 401 and determined to be 0.169 mmol g

Step C. Synthesis of 905. Resm 903 ( ^"7 .54 g, 1.27 mmol) and dimedone (2.19 g, 15.6 mmol) were placed in a 100 mL round bottomed flask and freshly distilled anhydrous tetrahydrofuran (60 mL) was added. Tetrakis (triphenylphosphine)palladium (0) (0.32 g, 0.28 mmol) was added and the nitrogen blanketed, sealed reaction was agitated for 15 h on a wrist action shaker. The res was filtered, washed with dimethyiacetamide (4 X 20 mL) , dichloromethane (4 X 20 mL) and dimethyiacetamide (1 X 20 mL) . Sufficient dimethyiacetamide was added to the resm to obtain a slurry followed by pyπdine (1.5 mL, 18.5 mmol) and a solution of 904 (5.5 mmol) in dichloromethane (10 mL) . The reaction was shaken under nitrogen for 8 h, then filtered. The resin was washed with dimethyiacetamide (5 X 20 mL) and dichloromethane (5 X 20 mL) .

Step D. Synthesis of 906. This compound was prepared from resm 905 (0.24 g, 0.038 mmol) using an Advanced ChemTech 396 Multiple Peptide synthesizer. The automated cycles consisted of a resm wash w th dimethylformamide (3 X 1 mL) , deprotection with 25 (v/vj piperidme in dimethylformamide (1 mL) for 10 mm followec by fresh reagent (1 mL) for 20 mm to yield resin 906. The resin was washed with dimethylformamide (3 X 1 L) and N-methypyrrolidone (3 X 1 mL, .

Step E. (910-922) Resin 906 was acylated with a solution of 0. M carboxylic acid and 0.4M HOBT in N- methypyrrolidone (0.5 mL) , a solution of 0. M HBTU m N-methylpyrrolidone (0.5 L) and a solution of 1.6M DIEA in N-methypyrrolidone (0.25 L) and the reaction was shaken for 2 hr at room temperature. The resm was washed with N-methylpyrrolidone (1 X 1 mL) , dimethylformamide ( X 1 mL) , 50% methanol m dichloromethane (5 X 1 mL) and dried in air. The aldehyde was cleaved from the resin and globally deprotected by treatment with 95% TFA/ 5 % H ₂ 0 (v/v, 1.5 mL) for 30 min at room temperature. After washing the resin with cleavage reagent (2 X 1 mL) , the combmed filtrates were added to cold 1:1 ether.hexane (35 mL) and the resulting precipitate was isolated by centrifugation and decantation. The resulting pellet was dissolved in acetonitrile (0.5 mL) and H ₂ 0 (0.5 L) and filtered through 0.45 micron microcentπfuge filters. The compound was purified by semi-preparative RP-HPLC with a Rainin Microsorb™ C18 column (5 μ, 21.4 X 250 mm) eluting with a lmear acetonitrile gradient (10% - 50%) containing O . l '-c TFA (v/v) over 30 mm at 12 mL/mm. Fractions containing the desired product were pooled and lyophilized to provide 910-922.

Analytical HPLC methods:

(1) Waters DeltaPak C18, 300A (5μ, 3.9 X 150 mm, . Linear acetonitrile gradient (0° - 25-) containing 0.1 TFA (v/v) over 14 min at 1 mL/m .

(2) Waters DeltaPak C18, 300A (5μ, 3.9 X 150 mm) . Linear acetonitrile gradient (5% - 45%) containing 0.1 ^' TFA (v/v) over 14 min at 1 mL/min.

696

(3S) -3- [ (3S) -2-OXO-3-(isoquinolin-1-oyl)amιno-5- hydroxyacetyl-2,3,4,5-tetrahydro-lH-l,5-benzodιazepme- 1-acetylamino]4-oxo-butyric acid (696) was synthesized from 600b by the method used to prepare 691a from 600b to afford 696. ¹ H NMR (CD3OD) δ 2.45 (m, IH) , 2.7 (m,

IH) , 3.75(d, IH), 3.95(q, IH) , 4.05(d, IH) , 4.3 ( , IH) , 4.45-4.65(m, 2H) , 5.05(m, IH) , 7.5-7.6 (m, 3H) , 1.1 (t, IH), 7.8(t, IH) , 7.98(t, IH) , 8.55(d, IH) , 9.1 (d, IH) .

