INHIBITION OF INTERFERON-GAMMA-INDUCIBLE PROTEIN 16 (IFI16)

CROSS-REFERENCE TO RELATED APPLICATIONS

[0001] This application is claiming priority to U.S. provisional application Ser. No. 61/918,645, filed December 19, 2013, and entitled "Inhibition Of Interferon-Gamma- Inducible Protein 16 (IFI16)," the disclosure of which is incorporated herein by reference in its entirety for all purposes.

STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH

[0002] This invention was made with government support under Grant Nos. AI0961 13 and 1DP1036502 awarded by the National Institutes of Health (NIH). The government has certain rights in the invention.

FIELD OF INVENTION

[0003] The present invention relates generally to the treatment of HIV-1 infection and AIDS. More specifically this invention provides composition and methods for the inhibition of interferon-gamma-inducible protein 16 (IFI16), a host cellular polypeptide shown herein to be a host sensor required for CD4 T-cell death due to abortive HIV-1 infection.

BACKGROUND OF THE INVENTION

[0004] Human Immunodeficiency Virus-Type 1 (HIV-1) is the etiologic agent that is responsible for Acquired Immunodeficiency Syndrome (AIDS), a syndrome characterized by depletion of CD4 ⁺ T-lymphocytes and collapse of the immune system. HIV-1 infection is pandemic and HIV-1 -associated diseases have become a world-wide health problem. At present, the number of persons infected with the pathogenic virus, HIV-1, has exceeded 33,000,000 worldwide including 2, 100,000 infections in 2013.

[0005] Helper CD4 T-cells are the most important cells in maintaining the body's powerful immunity and they are required for almost all our immune responses. As dramatically demonstrated in AIDS patients, a person lacking CD4 T-cells cannot fend off even microbes that are normally harmless. AIDS is caused by HIV-1, which infects and kills CD4 T-cells. [0006] When the disease progresses from HIV-1 infection to full-blown AIDS, it is because the number of CD4 T-cells has dropped significantly. AIDS is heralded by a total lymphocyte count of less than 500/mm ³ and a dangerously low T-cell count of below

200/mm ³ . With the immune system so depleted, the body becomes highly vulnerable to opportunistic diseases. As the term suggests, these are infections and other diseases that seize the opportunity presented by a weakened defense system. They commonly include herpes simplex virus infection and other herpes conditions, such as shingles and the oral yeast infection thrush; Kaposi's sarcoma, characterized by the dark lesions; CMV retinitis, a herpes virus that can cause blindness; meningitis, an infection of the spinal cord and brain; cervical cancer; tuberculosis; and a formerly rare type of pneumonia caused by Pneumocystis jiroveci.

[0007] Despite extensive efforts over the past quarter century, the precise mechanism by which HIV-1 causes progressive depletion of CD4 T-cells remains debated. Both direct and indirect cytopathic effects have been proposed. When immortalized T-cell lines are infected with laboratory-adapted HIV-1 strains, cells become productively infected and die by apoptosis (direct CD4 T-cell killing). Conversely, in more physiological systems, such as infection of lymphoid tissue with primary HIV- 1 isolates, the majority of dying cells appear as uninfected "bystander" CD4 T-cells (Finkel et al., 1995, Nat Med 1 : 129-134; Jekle et al., 2003, J Virol 77:5846-5854).

[0008] Various mechanisms have been proposed to contribute to the death of these bystander CD4 T-cells including the action of host-derived factors like tumor necrosis factor- ex, Fas ligand and TRAIL (Gandhi et al, 1998, J Exp Med 187: 1 1 13-1 122; Herbeuval et al., 2005, Blood 106:3524-3531), and viral factors like HIV-1 Tat, Vpr, and Nef released from infected cells (Schindler et al, 2006, Cell 125: 1055-1067; Westendorp et al, 1995, Nature 375:497-500). Considerable interest has also focused on the role of gpl20 and gp41 Env protein in indirect cell death, although it is not clear whether death signaling involves gpl20 binding to its chemokine receptor or gp41 -mediated fusion. It is also unclear whether such killing is caused by HIV-1 virions or by infected cells expressing Env.

[0009] Most studies have focused on death mechanisms acting prior to viral entry. Less is known about the fate of HIV- 1 -infected CD4 T-cells that do not express viral genes, in particular na ^' ive CD4 T-cells in tissues that are refractory to productive HIV-1 infection (Glushakova et al., 1995, Nat Med 1 : 1320-1322; Kreisberg et al., 2006, J Exp Med 203 :865- 870). In these cells, infection is aborted after viral entry, as reverse transcription is initiated but fails to reach completion (Kamata et al., 2009, PLoS Pathog 5, el 000342; Epub 1002009 Mar 1000320; Swiggard et al., 2004, AIDS Res Hum Retroviruses 20:285-295; Zack et al., 1990, Cell 61 :213-222; Zhou et al, 2005, J Virol 79:2199-2210).

[0010] Human lymphoid aggregate cultures (HLACs) prepared from tonsillar tissue closely replicate the conditions encountered by HIV-1 in vivo and thus form an attractive, biologically relevant system for studying HIV- 1 infection (Eckstein et al., 2001, Immunity 15:671-682). Lymphoid organs are the primary sites of HIV-1 replication and contain more than 98% of the body's CD4 T-cells. Moreover, events critical to HIV-1 disease progression occur in lymphoid tissues, where the network of cell-cell interactions mediating the immune response deteriorates and ultimately collapses. Primary cultures of peripheral blood cells do not fully mimic the cytokine milieu, the cellular composition of lymphoid tissue, nor the functional relationships that are undoubtedly important in HIV-1 pathogenesis. Finally, HLACs can be infected with a low number of viral particles in the absence of artificial mitogens, allowing analysis of HIV-1 cytopathicity in a natural and preserved environment.

[0011] In studies described more fully herein (e.g., see, Examples and Doitsh et al., 2010, Cell 143:789-801 ; Doitsh et al., 2013, Nature doi: 10.1038/naturel2940), it was discovered that the death of so-called uninfected "bystander" T-cells involves abortive HIV-1 infection. These cells die as a consequence of an innate immune response against the virus rather than a toxic effect of the viral DNA. As disclosed herein, this innate immne response is initiated by interferon-gamma-inducible protein 16 (IFI16) sensing of the viral DNA and assembly of Ml 6 infiammasomes that leads to activation of caspase-1.

[0012] Caspases are a family of at least fourteen cysteine-dependent aspartate-directed proteases that are key mediators in the signaling pathways for apoptosis and cell disassembly (Thornberry, 1998, Chem Biol 5:R97-R103). These signaling pathways vary depending on cell type and stimulus, but all apoptosis pathways appear to converge at a common effector pathway leading to proteolysis of key proteins. Caspases are involved in both the effector phase of the signaling pathway and further upstream at its initiation. The upstream caspases involved in initiation events become activated and in turn activate other caspases that are involved in the later phases of apoptosis.

[0013] Caspase-1, the first identified caspase, is also known as interleukin converting enzyme or "ICE." Caspase-1 exists as an inactive proenzyme, which undergoes proteolytic processing at conserved aspartic acid residues to produce two subunits, large (caspase-1 p20 subunit) and small (caspase-1 pl O subunit) that dimerize to form the active enzyme.

Caspase-1 polypeptides are derived from various caspase-1 isoform precursors. Caspase-1 converts the inactive precursor of interleukin-l-beta (pIL-Ι β) to the pro-inflammatory active form by specific cleavage of pIL-1 β between Asp-1 16 and Ala-117. Besides caspase-1 there are also eleven other known human caspases, all of which cleave specifically at aspartyl residues. They are also observed to have stringent requirements for at least four amino acid residues on the N-terminal side of the cleavage site.

[0014] The caspases have been classified into three groups depending on the amino acid sequence that is preferred or primarily recognized. One group of caspases, which includes caspases 1, 4, 5 and 1 1, have been shown to prefer hydrophobic aromatic amino acids at position 4 on the N-terminal side of the cleavage site (preferred sequence Trp-Glu-His-Asp). Another group of cspases, which includes caspases 2, 3 and 7, recognize aspartyl residues at both positions 1 and 4 on the N-terminal side of the cleavage site, and preferably a sequence of Asp-Glu-X-Asp. A third group of caspases, which includes caspases 6, 8, 9 and 10, tolerate many amino acids in the primary recognition sequence, but seem to prefer residues with branched, aliphatic side chains such as valine and leucine at position 1 (LeufV al-Glu-X- Asp).

[0015] The caspases have also been grouped according to their perceived function. The first subfamily consists of caspases-1 (ICE), 4, 5, 1 1 and 12. These caspases have been shown to be involved in pro-inflammatory cytokine processing and therefore play an important role in inflammation. Caspase-1, the most studied enzyme of this class, activates the IL-Ι β precursor by proteolytic cleavage. This enzyme therefore plays a key role in the inflammatory response. Applicants, however, are unaware of anything in the art suggesting the use of an IFI16 inhibitor for inhibiting caspase-1 in methods for the treatment of an HIV- 1 infection and AIDS and for use in related methods described herein.

[0016] The biological activities of interferons (IFNs) are mediated by IFN-induced proteins. The interferon-inducible p200 (IFI200) family of proteins is among the numerous gene products induced by interferons (IFNs), which are important regulators of cell growth, immunomodulation and host resistance to tumors and viral infections. The members of this family of proteins, now known as the ΡΥΗΓΝ protein family, are highly homologous to one another and consist of five murine proteins including p202, p203, p204 and p205 as well as three human homologues: IFI16, myeloid cell nuclear differentiation antigen (MNDA) and absent in melanoma (AIM) 2 (Asefa et al, 2004, Blood Cells Mol Dis 32(1): 155-67). They each possess at least one copy of a conserved 200 amino-acid DNA binding motif (ΗΓΝ domain) which exists in two types; the a and b domains. Most of the IFI200 proteins also possess a domain involved in apoptosis and interferon response (DAPIN)/PYRTN domain (PYD), which is a conserved motif associated with protein-protein interactions in the regulation of apoptotic and inflammatory signaling pathways (Asefa et al., 2004, Blood Cells Mol Dis 32(1): 155-67).

[0017] IFI16 previously had been shown to have a role in regulating cell proliferation and differentiation (Luan et al., 2008, Cytokine Growth Factor Rev 19:357-369). In a recent study employing interferon (IFN)p-inducing vaccinia virus DNA motif to affinity purify DNA -binding proteins from cytosolic extracts of human monocytes, IFI16 was identified as an innate immune sensor for intracellular DNA (Unterholzner et al., 2010, Nat Immunol 1 1 :997-1004; incorporated herein by reference in its entirety for all purposes). In that study, IFI16 was shown to directly bind to IFNp-stimulating double-stranded viral DNA, and to recruit STING polypeptide upon stimulation of cells with transfected DNA. Small interfering RNA (siRNA) targeting IFI16, or its murine ortholog p204, inhibited DNA-, but not RNA- induced, IRF3 and NF-κΒ activation, and IFNp induction. Importantly, Unterholzner et al. found that responses to DNA virus, but not to an RNA virus, were dependent on p204 (Unterholzner et al., 2010, Nat Immunol 1 1 :997-1004).

[0018] During Kaposi sarcoma associated herpesvirus (KSHV) infection of endothelial cells, IFI16 has been reported to interact with an adaptor molecule known as the apoptosis- associated speck-like protein containing CARD (ASC) and procaspase-1 to form a functional inflammasome, a cytoplasmic sensor of foreign molecules (Kerur et al, 201 1 , Cell Host Microbe 9(5):363-375; incorporated herein by reference in its entirety for all purposes). The inflammasome is a caspase-1 activating complex formed by interaction of three proteins: (i) a "sensor protein" recognizing a trigger, such as KSHV infection, (ii) the adaptor molecule ASC and (iii) procaspase- 1. Based on the identity of the sensor protein, four types of inflammasomes have been described: NLRPl, NLRC4, NLRP3 and AIM2 (Kerur et al., 2011, Cell Host Microbe 9(5):363-375). The inflammasome complex provides the molecular scaffold required for the proteolytic processing of inactive procaspase-1 to active caspase-1. Kerur et al. reported that KSHV infection induced caspase-1 activation via an inflammasome pathway involving IFI16 and ASC and that caspase-1 activation by KSHV was reduced by IFI16 and ASC silencing. (Kerur et al, 201 1 , Cell Host Microbe 9(5):363-375).

Interestingly, IFI16 knockdown did not affect caspase- 1 activation by vaccinia virus, demonstrating the specificity of IFI16 knockdown and confirming that IFI16 and ASC play critical roles in inflammasorae activation in response to KSHV infection (Kerur et al., 201 1, Cell Host Microbe 9(5):363-375).

[0019] IFI16 gene silencing resulted in enhanced replication of herpesviruses, in particular human cytomegalovirus (HCMV), whereas overexpression of IFI16 decreased both virus yield and viral DNA copy number (Gariano et al., 2012, PLoS Pathog 8(l):el002498, incorporated herein by reference in its entirety for all purposes).

[0020] The present treatments available for HIV- 1 infection and AIDS seek to block one or more steps involved in the production of viral particles and often are based on a combination of several drugs, a so-called cocktail of inhibitors of reverse transcriptase and protease inhibitors. Treatment options involve administration of reverse transcriptase inhibitors, inhibitors of viral protease, fusion, entry, or integration inhibitors in different combinations to block multiple steps in the viral life cycle. This approach, termed highly active antiviral therapy (HAART) has greatly decreased morbidity and mortality in people infected with HIV (Palella et al., 1998, N Engl JMerf 338(13):855-860). While HAART is quite effective and can reduce the virus back to undetectable levels in patient's blood, it is not a cure for the patient, because the virus is still present in the immune cells, and the disease can reappear at any time due to emergence of drug-resistant viruses; upon discontinuation of therapy viremia peaks and rapid progression to AIDS is frequently observed. Furthermore, the immunodeficiency and the HIV-1 specific T-cell dysfunction persist during HAART. This therapy requires life-long treatment and the treatment is very expensive. The cost of the drugs alone often exceeds USD 15,000. There are, in addition, several other problems associated with this therapy; difficulties with patient compliance (complicated drug regimens), development of resistant viruses, non-ideal pharmacokinetics and side effects such as, for example, suppression of bone-marrow and long-term metabolic effects.

[0021] The global health crisis caused by HIV- 1 is unquestioned, and while recent advances in drug therapies have been successful in slowing the progression of AIDS, these drugs are not perfect. For example, HIV-1 -infected individuals continue to display a low level of chronic inflammation despite antiretroviral therapy. Additionally, anti-retroviral therapy is currently only available to 12 million of the more than 33 million in need.

Identifying inhibitors of the pyroptotic death pathway that drives more than 95% of CD4 T cell depletion in HIV-1 infection, could provide a bridge therapy for the millions who are unable to access cART, a valuable adjunct to cART to enhance immune reconstitution, and a potential approach to prevent chronic inflammation and associated co-morbidities (e.g., cardiovascular disease, certain cancers, liver and renal disease, and neurodegeneration). Applicants herein provide novel compositions and methods for the screening of compounds useful for the treatment of HTV-1 infection and AIDS that overcome the afore-mentioned problems. In particular, in view of Applicants' finding that IFI16 as a host sensor required for CD4 T cell death due to abortive HIV infection, Applicants herein provide novel

compositions and methods for identifying compounds that inhibit the activity of IFI16.

Compounds identified as inhibitors of IFI16 will be useful for the treatment of HIV-1 infected patients and patients having AIDS.

BRIEF SUMMARY OF THE INVENTION

[0022] The progressive depletion of quiescent "bystander" CD4 T-cells, which are non- permissive to HIV-1 infection, is a principal driver of the acquired immunodeficiency syndrome (AIDS). These cells undergo abortive infection characterized by the cytosolic accumulation of incomplete HIV-1 reverse transcripts. These viral DNAs are sensed by a host sensor that triggers an innate immune response, leading to caspase-1 activation and pyroptosis. Using unbiased proteomic and targeted biochemical approaches as well as two independent methods of lentiviral shRNA-mediated gene knockdown in primary CD4 T- cells, Applicants herein identify Interferon-Gamma-Inducible Protein 16 (IFI16) as a host DNA sensor required for CD4 T-cell death due to abortive HIV-1 infection. These findings provide insights into a key host pathway that plays a central role in CD4 T-cell depletion during disease progression to AIDS.

[0023] This application discloses the surprising finding that IFI16 is a specific intracellular host sensor required for CD4 T-cell death due to abortive HIV-1 infection. Applicants herein disclose specific inhibitors for IFI16 and methods for identifying additional compounds that inhibit the activation, a level, and/or an activity of IFI16.

[0024] In one aspect of the present invention, an in vitro method for identifying an agent that inhibits a level or an activity of an IFI16 polypeptide in a cell is provided. In some embodiments, this method comprises the step of contacting a cell that produces an IFI16 polypeptide with a test agent. In some embodiments, the method further comprises the step of determining the effect, if any, of the test agent on the IFI16 polypeptide level or on the IF116 polypeptide activity. In some embodiments wherein the cell is abortively infected with a Human Immunodeficiency Virus Type-1 (HIV- 1 ), the cell undergoes pyroptosis. [0025] Agents can be screened for inhibiting various IFI16 polypeptide activities. In some embodiments of the present invention, an IFI16 polypeptide activity is selected from the group consisting of binding of the IFI16 polypeptide to a double-stranded DNA, binding of the IFI16 polypeptide to a single-stranded DNA, formation of an inflammasome complex, activating caspase-1 activity, signaling to interferon, translocating from a cell nucleus into the cytoplasm of a cell, translocating from the cytoplasm of the cell into the cell nucleus; binding of the IFI16 polypeptide to an ASC polypeptide, binding of the IFI16 polypeptide to a caspase-1 polypeptide, binding of the IFI16 polypeptide to a STING polypeptide, activating gene transcription of a target gene, and inducing type-I interferon production.

[0026] Various assays can be used to determine the effect, if any, of the test agent on IFI16 level or IFT16 polypeptide activity. In some embodiments of the present invention, an assay is selected from the group consisting of an assay determining a level of newly translated IFI16 polypeptide, an assay determining an intracellular localization of the IFI16 polypeptide, an assay detecting an IFI16 polypeptide comprising a label that provides a detectable signal, an assay determining binding of the IFI16 polypeptide to an ASC polypeptide, an assay determining binding of the IF116 polypeptide to a caspase-1 polypeptide, an assay determining binding of the IFI 16 polypeptide to a STING polypeptide, an assay determining formation of an inflammasome complex, an assay determining binding of the IFI16 polypeptide to a double-stranded DNA, an assay determining binding of the IFI16 polypeptide to a single-stranded DNA, an immunological assay, a fluorometric assay, an enzymatic assay, and a high throughput assay.

[0027] In assays comprising a step of detecting a label, various labels can be used. In some embodiments of the present invention, a label is selected from the group consisting of a radioisotope, a fluorescer, a chemiluminescer, an epitope tag, an enzyme, a fusion partner, a binding partner, β-galactosidase, luciferase, horse radish peroxidase, glutathione-S- transferase, hemagglutinin (HA), FLAG, c-myc, (His) _n , a fluorescent protein from an Anthozoaspecies, a green fluorescent protein (GFP) from Renilla reniformis, a GFP from Renilla mulleri, a GFP from Ptilosarcus guernyi, a GFP from Aequonia victoria, a humanized GFP and fluorescent mutants thereof.

[0028] In some embodiments wherein the assay comprises an immunological assay, the immunological assay comprises detecting the IFI16 polypeptide using an anti-IFI16 antibody or an antigen-binding fragment thereof. [0029] Various cells can be used in a cell-based assay for identifying an agent that inhibits a level or an activity of an IFI16 polypeptide. Such cells include a mammalian cell, an immortalized cell, a primary cell, a spleen cell, a tonsil cell, and a T-cell.

[0030] In some embodiments of a subject method a cell is genetically modified. Various genetic modification can be used. In some embodiments of the present invention, a cell is genetically modified with a recombinant nucleic acid comprising a nucleotide sequence encoding the 1FI16 polypeptide and wherein the IFI16 polypeptide is produced in the cell. Various nucleotide sequences encoding an IFI 16 polypeptide can be used. In some embodiments of the present invention, the nucleotide sequence encoding the IFI16 polypeptide is a nucleotide sequence that hybridizes under stringent hybridization conditions to a nucleotide sequence deposited under GenBank Accession Nos. BC017059.1,

NM 001206567.1, NM_005531.2, XM_00671 1290.1 , XM_005245127.2, XM_009435204.1 , XM_009435199, XM_009435194.1, XM_001 170378.3, XM_863928.2 or conservatively modified variants thereof.

[0031] In some embodiments of the present invention, a nucleotide sequence encoding an IFI16 polypeptide comprises a nucleotide sequence encoding a fusion partner. In such embodiments, an IFI16 fusion protein is produced in the cell and the IFI16 fusion protein comprises the IFI16 polypeptide and the fusion partner.

[0032] An IFI16 polypeptide may be expressed from a vector. Various vectors may be used. In some embodiments of the present invention, the IFI16 polypeptide is expressed from a lentiviral vector.

[0033] Various methods may be used to introduce a vector or a recombinant nucleic acid into a cell. In some embodiments, the cell is transiently transfected with the recombinant nucleic acid. In some embodiments, the cell is stably transfected with the recombinant nucleic acid.

[0034] In some embodiments, a test agent is a member of a library.

[0035] In some embodiments of a method for identifying an agent that inhibits a level or an activity of an IFI16 polypeptide, a cell comprises a non-cellular double-stranded or a non- cellular single-stranded DNA.

[0036] Some embodiments of a method of the invention are set forth in claim format below: Claim 1. An in vitro method for identifying an agent that inhibits a level or an activity of an IFI16 polypeptide in a cell, the method comprising the steps of:

(a) contacting a cell that produces an IFI 16 polypeptide with a test agent; and

(b) determining the effect, if any, of the test agent on the level or activity of the IFI 16 polypeptide,

wherein the cell, when abortively infected with a Human Immunodeficiency Virus Type-1 (HIV-1), undergoes pyroptosis.

Claim 2. The method according to claim 1 , wherein the IFI 16 polypeptide activity is selected from the group consisting of binding of the IFI 16 polypeptide to a double- stranded DNA, binding of the IFI 16 polypeptide to a single-stranded DNA, formation of an inflammasome complex, activating caspase-1 activity, signaling to interferon, translocating from a cell nucleus into the cytoplasm of a cell, translocating from the cytoplasm of the cell into the cell nucleus; binding of the IFI16 polypeptide to an ASC polypeptide, binding of the IFI 16 polypeptide to a caspase-1 polypeptide, binding of the IFI 16 polypeptide to a STING polypeptide, activating gene transcription of a target gene, and inducing type-I interferon production.

Claim 3. The method according to any one of claims 1 -2, wherein step (b) comprises an assay selected from the group consisting of:

(i) an assay determining a level of newly translated ΓΡΙ16 polypeptide;

(ii) an assay determining an intracellular localization of an IFI 16 polypeptide;

(iii) an assay detecting an IFI 16 polypeptide comprising a label that provides a detectable signal;

(iv) an assay determining binding of an IFI 16 polypeptide to an ASC polypeptide;

(v) an assay determining binding of an IFI 16 polypeptide to a caspase-1

polypeptide;

(vi) an assay determining binding of an IFI16 polypeptide to a STING

polypeptide;

(vii) an assay determining formation of an inflammasome complex;

(viii) an assay determining binding of an IFI 16 polypeptide to a double-stranded DNA;

(ix) an assay determining binding of an IFI 16 polypeptide to a single-stranded DNA; (x) an immunological assay;

(xi) a fluorometric assay;

(xii) an enzymatic assay; and

(xiii) a high throughput assay.

Claim 4. The method according to claim 3, wherein the label is selected from group consisting of a radioisotope, a fluorescer, a chemiluminescer, an epitope tag, an enzyme, a fusion partner, a binding partner, β-galactosidase, luciferase, horse radish peroxidase, glutathione-S-transferase, hemagglutinin (HA), FLAG, c-myc, (His) _n , a fluorescent protein from an Anthozoaspecies, a green fluorescent protein (GFP) from Renilla reniformis, a GFP from Renilla m lleri, a GFP from Ptilosarcus guernyi, a GFP from Aequonia victoria, a humanized GFP and fluorescent mutants thereof.

Claim 5. The method according to claim 3, wherein the immunological assay comprises detecting the IFI16 polypeptide using an anti-IFI16 antibody or an antigen-binding fragment thereof.

Claim 6. The method according to any of claims 1-5, wherein the cell is selected from the group consisting of a mammalian cell, an immortalized cell, a primary cell, a spleen cell, a tonsil cell and a T-cell.

Claim 7. The method according to any of claims 1-6, wherein the cell is genetically modified with a recombinant nucleic acid comprising a nucleotide sequence encoding the IFI16 polypeptide and wherein the IFI16 polypeptide is produced in the cell.

Claim 8. The method according to claim 7, wherein the nucleotide sequence encoding the IFI16 polypeptide is a nucleotide sequence that hybridizes under stringent hybridization conditions to a nucleotide sequence deposited under GenBank Accession Nos. BCO 17059.1 , NM_001206567.1 , NM_005531.2, XM_00671 1290.1 , XM_ 005245127.2, XM_009435204.1, XM _009435199, XM_009435194.1, XM_001 170378.3, XM_863928.2 or conservatively modified variants thereof.

Claim 9. The method according to any one of claim 1-8, wherein the IFI16 polypeptide is expressed from a vector.

Claim 10. The method according to any one claims 1 -9, wherein the IFI16 polypeptide is expressed from a lentiviral vector. Claim 11. The method according to any one of claims 7-10, wherein the nucleotide sequence encoding the IFI16 polypeptide comprises a nucleotide sequence encoding a fusion partner and wherein an IFI16 fusion protein comprising the IFI16 polypeptide and the fusion partner is produced in the cell.

Claim 12. The method according to any of claims 7-1 1, wherein the cell is transiently transfected with the recombinant nucleic acid.

Claim 13. The method according to any one of claims 7-1 1, wherein the cell is stably transfected with the recombinant nucleic acid.

Claim 14. The method according to any of claims 1-13, wherein the test agent is a member of a library.

Claim 15. The method according to any one of claims 1-14, wherein the cell comprises a non-cellular double-stranded or non-cellular single-stranded DNA.

[0037] Identified compounds, such as IFI16 inhibitors, are useful in numerous methods directly or indirectly targeting a level or an activity of an IFI16 polypeptide. Non-limiting methods include (i) a method for inhibiting an IFI16 activity in a patient expressing an IFI16 protein, (ii) a method for the treatment of HIV- 1 infection and AIDS, (iii) a method for slowing disease progression in a patient having an HlV-1 infection and/or having AIDS, (iv) a method for preventing the death of a CD4 T-cell, (v) a method for inhibiting formation of bioactive interleukin beta, (vi) a method for the inhibition of pyroptosis, (vii) a method for decreasing inflammation, (viii) a method for the inhibition of an HIV- 1 -induced

propathogenic host response, (ix) a method for inhibiting the binding of an IFI16 polypeptide to double-stranded DNA, (x) a method for inhibiting the binding of an IFI16 polypeptide to single-stranded DNA, (xi) a method for inhibiting formation of an inflammasome complex, (xii) a method for inhibiting activation of caspase-1 , (xiii) a method for inhibiting IFI16 signaling to interferon, and (xiv) combination therapies.

[0038] In some embodiments an IFI16 inhibitor is used in a method for treatment of a propathogenic condition in a host infected with a virus. In some embodiments, this method comprises the step of administering to a host infected with a virus and experiencing a propathogenic host response an agent that inhibits a level or an activity of a host polypeptide. Thereby the propathogenic condition is treated. The propathogenic condition is caused by the level or activity of the host polypeptide. In the absence of the agent, the host polypeptide interacts with a viral component.

[0039] The method can be used in hosts infected with various viruses. A preferred virus is Human Immunodeficiency Virus Type- 1 (HIV-1).

[0040] Various propathogenic conditions can be treated by the subject method. In some embodiments, the propathogenic condition is selected from the group consisting of inflammation, pyroptosis, decrease of CD4 T-cells, and AIDS.

[0041] A preferred host polypeptide whose level or activity is being inhibited in the subject method is interferon-inducible protein 16 (IFI16).

[0042] Various agents, such as IFU 6 inhibitors can be used in the subject method. In some embodiments, the agent is an IFU 6 inhibitor selected from the group consisting of an IFU 6 siRNA, an IFI16 antisense RNA, an IFU 6 ribozyme, an anti-IFI16 antibody or an antigen-binding fragment thereof, a small molecule IFU 6 inhibitor, an IF116 peptide inhibitor, a PUL83 peptide, and a dominant-negative IFI16 polypeptide.

[0043] Some embodiments of a method for treatment of a propathogenic condition in a host infected with a virus are set forth in claim format below:

Claim 1. A method for treatment of a propathogenic condition in a host infected with a virus, the method comprising the steps of administering to a host infected with a virus and experiencing a propathogenic host response an agent that inhibits a level or an activity of a host polypeptide; wherein the propathogenic condition is caused by the level or activity of the host polypeptide; wherein, in the absence of the agent, the host polypeptide interacts with a viral component; and whereby the propathogenic condition is treated.

Claim 2. The method according to claim 1, wherein the virus is Human Immunodeficiency Virus Type-1 (HIV-1 ).

Claim 3. The method according to any one of claims 1-2, wherein the propathogenic condition is selected from the group consisting of inflammation, pyroptosis, decrease of CD4 T-cells, and AIDS.

Claim 4. The method according to any one of claims 1-3, wherein the host polypeptide is interferon-inducible protein 16 (IF116).

Claim 5. The method according to any one of claims 1 -4, wherein the agent is an IFI16 inhibitor selected from the group consisting of an IFI16 siRNA, an IFI16 antisense RNA, an IFI16 ribozyme, an anti-IFI16 antibody or an antigen-binding fragment thereof, a small molecule IFI16 inhibitor, an IFI 16 peptide inhibitor, a PUL83 peptide, and a dominant- negative IFI16 polypeptide.

[0044] In one aspect, the invention provides a method for the treatment of a patient having an HIV-1 infection, of a patient suspected of having an HIV-1 infection, or of a patient having AIDS. In some embodiments, this method comprises the step of selecting a patient having an HIV-1 infection, suspected of having an HIV-1 infection or having AIDS. In some embodiments, this method comprises the step of administering to the patient in need of such treatment a therapeutically effective amount of an IFI16 inhibitor.

[0045] The patient being treated according to a method of the present invention may have cells comprising incomplete HIV-1 nucleic acids. The incomplete HIV-1 nucleic acids may be the product of an abortive HIV-1 reverse transcription reaction.

[0046] In some embodiments, the patient being treated according to a method of the present invention may have developed a resistance against an anti-HIV- 1 compound.

[0047] In some embodiments of the method for the treatment of a patient having an HIV- 1 infection or of a patient suspected of having an HIV-1 infection, or of a patient having AIDS, the method comprises the step of administering to the patient an anti HIV-1 compound. In some embodiments, HAART is co-administered to the patient.

[0048] In some embodiments of the method for the treatment of a patient having an HIV- 1 infection or of a patient suspected of having an HIV-1 infection, or of a patient having AIDS, the patient has a reduced T-cell count of less than 1,000/mm ³ , less than 750/mm ³ or less than 500/mm .

[0049] The invention also provides a method for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells. This method can be practiced in vitro and in vivo.

[0050] In some embodiments of the method for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells, the method comprises the step of contacting the population of CD4 T-cells with an IFI16 inhibitor, thereby preventing the death of the CD4 T-cell. When practiced in vivo, the method comprises the step of selecting a patient in need of having the CD4 T-cell contacted with an IFI1 inhibitor. [0051] The invention also provides a method for inhibiting pyroptosis. This method can be practiced in vitro and in vivo.

[0052] In some embodiments of the method for inhibiting pyroptosis, the method comprises the step of administering an IFI16 inhibitor to a patient in need of inhibiting pyroptosis. In some embodiments, the method comprises the steps of selecting a patient having cells undergoing pyroptosis and administering to the patient a pharmaceutically effective amount of an IFI16 inhibitor. Thereby pyroptosis is inhibited.

[0053] Also contemplated is the use of an IFI16 inhibitor for the preparation of a medicament for the treatment of HIV-1 infection and/or AIDS.

[0054] Also contemplated is the use of an IFI16 inhibitor for the preparation of a medicament for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells.

BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figures 1 A- I B depict a biochemical analysis of cytosolic DNA binding proteins in CD4 T-cells. (A) Tonsillar CD4 T-cell lysates were incubated with a 500-bp biotinylated HIV-1 Nef DNA probe or a control non-biotinylated DNA and immunoprecipitated with streptavidin-coated beads. Samples were separated by SDS-PAGE and silver stained. (B) Western blot analysis of nuclear histone H3 and beta-actin in whole or digitonin lysis buffer prepared CD4 T-cell lysates. Details are described in Example 2.

[0056] Figures 2A-2P depict a list of detected polypeptides using an unbiased proteomic approach involving DNA affinity chromatography and mass spectrometry to identify potential viral DNA sensor candidates. Details are described in Example 2.

[0057] Figures 3A and 3B depict a biochemical analysis of cytosolic DNA binding proteins in CD4 T-cells. (A) Top ranked hits (rank based on protein discriminant scores described in Example 1) from MS samples prepared as in Fig. 1A were Ku80, PARP-1, Ku70, RPA1, IFI16, and IFIX . (B) Western blot analysis of candidate DNA sensors. Details are described in Example 2.

[0058] Figures 4A-4D schematically depict expression of innate immune nucleic acid sensors in tonsil cells. (A) IFI16 mRNA is expressed at approximately four to five-fold higher levels than AIM2 mRNA in tonsillar CD4 T cells. Isolated CD4 T cells were analyzed by quantitative RT-PCR for relative IFI16 and AIM2 mRNA levels. Data were normalized to GAPDH. (* indicates p<0.05, Student's t test). (B) Western blot analysis of IFI16, histone H3, and GAPDH in cytosol and nuclear fractions compared to whole cell lysate from tonsillar cultures. (C) Quantitative RT-PCR assessing cGAS mRNA levels in THP-1 cells, complete tonsillar HLAC cultures, or isolated CD4 ⁺ or CD4 ^" populations relative to levels in HEK293T cells. Data were normalized to GAPDH. (D) Cell types from (C) were analyzed by immunoblotting for cGAS and β-actin expression. Details are described in Example 2.

[0059] Figures 5A-5C depict a binding assay demonstrating that IFI16 binds to dsDNA and to ssDNA. (A) SDS-PAGE and silver stain analysis of biotinylated dsDNA or ssDNA samples prepared as in Fig. 1A (Example 2) and competed with a 10-fold excess of ssDNA or dsDNA. (B) Western blot analysis of IFI16 and RIG-I binding samples in (A). (C) Western blots with high levels of protein input showing 1FI16 binding to biotinylated ssDNA and dsDNA and RIG-I-RNA controls. Details are described in Example 3.

[0060] Figures 6A-D schematically depict an analysis of activated splenic CD4 T cells that returned to a quiescence state. (A) Flow cytometry analysis depicting purified CD3 ⁺ CD4 ⁺ T cells from spleen (97.7%) used in this assay. (B) Activation markers CD25 and CD69 were analyzed by flow cytometry 48 hours following activation with 10μg/ml PHA and lOOU/ml interleukin (IL)-2. (C) Activated cells were infected with the indicated shRNA Lentivirus harboring mCherry reporter cassette and analyzed by flow cytometry for mCherry expression (10.6% and 15.3%). Cells positive for mCherry expression were then sorted for further analyses. (D) Flow cytometry analysis showing gating strategy for mCherry ⁺ CD4 ⁺ T cells and mCherry ^" CD4 ⁺ T cell populations post co-culture with productively infected HIV- 1-GFP reporter mCherry-cells. Details are described in Example 4.

[0061] Figures 7A-D schematically depict that IFI16 shRNA knockdown rescues activated and rested splenic CD4 T-cells from depletion following abortive HIV- 1 infection. (A) Western blot analysis of IFI16 and beta-actin expression in shRNA expressing mCherry ^"1" CD4 ⁺ T-cells after activation and rest in reduced IL-2. (B) Flow cytometry analysis of mCherry-positive CD4 T-cell survival after knockdown with shSCR or shIFI16-A and co- culture with either donor-matched mCherry- CD4 ⁺ T-cells or tonsillar HLAC spinoculated with an HIV-1 -GFP reporter virus. Cells were co-cultured in the presence or absence of 100 nM efavirenz, or with uninfected cells. Data represent the average of three independent experiments from three different donors. Error bars indicate standard error of the mean, * p<0.05 (Student's t-test), n.s. = not significant, p>0.1. (C) Flow cytometry analysis of CD25 and CD69 expression after IL-2 reduction. (D) Flow cytometry analysis of mCherry ^"1" GFP ⁺ populations in shRNA-expressing spleen cells post-co-culture. Details are described in Example 4.

[0062] Figures 8A-B schematically depict primary flow cytometry data for VLP-Vpx mediated lentiviral shRNA knockdown of IFI16. (A) Flow cytometry analysis showing live cell gates. (B) Flow cytometry analysis of mCherry ^"1" CD4 ⁺ T cells and mCherry ^" CD4 ⁺ T cells from HLAC spinoculated with VLP-Vpx pseudotyped with gpl 60 Env followed by spinoculation with shRNA lenti viruses pseudotyped with gpl60 Env and packaged with shScramble, sh!F116-A, or shIFI16-B. Cells were co-cultured with 293Ts either

untransfected or transfected with HIV-1 (NL4-3) in the presence or absence of the NNRTI efavirenz. Cells were analyzed 48 hours post-co-culture. All flow cytometry data are representative of three independent experiments from three different donors. Quantitation of these representative flow plots, including standard errors of the mean, and statistical analyses are provided in Figure 9B. Details are described in Example 5.

[0063] Figures 9A-F schematically depict that shRNA knockdown of IF116 rescues HIV- 1-induced tonsillar CD4 T-cell depletion. (A) Western blot analysis of IFI16 and beta-actin expression in mCherry ^4" tonsil CD4 T cells receiving shScramble, shIFI16-A or shIFI16-B.

(B) Quantitation of flow cytometry of HLAC infected with VLP-Vpx, followed by shScramble, shIFI16-A, B lentiviruses pseudotyped with HIV gp l 60 Env then co-cultured with 293T cells producing HIV-1. ** p<0.01 (Student's t-test), n.s. = not significant, p>0.1.

(C) Western blot analysis of shIFI16-C knockdown. (D) Quantitation of flow cytometry results as in (B). *** pO.001. (E) Quantitation of mCherry ⁺ gate of HLAC treated as in (B) with single round HIV-ΙΔΕην pseudotyped with gpl60 envelope or HIV-1 D116N integrase mutant. ** pO.01, * p<0.05. (F) Flow cytometry analysis of FLlCA-660 Caspase-1 and ΙΕΝβ intracellular staining in mCherry ^1" cells, histograms are representative of results obtained with two donors. Details as described in Example 5.

[0064] Figures 10A-H schematically depict that VLP-Vpx-facilitated shRNA knockdown of candidate DNA sensors, other than IFI16, do not rescue cells from depletion following abortive HIV-1 infection. (A) Western blot analysis of AIM2, STING, and HSP90 in shRNA expressing mCherry ^"1" THP-1 cells. (B) Quantitation of flow cytometry results for HLAC infected with shScramble, shAIM2, or shSTING. n.s. = not significant, p>0.1 (Student's t- test). (C) Western blot analysis of IFIX in mCherry ⁺ SupTl cells. (D) Quantitation of flow cytometry analysis as in (B) of shScramble and shIFIX. (E) Western blot analysis of DNPK- 1 in shRNA expressing mCherry ^"1" Jurkat T-cells. (F) Flow cytometry analysis as in (B) with shDNPK-1. (G) CFSE labeled HLAC were pre-treated with DMSO alone in uninfected and no drug conditions, 10 or 20 μΜ Nu7026 or 1 or 2 μΜ Nu7441 or 250 nM AMD3100.

