Description

Improved synthesis of hydrogen gas in genetically modified organisms by expression of oxidoreductases and ferredoxin, and improved hydrogenase activity and hydrogen synthesis in genetically modified organisms in the presence of oxygen with enhanced expression of E. coll ISC-operon

Field of the Invention The present invention relates to a process for producing hydrogen gas and/or hydrogenase enzyme using a microorganism.

Background of the Invention Hydrogen Production by microorganisms

H ₂ is a promising next generation energy vector for both mobile and stationary applications, particularly due to the minimal environmental impact of H ₂ to energy conversion (Cho, 2004; Keith and Farrell, 2003) . The current global market for H ₂ has been estimated to be worth $160 , 000,000,000 US dollars . If H ₂ is adopted at a large scale as fuel for mobile applications (example; automobile, airplane) then the current market is expected to become much greater. In comparison to the petrol-alternative ethanol, a number of outstanding issues (Service, 2004) still require further research and development in order for H ₂ production and use to reach commercial maturity as a petrol-alternative at a scale that is sufficient to have an environmental impact . Cost of production, with an impact on cost of distance travelled relative to other alternative fuels, is a major issue. H ₂ can

potentially be derived from a wide range of different non-renewable and renewable sources. Plant-derived biomass represents one potential source of renewable energy. Biomass can be converted to H ₂ by microorganisms through fermentation, however, the yield per starting substrate (sugar) is very poor compared to ethanol (reviewed by Angenent et al, 2004) . As biomass production is a major financial and environmental cost in biomass-derived fuel production (Hill et al, 2006) , yield of product per substrate remains a critical variable to enable economically and environmentally sustainable H ₂ -production.

A large number of microorganisms are capable of producing and consuming H ₂ with large variation in metabolic pathway diversity. In general, for sugar-fermenting species, the most common glycolytic intermediate node for H ₂ -production is pyruvate, with either formate (ex. Enterobacter spp.) or ferredoxin (ex. Clostridium spp.) as intermediate electron-acceptor/donors (Figure 1) . Both reactions are thermodynamically favourable and will therefore proceed even at high partial pressure of H ₂ with a maximum yield of 2 H ₂ /glucose. The glyceraldehyde-3 -phosphate (GAP) node is the other most important intermediate for which microorganisms have evolved both carbon-dependent (ethanol, lactate, butanol) and -independent (H ₂ ) pathways to remove unwanted electrons generated through oxidation. In most organisms, the nucleotide pyridine couple NADH/NAD ⁺ serves as the main GAP-derived intermediate, with a central role in overall cellular metabolism due to it ' s involvement in a large number

of other metabolically important reactions. As a result of such a central role, the relative ratio of NADH/NAD ⁺ has important implications for overall metabolism and is maintained at measurable so-called "steady-state" levels (Alexeeva et al, 2003) . In theory, another 2 H2/glucose could potentially be obtained from the GAP node if all of the NADH generated in the GAPDH-dependent reaction is chanelled into H2 according to reaction (1) :

(1) NADH + H ⁺ <-^ NAD ⁺ + H ₂

However, there remains some question of whether this reaction is physiologically relevant or not (Jungermann et al, 1973) , at least in the absence of H ₂ -consuming syntrophic partners. NADH-dependent H ₂ -synthesis at reported cellular NADH/NAD ⁺ -ratios is unlikely to be utilizable in a biotechnological process if the reaction reaches equilibrium at the very low partial pressure of H2 that have has been estimated (Angenent et al, 2004) .

Microbial H ₂ -producing pathways, based on extracellular sugar as the major donor of electrons, with a yield above 4 mol/glucose (33.3% theoretical potential) , have not yet been characterized to the stage that the process is understood and in all cases have been conducted using undefined complex media (Ooteghem et al, 2004; Niel et al,

2002) . However, yields of H ₂ between 2-4 mol/glucose

(16.7%-33% theoretical potential) have been reported using minimal media under laboratory conditions (Kumar et al, 2001) . If this process depends on H ₂ derived from G3P-oxidation, an

as yet unanswered question is by what mechanism any yield above 2 moles H ₂ /glucose can be realized with NADH as an intermediate?

NAD (P) H:H ₂ -pathways are catalyzed either by multimeric NAD(P)H-dependent hydrogenases (Malki et al, 1995, Soboh et al, 2004) or by a collection of the independent components NFOR, ferredoxin and hydrogenase (Thauer et al, 1971) . Although several NAD (P) H-dependent multimeric hydrogenases have been identified and characterized (Verhagen et al, 1999; Soboh et al, 2004) , the physiological role of any such complex has not yet been demonstrated except for the H ₂ -dependent NADP ⁺ -reductase of Desulfovibrio fructosovorans (Malki et al, 1995) for which there is only evidence of H ₂ -consumption, not H ₂ -production. Although several NFORs from H ₂ -producing Clostridium spp. were earlier shown to catalyze NAD (P) H-dependent H ₂ ~synthesis in vitro (Jungermann et al, 1971; Thauer et al, 1971) , not one independent NFOR operating in a NAD (P) H:H ₂ -pathway has yet been identified at the gene sequence level. Recently, a

NADPH: [4Fe4S] -ferredoxin-oxidoreductase (BsNFOR, encoded by the gene yumC) from Bacillus subtilis (Seo et al, 2004) , and a NAD (P)H: [4Fe4S] -ferredoxin-oxidoreductase (CtNFOR) from Chlorobium tepidum (Seo and Sakurai, 2002) were described. The former enzyme is most likely not involved in H ₂ -metabolism and its physiological role remains unknown, while the latter enzyme most likely has a role in photosynthesis similar to that of plant NADPH: [2Fe2S] -ferredoxin-oxidoreductases (Carrillo and Ceccarelli, 2003) .

H ₂ -metabolizing microorganisms often contain multiple hydrogenases with complex regulation and with physiological roles and directionality that in most cases remain undefined (Vignais et al, 2001) . A large number of these microorganisms are not yet amenable to genetic modification and the multimeric hydrogenases in particular are constitutents of large multi-gene operons for which heterologous expression systems are either not present (NiFe-hydrogenases) or only recently (FeFe, King et al, 2006) have been actualized. Therefore, the present invention describes an alternative approach, in which a modular system composed of ferredoxin, one or several oxidoreductases, and ferredoxin-dependent hydrogenase, are combined by co-expression of recombinant proteins in E. coli. The approach may also be transferrable to other organisms which already contain native ferredoxin-dependent hydrogenase and/or native ferredoxin.

Glyceraldehyde-3 -phosphate :Ferredoxin-Oxidoreductase In most organisms, oxidation of GAP is carried out by enzymes which reduce NAD ⁺ or NADP ⁺ , ie . GAPDH or GAPN. An alternative enzyme activity which is found in very few microorganisms is glyceraldehyde-3 -phosphate ferredoxin oxidoreductase (GAPOR) . GAPOR catalyzes a dual substrate electron-transfer reaction in which oxidation of glyceraldehyde-3 -phosphate (GAP) yields 3 -phosphoglycerate (3PG) concomittant with reduction of oxidized ferredoxin. GAPOR and its homologs are mainly found in archaea including both euryarchaeota and crenarcheaota, especially in hyperthermophiles (Mukund and Adams, 1995; Selig et al . ,

1997; van der Oost et al . , 1998) . In Pyrococcus furiosus, a hyperthermophilic archaea, it has been suggested, but never proven, that the GAPOR reaction is coupled to synthesis of molecular hydrogen as the final electron acceptor (Mukund and Adams, 1995) . Nevertheless, GAPOR is found not only in hydrogen-producing species, such as, Thermococcus celer as an active enzyme (Selig et al . , 1997) , and in P. abyssi (Cohen et al., 2003; http://www.genoscope.cns.fr/Pab/) and Thermococcus kodakarensis (Fukui et al . , 2005) as hypothetic homologs, but also in non-hydrogen-producing, rather, hydrogen-consuming species, such as, Desulfurococcus amylolyticus as an active enzyme (Selig et al . , 1997) , and Thermoproteus tenax (Siebers et al . , 2004), Methanococcus jannaschii (BuIt et al . , 1996), M. maripaludis (Hendrickson et al., 2004) as hypothetic homologs. The rationale behind the evolution of a GAPOR-dependent glycolytic pathway in place of a GAPDH-/PGK-dependent pathway, particularly in the latter group of organisms, remains unsolved.

Molybdenum and tungsten are chemically analogous (Kletzin and Adams, 1996) and are commonly associated with a diverse range of redox active enzymes that catalyze basic reactions in nitrogen, sulfur, and carbon metabolism (Kisker et al., 1997). GAPOR from Pyrococcus furiosus (pfGAPOR) contains a W-pterin (Mukund and Adams, 1995) and it appears specific for W because even in media containing excess Mo or vanadium (V) and trace amounts of W, pfGAPOR with a W-pterin is produced instead of Mo- or V-pterin (Mukund and Adams, 1996) . Although no GAPOR has yet been proven to function in a pathway resulting in H ₂ -synthesis, the potential to do so

clearly exists. The present invention describes an open system employing ferredoxin-dependent hydrogenase and ferredoxin. Expression of recombinant GAPOR in such a system may therefore create the following NAD (P) (H) -independent pathway of electron transfer;

(2) GAP -> Ferredoxin <6~> H ₂

A GAPOR-dependent pathway would most likely yield a net uni-directional pathway direction as GAPOR only is capable of catalyzing reduction of ferredoxin, not the reverse.