696b R oa

696d R' -o

696e R ¹ - v\ //

(3S) -2-0x0-3- (ιsoquιnolιn-1-oyl)amιno-5-hydroxyacetyl- N-[ (2RS, 3S) -benzyloxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4,5-tetrahydro-lH-l,5-benzodιazepme-l-acetamιde

(696a) was synthesized from 600b via methods used to prepare 690a from 600b to afford 696a. ^" " ^" H NMR (CDCl _j ) δ 0.95(t, 2H), 1.25(t, IH) , 1. (m, 2H) , 1.55 (m, IH) , 2.55(m, IH) , 2.85(m, IH) , 2.95(dd, IH) , 3.15(m, IH) , 3.55(1X1, IH) , 3.9(m, 2H) , 4.35(t, IH) , 4.4-4.55 ( , 2H), 4.75(m, IH) , 4.8-5.05(m, 2H) , 5.45(s, IH) , 5.55(d, IH) , 6.85(d, IH) , 7.15(d, IH) , 7.2-7.5(m, 5H) , 7.6-7.8 (m, 3H) , 8.45(d, IH) , 9.05(d, IH) , 9.35(d, IH) .

(3S) -2-0x0-3- (ιsoquιnolιn-1-oyl)amιno-5-hydroxyacetyl- N- [ (2RS, 3S) -ethoxy-5-oxo-tetrahydrofuran-3-yl] -2,3,4,5- tetrahydro-lH-1,5-benzodiazepme-1-carboxamide (696b) was synthesized from 600b via methods used to prepare 690a from 600b to afford 696b. ¹ H NMR (CDCl _j ) δ 0.9(m, 3H), 1.15(q, 3H) , 1.15(m, IH) , 1.65(m, IH), 2.5(m, IH), 2.8 (m, IH), 2.95-3.0(m, 2H) , 3.6(m, 2H) , 3.7-3.85(m, 4H) , 4.0(m, 2H), 4.3 (m, IH) , 4.55 (m, IH) , 4.65(m, IH), 4.85-4.95(m, IH) , 5.05 (m, IH) , 5.35(s, IH) , 5.45(d,

IH) , 6.85(d, IH) , 7.25(d, IH), 7.35-7.85 ( 6H) , 8.85(dd, 2H), 9.05(m, IH) , 9.35(dd, 2H) .

(3S) -2-OXO-3- (ιsoqumolιn-1-oyl)amιno-5-hydroxyacetyl- [2RS- (4-chlorobenzyl)oxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4,5-tetrahydro-lH-l ,5-benzodιazepιne-l-carboxamιde

(696c) was synthesized from 600b via methods used to prepare 690a from 600b to afford 696c. ¹ H NMR (CD ₃ 0Dj δ 1.25(t, IH) , 1.65(q, IH), 1.9 (m, IH), 2.9 (m, IH ,

3.05 (m, IH), 3.9(d, IH) , 4.2 (m, IH) , 4.3(d, IH) , 4.7- 5.0(m, 3H), 5.25(m, IH) , 5.7(s, IH) , 5.9(d, IH) , 7.5(d, 2H) , 7.7-7.9 (m, 3H) , 8.0(t, IH) , 8.2 (m, 2H) , 8.75(d, IH) , 9.35(d, IH) .

(3S) -2-0x0-3- (isoqumolm-l-oyl)aπuno-5-hydroxyacety1- (2HS-cyclopentyloxy-5-oxo-tetrahydrofuran-3-yl) - 2,3,4,5-tetrahydro-lH-l,5-benzodiazepme-1-carboxamide

(696d) was synthesized from 600b via methods used to prepare 690a from 600b to afford 696d. ¹ H NMR (CDC1 ₃ ) 5 0.9(t, IH) , 1.2(t, IH) , 1.3-1.45(m, 2H) , 1.6-1.8(m,

4H) , 2.45(m, IH) , 2.8 (m, IH) , 3.0(m, IH) , 3.4(q, IH) , 3.5(d, IH) , 4.0(m, 2H) , 4.2-4.3(m, 2H) , 4.55(d, IH), 4.65(m, IH), .9 (m, IH) , 5.05 ( , IH) , 5.4(s, IH) , 5.5(d, IH), 6.8(d, IH) , 7.3-7.9(m, 6H) , 8.5(d, IH) , 9.05(d, IH) , 9.4 (d, IH) .