CFSE ⁺ cells were co-cultured with donor-matched HLAC productively infected with HIV-1 and analyzed 3 days post co-culture. Quantified data represent the average of three independent experiments from three different donors. Error bars represent the standard errors of the mean. (H) shRNA target sequence and oligonucleotide sequences used in (A) through (F). (I) Summary model. Details are described in Example 6.

DETAILED DESCRIPTION OF THE INVENTION

I. DEFINITIONS

[0065] Throughout the present specification and the accompanying claims the words "comprise" and "include" and variations thereof such as "comprises", "comprising",

"includes" and "including" are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other elements or integers not specifically recited, where the context allows. No language in the specification should be construed as indicating any non-claimed element essential to the practice of the invention. As used herein, the term "consisting of is intended to mean including and limited to whatever follows the phrase "consisting of . Thus the phrase "consisting of indicates that the listed elements are required or mandatory and that no other elements may be present. The term "consisting essentially of means that the composition, method or structure may include additional ingredients, steps and/or parts, but only if the additional ingredients, steps and/or parts do not materially alter the basic and novel characteristics of the claimed composition, method or structure

[0066] The terms "a" and "an" and "the" and similar referents used in the context of describing the invention (especially in the context of the following claims) are to be construed to cover both the singular and the plural, unless otherwise indicated herein or clearly contradicted by context.

[0067] Recitation of ranges of values herein are merely intended to serve as a shorthand method of referring individually to each separate value falling within the range, unless otherwise indicated herein, each individual value is incorporated into the specification as if it were individually recited herein. Ranges may be expressed herein as from "about" (or "approximate") one particular value, and/or to "about" (or "approximate") another particular value. When such a range is expressed, another embodiment includes from the one particular value and/or to the other particular value. Similarly, when values are expressed as approximations, by use of the antecedent "about" or "approximate" it will be understood that the particular value forms another embodiment. It will be further understood that the endpoints of each of the ranges are significant both in relation to the other endpoint, and independently of the other endpoint. It is also understood that there are a number of values disclosed herein, and that each value is also herein disclosed as "about" that particular value in addition to the value itself. For example, if the value " 10" is disclosed, then "about 10" is also disclosed. It is also understood that when a value is disclosed that is "less than or equal to the value" or "greater than or equal to the value" possible ranges between these values are also disclosed, as appropriately understood by the skilled artisan. For example, if the value " 10" is disclosed the "less than or equal to 10 "as well as "greater than or equal to 10" is also disclosed.

[0068] All methods described herein can be performed in any suitable order unless otherwise indicated herein or otherwise clearly contradicted by context. Further, all methods described herein and having more than one step can be performed by more than one person or entity. Thus, a person or an entity can perform step (a) of a method, another person or another entity can perform step (b) of the method, and a yet another person or a yet another entity can perform step (c) of the method, etc. The use of any and all examples, or exemplary language (e.g. "such as") provided herein is intended merely to better illuminate the invention and does not pose a limitation on the scope of the invention otherwise claimed.

[0069] Units, prefixes, and symbols are denoted in their Systeme International de Unites (SI) accepted form. Unless otherwise indicated, nucleic acids are written left to right in 5' to 3' orientation; amino acid sequences are written left to right in amino to carboxy orientation.

[0070] Groupings of alternative elements or embodiments of the invention disclosed herein are not to be construed as limitations. Each group member may be referred to and claimed individually or in any combination with other members of the group or other elements found herein. It is anticipated that one or more members of a group may be included in, or deleted from, a group for reasons of convenience and/or patentability. When any such inclusion or deletion occurs, the specification is herein deemed to contain the group as modified thus fulfilling the written description of all Markush groups used in the appended claims.

[0071] The headings used herein are for organizational purposes only and are not meant to be used to limit the scope of the description or the claims, which can be had by reference to the specification as a whole. Accordingly, the terms defined immediately below are more fully defined by reference to the specification in its entirety.

[0072] Illustrations are for the purpose of describing a preferred embodiment of the invention and are not intended to limit the invention thereto.

[0073] Unless defined otherwise, all technical and scientific terms used herein have the meaning commonly understood by a person skilled in the art to which this invention belongs. The following references provide one of skill with a general definition of many of the terms used in this invention: Singleton et al, Dictionary of Microbiology and Molecular Biology (2nd ed. 1994); The Cambridge Dictionary of Science and Technology (Walker ed., 1988); The Glossary of Genetics, 5th Ed., R. Rieger et al. (eds.), Springer Verlag (1991); and Hale & Marham, The Harper Collins Dictionary of Biology (1991). As used herein, the following terms have the meanings ascribed to them unless specified otherwise.

[0074] As used herein, the term "about" refers to a range of values of plus or minus 10% of a specified value. For example, the phrase "about 200" includes plus or minus 10% of 200, or from 180 to 220, unless clearly contradicted by context.

[0075] As used herein, the term "administering" means the actual physical introduction of a composition into or onto (as appropriate) a host or cell. Any and all methods of introducing the composition into the host or cell are contemplated according to the invention; the method is not dependent on any particular means of introduction and is not to be so construed.

Means of introduction are well-known to those skilled in the art, and also are exemplified herein.

[0076] As used herein, the term "administration in combination," "combination therapy" or similar grammatical equivalents refers to both simultaneous and sequential administration of compounds. One or more IFI16 antagonists can be delivered or administered at the same site or a different site and can be administered at the same time or after a delay, preferably not exceeding 48 hours. Concurrent or combined administration, as used herein, means that one or more IFI16 antagonists are administered to a subject either (a) simultaneously, or (b) at different times during the course of a common treatment schedule. In the latter case, the compounds are administered sufficiently close in time to achieve the intended effect.

Concurrent or combined administration, as used herein, also means that one or more IFI16 antagonists can be administered in combination with another compound useful for the treatment of HIV- 1 infection and AIDS. [0077] As used herein, the terms "agent," "test agent" or "compound," used

interchangeably herein, mean any chemical compound, for example, a macromolecule or a small molecule disclosed herein. The agent can have a formula weight of less than about 200,000 grams per mole, less than about 150,000 grams per mole, less than about 100,000 grams per mole, less than about 75,000 grams per mole, less than about 50,000 grams per mole, less than about 25,000 grams per mole, less than about 10,000 grams per mole, less than about 5,000 grams per mole, less than about 1,000 grams per mole, or less than about 500 grams per mole. The agent can be naturally occurring (e.g., a herb or a nature product), synthetic, or both. When naturally occurring, an agent, according to the present invention, is being used in combination with a non-naturally occurring composition or another unrelated naturally occurring composition, thus, generating a non-naturally occurring composition. Alternatively, a naturally occurring agent is being used in a method that does not occur in nature. Examples of macromolecules are proteins, protein complexes, and glycoproteins, nucleic acids, e.g., DNA, RNA and PNA (peptide nucleic acid). Examples of small molecules are peptides, peptidomimetics (e.g., peptoids), amino acids, amino acid analogs, polynucleotides, polynucleotide analogs, nucleotides, nucleotide analogs, organic or inorganic compounds e.g., heteroorganic or organometallic compounds. An agent can be the only substance used by the method described herein. Alternatively, a collection of agents can be used either consecutively or concurrently in methods described herein. Alternatively, an agent can be a small molecule attached covalently or non-covalently to a macromolecule.

[0078] As used herein, the terms "altering the immune response" or "regulating the immune response" or grammatical equivalents thereof, refer to any alteration in any cell type involved in the immune response. The definition is meant to include an increase or decrease in the number of cells, such as CD4 T-cells, an increase or decrease in the activity of the cells, such as CD4 T-cells, or any other changes that can occur within the immune system. The cells may be, but are not limited to, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, or neutrophils. The definition encompasses both a stimulation or enhancement of the immune system to develop a sufficiently potent response to an IFI16 antagonist as described herein, as well as a suppression of the immune system to avoid a destructive response to a desirable target. In the case of stimulation of the immune system, the definition includes future protection against subsequent HIV-1 infection. [0079] As used herein, the terms "amount sufficient", an "effective amount" or

"therapeutically effective amount" or grammatical equivalents thereof refer to an amount of a given compound to ameliorate, or in some manner, reduce a symptom or stop or reverse progression of a disease, disorder, or condition. In some embodiments, the disease, disorder or condition is caused by an IFI16 polypeptide activity and it is desirable to inhibit such activity. In some embodiments, the desired activity of interest is diminishing, abolishing or interfering with the physiological action of an IFI16 polypeptide, which provides either a subjective relief of a symptom(s) or an objectively identifiable improvement as noted by a clinician or other qualified observer. In some embodiments, the desired activity of interest is decreasing the amount or activity of biologically active IL-Ι β. The dosing range varies with the compound used, the route of administration and the potency of the particular compound. Amelioration of a symptom(s) of a particular condition by administration of a pharmaceutical composition described herein refers to any lessening, whether permanent or temporary, lasting or transient that can be associated with the administration of the pharmaceutical composition. An "effective amount" can be administered in vivo and in vitro.

[0080] As used herein, the term "animal" refers to a multicellular organism of the kingdom Animalia, more preferably, to a mammal, more preferably to a primate and most preferably, to a human.

[0081] As used herein, the term "animal model" refers to a non-human animal that faithfully mimics a human disease and in which potential therapeutic compositions or potentially harmful compositions may be evaluated for their effect on the disease. A preferred animal model is one that mimics the progression of an HIV-1 infection. Such animal models are known in the art, e.g., humanized mouse models of HIV-1 infection (Denton and Garcia, 2013, AIDS Rev, 13(3): 135- 148), incorporated herewith by reference in its entirety for all purposes.

[0082] As used herein, the terms "antagonist" or "inhibitor" (used interchangeably herein) mean a chemical substance that diminishes, abolishes or interferes with the physiological action of a polypeptide. The antagonist may be, for example, a chemical antagonist, a pharmacokinetic antagonist, a non-competitive antagonist, or a physiological antagonist, such as a biomolecule, e.g., a polypeptide, a peptide antagonist or a non-peptide antagonist. A preferred antagonist diminishes, abolishes or interferes with a physiological action of an IFI16 polypeptide or an IFI16 activity. Specifically, an antagonist may act at the level of the interaction between a first polypeptide, e.g., an IFI16 polypeptide and a second polypeptide, for example, a binding partner, such as an ASC or caspase-1 polypeptide. The antagonist, for example, may competitively or non-competitively (e.g., allosterically) inhibit binding of the first polypeptide to the second polypeptide. A "pharmacokinetic antagonist" effectively reduces the concentration of an active drug at its site of action, e.g., by increasing the rate of metabolic degradation of the first polypeptide. A "competitive antagonist" is a molecule which binds directly to the first polypeptide in a manner that sterically interferes with the interaction of the first polypeptide with the second polypeptide. Non-competitive antagonism describes a situation where the antagonist does not compete directly with the binding, but instead blocks a point in the signal transduction pathway subsequent to the binding of the first polypeptide to the second polypeptide. Physiological antagonism loosely describes the interaction of two substances whose opposing actions in the body tend to cancel each other out. An antagonist can also be a substance that diminishes or abolishes expression of a first polypeptide. Thus, an IFI16 antagonist can be, for example, a substance that diminishes or abolishes: (i) the expression of the gene encoding IFI16, (ii) the translation of IFI16 mRNA, (iii) the post-translational modification of IFI16, or (iv) the interaction of IFI16 with other polypeptides in the formation of a multi-protein complex.

[0083] As used herein, the term "antibody" refers to an immunoglobulin molecule immunologically reactive with a particular antigen, and includes both polyclonal and monoclonal antibodies. The term also includes genetically engineered forms such as chimeric antibodies (e.g., humanized murine antibodies), fully humanized antibodies, and heteroconjugate antibodies (e.g., bispecific antibodies). The term "antibody" also includes antigen binding forms of antibodies, including fragments with antigen-binding capability (e.g., Fab', F(ab') ₂ , Fab, Fv and rlgG. See also, Pierce Catalog and Handbook, 1994-1995 (Pierce Chemical Co., Rockford, IL). See also, e.g., Kuby, J., Immunology, 3rd Ed., W.H. Freeman & Co., New York (1998), The term also refers to recombinant single chain Fv fragments (scFv). The term antibody also includes bivalent or bispecific molecules, diabodies, triabodies, and tetrabodies. Bivalent and bispecific molecules are described in, e.g., Kostelny et al. (1992) J Immunol 148: 1547, Pack and Pluckthun (1992) Biochemistry 31 : 1579, Gruber et al. (1994) J Immunol 5368, Zhu et al, (1997) Protein S 6:781, Hu et al. (1996) Cancer Res 56:3055, Adams et al. (1993) Cancer Res 53:4026, and McCartney et al. (1995) Protein Eng 8:301.

[0084] As used herein, the term "antisense-oligonucleotides" encompasses both nucleotides that are entirely complementary to a target sequence and those having a mismatch of one or more nucleotides, so long as the antisense-oligonucleotides can specifically hybridize to the target sequence. For example, antisense-oligonucleotides of the present invention include polynucleotides that have a homology (also referred to as sequence identity) of at least 70% or higher, preferably 80% or higher, more preferably 90% or higher, even more preferably 95% or higher over a span of at least 15 continuous nucleotides up to the full length sequence of any of the nucleotide sequences of an IFI16 gene. Algorithms known in the art can be used to determine the homology. Furthermore, derivatives or modified products of the antisense-oligonucleotides can also be used as antisense- oligonucleotides in the present invention. Examples of such modified products include lower alkyl phosphonate modifications such as methyl-phosphonate-type or ethyl-phosphonate- type, phosphorothioate modifications and phosphoroamidate modifications.

[0085] As used herein, the term "ASC" refers to apoptosis-associated speck-like protein containing CARD (also known as caspase recruitment domain-containing protein 5, PYD and CARD domain-containing protein, and target of methylation-induced silencing 1) and includes nucleic acids, polypeptides and polymorphic variants, alleles, mutants, and interspecies homologues thereof and as further described herein. Full-length ASC

polypeptides comprise an N-terminal PYRIN homology domain (PYD) and a caspase recruitment domain (CARD). Exemplary ASC polypeptide sequences can be found, e.g., at GenBank, for example, human ASC (GenBank accession Nos. Q9ULZ3, BAA87339);

human ASC isoform a (GenBank accession No. NP_037390.2); human ASC isoform b (GenBank accession No. NP_660183.1); rat ASC (GenBank accession Nos. BAC43754.1, NP_758825, 1); mouse ASC (GenBank accession No. NP_075747) and bovine ASC

(GenBank accession No. NP_777155.1). Exemplary ASC nucleic acid sequences can be found, e.g., at GenBank, for example, human ASC (GenBank accession No. AB023416.2); mouse ASC (GenBank accession Nos. AB059327.1, AB032249.1), and bovine ASC

(GenBank accession No. AB050006.1). An ASC (1) has an amino acid sequence that has greater than about 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of at least about 25, 50, 75, 100, 125, 150, 175, 190, 193, 195 amino acids, to a sequence as deposited under

GenBank Accession Nos., e.g., Q9ULZ3, BAA87339, NP_037390.2, NP_660183.1, BAC43754.1, NPJ758825.1, AB059327.1 , AB032249.1, or AB050006.1 ; (2) bind to antibodies, e.g., monoclonal and/or polyclonal antibodies, raised against an immunogen comprising an amino acid sequence as deposited under GenBank Accession Nos., e.g., Q9ULZ3, BAA87339, NP_037390.2, NP_660183.1, BAC43754.1, NP_758825.1,

AB059327.1, AB032249.1, or AB050006.1, or conservatively modified variants thereof or a fragment thereof; (3) specifically hybridize under stringent hybridization conditions to a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., AB023416.2, AB059327.1, AB050006.1 or conservatively modified variants thereof; (4) have a nucleic acid sequence that has greater than about 90%, preferably greater than about 96%, 97%, 98%, 99%,, or higher nucleotide sequence identity, preferably over a region of at least about 30, 50, 100, 200, 300, 400, 500, 550, 580 or more nucleotides, to a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., AB023416.2, AB059327.1 , AB050006.1 ; (5) have at least 25, often 50, 75, 100, 125, 150, 175, 190, 193, 195 contiguous amino acid residues of a polypeptide the sequence of which is deposited under GenBank Accession Nos., e.g., Q9ULZ3, BAA87339, NP_037390.2, NP_660183.1 , BAC43754.1, NP_758825.1, AB059327.1, AB032249.1, or AB050006.1 ; and/or (6) have at least 25, often 50, 75, 100, 125, 150, 200, 250, 300, 350, 400, 500, 550, 600 or more contiguous nucleotides of a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., AB023416.2, AB059327.1 , AB050006.1. Preferred is a mammalian ASC. A preferred mammalian ASC is a human ASC. Also preferred is a simian ASC.

[0086] As used herein, the term "biologically active" when referring to an agent or compound is art-recognized and refers to a form of an agent or compound that allows for it, or a portion of the amount of agent or compound administered, to be absorbed by, incorporated into, or otherwise physiologically available to a cell, a subject or a patient to which/whom it is administered.

[0087] As used herein, the term "biological sample" means a sample of biological tissue or fluid that contains nucleic acids or polypeptides. Such samples are typically from humans, but include tissues and fluids isolated from non-human primates, or rodents, e.g., mice, and rats. Biological samples may also include sections of tissues such as surgical biopsy, fine needle aspiration biopsy and autopsy samples, frozen sections taken for histological purposes, blood, plasma, serum, sputum, stool, tears, mucus, hair, skin, etc. Biological samples also include explants and primary and/or transformed cell cultures derived from patient tissues. A "biological sample" also refers to a cell or population of cells or a quantity of tissue or fluid from an animal. Most often, the biological sample has been removed from an animal, but the term "biological sample" can also refer to cells or tissue analyzed in vivo, i.e., without removal from the animal. Typically, a "biological sample" will contain cells from the animal, but the term can also refer to non-cellular biological material, such as non-cellular fractions of blood, saliva, or urine, that can be used to measure expression level of a polynucleotide or polypeptide. Numerous types of biological samples can be used in the present invention, including, but not limited to, a tissue biopsy or a blood sample. As used herein, a "tissue biopsy" refers to an amount of tissue removed from an animal, preferably a mammal, more preferable a primate, and most preferably a human. A "biological sample" encompasses samples that have been manipulated in any way after their procurement, such as by treatment with reagents; washed; or enrichment for certain cell populations, such as CD4 ⁺ T lymphocytes, glial cells, macrophages, tumor cells, peripheral blood mononuclear cells (PBMC), and the like. The term "biological sample" encompasses a clinical sample, and also includes cells in culture, cell supernatants, tissue samples, organs, bone marrow, and the like. As used herein, "providing a biological sample" means to obtain a biological sample for use in a method described herein. Most often, this will be done by removing a sample of cells from a subject, but can also be accomplished by using previously isolated cells (e.g., isolated by another person, at another time, and/or for another purpose), or by performing the methods of the invention in vivo.

[0088] As used herein, if, for example, a biological sample is obtained from a patient having a disease, the terms "control" or "control sample," refer to a biological sample from a healthy patient or a biological sample from a patient not having the disease.

[0089] As used herein, the term "carrier" in the context of "pharmaceutically acceptable carrier" refers to an inert substance used as a diluent, adjuvant, excipient or vehicle with which a drug, medicament or vaccine is administered.

[0090] As used herein, the term "caspase-1 " refers to nucleic acids, polypeptides and polymorphic variants, alleles, mutants, and interspecies homologues thereof and as further described herein, that: (1) have an amino acid sequence that has greater than about 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of at least about 25, 50, 75, 100, 150, 200, 250, 300, 350, or more amino acids, to a sequence as deposited under GenBank Accession Nos., e.g., NP_150634, NP_001214, AAT72297, or NPJ50635; (2) bind to antibodies, e.g., monoclonal and/or polyclonal antibodies, raised against an immunogen comprising an amino acid sequence as deposited under GenBank Accession Nos., e.g., NP_150634, NP 001214, AAT72297, or NP 150635, or conservatively modified variants thereof or a fragment thereof; (3) modulate at least partially, indirectly or directly the production of bioactive IL- 1 β; (4) specifically hybridize under stringent hybridization conditions to a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., NM_033292, NM_001223, AY660536, or NM_033293, or conservatively modified variants thereof; (5) have a nucleic acid sequence that has greater than about 90%, preferably greater than about 96%, 97%, 98%, 99%, or higher nucleotide sequence identity, preferably over a region of at least about 30, 50, 100, 200, 500, 1000, 1 ,200 or more nucleotides, to a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., NM_033292, NM_001223, AY660536, or NM_033293; (6) have at least 25, often 50, 75, 100, 150, 200, 250, 300, 350, or more contiguous amino acid residues of a polypeptide the sequence of which is deposited under GenBank Accession Nos., e.g., NP_150634, NP_001214, AAT72297, or NP_150635; and/or (7) have at least 25, often 50, 75, 100, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1 ,000, 1 ,200, or more contiguous nucleotides of a nucleic acid sequence as deposited under GenBank Accession Nos., e.g., NM_033292, NM_001223, AY660536, or NM_033293. Preferred is a mammalian caspase-1. A preferred mammalian caspase-1 is a human caspase-1. Also preferred is a simian caspase-1. Throughout the present specification and the accompanying claims the words "comprise" and "include" and variations such as "comprises", "comprising", "includes" and "including" are to be interpreted inclusively. That is, these words are intended to convey the possible inclusion of other additives, elements, components, integers or steps not specifically recited, where the context allows.

[0091] As used herein, a "combinatorial chemical library" refers to a collection of diverse chemical compounds generated by either chemical synthesis or biological synthesis, by combining a number of chemical "building blocks" such as reagents. For example, a linear combinatorial chemical library such as a polypeptide library is formed by combining a set of chemical building blocks (amino acids) in every possible way for a given compound length (i.e., the number of amino acids in a polypeptide compound). Millions of chemical compounds can be synthesized through such combinatorial mixing of chemical building blocks.

[0092] As used herein, the term "contacting" refers to an instance of exposure of at least one substance to another substance. For example, contacting can include contacting a substance, such as a cell or a polypeptide to an agent. A cell can be contacted with the agent, for example, by adding the agent to the culture medium (by continuous infusion, by bolus delivery, or by changing the medium to a medium that contains the agent) or by adding the agent to the extracellular fluid in vivo (by local delivery, systemic delivery, intravenous injection, bolus delivery, or continuous infusion). The duration of contact with a cell or group of cells is determined by the time the agent is present at physiologically effective (biologically active) levels or at presumed physiologically effective (biologically active) levels in the medium or extracellular fluid bathing the cell. In the present invention, for example, a virally infected cell (e.g. an abortively or productively HIV-1 infected cell) or a cell at risk for viral infection (e.g. , before, at about the same time, or shortly after an abortive or productive HIV-1 infection of the cell) is contacted with an agent. The term "contacting" is used herein interchangeably with the following: combined with, added to, mixed with, passed over, incubated with, flowed over, placed in direct physical association with another substance, etc.

[0093] As used herein, the term "decreased expression" refers to the level of a gene expression product that is lower and/or the activity of the gene expression product is lowered (decreased) relative to a control. Preferably, the decrease is at least about 20%, more preferably, the decrease is at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% and most preferably, the decrease is 100%, relative to a control. A preferred gene expression product to be decreased is IFI16. Another preferred gene expression product to be decreased is interleukin- 1 beta (IL-Ι β). Another preferred gene expression product to be decreased is caspase-1.

[0094] As used herein, the terms "derivative" or "derivatized" or "modified" refer to a compound that is produced from another compound of similar structure by the replacement of substitution of one atom, molecule or group by another. For example, a hydrogen atom of a compound may be substituted by alkyl, acyl, amino, hydroxyl, halo, haloalkyl, etc. to produce a derivative of that compound or a derivatized compound. The derivative of a compound preferably retains at least one function of the compound from which it is produced, such as diminishing, abolishing or interfering with the physiological action of an IFI16 polypeptide. The activity of derivative compounds is tested as described herein.

[0095] Synonyms of the term, "determining" are contemplated within the scope of the present invention and include, but are not limited to, detecting, measuring, assaying, or testing for the presence, absence, amount or concentration of a molecule, such as a protein (e.g., an IFI16, an ASC, or a caspase-1 protein), a nucleic acid (e.g., a nucleic acid comprising IFI 16, ASC or caspase-1 sequences, sense or anti-sense), a label, an agent and the like. The term refers to both qualitative and quantitative determinations. [0096] As used herein, by "determining the effect," "determining the functional effect" or grammatical equivalents thereof is meant assaying for a compound that increases or decreases a parameter that is indirectly or directly under the influence of an IFI16 polypeptide, e.g., physiological, functional, enzymatic, physical and chemical effects. Such functional effects can be measured by any means known to those skilled in the art, e.g., changes in

spectroscopic characteristics (e.g., fluorescence, absorbance, refractive index), hydrodynamic (e.g., shape), chromatographic, or solubility properties for the polypeptide, measuring inducible markers or activation and/or activity of the IFI16 polypeptide; measuring binding activity, e.g., binding of a compound to the IFI16 polypeptide, binding of an IFI16 polypeptide to single-stranded and/or double-stranded nucleic acids, such as DNA or RNA, assembly of the IFI16 polypeptide into an inflammasome complex, binding of an IFI16 polypeptide to an ASC polypeptide, binding of an IFI16 polypeptide to a caspase-1 polypeptide, measuring cellular proliferation, measuring apoptosis, pyroptosis, caspase-1 activity, or the like. The functional effects can be evaluated by many means known to those skilled in the art, e.g., microscopy for quantitative or qualitative measures of alterations in morphological features, measurement of changes in IFI16 RNA or protein levels, measurement of RNA or protein stability, identification of downstream or reporter gene expression (CAT, luciferase, β-gal, GFP and the like), e.g., via chemiluminescence, fluorescence, colorimetric reactions, antibody binding, inducible markers, and ligand binding assays. A physiological effect includes, but is not limited to, e.g., killing cells, killing a tissue, causing a cell to die by apoptosis, pyroptosis, viral infection, or other mechanism, causing a tissue to die by apoptosis, pyroptosis, viral infection, or other mechanism, causing a cell to stop proliferating, causing a tissue to stop proliferating, causing a cell to lose viability, and causing a tissue to lose viability. "Functional effects" include in vitro, in vivo, and ex vivo activities.

[0097] As used herein, the term "different" means not the same, not of the same identity.

[0098] As used herein, "disorder," "disease" or "pathological condition" are used inclusively and refer to any deviation from the normal structure or function of any part, organ or system of the body (or any combination thereof). A specific disease is manifested by characteristic symptoms and signs, including biological, chemical and physical changes, and is often associated with a variety of other factors including, but not limited to, demographic, environmental, employment, genetic and medically historical factors. Certain characteristic signs, symptoms, and related factors can be quantitated through a variety of methods to yield important diagnostic information. Disease specifically includes HIV-1 infection, AIDS, and pathological conditions associated with or developing in a subject as a consequence of HIV-1 infection and/or AIDS, such as pyroptosis.

[0099] As used herein, the terms "effective amount," "effective dose," "sufficient amount," "amount effective to," "therapeutically effective amount" or grammatical equivalents thereof mean a dosage sufficient to produce a desired result, to ameliorate, or in some manner, reduce a symptom or stop or reverse progression of a disorder, disease or pathological condition. In some embodiments, the desired result is a decrease in an IFI16 activity. Amelioration of a symptom of a particular condition by administration of a pharmaceutical composition described herein refers to any lessening, whether permanent or temporary, lasting or transient that can be associated with the administration of the pharmaceutical composition. An "effective amount" can be administered in vivo and in vitro.

[00100] As used herein, the term "ex vivo" means outside the body of the organism from which a cell or cells is obtained or from which a cell line is isolated.

[00101] As used herein, the term "full length" in the context of a polypeptide or a nucleic acid refers to a polypeptide or polynucleotide sequence, or a variant thereof, that contains all of the elements normally contained in one or more naturally occurring polynucleotide or polypeptide sequences. The "full length" may be prior to, or after, various stages of post- translational processing or splicing, including alternative splicing and signal peptide cleavage. In some embodiments, a "full-length" polypeptide or "full-length" are non- naturally occurring polypeptides or nucleic acids.

[00102] As used herein, the term "fusion protein" refers to a polypeptide that comprises two amino acid sequences, which when covalently joined together, form a non-naturally occurring polypeptide. In some embodiments, a fusion protein is an IFI16 fusion protein and comprises (i) an amino acid sequence selected from the group consisting of an amino acid sequence of an IFI16 polypeptide, an amino acid sequence of an IFI16 fragment, an amino acid sequence of an IFI16 subdomain polypeptide, an amino acid sequence of an IFI16 related polypeptide and an amino acid sequence of a fragment of an IFI16 related polypeptide and (ii) an amino acid sequence of a heterologous polypeptide (i.e., a non-IFI16 polypeptide, a non-IFI16 fragment or a non-IFI16 related polypeptide).

[00103] As used herein, the terms "genetically engineered", "genetically modified" or grammatical equivalents thereof refer to human manipulation intended to introduce a genetic change in a nucleic acid molecule or a polypeptide that, absent the human manipulation, would not occur in nature. In the context of a cell, the terms refer to a permanent or transient genetic change induced in the cell following introduction of new DNA (i.e., DNA exogenous to the cell) into the cell. Genetic change can be accomplished either by incorporation of the new DNA into the genome of the cell, or by transient or stable maintenance of the new DNA as an episomal element. Where the cell is a mammalian cell, a permanent genetic change is generally achieved by introduction of the DNA into the genome of the cell.

[00104] As used herein, "HAART" refers to a treatment for HIV-1 infection, which is a cocktail of anti-viral drugs known as Highly Active Anti-Retroviral Therapy. HAART includes two reverse transcriptase inhibitors and a protease inhibitor. HAART reduces the viral load in many patients to levels below the current limits of detection, but the rapid mutation rate of this virus limits the efficacy of this therapy (Perrin and Telenti, 1998, Science 280: 1871 -1873).

[00105] The term "heterologous" when used with reference to portions of a nucleic acid indicates that the nucleic acid comprises two or more subsequences that are not found in the same relationship to each other in nature. For instance, a nucleic acid is typically recombinantly produced, having two or more sequences from unrelated genes arranged to make a new functional nucleic acid, e.g., a promoter from one source and a coding region from another source. Similarly, a heterologous protein indicates that the protein comprises two or more subsequences that are not found in the same relationship to each other in nature (e.g., a fusion protein).

[00106] As used herein, "HIV- 1 " refers to the Human Immunodeficiency Virus type-1. It is recognized that the HIV-1 virus is an example of a hyper-mutable retrovirus, having many subtypes, each of which is included in the term "HIV-1.".

[00107] As used herein, the term "HIV-1 infection" refers to indications of the presence of the Human Immunodeficiency Virus type-1 (HIV-1) in an individual and includes asymptomatic seropositivity, aids-related complex (arc), and acquired immunodeficiency syndrome (AIDS). "HIV-1 infection" includes abortive and productive HIV-1 infection.

[00108] As used herein, the term "HIV-1 viral load" refers to the number of HIV-1 viral particles in a sample of blood plasma. HIV-1 viral load is increasingly employed as a surrogate marker for disease progression. It is measured by PCR and bDNA tests and is expressed in number of HIV-1 copies or equivalents per milliliter. In some embodiments of the present invention, methods comprise the step of determining an HIV-1 viral load in a subject. [00109] A "host cell" is a naturally occurring cell or a transformed cell that contains an expression vector and supports the replication or expression of a nucleic acid comprised by the expression vector. Host cells may be cultured cells, explants, cells in vivo, and the like. Host cells may be prokaryotic cells such as E. coli, or eukaryotic cells such as yeast, insect cells, amphibian cells, or mammalian cells such as CHO, 293, 3T3, HeLa, T-cells, and the like (see, e.g., the American Type Culture Collection catalog). A host cell outside of its natural environment, may be referred to herein simply as "cell."

[00110] For the purposes of this invention, the terms "hybridize" or "specifically hybridize" are used to refer to the ability of two nucleic acid molecules to hybridize under "stringent hybridization conditions." The phrase "stringent hybridization conditions" refers to conditions under which a nucleic acid molecule will hybridize to its target sequence, typically in a complex mixture of nucleic acids, but not detectably to other sequences. Stringent conditions are sequence-dependent and will be different in different circumstances. Longer sequences hybridize specifically at higher temperatures. An extensive guide to the hybridization of nucleic acids is found in Tijssen, Techniques in Biochemistry and Molecular Biology—Hybridization with Nucleic Probes, "Overview of principles of hybridization and the strategy of nucleic acid assays" (1993). Generally, stringent conditions are selected to be about 5-10°C lower than the thermal melting point (T _m ) for the specific sequence at a defined ionic strength pH. The T _m is the temperature (under defined ionic strength, pH, and nucleic acid concentration) at which 50% of the probes complementary to the target hybridize to the target sequence at equilibrium (as the target sequences are present in excess, at T _m , 50% of the probes are occupied at equilibrium). Stringent conditions may also be achieved with the addition of destabilizing agents such as formamide. For selective or specific hybridization, a positive signal is at least two times background, preferably at least 10 times background hybridization. Exemplary stringent hybridization conditions can be as follows: 50% formamide, 5xSSC, and 1% SDS, incubating at 42°C, or, 5xSSC, 1 % SDS, incubating at 65°C, with wash in 0.2x SC, and 0.1% SDS at 50°C. Antisense-oligonucleotides, such as siRNAs, described herein, and derivatives thereof act on cells producing a particular protein product, e.g., a protein encoded by an IF! 16 gene, by binding to the DNA or mRNA encoding the IFI16 protein, inhibiting transcription or translation thereof, promoting the degradation of the mRNAs and inhibiting the expression of the IFI16 protein, thereby resulting in the inhibition of an 1FI16 protein activity. [00111] As used herein, the term "IFI16" refers to interferon-inducible protein 16 (also known as gamma-interferon-inducible protein 16, interferon-inducible myeloid

differentiation transcriptional activator) and to nucleic acids, polypeptides and polymorphic variants, alleles, isoforms (e.g., those generated by alternative splicing), mutants, and interspecies homologues thereof and as further described herein. Full-length IFI 16 polypeptides comprise an N-terminal PYRIN homology domain (PYD) and two ΗΓΝ domains. Exemplary IFI 16 polypeptide sequences can be found, e.g., at GenBank, for example, human IFI16 (GenBank accession Nos. Q16666, AAB32519, AAH17059); human IFI 16 isoform l/isoform A (GenBank accession No. NP_001 193496); human IFI16 isoform 2/isoform B (GenBank accession No. NP 005522); human IFI 16 isoform XI (GenBank accession Nos. XP 005245184, XP_005245184.1), human IFI 16 isoform X2 (GenBank accession No. XP_00671353.1); human IFI16 isoform CRA_f (GenBank accession No. EAW52803.1); human IFI16 isoform CRA e (GenBank accession No. EAW52802.1 );

human IFI16 isoform CRA_d (GenBank accession No. EAW52801.1); human IFI16 isoform CRA_c (GenBank accession No. EAW52799.1); human IFI16 isoform CRA b (GenBank accession No. EAW52798.1); human IFI16 isoform CRA_a (GenBank accession No.

EAW52797.1); mouse IFI16 isoforms (GenBank accession Nos. CAJ18559.1,

XP_006536965.1, XP_006536964.1, XP 006536963) and bovine IFI16 (GenBank accession Nos. XP_002685923.1, XP 8690212.2). Exemplary IFI16 nucleic acid sequences can be found, e.g., at GenBank, for example, human IFI16 (GenBank accession Nos. BC017059.1, NM 001206567.1, NM 00553 1.2, XM_00671 1290.1, XM_005245127.2); chimpanzee IFI16 (GenBank accession Nos. XM_009435204.1, XM_009435 199, XM_00943 194.1,

XM 001 170378.3), and bovine IFI16 (GenBank accession No. XM 863928.2). An IFI16: (1) comprises an amino acid sequence that has greater than about 85%, 90%, preferably 91%, 92%, 93%, 94%, 95%o, 96%, 97%, 98% or 99% or greater amino acid sequence identity, preferably over a region of at least about 25, 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700. 750, 780 or more amino acids, to a mammalian IFI16, i.e., to a sequence as deposited under GenBank Accession Nos. e.g., Q 16666, AAB32519,

AAH17059, NP_001 193496, NP_005522, XP_005245184, XP_005245184.1,

XP_00671353.1 , No. EAW52803.1, EAW52802.1, EAW52801.1, EAW52799.1 ,

EAW52798.1, EAW52797.1, CAJ18559.1, XP_006536965.1, XPJ)06536964.1,

XP 006536963, or XP_002685923.1, XP_8690212.2; (2) binds to antibodies, e.g., monoclonal and/or polyclonal antibodies, raised against an immunogen comprising an amino acid sequence of a mammalian IFI16, i.e., to a sequence as deposited under GenBank Accession Nos. e.g., Q16666, AAB32519, AAH17059, NP_001 193496, NP_005522, XP 005245184, XP_005245184.1, XP_00671353.1, No. EAW52803.1, EAW52802.1, EAW52801.1, EAW52799.1, EAW52798.1, EAW52797.1, CAJ 18559.1 , XP_006536965.1 , XP_006536964.1, XP_006536963, or XP_002685923.1, XPJ690212.2, or conservatively modified variants thereof or a fragment thereof; (3) has at least one IFI16 activity as defined herein; (4) specifically hybridizes under stringent hybridization conditions to a nucleic acid sequence of a mammalian IFI16, i.e., to a sequence as deposited under GenBank Accession Nos. e.g., BC017059.1, NM_001206567.1, NM_005531.2, XM_00671 1290,1,

XM_005245127.2, XM 009435204.1, XM_009435199, XM 009435194.1 ,

XM_001 170378.3, or XM_863928.2 or conservatively modified variants thereof; (5) comprises a nucleic acid sequence that has greater than about 90%, preferably greater than about 96%, 97%, 98%, 99%, or higher nucleotide sequence identity, preferably over a region of at least about 100, 200, 500, 1000, 1 ,200, 1,500, 2,000, 2,500 or more nucleotides, to a nucleic acid sequences of a mammalian IFI16, i.e., to a sequence as deposited under GenBank Accession Nos. e.g., BC017059.1, NM_001206567.1, NM_005531 .2,

XM_006711290.1 , XM_005245127.2, XM_009435204.1, XM_009435199,

XM_009435194.1, XM_001 170378.3, or XM_863928.2; (6) have at least 25, often 50, 75, 100, 150, 200, 250, 300, 350, 400, 450, 500, 550, 600, 650, 700, 725, 750, or more contiguous amino acid residues of a mammalian 1FI16 polypeptide , i.e., a sequence as deposited under GenBank Accession Nos. e.g., Q16666, AAB32519, AAH17059,

NP_001 193496, NP_005522, XP_005245184, XP_005245184.1, XP_00671353.1, No. EAW52803.1 , EAW52802.1, EAW52801.1 , EAW52799.1 , EAW52798.1, EAW52797.1, CAJ18559.1 , XP_006536965.1, XP_006536964.1, XP 006536963, or XP 002685923.1, XP_8690212.2; and/or (7) have at least 25, often 50, 75, 100, 150, 200, 250, 300, 350, 400, 500, 600, 700, 800, 900, 1,000, 1,200, 1,500, 2,000, 2,500 or more contiguous nucleotides of a mammalian IFI16 nucleic acid sequences, i.e., of a sequence as deposited under GenBank Accession Nos. e.g., BC017059.1, NM_001206567.1, NM_005531.2, XM_00671 1290.1, XM_005245127.2, XM_009435204.1, XM_009435199, XM 009435194.1,

XM 001 170378.3, or XM_863928.2. Additional mammalian IFI16 nucleotide and polypeptide sequences are deposited with GenBank and can be conveniently located and retrieved by one of ordinary skill in the art. Preferred is a mammalian 1F116. A preferred mammalian IFT16 is a human IFI16. Also preferred is a simian IFI 6. [00112] As used herein, the term "IFI16 activity" refers to an activity caused directly or indirectly by an l 6 multi-protein complex (a multiprotein complex comprising an IFI16 polypeptide) or an IFI16 polypeptide. Non-limiting IFI16 activities include, for example, binding of an IFI16 polypeptide to double-stranded DNA, binding of an IFI16 polypeptide to single-stranded DNA, formation of an inflammasome complex, activating caspase-1 activity, signaling to interferon, translocating from a cell nucleus into the cytoplasm and vice versa; binding to an ASC polypeptide, binding to a caspase-1 polypeptide, binding to a STING polypeptide, activating gene transcription, and inducing type-I interferon production.