Hydrogenases and Importance of Iron Sulfur Cluster Integrity Microbial evolution of hydrogen is attributed to a family of enzymes known as hydrogenases, which catalyse the reversible reduction of protons to hydrogen (5) . Depending upon the catalytic centre, hydrogenases can be categorised into three sub-families; nickel-iron- (Ni-Fe) (6), iron-only (Fe-Fe) (7) and iron-sulphur (Fe-S) -free hydrogenases (8) . From an enzymological perspective, Fe-Fe hydrogenases are generally considered to be the most efficient enzymes in the biosynthesis of hydrogen and thus remain the most attractive choice in developing a biostrategy for mass-scale hydrogen production. More recent work has focused on the photobiological production of hydrogen in algae and cyanobacteria (9) . Fe-only hydrogenases characteristically contain a unique di-iron carbon monoxide- and cyanide-liganded complex within the active site known as the H-cluster and in most cases, but not all, additional

ferredoxin-like domains known as F-clusters. The high susceptibility of the H-cluster to inactivation by oxygen or oxygen-derived radicals presents the biggest hurdle in the exploitation of Fe-only hydrogenases for biotransformation (10, Vincent et al, 2005) . Complete maturation of Fe-only hydrogenases require a subset of proteins, commonly known as

HydE, HydF and HydG while electrons, necessary for its reduction, is in most cases provided by reduced ferredoxin

(11) . A common, underlying feature in all of the abovementioned proteins is the ubiquitous presence of iron-sulphur (Fe-S) clusters (12). For Fe-S cluster assembly and incorporation in bacteria, three distinct distinct routes are known to exist; commonly referred to as NIF (Nitrogen Fixation) , SUF (SUlFur mobilisation) and ISC (Iron Sulphur Cluster) pathways (13) . Of the three, the ISC pathway is considered to provide the "housekeeping" role of Fe-S cofactor insertion for the majority of Fe-S containing proteins under normal growth conditions in E. coli (14) . Nakamura et al (21) investigated the physiological effect of the ISC machinery on Fe-S protein synthesis in E. coli, using several recombinant ferredoxins as reporter proteins . It was observed that ferredoxin synthesis could quantitatively be enhanced several-fold with ISC coexpression. Similar reports from studies with other Fe-S proteins; lipoic acid synthase (22), ispH (23) and ispG (24), confirmed the general conclusion that the Fe-S assembly and incoporation was a limiting factor for the majority of Fe-S recombinant proteins synthesised in E. coli and that this limitation could be circumvented by increasing ISC gene dosage.

The present invention describes recombinant expression of a Fe-only hydrogenase from C. acetobutylicum (HydA) . As HydA requires the incorporation of five distinct Fe-S cofactors and hydrogenase maturation is dependent on the coexpression of a subset of additonal Fe-S proteins termed HydE, HydF and HydG (25) , we speculated whether Fe-S cluster assembly and insertion imposed any limitations on the synthesis of Fe-only hydrogenase in E. coli. Notably, all previous ISC coexpression studies utilised oxic, rather than anoxic, conditions for expression of recombinant Fe-S proteins even though Fe-S clusters in general are well known to be highly sensitive to oxygen (28) .

As stated above, FeFe-hydrogenases are notoriously sensitive to O ₂ -dependent inactivation and, in most cases, this inactivation is irreversible (Vincent et al, 2005) .

Inactivation of Fe-only hydrogenases, from binding of oxygen or oxygen-derived radicals to the H-cluster, is a major stumbling block toward the development of algal H ₂ -production (Ghirardi et al, 2000) . Two maj or methods to enhance tolerance of H ₂ to O ₂ or 0 ₂ -derived radicals can be envisioned; (1)

Engineer HydA structure to reduce physical access to

H-cluster by O ₂ or 0 ₂ -derived radicals, and (2) reduce concentration of direct active species (be it O ₂ or 0 ₂ -derived radicals) in the intracellular environment of

HydA-containing cells. The present invention describes the latter method. Both methods will likely complement each other .

Summary of the Invention

In one embodiment, the invention provides a modified recombinant host cell, wherein the cell is modified to contain at least one heterogeneous gene, wherein the heterogeneous gene is selected from the genes coding for a ferredoxin-dependent hydrogenase and oxidoreductase and ISC-operon.

In another embodiment, the invention provides a modified recombinant host cell according to claim 1, wherein the oxidoreductase is selected from the group consisting of NFOR (NAD(P)H:Ferredoxin-oxidoreductase) , GAPOR (Glyceraldehyde-3 -phosphate : ferredoxin-oxidoreductase) , HydB, HydC and combinations of the above.

In the above embodiments, the hydrogenase may be FeFe- and/or NiFe-type. The hydrogenase may be HydA and the cell may further be modified to contain heterogeneous genes coding for HydE, HydF and HydG.

In the above embodiments, the cell may be modified to contain the heterogeneous genes coding for a ferredoxin-dependent hydrogenase and oxidoreductase and thereby the synthesis of H ₂ in the host cell can be enhanced.

In the above embodiments, the cell may be modified to contain the heterogeneous genes coding for a ferredoxin-dependent hydrogenase and oxidoreductase and ISC-operon.

In the above embodiments, the cell may be modified to contain the heterogeneous genes coding for oxidoreductase and wherein the cell may further contain heterogeneous ferredoxin or flavodoxin.

In the above embodiments, the cell may contain heterogeneous oxidoreductase and heterogeneous hydrogenase . Alternatively, the cell may contain heterogeneous hydrogenase and homogenous oxidoreductase. The cell may contain heterogeneous oxidoreductase and homogenous hydrogenase .

In the above embodiments, the cell may be modified to contain the heterogeneous genes coding for HydA, HydE, HydF, HydG and ISC-operon. The cell may be modified to contain the heterogeneous genes coding for HydA, HydE, HydF, HydG and OR. The cell may be modified to contain the heterogeneous genes coding for HydA, HydE, HydF, HydG and OR and wherein the cell further contains heterogeneous ferredoxin or flavodoxin. The cell may be modified to contain the heterogeneous genes coding for HydA, HydE, HydF, HydG, OR and ISC-operon and wherein the cell further contains heterogeneous ferredoxin or flavodoxin.

In the above embodiments, the host cell can be selected from the group consisting of the genera Escherichia, Enterobacter, Clostridium, Corynebacteriυm, Bacillus, Thermotoga, Thermoanaerobacter, Saccharomyces, Pichia, Saccharomyces, Zymonas and Hansenula . The host cell can be selected from the group consisting of Enterobacter aerogenes,

Enterobacter cloacae, Clostridium acetobutylicum, Clostridium pasteurianum, Clostridium thermocellum, Clostridium cellulyticum, Corynebacterium glutamicum, Bacillus subtilis, Thermotoga maritima, Thermotoga neapolitana, Thermoanaerobacter tengcongensis, Zymonas mobilis and Saccharomyces cerevisiae .

In another embodiment, the invention provides a method for producing hydrogen, wherein the method comprises the steps of: preparing the modified recombinant host cell; culturing the host cell in a medium,- and collecting hydrogen.

In yet another embodiment, the invention provides a method for producing hydrogen, wherein the method comprises the steps of : preparing a protein preparation that contains a hydrogenase from the modified recombinant host cell; mixing the protein preparation with a source of electrons and protons; and incubating the mixture.

Brief description of the Drawings

The objects and features of the invention can be better understood with reference to the following detailed description and accompanying drawings . Note that most figures have been adjusted (equally in each entire respective figure) with respect to colour (decolourization) , brightness and contrast in order to optimize clarity and information content .

Figure 1 demonstrates H ₂ -producing pathways, native and introduced. Graphic illustration of pathway routes of

importance for fermentative H ₂ -production in microorganisms in general without any consideration for stoichiometry.

Figure 2 shows construction and analysis of synthetic hydrogenase synthesis operon. (a) Graphic illustration of plasmid map of the synthethic operon pCDOPFEGHisAFdx. (b) SDS-PAGE analysis of recombinant hydrogenase after His-tag purification. Left lane shows negative control (ie. No gene encoding HydA is present in cells) , right lane (gene encoding HydA is present in cells) . (c) A comparison of in vitro hydrogenase activity of crude lysates of cells harbouring either (dashed line) pCDOPFEGA or (whole line) pCDOPFEG and pET46-HydA. (d) In vivo H ₂ -accumulation using strains harbouring vectors with or without genes encoding ferredoxin and hydrogenase. Growth was performed in TB media at either 23 or 30 ⁰ C. The specific details of each strain line is listed in Table 4.

Figure 3 shows effect of NFOR co-factor specificity on H ₂ -accumulation in vivo, (a) SDS-PAGE analysis of crude extracts of cells expressing recombinant CtNFOR (lane 1) ,

BsNFOR (lane 2) , or negative control with empty plasmid (lane

3 ) . The expected molecular weight of CtNFOR and BsNFOR is 39.2 and 36.8 kDa, respectively, without the additional N-terminal 6-His-tag. (b) Assay of NADPH- and NADH-dependent reduction of methyl viologen using approximately 2 μg of each respective crude protein lysate. Assays were conducted in N ₂ -sparged sealed cuvettes . (c) Accumulated headspace pH ₂ (Pa) for closed cultures of BL21 (DE3 ) AydbKhost strain carrying pCDOPFEGA and pCpFd (grey circle, EME102) in response to presence or absence

of pBsNFOR (black squares, EMElOl) and pCtNFOR (empty diamonds, EME103) , respectively. (d) Accumulated molar quantity of H ₂ in headspace (16 mL headspace, grey squares ; 102 mL headspace, black diamonds) of closed cultures of cells carrying pBsNFOR (EMElOl) . The molar quantity of H ₂ accumulated in the same respective culture flasks (small or large) with cultures not expressing any recombinant NFOR (EME102) , has been deducted. Each value represents average of 3 independent replicates, (e) Consumption of H ₂ by different cell lines (grey squares, EMElOl; empty triangles, EME102; black circles, EME103) . Three different levels of H ₂ (0, ~125 Pa, -300 Pa) were added after 24 hours of induction with IPTG and the change in headspace pH ₂ was monitored thereafter.

Figure 4 shows M. maripaludis GAPOR catalyzes reduction of ferredoxin in vitro and enhances ferredoxin- and hydrogenase-dependent synthesis of H ₂ in vivo, (a) SDS-PAGE analysis of His-tag purified recombinant GAPOR. The expected molecular weight of M. maripaludis GAPOR without the

N-terminal 6-His-tag is 70.8 kDa. (b) Assay of GAP-dependent reduction of benzyl viologen and GAP- and C. pasteurianum

[4Fe4S] -ferredoxin-dependent reduction of metronidazole.

L-cysteine is added to start each reaction conducted within N ₂ -sparged sealed cuvettes. (c) Accumulation of H ₂ in headspace of cultures of strain lines EME16 (GAPOR + CpFd) , EME13 (BsNFOR + CpFd) , EME15 (CpFd) or wild-type BL21(DE3) .

Figure 5 shows Accumulation of H ₂ in headspace of closed cultures of strain lines wt AEFGFdx, wt AEFGIscFdx, IscR ^~

AEFGFdx, and IscR ^' AEFGIscFdx, in TB media cultures grown for 17 hrs with either air or N ₂ in the headspace at the start of the main culture .