(35) -2-0XO-3- (ιsoqumolιn-1-oyl)amιno-5-hydroxyacetyl- N- [ (2J ,3S) -phenethoxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4,5-tetrahydro-lH-l ,5-benzodιazepιne-l-acetamιde

(696e) was synthesized from 600b via methods used to prepare 690a from 600b to afford 696e. ¹ H NMR (CDC1 ₃ ) δ 1.2(t, IH) , 2.4(m, IH) , 2.8 (m, 2H) , 3.6(d, IH) , 3.7(q, IH) , 4.0(m, 2H), 4.3(d, 2H) , 4.65 (m, IH), 4.85(t, lri), 5.0(m, IH) , 5.35(d, IH) , 6.5(d, IH) , 7.15-7.85 (n, 8H) , 8.45(d, IH), 9.05(d, IH) , 9.4(d, IH) .

Example 32

Table 27

Example 33 Compounds 684a, 688b-l, 688c, 689b-l , 690a-l, 696-1, 696-2, 696a-2, 696a-l, 697, 697a, 698, 698a, 699, 699a, 699a-l, 699a-2 , 800 and 801 were prepared as described below.

H

Table 28

(35) -3- [ (3S) -2-OXO-3- (3,5-dimethyl-4- hydroxybenzoyl) ammo-5-hydroxyacetyl-2 ,3,4,5- tetrahydro-lH-1 ,5-benzodiazepme-1-acetylammo] 4,4- diethoxybutyric acid ethyl ester(690a-l) , was synthesized by the methods used to prepare 690a and

1 2100b to afford 690a-l, H NMR(CDC1 ₃ ) δ 1.15(t, 6H) , 1.3<t, 3H) , 2.25 (s, 6H) 2.60(d, 2H) , 3.50(m, 2H) , 3.70(m,4H), 4.05 (m, 2H) , 4.15(1X1, 2H) , 4.30 (α, IH) , 4.45 (m, IH) , 4.50(d, lHi 4.55(d, IH) , 4.70(t, IH; , 5.05(ιr, IH) , 5.30(s, IH] 6.70(d, IH), 7.10(d, 2H) , 7.30-7.50(m, 7H)

(35) -2-OXO-3- (3 , 5-dιchloro-4-amιnobenzoyl) amιno-5- hydroxyacetyl-N- [ (2_ S,35) 2-benzyloxy-5-oxo- tetrahydrofuran-3-yl] -2 ,3,4 ,5-tetrahydro-lH-l ,5- benzodιazepme-1-acetamide (697a) was syntnesizeo via methods used to prepare 677 to afford 840 mg of 697a, ¹ H NMR (CDC1 ₃ ) δ 1.78 (br. s, 2H) , 2.48-2.58 (α, 0.5H, ,

2.6-2.7 (m, 0.5H), 2.8-2.9 (m, 0.5H) , 2.92-3.03 (m, 0.5H) , 3.55-3.8 (m, 2H) , 3.92-4.02 (d, IH) , 4.25-4.3 (d, 0.5H) , 4.37-4.42 (d, 0.5H) , 4.43-4.48 (m, 0.5H) , 4.55-4.65 (m, 1.5H) 4.7-5.12 (m, 5H) , 5.44 (s, 0.5H) , 5.58-5.63 (d, 0.5H), 6.95-8.1 (m, 13H) .

(35) -3- [ (35) -2-OXO-3-(3,5-dιchloro4-amιnobenzoyl)amino- 5-acetyl-2 ,3, ,5-tetrahydro-lH-l ,5-benzodιazepιne-l- acetylamιno]4-oxobutyrιc acid (697) was synthesized via methods used to prepare 2002 from 2001 to afford 140 mg of 697, ¹ H NMR (CD ₃ 0D) δ 238-2.5 (m, IH) , 2.55-2.75 ( , IH) , 3.68-3.9 (m, 3H) , 3.95-4.03 (m, IH), 4.2-4.3 ( , IH), 4.4-4.7 (m, 4H) , 7.35-7.8 (m, 6H) .