[00113] As used herein, the terms "IFI16 antagonist," "IFI16 inhibitor" or "inhibitor of IFI16 activity" refer to a compound that is capable of preventing or inhibiting, whether fully or partially, a level or an IFI16 activity, as measured by any suitable assay, such as those described and referenced herein. A "peptide IFI16 inhibitor" comprises at least one natural amino acid or at least one non-natural amino acid.

[00114] As used herein, an "IFI16 homolog" refers to a polypeptide that comprises an amino acid sequence similar to that of a naturally occurring IFI16 polypeptide, but does not necessarily possess a similar or identical function as a naturally occurring IFI16 polypeptide.

[00115] As used herein, an "IFI16 isoform" refers to a variant of an IFI16 polypeptide that is encoded by the same gene, but differs in its pi or MW, or both. Such isoforms can differ in their amino acid composition (e.g., as a result of alternative splicing or limited proteolysis) and in addition, or in the alternative, may arise from differential post-translational modification (e.g., glycosylation, acetylation or phosphorylation).

[00116] As used herein, an "IFI16 ortholog" refers to a non-human polypeptide that (i) comprises an amino acid sequence similar to that of human IFI16 and (ii) possesses a substantially similar or substantially identical function to that of human IFI16 as determined by an assay described herein.

[00117] As used herein, the term "immune response" means any physiological change resulting in activation and/or expansion of a "B" cell population with production of antibodies, and/or activation and/or expansion of a "T" cell population.

[00118] As used herein, the term "incomplete HIV-1 nucleic acid" refers to a not full- length HIV-1 nucleic acid. Full-length HIV-1 nucleic acids have about 9,700-9,800 nucleotides (single-stranded) or about 9,700-9,800 base pairs (double-stranded). Thus, an "incomplete HIV-1 nucleic acid" is an HIV-1 nucleic acid of less than about 9,000 nucleotides (single-stranded) or less than about 9,000 base pairs (double-stranded).

Incomplete HIV-1 nucleic acids in a cell can be the result of an abortive HIV-1 reverse transcription reaction.

[00119] As used herein, the terms "individual," "subject," "host," and "patient" (used interchangeably herein), refer to a mammal, including, but not limited to, humans and non- human mammals, such as simians. Preferred is a human. The terms include mammals that are susceptible to diseases, in particular to HIV-1 infection. A preferred subject is a human. As used herein, "individual," "subject," "host" or "patient" to be treated for a pathological condition, disorder, or disease by a subject method means either a human or non -human mammal in need of treatment for a pathological condition, disorder, or disease. The term "non-human mammal" includes non-human primates (particularly higher primates), sheep, dogs, rodents (e.g., mouse or rat), guinea pig, goat, pig, cat, rabbits, cow , etc. In some embodiments, the subject is a human. In other embodiments, the subject is an experimental animal or an animal suitable as a disease model.

[00120] As used herein, the terms " inhibition" or "inhibits" mean to reduce a level or an activity as compared to a control (e.g. an activity in the absence of such inhibition). It is understood that inhibition can mean a slight reduction in the level or activity to the complete ablation of all level or activity. An "inhibitor" can be anything that reduces a level or an activity. For example, inhibition of an IFI16 level or IFI16 activity by a compound can be determined by assaying the amount of IFI16 in the presence of the composition to the amount of IFI16 in the absence of the compound. In this example, if the amount of IFI16 is reduced in the presence of the compound as compared to the amount of TFI 16 in the absence of the compound, the composition can be said to inhibit an IFI16 level or an IFI16 activity.

Inhibition of an IFI16 level or an IFI16 activity is achieved when the level or activity value relative to a control is reduced by about 10%, preferably about 20%, preferably about 30%, preferably about 40%, preferably about 50%, preferably about 60%, preferably about 70%, preferably about 80%, or preferably about 90-100%. Likewise, inhibition of cell death is achieved when cell death relative to a control is reduced by about 10%, preferably about 20%, preferably about 30%, preferably about 40%, preferably about 50%, preferably about 60%, preferably about 70%, preferably about 80%, or preferably about 90-100%. Likewise, inhibition of pyroptosis is achieved when pyroptosis relative to a control is reduced by about 10%, preferably about 20%, preferably about 30%, preferably about 40%, preferably about 50%, preferably about 60%, preferably about 70%, preferably about 80%>, or preferably about 90-100%.

[00121] As used herein, the term "in vitro" means outside the body of an organism from which a cell or cells is/are obtained or from which a cell line is isolated.

[00122] As used herein, the term "in vivo" means within the body of an organism from which a cell or cells is obtained or from which a cell line is isolated.

[00123] As used herein, the terms "label" or "detectable moiety" refer to a composition detectable by spectroscopic, photochemical, biochemical, immunochemical, chemical, or other physical means. For example, useful labels include ³ H, ¹²⁵ 1, ³² P, ¹⁴ C, fluorescent dyes, electron-dense reagents, enzymes (e.g., as commonly used in an ELISA), biotin, digoxigenin, or haptens and proteins or other entities which can be made detectable. In some

embodiments, a radiolabel is incorporated into a nucleic acid or into a polypeptide, such as an IFI 16, an ASC, or a caspase- 1.

[00124] As used herein, "level of an mRNA" in a biological sample refers to the amount of an mRNA transcribed from a gene that is present in a cell or a biological sample. The mRNA generally encodes a functional protein, although mutations may be present that alter or eliminate the function of the encoded protein. A "level of mRNA" need not be quantified, but can simply be detected, e.g., a subjective, visual detection by a human, with or without comparison to a level from a control sample or a level expected of a control sample. A preferred mRNA is an IFI 16 mRNA, an ASC mRNA or a caspase- 1 mRNA.

[00125] As used herein, "level of a polypeptide" in a biological sample refers to the amount of a polypeptide translated from an mRNA that is present in a cell or biological sample. The polypeptide may or may not have protein activity. A "level of a polypeptide" need not be quantified, but can simply be detected, e.g., a subjective, visual detection by a human, with or without comparison to a level from a control sample or a level expected of a control sample. A preferred polypeptide is an IFI 16 polypeptide, an ASC polypeptide or a caspase- 1 polypeptide.

[00126] As used herein, "mammal" or "mammalian" means or relates to the class mammalia including, but not limited to the orders carnivore (e.g., dogs and cats), rodentia (e.g., mice, guinea pigs, and rats), and primates (e.g., humans, chimpanzees, and monkeys). [00127] As used herein, the term "mammalian cell" includes reference to a cell derived from a mammal including, but not limited to, human, rat, mouse, guinea pig, chimpanzee, or macaque. The mammalian cell may be cultured in vivo or in vitro.

[00128] As used herein, the term "multi-protein complex" refers to the binding and non- covalent attachment of two or more polypeptides to each other. A preferred multi-protein complex is an infiammasome complex. A functional inflammasome complex comprises an IF116 polypeptide, an ASC polypeptide and a caspase-1 polypeptide.

[00129] As used herein, a "naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule consisting of a nucleotide sequence that occurs in nature. For example, a naturally occurring nucleic acid molecule can encode a natural protein. In contrast, a "non- naturally-occurring" nucleic acid molecule refers to an RNA or DNA molecule consisting of or comprising a nucleotide sequence that, in its entirety, does not occur in nature. A non- naturally occurring nucleic acid is a man-made nucleic acid. An example of a non-naturally occurring nucleic acid is a recombinant nucleic acid. Another exemplary non-naturally occurring nucleic acid is a heterologous nucleic acid. In some embodiments of the present invention, a non-naturally occurring nucleic acid is a cDNA. A naturally occurring nucleic acid can be distinguished structurally from a non-naturally occurring nucleic acid. For example, a naturally occurring nucleic acid comprises histones and methylated nucleotides (e.g., 5-methylcytosine (5mC), 5-hydroxymethylcytosine (5hmC), 5-formylcytosine (5fC), and 5-carboxycytosine (5caC)). A non-naturally occurring nucleic acid does not comprise histones. In some embodiments, a non-naturally occurring nucleic acid does not comprise a methylated nucleotide.

[00130] As used herein, a "naturally-occurring" polypeptide refers to a polypeptide molecule consisting of an amino acid sequence and having posttranslational modifications that occur in nature. For example, a naturally occurring polypeptide can be encoded by a naturally occurring nucleic acid. In contrast, a "non-naturally-occurring" polypeptide molecule refers to polypeptide molecule consisting of or comprising an amino acid sequence that, in its entirety, does not occur in nature and or to a polypeptide molecule having a posttranslational modification that does not occur in nature. A non-naturally occurring polypeptide is a man-made polypeptide. An example of a non-naturally occurring polypeptide is a recombinant polypeptide. Another exemplary non-naturally occurring polypeptide is a heterologous polypeptide. In some embodiments, a non-naturally occurring polypeptide is biotinylated (e.g., acylation of a lysine residue with a biotin appendage), such as a biotinylated IFI16 polypeptide. In some embodiments, a non-naturally occurring polypeptide is pegylated, such as a pegylated IFI16 polypeptide. A naturally occurring polypeptide can be distinguished structurally from a non-naturally occurring polypeptide. For example, a naturally occurring polypeptide comprises a distinctive set of post- translational modifications, including the addition of functional groups, such as acetate, phosphate, various lipids and various carbohydrates. A non-naturally occurring polypeptide is distinguished from a naturally occurring polypeptide by having at least one structural difference, i.e., at least one different post-translational modification.

[00131] As used herein, the terms "nucleic acid" or "oligonucleotide" or "polynucleotide" or grammatical equivalents thereof, mean at least two nucleotides covalently linked together. Oligonucleotides are typically from about 5, 6, 7, 8, 9, 10, 12, 15, 25, 30, 40, 50 or more nucleotides in length, up to about 100 nucleotides in length. Nucleic acids and

polynucleotides are polymers of any length, including longer lengths, e.g., at least about 200, at least about 300, at least about 500, at least about 1 ,000, at least about 2,000, at least about 3,000, at least about 5,000, at least about 7,000, at least about 10,000, etc. A nucleic acid may be single-stranded or double-stranded, as specified, or contain portions of both double- stranded or single-stranded sequences. As will be appreciated by those in the art, the depiction of a single-strand also defines the sequence of the complementary strand; thus the sequences described herein also provide the complement of the sequence. A nucleic acid may be DNA, both genomic and cDNA, RNA or a hybrid, where the nucleic acid may contain combinations of deoxyribo- and ribo-nucleotides, and combinations of bases, including uracil, adenine, thymine, cytosine, guanine, inosine, xanthine hypoxanthine, isocytosine, isoguanine, etc. "Transcript" typically refers to a naturally occurring RNA, e.g., a pre-mRNA, hnRNA, or mRNA, but also refers to an mRNA transcribed from a

recombinant, intronless or heterologous gene. As used herein, the term "nucleoside" includes nucleotides and nucleoside and nucleotide analogs, and modified nucleosides such as amino modified nucleosides. In addition, "nucleoside" includes non-naturally occurring analog structures. Thus, e.g., the individual units of a peptide nucleic acid, each containing a base, are referred to herein as a nucleoside.

[00132] A nucleic acid of the present invention will generally contain phosphodiester bonds, although in some embodiments, nucleic acid analogs are included that may have alternate backbones, comprising, e.g., phosphoramidate, phosphorothioate,

phosphorodithioate, or 0-methylphosphoroamidite linkages (see, Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press); and peptide nucleic acid backbones and linkages. Other analog nucleic acids include those with positive backbones; non-ionic backbones, and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506 and Chapters 6 and 7, ASC Symposium Series 580, Carbohydrate Modifications in Antisense Research, Sanghui & Cook, eds. Nucleic acids containing one or more carbocyclic sugars are also included. Modifications of the ribose-phosphate backbone may be done for a variety of reasons, e.g. to increase the stability and half-life of such molecules in physiological environments or as probes on a biochip. Mixtures of naturally occurring nucleic acids and non-naturally occurring nucleic acids (e.g., analogs) can be made; alternatively, mixtures of different nucleic acid analogs, and mixtures of naturally occurring nucleic acids and analogs may be made. A variety of references disclose such nucleic acid analogs, including, for example, (i) phosphoramidate (Beaucage et al., 1993, Tetrahedron 49(10): 1925 and references therein; Letsinger, 1970, J Org Chem 35:3800; Sprinzl et al., 1977, Eur J Biochem 81 :579; Letsinger et al., 1986, Nucl Acids Res 14:3487; Sawai et al., 1984, Chem Lett 805; Letsinger et al., 1988, J Am Chem Soc 1 10:4470; and Pauwels et al., 1986, Chemica Scripta 26: 141 ), (ii) phosphorothioate (Mag et al., 1991, Nucleic Acids Res 19: 1437; U.S. Pat. No. 5,644,048), (iii) phosphorodithioate (Briu et al., 1989, J Am Chem Soc 11 1 :2321), (iv) 0-methylphosphoroamidite linkages (see, Eckstein, Oligonucleotides and Analogues: A Practical Approach, Oxford University Press) and (v) peptide nucleic acid backbones and linkages (see, Egholm, 1992, J Am Chem Soc 1 14: 1895; Meier et al., 1992, Chem Int Ed Engl 31 : 1008; Nielsen, 1993, Nature 365:566; Carlson et al., Nature 1996, 380:207), all of which are incorporated by reference). Other analog nucleic acids include those with positive backbones (Denpcy et al., 1995, Proc Natl Acad Sci USA 92:6097, non- ionic backbones (U.S. Pat. Nos. 5,386,023, 5,637,684, 5,602,240, 5,216, 141 and 4,469,863; Kiedrowshi et al, 1991, Angew. Chem Intl Ed English 30:423; Letsinger et al., 1988, J Am Chem Soc 110:4470; Letsinger et al, 1994, Nucleoside & Nucleotide 13: 1597; Chapters 2 and 3, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook; Mesmaeker et al., 1994, Bioorganic & Medicinal Chem Lett 4:395; Jeffs et al., 1994, J Biomolecular NMR 34: 17; Tetrahedron Lett 37:743 (1996)) and non-ribose backbones, including those described in U.S. Pat. Nos. 5,235,033 and 5,034,506, and Chapters 6 and 7, ASC Symposium Series 580, "Carbohydrate Modifications in Antisense Research", Ed. Y. S. Sanghui and P. Dan Cook. Nucleic acids containing one or more carbocyclic sugars are also included within the definition of nucleic acids (see, Jenkins et al., 1995, Chem Soc Rev pp 169-176). Several nucleic acid analogs are described in Rawls, C & E News Jun. 2, 1997 page 35. All of these references are hereby expressly incorporated by reference.

[00133] Other analogs include peptide nucleic acids (PNA) which are peptide nucleic acid analogs. These backbones are substantially non-ionic under neutral conditions, in contrast to the highly charged phosphodiester backbone of naturally occurring nucleic acids. This results in two advantages for certain applications. First, the PNA backbone exhibits improved hybridization kinetics. PNAs have larger changes in the melting temperature (T _m ) for mismatched versus perfectly matched base pairs. DNA and RNA typically exhibit a 2- 4°C drop in T _m for an internal mismatch. With the non-ionic PNA backbone, the drop is closer to 7-9°C. Similarly, due to their non-ionic nature, hybridization of the bases attached to these backbones is relatively insensitive to salt concentration. In addition, PNAs are not degraded by cellular enzymes, and thus can be more stable.

[00134] The terms "optional" or "optionally" as used throughout the specification means that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances in which it does not. For example, "heterocyclo group optionally mono- or di-substituted with an alkyl group" means that the alkyl may, but need not, be present, and the description includes situations where the heterocyclo group is mono- or di-substituted with an alkyl group and situations where the heterocyclo group is not substituted with the alkyl group. The terms also refer to a subsequently described composition that may but need not be present, and that the description includes instances where the composition is present and instances in which the composition is not present.

[00135] As used herein, the term "pharmaceutically acceptable" refers to compositions that are physiologically tolerable and do not typically produce an allergic or similar untoward reaction when administered to a subject, preferably a human subject. Preferably, as used herein, the term "pharmaceutically acceptable" means approved by a regulatory agency of a federal or state government or listed in the U.S. Pharmacopeia or other generally recognized pharmacopeia for use in animals, and more particularly in humans.

[00136] As used herein, the term "physiologically functional derivative" refers to any pharmaceutically acceptable derivative of a compound of the present invention, for example an ester or an amide thereof, and includes any pharmaceutically acceptable salt, ester, or salt of such ester of a compound of the present invention which, upon administration to a mammal, such as a human, is capable of providing (directly or indirectly) a compound of the present invention or an active metabolite or residue thereof. It will be appreciated by those skilled in the art that the compounds of the present invention may be modified to provide physiologically functional derivatives thereof at any of the functional groups in the compounds, and that the compounds of the present invention may be so modified at more than one position.

[00137] As used herein, the tenn "plurality" means more than one. For example, a plurality of cells means at least two cells, at least three cells, at least four cells, and the like. Likewise, a plurality of agents means at least two agents, at least three agents, at least four agents, and the like.

[00138] As used herein, the terms "polypeptide" and "protein" (used interchangeably herein) refer to a polymer of amino acid residues. Preferred polypeptides are IFI16 polypeptides, in particular human IFI16 polypeptides.

[00139] As used herein, the term "population of cells" refers to cells, preferably mammalian cells, more preferably human cells, grown in vitro or in vivo. The term also refers to cells within a host and may comprise a mixture of cells, such as virally infected cells and uninfected cells. A preferred population of cells is a population of CD4 T-cells. A more preferred population of cells is a population of CD4 T-cells within a host. An even more preferred population of cells is a population of CD4 T-cells within a host comprising HIV-1 infected CD4 T-cells and uninfected CD4 T-cells.

[00140] As used herein, a "post-translational modification" refers to a structural modification of an amino acid sequence and includes (1) a post-translational modification involving addition of a hydrophobic group for membrane localization, such as (i)

myristoylation (attachment of a myristate, a C _]4 saturated acid), (ii) palmitoylation

(attachment of a palmitate, a C] ₆ saturated acid), (iii) isoprenylation or prenylation (addition of an isoprenoid group, such as farnesol or geranylgeraniol) and (iv) glypiation

(glycosylphosphatidylinositol (GPI) anchor formation via an amide bond to C-terminal tail; (2) a post-translational modification involving addition of a cofactor for enhanced enzymatic activity, such as (i) lipoylation (attachment of a lipoate (Cg) functional group), (ii) addition of flavin moiety (FMN or FAD), (iii) heme C attachment via thioether bond with a cysteine residue, (iv) phosphopantetheinylation (addition of a 4'-phosphopantetheinyl moiety from coenzyme A), and (v) retinylidene Schiff base formation; (3) a post-translational modification involving addition of a small chemical group, such as (i) acetylation (the addition of an acetyl group, either at the N-terminus of a protein or at a lysine residue), e.g., O-acethylation (esters), N-acetylation (amides), S-acetylation (thioesters), (ii) alkylation (the addition of an alkyl group, e.g., methyl, ethyl), (iii) amide bond formation (amidation at C-terminus, amino acid addition (e.g., arginylation, polyglutamylation (covalent linkage of glutamic acid residues to the N-terminus of a protein), polyglycylatio (covalent linkage of one or more glycine residues to a protein)), (iv) butyrylation, (v) gamma-carboxylation, (vi) glycosylation (addition of a glycosyl group to either arginine, asparagine, cysteine, hydroxylserine, serine, threonine, tyrosine, or tryptophan, (vii) polysialylation (addition of polysialic acid), (viii) malonylation, (ix) hydroxylation, (x) iodination, (xi) nucleotide addition (e.g., ADP- ribosylation), (xii) oxidation (xiii) phosphate ester (O-linked) or phosphoramidate (N-linked) formation, (xiv) phosphorylation (addition of a phosphate group usually to serine, threonine and tyrosine (C inked) or histidine (N-linked), (xv) adenylation (addition of adenylyl moiety, usually to tyrosine (0-linked) or histidine and lysine (N-linked), (xvi) propionylation, (xvii) pyroglutamate formation, (xviii) S-glutathionylation, (xix) S-nitrosylation, (xx) succinylation (addition of a succinyl group to lysine), (xxi) sulation (addition of a sulfate group to a tyrosine; (4) a post-translational modification involving a non-enzymatic addition in vivo, such as glycation (addition of a sugar molecule to a protein without the controlling action of an enzyme); (5) a post-translational modification involving a non-enzymatic addition in vitro, such as (i) biotinylation or (ii) pegylation; (6) a post-translational modification involving addition of other proteins or peptides, such as (i) ISGylation (covalent linkage to the

Interferon-Stimulated Gene 15), (ii) SUMOylation (covalent linkage to the Small Ubiquitin- related Modifier protein), (iii) ubiquitination (covalent linkage to the protein ubiquitin), (iv) Neddylation (covalent linkage to Nedd), and (v) Pupylation (covalent linkage to the

Prokaryotic ubiquitin-like protein); (7) a post-translational modification involving changing the chemical nature of an amino acid, such as (i) citrullination or deiminitation (conversion of arginine to citrulline), (ii) deamidation (conversion of glutamine to glutamic acid or asparagine to aspartic acid), (iii) eliminylation (conversion to an alkene by beta-elimination of phosphothreonine and phosphoserine, or dehydration of threonine and serine, as well as by decarboxylation of cysteine), and (iv) carbamylation (conversion of lysine to homocitrulline); (8) a post-translational modification involving a structural change, such as (i) disulfide bridge formation (covalent linkage of two cysteines), (ii) proteolytic cleavage (cleavage of a polypeptide at a peptide bond), and (iii) racemization (e.g., of proline by prolyl isomerase, of serine by protein-serine epimerase, of alanine or methionine). Post-translational modification of proteins can be detected by a variety of techniques, including mass spectrometry, Eastern blotting, and Western blotting. [00141] As used herein, the term "preventing death of a cell in a population of cells" or grammatical equivalents thereof means that in a population of cells more cells survive when contacted with a compound of the invention as compared to cells in a population of cells not contacted with the compound, but otherwise treated comparably (control). As such, the death of a cell is prevented, when at least about 5%, at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90%, or 100% of cells in a population of cells survive when contacted with a compound of the invention as compared to cells in a population of cells not contacted with the compound, but otherwise treated comparably (control).

[00142] As used herein, the term "prodrug" refers to a precursor or derivative form of a pharmaceutically active substance that is less cytotoxic to cells compared to the parent drug and is capable of being enzymatically activated or converted into the more active parent form. See, e.g., Wihnan, "Prodrugs in Cancer Chemotherapy" Biochemical Society

Transactions, 14, pp. 375-382, 615th Meeting Belfast (1986) and Stella et al., "Prodrugs: A Chemical Approach to Targeted Drug Delivery," Directed Drug Delivery, Borchardt et al, (ed.), pp. 247-267, Humana Press (1985). The prodrugs of this invention include, but are not limited to, phosphate-containing prodrugs, thiophosphate-containing prodrugs, sulfate- containing prodrugs, peptide-containing prodrugs, D-amino acid-modified prodrugs, glycosylated prodrugs, (3-lactam-containing prodrugs, optionally substituted

phenoxyacetamide-containing prodrugs or optionally substituted phenylacetamide-containing prodrugs, 5 fluorocytosine and other 5-fluorouridine prodrugs which can be converted into the more active cytotoxic free drug.

[00143] As used herein, the term "protease inhibitor" ("PI") refers to inhibitors of the HIV- 1 protease, an enzyme required for the proteolytic cleavage of viral polyprotein precursors (e.g., viral GAG and GAG Pol polyproteins), into the individual functional proteins found in infectious HlV-1. HIV protease inhibitors include compounds having a peptidomimetic structure, high molecular weight (7600 Daltons) and substantial peptide character, e.g.

CRIXIVAN ^® (available from Merck) as well as non-peptide protease inhibitors e.g., VIRACEPT ^® (available from Agouron).

[00144] A "purified" or "isolated" polypeptide or protein is substantially free of cellular material or other contaminating proteins from the cell or tissue source from which the protein is derived, or substantially free from chemical precursors or other chemicals when chemically synthesized. "Substantially free" means that the protein of interest in the preparation is at least 10% pure. In some embodiments, a preparation of a protein has less than about 30%, less than about 20%, less than about 10% and more preferably, less than about 5% (by dry weight) of a contaminating component (e.g., a protein not of interest, chemical precursors, and so forth). A sample comprising such purified or isolated protein, thus, is a non-naturally occurring sample. When the protein or biologically active portion thereof is recombinantly produced, it is also preferably substantially free of culture medium, i.e., culture medium represents less than about 20%, more preferably less than about 10%, and most preferably less than about 5% of the volume of the protein preparation.

[00145] The term "recombinant" when used with reference to, e.g., a cell, nucleic acid, protein, or vector, indicates that the cell, nucleic acid, protein or vector, has been modified by the introduction of a heterologous nucleic acid or protein or by an alteration of a native nucleic acid or protein, or that the cell is derived from a cell so modified. Thus, e.g., recombinant cells express genes that are not found within the native (non -recombinant) form of the cell or express native genes that are otherwise abnormally expressed, under-expressed or not expressed at all. By the term "recombinant nucleic acid" herein is meant a nucleic acid, originally formed in vitro, in general, by the manipulation of a nucleic acid, e.g., by using polymerases, endonucleases and nucleic acid modifying enzymes, in a form not normally found in nature. In this manner, operable linkage of different sequences can be achieved. Thus, an isolated, intron-less nucleic acid, in a linear form, or an expression vector formed in vitro by ligating DNA molecules that are not normally joined, are both considered recombinant for the purposes of this invention. It is understood that once a recombinant nucleic acid is made and reintroduced into a host cell or organism, it will replicate non- recombinantly, i.e., using the in vivo cellular machinery of the host cell rather than in vitro manipulations; however, such nucleic acids, once produced recombinantly, although subsequently replicated non-recombinantly, are still considered recombinant for the purposes of the invention. Similarly, a "recombinant protein" is a protein made using recombinant techniques, e.g., through the expression of a recombinant nucleic acid as depicted above.

[00146] A "related" polypeptide as used herein, refers to a homolog, an isoform, an ortholog, a fusion protein or fragments of a polypeptide or any combination thereof. A preferred related polypeptide is a related IFI16 polypeptide.

[00147] As used herein, the terms "salt" and "pharmaceutically acceptable salt" refer to salts of a compound which are prepared with relatively nontoxic acids or bases, depending on the particular substituents found on the compounds described herein. When compounds of the present invention contain relatively acidic functionalities, base addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired base, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable base addition salts include sodium, potassium, calcium, ammonium, organic amino, or magnesium salt, or a similar salt. When compounds of the present invention contain relatively basic functionalities, acid addition salts can be obtained by contacting the neutral form of such compounds with a sufficient amount of the desired acid, either neat or in a suitable inert solvent. Examples of pharmaceutically acceptable acid addition salts include those derived from inorganic acids like hydrochloric, hydrobromic, nitric, carbonic, monohydrogencarbonic, phosphoric, monohydrogenphosphoric, dihydrogenphosphoric, sulfuric, monohydrogensulfuric, hydriodic, or phosphorous acids and the like, as well as the salts derived from relatively nontoxic organic acids like acetic, propionic, isobutyric, maleic, malonic, benzoic, succinic, suberic, fumaric, mandelic, phthalic, benzenesulfonic, p- tolylsulfonic, citric, tartaric, methanesulfonic, and the like. Also included are salts of amino acids such as arginate and the like, and salts of organic acids like glucuronic or galactunoric acids and the like (see, for example, Berge et al., 1977, "Pharmaceutical Salts", Journal of Pharmaceutical Science, 66: 1-19). Certain specific compounds of the present invention contain both basic and acidic functionalities that allow the compounds to be converted into either base or acid addition salts. The neutral forms of a compound may be regenerated by contacting the salt with a base or acid and isolating the parent compound in the conventional manner. The parent form of the compound differs from the various salt forms in certain physical properties, such as solubility in polar solvents, but otherwise the salts are equivalent to the parent form of the compound for the purposes of the present invention.

[00148] By "small interfering RNA", "short interfering RNA", or "siRNA" is meant an isolated RNA molecule, preferably greater than 10 nucleotides in length, more preferably greater than 15 nucleotides in length, and most preferably 18, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, or 30 nucleotides in length that functions as a key intermediate in triggering sequence-specific RNA degradation. A range of 19-25 nucleotides is the most preferred size for siRNAs. siRNAs can also include short hairpin RNAs (shRNA) in which both strands of an siRNA duplex are included within a single RNA molecule. Double-stranded siRNAs generally consist of a sense and an anti-sense strand. Single-stranded siRNAs generally consist of only the antisense strand that is complementary to the target gene or mRNA. siRNA includes any form of RNA, preferably dsRNA (proteolytically cleaved products of larger dsRNA, partially purified RNA, essentially pure RNA, synthetic RNA, recombinantly produced RNA) as well as modified RNA that differs from naturally occurring RNA by the addition, deletion, substitution, and/or alteration of one or more nucleotides.

[00149] As used herein, the terms "subdomain," "domain," "functional domain" or grammatical equivalents thereof in the context of a protein, such as an IFI16, ASC or caspase-1, refer to a fragment of that protein, such as a fragment of IFI16, ASC or caspase-1, which retains at least one activity of the corresponding full-length protein and, e.g., participates in an interaction, such as an intra-molecular or an inter-molecular interaction. An inter-molecular interaction can be a specific binding interaction or an enzymatic, catalytic interaction (e.g., the interaction can be transient and a covalent bond is formed or broken). An inter-molecular interaction can be between the protein and another protein, between the protein and a nucleic acid, between the protein and another compound, or between a first molecule and a second molecule of the protein (e.g., a dimerization interaction). Biologically active portions/functional domains of a protein include peptides comprising amino acid sequences sufficiently homologous to or derived from the amino acid sequence of the protein which include fewer amino acids than the full length, natural protein, and exhibit at least one activity of the natural protein, such as an IFI16 activity. Biologically active

portions/functional domains can be identified by a variety of techniques including truncation analysis, site-directed mutagenesis, and proteolysis. Mutants or proteolytic fragments can be assayed for activity by an appropriate biochemical or biological (e.g., genetic) assay. In some embodiments, a functional domain is independently folded. Typically, biologically active fragments comprise a domain or motif with at least one activity of the proteins, e.g., an IFI16, an ASC, a caspase-1. A biologically active portion/functional domain of a protein can be a polypeptide which is, for example, about 10, about 25, about 50, about 100, about 200 or more amino acids in length. For example, biologically active portions/functional domains of an IFI16 polypeptide (i) can bind to an ASC polypeptide, (ii) can bind to a caspase-1 polypeptide, (iii) can bind to a STING polypeptide, (iv) can assemble into a multiprotein complex comprising, e.g., ASC or caspase-1, (v) can bind to a single-stranded nucleic acid, (vi) can bind to a double-stranded nucleic acid.

[00150] As used herein, the term "solvate" refers to a compound that is complexed to a solvent. Solvents that can form solvates with the compounds of the present invention include common organic solvents such as alcohols (methanol, ethanol, etc.), ethers, acetone, ethyl acetate, halogenated solvents (methylene chloride, chloroform, etc.), hexane and pentane. Additional solvents include water. When water is the complexing solvent, the complex is termed a "hydrate."

[00151] As used herein, the term "substantially not changing," "substantially the same," "substantially uniform," and grammatical equivalents thereof refer to a level, amount or concentration of a parameter, such as a chemical compound, a metabolite, a nucleic acid, a polypeptide, cell proliferation, or a physical parameter (such as absorption, half- life, pH, temperature, viscosity, length, width, height circumference, form, shape, weight, angle, etc.) that has an increase or decrease of less than 25%, preferably, less than 20%, more preferably, less than 15%, even more preferably, an increase or decrease of less than 10%, and most preferably, an increase or decrease of less than 5% when compared to the level, amount or concentration of the same biological, physiological or physical parameter of a sample, composition of matter, or object to which it is compared.

[00152] As used herein, the terms "treatment," "treating" or grammatical equivalents thereof refer to both therapeutic treatment and prophylactic or preventative measures. Those in need of treatment include those already with the disease or disorder as well as those in which the disease or disorder is to be prevented. Hence, a subject may have been diagnosed as having the disease or disorder or may be predisposed or susceptible to the disease. As such, the terms include: (1 ) preventing a pathological condition, disorder, or disease, i.e. causing the clinical symptoms of a pathological condition, disorder, or disease not to develop in a subject that may be predisposed to the pathological condition, disorder, or disease but does not yet experience any symptoms of the pathological condition, disorder, or disease; (2) inhibiting the pathological condition, disorder, or disease, i.e. arresting or reducing the development of the pathological condition, disorder, or disease or its clinical symptoms; or (3) relieving the pathological condition, disorder, or disease, i.e. causing regression of the pathological condition, disorder, or disease or its clinical symptoms. These terms encompass also prophylaxis, therapy and cure. Treatment means any manner in which the symptoms of a pathological condition, disorder, or disease are ameliorated or otherwise beneficially altered. Preferably, the subject in need of such treatment is a mammal, more preferably, a human.

II. INHIBITION OF INTERFERON-GAMMA-INDUCIBLE PROTEIN 16 (IFI16)

[00153] Applicants have studied the mechanisms by which HIV-1 kills helper CD4 T- cells— the fundamental problem in AIDS. Using a physiologically relevant system formed of human lymphoid tissues, it was demonstrated that killing of CD4 T-cells by HIV-1 is caused - at least in part by activation of 1F116. As such, killing of CD4 T-cells by HIV-1 can be prevented by inhibiting IFI16, more specifically, by inhibiting a level opf IFI16 or an IFI16 activity as described herein. Applicants' unexpected and surprising finding forms a new strategy for preserving CD4 T-cells in AIDS patients.

[00154] Despite the vigorous research over the last 30 years, the cause of CD4 T-cell death in AIDS remains poorly understood, and is cited as one of the top unsolved problems in HIV- 1 research. Applicants explored the mechanisms by which HIV-1 depletes CD4 T-cells using a unique, physiologically relevant experimental system formed of fresh human lymphoid cultures. In many regards, this system is one of the most powerful experimental approaches to modeling molecular and cellular events during HIV-1 infection in human patients.

Surprisingly, using this system, Applicants discovered that the overwhelming majority of the CD4 T-cells do not die from the actions of HIV-1 , but rather die from the cell's own defensive response to HIV- 1 before the virus can make copies of itself. After HIV-1 infection, >95% of lymphoid CD4 T-cells that die are not productively infected and accumulate cytoplasmic viral DNA due to incomplete reverse transcription It appears that HIV- 1 enters the CD4 T-cells that are destined to die and starts to make a DNA copy of its RNA, a process called reverse transcription. However, during this process, the incomplete DNA intermediates (incomplete HIV-1 nucleic acids) that accumulate in the cells are sensed and serve to trigger the cell to 'commit suicide' in an attempt to protect the body (Doitsh et al., 2010, Cell, 143(5):789-801 ; incorporated herewith by reference). While this response is likely designed to be protective, HIV-1 subverts and amplifies it so effectively that it becomes a central driver of HIV-1 pathogenesis.

[00155] A second surprise was finding that the mechanism of cell death was not a silent one. These infected cells die a fiery death known as pyroptosis, causing significant inflammation as they release their cellular contents and chemical signals, which recruit healthy CD4 T-cells to the site of infection. This establishes a vicious cycle, whereby the dying CD4 T-cells release inflammatory signals that attract more cells to die (Doitsh et al., 2010, Cell, 143(5):789-801 ; incorporated herewith by reference).

[00156] Destruction of cells by pyroptosis also releases high levels of an intracellular component called adenosine-5 '-triphosphate (5ΆΤΡ) into the extracellular space.

Extracellular ATP binds to membrane channels termed P2X7 purinergic receptors and acts as an inflammatory stimulus to induce pyroptosis in nearby cells. Thus, pyroptosis activated initially by HIV-1 infection may result in an avalanche of new rounds of pyroptosis in healthy CD4 T-cells by the repeated release of intracellular ATP in a virus-independent manner.

[00157] Lymphoid tissues serve as home to more than 98% of the body's CD4 T-cells and form the primary sites of HlV-1 replication and spread. Applicants' experimental system, built on these tissues, closely recapitulates these conditions and thus, provides a compelling experimental platform for studying HIV-1 pathogenesis and exploring new strategies aimed at blocking CD4 T-cell death, thereby curbing AIDS progression (Doitsh et al., 2010, Cell, 143(5):789-801 ; incorporated herewith by reference).

[00158] The data provided herein suggest that CD4 T-cell depletion in AIDS is not triggered by HIV-1 toxicity, but is mediated by a cellular antiviral innate immune response against the virus. This response involves intense inflammation associated with the pyroptotic death of CD4 T-cells, and was likely designed to protect the host. However, the ensuing inflammation that results during this process may spin out of control with inflammation attracting new CD4 T-cells to undergo new rounds of infection and cell death.

[00159] The finding that CD4 T-cell death is associated with inflammation provides an unexpected and exciting nexus between the virus and host with strong implications for the role of inflammation in HIV-1 pathogenesis and disease progression. It is striking that Simian Immunodeficiency Virus (SIV) infection of its natural monkey hosts does not result in AIDS. While SIV is cytopathic for CD4 T-cells like HIV- 1 (i.e., it also kills monkeys' CD4 T-cells), monkeys do not mount an inflammatory response when SIV infection occurs, as occurs with an HIV-1 infection in humans. Thus, from an evolutionary point of view, the threat of AIDS has been neutralized not by controlling the virus but by negating an inflammatory response by the host against the virus. The discoveries described herein, namely that Interferon-Gamma-Inducible Protein 16 (IF116) is the long-sought after cellular sensor of abortive HIV-1 infection and that IFI16 antagonists can be used to block the inflammation occurring during CD4 T-cell pyroptosis and thus, interrupt the generation of inflammatory signals is surprising and unexpected. Thus, IFI16 antagonists open the door to use of an entirely new class of "anti-A!DS" agents to curb CD4 T-cell loss by suppressing a host's propathogenic response, i.e., pyroptosis and the associated inflammatory response that is pivotal in HIV-1 pathogenesis.

III. COMPOUNDS AND COMPOSITIONS

[00160] Applicants' invention described herein provides for compositions and methods for identifying compounds that inhibit an IFI16 activity. Preferably, inhibitors of IFI16 are small molecule compounds (peptide and non-peptide small molecule compounds), that inhibit activation and/or an activity of EFI16. Those compounds are useful in the methods of the present invention, in particular, in methods for the treatment of a patient having an HIV-1 infection or suspected of having an HIV-1 infection or having AIDS and in methods for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells.