Detailed Description of the Invention

The present invention can be broadly divided into two sections: (1) Enhanced H ₂ -production by recombinant expression of ferredoxin-dependent oxidoreductases (NFOR and/or GAPOR constituting examples) , ferredoxin and ferredoxin-dependent hydrogenase, and (2) Enhanced hydrogenase activity, hydrogenase synthesis and H ₂ -production, by expression of E. coli ISC-operon and/or by deletion of the iscR-gene in E. coli, in the presence of O ₂ at some stage during the production process. As an example, in the first instance, (1) , recombinant hydrogenase, ferredoxin and NFOR or GAPOR are expressed simultaneously. The choice of oxidoreductase affects H ₂ -accumulation under closed conditions. It is demonstrated that NFOR with substrate specificity for NADP(H) only, and not NAD(H) , is prefferable for H ₂ -accumulation. In the second instance, (2), recombinant hydrogenase is over-expressed together with E. coli ISC-operon. It is demonstrated that a greater quantity of hydrogenase and greater specific and total activity of hydrogenase is obtained, if the E. coli ISC-operon is overexpressed as compared to no recombinant expression of ISC-operon, when this procedure is carried out in the presence of O ₂ at some stage of the experiment. It is also demonstrated that deletion of the E. coli gene iscR may substitute for recombinant expression of the E. coli ISC-operon.

Homology

C. tepidum C1512 (encodes known NADH- and NADPH-dep. NFOR) displays 60% similarity to B. subtilis yumC at the encoded amino acid level. It is possible, based on the analysis by Seo et al (2004) and Seo and Sakurai (2002), that any deduced protein annotated as a thioredoxin reductase, and which lacks the dicysteine motif (located between amino acid 120 and 150 in Figure 9 of Seo and Sakurai, 2002) that apparently is required for function of genuine thioredoxin reductases which is missing in all putative thioredoxin reductases that catalyze an NFOR-reaction, will catalyze an NFOR-reaction.

P. furlosus GAPOR (AE010169.1) is the only other proven GAPOR-encoding gene, apart from that of M. maripaludis, and the deduced amino acid sequence of M. maripaludis GAPOR displays 60% similarity to the deduced amino acid sequence of P. furiosus GAPOR.

Any oxidoreductase that is classified into the EC category of 1.18.1.2 (Ferredoxin-NADP ⁺ reductases) or 1.18.1.3 (Ferredoxin-NAD ⁺ reductases) could in theory be used in a similar way to that of yumC .

" Plant-type" FNRs (EC 1.18.1.2; http : //www. genome . jp/dbget-bin/www_bget?ec : 1.18.1.2 ) Ferredoxin-NADP ⁺ -reductases. Of which E. coli fpr (Bianchi et al, 1993), Anabaena petH (Fillat et al, 1990) and homologues thereof constitute one set of candidates .

Examples

Materials and Methods for all Examples

Materials

All chemical reagents (except where noted) were obtained from either SIGMA (Japan) or WAKO Pure Chemical Industries, Ltd. (Osaka, Japan) , except where stated. Plasmid DNA expression vectors were all obtained from Novagen (Merck KgaA, Darmstadt, Germany) . Restriction enzymes were purchased from New England Biolabs (Beverly, USA) . Competent E. coli host cells were obtained from Novagen (Novablue (DE3) or BL21 (DE3) ) or Stratagene (BL21-gold (DE3) ) . Gas standards were obtained from GL Sciences (Tokyo, Japan,- 100% (v/v) CO ₂ ; 100% (v/v) O ₂ ; 100% (v/v) H ₂ ) or Kamimaru (Yokohama, Japan) (5% (v/v) CO ₂ , 5% (v/v) H ₂ , 90% (v/v) N ₂ ) . Genomic DNA for PCR amplification was either obtained directly from ATCC {Clostridium acetobutylicum 824D-5, Chlorobium tepidum 49652D) or isolated from reference strains obtained from Deutsche Sammlung von Mikroorganismen und Zellkulturen GmbH

(DSMZ) (B. sujbtilisDSM 402; C. pasteurianum DSM 525) or Japan

Collection of Microorganisms (Saitama, Japan) (M. maripaludis JCM 13030) . Qiagen DNAeasy was used for DNA isolation. SDS-PAGE was conducted using pre-cast 12% gels (TEFCO, Japan) . For terrific broth (TB) media, Bacto™ yeast extract and Bacto™ tryptone were obtained from BD, Japan. Synthethic oligonucleotides were obtained from Hokkaido Systems Science (Hokkaido, Japan) .

Bacterial strains, plasmids and growth conditions

The bacterial strains and plasmids used in this study- are listed in table 1. All vector constructs, except for synthethic pCDOPFEG and derivatives thereof, requiring restriction enzyme digests were generally prepared as follows: Open reading frame DNA encoding the intended target protein(s) ("insert DNA") was amplified by PCR (32-34 cycles) using DNA template and primers listed in Table 1 and Accuprime Pfx DNA polymerase (Invitrogen Corporation, Carlsbad, USA) according to manufacturer's instructions. Specific details regarding each DNA template is listed in Table 2. PCR products were subjected to electrophoresis in 1.5-2.0% SeaPlaque GTG Agarose (Cambrex, Rockland, USA) , stained with SYBR Green I nuceleic acid gel stain (Cambrex, Rockland, USA) and visualized by fluorescence imaging using a Fujifilm FLA-3000

(Fuji Photo Film Co., Tokyo, Japan). Excised gel slices containing target PCR products were subjected to gel purification using Zymoclean gel DNA recovery kit (Zymo

Research, Orange, USA) according to manufacturer's instructions. Purified "insert DNA" and plasmid DNA were subjected to restriction enzyme digests (restriction enzymes are listed in Table 3) according to manufacturer's instructions followed by electrophoresis and gel purification as above. Purified and digested plasmid DNA was ligated to respective "insert" DNA according to Table 3 using a Quick Ligation Kit (New England Biolabs, Beverly, USA) according to manufacturer's instructions. Vector constructs using Ek/LIC-vectors as plasmid backbone (Indicated in Table 3) were prepared according to manufacturer's instructions using "insert DNA" prepared as above (without restriction

enzyme digests) . All _. ligation reactions were used to transform Novablue (DE3) cells according to manufacturer's instructions and plasmid stocks were prepared using a QIAprep

Spin Miniprep Kit (QIAGEN, Maryland, USA) and stored at -30 ⁰ C. "Positive" clones were identified by gel electrophoresis after restriction enzyme analysis using either Ncol and Avrll

(Ek/LIC constructs) or the same restriction enzymes as used for "insert DNA" preparation. A selection of all plasmid vector constructs were tested for expression of soluble recombinant protein (as described below) and end-sequencing to verify the identity of the PCR amplification products

(Hokkaido Systems Science, Hokkaido, Japan) . All pET46-Ek/LIC constructs contained a vector-derived His-tag at the 5' -end, whilst the vector-derived His-tags and MCS2 were excised from all other non-Ek/LIC vectors. The identify of each plasmid gene construct was verified by sequencing and function was verified by SDS-PAGE and enzyme activity assay of crude lysates after test expression.

Construction of pCDOPFEG, a synthetic operon encoding all three hydrogenase maturation factors, and derivatives therof , was carried out as described below. An RBS-hydF PCR product, containing (in the 5' -direction) a ribosomal binding sequence (RBS) , eight arbitrary nucleotides (AAAATAAA) , followed by the gene for C. acetohutylicum hydF, was synthesized using primers CAHydF_For_NcoI and RBS_CAHydF_revStuI and prepared as described above. The plasmid pCDF-Duet (Novagen, Carlsbad, USA) was digested with restriction enzymes Ncol and EcoRV, and ligated to the RBS-hydF PCR product, as described above, to generate pCDOPF.

pCDFOPFE was generated in the same way using pCDFOPF as plasmid derivative and a PCR product synthesized using the primers RBS_CAHydeE_ForSwaI and RBS_CAHydE_RevAvrII, which then subsequently was employed to generate pCDOPFEG using the primers RBS_CaHydG_ForSwaI and RBS_CAHydG_RevAvrII . pCDPOPFEGA, pCDOPFEGHisA, and pCDOPFEGHisAFdx, were generated in the same way using pCDFOPFEG as plasmid derivative and PCR products synthesized using the primers RBS_CAHydA_ForSwaI and RBS_CAHydA_RevStuI (addition of HydA to pCDOPFEG) , pET46His_BspHI_For and RBS__CAHydA_RevStuI (addition of HisHydA to pCDOPFEG) , and CPFdx4__HisRBS_F_BamHl and CPFdx4_RHisRBSAvr (addition of CpFd to pCDOPFEGHisA) , respectively. All primers used for construction of pCDOPFEG and derivatives are listed in Table 1. Expression of all contained target genes was confirmed and the identity of each new insert confirmed by sequencing after each step.

Gene deletions were first prepared in MG1655 (Datsenko and Wanner) and then transferred to Novagen BL21(DE3) by Pl transduction using Pl phage 5757 obtained from DSMZ. The primers used for deletion are listed in Table 1. The MG1655 iscR ^' strain (University of Wisconsin, USA) was used as template forpreparation of BL21 (DE3) iscR ^' as described above . All chromosomal deletions were verified by PCR.

Cultivations for NFOR-related experiments were performed in 20 - 50 ml MOPS minimal medium (Teknova) containing 1.5% glucose as carbon and energy source. When appropriate kanamycin (50 μg/ml) , carbenicillin (50 μg/ml) or spectinomycin (50 μg/ml) was added to the medium. For in vivo

H ₂ -synthesis, BL21(DE3) and derivatives thereof or BL21-Gold (DE3) were transformed with, a combination of vectors listed in Table 4. Strains were either freshly transformed prior to each experiment or stored as 8% glycerol stocks below -80 ⁰ C. The gas composition of the headspace was analyzed by gas chromatography as described below. Pre-cultures were inoculated from a fresh LB plate and grown (aerobically or anaerobically) at 30-37°C to an OD ₆ oo between 0.1-1.0. Pre-cultures were then used to inoculate main cultures (same media with addition of 0.05 mM IPTG) at an approximate OD _60O of 0.02. All main cultures were grown at 30 ⁰ C in serum bottles capped with butyl rubber septum and sparged with 99.9995% N ₂ for >5 min following inoculation. Cultivations for hydrogenase-related experiments were performed as above, except Terrific Broth media was employed instead of MOPS minimal media, and loosely capped centrifuge tubes or capped and sparged serum bottles were used as growth vessels, and inoculation of main cultures was done at -2% (v/v) , and 0.5 mM IPTG was used to induce expression. Cultivations for GAPOR-related experiments were all conudcted at 37oC using either LB or M9 media. The M9 medium contained (per liter of deionized ultrafiltered water) 0.8 g of NH ₄ Cl , 0.5 g of NaCl ,

7.5 g of Na ₂ HPO ₄ x2H ₂ O, 3.0 g of KH2PO4. The following

^■ components were sterilized separately and then added (per liter of medium) ; 2 ml of 1 M MgSO ₄ X7H ₂ O, 1 ml of 0.1 M CaCl ₂ ,

0.3 ml of 1 mM filter-sterilized thiamine-HCl , 10 ml of a trace element solution containing (per liter) 1 g of FeCl ₃ x6H ₂ O,

0.18 g of ZnS0 ₄ x7H ₂ 0, 0.12 g of CuCl ₂ x2H ₂ O, 0.12 g of MnSO ₄ XH ₂ O, and 0.18 g of CoCl ₂ x6H ₂ 0. Sterilized glucose was added to a final concentration of 2 g per liter. Any of the following

was added further (per liter of medium) 10 ml of 10 mM Na ₂ W0 ₄ x2H ₂ 0, 10 ml of 10 mM Na ₂ Mo04x2H ₂ 0, 5 ml of 10 mM Na ₂ WO ₄ x2H ₂ O and 5 ml of 10 mM Na ₂ MoO ₄ X2H ₂ O, or 10 ml of deionized ultrafiltered water.