(35) -3- [ (35)-2-Oxo-3-(3,5-dιmethyl-4- methoxybenzoyl)ammo-5-hydroxyacetyl-2,3,4,5- tetrahydro-lH-1,5-benzodιazepme-l-acetylammo]4- acetoxy-3-butenoιc acid ethyl ester(684a), was synthesized by the methods used to prepare 2100-j to afford 684a, ¹ H NMR (500 MHz, CDC1 ₃ mixture of diastereomers) δ 1.3 (s, 9H) , 1.8(s, 3H), 2.1(s, 3H) , 2.15(s, 3H) , 2.3(s, 6H) , 3.3-3.5(m, 3H) , 3.65(s, 3H) , 3.9( , IH) , 4.1(d, IH) , 4.3(d, IH) , 4.6-4.8(m, 3H) , 5.0(m, IH) , 6.7(s, IH) , 7.0(d, IH) , 7.1 (d, IH) , 7.2- ^~ \5(m, 6H) .

(3S) -2-Oxo-3-ιsoquιnolm-l-oylammo-5-formyl-N- [(2K5,35) 2-benzyloxy-5-oxo-tetrahydrofuran-3-yl ] - 2,3,4,5-tetrahydro-lH-l ,5-benzodιazepιne-l- acetamide(698a) was synthesized via methods used to prepare 652 to afford 795 mg of 698a ¹ H NMR (500 MHz, CDC1 ₃ mixture of diastereomers) δ 2.8 (m, 2H) , 4.0(m, IH , 4.5-4.8 (m, 4H) , 5.2 (m, IH), 5.5(s, IH), 5.75(d,

IH) , 7.3-7.85 (1X1, 11H) , 7.9(t, IH) , 8.2 (d, IH) , 8.6(m, IH) , 9.3 (m, IH) .

(35) -3- [ (35) -2-Oxo-3-ιsoquιnolιn-l-oylamιno-5-foπxtyl- 2,3,4 ,5-tetrahydro-lH-l,5-benzodιazepιne-l- acetylammo]4-oxobutyr xc acid(698) was synthesized via methods used to prepare 653 to afford 225 mg of 698 H NMR (500 MHz, CD ₃ OD) δ 2. (m, IH) , 2.6 (m, IH) , 3.9(m, IH) , 4.2(m, IH) , 4.3-4.7 ( , 4H) , 5.1(m, IH) , 7.3-7.5(m, 4H) , 7.6-7.8 (m, 2H) , 7.8(m, 2H) , 8.2(d, IH) , 8.5(d, IH) , 9.0 (d, IH) .

(3S) -2-Oxo-3-isoquinol -l-oylamino-5-methoxyacetyl-N- [ (2RS,3S) 2-benzyloxy-5-oxo-tetrahydrofuran-3-yl]- 2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepιne-l- acetamide(699a) was synthesized via methods used to prepare 655 to afford 820 mg of 699a as a tan solid, H NMR (500 MHz, CDC1 ₃ ) δ 2.60 (ddd, IH) , 2.90 (ddd, IH) , 3.20 (s, 3H), 3.25 (s, 3H) , 3.70 (t, IH) , 3.90 (m, 2H) , 4.20 (dd, IH), 4.60 (m, 2H) , 4.70-5.00 (m, 5H) , 5.55 (d, IH) , 7.00 (d, IH), 7.20-7.50 (m, 7H) , 8.45 (dd, IH) , 9.0 (dd, IH) , and 9.35 ppm (dd, IH) .