A. IFI16

[00161] The interferon-inducible 16 (IFI16) is a member of the ΡΥΗΓΝ protein family that contains an amino-terminal PYRIN domain (PYD) and two DNA binding HIN domains (ΗΓΝ-Α and ΗΓΝ-Β), one located at the C-terminal end and one in the central part of IFI16. IFI16 is also known as PYH1N2, IFNGIP1 and MGC9466. Ml 6 is a member of the ΗΓΝ- 200 (hematopoietic interferon-inducible nuclear antigens with 200 amino acid repeats) family of cytokines. Alternatively spliced transcript variants encoding different IFI16 isoforms have been found for this gene. For example, IFI16 isoform 1 lacks an in-frame exon in the 5' coding region and has an additional in-frame exon in the 3' coding region, compared to IFI16 isoform 2. The resulting isoform 1 is of the same size but lacks a segment in the N- terminal region and has an additional segment in the C-terminal region, compared to IFI16 isoform 2 (e.g., see GenBank accession Nos. NP_001 193496, NP_005522). IFI16 has been shown to have a role in regulating cell proliferation and differentiation (Luan et al., 2008, Cytokine Growth Factor Rev 19:357-369).

[00162] Various IFIl 6 polypeptides are useful for practicing compositions and methods of the present invention. In some embodiments of the present invention, an IFI16 polypeptide is selected from the group consisting of IFIl 6 isoform 1 , IFIl 6 polypeptide comprising an amino acid sequence from IFIl 6 isoform 1 , IFIl 6 isoform 2, an IFI16 polypeptide comprising an amino acid sequence from IFIl 6 isoform 2, IFIl 6 isoform 3, an IFIl 6 polypeptide comprising an amino acid sequence from IFIl 6 isoform 3, IFIl 6 isoform XI, an IFIl 6 polypeptide comprising an amino acid sequence from IFI l 6 isoform XI, IFI16 isoform X2, an IFIl 6 polypeptide comprising an amino acid sequence from IF! 16 isoform X2, IFIl 6 isoform CRF_a, an IFIl 6 polypeptide comprising an amino acid sequence from IFI l 6 isoform CRF_a, IFIl 6 isoform CRF_b, an IFIl 6 polypeptide comprising an amino acid sequence from IFIl 6 isoform CRF_b, IFIl 6 isoform CRF_c, an IFIl 6 polypeptide comprising an amino acid sequence from IF! 16 isoform CRF__c, IFIl 6 isoform CRF_d, an IFIl 6 polypeptide comprising an amino acid sequence from IFIl 6 isoform CRF_d IFIl 6 isoform CRF_e, an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_e, IFI16 isoform C F_f, an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_f and fragments thereof retaining at least one IFI16 activity. Fragments retaining at least one IFI16 activity can be obtained from the nucleic acid and protein sequences disclosed herein (see GenBank accession Nos.) and can be tested as described herein (e.g., see Examples 1-6).

[00163] In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform 1 (also known as IFI16 isoform A; see Fig. 9 A). In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform 1 and having at least one IFI16 activity. Exemplary IFI16 isoform 1 sequences are disclosed herein and can further be obtained from GenBank as disclosed herein.

[00164] In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform 2 (also known as IFI16 isofonn B; see Fig. 9A). In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform 2 and having at least one IFI16 activity. Exemplary IFI 16 isofonn 2 sequences are disclosed herein and can further be obtained from GenBank as disclosed herein.

[00165] In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform 3 (also known as IFI16 isoform C; see Fig. 9C). In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform 3 and having at least one IFI16 activity. Exemplary IFI 16 isoform 3 sequences are disclosed herein and can further be obtained from GenBank as disclosed herein.

[00166] In some embodiments of the present invention, an l 6 polypeptide is 1F116 isoform XI . In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform XI and having at least one IFI16 activity. In some embodiments of the present invention, an IFU6 polypeptide is IFI16 isoform X2. In some embodiments of the present invention, an IF116 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform X2 and having at least one IFI16 activity. Exemplary IFI16 isoform XI sequences can be obtained from GenBank as disclosed herein. [00167] In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform CRF_a. In some embodiments of the present invention, an IFI16 polypeptide is an IF! 16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_a and having at least one IFI16 activity. In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform CRF_b. In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_b and having at least one IFI16 activity. In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform CRF_c. In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_c and having at least one TFT 16 activity. In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform CRF d. In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide comprismg an amino acid sequence from IF! 16 isoform CRF_d and having at least one IF! 16 activity. In some embodiments of the present invention, an IFI 16 polypeptide is IFI16 isoform CRF_e. In some embodiments of the present invention, an 1FI 16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_e and having at least one IFI16 activity. In some embodiments of the present invention, an IFI16 polypeptide is IFI16 isoform CRF_f. In some embodiments of the present invention, an IFI 16 polypeptide is an IFI16 polypeptide comprising an amino acid sequence from IFI16 isoform CRF_f and having at least one IFI16 activity. Exemplary IF116 isoform CRF_a, CRF_b, CRF_c, CRF_d, CRF_e, and CRF_f sequences can be obtained from GenBank as disclosed herein.

[00168] In some embodiments, an IFI16 polypeptide is an IFI16 polypetide that comprises at least one post-translational modification that is not found in a naturally occurring IFI16 polypeptide.

1. IFI16 Fragments

[00169] Also useful for practicing compositions and methods of the present invention are IFI16 polypeptide fragments. In some embodiments of the present invention, an 1FI16 polypeptide is an IFI16 polypeptide fragment comprising the C-terminal ΗΓΝ-200 IFI16 DNA binding domain. In some embodiments of the present invention, an IFI16 polypeptide is an IF116 polypeptide fragment comprising the central ΗΓΝ-200 IFI16 DNA binding domain. In some embodiments of the present invention, an IFI16 polypeptide is an 1FI16 polypeptide fragment comprising the C-terminal ΗΓΝ-200 IFI16 DNA binding domain and the central HIN-200 IFI16 DNA binding domain.

[00170] In some embodiments of the present invention, an 1FI16 polypeptide is an IFI16 polypeptide fragment comprising the N-terminal IFI16 PYD domain.

[00171] In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide fragment comprising the N-terminal IFI16 PYD domain and the C-terminal HIN- 200 IFI16 DNA binding domain. In some embodiments of the present invention, an IFI16 polypeptide is an IFI16 polypeptide fragment comprising the N-terminal l 6 PYD domain and the central HIN-200 IFI16 DNA binding domain. In some embodiments of the present invention, an IFI 16 polypeptide is an IFI 16 polypeptide fragment comprising the N-terminal IFI16 PYD domain, the C-tenninal HIN-200 IFI 16 DNA binding domain, and the central HIN-200 IFI16 DNA binding domain.

2. Mutant IFI16

[00172] In some embodiments of the present invention, an IFI16 protein is a mutant IFI 16 protein. Mutant IFI16 proteins are non-naturally occurring IFI16 proteins. They are useful in practicing compositions and methods described herein. For example, a mutant IFI16 protein may be lacking one or more of IFI 16 activities, such as a DNA binding activity. Among others, such IFI16 mutant proteins are useful as controls in compositions and methods described herein, e.g., in screening methods for identifying IFI 16 inhibitors. IFI16 mutant proteins are also useful as IFI16 inhibitors, e.g., functioning as dominant negative inhibitors of an IFI16 activity. Likewise, an IFI16 mutant may be generated, as described herein, to distinguish it from an endogenous IFI16 protein or wild-type IFI16 protein.

[00173] A mutated TFI16 protein may be produced in a variety of ways. A mutated IFI 16 is a non-naturally occurring IFI16 protein. For example, a mutation may be introduced, e.g., in the IFI 16 PYRIN domain or in one or both of the IFI 16 ΗΓΝ domains, or elsewhere within an IFI 16 protein. A mutation may be a substitution of one or more amino acid residues within the IFI 16 wild-type sequence, a deletion of one or more amino acid residues from the IFI 16 wild-type sequence, or an addition of one or more amino acid residues to the IFI 16 wild-type sequence. In some embodiments of the present invention, a mutated IFI16 comprises a deletion of amino acid residues 1-83, which is a useful IFI16 mutant protein lacking a functional PYRIN domain (Μ16Δ1-83). IFI16Al-83 is an about 70kDa protein. A deletion of amino acid residues 515-710 is a useful IFI16 mutant protein lacking the functional HIN-B DNA-binding domain at the C-terminus (IFI16A515-710). IFI16A515-710 is an about 60kDa protein. Both IFI16Al -83 and IFI16Δ515-710 may act as dominant negative forms of the wild-type IFI16 protein.

3. IFI16 Fusion Polypeptides

[00174] In another preferred embodiment of the present invention, an IFI16 polypeptide is an IFI 16 fusion polypeptide.

[00175] In some embodiments of the present invention, an IFI16 fusion polypeptide comprises an epitope-tag. An epitope tag includes, but is not limited to e.g., Flag, hemagglutinin (HA) or a 6xHis-tag. Epitope tags allow easy detection and purification of polypeptides attached to these tags. Detection and purification is performed using e.g., an anti-Flag antibody, an anti-HA antibody or an anti-6xHis-antibody.

[00176] In some embodiments of the present invention, an IFI16 fusion polypeptide comprises a detectable protein, e.g., a green fluorescent protein (GFP), a fluorescent protein from an Anthozoa species, a luciferase, a β-galactosidase, horse radish peroxidase, and the like.

4. ASC And Caspase-1

[00177] As described herein, an IFI16 polypeptide interacts with a ASC polypeptide and a caspase-1 polypeptide. Suitable assays for detecting an interaction between the IFI16 polypeptide and the ASC polypeptide or between the IFI16 polypeptide and the caspase-1 polypeptide are provided herein. As with IFI16, several useful ASC polypeptides and caspase-1 polypeptides can be used in those assays. Suitable ASC and caspase-1 nucleotide and polypeptide sequences for practicing methods and compositions of the present invention are described herein and can be obtained from GenBank as set forth herein.

[00178] In some embodiments, an ASC polypeptide is a non-naturally occurring ASC polypeptide. In some embodiments, an ASC polypeptide is an ASC fusion polypeptide comprising an epitope tag or a detectable protein as described herein. In some embodiments, an ASC polypeptide comprises a detectable label. In some embodiments, an ASC polypeptide is a related ASC polypeptide. In some embodiments, an ASC polypeptide is an ASC polypetide that comprises at least one post-translational modification that is not found in a naturally occurring ASC polypeptide.

[00179] In some embodiments, a caspase- 1 polypeptide is a non-naturally occurring caspase-1 polypeptide. In some embodiments, a caspase-1 polypeptide is a caspase-1 fusion polypeptide comprising an epitope tag or a detectable protein as described herein. In some embodiments, a caspase-1 polypeptide comprises a detectable label. In some embodiments, a caspase-1 polypeptide is a related caspase-1 polypeptide. In some embodiments, a caspase-1 polypeptide is a caspase-1 polypetide that comprises at least one post-translational modification that is not found in a naturally occurring caspase-1 polypeptide.

B. IFI16 Inhibitors

[00180] The present invention provides agents that reduce or inhibit a level of IFI16 or an IFI16 activity. The IFI16 activity can be an IFI16 activity of an IFI16 polypeptide or of an IFI16 polypeptide within a multi -protein complex comprising the IFI16 polypeptide. Of particular interest in many embodiments are agents identified using a screening method of the invention. The subject agents are useful for inhibiting lentiviral replication, and therefore are useful for treating lentiviral infections and useful in methods described herein.

[00181] As described herein, various agents function as an IFI16 inhibitor or as an IFI16 antagonist. In some embodiments of the present invention, an IFI16 inhibitor is a chemical antagonist. In some embodiments of the present invention, an IFI16 inhibitor is a pharmacokinetic antagonist. In some embodiments of the present invention, an IFI 16 inhibitor is a non-competitive antagonist. In some embodiments of the present invention, an IFI 16 inhibitor is a physiological antagonist, such as a biomolecule, e.g., a polypeptide, a peptide antagonist or a non-peptide antagonist.

[00182] In some embodiments of the present invention, an IFI16 inhibitor acts at the level of the interaction between an IFI 16 polypeptide and a second polypeptide, for example, a binding partner, such as an ASC, a caspase-1 polypeptide, or a STING polypeptide. In some embodiments, the IFI16 inhibitor competitively inhibits binding of the IFI 16 polypeptide to another polypeptide, such as ASC, caspase-1, or STING. In some embodiments, the IFI16 inhibitor acts non-competitively (e.g., allosterically) inhibiting binding of the IFI16 polypeptide to another polypeptide, such as ASC, caspase-1, or STING.

[00183] In some embodiments of the present invention, an IFI 16 inhibitor is a

pharmacokinetic antagonist. In some embodiments of the present invention, an IFI 16 inhibitor is a competitive antagonist. In some embodiments of the present invention, an IFI 16 inhibitor is a non-competitive antagonist. In some embodiments of the present invention, an IFI 16 inhibitor is a physiological antagonist

[00184] A variety of agents that inhibit a level or activity of an IFI 16 polypeptide as described herein, can be used. They include siRNA, antisense RNA, ribozymes, antibodies, small molecules, large molecules, and dominant negative proteins. SiRNA, antisense RNA, ribozymes, antibodies, small molecules, large molecules, and dominant negative proteins are particularly useful for inhibiting an activity of a nucleic acid or polypeptide. Thus, in one embodiment, the present invention provides compositions comprising siRNA, antisense RNA, ribozymes, antibodies, small molecules, large molecules, or dominant negative proteins for inhibiting an IFI16 nucleic acid or an IFI16 polypeptide and methods for using the siRNA, antisense RNA, ribozymes, antibodies, small molecules, large molecules, or dominant negative proteins for inhibiting an 1F116 nucleic acid or an IFI16 polypeptide both in vitro and in vivo. These methods and compositions are useful for the treatment of pathological conditions, disorders, or diseases, and interfering with an I FT 16 polypeptide activity. In some embodiments, a pathological condition, disorder, or disease is characterized by, caused by or associated with an elevated level or elevated activity of an IFI16 polypeptide relative to normal. Upon administration of an siRNA, an antisense RNA, a ribozyme, an antibody, a small molecule, a large molecule, or a dominant negative protein for inhibiting an TFI16 nucleic acid or an IFI16 polypeptide as described herein to an individual having such pathological condition, disorder, or disease, the elevated level or activity of the IF! 16 polypeptide in the individual is inhibited.

[00185] The following provides non-limiting examples of IFI16 inhibitors.

1. SiRNA Inhibitors

[00186] In some embodiments of the present invention, an IFI16 inhibitor is an antisense- oligonucleotide, more specifically an IFI16 antisense oligonucleotide.

[00187] In many species, introduction of double-stranded RNA (dsRNA) which may alternatively be referred to herein as small interfering RNA (siRNA), induces potent and specific gene silencing, a phenomena called RNA interference or RNAi. RNAi is an attractive biotechnological tool because it provides a means for knocking out the activity of specific genes. RNAi is usually described as a post-transcriptional gene-silencing (PTGS) phenomenon in which dsRNAs trigger degradation of homologous mRNA in the cytoplasm. The basic process involves a dsRNA that is processed into shorter units (called short or small interfering RNAs (siRNAs)) that guide recognition and targeted cleavage of homologous messenger RNA (mRNA). The dsRNAs that (after processing) trigger RNAi/PTGS can be made in the nucleus or cytoplasm in a number of ways. The processing of dsRNA into siRNAs, which in turn degrade mRNA, is a two-step RNA degradation process. The first step involves a dsRNA endonuclease (ribonuclease Ill-like; RNase Ill-like) activity that processes dsRNA into sense and antisense RNAs which are 21 to 25 nucleotides (nt) long (i.e., siRNA). In Drosophila, this RNase Ill-type protein is termed Dicer. In the second step, the antisense siRNAs produced combine with, and serve as guides for, a different ribonuclease complex called RNA-induced silencing complex (RISC), which cleaves the homologous single- stranded mR As. RISC cuts the mRNA approximately in the middle of the region paired with the antisense siRNA, after which the mRNA is further degraded. dsRNAs from different sources can enter the processing pathway leading to RNAi PTGS.

[00188] In some embodiments of the present invention, an IF116 inhibitor is a small interfering RNA (siRNA), more specifically, an siRNA directed against an IFI16 mRNA. In addition to the description provided herein, useful siRNA technologies are described, e.g., in PCT applications WO00/44895, W099/32619, WO01/75164, WO01/92513, WO01 /29058, WO01/89304, WO02/16620, and WO02/29858; and U.S. Patent Publication No.

20040023390.

[00189] Thus, agents of the present invention that are useful for practicing methods of the present invention include, but are not limited to siRNAs of IFI16. Typically, such agents are capable of (i) binding to (hybridizing with) an IFI16 mRNA, (ii) interfering with translation of an IFI16 mRNA, and/or (iii) leading to degradation of an IFI16 mRNA. The present invention provides compositions and methods using RNA interference to inhibit IFI16 expression. In some embodiments of the present invention, an IFI16 siRNA inhibits the translation of an IFI16 mRNA (e.g., see Figs. 7A, 9A, 10A.)

[00190] In designing RNAi experiments there are several factors that need to be considered such as the nature of the siRNA, the durability of the silencing effect, and the choice of delivery system. To produce an RNAi effect, the siRNA that is introduced into the organism should preferably contain exonic sequences. However, siRNAs directed against e.g., exon/intron splice sequences may also be chosen. Furthermore, the RNAi process is homology dependent, so the sequences must be carefully selected so as to maximize gene specificity, while minimizing the possibility of cross-interference between homologous, but not gene-specific sequences. Preferably an siRNA exhibits greater than 90% or even 100% identity between the sequence of the siRNA and the gene to be inhibited. Sequences less than about 80% identical to the target gene are substantially less effective. Thus, the greater the homology between the siRNA of IFI16 and the IFI16 gene whose expression is to be inhibited, the less likely expression of unrelated genes will be affected. In addition, the size of the siRNA is important. Generally, the present invention relates to IFI16 siRNA molecules which are double or single stranded and comprise at least about 19-25 nucleotides, and are able to inhibit the gene expression of IFI16. In the context of the present invention, an IFI16 siRNA is preferably less than 500, less than 200, less than 100, less than 50 or less than 25 nucleotides in length. More preferably, an IFI1 siRNA is from about 19 nucleotides to about 25 nucleotides in length.

[00191] A composition comprising an IFI16 siRNA as described herein is useful in a method for inhibiting a level or activity of an IFI16 polypeptide in a mammalian cell or in a method for the treatment of a pathological condition, disorder or disease as described herein. In some embodiments of the present invention, an IFI16 siRNA molecule comprises at least 19 nucleotides, having at least one strand that is substantially complementary to at least ten but no more than thirty consecutive nucleotides of an IFI16 gene and that reduces the expression of the IFI16 gene or protein.

[00192] In some embodiments, an IFI16 siRNA comprises an IFI16 target sequence and an oligo sequence.

[00193] In some embodiments, an IFI16 siRNA comprises the nucleotide sequence 5'- CCACAATCTACGAAATTCATCCACAATCTACGAAATTCATTCAAGAGATGAATTT CGTAGATTGTGGTTTTTTC-3 wherein the nucleotide sequence 5'- CC AC A ATCTACGAAATTCA-3 ' is the IFI16 target sequence and 5'- TCCACAATCTACGAAATTCATTCAAGAGATGAATTTCGTAGATTGTGGTTTTTTC- 3' is the oligo sequence. (IFI16-A, Fig, 10H). In some embodiments, an IFI16 siRNA comprises the target nucleotide sequence 5'-CCACAATCTACGAAATTCA-3'.

[00194] In some embodiments, an IFI16 siRNA comprises the nucleotide sequence 5'- AAGAACATTGTTCTACTAA

TAAGAACATTGTTCTACTAATTCAAGAGATTAGTAGAACAATGTTCTTTTTTTTC- 3', wherein the nucleotide sequence 5'- AAGAACATTGTTCTACTAA-3' is the IF116 target sequence and 5'-

TAAGAACATTGTTCTACTAATTCAAGAGATTAGTAGAACAATGTTCTTTTTTTTC- 3' is the oligo sequence. (IFI16-B, Fig, 10H). In some embodiments, an IFI16 siRNA comprises the target nucleotide sequence 5'- AAGAACATTGTTCTACTAA-3'.

[00195] In some embodiments, an IFI16 siRNA comprises the nucleotide sequence 5'- GGGGTGAATTCACTTATTATGGGGTGAATTCACTTATTATTCAAGAGATAATAAG TG AATTCACCCCTTTTTTC-3 ' , wherein the nucleotide sequence 5 '- GGGGTGAATTCACTTATTA-3 ' is the IFI16 target sequence and 5'- TGGGGTGAATTCACTTATTATTCAAGAGATAATAAGTGAATTCACCCCTTTTTTC- 3' is the oligo sequence. (IFI16-C, Fig, 10H). In some embodiments, an IFI16 siRNA comprises the target nucleotide sequence 5 '-GGGGTGAATTC ACTTATTA-3 ' .

[00196] In some embodiments, an IFI16 siRNA comprises the nucleotide sequence 5'- GGUGCUGAACGCAACAGAAUCAUUU-3 ' .

[00197] In some embodiments of the present invention, an IFI16 siRNA has the general formula 5'-[A]-[B]-[A']-3', wherein [A] is a ribonucleotide sequence corresponding to a target sequence of an IFI16 gene; [B] is a ribonucleotide sequence consisting of about 3 to about 23 nucleotides; and [A ¹ ] is a ribonucleotide sequence complementary to [A]. Herein, the phrase a "target sequence of an IF! 16 gene" or "IFI16 target sequence" refers to a sequence that, when introduced into a mammalian cell, is effective for inhibiting or reducing the translation of an IFI1 6 mRNA.

[00198] Nucleic acid sequences encoding IFI16 are described in the art and are available at GenBank (described herein). Having these sequences at hand, a skilled artisan using the disclosure provided herein, including exemplary IFI16 siRNAs (see above and Examples), can readily identify, without undue experimentation, additional siRNAs for practicing methods and compositions of the present invention.

[00199] Other than the siRNAs disclosed herein, siRNAs useful to practice a method of the present invention can be identified as follows. Beginning with the AUG start codon of the transcript (e.g., an IF116 mRNA), the transcript is scanned downstream for AA dinucleotide sequences. The occurrence of each AA and the 3' adjacent 19 nucleotides as potential siRNA target sites are recorded. It may not be recommended to design siRNAs against the 5' and 3' untranslated regions (UTRs) and regions near the start codon (within 75 bases) as these may be richer in regulatory protein binding sites, and thus the complex of endonuclease and siRNAs that were designed against these regions may interfere with the binding of UTR-binding proteins and/or translation initiation complexes (Tuschl, et al. 1999, Genes Dev 13 (24): 3191-7). The potential target sites are then compared to the human genome database or other mammalian sequences, depending on the species in which expression of the IFIl 6 gene is to be inhibited. Any target sequences with significant homology to other coding sequences are eliminated from consideration. The homology search can be performed using BLAST (Altschul et. al., 1997, Nucleic Acids Res 25:3389- 402; Altschul et. al., 1990, J Mol Biol 215:403-10). Next, qualifying target sequences are selected for synthesis. On the website of Ambion, several preferable target sequences can be selected along the length of the gene for evaluation. [00200] An IFI16 siRNA double-stranded molecule of the present invention may comprise a sense strand and an antisense strand, wherein the sense strand comprises a ribonucleotide sequence corresponding to an IFI16 target sequence, and wherein the antisense strand comprises a ribonucleotide sequence which is complementary to said sense strand, wherein said sense strand and said antisense strand hybridize to each other to form said double- > stranded molecule, and wherein said double-stranded molecule, when introduced into a cell expressing an IFI 16 gene, inhibits expression of said gene.

[00201] An IFI 1 siRNA double-stranded molecule of the present invention may be a polynucleotide that is physically or chemically altered from its natural state, or chemically synthesized. According to the present invention, such double-stranded molecules include those composed of DNA, RNA, and derivatives thereof. A DNA is suitably composed of bases such as A, T, C and G, and T is replaced by U in an RNA.

[00202] In some embodiments of the present invention, a siRNA comprises an alteration of one or more nucleotides. Such alterations can include the addition of non-nucleotide material, such as to the end(s) of the 19 to 25 nucleotide long RNA or internally (at one or more nucleotides of the RNA). In some embodiments, the RNA molecule comprises a 3'- hydroxyl group. Nucleotides in the RNA molecules can also comprise non-standard nucleotides, including non-naturally occurring nucleotides or deoxyribonucleotides. The double-stranded oligonucleotide may contain a modified backbone, for example,

phosphorothioate, phosphorodithioate, or other modified backbones known in the art, or may contain non-natural internucleoside linkages. Additional modifications of siRNAs (e.g., 2'-0- methyl ribonucleotides, 2'-deoxy-2'-fluoro ribonucleotides, "universal base" nucleotides, 5-C- methyl nucleotides, one or more phosphorothioate intern ucleotide linkages, and inverted deoxyabasic residue incorporation) can be found in the U.S. Patent Application No.

20040019001 and U.S. Pat. No. 6,673,611 (incorporated by reference). Collectively, all such altered RNAs described above are referred to as modified siRNAs.

[00203] SiRNAs may be expressed from a vector. The vector preferably comprises a regulatory sequence adjacent to the region encoding the present double-stranded molecule that directs the expression of the IFI16 siRNA molecule in an appropriate cell. For example, the double-stranded molecules of the present invention are intracellularly transcribed by cloning their coding sequence into a vector containing, e.g., an RNA polymerase III transcription unit from the small nuclear RNA (snRNA) U6 or the human HI RNA promoter. [00204] Alternatively, the vectors are produced, for example, by cloning an IFI16 target sequence into an expression vector so that the sequence is operatively linked to a regulatory sequence of the vector in a manner to allow expression thereof (transcription of the DNA molecule) (Lee et al., 2002, Nature Biotechnology 20:500-505). For example, the

transcription of an RNA molecule having an antisense sequence to the target sequence is driven by a first promoter (e.g., a promoter sequence linked to the 3'-end of the cloned DNA) and that having the sense strand to the target sequence by a second promoter (e.g., a promoter sequence linked to the 5'-end of the cloned DNA). The expressed sense and antisense strands hybridize to each other in vivo to generate an siRNA construct to silence a gene that comprises the target sequence. Furthermore, two constructs (vectors) may be utilized to respectively produce the sense and anti-sense strands of an siRNA construct.

[00205] Introduction of siRNA into cells can be achieved by methods known in the art and disclosed herein, including for example, microinjection, electroporation, or transfection of a vector comprising a nucleic acid from which the siRNA can be transcribed. Alternatively, an IFI16 siRNA can be directly introduced into a cell in a form that is capable of binding to an IFI16 mRNA transcript. To increase durability and membrane-permeability the siRNA may be combined or modified with liposomes, poly-L-lysine, lipids, cholesterol, lipofectine or derivatives thereof. Preferred are cholesterol -conjugated IFI16 siRNAs (see, Song et al., 2003, Nature Med 9:347-351).

[00206] For introducing the vectors into a cell, a transfection-enhancing agent can be used. FuGENE6 (Roche Diagnostics), Lipofectamine 2000 (Invitrogen), Oligofectamine

(Invitrogen), and Nucleofector (Wako pure Chemical) are useful transfection-enhancing agents. Transfection of vectors expressing siRNA polynucleotides of the invention can be used to inhibit an IFI16 in a mammalian cell. Thus, it is another aspect of the present invention to provide a double-stranded molecule comprising a sense-strand and antisense- strand which function as an siRNA for IFI16, and a vector encoding the double-stranded molecule. Further, siRNAs and vectors comprising siRNA nucleic acid sequences and methods for preparing and using same are described, for example, in U.S. Patent Application No. 20060051815, which is incorporated herewith in its entirety by reference.

[00207] Preferably, an 1F116 siRNA is capable of decreasing the expression of IFI16 in a cell by at least about 10%, at least about 20%, at least about 30%, or at least about 40%, more preferably, by at least about 50%, at least about 60%, or at least about 70%, and most preferably, by at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more. In some instances, complete inhibition of IFI16 expression is desirable.

2. Antisense RNA And Ribozvmes

[00208] A variety of agents can be used to inhibit a level or activity of an IFI16 polypeptide as described herein. For example, the expression of IFI16 can be inhibited by administering to a cell or a subject a nucleic acid that inhibits or antagonizes the expression of an IFI16 gene. In addition to siRNAs, described above, antisense oligonucleotides or ribozymes which disrupt the expression of an IFI16 gene can be used for inhibiting the level or activity of an IFI16 polypeptide. Thus, in some embodiments of the present invention, an inhibitor of a level or activity of an IFI16 polypeptide is an anti-sense RNA, which can be identified as described herein.

[00209] As noted above, antisense-oligonucleotides corresponding to any portion of the nucleotide sequence of an IFI16 gene can be used to reduce the expression level of the IFI16 gene. Specifically, an antisense-oligonucleotide against an IFI16 gene may act by binding to any of the IFI16 mRNAs, thereby inhibiting the transcription of an IFU6 gene, translation of and IFI16 mRNA, promoting the degradation of an IFI16 mRNA, inhibiting the expression of proteins encoded by an IFI16 gene, and/or finally inhibiting an activity of an IFI16 polypeptide.

[00210] Generally, ribozymes are classified into large ribozymes and small ribozymes. A large ribozyme is known as an enzyme that cleaves the phosphate ester bond of nucleic acids. After the reaction with the large ribozyme, the reacted site consists of a 5'-phosphate and 3'- hydroxyl group. The large ribozyme is further classified into (1) group I intron RNA catalyzing transesterification at the 5'-splice site by guanosine; (2) group II intron RNA catalyzing self-splicing through a two-step reaction via lariat structure; and (3) RNA component of the ribonuclease P that cleaves the tRNA precursor at the 5' site through hydrolysis. On the other hand, small ribozymes have a smaller size (about 40 bp) compared to the large ribozymes and cleave RNAs to generate a 5 '-hydroxy 1 group and a 2'-3' cyclic phosphate. Hammerhead type ribozymes (Koizumi et al., 1988, FEBS Lett 228:225) and hairpin type ribozymes (Buzayan, 1986, Nature 323:349; Kikuchi and Sasaki, 1991, Nucleic Acids Res 19: 6751) are included in the small ribozymes. Methods for designing and constructing ribozymes are known in the art (see Koizumi et al., 1988, FEBS Lett 228:225; Koizumi et al, 1989, Nucleic Acids Res 17:7059; Kikuchi and Sasaki, 1991, Nucleic Acids Res 19: 6751) and ribozymes inhibiting the expression of an IFI16 polypeptide can be constructed based on the sequence information of the nucleotide sequence encoding an IFI16 polypeptide according to conventional methods for producing ribozymes.

[00211] Preferably, an IFI16 antisense RNA or ribozyme is capable of decreasing the expression of IFI16 in a cell by at least about 10%, at least about 20%, at least about 30%, or at least about 40%, more preferably, by at least about 50%, at least about 60%, or at least about 70%, and most preferably, by at least about 75%, at least about 80%, at least about 85%o, at least about 90%, at least about 95% or more. In some instances, complete inhibition of IFI16 expression is desirable.

3. Anti-IFI16 Antibodies

[00212] In some embodiments of the present invention, an agent for inhibiting an IFI16 activity is an antibody specific for IFI16 or an antigen-binding fragment thereof. In some embodiments of the present invention, an agent for inhibiting an IFI16 activity is an antibody specific for IFI16 isoform a or an antigen-binding fragment thereof. In some embodiments of the present invention an agent for inhibiting an IFI16 activity is an antibody specific for IFI16 isoform b or an antigen-binding fragment thereof. In some embodiments of the present invention an agent for inhibiting an IFI16 activity is an antibody specific for IFI16 isoform c or an antigen-binding fragment thereof.

[00213] An anti-IFI16 antibody may be selected from a polyclonal anti-IFI16 antibody, a monoclonal anti-IFI16 antibody, a chimeric anti-IFI16 antibody, a humanized anti-IFI16 antibody, a human anti-IFI16 antibody, a recombinant anti-IFI16 antibody or an antigen- binding fragment thereof. Preferably, an anti-IFI16 antibody is a non-naturally occurring anti-IFI16 antibody. A non-naturally occurring anti-IFI16 antibody can be differentiated from a naturally occurring anti-IFI 16 antibody by having a different glycosylation pattern than a naturally occurring anti-IFI 16 antibody.

[00214] Anti-IFI 6 antibodies are described herein. In addition to the anti-IFI 16 antibodies described herein, other IFI16 antibodies can be generated against an TFI16 polypeptide. Particularly useful are anti-IFI 16 antibodies that contain at least one binding site for IFI 16. An antibody fragment may be selected from a Fab fragment, a Fab '-fragment, a F(ab') ₂ fragment or a single-chain Fv fragment.

[00215] Preferably, an anti-IFIl 6 antibody or fragment thereof is capable of decreasing a level or activity of an IFI16 polypeptide by at least about 10%, at least about 20%, at least about 30%), or at least about 40%), more preferably, by at least about 50%, at least about 60%, or at least about 70%, and most preferably, by at least about 75%, at least about 80%o, at least about 85%, at least about 90%, at least about 95% or more. In some instances, complete inhibition of an Ml 6 level or IFI16 activity is desirable.

4. Small Molecule Inhibitors

[00216] In some embodiments, an agent for inhibiting a level or an activity of an IFI16 polypeptide is a small molecule, e.g., a small organic or inorganic compound having a molecular weight of more than 50 and less than about 2,500 Daltons. Agents may comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and may include at least an amine, carbonyl, hydroxyl or carboxyl group, and may contain at least two of the functional chemical groups. The agents may comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[00217] Preferably, a small molecule is capable of decreasing a level or activity of an IFI16 polypeptide by at least about 10%, at least about 20%, at least about 30%, or at least about 40%), more preferably, by at least about 50%, at least about 60%, or at least about 70%, and most preferably, by at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more. In some instances, complete inhibition of an IFI16 level or IFI16 activity is desirable.

5. Peptide Inhibitors

[00218] In some embodiments of the present invention, an agent inhibiting an IFI16 activity is a peptide IFI16 inhibitor or single stereoisomers, mixtures of stereoisomers, pharmaceutically acceptable salts or prodrugs thereof.

[00219] It is possible to generate reversible or irreversible inhibitors of IFI16 activation by coupling IFI16-specific peptides to certain aldehyde, nitrile or ketone compounds. Such inhibitors can successfully inhibit the induction of apoptosis in various tumor cell lines (Schlegel et al., J Biol Chem (1996) 271 : 1841 ; Martins et al, J Biol Chem (1997) 272:7421 ; Huang et al, Mol Cell Biol (1999) 19:2986; Guo and Kyprianou, Cancer Res (1999) 59: 1366) as well as normal cells (Zaks et al, J Immunol (1999) 162:3273; Gastman et al, Cancer Res (1999) 59: 1422). Peptide IFI16 inhibitors can be derivatized and act as effective irreversible inhibitors with no apparent added cytotoxic effect. Peptide IFI16 inhibitors can be derivatized to include fluoromethyl ketone (fmk), tetra fluoro phenoxy methyl ketone (tfpmk) or an aldehyde group at the C-terminus. Peptide IFI16 inhibitors can also be synthesized with a benzyloxycarbonyl group (known as BOC or Z) or an acetyl group at the N-terminus and with O-methyl side chains. They exhibit enhanced cellular permeability, thus greatly facilitating their use in both in vitro cell culture as well as in vivo animal and human studies

[00220] In some embodiments, an active agent inhibiting an IFI16 activity is a peptide (e.g., peptide inhibitors of IFI16 activity). Suitable peptides include peptides of from about 3 amino acids to about 50 amino acids, from about 5 amino acids to about 30 amino acids, from about 10 amino acids to about 25 amino acids, from about 25 amino acids to about 50 amino acids, from about 50 amino acids to about 75 amino acids, or from about 75 amino acids to about 100 amino acids in length. In some embodiments, the peptide is linear; in other embodiments, the peptide is cyclized. In some embodiments, the peptide is modified, e.g., comprises one or more non-peptide moieties covalently or non-covalently linked to the peptide. Suitable non-peptide moieties include, but are not limited to, polyethylene glycol (PEG) moieties; carbohydrate moieties; lipid moieties; fatty acid moieties; polysaccharide moieties; phosphate groups; and the like. In some embodiments, the active peptide is linked to a heterologous peptide, e.g., a heterologous peptide that confers increased stability or residence time in vivo; a heterologous peptide that facilitates crossing a cell membrane; a heterologous peptide that binds to a cell surface receptor; a heterologous peptide that provides for dimerization; a heterologous peptide that provides an epitope tag; a heterologous peptide that provides a detectable signal; and the like.

[00221] Peptides can include naturally-occurring and non-naturally occurring amino acids. Peptides may comprise D-amino acids, a combination of D- and L-amino acids, and various "designer" amino acids (e.g., β-methyl amino acids, Ca-methyl amino acids, and Na-methyl amino acids, etc.) to convey special properties to peptides. Additionally, a peptide may be a cyclic peptide. Peptides may include non-classical amino acids in order to introduce particular conformational motifs. Any known non-classical amino acid can be used. Non- classical amino acids include, but are not limited to, l,2,3,4-tetrahydroisoquinoline-3- carboxylate; (2S,3S)-methylphenylalanine, (2S,3R)-methyl-phenylalanine, (2R,3S)-methyl- phenylalanine and (2R,3R)-methyl-phenylalanine; 2-aminotetrahydronaphthalene-2- carboxylic acid; hydroxy-l ,2,3,4-tetrahydroisoquinoline-3-carboxylate; β-carboline (D and L); HIC (histidine isoquinoline carboxylic acid); and HIC (histidine cyclic urea). Amino acid analogs and peptidomimetics may be incorporated into a peptide to induce or favor specific secondary structures, including, but not limited to, LL-Acp (LL-3-amino-2-propenidone-6- carboxylic acid), a β-turn inducing dipeptide analog; β-sheet inducing analogs; β-turn inducing analogs; a-helix inducing analogs; γ-turn inducing analogs; a Gly-Ala turn analog; amide bond isosteres; tretrazol; and the like.

[00222] A peptide may be a depsipeptide, which may be a linear or a cyclic depsipeptide. Kuisle et al. (1999) Tet Letters 40: 1203-1206. "Depsipeptides" are compounds containing a sequence of at least two alpha-amino acids and at least one alpha-hydroxy carboxylic acid, which are bound through at least one normal peptide link and ester links, derived from the hydroxy carboxylic acids, where "linear depsipeptides" may comprise rings formed through S— S bridges, or through an hydroxy or a mercapto group of an hydroxy-, or mercapto-amino acid and the carboxyl group of another amino- or hydroxy-acid but do not comprise rings formed only through peptide or ester links derived from hydroxy carboxylic acids. "Cyclic depsipeptides" are peptides containing at least one ring formed only through peptide or ester links, derived from hydroxy carboxylic acids.

[00223] Peptides may be cyclic or bicyclic. For example, the C-terminal carboxyl group or a C-terminal ester can be induced to cyclize by internal displacement of the—OH or the ester (-OR) of the carboxyl group or ester respectively with the N-terminal amino group to form a cyclic peptide. For example, after synthesis and cleavage to give the peptide acid, the free acid is converted to an activated ester by an appropriate carboxyl group activator such as dicyclohexylcarbodiimide (DCC) in solution, for example, in methylene chloride (CH2CI2), dimethyl formamide (DMF) mixtures. The cyclic peptide is then formed by internal displacement of the activated ester with the N-terminal amine. Internal cyclization as opposed to polymerization can be enhanced by use of very dilute solutions. Methods for making cyclic peptides are well known in the art.