Protein preparation

Crude extracts were prepared from cell pellets either using 0.5-1.0 mg/ml Chicken Lysozyme (Wako) according to instructions in the pET-manual (Novagen) , or using BugBuster™ Reagent (Novagen) , or Easylyse kit (Epicentre) , according to manufacturer's instructions. Oxygen-sensitive proteins were handled exclusively under anoxic conditions except where noted. His-tag affinity purification of recombinant proteins was carried out using a His MicroSpin Purification Module or HisTrap HP (GE healthcare) according to manufacturer's instructions.

Enzyme Assays

All oxidoreductase assays were conducted under anaerobic conditions using quartz cuvettes fitted with open top screw cap (GL Sciences Inc, Tokyo, Japan) and butyl rubber stopper (VOIGT GLOBAL DISTRIBUTION LLC, Kansas City, USA) . All reaction buffers and other additives were N ₂ -sparged prior to use. NAD (P) H-dependent reduction of methyl viologen (MV) was measured by following the reduction of MV at 600 nm (absorbance) . One-ten μg of crude protein or 0.5-1.0 μg of purified protein was added to N ₂ -sparged reaction mixture (50 mM TrisηCl (pH 7.5), 10 mM Flavine adenine dinucleotide, 0.5-1.0 mM NAD(P)H, 1 mM MV) to start the reaction. Dithionite- and Hydrogenase-dependent synthesis of H ₂ was

measured using Serum bottles, containing 50 mM potassium phosphate (pH 7.5) . The buffer solutions were sparged with nitrogen and tightly sealed. His-tag purified hydrogenase

(0.1-2.8 mg) and 5 μM C. Pasteurianum ferredoxin (Sigma-Aldrich, Japan) were added to the sparged buffer solution and the solution pre-equilibrated at 37 ⁰ C. After initiation of the reaction, by addition of sodium dithionite

(25 mM) , the vessel headspace was sampled for hydrogen at selected timepoints. GAPOR activity was routinely measured as previously reported by Mukund et al (26) by the following the reduction of benzyl viologen (BV) at A ₆ oo (ε _B v = 7,400 M ^"1 cm ^"1 ), (2) at room temperatures. The reaction mixture contained 30 μM GAP, 3 mM BV, 56 μM Na ₂ MoO ₄ , 50 mM EPPS buffer, pH 8.4. GAP-dependent reduction of ferredoxin was monitored by following the reduction of metronidazole (MNZ) at A ₃₂ o (&mz = 9.3 mM ^"1 cm ^"1 ) at room temperatures, as modified from Soboh et al (41) . The reaction mixture contained 30 μM GAP, 2 mM Clostridiumpasteurianum ferredoxin, 0. ImMMNZ, 56μMNa ₂ Mo0 ₄ , 50 mM EPPS buffer, pH 8.4. C. pasteurianum ferredoxin was used instead of M. maripaludis ferredoxin, which is not available from commercial resources. The assays were started with the addition of 63 mM cysteine-HCl, which is added to ensure completely anoxic conditions, using syringes. Assay dependency was confirmed for all assays by testing that no or only marginal activity was observed when any key-component was omitted from each respective assay.

Analysis

Gaseous samples were analyzed using an Agilent 6890N gas chromatograph fitted with a CarboxenTM 1010 PLOT

capillary column (30mx0.32mm) (Supelco, Bellefonte, USA). Five mL of gas was extracted with a syringe, allowed to equilibrate to atmospheric pressure (<10 s) and then injected into a gas loop (250 μL) connected to a controllable valve box inlet. The sample contained within the gas loop (ambient pressure and temperature) was injected onto the column via a split/splitless inlet (ambient temperature, 10:1 split ratio) . Alternatively, 100-200 μL of gas was sampled using a samplelock syringe (Hamilton) and injected directly into the split/splitless inlet via rubber septum. Each sample was subjected to a thermal program (35 ⁰ C 6.0 min, ramp 24 °C/min up to 200 ⁰ C) for simultaneous H ₂ and CO ₂ analysis and (35 ⁰ C 5.3 min) in case only H ₂ was analyzed. The carrier gas was N ₂ (17.6 mL/min) and a thermal conductivity detector (230 ⁰ C, 2.0 mL/min) was used to detect samples. H ₂ (-3.3 min) , O ₂ (4.5 min) and CO ₂ (12.7 min) were quantified by comparison with calibration curves prepared with 5% (v/v) and 100% (v/v) standard gas samples applied in a range of volumes.

Glucose analysis was conducted using a D-glucose kit from Roche-Biopharm according to manufacturer's instructions .

For cofactor analysis the purified protein was subj ected to metal content analysis using inductively coupled plasma-mass spectrometry (ICP-MS, SPQ-9000, SII nanotechnology) after wet-sample digestion by 5 ml HNO3 and

1 ml HC1O4 (13) . Controls were conducted using

[2Fe-2S] -ferredoxin from Spinach (Sigma) and bovine serum albumin (Sigma) .

Pterin content was measured using 0.5 mg GAPOR by the previously described methods (24, 32) with fluorescence detection (lambda ex = 363 nm, lambda em = 442 nm) . The pterin content was calculated by comparison with pterin-6-carboxylic acid. Xanthine oxidase from butter milk

(Sigma) was used as a positive control.

Acid labile sulfide was measured by the method described elsewhere (6, 30) . The positive control was Na ₂ Sx9H ₂ O and one nmol of S2 ^~ gave A ₆₇₀ =O.0014.

Example 1

Expression of recombinant hydrogenase and ferredoxin using a synthethic operon results in H ₂ -accumulation

The plasmid pDOPFEGA, containing a synthethic operon that enables simultaneous expression of the three maturation factors HydF, HydE and HydG, and the FeFe-hydrogenase HydA, all from C. acetobutylicum, and a second plasmid (pDOPFEGAFdx, see plasmid map in Fig.2a) also encoding a [4Fe4S] -ferredoxin from C. pasteurianum were created and verified to function by SDS-PAGE (Fig. 2b) , hydrogenase assays (Fig. 2c) and in vivo H ₂ -synthesis under closed conditions (Fig. 2d) . Growth of BL21(DE3) under closed anaerobic conditions results in no or very small accumulation of H ₂ (Fig. 2d) . Expression of active recombinant hydrogenase (ie. pDOPFEGA) under the same conditions results in clearly measurable H ₂ -accumulation and additional co-expression of C. pasteurianum ferredoxin (ie. pDOPFEGAFdx) enhances H ₂ -accumulation by at least a factor of 2 (Fig. 2d) . BL21(DE3) is therefore capable of reducing

the recombinant ferredoxin by an unknown mechanism. Deletion mutants for the two most likely candidates; fpr (NADPH :flavodoxin/ferredoxin-oxidoreductase) and ydbK (putative pyruvate : flavodoxin/ferredoxin-oxidoreductase) (Blaschkowski et al, 1982) were prepared. Whilst removal of fprdid not have an effect onNFOR-independent H ₂ -accumulation, deletion of ydbK abolished all ferredoxin-independent but hydrogenase-dependent H ₂ -accumulation, as δydhK strains carrying pDOPFEGA yielded similar levels of H2 as strains with empty plasmid only. The ydbK gene product may therefore have contributed towards reduction of HydA by an unknown mechanism, however it was not responsible for H ₂ -synthesis dependent upon the reduction of CpFd.

Example 2

Co-Expression of NADPH-dependent NFOR together with recombinant ferredoxin-dependent hydrogenase and ferredoxin results in H ₂ -accumulation

Expression (Fig. 3a) and activity (Fig. 3b) of two recombinant NFORs (NADPH-dependent BsNFOR and NADH- and

NADPH-dependent CtNFOR) was confirmed. Co-expression of all independent components in Example 1 and 2, ie. hydrogenase, hydrogenase maturation factors, ferredoxin and NFOR, under closed anaerobic batch conditions resulted in accumulation of H ₂ in the headspace of closed batch cultures which varied over time (Fig. 3c, d) . Maximum yield, partial H ₂ pressure and rates of H ₂ -accumulation were dependent upon the combined presence of active HydA, CpFd and BsNFOR, with partial

H ₂ -pressure typically reaching a maximum of 500-1200 Pa over 48 hrs depending on the headspace and liquid culture volume

ratio. In contrast, co-expression of the NADH- and NADPH-dependent CtNFOR with CpFd and CaHydA resulted in a reduction in H ₂ -yield in comparison with cell lines lacking CtNFOR (Fig.3c) . The total yield of H ₂ was strongly dependent upon the volume of the fermentation vessel (Fig. 3d) and varied between 10 to 50 mmol H ₂ /mol glucose at most. Omission of either CpFd or HydA typically resulted in 5-fold lower (or more) H ₂ -accumulation over a 24 hr period.