(3S) -2-OXO-3- (3,5-dimethyl-4-hydroxybenzoyl)ammo-5- methoxyacetyl-N- [ (2JS,3S) 2-benzyloxy-5-oxo- tetrahydrofuran-3-yl] -2,3,4 ,5-tetrahydro-7-fluoro-lH- 1 ,5-benzodιazepme-l-acetamιde(688b-l) was synthesized via methods used to prepare 655 to afford 600 mg of 688b-l, ¹ H NMR (CDC1 ₃ ; mix. of diastereomers1 δ 2.21 (s, 3H), 2.28 (s, 3H), 2.42-2.50 (m, 0.5 H), 2.58-2.65 (m, 0.5H), 2.83-2.91 (m, 0.5H), 2.98-3.1 (m, 0.5H) , 3.18 (s,1.5H) , 3.22 (s, 1.5H), 3.72-3.78 (d, IH), 3.73- 3.9 (m, 2H) , 4.08-4.15 (d, IH), 4.5-4.69 (m, 3H^, . ^" -

4.85 (m, IH) , 4.88-5.1 (m, 2H) , 5.45 (s, 0.5H) , 5.55- 5.65 (d, 0.5H), 6.85-6.92 (m, IH) , 7.02-7.13 (m, 2H) , 7.24-7.55 (m, 9H) .

(35) -3-[ (35)-2-Oxo-3-(3,5-dιmethyl-4- hydroxybenzoyl)amιno-5-methoxyacetyl-2 ,3,4,5- tetrahydro-7-fluoro-lH-1,5-benzodιazepιne-l- acetyla ino]4-oxobutyrιc acιd(689b-l) was synthesized via methods used to prepare 2002 from 2001 to afford 689b-l, ¹ H NMR (CD ₃ 0D) δ 2.18 (s, 6H) , 2.36-2.47 (m,

IH), 2.6-2.72 (m, IH) , 3.34 (s, 3H) , 3.66-3.88 (m, 2H) , 3.95-4.05 (m, IH) , 4.2-4.78 (m, 5H) , 4.9 (m, IH) , 7.3- 7.41 (m, 2H) , 7.48 (s, 2H) , 7.5-7.63 (m, IH) .

(3S) -3- [ (35) -2-Oxo-3-isoquιnolin-l-oylam o-5- methoxyacetyl-2,3,4 ,5-tetrahydro-lH-l ,5-benzodιazepme- 1-acetylamino]4-oxobutyric acid(699) was synthesized via methods used to prepare 2002 from 2001 to afford 699 as a white solid, ¹ H NMR (500 MHz, CD ₃ OD) δ 2.50 (m, IH) , 2.70 (m, IH) , 3.25 (s, 3H) , 3.80 (bd, IH) , 3.90 (bd, IH), 4.00 (bd, IH) , 4.30 (m, IH) , 4.50-4.70 (m, 3H) , 4.80-4.85 (bt, IH) , 5.00 (bm, IH) , 7.40-7.55 (m, 5H), 7.70 (bm, IH) , 7.85 (bm, IH) , 8.00 (bm, IH) , 8.55 (bd, IH), and 9.05 ppm (bd, IH) .

(35) -2-Oxo-3-ιsoquinolm-l-oylamιno-5-hydroxyacetyl-N- [(2i?S,35) 2-benzyloxy-5-oxo-tetrahydrofuran-3-yl] -

2,3,4,5-tetrahydro-7-fluoro-lH-1 ,5-benzodιazepme-l- acetamide(696a-l) was synthesized via methods used to prepare 656 to afford 800 as a yellow solid, H NMP

(500 MHz, CDC1 ₃ ) δ 2.55 (add, IH) , 2.85 (ddd, IH) , 3.70-3.80 (m, 2H) , 3.95 (bm, IH) , 4.05 (d, IH, , 4.30

(a, IH), 4.40-4.60 (m, 4H) , 4.70- 5.05 (m, 4H) , 5.55

(d, IH), 7.10 (d, IH) , 7.20-7.35 (m, 3H) , 7.40- 7.50 ( , IH) , 7.60- 7.85 (m, 3H) , 8.40 (dd, IH) , 9.10 ( , IH) , and 9.30 pp (m, IH) .