[00224] The term "bicyclic" refers to a peptide in which there exists two ring closures. The ring closures are formed by covaient linkages between amino acids in the peptide. A covaient linkage between two nonadjacent amino acids constitutes a ring closure, as does a second covaient linkage between a pair of adjacent amino acids which are already linked by a covaient peptide linkage. The covaient linkages forming the ring closures may be amide linkages, i.e., the linkage formed between a free amino on one amino acid and a free carboxyl of a second amino acid, or linkages formed between the side chains or "R" groups of amino acids in the peptides. Thus, bicyclic peptides may be "true" bicyclic peptides, i.e., peptides cyclized by the formation of a peptide bond between the N-terminus and the C-terminus of the peptide, or they may be "depsi-bicyclic" peptides, i.e., peptides in which the terminal amino acids are covalently linked through their side chain moieties.

[00225] A desamino or descarboxy residue can be incorporated at the terminii of the peptide, so that there is no terminal amino or carboxyl group, to decrease susceptibility to proteases or to restrict the conformation of the peptide. C-terminal functional groups include amide, amide lower alkyl, amide di(lower alkyl), lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.

[00226] A desamino or descarboxy residue can be incorporated at the terminii of the peptide, so that there is no terminal amino or carboxyl group, to decrease susceptibility to proteases or to restrict the conformation of the peptide. C-terminal functional groups include amide, amide lower alkyl, amide di(lower alkyl), lower alkoxy, hydroxy, and carboxy, and the lower ester derivatives thereof, and the pharmaceutically acceptable salts thereof.

[00227] An active peptide (e.g., peptide inhibitors of an IFI16 activity) will in some embodiments be conjugated to decapeptides comprised of arginine residues to allow uptake across the plasma membrane by protein transduction. Such modifications allow peptides to enter cells (e.g., cross the plasma membrane) with high efficiency.

[00228] In some embodiments, an active peptide (e.g., peptide inhibitors of an IFI16 activity) is a peptide aptamer. Peptide aptamers are peptides or small polypeptides that act as dominant inhibitors of protein function. Peptide aptamers specifically bind to target proteins, blocking their function ability. Kolonin and Finley (1998) Proc Natl Acad Sci USA 95: 14266- 14271. Due to the highly selective nature of peptide aptamers, they may be used not only to target a specific protein, but also to target specific functions of a given protein (e.g. a protein binding function). Further, peptide aptamers may be expressed in a controlled fashion by use of promoters which regulate expression in a temporal, spatial or inducible manner.

[00229] Peptide aptamers that bind with high affinity and specificity to a target protein may be isolated by a variety of techniques known in the art. Peptide aptamers can be isolated from random peptide libraries by yeast two-hybrid screens (Xu et al., (1997) Proc Natl Acad Sci USA 94: 12473-12478). They can also be isolated from phage libraries (Hoogenboom et al., Immunotechnology (1998) 4: 1-20) or chemically generated peptides/libraries.

[00230] Preferably, an IFI16 peptide inhibitor is capable of decreasing a level or activity of an IFI16 polypeptide by at least about 10%, at least about 20%, at least about 30%, or at least about 40%), more preferably, by at least about 50%, at least about 60%), or at least about 70%, and most preferably, by at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more. In some instances, complete inhibition of an Ml 6 level or IFI16 activity is desirable.

6. pUL83

[00231] In some embodiments of the present invention, an agent inhibiting an 1FI16 activity is a protein. Suitable proteins include, but are not limited to, the human

cytomegalovirus protein pUL83 (also termed pp65; see UniProtKB/Swiss-Prot: P06725.2), an antagonist of IFN- inducible genes, that recently has been shown to interact with IFI16 (Christea et al, 2010, J Virol 84:7803-7814). Full-length pUL83 is a 561 amino acid polypeptide (UniProtKB/Swiss-Prot: P06725.2). In some embodiments, an agent inhibiting an IFI16 activity is a pUL83 fragment, such as a domain of pUL83 binding to IFI16. In some embodiments, an agent inhibiting an IFI16 activity is a pUL83 fragment, such as a domain of pUL83 binding to the IFI16 pyrin domain. In some embodiments, an agent inhibiting an TFI16 activity is a pUL83 fragment, such as a domain of pUL83 blocking the oligomerization of IFI16. In some embodiments, an agent inhibiting an IFI16 activity is a pUL83 fragment, such as a domain of pUL83 comprising its N-terminal pyrin association domain (PAD) and interacting with the pyrin domain of TFI16 (Li and Christea, 2013 Cell Host Microbe 14(5):591 -9).

[00232] Preferably, a pUL83 or pUL fragment is capable of decreasing a level or activity of an IFI16 polypeptide by at least about 10%, at least about 20%, at least about 30%, or at least about 40%, more preferably, by at least about 50%, at least about 60%, or at least about 70%), and most preferably, by at least about 75%, at least about 80%, at least about 85%), at least about 90%>, at least about 95% or more. In some instances, complete inhibition of an IFI16 level or IFI16 activity is desirable.

7. Dominant Negative IFI16 Polypeptides

[00233] A variety of agents can be used to inhibit a level or an activity of an IFI16 polypeptide. In some embodiments of the present invention, an IFI16 inhibitor is a dominant negative IFI16 polypeptide which can be identified as described herein.

[00234] As described by the present inventors, an IFI16 polypeptide assembles into a multiprotein complex, the inflammasome. Thus, in some embodiments of the present invention, an IFI16 inhibitor is a dominant negative IFI16 polypeptide inhibiting the assembly of an IFI16 polypeptide into a biological active multiprotein complex. Upon inhibition of the assembly of the biologically active complex (i.e., the formation of a functional inflammasome), one or more activities of an IFI16 polypeptide may be inhibited or reduced.

[00235] Preferably, a dominant negative IFI 16 polypeptide is capable of decreasing a level or activity of an IFI 16 polypeptide by at least about 10%, at least about 20%, at least about 30%, or at least about 40%, more preferably, by at least about 50%, at least about 60%, or at least about 70%, and most preferably, by at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95% or more. In some instances, complete inhibition of an IFI 16 level or IFI 16 activity is desirable.

IV. METHODS

A. Identifying And Testing IFI16 Inhibitors

[00236] The present invention identified 1FI16 as the cellular sensor for abortive HIV-1 infection. In addition, the present invention also discloses various IFI 16 activities. Based on the findings described herein, Applicants have devised a variety of methods for identifying agents decreasing an IFI 16 activity. The IFI 16 activity can be an IFI 16 activity of an IFI 16 polypeptide or of an IFI 16 polypeptide within a multi -protein complex comprising the IFI 16 polypeptide.

[00237] The present invention describes a variety of screening methods for identifying an IFI 16 inhibitor. Agents decreasing an IFI 16 activity are identified using methods described herein. A number of different screening protocols can be utilized to identify agents that decrease an IFI16 level or an IFI 16 activity. The terms "identifying" and "screening" are used interchangeably herein.

1. Agents And General Considerations For Screening Methods

[00238] The terms "agent," "test agent," "candidate agent" and "compound" are used interchangeably herein. Agents encompass numerous chemical classes, and are generally synthetic, semi- synthetic, or naturally-occurring inorganic or organic molecules.

a. Agents

[00239] Preferred are agents that selectively inhibit an IFI 16 level or an IFI 16 activity. Thus, in certain embodiments, an agent which is suitable for use in a subject treatment method as described herein and which inhibits an IFI16 level or an IFI16 activity, is a selective inhibitor of IFI16 or a selective antagonist of IFI 16. An agent that is a selective inhibitor of an IFI 16 activity is an agent that does not substantially inhibit or activate other cellular genes, other cellular polypeptides or other cellular enzymes, e.g., at the IC ₅₀ for IFI16, the agent does not result in more than about 5%, more than about 10%, or more than about 25% inhibition or activation of another cellular gene, cellular polypeptide or cellular enzyme.

[00240] Agents may comprise functional groups necessary for structural interaction with proteins, particularly hydrogen bonding, and may include at least an amine, carbonyl, hydroxyl or carboxyl group, and may contain at least two of the functional chemical groups. Agents may comprise cyclical carbon or heterocyclic structures and/or aromatic or polyaromatic structures substituted with one or more of the above functional groups. Agents are also found among biomolecules including peptides, saccharides, fatty acids, steroids, purines, pyrimidines, derivatives, structural analogs or combinations thereof.

[00241] Candidate agents are obtained from a wide variety of sources including libraries of synthetic or natural compounds. For example, numerous means are available for random and directed synthesis of a wide variety of organic compounds and biomolecules, including expression of randomized oligonucleotides and oligopeptides. Alternatively, libraries of natural compounds in the form of bacterial, fungal, plant and animal extracts are available or readily produced. Additionally, natural or synthetically produced libraries and compounds are readily modified through conventional chemical, physical and biochemical means, and may be used to produce combinatorial libraries. Known pharmacological agents may be subjected to directed or random chemical modifications, such as acylation, alkylation, esterification, amidification, etc. to produce structural analogs.

[00242] Any candidate agent, for example, cell extracts, cell culture supernatants, products of fermenting microorganism, extracts from marine organisms, plant extracts, purified or crude proteins, peptides, non-peptide compounds, nucleic acids, saccharides, lipids, synthetic micromolecular compounds and natural compounds and the like, can be used in the screening methods of the present invention.

[00243] Optionally, the method for identifying an agent that inhibits a level or activity of an IFI16 polypeptide comprises the step of identifying a structure or sequence of the agent.

[00244] An agent isolated by a screening method of the present invention is a candidate for drugs, which inhibit a level or activity of an IFI16 polypeptide. The candidate drugs are useful for treating or preventing a pathological condition, disorder, or disease as described herein. An agent in which a part of the structure of the agent obtained by a screening method of the present invention is converted by the addition, deletion and/or replacement of a chemical group, residue, or side chain, is included in the agents obtained by the screening methods of the present invention. An agent effective in inhibiting a level or activity of an IFI16 polypeptide can be further tested for its ability to treat or prevent a disorder, disease or pathological condition in animal models and/or test subjects.

[00245] Agents identified by any of the subject screening methods described herein are useful as biologically active agents. In some embodiments of the present invention, the biologically agent inhibits a level or activity of an IFI16 polypeptide as described herein.

i. Libraries

[00246] A test agent can also be obtained using any of the numerous approaches in combinatorial library searching described herein, including (1) biological libraries, (2) spatially addressable parallel solid phase or solution phase libraries, (3) synthetic library methods requiring deconvolution, (4) the "one-bead one-compound" library method and (5) synthetic library methods using affinity chromatography selection. The biological library methods using affinity chromatography selection is limited to peptide libraries, while the other four approaches are applicable to peptide, non-peptide oligomer or small molecule libraries of compounds (Lam, 1997, Anticancer Drug Des 12: 145)..

[00247] Examples of methods for the synthesis of molecular libraries can be found in the art (DeWitt et al., 1993, Proc Natl Acad Sci USA 90: 6909; Erb et al, 1994, Proc Natl Acad Sci USA 91 : 11422; Zuckermann et al., 1994, JMed Chem 37:2678; Cho et al., 1993, Science 261 : 1303; Carell et al., 1994, Angew Chem Int Ed Engl 33:2059; Carell et al„ 1994, Angew Chem Int Ed Engl 33 :2061 ; Gallop et al., 1994, JMed Chem 37: 1233). Devices for the preparation of combinatorial libraries are commercially available (see, e.g., 357 MPS, 390 MPS, Advanced Chem Tech, Louisville Ky., Symphony, Rainin, Woburn, Mass., 433A Applied Biosystems, Foster City, Calif, 9050 Plus, Millipore, Bedford, Mass.). In addition, numerous combinatorial libraries are themselves commercially available (see, e.g.,

ComGenex, Princeton, N.J., Asinex, Moscow, Ru, Tripos, Inc., St. Louis, Mo., ChemStar, Ltd, Moscow, RU, 3D Pharmaceuticals, Exton, Pa., Martek Biosciences, Columbia, Md., etc.). Those and others can be used in the screening methods described herein.

[00248] Libraries of compounds may be presented in various formats, e.g., in solution (see Houghten, 1992, Bio/Techniques 13:412) or on beads (Lam, 1991, Nature 354: 82), chips (Fodor, 1993, Nature 364:555), bacteria (U.S. Pat. No. 5,223,409), spores (U.S. Pat. Nos. 5,571,698, 5,403,484, and 5,223,409), plasmids (Cull et al., 1992, Proc Natl Acad Sci USA 89: 1865) or phage (Scott and Smith, 1990, Science 249:386; Devlin, 1990, Science 249:404; Cwirla et al., 1990, Proc Natl Acad Sci USA 87:6378; Felici, 1991, JMol Biol 222 301 ; US Pat. Application 20020103360). The candidate agent contacted to a cell or protein according to the screening methods of the present invention may be a single agent or a combination of agents. When a combination of agents is used in the screening methods of the invention, the agents may be contacted to the cell or protein sequentially or simultaneously.

ii. Small Molecules

[00249] In some embodiments, an agent is a small organic compound having a molecular weight of more than 50 Daltons and less than about 2,500 Daltons.

iii. Large Molecules

[00250] In some embodiments, a candidate agent has a molecular weight of greater than 2,500 Daltons. In these embodiments, a candidate agent may be a peptide, an oligopeptide, a polypeptide, a carbohydrate, a polysaccharide, a lipid, a lipopolysaccharide, a glycoprotein, a proteoglycan, a lipoprotein, or other macromolecule.

iv. Prodrugs

[00251] Prodrugs are also included within the context of this invention. Prodrugs are any covalently bonded carriers that release in vivo an agent inhibiting a level or activity of an IFI16 polypeptide when such prodrug is administered to a patient. Prodrugs are generally prepared by modifying functional groups in a way such that the modification is cleaved, either by routine manipulation or in vivo, yielding the biologically active agent.

b. IFI16 Polypeptide and IFI16 Expression Vectors

[00252] A subject IFI16 polypeptide used in a screening method of the present invention may be a naturally occurring IFI16 polypeptide or a recombinant IFI16 polypeptide as described herein. A naturally occurring IFI16 polypeptide can be purified, e.g., from human or mouse tissue or e.g., from human or mouse cells. Recombinant IFI16 can be purified from any suitable expression system as known in the art, e.g., purification of recombinant proteins from a host cell, preferably a mammalian host cell. In certain embodiments, an IFI16 polypeptide is an IFI16 related polypeptide. As described herein, an IFI16 polypeptide for use in a screening method can be from various species, including, but not limited to, human, mouse, or rat. A preferred IFI16 polypeptide is a human IFIl 6 polypeptide.

[00253] As further described herein, an IFI16 polypeptide for use in a screening method may be a full-length IFI16 or a fragment or domain thereof. In addition, an IFIl 6 related polypeptide, an IFIl 6 homolog, an IFIl 6 isoform or an IFIl 6 ortholog can be used to practice screening methods and compositions of the present invention. A preferred IFI16 polypeptide fragment of the present invention comprises a nucleic acid binding domain.

[00254] In some embodiments, the effect of a test agent on an 1F116 protein level of IF! 16 activity is determined by introducing expression vectors, which include IFI16 coding sequences, into suitable eukaryotic cells in in vitro culture, generating genetically modified cells that produce IFI16 proteins; contacting the genetically modified cells with a test agent; and determining the effect, if any, of the test agent on the level of IFI16 protein (or level of IFI16 mRNA) produced by the genetically modified cell. Likewise, the effect, if any, of the test agent on an IFI16 activity is determined.

[00255] Expression vectors that are suitable for expression in eukaryotic cells are constructed to include a coding region for a IFI16 protein (for production of IFI16 protein in the cell). An IFI16 nucleic acid used in a screening method of the present invention may be a naturally occurring IFI16 nucleic acid or a recombinant IFI16 nucleic acid as described herein.

[00256] An expression vector comprising an IFI16 coding region will generally include regulatory sequences ("control sequences" or "control regions") which are necessary to effect the expression of an IFI16-coding polynucleotide to which they are operably linked.

Expression vectors typically comprise a transcription initiation region, a promoter region, an IF116-coding nucleotide sequence, and a transcriptional termination region. Suitable promoters include constitutive promoters and inducible promoters, a number of which are well known in the art. Expression vectors generally have convenient restriction sites located near the promoter sequence to provide for the insertion of nucleic acid sequences encoding IFI16 protein(s). A selectable marker operative in the expression host may be present.

Suitable nucleic acid sequences encoding IFI16 are provided herein by reference to GenBank accession numbers. Similarly, suitable nucleic acid sequences encoding ASC or caspase-1 are provided herein by reference to GenBank accession numbers.

c. Controls

[00257] The invention provides in vitro assays for identifying, e.g., in a high throughput format, agents that can inhibit a level or activity of an IFI16 polypeptide. Control reactions that measure a level or activity of the IFI16 polypeptide in a reaction that does not include a test agent are optional, as the assays are highly uniform. However, such optional control reactions are appropriate and increase the reliability of the assay. Accordingly, in some embodiments, the methods of the invention include a control reaction. For each of the assay formats described herein, a "no agent" control reaction, which does not include the test agent, provides a background level or background activity of the IFI16.

[00258] Thus, assays of the invention usually include one or more controls. Thus, a test sample includes a test agent, and a control sample has all the components of the test sample except for the test agent. Generally a plurality of assay mixtures is run in parallel with different agent concentrations to obtain a differential response to the various concentrations. Typically, one of these concentrations serves as a negative control, i.e. at zero concentration or below the level of detection. Screening methods of the present invention involve screening agents to identify an agent that inhibits a level or activity of an IFI16. The tenn "inhibit a level or activity of an IFI16" encompasses a decrease in the measured level of an 1FI16 polypeptide, a decrease in the measured level of an 1FI16 nucleic acid, or a decrease in a measured IFI16 activity, when compared to a suitable control.

[00259] An agent of interest and for use in a therapeutic method described herein is an agent that decreases a level or activity of an IFI16 polypeptide by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 55%, at least about 60%, at least about 65%, at least about 70%, at least about 75%, at least about 80%, at least about 85%, at least about 90%, at least about 95%, at least about 100%, relative to a suitable control, preferably a control in the absence of the agent.

d. Labels

[00260] In some embodiments of the present invention, a screening assay comprises one or more molecules, such as an IFI16 polypeptide, an ASC polypeptide, a caspase-1 polypeptide, or a STING polypeptide that are joined to a label. The label directly or indirectly provides a detectable signal. Various labels can be used. Useful labels include, but are not limited to, radioisotopes, fluorescers, chemiluminescers, enzymes (such as horseradish peroxidase or alkaline phosphatase), specific binding molecules, particles, e.g. magnetic particles, and the like. Specific binding molecules include pairs, such as biotin and streptavidin, digoxin and antidigoxin, etc. For the specific binding members, the complementary member would normally be labeled with a molecule that provides for detection, in accordance with known procedures.

[00261] Labels also include epitopes recognized by an antibody, and equivalents thereof. e. Additional Components in Screening Assays

[00262] As one of ordinary skill in the art will appreciate, a variety of reagents may be included in a screening method or screening assay. These include reagents like salts, neutral proteins, e.g. albumin, detergents, etc. that are used to facilitate optimal protein-protein binding and/or reduce non-specific or background interactions. Reagents that improve the efficiency of the assay, such as nuclease inhibitors, anti-microbial agents, etc. may be used. The components may be added in any order. Incubations are performed at any suitable temperature, typically between 4°C and 40°C. Incubation periods are selected for optimum activity, but may also be optimized to facilitate rapid high-throughput screening. Typically, an incubation period of between 0.1 and 1 hour will be sufficient.

f. Assay Formats

[00263] Screening methods and screening assays may be designed in a number of different ways, where a variety of assay configurations and protocols may be employed, as are known in the art. Agents for inhibiting an IFI16 activity as described herein, can be identified, tested and verified using a variety of assays. These assays include, but are not limited to, for example, Northern blot assays, in situ hybridization, Western blot assays,

immunoprecipitation assays, immunohistochemistry, cell-based assays, binding assays, and an in vivo assay, and the like. In vitro assays may use a purified IF! 16 polypeptide or a multiprotein complex comprising an IFI16 polypeptide.

i. In Vitro Assays

[00264] In some embodiments of the present invention, a screening protocol is used in vitro.

[00265] For in vitro assays, a subject polypeptide, such as an IFI16 polypeptide, may be, but need not be purified. Subject proteins can be purified to substantial purity, e.g., by column chromatography, immunopurification methods, selective precipitation using ammonium sulfate, and others. Purification of subject polypeptides from cells or host cells can be partial. Preferred, however, are subject polypeptides that are at least about 50%, at least about 60%, at least about 70%, at least about 80%, or at least about 90% pure as determined by standard SDS-PAGE.

[00266] In some embodiments, one of the components, e.g., an IFI16 polypeptide, is bound to a solid support, and the remaining components are contacted with the support bound component. [00267] Where the assay is a binding assay, following the contacting and incubation steps, the subject methods will generally, though not necessarily, further include a washing step to remove unbound components, where such a washing step is generally employed when required to remove label that would give rise to a background signal during detection, such as radioactive or fluorescently labeled non-specifically bound components. Following the optional washing step, the presence of bound complexes will then be detected.

[00268] The interaction between two molecules, such as IFI16 and ASC, procaspase-1 or STING and an agent or IFI16 and an agent can also be detected, e.g., using a fluorescence assay in which at least one molecule is fluorescently labeled. One example of such an assay includes fluorescence energy transfer (FET or FRET for fluorescence resonance energy transfer) (see, for example, Lakowicz et al., U.S. Pat. No. 5,631, 169; Stavrianopoulos et al., U.S. Pat. No. 4,868, 103). A fluorophore label on the first, ^" donor ^" molecule is selected such that its emitted fluorescent energy will be absorbed by a fluorescent label on a second, ^" acceptor" molecule, which in turn is able to fluoresce due to the absorbed energy.

Alternately, the ^" donor ^" protein molecule may simply utilize the natural fluorescent energy of tryptophan residues. Labels are chosen that emit different wavelengths of light, such that the "acceptor ^" molecule label may be differentiated from that of the ^" donor. ^" Since the efficiency of energy transfer between the labels is related to the distance separating the molecules, the spatial relationship between the molecules can be assessed. In a situation in which binding occurs between the molecules, the fluorescent emission of the "acceptor ^" molecule label in the assay should be maximal. A FET binding event can be conveniently measured through standard fluorimetric detection means (e.g., using a fluorimeter).

[00269] Another example of a fluorescence assay is fluorescence polarization (FP). For FP, only one component needs to be labeled. A binding interaction is detected by a change in molecular size of the labeled component. The size change alters the tumbling rate of the component in solution and is detected as a change in FP (see, e.g., Nasir et al., 1999, Comb Chem HTS 2: 177-190; Jameson et al., 1995, Methods Enzymol 246:283; Seethala et al., 1998, Anal Biochem 255:257). Fluorescence polarization can be monitored in multiwell plates, e.g., using the Tecan Polarion.TM. reader (see, e.g., Parker et al., 2000, J Biomol Screen 5:77-88; and Shoeman, et al, 1999, Biochemistry 38: 16802-16809).

[00270] In another embodiment, determining the ability of a protein, such as an IFI16 protein, to bind to a target molecule (e.g., ASC, procaspase-1 , STING) or the ability of an agent to bind to an l 6 polypeptide can be accomplished using real-time Biomolecular Interaction Analysis (BIA) (see, e.g., Sjolander and Urbaniczky, 1991, Anal Chem 63:2338- 2345 ; Szabo et al., 1995, Curr Opin Struct Biol 5:699-705). "Surface plasmon resonance" or "BIA" detects biospecific interactions in real time, without labeling any of the interactants (e.g., BIAcore). Changes in the mass at the binding surface (indicative of a binding event) result in alterations of the refractive index of light near the surface (the optical phenomenon of surface plasmon resonance (SPR), resulting in a detectable signal which can be used as an indication of real-time reactions between biological molecules.

ii. In Vivo Assays

[00271] Identification and testing of agents for inhibiting a level or activity of an IFI16 polypeptide can also be performed in vivo. In this method, an agent is administered to a non- human animal, preferably a mouse, more preferred, an animal model for HTV-1 infection, and blood samples or tissue samples are taken from the animal at various times after

administration of the agent and tested for a level or activity of IFI16.

iii. Cell-Based Assays

[00272] Identification and testing of agents for inhibiting a level or activity of an IFI16 can also be performed using cell-based assays. Thus, other preferred screening protocols can be used in cells, particularly mammalian cells, and preferably, human cells.

[00273] In some embodiments, an IFI16 protein whose activity is being assayed is an endogenous protein (e.g., an IFI16 protein that is normally produced by the cell). In some embodiments, an IFI16 protein whose activity is being assayed is encoded on an expression construct and introduced into a cell, such that the encoded IFI16 protein is produced in the cell.

[00274] Whether a test agent inhibits an IFI16 protein level can be determined by any known method for determining the level of a particular protein in a cell. In some embodiments, the assay is an immunological assay, using an anti-IFI16 antibody. Such methods include, but are not limited to, immunoprecipitating Ml 6 from a cellular extract, and analyzing the immunoprecipitated IFI16 by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE); detecting a detectable fusion partner in a cell that produces a fusion protein that includes IFI16 and a fusion partner that provides a detectable signal; standard SDS-PAGE and immunoblotting (e.g., transfer of proteins from a gel generated during SDS-PAGE to a membrane, and probing the membrane with detectably labeled antibodies) of IFI16 from cells producing IFI16. [00275] Expression vectors are introduced into eukaryotic cells using any convenient means, including calcium phosphate precipitation; electroporation; infection (where the expression vectors are packaged into viral particles); liposome-mediated transfection; and the like. Suitable cells are eukaryotic cells, typically mammalian cells, including primary cells, immortalized cell lines, etc., including, but not limited to, COS cells, 293T cells, Jurkat cells, H9 cells, and the like.

[00276] In some embodiments, T lymphocytes, B lymphocytes, natural killer (NK) cells, macrophages, eosinophils, mast cells, dendritic cells, or neutrophils are used.

[00277] A cell can be transiently or stably transfected with an expression construct, such as an IFI16 expression construct, an ASC expression construct, or a procaspase-1 expression construct.

[00278] In some embodiments of the screening methods of the present invention, a two- hybrid system utilizing cells may be used ("MATCHMAKER Two-Hybrid system", "Mammalian MATCHMAKER Two-Hybrid Assay Kit", "MATCHMAKER one-Hybrid system" (Clontech); "HybriZAP Two-Hybrid Vector System" (Stratagene); see also Dalton and Treisman, 1992, Cell 68: 597-612; Fields and Sternglanz, 1994, Trends Genet 10:286- 92).

[00279] In the two-hybrid system, for example, an IFI16 polypeptide, is fused to the SRF- binding region or GAL4-binding region and expressed in yeast cells. An ASC, procaspase-1 or STING polypeptide that binds to the IFI16 polypeptide is fused to the VP16 or GAL4 transcriptional activation region and also expressed in the yeast cells in the presence or absence of an agent. Alternatively, the ASC, procaspase-1 or STING polypeptide that binds to the IFI16 polypeptide may be fused to the SRF-binding region or GAL4-binding region, and the IFI16 polypeptide is fused to the VP 16 or GAL4 transcriptional activation region. The binding of the two hybrid polypeptides activates a reporter gene, making positive clones detectable. As a reporter gene, for example, Ade2 gene, lacZ gene, CAT gene, luciferase gene and HIS3 gene can be used.

[00280] An agent that does not bind to IFI16 or ASC, procaspase-1 or STING does not affect the activation of the reporter gene. However, an agent that decreases the binding of IFI16 to ASC, procaspase-1 or STING results in a weaker activation of the reporter gene. iv. Computer-Based Assays

[00281] It is also possible to use structure-activity relationships (SAR) and structure-based design principles to identify agents decreasing a level or activity of a polypeptide, such as an IFI16 polypeptide. SARs provide information about the activity of related agents in at least one relevant assay. Correlations are made between structural features of an agent of interest and an activity. For example, it may be possible by evaluating SARs for a family of agents that interact with an IFI16 polypeptide to identify one or more structural features required for activity. A library of agents can then be produced that vary these features and then the library is screened. Structure-based design can include determining a structural model of the physical interaction of the agent and its target, such as an IFI16 polypeptide. The structural model can indicate how an antagonist of the target can be engineered.

[00282] Both the SAR and the structure-based design approach can be used to identify a pharmacophore. Pharmacophores are a highly valuable and useful concept in drug discovery and drug-lead optimization. A pharmacophore is defined as a distinct three dimensional (3D) arrangement of chemical groups essential for biological activity. Since a pharmaceutically active molecule must interact with one or more molecular structures within the body of the subject in order to be effective, and the desired functional properties of the molecule are derived from these interactions, each active compound must contain a distinct arrangement of chemical groups which enable this interaction to occur. The chemical groups, commonly termed descriptor centers, can be represented by (a) an atom or group of atoms; (b) pseudo- atoms, e.g., a center of a ring, or the center of mass of a molecule; (c) vectors, e.g., atomic pairs, electron lone pair directions, or the normal to a plane. Once fonnulated, a

pharmacophore can be used to search a database of chemical compounds, e.g., for those having a structure compatible with the pharmacophore (see, for example, U.S. Pat. No. 6,343,257; Martin, 1992, J Med Chem 35, 2145-54). Database search queries are based not only on chemical property information but also on precise geometric information.

[00283] Computer-based approaches can use database searching to find matching templates (Martin, 1992, J Med Chem 35 :2145-54; incorporated herein by reference).

Existing methods for searching 2-D and 3-D databases of compounds are applicable. Lederle of American Cyanamid (Pearl River, N.Y.) has pioneered molecular shape-searching, 3D searching and trend-vectors of databases. Commercial vendors and other research groups also provide searching capabilities (MACSS-3D, Molecular Design Ltd. (San Leandro, Calif.); CAVEAT, Lauri, G et al., University of California (Berkeley, Calif.); CHEM-X, Chemical Design, Inc. (Mahwah, N.J.)). Software for these searches can be used to analyze databases of potential drug compounds indexed by their significant chemical and geometric structure (e.g., the Standard Drugs File (Derwent Publications Ltd., London, England), the Bielstein database (Bielstein Information, Frankfurt, Germany or Chicago) and the Chemical Registry database (CAS, Columbus, Ohio)).

[00284] Once a compound is identified that matches the pharmacophore, it can be tested for activity, e.g., for binding to a polypeptide and/or for modulating a biological activity of a polypeptide, e.g., decreasing an IFI16 polypeptide activity.

[00285] Thus, in one aspect of the present invention, an agent is identified that is designed to interact with an IFI16 polypeptide or binds to an IFI16 polypeptide by employing a structure of an IFI16 polypeptide.

[00286] Thus, another assay for candidate agents that inhibit the level or activity of an IFI16 polypeptide involves computer assisted drug design, in which a computer system is used to generate a three-dimensional structure of an IFI16 polypeptide on the structural information encoded by its amino acid sequence. The input amino acid sequence interacts directly and actively with a pre-established algorithm in a computer program to yield secondary, tertiary, and quaternary structural models of the protein. The models of the protein structure are then examined to identify regions of the structure that have the ability to bind, e.g., another polypeptide or an agent. These regions are then used to identify inhibitors that inhibit a level or activity of an IFI16 polypeptide.

[00287] The three-dimensional structural model of the protein is generated by entering protein amino acid sequences of at least 10 amino acid residues or corresponding nucleic acid sequences encoding an IFI16 polypeptide into the computer system. The amino acid sequences encoded by the nucleic acid sequences provided herein (see GenBank accession numbers) represent the primary sequences or subsequences of the proteins, which encode the structural information of the proteins. At least 10 residues of an amino acid sequence (or a nucleotide sequence encoding 10 amino acids) are entered into the computer system from computer keyboards, computer readable substrates that include, but are not limited to, electronic storage media (e.g., magnetic diskettes, tapes, cartridges, and chips), optical media (e.g., CD ROM), information distributed by internet sites, and by RAM. The three- dimensional structural model of the protein is then generated by the interaction of the amino acid sequence and the computer system, using software known to those of skill in the art. [00288] The amino acid sequence represents a primary structure that encodes the information necessary to fonn the secondary, tertiary and quaternary structure of the protein of interest. The software looks at certain parameters encoded by the primary sequence to generate the structural model. These parameters are referred to as "energy terms," and primarily include electrostatic potentials, hydrophobic potentials, solvent accessible surfaces, and hydrogen bonding. Secondary energy terms include van der Waals potentials.

Biological molecules form the structures that minimize the energy terms in a cumulative fashion. The computer program is therefore using these terms encoded by the primary structure or amino acid sequence to create the secondary structural model.

[00289] The tertiary structure of the protein encoded by the secondary structure is then formed on the basis of the energy terms of the secondary structure. The user at this point can enter additional variables such as whether the protein is membrane bound or soluble, its location in the body, and its cellular location, e.g., cytoplasmic, surface, or nuclear. These variables along with the energy terms of the secondary structure are used to form the model of the tertiary structure. In modeling the tertiary structure, the computer program matches hydrophobic faces of secondary structure with like, and hydrophilic faces of secondary structure with like.

[00290] Once the structure has been generated, potential binding regions on the polypeptide are identified by the computer system. Three-dimensional structures for potential agents are generated by entering amino acid or nucleotide sequences or chemical formulas of compounds, as described herein. The three-dimensional structure of the potential agent is then compared to that of IFI16 to identify binding sites on IFI16. Binding affinity between the protein and agents is determined using energy terms to determine which agents have an enhanced probability of binding to the protein.

v. High Throughput Assays

[00291] In some embodiments, a method for identifying an inhibitor inhibiting a level or activity of an IFI16 comprises a high throughput screening method. In some embodiments, a high throughput screening method involves providing a combinatorial chemical or peptide library containing a large number of agents and thus, potential therapeutic compounds. Such "combinatorial chemical libraries" are then screened in one or more assays, as described herein, to identify those library members (particular chemical species or subclasses) that display a desired characteristic activity. The agents thus identified can serve as conventional "lead agents" or can themselves be used as potential or actual therapeutics. [00292] Preparation and screening of combinatorial chemical libraries is well known to those of skill in the art. Such combinatorial chemical libraries include, but are not limited to, peptide libraries (see, e.g., U.S. Pat. No. 5,010, 175, Furka, 1991, Int JPept Prot Res 37:487- 493 (1991) and Houghton et al., 1991, Nature 354:84-88). Other chemistries for generating chemical diversity libraries can also be used. Such chemistries include, but are not limited to, peptoids (e.g., PCT Publication No. WO 91/19735), encoded peptides (e.g., PCT Publication No. WO 93/20242), random bio-oligomers (e.g., PCT Publication No. WO 92/00091), benzodiazepines (e.g., U.S. Pat. No. 5,288,514), diversomers such as hydantoins,

benzodiazepines and dipeptides (Hobbs et al., 1993, Proc Natl Acad Sci USA 90:6909-6913), vinylogous polypeptides (Hagihara et al., 1992, JAmer Chem Soc 114:6568), nonpeptidal peptidomimetics with glucose scaffolding (Hirschmann et al., 1 92, JAmer Chem Soc 1 14:9217-9218), analogous organic syntheses of small compound libraries (Chen et al., 1 94, JAmer Chem Soc 1 16:2661), oligocarbamates (Cho et al., 1993, Science 261 : 1303), and/or peptidyl phosphonates (Campbell et al, 1994, J Org Chem 59:658), nucleic acid libraries (see, Ausubel, Berger and Sambrook), peptide nucleic acid libraries (see, e.g., U.S. Pat. No.

5,539,083), antibody libraries (see, e.g., Vaughn et al., 1996, Nature Biotechnology

14(3):309-314 and PCT/US96/10287), carbohydrate libraries (see, e.g., Liang et al., 1996, Science 274: 1520-1522 and U.S. Pat. No. 5,593,853), small organic molecule libraries (see, e.g., benzodiazepines, Baum C&EN, Jan. 18, 1993, page 33; isoprenoids, U.S. Pat. No.

5,569,588; thiazolidinones and metathiazanones, U.S. Pat. No. 5,549,974; pyrrolidines, U.S. Pat. Nos. 5,525,735 and 5,519,134; morpholino compounds, U.S. Pat. No. 5,506,337;

benzodiazepines, U.S. Pat. No. 5,288,514, and the like). Additional examples of methods for the synthesis of molecular libraries can be found, e.g., in: DeWitt et al, 1993, Proc Natl Acad Sci USA 90:6909; Erb et al, 1994, Proc Natl Acad Sci USA 91 : 1 1422; Zuckemmann et al., 1994, J Med Chem 37:2678; Cho et al., 1993, Science 261 : 1303; Carrell et al., 1994, Angew Chem Int EdEngl 33:2059; Carell et al., 1994, Angew Chem Int Ed Engl 33:2061 ; and Gallop et al., 1994, J Med Chem 37: 1233.

[00293] High throughput assays are often used in screening for agents. Thus, in high throughput assays for identifying inhibitors of an IFI16 activity, it is possible to screen up to several thousand different candidate agents or ligands in a single day. In particular, each well of a microtiter plate can be used to run a separate assay against a selected potential agent, or, if concentration or incubation time effects are to be observed, every 5-10 wells can test a single agent. Thus, a single standard microtiter plate can assay about 100 (e.g., 96) agents. If 1 ,536 well plates are used, then a single plate can easily assay from about 100 to more than 1,500 different agents. It is possible to assay several different plates per day; assay screens for up to about 6,000-20,000 different agents are possible using the integrated systems of the invention. Also microfluidic approaches to reagent manipulation are useful to practice aspects of the present invention.

[00294] Various assay formats can be used. For example, the molecule of interest can be bound to the solid state component, directly or indirectly, via covalent or non-covalent linkage, e.g., via a tag. The tag can be any of a variety of components. In general, a molecule that binds the tag (a tag binder) is fixed to a solid support, and the tagged molecule of interest (e.g., an IFI16 polypeptide as described herein) is attached to the solid support by interaction of the tag and the tag binder.

[00295] A number of tags and tag binders can be used, based upon known molecular interactions well described in the literature. For example, where a tag has a natural binder, for example, biotin, protein A, or protein G, it can be used in conjunction with appropriate tag binders (avidin, streptavidin, neutravidin, the Fc region of an immunoglobulin, etc.).

Antibodies to molecules with natural binders such as biotin and appropriate tag binders are also widely available (see, SIGMA Immunochemicals 1998 catalogue SIGMA, St. Louis Mo).

[00296] Similarly, any haptenic or antigenic compound can be used in combination with an appropriate antibody to form a tag/tag binder pair. Thousands of specific antibodies are commercially available and many additional antibodies are described in the literature. For example, in one common configuration, the tag is a first antibody and the tag binder is a second antibody which recognizes the first antibody. In addition to antibody-antigen interactions, receptor-ligand interactions are also appropriate as tag and tag-binder pairs, such as agonists and antagonists of cell membrane receptors (e.g., cell receptor-ligand interactions such as transferrin, c-kit, viral receptor ligands, cytokine receptors, chemokine receptors, interleukin receptors, immunoglobulin receptors and antibodies, the cadherin family, the integrin family, the selectin family, and the like; see, e.g., Pigott & Power, The Adhesion Molecule Facts Book I (1993)). Similarly, toxins and venoms, viral epitopes, hormones (e.g., opiates, steroids, etc.), intracellular receptors (e.g., which mediate the effects of various small ligands, including steroids, thyroid hormone, retinoids and vitamin D; peptides), drugs, lectins, sugars, nucleic acids (both linear and cyclic polymer configurations), oligosaccharides, proteins, phospholipids and antibodies can all interact with various cell receptors.