In order to identify the reason for complete lack of H ₂ -accumulation in CtNFOR-expressing cells, in vitro NAD(P)H-dependent H ₂ -synthesis was conducted following 24-48 hrs of expression. The addition of co-factor regeneration systems was necessary in order to observe any product formation. In contrast to the in vivo results, extracts from cell lines heterologousIy expressing CtNFOR displayed greater ability to reduce CpFd (110 +/-64 nmoles H ₂ /min/mg protein) than extracts prepared from cell lines with BsNFOR

(70 +/-14 nmoles H ₂ /min/mg protein) . Addition of 250 μM MV to in vitro reactions generally enhanced the rate of

H ₂ -synthesis by a factor of 10-20. No H ₂ -formation was detected in reactions using lysates of cell lines that did not express both recombinant NFOR and recombinant CpFd. Further analysis was conducted by addition of H ₂ to N ₂ -sparged cultures after 24 hrs of growth. Whilst BsNFOR-expressing cells continued to accumulate H ₂ , the opposite was observed with CtNFOR-expressing cells (Fig. 3e) . It is clearly concluded that both BsNFOR and CtNFOR catalyzed a functioning NAD (P) H:H ₂ -pathway. As the only (known) property which differes between CtNFOR and BsNFOR is the differential

substrate specificity, it is further concluded that the addition of NADH-specificity, to existing NADPH-specificity, results in reverse flow, ie. H ₂ -consumption followed by reduction of NAD ⁺ . This is the reason why no H ₂ ~accumulation is observed in CtNFOR-expressing cell cultures.

Example 3

Co-Expression ofM. maripaludis GAPOR (MmGAPOR) together with recombinant ferredoxin-dependent hydrogenase and ferredoxin results in H ₂ -accumulation

The gene encoding a homolog of P. furiosus GAPOR (PfGAPOR) in M. maripaludis was cloned and expressed in E. coli BL21 (Fig. 4a) . Crude and purified protein preparations of MmGAPOR, expressed in standard laboratory complex media (LB) , catalyzed GAP-dependent reduction of benzyl viologen C. pasteurianum [4Fe4S] -ferredoxin- and GAP-dependent reduction of metronidazole (Fig.4b) . As PfGAPOR contains the rare element tungsten (W) as a pterin-cofactor it was of interest if this also was the case for MmGAPOR. MmGAPOR was therefore expressed in minimal media with defined metal content . Only cells cultured in media to which only molybdenum (Mo) had been added were able to synthesize active recombinant GAPOR (Table 6) . As only <20% of the predicted Mo- and Fe-content was detected by ICP-MS using acid hydrolysates of purified MmGAPOR, most of the protein preparation was most likely inactive. When MmGAPOR was co-expressed in BL21(DE3) together with C. pasteurianum [4Fe4S] -ferredoxin, and active hydrogenase using pCDOPFEGA, enhanced H2-accumulation was observed in closed fermentation vessels (Fig. 4c) . Competition with JE?. coli GAPDH will in this case reduce

potential H ₂ -formation. Furthermore, when MmGAPOR was expressed in Rosetta2 -garni cells, instead of BL21 (DE3) , more than 6Ox greater specific activity was detected (Table 6) . A shift to strains other than BL21 (DE3) is therefore expected to substantially enhance the potential to synthesize H ₂ -

Example 4

Co-expression of E. coli zwf together with recombinant NADPH-dependent NFOR, ferredoxin-dependent hydrogenase and ferredoxin results in enhanced H ₂ -accumulation

Overexpression of E. coli zwf, the gene encoding glucose-6-phosphate dehydrogenase which catalyzes the first step away from glycolysis and towards the pentose phosphate pathway (PPP) , results in enhanced NADPH-dependent metabolite-formation (Lim et a.1, 2002) . The effect of zwf on metabolic flux can most likely be interpreted as enhanced PPP-flux at the expense of glycolytic flux.

To strains employed in Example 2 (above) , expressing recombinant ferredoxin, ferredoxin-dependent hydrogenase and ferredoxin- and NADP-dependent oxidoreductase, also expression of recombinant zwf was added by introduction of an additional plasmid, pCOLAzwf (Table 3) . The yield of

H ₂ -accumulation in closed fermentation vessels was enhanced from between 10 to 50 mmol H ₂ /mol glucose to 100-190 mmol H ₂ /mol glucose by overexpression of zwf. Combining (a) knowledge in the literature regarding the effect of zivf-overexpression on metabolic flux, and (b) experiments in the present Invention demonstrating that zwf-overexpression enhances NADPH-dependent H ₂ -synthesis, it can be inferred that even

further shift in flux-distribution away from from the Embden-Meyerhof-Parnas pathway, and into the PPP, will results in even further enhanced yield of H ₂ /glucose . Example 4 therefore represents proof of principle that the entirely novel approach of oxidizing sugar through the PPP can be combined to yield even further H ₂ on top of that which potentially can be obtained from the GAP- and PYR-nodes (Fig. D -

Example 5

Enhanced hydrogenase-activity when recombinant hydrogenase is expressed under oxic conditions and either (a) the E. coll ISC operon also is expressed from a plasmid, or (b) expression of hydrogenase is conducted in E. coli iscR ^' strain. Recombinant C. pasteurianum [4Fe4S] -ferreodxin or C. acetobutylicum ferredoxin-dependent hydrogenase (HydA) with an N-terminal His-tag and the three maturation factors HydF, HydE, and HydG was expressed in BL21 (DE3) or BL21 (DE3) AiscR. A plasmid carrying genes of the ISC-operon encoding the six E. coli proteins IscS, IscU, IscA, HscA, HscB and Fdx was also introduced as an additional variable. It has earlier been demonstrated that deletion of iscR results in enhanced expression of the above mentioned six protein members of the E. coli ISC operon (Giel et al, 2006) . Expression was conducted either (a) under strictly anoxic conditions in closed N ₂ -sparged serum bottles, or (b) in vessels exposed to room air, ie. oxic conditions. Following expression and lysis, HydA and ferredoxin were purified by affinity- and ion-exchange chromatography, respectively, and the quantity of holoferredoxin and total and specific activity of HydA was

determined. In the below discussion, employment of overexpression of the ISC-operon or strains in which the negative transcriptional regulatorof the ISC-operon iscR is deleted, is designated as Overexpression of ISC-operon' and is compared to wild-type strains where no changes to the ISC-operon is made. The results (Table 5) clearly demonstrate several key-points: (1) Overexpression of ISC-operon' had no significant effect on yield of holoferredoxin under anoxic conditions, (2) a positive effect of 'Overexpression of ISC-operon' on holoferredoxin yield was observed under oxic conditions, (3) Total and specific activity of HydA was strongly negatively affected in wild-type strains under oxic conditions in comparison to anoxic conditions, (4) 'Overexpression of ISC-operon' resulted in enhanced total and specific HydA-activity under oxic conditions and reduced specific acitivity under anoxic conditions, and most notably

(5) 'Overexpression of ISC-operon' resulted in total activites under oxic conditions which exceeded that of wild-type strains under anoxic conditions. Taken together, the results from the ferredoxin-experiments demonstrate that the system employed in the present Invention functions as expected except for the fact that no positive effect of Overexpression of ISC-operon' was observed under anoxic conditions. However, anoxic conditions were never reported in previous studies. Hence, it can be concluded that the previously reported positive effect of 'Overexpression of ISC-operon' on FeS-cluster proteins is strongly related to O ₂ - Results from the HydA-experiment demonstrate that 'Overexpression of ISC-operon' can be effectively utilized to dramatically enhance both total and specific

hydrogenase-activity in the presence of O ₂ . The effect is obtained by a combination of enhanced specific acitivity and enhanced accumulation of hydrogenase, and it is at present not possible to distinguish between the two possibilities of reasons; (1) 'Overexpression of ISC-operon' enhances de novo synthesis of PeS-cluster proteins and/or (2) ^λ Overexpression of ISC-operon' enhances repair of damaged FeS-cluster protein. Nevertheless, the strategy of 'Overexpression of ISC-operon' may be used on it ' s own or to complement additional strategies aimed at enhancing hydrogenase-activity in the presence of O ₂ .

Example 6

Enhanced H ₂ -accumulation when recombinant hydrogenase is expressed under oxic conditions and either (a) the E. colx ISC operon also is expressed from a plasmid, or (b) expression of hydrogenase is conducted in E. colx iscR ^' strain.

Following on from example 5, the same ISC-based gene/strain-strategies were also tested to see if they would affeet H2-accumulation under closed conditions . In this case, recombinant ferredoxin and hydrogenase were co-expressed together to allow accumulation of H ₂ , since it was demonstrated in example 1 and 3 that this results in considerable H ₂ -accumulation. BL21(DE3) or BL21 (DE3) AiscR host strains harbouring either pCDOPFEGAFdx or pCDOPFEGAFdx

& pISC were grown in closed serum bottles with either air or

100% (v/v) N ₂ as headspace gas, and H ₂ in the headspace was quantified after 17 hrs of growth (Fig. 5) . The main conclusions from this work is; (1) O ₂ has a strong negative effect on H ₂ -accumulation in wild-type strain background, (2)

'Overexpression of ISC-operon' enhances H ₂ -accumulation >30-fold, (3) the total quantity of H ₂ accumulated under oxic conditions, using the BL21 (DE3) AiscR host, exceeds that of wild-type BL21(DE3) under anoxic conditions. Figure 5 shows total H ₂ -accumulation per culture vessel. If H ₂ is normalized against the final optical density, the rate of H ₂ -production is greater under anoxic conditions, as the final optical density was ~5-fold less under anoxic conditions (data not shown) . However, this also demonstrates a reason for employing oxic conditions, as the metabolism and growth of E. coll differs greatly depending on the presence or absence of O ₂ . From the last two examples presented in the present invention, we can conclude that it maybe beneficial to switch from anoxic to at least partially oxic conditions to obtain final net maximum H ₂ -production, as long as total hydrogenase-activity can be maintained sufficiently high by ISC-based gene-strategies .

The present invention will now be described more fully hereinafter with reference to the accompanying figures, in which embodiments of the invention are shown.