(35) -2-Oxo-3-ιsoquιnolιn-l-oylamιno-5-hydroxyacetyl-N- [(2RS,3S) 2-benzyloxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4,5-tetrahydro-7-chloro-lH-l ,5-benzodιazepme-l- acetamide(696a-2) was synthesized via methods used to prepare 677, to afford 204 mg of 696a-2 as a white solid,with the exception that the reduction of the nitro- group was done as follows: To a solution of the nitro compound (7.2 g, 20 mmol) m MeOH was added NH ₄ C1 (2.1 g, 39 mmol) and Zn (17 g, 260 mmol) . The resulting mixture was heated to reflux 1 hour after which it was cooled and filtered through celite. The filtrated was concentrated m vacuo then treated with cold IN HCl to afford 3.6 g of a pale red solid. H NMR(CDC1 ₃ ) δ 1.85(s, IH) , 2.45(d, 0.5H), 2.50-2.65(m, 0.5H), 2.80-2.90(m, 0.5H), 2.90-3.00(m, 0.5H), 3.45(s, 0.5H), 3.55-3.75(1X1, IH) , 3.85-4.15(m, 2H) , 4.25(d, IH) , 4.40-4.65(m, 2H) , 4.70-4.80(m, 0.5H) , .85-5.15 (m, 3H) , 5.40(s, 0.5H), 5.60(d, 0.5H), 7.00(d, 0.5H), 7.15- 7.90 (m, 12.5H) , 8.35-8.45(m, IH) , 9.00-9.10 (m, IH) , 9.25-9.40(m, IH)

(35) -3- [ (35) -2-Oxo-3-ιsoquιnolm-l-oylamιno-5- hydroxyacetyl-2 ,3,4 ,5-tetrahydro-7-fluoro-lH-1 ,5- benzodιazepιne-1-acetylamιno]4-oxobutyrιc acid(696-1) was synthesized via methods used to prepare 2002 from 2001 to afford 140 mg of 696-1 as a white solid, ^X H NMR (500 MHz, CD ₃ OD) δ 2.50 (m, IH) , 2.70 (m, IH) , 3.85 (d, IH), 3.95 (m, IH), 4.10 (d, IH), 4.35 ( , IH), 4.50- 4.60 (m, 2H) , 4.80 (bm, IH) , 5.00 (m, IH) , 7.40- 7.48

(m, 3H) , 7.65 (m, IH) , 7.75 (t, IH) , 7.85 (t, IK) , 8.00 (d, IH) , 8.55 (d, IH) , and 9.05 ppm (d, IH) .

(3S) -3- [ (3S) -2-Oxo-3-isoquinolin-l-oylamιno-5- hydroxyacetyl-2,3,4 ,5-tetrahydro-7-chloro-lH-l ,5- benzodiazepme-1-acetylamino]4-oxobutyric acid(696-2) was synthesized via methods used to prepare 2002 from 2001 to afford 250 mg of 696-2as a white solid, ^X H NMR(CD ₃ 0D) δ 2.40-2.55(m, IH) , 2.60-2.75(m, IH) , 3.80- 4.00 (m, 2H) , 4.05(d, IH) , 4.20-4.35 (m, IH) , 4.45- 4.65(m, 3H) , 4.80-5.10(m, 2H)

(35) -2-Oxo-3-isoquinolin-l-oylamino-5-methoxyacetyl-N- [ (2.R5,3S) 2-benzyloxy-5-oxo-tetrahydrofuran-3-yl] - 2,3,4,5-tetrahydro-7-fluoro-lH-l ,5-benzodiazepine-l- acetamide(699a-l) was synthesized via methods used to prepare 655 to afford 699a-l ¹ H NMR (500 MHz, CDC1 ₃ ) δ 2.55 (ddd, IH), 2.90 (ddd, IH) , 3.25 (s, 3H) , 3.28 (s, 3H) , 3.80 (bt, 2H), 3.95 (bm, 2H) , 4.25 (dd, IH) , 4.45- 4.90 (m, 3H), 5.60 (d, IH) , 7.05- 7.40 ( , 8H), 7.50 (bm, IH) , 7.65- 7.85 (m, 2H) , 8.45 (d, IH) , 9.1 (m, IH) , and 9.35 ppm (m, IH)

(3S) -3- t (3S) -2-0xo-3-isoquinolin-l-oylamino-5- methoxyacetyl-2,3,4 ,5-tetrahydro-7-fluoro-lH-1 ,5- benzodiazepine-1-acetylamino]4-oxobutyric acid(699a-2) was synthesized via methods used to prepare 2002 from 2001 to afford 699a-2 ¹ H NMR (500 MHz, CD ₃ 0D) δ 2.51

(m, IH) , 2.70 (dt, IH) , 3.31 (bs, 3H) , 3.90 (bdt, IH) , 3.95 (bm, IH) , 4.05 (d, IH) , 4.35 (m, IK), 4.50 (d, IH) , 4.60 (dd, IH), 4.65 (dt, IH) , 4.80 (m, IH) , 5.05 (m, IH), 7.35- 7.48 (m, 3H) , 7.65 (bm, IH) , 7.75 (t,

I H ) , 7 . 82 ( t , IH ) , 8 . 05 ( d, I H ) , 8 . 55 ( d, IH ) , and 9 . 05 ppm ( d, IH ) .