[00297] Synthetic polymers, such as polyurethanes, polyesters, polycarbonates, polyureas, polyamides, polyethyleneimines, polyarylene sulfides, polysiloxanes, polyimides, and polyacetates can also form an appropriate tag or tag binder. Many other tag/tag binder pairs are also useful in assay systems described herein, as would be apparent to one of skill upon review of this disclosure.

[00298] Common linkers such as peptides, polyethers, and the like can also serve as tags, and include polypeptide sequences, such as poly Gly sequences of between about 5 and 200 amino acids. Such flexible linkers are known to those of skill in the art. For example, poly(ethylene glycol) linkers are available from Shearwater Polymers, Inc., Huntsville, Ala. These linkers optionally have amide linkages, sulfhydryl linkages, or heterofunctional linkages.

[00299] Tag binders can be fixed to solid substrates using any of a variety of methods currently available. Solid substrates are commonly derivatized or functionalized by exposing all or a portion of the substrate to a chemical reagent which fixes a chemical group to the surface which is reactive with a portion of the tag binder. For example, groups which are suitable for attachment to a longer chain portion would include amines, hydroxyl, thiol, and carboxyl groups. Aminoalkylsilanes and hydroxyalkylsilanes can be used to functionalize a variety of surfaces, such as glass surfaces. The construction of such solid phase biopolymer arrays is well described in the literature (see, e.g., Merrifield, 1965, Endeavour 24:3-7; Merrifield, 1964, Biochemistry 3: 1385-90; Merrifield and Stewart, 1965, Nature

207(996):522-3; Merrifield, 1965, Science 150(693): 178-85 (describing solid phase synthesis of, e.g., peptides); Geysen et al., 1987, J Immun Meth 102:259-274 (describing synthesis of solid phase components on pins); Frank and Doring, 1988, Tetrahedron 44:6031-6040 (describing synthesis of various peptide sequences on cellulose disks); Fodor et al, 1991, Science 251 :767-777; Sheldon et al„ 1993, Clinical Chemistry 39(4):718-719; and Kozal et al., 1996, Nature Medicine 2(7):753-759 (all describing arrays of biopolymers fixed to solid substrates). Non-chemical approaches for fixing tag binders to substrates include other common methods, such as heat, cross-linking by UV radiation, and the like.

g. Contacting an Agent

[00300] In general terms, a screening method for identifying an agent that decreases an IFI16 activity involves screening a variety of agents. In some embodiments of the present invention, a screening method comprises the step of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide or (in) a mammalian cell expressing an IFI16 polypeptide; and (b) assaying a level or activity of the IFI16 polypeptide in the presence of the agent. A decrease in the level or activity of an IFI16 polypeptide measured in comparison to the level or activity of the IFU 6 polypeptide in a suitable control (e.g., an IFI16 polypeptide in the absence of the agent, a biological sample comprising an IFI16 polypeptide in the absence of the candidate agent or a mammalian cell expressing an IFI16 polypeptide in the absence of the candidate compound) is an indication that the agent decreases a level or an activity of the IFI16 polypeptide.

[00301] Determining the effect of the agent on the level or activity of an IFI16 in a cell or in an assay mixture can be performed in a variety of ways. In a preferred embodiment, this step comprises an immunological assay using an antibody specific for IFI16 as described herein. A decrease of detectable IFI16 polypeptide in the presence of an agent is indicative of an agent decreasing an IFI16 activity.

[00302] In some embodiments of the present invention, a screening method for identifying an agent that decreases an IFI16 activity comprises the step of (a) contacting an agent with (i) an IF116 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide or (iii) a mammalian cell expressing an IFI16 polypeptide; and (b) determining if the agent binds to the IFI16 polypeptide. Thereby an agent binding to an IFI16 polypeptide is identified.

h. Assessing Agents for Cytotoxic Activity

[00303] Agents that inhibit an IFI16 activity to a desired extent may be selected for further study, and assessed for cellular availability, cytotoxicity, biocompatibility, etc. A candidate agent is assessed for any cytotoxic activity it may exhibit toward the cell used in an assay. Such assays include, but are not limited to, a trypan blue dye exclusion assay, an MTT ([3- (4,5-dimethylthiazol-2-yl)-2,5-diphenyl-2H-tetrazolium bromide]) assay, and the like.

Agents that do not exhibit significant cytotoxic activity are considered candidate agents for therapeutic treatment.

i. Detection of mRNA

[00304] Methods of the present invention may optionally comprise the step of detecting a nucleic acid, such as an mRNA. In one embodiment, such a method comprises determining or detecting an mRNA, preferably an IFI16 mRNA, an ASC mRNA or a procaspase-1 mRNA. Other mRNAs encoding polypeptides described herein can also be determined using the following methods. Methods of evaluating mRNA expression of a particular gene are well known to those of skill in the art, and include, inter alia, hybridization and amplification based assays.

i. Hybridization-based Assays

[00305] Methods of detecting and/or quantifying the level of a gene transcript (mRNA or cDNA made therefrom) using nucleic acid hybridization techniques are known to those of skill in the art. For example, one method for evaluating the presence, absence, or quantity of a polynucleotide involves a Northern blot. Gene expression levels can also be analyzed by techniques known in the art, e.g., dot blotting, in situ hybridization, RNase protection, probing DNA microchip arrays, and the like (e.g., see Sambrook, J., Fritsch, E. F., and Maniatis, "Molecular Cloning A Laboratory Manual" published by Cold Spring Harbor Laboratory Press, 2nd edition, 1989).

ii. Amplification-based Assays

[00306] In another embodiment, amplification-based assays are used to measure the expression level of a gene. In such an assay, the nucleic acid sequences act as a template in an amplification reaction (e.g., Polymerase Chain Reaction, or PCR). In a quantitative amplification, the amount of amplification product will be proportional to the amount of template in the original sample. Comparison to appropriate controls provides a measure of the level of an mRNA in the sample. Methods of quantitative amplification are well known to those of skill in the art. Detailed protocols for quantitative PCR are provided, e.g., in Innis et al. (1990) PCR Protocols, A Guide to Methods and Applications, Academic Press, Inc. N.Y.).

[00307] In one embodiment, a TaqMan-based assay is used to quantify a polynucleotide. TaqMan-based assays use a fluorogenic oligonucleotide probe that contains a 5' fluorescent dye and a 3' quenching agent. The probe hybridizes to a PCR product, but cannot itself be extended due to a blocking agent at the 3' end. When the PCR product is amplified in subsequent cycles, the 5' nuclease activity of the polymerase, e.g., AmpliTaq, results in the cleavage of the TaqMan probe. This cleavage separates the 5' fluorescent dye and the 3' quenching agent, thereby resulting in an increase in fluorescence as a function of amplification (see, for example, Heid et al, 1996, Genome Res 6(10):986-94; Morris et al., 1996, J Clin Microbiol 34(12):2933-6).

[00308] Other suitable amplification methods include, but are not limited to, ligase chain reaction (LCR) (see, Wu and Wallace, 1989, Genomics 4:560; Landegren et al., 1988, Science 241 : 1077; and Barringer et al., 1990, Gene 89: 1 17), transcription amplification (Kwoh et al., 1989, Proc Natl Acad Sci USA 86: 1 173), self-sustained sequence replication (Guatelli et al., 1990, Proc Natl Acad Sci USA 87: 1874), dot PCR, and linker adapter PCR, etc.

i. Detection of Polypeptide

[00309] Methods of the present invention may optionally comprise the step of determining or detecting a polypeptide, such as an IFI16 polypeptide, an ASC polypeptide, or a procaspase-1 polypeptide. Other polypeptides described herein can also be determined using the following methods.

[00310] The expression level of a polypeptide may be determined by a variety of methods, including, but not limited to, affinity capture, mass spectrometry, traditional immunoassays and immunoprecipitation assays, PAGE, Western Blotting, R1A, or HPLC, or as known by one of skill in the art.

[00311] Detection paradigms that can be employed to this end include optical methods, electrochemical methods (voltametry and amperometry techniques), atomic force microscopy, and radio frequency methods, e.g., multipolar resonance spectroscopy.

Illustrative of optical methods, in addition to microscopy, both confocal and non-confocal, are detection of fluorescence, luminescence, chemi luminescence, absorbance, reflectance, transmittance, and birefringence or refractive index (e.g., surface plasmon resonance, ellipsometry, a resonant mirror method, a grating coupler waveguide method or

interferometry).

[00312] The following describes with particularity screening assays involving measuring a level of an IFI16 nucleic acid, of an IFI16 polypeptide and/or of an IFI16 activity. IFI16 nucleic acids and polypeptides and general considerations useful for practicing those assays have been described herein and are not set forth again in the context of the specific methods described below.

2. Screening For IFI16 Inhibitors Inhibiting An IFI16 Level Or An IFI16 Activity

[00313] The present invention provides methods of identifying an agent that inhibits an IFI16 level or an IFI16 activity. More specifically, the present invention provides an in vitro screening method for identifying an agent inhibiting an IFI16 level or an IF116 activity. Thus, a method for identifying an agent that inhibits an IFI16 level or an IFI16 activity is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 or (iii) a mammalian cell expressing an IFI16 polypeptide and (b) determining the effect, if any, of the agent on the IFI16 level or on the IFI16 activity. Thereby an agent inhibiting an IFI16 level or an IFI16 activity is identified.

[00314] A test agent that affects an IFI16 level or an IFI16 activity is a candidate agent for treating lentiviral infections, such as an HIV-1 infection and AIDS, and for use in a subject treatment method described herein.

[00315] A subject assay for identifying agents that inhibit an IFI16 level or an IFI16 activity can be designed in a number of ways. In some embodiments, the assay provides for determining the effect of a test agent on a level or on an activity of an IFI16 protein in a cell. In some embodiments, the assay provides for detennining the effect of a test agent on a level or on an activity of an l 6 protein in a cell-free assay.

[00316] Whether a test agent inhibits an IFI16 level or an IFI16 activity can be determined by methods described herein (see Examples 1-6).

3. Screening For IFI16 Inhibitors Preventing The Death Of CD4 T-Cells

[00317] The present invention provides an in vitro screening method for identifying an IFI16 inhibitor preventing the death of a CD4 T-cell in a population of CD4 T-cells. In some embodiments, the population of CD4 T cells comprises HIV-1 infected and uninfected CD4 T-cells.

[00318] In some embodiments, the method comprises the step of contacting a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells with an agent. In some embodiments, the method comprises the step of determining the death of CD4 T-cells. The death or survival of CD4 T-cells can be determined as described herein.

[00319] In some embodiments, the method comprises the step of identifying the agent as an IFI 16 inhibitor for preventing the death of CD4 T-cells if upon contacting CD4 T-cells with the agent, the death of substantially more CD4 T-cells is prevented when compared to a control wherein the CD4 T-cells are not contacted with the same test agent.

[00320] In some embodiments of this method, the CD4 T-cell comprises incomplete HIV- 1 nucleic acids. In some embodiments of this method, the CD4 T-cell is infected with HIV-1 In some embodiments of this method, the CD4 T-cell comprises an HIV-1 expression vector. Suitable HIV- 1 expression vectors are described herein. 4. Screening For IFI16 Inhibitors Preserving CD4 T-Cells

[00321] As described herein, it was found that HIV-1 infection leads to a decrease of CD4 T-cells in an HIV- 1 infected host. The present invention provides an in vitro screening method for identifying an IFI16 inhibitor preserving CD4 T-cells.

[00322] In some embodiments, the method comprises the step of contacting a CD4 T-cell in a population of CD4 T-cells. In some embodiments, the population of CD4 T-cells comprises HIV-1 infected and uninfected CD4 T-cells with an agent. In some embodiments, the method comprises the step of determining the number of CD4 T-cells preserved. The preservation of CD4 T-cells can be determined as described herein.

[00323] In some embodiments, the method comprises the step of identifying the agent as an IF! 16 inhibitor for preserving CD4 T-cells if upon contacting CD4 T-cells with the agent, substantially more CD4 T-cells are preserved when compared to a control wherein the CD4 T-cells are not contacted with the same agent.

[00324] In some embodiments of this method, the CD4 T-cell comprises incomplete HIV- 1 nucleic acids. In some embodiments of this method, the CD4 T-cell is infected with HIV-1. In some embodiments of this method, the CD4 T-cell comprises an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

5. Screening For IFI16 Inhibitors Inhibiting Formation of Bioactive Interleukin Beta

[00325] Mammalian interleukin- 1 beta (IL-Ιβ) plays an important role in various pathologic processes, including chronic and acute inflammation and autoimmune diseases

(Oppenheim et. al. 1986, Immunology Today, 7:45-56). IL-Ι β is synthesized as a cell associated precursor polypeptide (pro-IL-Ιβ) that is unable to bind IL-1 receptors and is biologically inactive (Mosley et al, 1987, J Biol Chem 262:2941 -2944). By inhibiting conversion of precursor IL-1 β to mature IL-Ι β, the activity of interleukin- 1 can be inhibited.

Interleukin- 1 β converting enzyme (ICE) , also known as caspase-1, is a protease responsible for the activation of IL-1 β (Thornberry et al., 1992, Nature 356:768; Yuan et al., 1993, Cell

75:641). ICE is a substrate-specific cysteine protease that cleaves the inactive prointerleukin-

1 to produce the mature IL-1 .

[00326] As described herein, it was found that in CD4 T-cells, abortive production of HIV-1 reverse transcripts, leads to the production and secretion of bioactive IL-Ι β, and ultimately to cell death (see also Doitsh et al., 2010, Cell 143:789-801 ; Doitsh et al., 2013, Nature 10.1038/naturel2940). The present invention provides an in vitro screening method for identifying an IF116 inhibitor inhibiting the formation of bioactive IL-Ι β.

[00327] Cells, preferably, CD4 T-cells, secreting bioactive IL-Ι β may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting cells secreting IL-Ι β with an agent.

[00328] In some embodiments, the method comprises the step of determining the amount of bioactive and/or secreted IL-Ι β formed. Formation of bioactive and/or secreted IL-Ι β can be determined using assays described herein. For example, IL-l p processing and secretion can be conveniently monitored, e.g., by Western blotting using an anti-IL-Ι β antibody. An increase of IL-Ιβ gene expression can be conveniently monitored, e.g., by PCR or Northern blotting.

[00329] In some embodiments, the method comprises the step of identifying the agent as an IFI16 inhibitor for inhibiting the formation of bioactive IL-Ι β if upon contacting the cells, preferably, CD4 T-cells, with the agent, substantially less bioactive and/or secreted IL-Ι β is formed when compared to a control wherein the cells, preferably, CD4 T-cells, are not contacted with the same agent.

[00330] In some embodiments of this method, cells secreting IL-Ι β comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells secreting IL-Ιβ are infected with HIV-1. In some embodiments of this method, cells secreting IL-Ιβ comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

6. Screening For IFI16 Inhibitors Inhibiting Pyroptosis

[00331] As described herein, it was found that abortive production of HIV-1 reverse transcripts leads to pyroptosis and ultimately to cell death. The present invention provides an in vitro screening method for identifying an IFI16 inhibitor inhibiting pyroptosis.

[00332] Cells, preferably CD4 T-cells undergoing pyroptosis may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting cells undergoing pyroptosis with an agent and determining if pyroptosis is inhibited. Inhibition of pyroptosis can be determined using assays described herein.

[00333] In some embodiments, the method comprises the step of identifying the agent as an IFI16 inhibitor for inhibiting pyroptosis if upon contacting cells, preferably CD4 T-cells, undergoing pyroptosis with the agent, substantially less pyroptosis is determined when compared to a control wherein the cells, preferably CD4 T-cells, undergoing pyroptosis are not contacted with the same agent.

[00334] In some embodiments of this method, cells undergoing pyroptosis comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells undergoing pyroptosis are infected with HIV- 1. In some embodiments of this method, cells undergoing pyroptosis comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

7. Screening For IFI16 Inhibitors Inhibiting Translocation of IFI16 From The Nucleus Into The Cytoplasm

[00335] IFI16 is mainly localized in the nucleus of cells (Hornung et al., 2009, Nature

458:514-518). The present invention provides a method for identifying an agent modulating the cellular localization of an IF116 polypeptide. In a preferred embodiment, this method comprises the steps of (a) contacting a cell expressing an IFI16 polypeptide with an agent and

(b) determining the cellular localization of the IFI16 polypeptide. Thereby an agent modulating the cellular localization of the IFI16 polypeptide is identified

[00336] The present invention further provides an in vitro screening method for identifying an IFI16 inhibitor inhibiting IFI16 translocation from the cell nucleus into the cytoplasm. Presence of IFI 16 in the nucleus and/or cytoplasm or translocating of IFI16 from the nucleus into the cytoplasm can be monitored by immunohistochemical methods.

[00337] Cells, preferably CD4 T-cells may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method of identifying an IFI16 inhibitor inhibiting translocation of IFI16 from the nucleus into the cytoplasm comprises the step of contacting a cell with an agent and determining the cellular localization of IFI16.

[00338] In some embodiments, the method comprises the step of identifying the agent as an IFI16 inhibitor for inhibiting translocation from the nucleus into the cytoplasm if upon contacting cells, preferably CD4 T-cells, with the agent, substantially less l 6 is found in the cytoplasm when compared to a control wherein the cells, preferably CD4 T-cells, are not contacted with the same agent.

[00339] A preferred agent is an agent that increases the localization of an IFI16 polypeptide to the cell nucleus. Increasing the localization of an IFI16 polypeptide includes prolonged retention of the IFI16 polypeptide at the desired cellular location. Cellular localization of an IFI16 polypeptide can be determined by a variety of methods. A preferred non-limiting method is immunohistochemistry or analysis of cellular fractions by immunoblotting using anti-IFI16 antibodies.

[00340] In some embodiments of this method, cells comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells are infected with HIV- 1. In some embodiments of this method, cells comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

[00341] Translocation of IFI16 from the nucleus into the cytoplasm (or from the cytoplasm into the nucleus) can be monitored in various ways, e.g., by confocal microscopy.

8. Screening For IFI16 Inhibitors Decreasing Inflammation

[00342] As described herein, it was found that abortive production of HIV-1 reverse transcripts leads to inflammation in an HIV-1 infected patient. It is desirable to decrease inflammation. It is particularly desirable to decrease inflammation in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides an in vitro screening method for identifying a test agent inhibiting IFI16 and thus, decreasing inflammation. Inflammation may be determined by measuring the expression level of IL-Ι β and other inflammatory cytokines.

[00343] Cells, preferably CD4 T-cells may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting a cell having an up-regulated expression level of one or more inflammatory cytokines (e.g., IL- Ι β) with an agent and determining if inflammation is decreased. A decrease in inflammation is evidenced by a reduced expression level of the one or more inflammatory cytokines, which can be determined using assays described herein. Also a human protein cytokine array kit can be used to determine expression levels of inflammatory cytokines (e.g., Ray Biotech, Norcross, GA, USA). Cytokine expression levels also may be determined in conditioned cell culture medium, e.g., cell culture medium collected at different times p.i. from infected and uninfected cells. For example, secretion of inflammatory cytokines can be conveniently monitored, e.g., by Western blotting using an anti-antibody to the respective inflammatory cytokine. An increase or decrease of inflammatory cytokine gene expression can be conveniently monitored, e.g., by PCR or Northern blotting.

[00344] In some embodiments, the method comprises the step of identifying the agent as an IFI16 inhibitor for decreasing inflammation if upon contacting cells, preferably CD4 T- cells, showing evidence of inflammation with the agent, substantially less expression of one or more inflammatory cytokines is determined when compared to a control wherein the cells, preferably CD4 T-cells, showing evidence of inflammation are not contacted with the same agent.

[00345] In some embodiments of this method, cells showing inflammation comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells showing inflammation are infected with HIV-1. In some embodiments of this method, cells showing inflammation comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

9. Screening For IFI16 Inhibitors Inhibiting Binding of IFI16 To Double-Stranded DNA

[00346] As described herein, it was found that IFI16 binds to double-stranded DNA. It is desirable to inhibit the binding of IFI16 to double-stranded DNA. It is particularly desirable to inhibit the binding of IFI16 to double-stranded DNA in a host infected with HIV-1 and/or in a host having AIDS. Preferably, the double-stranded DNA is a non-cellular double- stranded DNA, i.e., a double-stranded DNA that does not naturally occur in a cell into which it is introduced. Preferably, the double-stranded DNA is a double-stranded DNA comprising HIV-1 sequences.

[00347] The present invention provides an in vitro screening method for identifying an agent inhibiting binding of IFI16 to double-stranded DNA. Thus, a method for identifying an agent that decreases the binding of an IFI16 polypeptide and a double-stranded DNA is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide and a double-stranded DNA or (iii) a mammalian cell expressing an IFI16 polypeptide and comprising a double-stranded DNA and (b) determining the effect, if any, of the agent on the binding of the IFI 16 polypeptide to double-stranded DNA. Thereby an agent inhibiting the binding of an IFI16 polypeptide to a double-stranded DNA is identified.

[00348] Binding to double-stranded DNA can be determined in, e.g., cell-based assays or by in vitro binding assays. Determining binding of IFI16 to double-stranded DNA in a cell- based assay is described herein, e.g., in Example 3.

[00349] Cells, preferably CD4 T-cells may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting a cell comprising an IFI16 polypeptide and a double-stranded DNA with a test agent and determining if binding of the IFI16 polypeptide to the double-stranded DNA is inhibited. An inhibition of IFI16 binding to double-stranded DNA is evidenced by a reduced binding of IFI16 to the double-stranded DNA, which can be determined using assays described herein.

[00350] In some embodiments, the method comprises the step of identifying the agent as an inhibitor for IFI16 binding to double-stranded DNA if, upon contacting cells, preferably CD4 T-cells, with the agent, a substantially reduced binding of IFI16 polypeptide to double- stranded DNA is determined when compared to a control wherein the cells, preferably CD4 T-cells, are not contacted with the same agent.

[00351] The double-stranded DNA, preferably, is in the cytosol of the cell (cytosolic double-stranded DNA).

[00352] The double-stranded DNA may be of various length. In some embodiments of the present invention, the double-stranded DNA comprises at least about 10 base pairs (bps) of dsDNA, at least about 20 bps of dsDNA, at least about 30 bps of dsDNA, at least about 40 bps of dsDNA, at least about 50 bps of dsDNA, at least about 60 bps of dsDNA, at least about 70 bps of dsDNA, at least about 80 bps of dsDNA, at least about 90 bps of dsDNA, at least about 100 bps of dsDNA, at least about 150 bps of dsDNA, or at least about 200 bps of dsDNA. In some embodiments of the present invention, the double-stranded DNA comprises less than about 10 bps of dsDNA, less than about 20 bps of dsDNA, less than about 30 bps of dsDNA, less than about 40 bps of dsDNA, less than about 50 bps of dsDNA, less than about 60 bps of dsDNA, less than about 70 bps of dsDNA, less than about 80 bps of dsDNA, less than about 90 bps of dsDNA, less than about 100 bps of dsDNA, less than about 150 bps of dsDNA, or less than about 200 bps of dsDNA.

[00353] In some embodiments, the double-stranded DNA comprises HIV-1 nucleotide sequences. In some embodiments, the double-stranded DNA comprises HIV-1 dsDNA.

[00354] In some embodiments of this method, the cells comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, the cells are infected with HIV-1. In some embodiments of this method, the cells comprise an HIV- 1 expression vector. Suitable HIV-1 expression vectors are described herein.

[00355] Non cell-based binding assays include, but are not limited to in vitro binding assays comprising a test sample comprising (i) an IFI16 polypeptide and (ii) a double- stranded DNA and (iii) a test agent or (iii) a control agent. Upon combining (i), (ii) and (iii), binding of IFI16 to the dsDNA is determined. In some embodiments, the method comprises the step of identifying the test agent as an inhibitor of IFI16 binding to double-stranded DNA if, upon adding the test agent to the sample, a substantially reduced binding of IFI16 polypeptide to double-stranded DNA is determined when compared to a control wherein the sample is not contacted with the same test agent or a control agent.

[00356] In some embodiments, the double-stranded DNA is bound to a solid support, such as a membrane, an array or a bead. The beads may be magnetic. The dsDNA may comprise a biotin label and the solid support comprises streptavidin for binding the biotinylated dsDNA. IFI16 is added to the dsDNA bound to the solid support and binding of IFI16 to the dsDNA is determined. In some embodiments of the present invention, the IFI16 polypeptide is labeled and binding of IFI16 to the dsDNA is determined by detecting the label. In some embodiments, bound IFI16 is determined using an anti-IFI 6 antibody.

[00357] In some embodiments, the double-stranded DNA, preferably a double-stranded DNA comprising HIV-1 nucleotide sequences, is labeled. Non-limiting labels include a biotin label and a fluorescent label.

[00358] Various dsDNAs can be used in the subject method. In some embodiments, a dsDNA comprises the sequence 5 '-

AAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGG

CTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACAC

AAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGGTCAGATATC

CACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGGTAG

AAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATG

GAATGGATGACCCTGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAG

CATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACA

TCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTG

GGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTT

GCCTGTACTG-3 ' (as used in Example 3).

[00359] In some embodiments, instead of full-length IFT16 polypeptide, a fragment thereof, i.e., a shorter than full-length IFI16 polypeptide, may be used. An IFI16 fragment useful for binding studies with double-stranded DNA is an IFI16 polypeptide comprising a HIN-200 domain. Another IFI16 fragment useful for binding studies with double-stranded DNA is an IFI16 polypeptide comprising both ΗΓΝ-200 domains. 10. Screening For IFI16 Inhibitors Inhibiting Binding Of IFI16

To Single-Stranded DNA

[00360] As described herein, it was found that IFI16 binds to single-stranded DNA. It is desirable to inhibit the binding of IFI16 to single-stranded DNA. It is particularly desirable to inhibit the binding of IFI16 to single-stranded DNA in a host infected with HIV-1 and/or in a host having AIDS. Preferably, the single-stranded DNA is a non-cellular single-stranded

DNA, i.e., a single-stranded DNA that does not naturally occur in a cell into which it is introduced. Preferably, the single-stranded DNA is a double-stranded DNA comprising HIV-

1 sequences. The present invention provides methods for inhibiting the binding of IFI16 to single-stranded DNA.

[00361] The present invention provides an in vitro screening method for identifying an agent inhibiting binding of IFI16 to single-stranded DNA. Thus, a method for identifying an agent that decreases the binding of an IFI16 polypeptide and a single-stranded DNA is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide and a single-stranded DNA or (iii) a mammalian cell expressing an IFI16 polypeptide and comprising a single-stranded DNA and (b) determining the effect, if any, of the agent on the binding of the IFI16 polypeptide to single-stranded DNA. Thereby an agent inhibiting the binding of an IFI16 polypeptide to a single-stranded DNA is identified.

[00362] Binding to single-stranded DNA can be determined in, e.g., cell-based assays or by in vitro binding assays. Determining binding of IFI16 to single-stranded DNA in a cell- based assay is described herein, e.g., in Example 3.

[00363] Cells, preferably CD4 T-cells may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting a cell comprising an IFI16 polypeptide and a single-stranded DNA with a test agent and determining if binding of the IFI16 polypeptide to the single-stranded DNA is inhibited. An inhibition of IFI16 binding to single-stranded DNA is evidenced by a reduced binding of IFI16 to the single-stranded DNA, which can be determined using assays described herein.

[00364] In some embodiments, the method comprises the step of identifying the agent as an inhibitor for IF! 16 binding to single-stranded DNA if, upon contacting cells, preferably CD4 T-cells, with the agent, a substantially reduced binding of IFI16 polypeptide to single- stranded DNA is determined when compared to a control wherein the cells, preferably CD4 T-cells, are not contacted with the same agent.

[00365] The single-stranded DNA, preferably, is in the cytosol of the cell (cytosolic single-stranded DNA).

[00366] The single-stranded DNA may be of various length. In some embodiments of the present invention, the single-stranded DNA comprises at least about 10 nucleotides (nts) of ssDNA, at least about 20 nts of ssDNA, at least about 30 nts of ssDNA, at least about 40 nts of ssDNA, at least about 50 nts of ssDNA, at least about 60 nts of ssDNA, at least about 70 nts of ssDNA, at least about 80 nts of ssDNA, at least about 90 nts of ssDNA, at least about 100 nts of ssDNA, at least about 150 nts of ssDNA, or at least about 200 nts of ssDNA. In some embodiments of the present invention, the single-stranded DNA comprises less than about 10 nts of ssDNA, less than about 20 nts of ssDNA, less than about 30 nts of ssDNA, less than about 40 nts of ssDNA, less than about 50 nts of ssDNA, less than about 60 nts of ssDNA, less than about 70 nts of ssDNA, less than about 80 nts of ssDNA, less than about 90 nts of ssDNA, less than about 100 nts of ssDNA, less than about 150 nts of ssDNA, or less than about 200 nts of ssDNA.

[00367] In some embodiments, the single-stranded DNA comprises HIV-1 nucleotide sequences. In some embodiments, the single-stranded DNA comprises HIV-1 ssDNA.

[00368] In some embodiments of this method, the cells comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, the cells are infected with HIV-1. In some embodiments of this method, the cells comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein.

[00369] Non cell-based binding assays include, but are not limited to in vitro binding assays comprising a test sample comprising (i) an IFI16 polypeptide and (ii) a single-stranded DNA and (iii) a test agent or (iii) a control agent. Upon combining (i), (ii) and (iii), binding of IFI16 to the ssDNA is determined. In some embodiments, the method comprises the step of identifying the test agent as an inhibitor of IFI16 binding to single-stranded DNA if, upon adding the test agent to the sample, a substantially reduced binding of IFI16 polypeptide to single-stranded DNA is determined when compared to a control wherein the sample is not contacted with the same test agent or a control agent.

[00370] In some embodiments, the single-stranded DNA is bound to a solid support, such as a membrane, an array or a bead. The beads may be magnetic. The ssDNA may comprise a biotin label and the solid support comprises streptavidin for binding the biotinylated ssDNA. IFI 16 is added to the ssDNA bound to the solid support and binding of IFI16 to the ssDNA is determined. In some embodiments of the present invention, the IFI16 polypeptide is labeled and binding of IFI16 to the ssDNA is determined by detecting the label. In some embodiments, bound IFIl 6 is determined using an anti-IFI16 antibody.

[00371] In some embodiments, the single-stranded DNA, preferably a single-stranded DNA comprising HIV-1 nucleotide sequences, is labeled. Non-limiting labels include a biotin label and a fluorescent label.

[00372] Various ssDNAs can be used in the subject method. In some embodiments, a ssDNA comprises the sequence 5 '-CAGTACAGGCAAAAAG

CAGCTGCTTATATGCAGCATCTGAGGGCTCGCCACTCCCCAGTCCCGCCCAG GCCACGCCTCCCTGGAAAGTCCCCAGCGGAAAGTCCCTTGTAGCAAGCTCGA TGTCAGCAGTTCTTGAAGTACTCCGGATGCAGCTCTCGGGCCACGTGATGAA ATGCTAGGCGGCTGTC AA ACCTCC ACTC-3 ' ( as used in Example 3).

[00373] In some embodiments, instead of full-length IFIl 6 polypeptide, a fragments thereof, i.e., a shorter than full-length IFI16 polypeptide, may be used. An IFI16 fragment useful for binding studies with single-stranded DNA is an IFIl 6 polypeptide comprising a ΗΓΝ-200 domain. Another IFI16 fragment useful for binding studies with single-stranded DNA is an IF! 16 polypeptide comprising both H1N-200 domains.

11. Screening For IFI16 Inhibitors Inhibiting Binding Of IFI16 To ASC

[00374] It was found that IFIl 6 binds to ASC. It is desirable to inhibit the binding of IFIl 6 to ASC. It is particularly desirable to inhibit the binding of IFIl 6 to ASC in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting the binding of IFIl 6 to ASC.

[00375] The present invention provides an in vitro screening method for identifying an agent inhibiting the binding of an IFIl 6 polypeptide to an ASC polypeptide. Thus, a method for identifying an agent that inhibits the binding of an IFIl 6 polypeptide to an ASC polypeptide is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI l 6 polypeptide, (ii) with a biological sample comprising an IFIl 6 polypeptide and an ASC polypeptide or (iii) a mammalian cell expressing an IFIl 6 polypeptide and an ASC polypeptide and (b) determining the effect, if any, of the agent on the binding of the IFIl 6 polypeptide to the ASC polypeptide. Thereby an agent inhibiting the binding of an IFI16 polypeptide to an ASC polypeptide is identified.

[00376] In some embodiments, ASC is expressed endogenously in a cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to ASC. In some embodiments, ASC is expressed exogenously in a cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to ASC. When expressed exogenously, an expression vector comprising a nucleotide sequence encoding an ASC protein is introduced into the cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to ASC.

[00377] A complex formed between IFI16 and ASC can be detected using, e.g., co- immunoprecipitation and an anti-IFI16 antibody and an anti-ASC-antibody. Similarly, the inhibition of complex formation between IFI16 and ASC in the presence of an agent, such as an IFI16 inhibitor, can be detected using, e.g., co-immunoprecipitation and an anti-IFI16 antibody and an anti-ASC-antibody.

12. Screening For IFI16 Inhibitors Inhibiting Binding Of IFI16 To Caspase-1

[00378] It was found that IFI16 binds to caspase-1. It is desirable to inhibit the binding of IFI16 to caspase-1. It is particularly desirable to inhibit the binding of IFI16 to caspase-1 in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting the binding of IFI16 to caspase-1.

[00379] The present invention provides an in vitro screening method for identifying an agent inhibiting the binding of an IFI16 polypeptide to a caspase-1 polypeptide. Thus, a method for identifying an agent that inhibits the binding of an LFI16 polypeptide to a caspase- 1 polypeptide is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide and a caspase-1 polypeptide or (iii) a mammalian cell expressing an IFI16 polypeptide and a caspase-1 polypeptide and (b) determining the effect, if any, of the agent on the binding of the IFI16 polypeptide to the caspase-1 polypeptide. Thereby an agent inhibiting the binding of an IFI16 polypeptide to a caspase-1 polypeptide is identified.

[00380] In some embodiments, caspase-1 is expressed endogenously in a cell used for screening an IF! 16 inhibitor inhibiting the binding of IFI16 to caspase-1. In some embodiments, caspase-1 is expressed exogenously in a cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to caspase-1. When expressed exogenously, an expression vector comprising a nucleotide sequence encoding a caspase-1 protein is introduced into the cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to caspase-1.

[00381] A complex formed between IFI16 and caspase-1 can be detected using, e.g., co- immunoprecipitation and an anti-IF116 antibody and an anti-caspase-1 antibody. Similarly, the inhibition of complex formation between IFI16 and caspase-1 in the presence of an agent, such as an IFI16 inhibitor, can be detected using, e.g., co-immunoprecipitation and an anti- IFI16 antibody and an anti-caspase-1 antibody.

13. Screening For IFI16 Inhibitors Inhibiting Binding Of IFI16 To STING

[00382] It was found that IFI16 binds to STING (see also Unterholzner et al., 2010, Nat Immunol 1 1 :997- 1004). It is desirable to inhibit the binding of IFI16 to STING. It is particularly desirable to inhibit the binding of IFI16 to STING in a host infected with HIV- 1 and/or in a host having AIDS. The present invention provides methods for inhibiting the binding of TFI16 to STING.

[00383] The present invention provides an in vitro screening method for identifying an agent inhibiting the binding of an IFI16 polypeptide to a STING polypeptide. Thus, a method for identifying an agent that inhibits the binding of an IFI16 polypeptide to a STING polypeptide is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting an agent with (i) an IFI16 polypeptide, (ii) with a biological sample comprising an IFI16 polypeptide and a STING polypeptide or (iii) a mammalian cell expressing an IFI16 polypeptide and a STING polypeptide and (b) determining the effect, if any, of the agent on the binding of the IFI16 polypeptide to the STING polypeptide. Thereby an agent inhibiting the binding of an IFI 16 polypeptide to a STING polypeptide is identified.

[00384] In some embodiments, STING is expressed endogenously in a cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to STING. In some

embodiments, STING is expressed exogenously in a cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to STING. When expressed exogenously, an expression vector comprising a nucleotide sequence encoding a STING protein is introduced into the cell used for screening an IFI16 inhibitor inhibiting the binding of IFI16 to STING.

[00385] A complex formed between IFI16 and STING can be detected using, e.g., co- immunoprecipitation and an anti-IFI16 antibody and an anti-STING-antibody. Similarly, the inhibition of complex formation between IFI16 and STING in the presence of a test agent, such as an IFI16 inhibitor, can be detected using, e.g., co-immunoprecipitation and an anti- IFI16 antibody and an anti-STING-antibody.

14. Screening For IFI16 Inhibitors Inhibiting Formation Of An Inflammasome Complex

[00386] As described herein, it was found that 1FI16 participates in the formation of a multi-protein complex, more specifically, an inflammasome complex. It is desirable to inhibit formation of an inflammasome complex. It is particularly desirable to inhibit formation of an inflammasome complex in a host infected with HIV-1 and/or in a host having

AIDS. The present invention provides methods for inhibiting the formation of an inflammasome complex.

[00387] In one aspect of the present invention, a method for identifying an agent that inhibits the assembly of an inflammasome complex is provided. In some embodiments of the present invention, this method comprises the steps of (a) contacting a cell expressing an IFI16 polypeptide, an ASC polypeptide and a procaspase-1 polypeptide with an agent and (b) determining the effect, if any, of the agent on the assembly of the IFI16 polypeptide into the inflammasome complex comprising the IFI16 polypeptide. Thereby an agent inhibiting the assembly of an inflammasome complex comprising an IFI16 polypeptide is identified. In some embodiments of the present invention, this method comprises the steps of (a) contacting a cell expressing an IFI16 polypeptide, an ASC polypeptide and a procaspase- 1 polypeptide with an agent and (b) determining the effect, if any, of the agent on the assembly of the ASC polypeptide into the inflammasome complex comprising the ASC polypeptide. Thereby an agent inhibiting the assembly of an inflammasome complex comprising an ASC polypeptide is identified. In some embodiments of the present invention, this method comprises the steps of (a) contacting a cell expressing an IFI16 polypeptide, an ASC polypeptide and a procaspase-1 polypeptide with an agent and (b) determining the effect, if any, of the agent on the assembly of the procaspase-1 polypeptide into the inflammasome complex comprising the procaspase-1 polypeptide. Thereby an agent inhibiting the assembly of an inflammasome complex comprising a procaspase-1 polypeptide is identified.

[00388] Inhibition of inflammasome complex formation can be tested in a variety of ways, e.g., by column chromatography or co-immunoprecipitation assays. As described herein, the inflammasome comprises three proteins, IFI16, ASC and procaspase-1. The presence of ASC and procaspase-1 within the inflammasome can be demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the inflammasome complex using an anti-IFI16 antibody and then investigating the presence or absence of procaspase-1 and ASC in the immunoprecipitate using an anti -procaspase-1 antibody and/or an anti-ASC antibody. The amount of each polypeptide, i.e., IFI16, ASC, and procaspase-1 , in a cellular extract obtained from cells contacted with an 1FI16 inhibitor is compared to the amount of IFI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI16 inhibitor. A lower amount of IFI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an IFI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

[00389] Alternatively, the presence of IFI16 and procaspase-1 within the inflammasome can be demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the inflammasome complex using an anti-ASC antibody and then investigating the presence or absence of procaspase-1 and IFI16 in the immunoprecipitate using an anti -procaspase-1 antibody and/or an anti-IFTl 6 antibody. The amount of each polypeptide, i.e., IFU6, ASC, and procaspase-1, in a cellular extract obtained from cells contacted with an 1F116 inhibitor is compared to the amount of IFI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI16 inhibitor. A lower amount of IFI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an 1FI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

[00390] The presence of IFI16 and ASC within the inflammasome also can be demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the

inflammasome complex using an anti-procaspase-1 antibody and then investigating the presence or absence of ASC and l 6 in the immunoprecipitate using an anti-ASC antibody and/or an anti-IFI16 antibody. The amount of each polypeptide, i.e., IFI16, ASC, and procaspase-1, in a cellular extract obtained from cells contacted with an 1FI16 inhibitor is compared to the amount of IFI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI16 inhibitor. A lower amount of 1FI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an IFI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

[00391] When using cells that do not endogenously express sufficient amounts of IFI16, ASC and/or caspase- 1 (i.e., cells that minimal endogenous levels of these proteins), those polypeptides can be expressed in cells using transient or stable transfection. Plasmids encoding full-length caspase-1 , ASC and IFI16 are transfected into cells using methods known in the art. Expression of these proteins is verified, e.g., by Western blotting and/or PCR.