Table 1. List of oligonucleotide primers

Primer Name Sequence Gene template

YumCFI (Ek/LIC) δ'-GACGACGACAAGATGCGTGAGGATACAAAGGTTTATG 6

YumCRI (Ek/LIC) 5'-GAGGAGAAGCCCGGTTTATTTATTTTCAAAAAGACTTGTTGAGTG 6

CpFdF (Ncol) δ'-ATCCATGGCATATAAAATCGCTGATTCATGTGTAAGC 9

CpFdR (Sail) δ'-TTTGTCGACTTATTCTTGTACTGGTGCTCCAACTGG 9 gaporF (Ek/LIC) δ'-GACGACGACAAGATGAACATTTTGATTGATGG 8 gaporR (Ek/LIC) δ'-GAGGAGAAGCCCGGTTTATTCTTTTAATTTCCAG 8

CAHydF_For_Ncol 5'- aatatacoA rGGATGAACTTAACTCAACACCCAAAGG -3' 3

RBS_CAHydF_RevStul 5'- aggcctcctgaTTAGTTCCTACTCGATTGATTAAATATTCTATCAGC -3' 3

RBS_CAHydE_ForSwal 5'- atataatatttaaataaaATGGATAATATAATAAAGTTAATTAATAAAGC-3' 2

RBS_CAHydE_RevAvrll 5'- tacctaggaggcctcctgaTTAACCAATAGATTCTTTGTAGC -3' 2

RBS_CAHydG_ForSwal 5'- atataatatttaaataaaATGTATAATGTTAAATCTAAAGTTGCAACTG -3' 4

RBS_CAHydG_RevAvrll 5'- tacctaggaggcctcctgaTTAGAATCTAAAATCTCTTTGTCCC -3' 4

PET46HIS_BSPHI_FOR 5 ¹ - AAA AAA A ATG GCA CAT CAC CAC CAC CAT CAC G - 3' G1 A

RBS_CAHYDA_FORSWAI 5'- ATATAATATTTAAATAAAATGAAA ACAATA ATCTTA AATGGC AATGAA G -3' Gl _ω

RBS_CAHYDA_REVSTUI 5'- TACCTAGGAGGCCTCCTTATTCATGTTT TGA AACATT TTTATCTTT TGTG -3 ¹ G1 , G1 A * ^•

RBSCAM_SCALHYDAF0R5 ^I -ACAACAGTACTGCGATGAGTGGCAGGGCGGGGCGTAAGGAGGAAAATCATG

CAATAATCTTAAATGGCAATGAAGTGC 3' G5

CPFDX4_HISRBS_F_BAMH1 5'- ATAGGATCCGAATTTAAATAAAATGGCATATAAAATCGCTGATTCATG -3' G9 CPFDX4_RH ISRBSAVR 5 ¹ - ATT CCTAGGCCTCCTTAGTGATGATGGTGGTGATGCGCAGATTCTTGTACTG

GTGCTCCAACTGGAC - 3' G9 lscF2 (Ncol) δ'-TTCCATGGAATTACCGATTTATCTCGACTACTCCGC G5 (iscS) lscR2 (Xhol) δ'-ACTCGAGTTAATGCTCACGCGCATGGTTGATAGTG G5 (fdx)

CtepFI 5'-GACGACGACAAGATgttagatattcacaatccagcgaccgacc G10

CtepRI 5'-GAGAGAAGCCCGGTttactctgccttgttctccgtcgcgttgc G10

Each designed restriction enzyme site is underlined. Codon or nucleotide-changes are indicated in bold. The gene template number refers to Table 2. The physical gene template employed in each PCR reaction consisted of genomic DNA extracted from cultures of each respective organism using the DNeasy Tissue Kit (QIAGEN GmbH, Hilden, Germany).

Table 2. Genes used in the present studies

# Name Encoded Tvoe of Enzvme Oriqinatinα orqanism Database # Reference

1 HydA Hydrogenase, catalytic unit C. acetobutylicum U 15277 Gorwa

2 HydE Hydrogenase maturation factor C. acetobutylicum CAC1631 Posewitz

3 HydF Hydrogenase maturation factor C. acetobutylicum CAC1651 Posewitz

4 HydG Hydrogenase maturation factor C. acetobutylicum CAC1356 Posewitz

5 ISC operon Iron Sulfur Cluster assembly factors Escherichia coli * Kriek

6 yumC NADPH:Ferredoxin-oxidoreductase Bacillus subtilis CAB15201 Seo

7 gapor ** Methanococcus maripaludis CAF30501 Oost

8 ferredoxin (Fd) 4Fe4S-ferredoxin C. pasteurianum M11214 Graves

9 CT1512 NAD(P)H :Ferredoxin-oxidoreductase Chlorobium tepidum NP_662397 Seo OJ

10 zwf Glucose-6-phosphate dehydrogenase Escherichia coli NP_416366 Rowley IJl

*iscS (YP_026169 ), iscU (G7324), iscA (EG12132), hscB (EG12131), hscA (EG12130), fdx (NP_417020 ) ^Glyceraldehyde-S-phosphateiFerredoxin-oxidoreductase

Table 3 - List of Plasmids and Plasmid constructs

List of plasmids

Plasmid name Features Reference pKD46 repA 101 (ts) , araBP-gam-bet-exo, oriR 101, bla Datsenko and Wanner pKD13 oriRy, bla Datsenko and Wanner pCP20 thermosensitive replicon, yeast flp ^~ recombinase, ampr Datsenko and Wanner

List OJf plasmid vector constructs

Construct name Plasmid backbone ORF 1 ORF 2 0RF3 ORF 4 ORF 5 pBsNFOR pET46-Ek/LIC 6 pCtNFOR pET46-Ek/LIC 9 pGAPOR pET46-Ek/LIC 7 OJ pET46-HydA pET46-Ek/LIC 1 pCpFd pCOLA-Duet 8 (MCSl) pISC pACYC-Duet 5 pCDOPF pCDF-Duet 3 pCDOPFE pCDOPF 3 2 pCDOPFEG pCDOPFE 3 2 4 pCDOPFEGA pCDOPFEG 3 2 4 pCDOPFEGHisA pCDOPFEG 3 2 4 1 (N-terminal His-tag) pCDOPFEGHisAFdx pCDOPFEGHisA 3 2 4 1 8

Table 4 - List of strains

General Strains

Name Source Genotype

BL21(DE3) Novagen

BL21(DE3) wcλ " Veit (Present Study) iscK

BL21(DE3) ydbK Veit (Present Study) ydbK

BL21(DE3) fpf Veit (Present Study) fpf

Transformed strains

Name Host DET pCDF pCOLA pACYC

EMEl BL21(DE3) pBsNFOR pCDOPFEGAFdx

EME2 BL21(DE3) pBsNFOR pCDOPFEGA

EME3 BL21(DE3) pET-Duet (empty) pCDOPFEGAFdx

EME4 BL21(DE3) pBsNFOR OJ

^J

EME5 BL21(DE3) pET-Duet (empty)

EME6 BL21(DE3) pBsNFOR

EME8 BL21(DE3) pET-Duet (empty) pCDOPFEG

EME9 BL21(DE3) pCtNFOR pCDOPFEGAFdx

EMElO BL21(DE3) pCpFdYumC pCDOPFEGA

EMEU BL21(DE3) pET-Duet (empty) pCDOPFEGA

EME13 BL21(DE3) pBsNFOR pCDOPFEGA pCOLACpFd

EME14 BL21(DE3) pCDOPFEGA pCOLACpFdYumC

EME15 BL21(DE3) pCDOPFEGA pCOLACpFd

EMEl 6 BL21(DE3) pGAPOR pCDOPFEGA pCOLACpFd

EMElOl BL2l(OB3) ydbK pBsNFOR pCDOPFEGA pCOLACpFd

EMEl 02 BL2l(DE3) ydbK pET pCDOPFEGA pCOLACpFd

EME103 BL21(DE3) ydbK pCtNFOR pCDOPFEGA pCOLACpFd

Table 4 - List of strains (Continued)

Name Host pET pCDF pCOLA PACYC

EME104 BL21(DE3) jpr pBsNFOR pCDOPFEGA pCOLACpFd

EME105 BL21(DE3)jfcr pBsNFOR pCDOPFEGA pCOLACpFd

EME104 BL21(DE3) pYumC pCDOPFEGHisAFdx pCOLAempty

EME105 BL21(DE3) pETempty pCDOPFEGHisAFdx pCOLAzwf

LO

00

Table 4 - List of strains (Continued)

Transformed strains used in ISC-related experiments -properties

wtAEFG E. co/i BL21(DE3) Y Y X wt EFGIsc E. co/z BL21(DE3) X V Y Y wtEFG E. co/i BL21(DE3) X Y X

IscR ^' AEFGIsc E. co/i BL21(DE3) ZsciT Y Y Y Y

IscR ^' AEYG E. coli BL21(DE3) IscK Y Y X

IscR ^' EFGIsc E. coli BUZl (DE3) IscK Y Y Y

IscR- EFG E. co/i BL21(DE3) IscK X Y Y X U) wt Fdxlsc E. co/i BL21(DE3) Y Y wtFdx E. co/i BL21(DE3) X Y wtlsc E. co/i BL21 (DE3) Y X wt control E. coli BL21(DE3) X X

IscR ^' Fdxlsc E. co/i BL21(Dε3) IscK Y Y

IscR ^' Fdx K coHBUZl (OEi)IScR ^' X Y

IscR ^' Isc E. coHBUll (OEh) IscR- Y X

IscR ^' control E. coli BUZl (DE3) IscR ^' X X wtAEFGIscFdx E. coli BL21 (DE3) S SSS Y Y Y wtAEFGFdx E. co/i BL21(Dε3) Y X Y

/jcλ ^" AEFGIscFdx E. coli BL21(Dε3) IscR ^' Y Y Y

IscR ^' AEFGFdx E. coli BL21 (Oε3) IscR- Y X Y

Transformed strains used in ISC-related experiments - composition

Table 4 - List of strains (Continued)

Table 5 a

Protein

HydA quantity Total activity Total activity Specific activity

μmol hydrogen μmol hydrogen μmol hydrogen/min/mg

Strain (μg/ml) / min / culture /min /OD HydA

ANOXIC

WtAEFG 4 30.7/25.5 20.7/17.2 172.5/143.3 wtAEFGIsc 6 4.6/6.0 2.7/3.5 15.4/20.0

IscR AEFG 1 3.0/3.7 2.0 / 2.5 69.5/85.0

IscR ^' AEFGIsc 39 70.9 / 68.6 44.7 / 43.2 36.2 / 35.0

OXIC

WtAEFG 5 0.8/1.0 0.3/0.4 1.6/2.0 wt AEFGIsc 17 13.9/20.3 5.8 / 8.4 8.2/11.9 lscR~ AEFG 93 35.6 / 45.8 20.5 / 26.4 3.8/4.9

/sc/TAEFGIsc 57 41.1/50.3 18.8/23.1 7.2 / 8.8

Table 6

Sample MoI GAPOR Spec. Mo** W** Fe** Pterin** Acid mass yield" activity* labile PdDa] sulfide**

W 71 5.9 UDt 0.013 0.02 N.D. § N.D. N.D.

Mo 71 4.4 1.8 0.17 0.00073 1.3 0.34 6.1

W+Mo 71 5.8 UD 0.01 0.022 N.D. N.D. N.D. no metal 71 3.5 UD 0.012 0.022 N.D. N.D. N.D.

Rosetta2-gami 120

*1 mmole G3P oxidized per min per mg protein %XSD . undetectable .

** [g-atoms / mol] # [ ^m _T / 3 ^we t cells]

§ N . D . Not determined .