(35) -3- [ (3S) -2-OXO-3- (3,5-dιmethyl-4- hydroxybenzoyl)amιno-5-methoxyacetyl-2,3,4,5- tetrahydro-lH-1,5-benzodιazepxne-l-acetylamιno]4- oxobutyπc acid, 0-2,6-dιchlorobenzyl oxime(688c) was synthesized via methods used to prepare 308d to afford 800, ¹ H NMR (CD ₃ 0D) δ 2.2 (s, 6H) , 2.58-2.83 ( , 2H) , 3.28 (s, 3H) , 3.29-3.34 (m, IH) , 3.68-3.80 (m, 2H), 3.95-4.05 (dd, IH) , 4.38-4.48 (dd, IH) , 4.82-5.00 (m, 2H), 5.26-5.36 (m, 2H) , 7.22-7.65 qx, 10H) .

(35) -2-Oxo- (2 ,4-dimethylthιazo-5-yl)amιno-5- hydroxyacetyl-N- [ (2RS, 3S) 2-benzyloxy-5-oxo¬ tetrahydrofuran-3-yl] -2,3,4,5-tetrahydro-lH-l,5- benzodιazepιne-1-acetamιde(800) was synthesized via methods used to prepare 696a-l to afford 204 mg of 800 as a yellow solid, ¹ H NMR(CDC1 ₃ ) (mixture of diastereomers) δ 1.70(s, IH) , 2.40-2.80 ( , 7H) , 2.80- 2.90(m, 0.5H), 2.95-3.05(m, 0.5H) , 3.30-3.35(m, 0.5H) , 3.45-3.55{m, 0.5H), 3.55-3.65 (m, IH) , 3.80-4.05 (m, 2H) , 4.30-4.50(m, 2H), 4.55-4.65(m, IH) , 4.75-4.95(m, 3H) , 5.45(s, 0.5H), 5.55(d, 0.5H), 6.70(d, 0.5H) , 6.90(d, 0.5H), 7.15-7.80(m, 10H)

(35) -3- [ (35) -2-OXO-3- (2,4-dιmethylthιazo-1-oyl)ammo-5- hydroxyacetyl-2,3,4,5-tetrahydro-lH-l ,5-benzodιazepme- 1-acetylammo]4-oxobutyric acιd(801) was synthesizeα via methods used to prepare 2002 frorr 2001 to afford 801.

Example 34 Compounds 720-73 were prepared by methods similar to the methods used to prepare compounds 619- 635 (see, Example 13) . Physical data for compounds 720-73 is listed m Table 29.

Table 29

Compound Structure MF MW MS (M+Na) +

722 C27H30N4O9 554.56 11.761 99% 578.2

723 C26H28N409 540.53 10.655 79% 564.5

Example 35 Compounds 736-767 were prepared by methods similar to the methods used to prepare compounds 619- 635 (see, Example 13) . Physical data for compounds 736-767 is listed m Table 30.

Tabl e 30

The data of the examples above demonstrate that compounds accordmg to this mvention display inhibitory activity towards IL-lβ Converting Enzyme.

Insofar as the compounds of this invention aie able to inhibit ICE m vitro and furthermore, may be delivered orally to mammals, they are of evident clinical utility for the treatment of IL-1-, apoptosis-, IGIF-, and IFN-γ mediated diseases. These tests are predictive of the compounds ability to inhibit ICE m. vivo. While we have described a number of embodiments of this invention, it is apparent that our basic con¬ structions may be altered to provide other embodiments which utilize the products and processes of this inven¬ tion. Therefore, it will be appreciated that tne scope of this invention is to be defined by the appended claims, rather than by the specific embodiments which have been presented by way of example.