[00392] While preferably, a cell-based assay is used to identify test agents as IFI16 inhibitors that inhibit formation of an inflammasome complex, non-cell-based assays may be used as well. In an exemplary non-cell-based assay, full-length IFI16, ASC and caspase- 1 polypeptides are contacted to each other to form an inflammasome complex. Essentially, an inflammasome complex is reconstituted. A test agent is being added after inflammasome complex formation and it is determined if upon adding the test agent, the complex falls apart. Alternatively, the test agent is added during the assembly of the inflammasome complex and it is determined if the test agent inhibits the formation of the inflammasome complex, e.g., whether the test agent inhibits binding of 1FI16 to caspase-1 or whether the test agent inhibits binding of IFI16 to ASC. Variations of such binding assays will be apparent to one of ordinary skill in the art. For example, instead of full-length IFI16, ASC and caspase-1 polypeptides, fragments thereof, i.e., shorter than full-length polypeptides, may be used in those assays. An IFI16 fragment useful for binding studies with ASC is an IFI16 polypeptide comprising the IFI16 PYD domain.

15. Screening For IFI16 Inhibitors Inhibiting Caspase-1

Activation

[00393] As described herein, it was found that IFI16 acts downstream of caspase-1 and that upon formation of an inflammasome complex, caspase-1 is activated. It is desirable to inhibit caspase-1 activation. It is particularly desirable to inhibit caspase-1 activation in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting caspase-1 activation.

[00394] Activation of caspase-1 and inhibition thereof can be conveniently monitored by determining the presence of the ~20-kDa activated caspase-1 (p20) in cells, e.g., by Western blotting using an anti caspase-1 antibody, (e.g., see Doitsh et al., 2010, Cell 143:789-801 ; Doitsh et al., 2013, Nature 10.1038/naturel2940).

16. Screening For IFI16 Inhibitors Inhibiting IFI16 Signaling To Interferon

[00395] As described herein, it was found that IFI16 signals to interferon. It is desirable to inhibit IFI16 signaling to interferon. It is particularly desirable to inhibit IFI16 signaling to interferon in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for the inhibition of IFI16 signaling to interferon. B. Testing IFI16 Inhibitors

[00396] The present invention provides for IFI16 inhibitors for use in the methods of the present invention. These inhibitors are useful as pharmaceutical agents, especially in the treatment of HTV-1 infection and AIDS and in methods inhibiting death of CD4 T-cells as more fully described herein. Pharmaceutically acceptable salts of the compounds disclosed herein can be used to practice the present invention.

[00397] The IFI16 inhibitors described herein and agents derived therefrom through routine chemical manipulations that are useful for practicing the present invention can be tested for their potential to inhibit the activation and/or activity of IFI16 using assays described herein (see also, Doitsh et al., 2013, Nature doi: 10.1038/naturel2940; Monroe et al, Sciencexpress Reports, December 19, 2013, doi: 10.1 126/sciencel243640, and

Supplementary Materials for same, each of which is fully incorporated herewith by reference in its entirety for all purposes). .

[00398] IFI16 inhibitors known in the art and/or identified by a subject method herein and agents derived therefrom through routine chemical manipulations are useful for practicing the methods described below. They will be set forth exemplary once for practicing the method for the treatment of HIV- 1 infection and/or AIDS. One of skill in the art will appreciate that IFI16 inhibitors can also be used for practicing the other methods described herein.

C. Treatment Methods Using IFI16 Inhibitors

[00399] The present invention describes a variety of treatment methods using an IF116 inhibitor described herein and/or an IFI16 inhibitor identified by a screening method described herein. Thus, agents identified herein find use in a variety of methods, for example agents can be used for inhibiting a level or activity of an IFI16 polypeptide or for treatment of a pathological condition, disorder or disease. These methods can be practiced in vitro and, in vivo. Preferably, patients treated by any one of the methods are humans and non-human animals.

1. Inhibiting An IFI16 Activity In A Patient Expressing An IFI16 Protein

[00400] IFI16 inhibitor compounds are particularly useful for inhibiting an IFI16 polypeptide activity in a patient expressing an IFI16 polypeptide and, in particular, for inhibiting an elevated IFI16 polypeptide activity in a patient expressing an elevated level or an elevated activity of an IFI16 polypeptide. The present invention provides methods for inhibiting an IFI16 polypeptide activity in a patient expressing an IFI16 polypeptide. [00401] Thus, the present invention provides a method for the treatment of an individual having an elevated IFI16 polypeptide activity when compared to a normal condition or control. In some embodiments, this method comprises the step of administering to an individual having an elevated IFI16 polypeptide activity and in need of having such elevated IFI16 polypeptide activity inhibited a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the individual having an elevated IFI16 polypeptide activity is treated. In some embodiments, this method comprises the step of administering to an individual having an elevated IFI16 polypeptide activity and in need of having such elevated IFI16 polypeptide activity inhibited a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the individual having an elevated IFI16 polypeptide activity is treated.

[00402] In some embodiments, the individual has been diagnosed having an elevated IFI16 polypeptide activity. In some embodiments, the individual has been diagnosed having an elevated IFI16 polypeptide activity as a consequence of having an HIV-l infection and/or as a consequence of having AIDS..

[00403] Preferably the elevated IFI16 level or IFI16 activity in the individual is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the elevated IFI16 level or Ml 6 activity in the individual prior to the treatment. Preferably the elevated 1FI16 level or elevated IFI16 activity in the individual is reduced to an IFI16 level or IFI16 activity that is present in a healthy individual.

[00404] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for the treatment of an individual having an elevated IFI16 polypeptide activity using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting an elevated l 6 polypeptide activity in a patient expressing an elevated level or elevated activity of an Ml 6 polypeptide. In some embodiments, a pharmaceutical composition comprises (i) n IFI16 inhibitor in an amount sufficient to inhibit an elevated Ml 6 polypeptide activity in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide and (ii) a pharmaceutically acceptable carrier. [00405] The present invention further provides a use of an IFI16 inhibitor for inhibiting an elevated IFI16 polypeptide activity in a mammalian cell expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of contacting the mammalian cell with an amount of the l 6 inhibitor sufficient to inhibit the elevated IF116 polypeptide activity in the mammalian cell expressing an elevated level or elevated activity of an IFI16 polypeptide and wherein the IFI16 polypeptide activity in the mammalian cell is inhibited.

[00406] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting an elevated IFI16 polypeptide activity in a mammalian cell expressing an elevated level or elevated activity of an IFI16 polypeptide. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit an elevated IFI16 polypeptide activity in the mammalian cell expressing an elevated level or elevated activity of an 1FI16 polypeptide and (ii) a pharmaceutically acceptable carrier.

2. Treatment Of HIV-1 Infection And/Or AIDS

[00407] IFI16 inhibitor compounds are particularly useful for the treatment of a patient having an HIV-1 infection and/or AIDS. It is desirable to treat a patient having an HIV-1 infection and/or AIDS.

[00408] The present invention provides methods for the treatment of an HIV-1 infection and/or AIDS. The present invention also provides a method for the treatment of a patient having an HIV-1 infection or suspected of having an HIV-1 infection or having AIDS. In some embodiments, this method comprises the steps of selecting a patient having an HIV-1 infection or suspected of having an HIV- 1 infection or having AIDS and administering to the patient a compound of the invention.

[00409] In some embodiments of the present invention, the method for the treatment of a patient having an HIV-1 infection or suspected of having an HIV-1 infection or having AIDS comprises the step of administering to the patient having an HIV-1 infection or suspected of having an HIV-1 infection or having AIDS an IFI16 inhibitor. Thereby the patient is treated.

[00410] The invention allows the selection of patients for treatment with a compound described herein, based on an appreciated need of the patient for a treatment of HIV-1 infection or for a treatment of AIDS. In some embodiments this method comprises the step of selecting a patient having an HTV-1 infection or suspected of having an HIV-1 infection or having AIDS and administering to the patient an IFI16 inhibitor. Thereby the patient is treated.

[00411] In some embodiments, the method comprises the step of selecting a patient on the basis of that patient being in need of the inhibition of IFI16 for the treatment of the HIV-1 infection or AIDS.

[00412] In some embodiments of methods for the treatment of HIV-1 infection and/or AIDS, the method comprises the step of administering to a patient in need of such treatment an effective amount of an IFI16 inhibitor or a pharmaceutically acceptable salt, prodrug or active derivative of such a substance. The substance in question has been identified as one that is capable of treating HIV-1 infection or AIDS in a patient by their effect on inhibition of activity of IFI16.

[00413] In some embodiments of this method, the patient comprises cells having incomplete HIV-1 nucleic acids.

[00414] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for the treatment of HIV-1 infection and AIDS using a compound of the present invention, such as an IF! 16 inhibitor, are described below.

[00415] In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has developed a resistance against an antiviral HIV-1 drug. Resistance of an HIV-1 infected patient to an antiviral HIV-1 drug typically is determined by a treating clinician.

[00416] In some embodiments of this method, the method comprises the step of administering to the patient an anti HIV-1 compound, such as a HAART compound and as described further below.

[00417] In some embodiments of the method for treating an HIV- 1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 1,000/mm ³ . In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 750/mm ³ . In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 500/mm ³ . In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced T-cell count of less than

500/mm ³ . In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced T-cell count of less than 375/mm ³ . In some embodiments of the method for treating an HIV-1 infection and/or AIDS, the method comprises the step of selecting a patient who has a reduced T-cell count of less than 200/mm ³ .

[00418] Preferably, the HIV-1 infection and/or AIDS symptoms in the individual are reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%>, at least about 80%, at least about 90% or more relative to the HIV-1 infection and/or AIDS symptoms in the individual prior to the treatment. Preferably, the HIV-1 infection and/or AIDS symptoms in the individual are reduced to a level that is present in a healthy individual.

[00419] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for the treatment of an HIV-1 infection and/or AIDS using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for treating an HIV-1 infection and/or AIDS. In some embodiments, a pharmaceutical composition comprises (i) an Ml 6 inhibitor in an amount sufficient to treat an HIV-1 infection and/or AIDS in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide and (ii) a pharmaceutically acceptable carrier.

[00420] The present invention further provides a use of an IFI16 inhibitor for treating an HIV-1 infection and/or AIDS in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to treat the HIV-1 infection and/or AIDS and wherein the IFI16 polypeptide activity in the patient is inhibited.

[00421] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for treatment of an HIV-1 infection and/or AIDS in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to treat the HIV-1 infection and/or AIDS and (ii) a pharmaceutically acceptable carrier. 3. Slowing Disease Progression In A Patient Having An HIV-1

Infection And/Or Having AIDS

[00422] IFI16 inhibitor compounds are particularly useful for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS. It is desirable to slow disease progression in a patient in a patient having an HIV-1 infection and/or having AIDS. The present invention provides methods for slowing disease progression in a patient having an

HIV-1 infection and/or having AIDS. Disease progression in a patient having an HIV-1 infection and/or having AIDS includes, but is not limited to, the patient experiencing a reduced CD4 T-cell count and the patient experiencing pyroptosis.

[00423] The present invention provides a method for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS. In some embodiments, this method comprises the step of administering to an individual experiencing disease progression and in need of having such disease progression treated a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the disease progression in a patient having an HIV-1 infection and/or having AIDS is treated. In some embodiments, this method comprises the step of administering to an individual experiencing disease progression and in need of having such disease progression treated a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI 16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI 16 inhibitor. Thereby the disease progression in a patient having an HIV-1 infection and/or having AIDS is treated.

[00424] In some embodiments, the individual has been diagnosed having a disease progression as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00425] Preferably the disease progression in the individual is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the disease progression in the individual prior to the treatment.

[00426] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS using a compound of the present invention, such as an IFI16 inhibitor, are described below. Preferably the elevated IFI16 level or IFI16 activity in the individual is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the elevated IFI16 level or IFI16 activity in the individual prior to the treatment. Preferably the elevated IFI16 level or elevated IFI16 activity in the individual is reduced to an IFI16 level or 1FI16 activity that is present in a healthy individual.

[00427] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for the treatment of an individual having an elevated IFI16 polypeptide activity using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS. In some embodiments, a pharmaceutical composition comprises (i) an 1FI 16 inhibitor in an amount sufficient to slow disease progression in a patient having an HIV-1 infection and/or having AIDS and (ii) a pharmaceutically acceptable carrier.

[00428] The present invention further provides a use of an IFI16 inhibitor for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS, wherein the use comprises the step of administering to the patient an amount of the IFI 16 inhibitor sufficient to slow disease progression in a patient having an HIV- 1 infection and/or having AIDS and wherein the disease progression in a patient having an HIV-1 infection and/or having AIDS is reduced.

[00429] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for slowing disease progression in a patient having an HIV-1 infection and/or having AIDS. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to slow disease progression in a patient having an HIV-1 infection and/or having AIDS and (ii) a pharmaceutically acceptable carrier.

4. Preventing Death Of CD4 T-Cells

[00430] As described herein, it was found that HIV-1 infection leads to the death of CD4 T-cells. As it has been shown, death of CD4 T-cells, as a consequence of HIV-1 infection, is attributed to pyroptosis. It is desirable to prevent the death of CD4 T-cells. It is particularly desirable prevent the death of CD4 T-cells in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for the preventing the death of a CD4 T-cells. In particular, the present invention provides methods for preventing the death of a CD4 T-cells as a consequence of pyroptosis.

I l l [00431] The present invention provides methods for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells.

[00432] The methods for preventing death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells can be practiced in vitro and in vivo. For practicing the method in vitro, CD4 T-cells may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells with a compound described herein. Thereby the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells is prevented. The survival of CD4 T-cells using a method of the invention can be determined as described herein.

[00433] When practicing the method in vivo, in some embodiments, the method comprises the steps of (a) selecting a patient having a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells and (b) administering to the patient an IFI16 inhibitor. Thereby the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells is prevented.

[00434] In some embodiments of the method for preventing death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 1,000/mm ³ . In other embodiments, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 750/mm ³ . In yet other embodiments, the method comprises the step of selecting a patient who has a reduced total lymphocyte count of less than 500/mm ³ . In some embodiments of the method for preventing death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells, the method comprises the step of selecting a patient who has a reduced T-cell count of less than 500/mm ³ . In other embodiments, the method comprises the step of selecting a patient who has a reduced T-cell count of less than 375/mm ³ . In yet other embodiments, the method comprises the step of selecting a patient who has a reduced T-cell count of less than 200/mm ³ .

[00435] In some embodiments of this method, the CD4 T-cell comprises incomplete HIV- 1 nucleic acids.

[00436] In some embodiments of this method, the method comprises the step of contacting the CD4 T-cell with an IFI16 inhibitor. [00437] In some embodiments of this method, the method comprises the step of administering to the patient an anti HIV-1 compound, such as a HAART compound and as described further below.

[00438] Preferably the death of CD4 T-cells is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to death of CD4 T- cells in the individual prior to the treatment. Preferably, the death of CD4 T-cells in the individual are reduced to a level of CD4 T-cell death that is present in a healthy individual.

[00439] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for preventing death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for preventing the death of a CD4 T-cell in a patient having an HIV-1 infection and/or having AIDS. In some embodiments, a pharmaceutical composition comprises (i) an IF116 inhibitor in an amount sufficient to prevent the death of a CD4 T-cell in a patient having an HIV-1 infection and/or having AIDS and (ii) a

pharmaceutically acceptable carrier.

[00440] The present invention further provides a use of an IFI16 inhibitor for preventing the death of a CD4 T-cell in a patient having an HIV-1 infection and/or having AIDS, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to prevent the death of the CD4 T-cell and wherein the death of the CD4 T-cell is prevented.

[00441] The present invention further provides a use of an TFI16 inhibitor for preventing the death of a CD4 T-cell, wherein the use comprises the step of contacting a CD4 T-cell within a population of CD4 T-cells with an amount of the IFI16 inhibitor sufficient to prevent the death of the CD4 T-cell and wherein the death of the CD4 T-cell is prevented.

[00442] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for preventing the death of a CD4 T-cell in a patient having an HIV-1 infection and/or having AIDS. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to prevent the death of a CD4 T-cell in a patient having an HIV-1 infection and/or having AIDS and (ii) a pharmaceutically acceptable carrier. 5. Inhibiting Formation Of Bioactive Interleukin Beta

[00443] Mammalian interleukin- 1 beta (IL-1 β) plays an important role in various pathologic processes, including chronic and acute inflammation and autoimmune diseases (Oppenheim et. al. 1986, Immunology Today, 7:45-56). IL-1 β is synthesized as a cell associated precursor polypeptide (pro-IL- 1 β) that is unable to bind IL- 1 receptors and is biologically inactive (Mosley et al, 1987, J Biol Chem 262:2941 -2944); By inhibiting conversion of precursor IL-Ι β to mature IL-1 β, the activity of interleukin- 1 can be inhibited. Interleukin- 1 β converting enzyme (ICE) , also known as caspase-1, is a protease responsible for the activation of IL-1 β (Thornberry et al., 1992, Nature 356:768; Yuan et al., 1993, Cell 75:641). ICE is a substrate-specific cysteine protease that cleaves the inactive prointerleukin- 1 to produce the mature IL-1.

[00444] As described herein, it was found that in CD4 T-cells, abortive production of HIV-1 reverse transcripts, leads to the production and secretion of bioactive IL-Ι β, and ultimately to cell death. The present invention provides methods for inhibiting the formation of bioactive IL-1 β.

[00445] The methods for inhibiting the formation of bioactive interleukin-beta (IL-Ιβ) can be practiced in vitro and in vivo. For practicing the method in vitro, cells, preferably CD4 T- cells, secreting bioactive IL-1 β may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting cells secreting IL-1 β with a compound described herein. Thereby the formation of bioactive IL-1 β is inhibited. Formation of bioactive IL-Ιβ can be determined using assays described herein.

[00446] When practicing the method in vivo, in some embodiments, the method comprises the steps of (a) selecting a patient having cells secreting IL-Ι β and having an HIV-1 infection or being suspected of having an HIV-1 infection or having AIDS and (b) administering to the patient a compound described herein. Thereby the formation of bioactive IL- 1 β is inhibited.

[00447] In some embodiments of this method, cells secreting IL-Ι β comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells secreting IL-1 β are infected with HIV-1. In some embodiments of this method, cells secreting IL-1 β comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein,

[00448] In some embodiments of this method, the method comprises the step of contacting a cell secreting IL-1 β with an IFI16 inhibitor. [00449] In some embodiments of this method, the method comprises the step of administering to the patient an anti HlV-1 compound, such as a HAART compound and as described further below.

[00450] IL-Ιβ processing and secretion can be conveniently monitored, e.g., by Western blotting using an anti-IL-Ι β antibody. An increase of IL-Ι β gene expression can be conveniently monitored, e.g., by PCR or Northern blotting.

[00451] Preferably, formation of bioactive IL-Ι β is reduced by at least about 10%, at least about 20%), at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the formation of IL-Ι β in the individual prior to the treatment. Preferably, formation of IL-Ι β in the individual is reduced to a level that is present in a healthy individual.

[00452] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting formation of bioactive IL-Ιβ using a compound of the present invention, such as an IF116 inhibitor, are described below. Provided are pharmaceutical compositions inhibiting the formation of bioactive IL-Ι β. In some embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit formation of bioactive IL-1 β in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide and (ii) a pharmaceutically acceptable carrier.

[00453] The present invention further provides a use of an IFI16 inhibitor for inhibiting the formation of bioactive IL-Ι β in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to inhibit formation of bioactive IL-1 β and wherein formation of bioactive IL-1 β is inhibited.

[00454] The present invention further provides a use of an IFI16 inhibitor for inhibiting the formation of bioactive IL-1 β in a mammalian cell expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of contacting the mammalian cell with an amount of the IFI16 inhibitor sufficient to inhibit formation of bioactive IL-Ι β and wherein formation of bioactive IL-1 β is inhibited.

[00455] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting formation of bioactive IL-1 β in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit formation of bioactive 1L- 1 β and (ii) a pharmaceutically acceptable carrier.

6. Inhibiting Pyroptosis

[00456] As described herein, it was found that abortive production of HIV-1 reverse transcripts leads to pyroptosis and ultimately to cell death.

[00457] The present invention provides methods for inhibiting pyroptosis.

[00458] The methods for inhibiting pyroptosis can be practiced in vitro and in vivo. For practicing the method in vitro, cells, preferably CD4 T-cells undergoing pyroptosis may be prepared as human lymphoid aggregate cultures (HLACs) as described herein. In some embodiments, the method comprises the step of contacting cells undergoing pyroptosis with a compound described herein, thereby inhibiting pyroptosis. Inhibition of pyroptosis can be determined using assays described herein.

[00459] When practicing the method in vivo, in some embodiments, the method comprises the steps of (a) selecting a patient having cells undergoing pyroptosis and having an HIV-1 infection or being suspected of having an HIV-1 infection or having AIDS and (b) administering to the patient an IFI16 inhibitor. Thereby the pyroptosis is inhibited.

[00460] In some embodiments, this method comprises the step of administering to an individual experiencing an elevated level of pyroptosis and in need of having such elevated level of pyroptosis treated a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the elevated level of pyroptosis in a patient having an elevated level of pyroptosis is treated. In some

embodiments, this method comprises the step of administering to an individual experiencing an elevated level of pyroptosis and in need of having such elevated level of pyroptosis treated a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the elevated level of pyroptosis in a patient having an elevated level of pyroptosis is treated. In some embodiments, a patient having an elevated level of pyroptosis is a patient having an HIV-1 infection and/or having AIDS.

[00461] In some embodiments, the individual has been diagnosed having an elevated level of pyroptosis. In some embodiments, the individual has been diagnosed having an elevated level of pyroptosis as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00462] In some embodiments of this method, cells undergoing pyroptosis comprise incomplete HIV-1 nucleic acids. In some embodiments of this method, cells undergoing pyroptosis are infected with HIV-1. In some embodiments of this method, cells undergoing pyroptosis are abortively infected with HIV-1. In some embodiments of this method, cells undergoing pyroptosis comprise an HIV-1 expression vector. Suitable HIV-1 expression vectors are described herein..

[00463] In some embodiments of this method, the method comprises the step of contacting a cell undergoing pyroptosis with an IFI16 inhibitor.

[00464] In some embodiments of this method, the method comprises the step of administering to the patient an anti HIV-1 compound, such as a HAART compound and as described further below.

[00465] Preferably, pyroptosis in the individual experiencing pyroptosis is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the level of pyroptosis in the individual prior to the treatment. Preferably, pyroptosis in the individual having an elevated level of pyroptosis is reduced to a level of pyroptosis that is present in a healthy individual.

[00466] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting pyroptosis using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting pyroptosis. In some embodiments, a

pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit pyroptosis in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide and (ii) a pharmaceutically acceptable carrier.

[00467] The present invention further provides a use of an IFI16 inhibitor for inhibiting pyroptosis in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to inhibit pyroptosis and wherein pyroptosis is inhibited.

[00468] The present invention further provides a use of an IFI 16 inhibitor for inhibiting pyroptosis in a mammalian cell expressing an elevated level or elevated activity of an IFI 16 polypeptide, wherein the use comprises the step of contacting the mammalian cell with an amount of the IFI16 inhibitor sufficient to inhibit pyroptosis and wherein pyroptosis is inhibited.

[00469] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting pyroptosis in a patient expressing an elevated level or elevated activity of an IFI 16 polypeptide. In some embodiments, the medicament comprises (i) an IFI 16 inhibitor in an amount sufficient to inhibit pyroptosis and (ii) a pharmaceutically acceptable carrier.

7. Decreasing Inflammation

[00470] As described herein, it was found that abortive production of HIV-1 reverse transcripts leads to an increased level of inflammation in an HIV-1 infected patient. It is desirable to decrease the level of inflammation. It is particularly desirable to decrease the level of inflammation in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for decreasing a level of inflammation.

[00471] The present invention provides a method for decreasing a level of inflammation in a patient having an elevated level of inflammation when compared to a healthy individual. In some embodiments, this method comprises the step of administering to an individual experiencing an elevated level of inflammation and in need of having such elevated level of inflammation treated a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the elevated level of inflammation in a patient having an elevated level of inflammation is treated. In some embodiments, this method comprises the step of administering to an individual experiencing an elevated level of inflammation and in need of having such elevated level of inflammation treated a pharmaceutical composition comprising a biologically active 1FI16 inhibitor that inhibits a level or activity of an IFI 16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI 16 inhibitor. Thereby the elevated level of inflammation in a patient having an elevated level of inflammation is treated. In some embodiments, a patient having an elevated level of inflammation is a patient having an HIV-1 infection and/or having AIDS.

[00472] In some embodiments, the individual has been diagnosed having an elevated level of inflammation. In some embodiments, the individual has been diagnosed having an elevated level of inflammation as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00473] Preferably, the elevated level of inflammation in the individual having an elevated level of inflammation is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%), at least about 90%> or more relative to the elevated level of inflammation in the individual prior to the treatment. Preferably, the elevated level of inflammation in the individual having an elevated level of inflammation is reduced to a level of inflammation that is present in a healthy individual.

[00474] Fonnulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for decreasing a level of inflammation in a patient having an elevated level of inflammation when compared to a healthy individual using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for decreasing inflammation. In some

embodiments, a pharmaceutical composition comprises (i) an l 6 inhibitor in an amount sufficient to decrease inflammation in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide and (ii) a pharmaceutically acceptable carrier.

[00475] The present invention further provides a use of an IFI16 inhibitor for decreasing inflammation in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to decrease inflammation and wherein inflammation is decreased.

[00476] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for decreasing inflammation in a patient expressing an elevated level or elevated activity of an IFI16 polypeptide. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to decrease inflammation and (ii) a pharmaceutically acceptable carrier.

8. Inhibiting An HIV-l-Induced Propathogenic Host Response

[00477] As described herein, it was found that abortive production of HIV-1 reverse transcripts leads to the inhibition of an HIV-1 -induced propathogenic host response. A propathogenic host response means that a host infected with a virus, e.g., an HIV-1, experiences a worsening of a health condition that is due to the activity of one or more host polypeptides, rather than the direct consequence of a viral polypeptide. A preferred propathogenic host response is one that is caused by an 1FI16 polypeptide activity or by a caspase-1 polypeptide activity. Propathogenic responses also include inflammation, pyroptosis, decrease of CD4 T-cells, and AIDS. It is desirable to inhibit a virus-induced propathogenic host response. It is even more desirable to inhibit an HIV-1 -induced propathogenic host response. It is particularly desirable to inhibit an HIV-1 -induced propathogenic host response in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for the inhibition of a virus-induced propathogenic host response. In some embodiments, the virus is HIV-1.

[00478] The present invention provides a method for inhibiting a virus-induced propathogenic host response in a host showing a propathogenic host response when compared to a healthy individual. In some embodiments, this method comprises the step of

administering to a host experiencing a propathogenic host response and in need of having such propathogenic host response treated a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI 16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFT 16 inhibitor. Thereby the propathogenic host response in a host having a propathogenic host response is treated. In some embodiments, this method comprises the step of administering to a host experiencing a propathogenic host response and in need of having such propathogenic host response treated a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI 16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the propathogenic host response in a patient having a propathogenic host response is treated. In some embodiments, a patient having a propathogenic host response is a patient having an HIV-1 infection and/or having AIDS.

[00479] In some embodiments, a method for treatment of a propathogenic condition in a host infected with a virus comprises the step of administering to a host infected with a virus and having a pro-pathogenic condition an agent that inhibits an activity of a host polypeptide. Thereby the propathogenic condition is treated. In some embodiments, the propathogenic condition is caused by the activity of the host polypeptide In some embodiments, in the absence of the agent, the host polypeptide interacts with a viral component.

[00480] In some embodiments of this method, the virus is Human Immunodeficiency Virus Type- 1 (HIV-1). [00481] In some embodiments of this method, the propathogenic host response is selected from the group consisting of inflammation, pyroptosis, decrease of CD4 T-cells, and AIDS.

[00482] In some embodiments of this method, the host polypeptide is interferon-inducible protein 16 (IFI 16).

[00483] In some embodiments of this method, the agent is selected from the group consisting of an IFI 16 siRNA, an anti-IFI16 antibody or an antigen-binding fragment thereof, and a PUL83 peptide.

[00484] In some embodiments, the host has been diagnosed having a propathogenic host response. In some embodiments, the host has been diagnosed having a propathogenic host response as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00485] Preferably, the propathogenic host response in the host having a propathogenic host response is reduced by at least about 10%, at least abqut 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%), at least about 90%> or more relative to the propathogenic host response in the host prior to the treatment. Preferably, the propathogenic host response in the host having a propathogenic host response is reduced to a level that is present in a healthy individual.

[00486] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting a virus-induced propathogenic host response in a host showing a propathogenic host response using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are

pharmaceutical compositions for inhibiting a virus-induced propathogenic host response in a host showing a propathogenic host response and expressing an elevated level or elevated activity of an IFI 16 polypeptide. In some embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit the virus-induced propathogenic host response in the host and (ii) a pharmaceutically acceptable carrier.

[00487] The present invention further provides a use of an IFI16 inhibitor for inhibiting a virus-induced propathogenic host response in a host showing a propathogenic host response, wherein the use comprises the step of administering to the patient an amount of the IFI16 inhibitor sufficient to inhibit the virus-induced propathogenic host response and wherein the propathogenic host response is inhibited. [00488] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting a virus-induced propathogenic host response in a host showing a propathogenic host response In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit the virus-induced propathogenic host response and (ii) a pharmaceutically acceptable carrier.

9. Inhibiting Binding Of An IFI16 Polypeptide To Double- Stranded DNA

[00489] As described herein, it was found that an IFI16 polypeptide binds to double- stranded DNA. It is desirable to inhibit the binding of an IFI16 polypeptide to double- stranded DNA. It is particularly desirable to inhibit the binding of an IFI16 polypeptide to double-stranded DNA in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting the binding of an IFI16 polypeptide to double-stranded DNA. In some embodiments, the double-stranded DNA is an HIV-1 nucleic acid.

[00490] The present invention provides a method for inhibiting the binding of an IFI16 polypeptide to a double-stranded DNA in a host. In some embodiments, this method comprises the step of administering to a host in need of having binding of an 1F116 polypeptide to double-stranded DNA inhibited a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the binding of the IFI16 polypeptide to the double-stranded DNA is inhibited. In some embodiments, this method comprises the step of administering to a host in need of having binding of an IFI16 polypeptide to double-stranded DNA inhibited a pharmaceutical composition comprising a biologically active l 6 inhibitor that inhibits a level or activity of an IFI 16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the binding of the IFI16 polypeptide to the double-stranded DNA is inhibited. In some embodiments, a patient in need of having the binding of an Ml 6 polypeptide to double-stranded DNA inhibited is a patient having an HIV-1 infection and/or having AIDS.

[00491] Preferably the binding of the IFI16 polypeptide to double-stranded DNA is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the binding of the IFI16 polypeptide in the host prior to the treatment. Preferably, the binding of the IFI16 polypeptide to double-stranded DNA is reduced to a level that is present in a healthy individual.

[00492] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting the binding of an IFI16 polypeptide to double-stranded DNA using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting a binding of an IFI16 polypeptide to double-stranded DNA. In some embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit binding of the IFI16 polypeptide to double-stranded DNA and (ii) a pharmaceutically acceptable carrier.

[00493] The present invention further provides a use of an IFI16 inhibitor for inhibiting the binding of an IFIl 6 polypeptide to double-stranded DNA, wherein the use comprises the step of administering to a patient an amount of the IFIl 6 inhibitor sufficient to inhibit the binding of the IFIl 6 polypeptide to the double-stranded DNA and wherein the binding of the IFIl 6 polypeptide to the double-stranded DNA is inhibited.

[00494] The present invention further provides a use of an IFIl 6 inhibitor for inhibiting the binding of an IFIl 6 polypeptide to double-stranded DNA, wherein the use comprises the step of contacting a mammalian cell with an amount of the IFIl 6 inhibitor sufficient to inhibit the binding of the IFIl 6 polypeptide to the double-stranded DNA and wherein the binding of the IFIl 6 polypeptide to the double-stranded DNA is inhibited.

[00495] The present invention further provides a use of an IFIl 6 inhibitor for producing a medicament for inhibiting the binding of an IFIl 6 polypeptide to a double-stranded DNA. In some embodiments, the medicament comprises (i) an IFIl 6 inhibitor in an amount sufficient to inhibit the binding of the IFI16 polypeptide to the double-stranded DN A and (ii) a pharmaceutically acceptable carrier.

10. Inhibiting Binding of An IFI16 Polypeptide To Single- Stranded DNA

[00496] As described herein, it was found that an IFIl 6 polypeptide binds to single- stranded DNA. It is desirable to inhibit the binding of an IFIl 6 polypeptide to single- stranded DNA. It is particularly desirable to inhibit the binding of an IFIl 6 polypeptide to single-stranded DNA in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting the binding of an IFIl 6 polypeptide to single-stranded DNA. In some embodiments, the single-stranded DNA is an HIV-1 nucleic acid.

[00497] The present invention provides a method for inhibiting the binding of an IPI16 polypeptide to a single-stranded DNA in a host. In some embodiments, this method comprises the step of administering to a host in need of having binding of an IFI16 polypeptide to single-stranded DNA inhibited a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the binding of the IFI16 polypeptide to the single-stranded DNA is inhibited. In some embodiments, this method comprises the step of administering to a host in need of having binding of an IFI16 polypeptide to single-stranded DNA inhibited a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the binding of the IFI16 polypeptide to the single-stranded DNA is inhibited. In some embodiments, a patient in need of having the binding of an IFI16 polypeptide to single- stranded DNA inhibited is a patient having an HIV-1 infection and/or having AIDS.

[00498] Preferably the binding of the IFI16 polypeptide to single-stranded DNA is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the binding of the IFI16 polypeptide in the host prior to the treatment. Preferably, the binding of the IFI16 polypeptide to single-stranded DNA is reduced to a level that is present in a healthy individual.

[00499] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting the binding of an IFI16 polypeptide to single-stranded DNA using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting the binding of an IFI16 polypeptide to single-stranded DNA. In some

embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit binding of the IFI16 polypeptide to single-stranded DNA and (ii) a pharmaceutically acceptable carrier.

[00500] The present invention further provides a use of an IFI16 inhibitor for inhibiting the binding of an IFI16 polypeptide to single-stranded DNA, wherein the use comprises the step of administering to a patient an amount of the IFI16 inhibitor sufficient to inhibit the binding of the IFI16 polypeptide to the single-stranded DNA and wherein the binding of the IFI 16 polypeptide to the single-stranded DNA is inhibited.

[00501] The present invention further provides a use of an IFI1 inhibitor for inhibiting the binding of an IFI16 polypeptide to single-stranded DNA, wherein the use comprises the step of contacting a mammalian cell with an amount of the IFI 16 inhibitor sufficient to inhibit the binding of the IFI16 polypeptide to the single-stranded DNA and wherein the binding of the IFI16 polypeptide to the single-stranded DNA is inhibited.

[00502] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting the binding of an IFI16 polypeptide to a single-stranded DNA. In some embodiments, the medicament comprises (i) an Ml 6 inhibitor in an amount sufficient to inhibit the binding of the IFI16 polypeptide to the single-stranded DNA and (ii) a pharmaceutically acceptable carrier.

11. Inhibiting Formation Of An Inflammasome Complex

[00503] As described herein, it was found that IFI16 participates in the formation of an inflammasome complex. It is desirable to inhibit formation of an inflammasome complex. It is particularly desirable to inhibit formation of an inflammasome complex in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting the formation of an inflammasome complex.

[00504] In some embodiments, the method for inhibiting the formation of an

inflammasome complex comprises the step of administering to a host in need of having the formation of an inflammasome complex inhibited a therapeutically effective amount of an l 6 inhibitor that inhibits a level or activity of an Ml 6 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the formation of an inflammasome complex is inhibited. In some embodiments, this method comprises the step of administering to a host in need of having the formation of an inflammasome complex inhibited a pharmaceutical composition comprising a biologically active l 6 inhibitor that inhibits a level or activity of an l 6 polypeptide or a

pharmaceutically acceptable salt, prodrug or active derivative of such an Ml 6 inhibitor. Thereby the formation of an inflammasome complex is inhibited. In some embodiments, a patient in need of having the formation of an inflammasome complex inhibited is a patient having an HIV-1 infection and/or having AIDS.

[00505] Preferably the formation of an inflammasome complex is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the formation of the inflammasome complex in the host prior to the treatment. Preferably, the formation of an inflammasome complex is reduced to a level that is present in a healthy individual.

[00506] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting the formation of an

inflammasome complex using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting the formation of an inflammasome complex. In some embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit formation of an inflammasome complex and (ii) a pharmaceutically acceptable carrier.

[00507] The present invention further provides a use of an IFI16 inhibitor for inhibiting the formation of an inflammasome complex, wherein the use comprises the step of administering to a patient an amount of the IFI16 inhibitor sufficient to inhibit the formation of an inflammasome complex and wherein the formation of the inflammasome complex is inhibited.

[00508] The present invention further provides a use of an IFI 6 inhibitor for inhibiting the formation of an inflammasome complex, wherein the use comprises the step of contacting a mammalian cell with an amount of the 1FI16 inhibitor sufficient to inhibit the formation of an inflammasome complex and wherein the formation of the inflammasome complex is inhibited.

[00509] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting the formation of an inflammasome complex. In some

embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit the formation of an inflammasome complex and (ii) a pharmaceutically acceptable carrier.

[00510] Inhibition of inflammasome complex formation can be tested in a variety of ways. As described herein, the inflammasome comprises three proteins, IFI16, ASC and procaspase-1. The presence of ASC and procaspase-1 within the inflammasome can be demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the

inflammasome complex using an anti-IFIl 6 antibody and then investigating the presence or absence of procaspase- 1 and ASC in the immunoprecipitate using an anti-procaspase-1 antibody and/or an anti-ASC antibody. The amount of each polypeptide, i.e., IFI16, ASC, and procaspase- 1, in a cellular extract obtained from cells contacted with an IFI16 inhibitor is compared to the amount of 1FI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI16 inhibitor. A lower amount of IFI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an 1FI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

[00511] Alternatively, the presence of IFI16 and procaspase-1 within the inflammasome can be demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the inflammasome complex using an anti-ASC antibody and then investigating the presence or absence of procaspase-1 and IFI16 in the immunoprecipitate using an anti-procaspase- 1 antibody and/or an anti-IFI16 antibody. The amount of each polypeptide, i.e., 1F116, ASC, and procaspase-1 , in a cellular extract obtained from cells contacted with an IF116 inhibitor is compared to the amount of IFI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI 16 inhibitor. A lower amount of IFI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an IFI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

[00512] The presence of IFI16 and ASC within the inflammasome also can be

demonstrated, e.g., by preparing a cellular extract and immunoprecipitating the

inflammasome complex using an anti-procaspase- 1 antibody and then investigating the presence or absence of ASC and IFI16 in the immunoprecipitate using an anti-ASC antibody and/or an anti-IFI16 antibody. The amount of each polypeptide, i.e., IFI16, ASC, and procaspase-1 , in a cellular extract obtained from cells contacted with an IFI16 inhibitor is compared to the amount of IFI16, ASC, and procaspase-1 in a cellular extract obtained from cells not contacted with an IFI16 inhibitor. A lower amount of IFI16, ASC or procaspase-1 polypeptides in the cellular extract obtained from cells contacted with an IFI16 inhibitor identifies that IFI16 inhibitor as an inhibitor of inflammasome complex formation.