Summary of analytical data obtained using MmGAPOR purified from lysates of BL21 (DE3 ) grown in M9 minimal media with the addition of equimolar content of either W, Mo , W and Mo , or no metal . The specific activity of MmGAPOR expressed in Rosetta-2 -garni (DE3 ) cells is shown underneath .

REFERENCES

Arakaki, A. K., Ceccarelli, E.A, Carrillo, N. (1997) Plant-type ferredoxin-NADP ⁺ reductases: a basal structural framework and a multiplicity of functions. FASEB J. 11, 133-140

Asada, Y., Koike, Y., Schnackenberg, J., Miyake, M., Uemura, I., Miyake, J. (2000) Heterologous expression of clostridial hydrogenase in the cyanobacterium Synechococcus PCC7942. Biochim. Biophys . Acta 1490, 269-278

Atta, M., Lafferty, M. E., Johnson, M. K., Gaillard, J., Meyer, J. (1998) Heterologous biosynthesis and characterization of the [2Fe2S] -containing N-terminal domain- of Clostridium pasteurianum hydrogenase. Biochemistry 37, 15974-15980

Ballantine, S. P., Boxer, D.H. (1985) Nickel-containing hydrogenase isoenzymes from anaerobically grown Escherichia coli K-12. J. Bacteriol. 163(2), 454-459

Bianchi, V., Reichard, P., Eliasson, R., Pontis, E., Krook, M., Jornvall, H., Haggard-Ljungquist , E. (1993) Escherichia coli ferredoxin NADP ⁺ reductase: Activation of E. coli anaerobic ribonucleotide reduction, cloning of the gene (fpr) , and overexpression of the protein. J. Bacteriol. 175(6), 1590-1595

Blaschkowski, H. P., Neuer, G., Ludwig-Festl M., Knappe, J.

(1982) Routes of flavodoxin and ferredoxin reduction in Escherichia coli. CoA-acylating pyruvate: flavodoxin and NADPH: flavodoxin oxidoreductases participating in the activation of pyruvate formate-lyase. Eur. J. Biochem.123 (3) , 563-569

Carillo, N., Ceccarelli, E.A. (2003) Open questions in ferredoxin-NADP ⁺ reductase catalytic mechanism. Eur. J. Biochem. 270, 1900-1915

Djamanm O., Outten, F. W., Imlay, J.A. (2004) Repair of oxidized iron-sulfur clusters in Escherichia coli. J. Biol. Chem. 279(43), 44590-44599

Dyall, S.D., Yan, W., Delgadillo-Correa, M. G. , Lunceford, A., Loo, J.A., Clarke, CF. , Johnson, P.J. (2004) Non-mitochondrial complex I proteins in a hydrogenosomal oxidoreductase complex. Nature 431, 1103-1107

Fillat, M. F., Bakker, H.A. C, Weisbeek, P.J. (1990) Sequence of the ferredoxin-NADP ⁺ -reductase gene from Anabaena PCC 7119. Nucl. Acid Res. 18(23), 7161

Fitzgerald, MP, Rogers, LJ, Rao, KK, Hall DO (1980) . Efficiency of ferredoxins and flavodoxins as mediators in systems for hydrogen evolution. Biochem. J. 192, 665-672

Friedrich, T., Scheide, D. (2000) The respiratory complex I of bacteria, archaea, and eukarya and its module common with membrane-bound multisubunit hydrogenases . FEBS lett . 479,

1 - 5

Ghirardi, M. L., Zhang, L., Lee, J.W. , Flynn, T., Seibert, M., Greenbaum, E., Melis, A. (2000) Microalgae: a green source of renewable H ₂ . Trends Biotech. 18, 506-511

Girbal, L., Abendroth, G., Winkler, M., Benton, P.M. C, Meynial-Salles, I., Croux, C, Peter, J.W., Happe, T., Soucaille, P. (2005) Homologous and heterologous overexpression in Clostridium acetobutylicum and characterization of purified Clostridial and Algal Fe-only hydrogenases with high specific activities. Appl . Environ. Microbiol. 71, 2777-2781

Gottschalk, G., (1986) Bacterial Metabolism. 2nd ed. Springer-Verlag, New York

Gorwa, M. -F., Croux, C, Soucaille, P. (1996) Molecular characterization and transcriptional analysis of the putative hydrogenase gene of Clostridium acetobutylicum ATCC 824. J. Bacteriol. 178(9), 2668-2675

Grawert, T., Kaiser, J., Zepeck, F., Laupitz, R., Hecht, S., Amslinger, S., Schramek, N., Schleicher, E., Weber, S., Haslbeck, M., Buchner, J., Rieder, C, Arigoni, D., Bacher, A., Eisenreich, W., Rohdich, F. (2004) IspH protein of Escherichia coli: Studies on iron-sulfur cluster implementation and catalysis. J. Amer. Chem. Soc. 126, 12847-12855

Hallenbeck, P. C, Benemann, J. R. (2002) Biologyical hydrogen production; fundamentals and limiting processes. Int. J. Hydrogen Energy 27, 1185-1193

Hendrickson EL, Kaul R, Zhou Y, Bovee D, Chapman P, Chung J, Conway de Macario E, Dodsworth JA, Gillett W, Graham DE, Hackett M, Haydock AK, Kang A, Land ML, Levy R, Lie TJ, Major TA, Moore BC, Porat I, Palmeiri A, Rouse G, Saenphimmachak C, Soil D, Van Dien S, Wang T, Whitman WB, Xia Q, Zhang Y, Larimer FW, OlsonMV, Leigh JA (2004) Complete genome sequence of the genetically tractable hydrogenotrophic methanogen Methanococcus maripaludis. J. Bacterid. 186(20), 6956-6969

Hrdy, I., Hirt, R. P., Dolezal, P., Bardonova, L., Foster, P. G., Tachezy, J., Embley, T.M. (2004) Trichomonas hydrogenosomes contain the NADH dehydrogenase module of mitochondrial complex I. Nature 432, 618-622

Jenkins, CM., Waterman, M. R. (1994) Flavodoxin and NADPH-flavodoxin reductase from Escherichia coli support bovine cytochrome P450cl7 hydroxylase activities. J. Biol. Chem. 269(44), 27401-27408

Jungermann, K., Thauer, R. K., Leimenstoll, G., Decker, K. (1973) Function of reduced pyridine nucleotide-ferredoxin oxidoreductases in saccharolytic Clostridia. Biochim. Biophys. Acta 305, 268-280

Kalia, V. C, LaI, S., Ghai, R., Mandal, M., Chauhan, A. (2003) Mining genomic databases to identify novel hydrogen producers .

Trends in biotechnology 21(4), 152-156

Kriek, M., Peters, L., Takahashi, Y-, Roach, P. L. (2003) Effect of iron-sulfur cluster assembly proteins on the expression of Escherichia coli lipoic acid synthase. Prot. Expr. Pur. 28, 241-245

Lamed, R.J., Lobos, J. H., Su, T.M. (1988) Effects of stirring and hydrogen on fermentation products of Clostridium thermocellum. Appl. Env. Microbiol. 54, 1216-1221

Lee, M.J., Zinder, S.H. (1988) Hydrogen partial pressures in a thermophilic acetate-oxidizing methanogenic culture. Appl. Environ. Micriobiol . 54, 1457-1461

Levin, D. B., Pitt, L., Love, M. (2004) Biohydrogen production: prospects and limitations to practical application. Int. J. Hydrogen Energy 29, 173-185

Lim, S. -J., Jung, Y. -M., Shin, H. -D., Lee, Y. -H. (2002) J. Biosci. Bioeng. 93, 543-549

Logan, B. (2004) Extracting hydrogen and electricity from renewable resources. Env. Sci. Tech. May 1, 161A-167A

Malki, S., Saimmaime, I., Luca, G., Rousset, M., Dermoun, Z., Belaich, J. -P. (1995) Characterization of an operon encoding an NADP-reducing hydrogenase in Desulfovibrio fructosovorans . J. Bacteriol . 177, 2628-2636

Massanz, C, Schmidt, S., Friedrich, B. (1998) Subforms and in vitro reconstitution of the NAD-reducing hydrogenase of Alcaligenes eutrophus. J. Bacteriol . 180, 1023-1029

Meuer, J., Kuettner, H. C, Zhang, J. K., ^' Hedderich, R., Metcalf, W. W. (2002) Genetic analysis of the archaeon Methanosarcina barker! Fusaro reveals a central role for Ech hydrogenase and ferredoxin in methanogenensis and carbon fixation. Proc. Natl. Acad. USA 99, 5632-5637

Mishra, J., Khurana, S., Kumar, N., Ghosh, A. K., Das, D. (2004) Biochm. Biophys . Res. Comm. 324, 679-685

Morimoto, K., Kimura, T., Sakka, K., Ohtniya, K. (2005) Overexpression of a hydrogenase gene in Clostridium paraputrificum to enhance hydrogen gas production. FEMS Microbiol. Lett. 246, 229-234

Mukund, S., Adams., M. W. W. (1995) Glyceraldehyde-3 -phosphate ferredoxin oxidoreductase, a novel tungsten-containing enzyme with a potential glycolytic role in the hyperthermophilic archaeon Pyrococcus furiosus . J. Biol. Chem. 270, 8389-8392

Mukund, S., Adams, M.W.W. (1996) Molybdenum and vanadium do not replace tungsten in the catalytically active forms of the three tungstoenzymes in the hyperthermophilic archaeon Pyrococcus furiosus. J- Bacteriol. 178, 163-167

Nakamura, M., Saeki, K., Takahashi, Y. (1999) Hyperproduction

of recombinant ferredoxins in Escherichia coli by coexpression of the

0RF1-0RF2-iscS-iscU-±scA-hscB~hscA-fdx-0RF3 gene cluster. J. Biochem. 126, 10-18

Nishio, N., Nakashimada, Y-, N (2004) High rate production of hydrogen/methane from various substrates and wastes. Adv. Biochem. Engin. /Biotechnol . 90, 63-87

Odom, J.M., Peck, H. D. (1981) Hydrogen cycling as a general mechanism for energy coupling in the sulfate reducing bacteria, Desulfovibrio sp. FEMS Microbiol . Lett. 12, 47-50

Oost, , J. V. D., Schut, G., Kengen, S.W.M., Hagen, W. R. , Thomm, M., Vos, W.M. (1998) The ferredoxin-dependent conversion of glyceraldehyde-3 -phosphate in the hyperthermophilic archaeon Pyrococcus furiosus represents a novel site of glycolytic regulation. J. Biol. Chem. 273(43), 28149-28154

Pan, G., Menon, A. L., Adams, M.W. (2003) Characterization of a [2Fe-2S] protein encoded in the iron-hydrogenase operon of Thermotoga maritima. J. Biol. Inorg. Chem. 8(4), 469-474

Pauss, A., Andre, G., Perrier, M., Guiot, S.R. (1990) Liquid-to-gas mass transfer in anaerobic processes: Inevitable transfer limitations of methane and hydrogen in the biomethanation process. Appl . Environ. Microbiol. 56, 1636-1644

Peters, J. W., Lanzilotta, W.N., Lemon, B.J., Seefeldt, L. C.

(1998) X-ray crystal structure of the Fe-only hydrogenase (CpI) from Clostridium pasteurianum to 1.8 Angstrom resolution. Science 282, 1853-1858

Posewitz, M. C, King, P.W., Smolinski, S. L., Zhang, L., Seibert, M., Ghirardi, M. L. (2004) Discovery of two novel radical S-Adenosylmethionine proteins required for the assembly of an active [Fe] hydrogenase. J. Biol. Chem.279(24) , 25711-25720

Rubach, J. K., Brazzolotto, X., Gaillard, J., Fontecave, M. (2005) Biochemical characterization of the HydE and HydG iron-only hydrogenase maturation enzymes from Thermotoga maritima. FEBS Lett. 579, 5055-5060

Sambrook, J., Russell, D.W. (2001) Molecular Cloning: A laboratory manual . Cold Spring Harbor Laboratory Press

Sapra, R., Bagramyan, K., Adams, M.W. W. (2003) A simple energy-conserving system: Proton reduction coupled to proton- translocation. Proc. Natl. Acad. USA 100, 7545-7550

Seo, D., Sakurai, H. (2002) Purification and characterization of ferredoxin-NAD (P) ⁺ -reductase from the green sulfur bacterium Chlorobium tepidum. Biochim. Biophys Acta 1597, 123-132

Seo D., KaminoK., Inoue, K., Sakurai, H. (2004) Purification and characterizaiton of ferredoxin-NADP ⁺ reductase encoded by Bacillus subtilis yumC. Arch. Microbiol. 182, 80-89

Sawers, R. G. (2005) Formate and its role in hydrogen production in Escherichia coli. Biochem. Soc. Trans. 33, 42-46

Schink, B. (1997) Energetics of syntrophic cooperation in methanogenic degradation. Microbiol. MoI. Biol. Rev. 61, 262-280

Schwartz, CJ. , Giel, J. L., Patschkowski, T., Luther, C, Ruzicka, F.J., Beinert, H., Kiley, P.J. (2001). Proc . Natl. Acad. Sci. USA 98(26), 14895-14900

Shin, H. -S., Youn, J. -H., Kim, S. -H. (2004) Hydrogen production from food waste in anaerobic mesophilic and thermophilic acidogenesis . Int. J. Hydrogen Energy 29, 1355-1363

Silva, P.J., Van den Ban, E. C.D., Wassink, H., Hakker, H., Castro, B., Robb, F. T., Hagen, W. R. (2000) Enzymes of hydrogen metabolism in Pyrococcus furiosus. Eur. J. Biochem. 267, 6541-6551

Soboh, B., Linder, D., Hedderich, R. (2004) A multisubunit membrane-bound [NiFe] hydrogenase and an NADH-dependent

Fe-only hydrogenase in the fermenting bacterium

Thermoanaerobacter tengcongensis. Microbiol.150, 2451-2463

Ta, D. T., Vickery, L. E. (1992) Cloning, sequencing, and overexpression of a [2Fe-2S] ferredoxin gene from Escherichia

coli. J. Biol. Chem. 267(16), 11120-11125

Verhees, CH. , Kengen, S.W.M., Tuininga, J. E., Schut, G.J., Adams, M.W.W., Vos, W.M., Oost, J.V.D. (2003) The unique features of glycolytic pathways in archaea. Biochem. J. 375, 231-246

Vignais, P.M., Billoud, B., Meyer, J. (2001) Classification and phylogeny of hydrogenases . FEMS Microbiol. Rev. 25, 455-501

Woodward, J., Orr, M., Cordray, K., Greenbaum, E. (2003) Nature 405, 1014-1015

Yoshida, A., Nishimura, T., Kawaguchi, H., Inui, M., Yukawa, H. (2005) Enhanced hydrogen production from formic acid by formate hydrogen lyase-overexpressing Escherichia coli strains. Appl . Environ. Microbiol. 71(11), 6762-6768

Fabrizio Canonaco, Tracy A. Hess, Sylvia Heri, Taotao Wang, Thomas Szyperski, Uwe Sauer (2001) Metabolic flux response to phosphoglucose isomerase knock-out in Escherichia coli and impact of overexpression of the soluble transhydrogenase UdhA. FEMS Microbiology Letters 204 (2001) 247 ^{^} 252

Park, M.-O., Mizutani, T., Jones P. R. (Submitted) Glyceraldehyde-3 -phosphate ferredoxin oxidoreductase from Methanococcus maripaludis. Manuscript in Preparation

Rowley, DL, Wolf, RE (1991) J. Bacteriol . 173(1), 968-Seo, D., Sakurai, H. (2002) Purification and characterization of ferredoxin-NAD (P) + reductase from the green sulfur bacterium Chlorobium tep±dum. Biochim. Biophys . Acta 1597, 123-132

Alexeeva, S., Hellingwerf, K.J., Joost Teixeira de Mattos, M. (2003) J. Bacteriol. 185, 204-209

Angenent, L. T., Karim, K., Al-Dahhan, M., Wrenn, B.A., Domiguez-Espinosa, R. (2004) Trends Biotechnol .22, 477-485.

Blaschkowski, H. P., Neuer, G., Ludwig-Festl M., Knappe, J. (1982) Eur. J. Biochem. 123, 563-569.

Brumaghim, J. L., Li, Y., Henle, E., Linn, S. (2003) J. Biol.

Chem. 278, 42495-42504.

Canonaco, F., Hess, T.A., Heri, S., Wang, T., Szyperski, T.,

Sauer, U. (2001) FEMS Microbiology Letters 204 (2001)

247-252.

Fischer, E., Sauer, U. (2003) Eur. J. Biochem. 270, 880-891.

Gorwa, M. -F., Croux, C, Soucaille, P. (1996) J. Bacteriol. 178, 2668-2675.

Hanson, R. L., Rose, C. (1980) J. Bacteriol. 141, 401-404.

Haveman, S.A., Brunelle, V., Voordouw, J. K., Voordouw, G., Heidelberg, J. F., Rabus, R. (2003) J. Bacteriol. 185, 4345-4353.

Hill, J., Nelson, E., Tilman, D., Polasky, S., Tiffany, D. (2006). Proc. Natl. Acad. Sci . USA 103, 11206-11210.

Ishii, S., Kosaka, T., Hotta, Y., Watanabe, K. (2006) Appl . Environ. Microbiol. 72(7), 5093-5096

Jungermann, K., Rupprecht, E., Ohrloff, C, Thauer, R., Decker, K. (1971) J. Biol. Chem. 246, 960-963.

Jungermann, K., Thauer, R. K., Leimenstoll, G., Decker, K. (1973) Biochim. Biophys . Acta 305, 268-280.

King, P.W., Posewitz, M. C, Ghirardi, M. L., Seibert, M. (2006) J. Bacteriol. 188, 2163-2172.

Kumar, N., Ghosh, A., Das, D. (2001) Biotechnol . Lett. 23, 537-541.

Lamed, R.J., Lobos, J. H. , Su, T.M. (1988) Appl. Env. Microbiol, 54, 1216-1221.

Lim, S. -J., Jung, Y. -M., Shin, H. -D., Lee, Y. -H. (2002) J. Biosci. Bioeng. 93, 543-549.

Malki, S., Saimmaime, I., Luca, G., Rousset, M., Dermoun, Z., Belaich, J. -P. (1995) J. Bacteriol. 177, 2628-2636.

Nakashimada, Y., Rach,am, M.A. , Kakizono, T., Nishio, N. (2002) Int. J. Hydrogen Energy 27, 1399-1405.

Niel, E.W.J. , Budde, M.A.W. , deHaas, G. G. , vanderWal, F.J., Claassen, P. A. M., Stams, A. J. M. (2002) Int. J. Hydrogen Energy 27, 1391-1398.

Pauss, A., Andre, G., Perrier, M., Guiot, S.R. (1990) Appl. Environ. Microbiol. 56, 1636-1644

Posewitz, M. C, King, P.W., Smolinski, S. L., Zhang, L., Seibert, M., Ghirardi, M. L. (2004) J. Biol. Chem. 279, 25711-25720.

Sanwal, B.D. (1970) J. Biol. Chem. 245, 1626-1631.

Sapra, R., Bagramyan, K., Adams, M. W.W. (2003) Proc . Natl. Acad. USA 100, 7545-7550.

Sauer, U., Canonaco, F., Heri, S., Perrenoud, A., Fischer, E. (2004) J. Biol. Chem. 279, 6613-6619.

Seo, D., Sakurai, H. (2002) Biochim. Biophys Acta 1597, 123-132.

Seo D., Kamino K., Inoue, K., Sakurai, H. (2004) Arch. Microbiol. 182, 80-89.

Sawers, R. G. (2005) Biochem. Soc. Trans. 33, 42-46.

Soboh, B., Linder, D., Hedderich, R. (2004) Microbiol. 150, 2451-2463.

Thauer, R. K., Rupprecht, E., Ohrloff, C, Jungermann, K., Decker, K. (1971) J. Biol. Chem. 246, 954-959.

Vignais, P.M., Billoud, B., Meyer, J. (2001) FEMS Microbiol . Rev. 25, 455-501.

Yoshida, A., Nishimura, T., Kawaguchi, H., Inui, M., Yukawa, H. (2005) Appl. Environ. Microbiol. 71(11), 6762-6768.

Varma, A., Boesch, B.W., Palsson, B.O. (1993) Appl. Environ. Microbiol. 59, 2465-2473.

Verhagen, M. F. J.M., O'Rourke, T., Adams, M.W. W. (1999) Biochim. Biophys . Acta 1412, 212-219.

Vincent, K.A. , Parkin, A., Lenz, O. , Albracht, S.P.J. , Fonteci11a-Camps, J. C, Cammack, R., Friedrich, B., Armstrong, F.A. (2005) J. Am. Chem. Soc . 127, 18179-18189

Wilson, D. F. (1980) Biochim. Biophys. Acta 616, 317-380