12. Inhibiting Caspase-1 Activation

[00513] As described herein, it was found that IFI16 acts downstream of caspase-1 and that upon formation of an inflammasome complex, caspase-1 is activated. It is desirable to inhibit caspase-1 activation. It is particularly desirable to inhibit caspase-1 activation in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for inhibiting caspase-1 activation.

[00514] The present invention provides a method for inhibiting activation of caspase-1 in a host. In some embodiments, this method comprises the step of administering to a host in need of having caspase-1 activation inhibited a therapeutically effective amount of an Ml 6 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI16 inhibitor. Thereby the caspase- 1 activation in the host is inhibited. In some embodiments, this method comprises the step of administering to a host in need of having caspase-1 activation inhibited a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an 1F116 inhibitor. Thereby the caspase-1 activation in the host is inhibited. In some embodiments, a patient in need of having activation of caspase-1 inhibited is a patient having an HIV-1 infection and/or having AIDS.

[00515] In some embodiments, the host has been diagnosed having caspase-1 activity. In some embodiments, the host has been diagnosed having caspase-1 activity as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00516] Preferably the activation of caspase 1 in the host is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%, at least about 70%, at least about 80%, at least about 90% or more relative to the activation of caspase- 1 in the host prior to the treatment. Preferably, the activation of caspase-1 in the host is reduced to a level that is present in a healthy individual.

[00517] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting activation of caspase-1 in a host using a compound of the present invention, such as an IFI16 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting the activation of caspase-1. In some embodiments, a pharmaceutical composition comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit activation of caspase-1 and (ii) a pharmaceutically acceptable carrier.

[00518] The present invention further provides a use of an IFI16 inhibitor for inhibiting activation of caspase-1, wherein the use comprises the step of administering to a patient an amount of the IFI16 inhibitor sufficient to inhibit activation of caspase-1 and wherein the activation of caspase-1 is inhibited.

[00519] The present invention further provides a use of an IFI16 inhibitor for inhibiting the activation of caspase-1 , wherein the use comprises the step of contacting a mammalian cell with an amount of the IFI16 inhibitor sufficient to inhibit activation of caspase-1 and wherein activation of caspase-1 is inhibited. [00520] The present invention further provides a use of an IFI16 inhibitor for producing a medicament for inhibiting the activation of caspase-1. In some embodiments, the medicament comprises (i) an IFI16 inhibitor in an amount sufficient to inhibit activation of caspase- 1 and (ii) a pharmaceutically acceptable carrier.

[00521] Activation of caspase-1 and inhibition thereof, can be conveniently monitored by determining the presence of the ~20-kDa activated caspase-1 (p20) in cells, e.g., by Western blotting using an anti caspase-1 antibody, (e.g., see Doitsh et al., 2010, Cell 143:789-801 ; Doitsh et al., 2013, Nature 10.1038/naturel2940).

13. Inhibiting IFI16 Signaling To Interferon

[00522] As described herein, it was found that IFI16 signals to interferon. It is desirable to inhibit IFI16 singling to interferon. It is particularly desirable to inhibit IFI16 signaling to interferon in a host infected with HIV-1 and/or in a host having AIDS. The present invention provides methods for the inhibition of IFI16 signaling to interferon.

[00523] The present invention provides a method for inhibiting IFI16 signaling to interferon in a host. In some embodiments, this method comprises the step of administering to a host in need of having IFI16 signaling to interferon inhibited a therapeutically effective amount of an IFI16 inhibitor that inhibits a level or activity of an IFI16 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI 16 inhibitor. Thereby the IFI 16 signaling to interferon in the host is inhibited. In some embodiments, this method comprises the step of administering to a host in need of having IFI 16 signaling to interferon inhibited a pharmaceutical composition comprising a biologically active IFI16 inhibitor that inhibits a level or activity of an l 6 polypeptide or a pharmaceutically acceptable salt, prodrug or active derivative of such an IFI 16 inhibitor. Thereby the IFI 16 signaling to interferon in the host is inhibited, In some embodiments, a patient in need of having IFI16 signaling to interferon inhibited is a patient having an HIV-1 infection and/or having AIDS.

[00524] In some embodiments, the host has been diagnosed having IFI16 signaling to interferon. In some embodiments, the host has been diagnosed having IFI16 signaling to interferon as a consequence of having an HIV-1 infection and/or as a consequence of having AIDS.

[00525] Preferably the IFI 16 signaling to interferon in the host is reduced by at least about 10%, at least about 20%, at least about 30%, at least about 40%, at least about 50%, at least about 60%), at least about 70%, at least about 80%), at least about 90%) or more relative to the IFIl 6 signaling in the host prior to the treatment. Preferably, the IFIl 6 signaling to interferon in the host is reduced to a level that is present in a healthy individual.

[00526] Formulation, administration, therapeutic effective amounts and dosing of pharmaceutical compositions useful in methods for inhibiting IFIl 6 signaling to interferon in a host using a compound of the present invention, such as an IFIl 6 inhibitor, are described below. Provided are pharmaceutical compositions for inhibiting IFIl 6 signaling to interferon. In some embodiments, a pharmaceutical composition comprises (i) an IFIl 6 inhibitor in an amount sufficient to inhibit IFI16 signaling to interferon and (ii) a

pharmaceutically acceptable carrier.

[00527] The present invention further provides a use of an IFIl 6 inhibitor for inhibiting IFIl 6 signaling to interferon, wherein the use comprises the step of administering to a patient an amount of the IFI 16 inhibitor sufficient to inhibit IFI16 signaling to interferon and IFI16 signaling to interferon is inhibited.

[00528] The present invention further provides a use of an IFIl 6 inhibitor for inhibiting the IFIl 6 signaling to interferon, wherein the use comprises the step of contacting a mammalian cell with an amount of the IFI16 inhibitor sufficient to inhibit IFIl 6 signaling to interferon and wherein IFIl 6 signaling to interferon is inhibited.

[00529] The present invention further provides a use of an IFIl 6 inhibitor for producing a medicament for inhibiting IFI16 signaling to interferon. In some embodiments, the medicament comprises (i) an IFIl 6 inhibitor in an amount sufficient to inhibit IFIl 6 signaling to interferon and (ii) a pharmaceutically acceptable carrier.

14. Combination Therapy

[00530] In a preferred embodiment of the present invention, an IFIl 6 inhibitor of the invention is used in a method for treating an HIV-1 infection or AIDS in a patient in need of such treatment. Preferably this method is practiced in vivo. Preferably this method is practiced in a host infected with HIV-1, e.g., a human infected with HIV-1. In some embodiments, this method comprises the step of administering to the HIV-1 infected host a therapeutically effective amount of a composition comprising an effective amount of an IFIl 6 inhibitor or a pharmaceutically acceptable salt, prodrug or active derivative of such a substance.

[00531] Importantly, unlike current antiretroviral drugs designed to interfere with viral components, the IFIl 6 inhibitors, do not target HIV-1 itself. Instead these inhibitors target the host CD4 T-cells themselves and thus obviate any potential problems with viral drug resistance. This approach can be used in combination with antiviral drugs, and be particularly useful for treatment of a patient with acute inflammation associated with rapid CD4 T-cell decline, or in a patient who has developed resistance to multiple drugs and for whom few or no therapeutic options remain.

[00532] In order to increase the effectiveness of methods for the treatment of an HIV-1 infection and/or AIDS, it may be desirable to combine an inhibitor for IFI16 activity with other agents effective in the treatment or prevention of HIV-1 infection or AIDS, such as an anti HIV-1 compound. When practiced in vivo, methods of the present invention, optionally comprise the step of administering HAART. Thus, in yet another embodiment of the present invention, a method of treating an HIV-1 infection or AIDS in an HIV-1 infected host in vivo comprises the step of administering highly active antiretroviral therapy (HAART). The current standard of care using HAART is usually a combination of at least three nucleoside reverse transcriptase inhibitors and frequently includes a protease inhibitors, or alternatively a non-nucleoside reverse transcriptase inhibitor. Patients who have low CD4+ cell counts or high plasma RNA levels may require more aggressive HAART. Patients with relatively normal CD4+ cell counts and low to non-measurable levels of plasma HIV RNA over prolonged periods (i.e. slow or non-progressors) may require less aggressive HAART. For antiretroviral-naive patients who are treated with initial antiretroviral regimen, different combinations (or cocktails) of antiretroviral drugs can be used.

[00533] Preferably, a composition comprising an inhibitor for the activation and/or activity of IF116 may be coadministered with a "cocktail" of nucleoside reverse transcriptase inhibitors, non-nucleoside HIV reverse transcriptase inhibitors, and protease inhibitors, i.e., anti HIV-1 compounds. For example, a composition comprising an inhibitor for the activation and/or activity of IFI16 may be coadministered with a cocktail of two nucleoside reverse transcriptase inhibitors (e.g. ZIDOVUDINE ^® (AZT) and LAM1VUDINE ^® (3TC)), and one protease inhibitor (e.g. INDINAVIR ^® (MK-639)). A composition comprising an inhibitor for the activation and/or activity of IFI16 may also be coadministered with a cocktail of one nucleoside reverse transcriptase inhibitor (e.g. STAVUDINE ^® (d4T)), one non-nucleoside reverse transcriptase inhibitor (e.g. NEVIRAPINE ^® (BI-RG-587)), and one protease inhibitor (e.g. NELFINAVIR ^® (AG-1343)). Alternatively, a composition comprising an inhibitor for the activation and/or activity of IFI16 may be coadministered with a cocktail of one nucleoside reverse transcriptase inhibitor (e.g. ZIDOVUDINE ^® (AZT)), and two protease inhibitors (e.g. NELFINAVIR (AG- 1343) and SAQINAVIR (Ro-31-8959)).

[00534] In some embodiments, a composition comprising an inhibitor for the activation and/or activity of 1FI 16 may be coadministered with an HIV-1 protease inhibitor. Typical suitable protease inhibitors for use in combination therapy include saquinavir (Ro 31 -8959) available in hard gel capsules (INVIRASE ^® ) and as soft gel capsules (FORTOVASE ^® ) from Roche Pharmaceuticals, Nutley, NJ. 071 10-1 199; RITONAVIR ^® (ABT-538, NORVIR ^® ) from Abbott Laboratories, Abbott Park, ill. 60064; indinavir (MK-639, CRIXIVAN ^® ) from Merck & Co., Inc., West Point, Pa. 19486-0004; nelfnavir (AG-1343, VIRACEPT ^® ) from Agouron Pharmaceuticals, Inc., La Jolla Calif. 92037-1020; amprenavir (141W94,

AGENERASE ^® ), a non-peptide protease inhibitor under development by Vertex

Pharmaceuticals, Inc., Cambridge, Mass. 02139-421 1 and available from Glaxo-Wellcome, Research Triangle, N.C. under an expanded access program; LASINAVIR ^® (BMS-234475) available from Bristol-Myers Squibb, Princeton, NJ. 08543 (originally discovered by Novartis, Basel, Switzerland (CGP-61755); DMP-450, a cyclic urea discovered by Dupont and under development by Triangle Pharmaceuticals; BMS-2322623, an azapeptide under development by Bristol-Myers Squibb, Princeton, N.J. 08543, as a 2nd-generation HIV-1 PI; ABT-378 under development by Abbott, Abbott Park, 111. 60064; and AG- 1549 an orally active imidazole carbamate discovered by Shionogi (Shionogi #S-1 153) and under development by Agouron Pharmaceuticals, Inc., LaJolla Calif. 92037-1020.

[00535] Other antiviral agents for use in combination therapy with an IFI16 inhibitor include hydroxyurea, ribavirin, IL-2, IL-12, pentafuside and Yissum Project No. 1 1607. Hydroxyurea (Droxia), an inhibitor of ribonucleoside triphosphate reductase, the enzyme involved in the activation of T-cells, was discovered at the NCI and is under development by Bristol-Myers Squibb; in preclinical studies, it was shown to have a synergistic effect on the activity of didanosine and has been studied with stavudine. IL-2 is disclosed in Ajinomoto EP-0142268, Takeda EP-0176299, and Chiron U.S. Patent Nos. RE33653, 4,530,787, 4,569,790, 4,604,377, 4,748,234, 4,752,585, and 4,949,314, and is available under

PROLEUKIN ^® (aldesleukin) from Chiron Corp., Emeryville, Calif. 94608-2997 as a lyophilized powder for IV infusion or sc administration upon reconstitution and dilution with water; a dose of about 1 to about 20 million IU/day, sc is preferred; a dose of about 15 million IU/day, sc is more preferred. IL-12 is disclosed in W096/25171 and is available from Roche Pharmaceuticals, Nutley, NJ. 07110-1199 and American Home Products, Madison, N.J. 07940; a dose of about 0.5 microgram/kg/day to about 10 microgram/kg/day, sc is preferred. Pentafuside (DP-178, T-20) a 36-amino acid synthetic peptide, is disclosed in U.S. Pat. No. 5,464,933 licensed from Duke University to Trimeris which is developing pentafuside in collaboration with Duke University; pentafuside acts by inhibiting fusion of HlV-1 to target membranes. Pentafuside (3 100 mg/day) is given as a continuous sc infusion or injection together with efavirenz and 2 Pi's to HIV-1 positive patients refractory to a triple combination therapy; use of 100 mg/day is preferred. Yissum Project No. 11607, a synthetic protein based on the HIV-1 Vif protein, is under preclinical development by Yissum

Research Development Co., Jerusalem 91042, Israel. Ribavirin, Ι-β-D-ribofuranosyl-lH- l,2,4-triazole-3-carboxamide, is available from ICN Pharmaceuticals, Inc., Costa Mesa, Calif; its manufacture and formulation are described in U.S. Pat. No. 4,211,771.

[00536] Coadministration in the context of this invention is defined to mean the administration of more than one therapeutic in the course of a coordinated treatment to achieve an improved clinical outcome. Such coadministration may also be coextensive, that is, occurring during overlapping periods of time. Further discussion of such conventional treatment can be found in the art (e.g., Gulick, 1997; Qual Life Res 6:471 -474; Henry et al., 1997, Postgrad Med 102: 100-107; Hicks, 1997, Radiol Clin North Am 35:995-1005;

Goldschmidt, 1996, Am Fam Physician 54:574-580).

V. PHARMACEUTICAL COMPOSITIONS

[00537] In one aspect the present invention provides a pharmaceutical composition or a medicament comprising an inhibitor for the activation and/or activity of IFI16 of the present invention and a pharmaceutically acceptable carrier. A pharmaceutical composition or medicament can be administered to a subject for the treatment of, for example, a condition or disease as described herein.

[00538] A pharmaceutical composition may include any combinations of one or more inhibitors for the activation and/or activity of an IFI16.

A. Formulation And Administration

[00539] Inhibitors for the activation and/or activity of IFI16 are useful in the manufacture of a pharmaceutical composition or a medicament comprising an effective amount thereof in conjunction or mixture with excipients or carriers suitable for either enteral or parenteral application. [00540] In some embodiments, a pharmaceutical preparation is a tablet containing in addition to a compound of the invention an adjuvant or carrier such as talc, starch, lactose, tragacanth or magnesium stearate.

[00541] Pharmaceutical compositions or medicaments for use in the present invention can be formulated by standard techniques using one or more physiologically acceptable carriers or excipients. Suitable pharmaceutical carriers are described herein and in "Remington's Pharmaceutical Sciences" by E.W. Martin. The compounds of the present invention and their physiologically acceptable salts and solvates can be formulated for administration by any suitable route that achieves their intended purpose, including via inhalation, topically, nasally, orally, parenterally, or rectally. Thus, the administration of the pharmaceutical composition may be made by intradermal, subdermal, intravenous, intramuscular, intranasal, intracerebral, intratracheal, intraarterial, intraperitoneal, intravesical, intrapleural,

intracoronary or intratumoral injection, with a syringe or other devices. Transdermal administration is also contemplated, as are inhalation or aerosol administration. Tablets and capsules can be administered orally, rectally or vaginally.

[00542] For oral administration, a pharmaceutical composition or a medicament can take the form of, for example, a tablet or a capsule prepared by conventional means with a pharmaceutically acceptable excipient. Preferred are tablets and gelatin capsules comprising the active ingredient, i.e., a small molecule compound of the present invention, together with (a) diluents or fillers, e.g., lactose, dextrose, sucrose, mannitol, sorbitol, cellulose (e.g., ethyl cellulose, microcrystalline cellulose), glycine, pectin, polyacrylates and/or calcium hydrogen phosphate, calcium sulfate; (b) lubricants, e.g., silica, talcum, stearic acid, its magnesium or calcium salt, metallic stearates, colloidal silicon dioxide, hydrogenated vegetable oil, corn starch, sodium benzoate, sodium acetate and/or polyethyleneglycol; for tablets also (c) binders, e.g., magnesium aluminum silicate, starch paste, gelatin, tragacanth, methylcellulose, sodium carboxymethylcellulose, polyvinylpyrrolidone and/or hydroxypropyl methylcellulose; if desired (d) disintegrants, e.g., starches (e.g., potato starch or sodium starch), glycolate, agar, alginic acid or its sodium salt, or effervescent mixtures; (e) wetting agents, e.g., sodium lauryl sulphate, and/or (f) absorbents, colorants, flavors and sweeteners.

[00543] Tablets may be either film coated or enteric coated according to methods known in the art. Liquid preparations for oral administration can take the form of, for example, solutions, syrups, or suspensions, or they can be presented as a dry product for constitution with water or other suitable vehicle before use. Such liquid preparations can be prepared by conventional means with pharmaceutically acceptable additives, for example, suspending agents, for example, sorbitol syrup, cellulose derivatives, or hydrogenated edible fats;

emulsifying agents, for example, lecithin or acacia; non-aqueous vehicles, for example, almond oil, oily esters, ethyl alcohol, or fractionated vegetable oils; and preservatives, for example, methyl or propyl-p-hydroxybenzoates or sorbic acid. The preparations can also contain buffer salts, flavoring, coloring, and/or sweetening agents as appropriate. If desired, preparations for oral administration can be suitably formulated to give controlled release of the active compound.

[00544] In some embodiments of the present invention, a tablet suitable for oral administration comprises 0.3 to 100 milligrams, preferably 2 to 10 milligrams, of an IFI16 inhibitor.

[00545] IFI16 inhibitors can be formulated for parenteral administration by injection, for example by bolus injection or continuous infusion. Formulations for injection can be presented in unit dosage form, for example, in ampoules or in multi-dose containers, with an added preservative. Injectable compositions are preferably aqueous isotonic solutions or suspensions, and suppositories are preferably prepared from fatty emulsions or suspensions. The compositions may be sterilized and/or contain adjuvants, such as preserving, stabilizing, wetting or emulsifying agents, solution promoters, salts for regulating the osmotic pressure and/or buffers. Alternatively, the active ingredient can be in powder form for constitution with a suitable vehicle, for example, sterile pyrogen-free water, before use. In addition, they may also contain other therapeutically valuable substances. The compositions are prepared according to conventional mixing, granulating or coating methods, respectively, and contain about 0.1 to 75%, preferably about 1 to 50%, of the active ingredient.

[00546] For administration by inhalation, the compounds may be conveniently delivered in the form of an aerosol spray presentation from pressurized packs or a nebulizer, with the use of a suitable propellant, for example, dichlorodifluoromethane, trichlorofluoromethane, dichlorotetrafluoroethane, carbon dioxide, or other suitable gas. In the case of a pressurized aerosol, the dosage unit can be determined by providing a valve to deliver a metered amount. Capsules and cartridges of, for example, gelatin for use in an inhaler or insufflator can be formulated containing a powder mix of the compound and a suitable powder base, for example, lactose or starch.

[00547] Suitable formulations for transdermal application include an effective amount of a compound of the present invention with carrier. Preferred carriers include absorbable pharmacologically acceptable solvents to assist passage through the skin of the host. For example, transdermal devices are in the form of a bandage comprising a backing member, a reservoir containing the compound optionally with carriers, optionally a rate controlling barrier to deliver the compound to the skin of the host at a controlled and predetermined rate over a prolonged period of time, and means to secure the device to the skin. Matrix transdermal formulations may also be used.

[00548] Suitable formulations for topical application, e.g., to the skin and eyes, are preferably aqueous solutions, ointments, creams or gels well-known in the art. Such may contain solubilizers, stabilizers, tonicity enhancing agents, buffers and preservatives.

[00549] The compounds can also be formulated in rectal compositions, for example, suppositories or retention enemas, for example, containing conventional suppository bases, for example, cocoa butter or other glycerides.

[00550] Furthermore, the compounds can be formulated as a depot preparation. Such long-acting formulations can be administered by implantation (for example, subcutaneous ly or intramuscularly) or by intramuscular injection. Thus, for example, the compounds can be formulated with suitable polymeric or hydrophobic materials (for example as an emulsion in an acceptable oil) or ion exchange resins, or as sparingly soluble derivatives, for example, as a sparingly soluble salt,

[00551] The compositions can, if desired, be presented in a pack or dispenser device that can contain one or more unit dosage forms containing the active ingredient. The pack can, for example, comprise metal or plastic foil, for example, a blister pack. The pack or dispenser device can be accompanied by instructions for administration.

[00552] In some embodiments of the present invention, a pharmaceutical composition or medicament comprises an effective amount of an inhibitor for the activation and/or activity of 1FI16 as described above, and another therapeutic agent, such as a component used for HAART, as described herein. When used with compounds of the invention, such therapeutic agent may be used individually (e.g., a component used for HAART and compounds of the present invention), sequentially (e.g., a component used for HAART and compounds of the present invention for a period of time followed by e.g., a second component used for HAART and compounds of the present invention), or in combination with one or more other such therapeutic agents (e.g., a reverse transcriptase inhibitor used for HAART, a protease inhibitor used for HAART, and compounds of the present invention). Administration may be by the same or different route of administration or together in the same pharmaceutical formulation.

[00553] In a some embodiments of the present invention, a pharmaceutical composition comprises (i) an IFI16 inhibitor or a pharmaceutically acceptable salt, prodrug or active derivative of such a substance and (ii) a pharmaceutically acceptable carrier.

[00554] In a some embodiments of the present invention, a pharmaceutical composition comprises (i) an IFI16 inhibitor or a pharmaceutically acceptable salt, prodrug or active derivative of such a substance, (ii) an inhibitor for use in HAART, and (iii) a

pharmaceutically acceptable carrier.

B. Therapeutic Effective Amount And Dosing

[00555] In some embodiments of the present invention, a pharmaceutical composition or medicament comprising an IFI16 inhibitor is administered to a subject, preferably a human, at a therapeutically effective dose to prevent, treat, or control a condition or disease as described herein, such as HIV-1 infection and AIDS. The pharmaceutical composition or medicament comprising an IFI16 inhibitor is administered to a subject in an amount sufficient to elicit an effective therapeutic response in the subject. An effective therapeutic response is a response that at least partially arrests or slows the symptoms or complications of the condition or disease. An amount adequate to accomplish this is defined as

"therapeutically effective dose."

[00556] The dosage of active IFI16 inhibitors administered is dependent on the species of warm-blooded animal (mammal), preferably a human, the body weight, age, individual condition, surface area of the area to be treated and on the form of administration. The size of the dose also will be determined by the existence, nature, and extent of any adverse effects that accompany the administration of a particular small molecule compound in a particular subject. A unit dosage for oral administration to a mammal of about 50 to 70 kg may contain between about 5 and 500 mg of the active ingredient. Typically, a dosage of the active IFI16 inhibitor of the present invention, is a dosage that is sufficient to achieve the desired effect. Optimal dosing schedules can be calculated from measurements of compound accumulation in the body of a subject. In general, dosage may be given once or more daily, weekly, or monthly. Persons of ordinary skill in the art can easily determine optimum dosages, dosing methodologies and repetition rates.

[00557] In some embodiments of the present invention, a pharmaceutical composition or medicament comprising an l 6 inhibitor is administered in a daily dose in the range from about 0.1 mg of each compound per kg of subject weight (0.1 mg/kg) to about lg/kg for multiple days. In other embodiments, the daily dose is a dose in the range of about 5 mg/kg to about 500 mg/kg. In yet other embodiments, the daily dose is about 10 mg/kg to about 250 mg/kg. In other embodiments, the daily dose is about 25 mg/kg to about 150 mg/kg. A preferred dose is about 10 mg/kg. The daily dose can be administered once per day or divided into subdoses and administered in multiple doses, e.g., twice, three times, or four times per day. However, as will be appreciated by a skilled artisan, inhibitors for the activation and/or activity of IFI16 may be administered in different amounts and at different times.

[00558] In some embodiments, a tablet comprises from 0.5 to 100 mg of the active ingredient of an IFI16 inhibitor, preferably from 1 to 50 mg, more preferably from 1.5 to 25 mg, even more preferably from 2 to 10 mg.

[00559] To achieve the desired therapeutic effect, IFI16 inhibitors may be administered for multiple days at the therapeutically effective daily dose. Thus, therapeutically effective administration of compounds to treat a condition or disease described herein in a subject requires periodic (e.g., daily) administration that continues for a period ranging from three days to two weeks or longer. Typically, compounds will be administered for at least three consecutive days, often for at least five consecutive days, more often for at least ten, and sometimes for 20, 30, 40 or more consecutive days. When used to prevent the appearance or manifestation of a condition or disease described herein, administration of a pharmaceutical composition may be done daily for as long as the appearance or manifestation of the condition or disease is to be prevented. While consecutive daily doses are a preferred route to achieve a therapeutically effective dose, a therapeutically beneficial effect can be achieved even if the compounds are not administered daily, so long as the administration is repeated frequently enough to maintain a therapeutically effective concentration of the compounds in the subject. For example, one can administer the compounds every other day, every third day, or, if higher dose ranges are employed and tolerated by the subject, once a week. A preferred dosing schedule, for example, is administering daily for a week, one week off and repeating this cycle dosing schedule for 3-4 cycles.

[00560] Optimum dosages, toxicity, and therapeutic efficacy of IFI16 inhibitors may vary depending on the relative potency of individual compounds and can be determined by standard pharmaceutical procedures in cell cultures or experimental animals, for example, by determining the LD ₅ o (the dose lethal to 50% of the population) and the ED ₅₀ (the dose therapeutically effective in 50% of the population). The dose ratio between toxic and therapeutic effects is the therapeutic index and can be expressed as the ratio, LD ₅₀ /ED ₅ o. 1F116 inhibitors that exhibit large therapeutic indices are preferred. While IFI16 inhibitors that exhibit toxic side effects can be used, care should be taken to design a delivery system that targets such compounds to the site of affected tissue to minimize potential damage to normal cells and, thereby, reduce side effects.

[00561] The data obtained from, for example, cell culture assays and animal studies can be used to formulate a dosage range for use in humans. The dosage of such small molecule compounds lies preferably within a range of circulating concentrations that include the ED50 with little or no toxicity. The dosage can vary within this range depending upon the dosage form employed and the route of administration. For any compounds used in the methods of the invention, the therapeutically effective dose can be estimated initially from cell culture assays. A dose can be formulated in animal models to achieve a circulating plasma concentration range that includes the IC50 (the concentration of the test compound that achieves a half-maximal inhibition of symptoms) as determined in cell culture. Such information can be used to more accurately determine useful doses in humans. Levels in plasma can be measured, for example, by high performance liquid chromatography (HPLC). In general, the dose equivalent of compounds is from about 1 ng/kg to 100 mg/kg for a typical subject.

[00562] For the treatment of an HIV-1 infection and/or AIDS or for preventing the death of a CD4 T-cell in a population of CD4 T-cells comprising HIV-1 infected and uninfected CD4 T-cells there may be no fixed dosage regimen for administering an IFI16 inhibitor. The patient's viral load or CD4 T-cell count may be measured periodically to determine the minimum effective dose for the patient.

[00563] In some embodiments, a starting dose of an IFI16 inhibitor is 2.5 to 5 mg daily, which may be administered with breakfast or a first main meal. In some embodiments, a maintenance dose for an IFI16 inhibitor is in the range of 1.25 to 20 mg daily, which may be given as a single dose or in divided doses. Dosage increases should be made in increments of no more than 2.5 mg at weekly intervals based upon the patient's response (such as increasing or lowering viral load, increasing or decreasing CD4 T-cell count). Once-a-day therapy is usually satisfactory, based upon usual meal patterns and the half-life of some IFI16 inhibitors, some patients, particularly those receiving more than 10 mg daily, may have a more satisfactory response with twice-a-day dosage. [00564] in some embodiments, a starting dose of an IF! 16 inhibitor is 1 to 2 mg daily, which may be administered with breakfast or a first main meal. In some embodiments, a maintenance dose for the IFI16 inhibitor is in the range of 1 to 4 mg daily, which may be given as a single dose or in divided doses. In some embodiments, the maximum

recommended dose is 8 mg once daily. After reaching a dose of 2 mg, dosage increases should be made in increments of no more than 2 mg at 1 -2 week intervals based upon the patient's response (such as increasing or lowering viral load, increasing or decreasing CD4 T- cell count). Once-a-day therapy is usually satisfactory, based upon usual meal patterns and the half-life of some IFI16 inhibitors, some patients, particularly those receiving more than 8 mg daily, may have a more satisfactory response with twice-a-day dosage.

[00565] Following successful treatment, it may be desirable to have the subject undergo maintenance therapy to prevent the recurrence of the condition or disease treated.

[00566] Upon improvement of a patient's condition, a maintenance dose of a compound, composition or combination of this invention may be administered, if necessary.

Subsequently, the dosage or frequency of administration, or both, may be reduced, as a function of the symptoms, to a level at which the improved condition is retained. When the symptoms have been alleviated to the desired level, treatment should cease. Patients may, however, require intermittent treatment on a long-term basis upon any recurrence or disease symptoms.

[00567] As the skilled artisan will appreciate, lower or higher doses than those recited above may be required. Specific dosage and treatment regimens for any particular patient will depend upon a variety of factors, including the activity of the specific compound employed, the age, body weight, general health status, sex, diet, time of administration, rate of excretion, drug combination, the severity and course of the disease, and the patient's disposition to the disease and the judgment of the treating physician.

VI. KITS

[00568] For use in diagnostic, research, and therapeutic applications suggested above, kits are also provided by the invention. In the diagnostic and research applications such kits may include any or all of the following: assay reagents, buffers, a compound of the present invention, an IFI16 polypeptide, an ASC polypeptide, a caspase polypeptide, an IL-Ι β polypeptide, an HIV-1 polypeptide, an IFI16 nucleic acid, an ASC nucleic acid, a caspase-1 nucleic acid, an IL-Ιβ nucleic acid, an HIV-1 nucleic acid, an anti-HIV-1 polypeptide antibody, hybridization probes and/or PCR primers, expression constructs for e.g., a virion, a cell expressing an IFI16 polypeptide, a cell expressing an HIV-1 polypeptide, a component for use in HAART. A therapeutic product may include sterile saline or another

pharmaceutically acceptable emulsion and suspension base.

[00569] In some embodiments of the present invention, a kit comprises one or more inhibitors for TFTl 6. Optionally, the kit includes one or more components used for HAART as described herein. Typically, these compounds are provided in a container.

[00570] This invention provides kits for use in the methods described herein. In some embodiments of the present invention this kit comprises (i) a first container containing an inhibitor for IFI16 and (ii) an instruction for using the inhibitor for IFI16 in a method of the present invention. In other embodiments, this kit comprises any of the compounds described herein and above, which will be provided in a separate container.

[00571] In addition, a kit may include instructional materials containing directions (i.e., protocols) for the practice of methods of this invention. The instructions may be present in the subject kits in a variety of forms, one or more of which may be present in the kit. While the instructional materials typically comprise written or printed materials they are not limited to such. Any medium capable of storing such instructions and communicating them to an end user is contemplated by this invention. Such media include, but are not limited to electronic storage media (e.g., magnetic discs, tapes, cartridges, chips), optical media (e.g., CD ROM), and the like. Such media may include addresses to internet sites that provide such instructional materials. Optionally, the instruction comprises warnings of possible side effects and drug-drug or drug-food interactions.

[00572] A wide variety of kits and components can be prepared according to the present invention, depending upon the intended user of the kit and the particular needs of the user.

[00573] In some embodiments of the present invention, the kit is a pharmaceutical kit and comprises a pharmaceutical composition comprising (i) one or more inhibitors for IFI16 and (ii) a pharmaceutical acceptable carrier. In other embodiments, the pharmaceutical kit comprises a component for use in HAART as described herein. Pharmaceutical kits optionally comprise an instruction stating that the pharmaceutical composition can or should be used for treating a condition or disease described herein.

[00574] Preferred embodiments of this invention are described herein, including the best mode known to the inventors for carrying out the invention. Of course, variations, changes, modifications and substitution of equivalents on those preferred embodiments will become apparent to those of ordinary skill in the art upon reading the foregoing description. The inventors expect skilled artisans to employ such variations, changes, modifications and substitution of equivalents as appropriate, and the inventors intend for the invention to be practiced otherwise than specifically described herein. Those of skill in the art will readily recognize a variety of non-critical parameters that could be changed, altered or modified to yield essentially similar results. Accordingly, this invention includes all modifications and equivalents of the subject matter recited in the claims appended hereto as permitted by applicable law. Moreover, any combination of the above-described elements in all possible variations thereof is encompassed by the invention unless otherwise indicated herein or otherwise clearly contradicted by context.

[00575] As can be appreciated from the disclosure above, the present invention has a wide variety of applications. While each of the elements of the present invention is described herein as containing multiple embodiments, it should be understood that, unless indicated otherwise, each of the embodiments of a given element of the present invention is capable of being used with each of the embodiments of the other elements of the present invention and each such use is intended to form a distinct embodiment of the present invention.

[00576] The referenced patents, patent applications, and scientific literature referred to herein are hereby incorporated by reference in their entirety as if each individual publication, patent or patent application were specifically and individually indicated to be incorporated by reference. Any conflict between any reference cited herein and the specific teachings of this specification shall be resolved in favor of the latter. Likewise, any conflict between an art- understood definition of a word or phrase and a definition of the word or phrase as specifically taught in this specification shall be resolved in favor of the latter.

[00577] As can be appreciated from the disclosure above, the present invention has a wide variety of applications. The invention is further illustrated by the following examples, which are only illustrative and are not intended to limit the definition and scope of the invention in any way.

[00578] The below examples are meant to illustrate specific embodiments of the methods and compositions described herein. VII. EXAMPLES

Example 1. General

i. Cell Culture and Tissues

[00579] Human tonsillar and splenic tissue was purchased from Cooperative Human Tissue Network and processed as previously described (Orzalli et al., 2012, Proc Natl Acad Sci USA 109:E3008-E3017). HEK293T cells were cultured in DMEM supplemented with %10 FBS, 2mM L-glutamine, l OOuM streptomycin, and l OOU/ml penicillin.

ii. Plasmids and Viruses

[00580] pSicoR-m Cherry vector was obtained from M. Spindler (Salomonis et al, 2010, Proc Natl Acad Sci USA 107(23): 10514-10519). NLENG1 and Dl 16N plasmids were obtained from D.N. Levy (The University of Alabama, Birmingham, USA; Levy et al., 2004, Proc Natl Acad Sci USA 102(12):4204-9).

iii. Reagents

[00581] Caspase-1 inhibitor 11 (Ac-YVAD-CMK, EMD Millipore; Billerica. MA, USA) and DNPK-1 inhibitors Nu7026 and Nu7441 (Tocris Biosciences; Bristol, United Kingdom) were solubilized in DMSO and used at a final concentration of ΙΟΟμΜ, 10μΜ or 20μΜ, 1 μΜ or 2μΜ, respectively. Intracellular detection of activated caspase-1 and IFN was performed 16 hours post co-culture with HIV-1 producing 293T cells. FLICA-660-Caspase-l (YVAD- FMK, Immunochemistry Technologies; Bloomington, MN, USA) was used according to manufacturer's protocol. Anti-human-IFNp F1TC (Antigenix America; Huntington Station, NY, USA) was used in conjunction with the intracellular fixation and permeabilization kit (eBioscience; San Diego, CA, USA) according to manufacturer's protocol (without addition of protein transport inhibitors). Efavirenz and AZT were obtained from the AIDS Reagent Program, Division of AIDS, NIAID, NIH.

iv. Biotinylation of Nucleic Acid Probes

[00582] 5' biotinylated double-stranded (ds) HIV-1 DNA was generated by PCR: forward primer (5 ' biotin-AAGGC AGCTGTAG ATCTTAG-3 ' ) and reverse primer (5 '-

C AGTACAGGC AAAAAGC AGC-3 ' ) . 5' biotinylated single-stranded (ss) HIV-1 DNA was purchased from IDT DNA Technologies (Coralville, Iowa, USA): 5' biotin-

CAGTACAGGCAAAAAGCAGCTGCTTATATGCAGCATCTGAGGGCTCGCCACTCC

CCAGTCCCGCCCAGGCCACGCCTCCCTGGAAAGTCCCCAGCGGAAAGTCCCTTGT

AGCAAGCTCGATGTCAGCAGTTCTTGAAGTACTCCGGATGCAGCTCTCGGGCCAC

GTGATGAAATGCTAGGCGGCTGTCAAACCTCCACTC. Poly(I:C) (InvivoGen; San Diego, CA, USA) was biotinylated using 5' EndTag Nucleic Acid Labeling System (Vector Labs, Burlingame, CA) according to the manufacturer's instructions.

v. Immunoprecipitation of Biotinylated Nucleic Acid

[00583] 20 million tonsillar CD4 ⁺ T cells were lysed in digitonin lysis buffer (0.5% digitonin, 20mM Tris-HCl, pH7.4, and 150 mM NaCl) on ice for 10 minutes. The cell lysates were centrifuged at 10,000xg for 10 minutes at 4°C. Lysates were pre-cleared with Dynabeads followed by the addition of 5'-biotinylated DNA or RNA pre-coupled to

Dynabeads (MyOne Streptavidin Tl, Invitrogen; Grand Island, New York, USA). Samples were incubated at 4°C for 1 hour. Precipitated DNA-protein complexes were washed in digitonin lysis buffer. Proteins were eluted by boiling in 2% SDS loading buffer and resolved by 12.5% (Fig 1A) and 10% (Fig 5A) SDS-PAGE followed by silver staining or Western blotting. For mass spectrometry, proteins were eluted with 2M KC1 buffer w/ 0.05%

apigest (Waters Corporation; Milford, MA, USA) at RT for 20 minutes.

vi. Mass Spectrometry Analysis

[00584] Eluted proteins were digested with trypsin prior to LC-MS/MS analysis. Samples were denatured and reduced in 2M urea, 10 mM NH ₄ HCO ₃ , 2 mM DTT for 30 minutes at 60°C, then alkylated with 2 mM iodoacetamide for 45 minutes at room temperature. Trypsin (Promega Corporation; Madison, WI, USA) was added at a 1 : 100 enzyme:substrate ratio and digested overnight at 37°C. Following digestion, samples were concentrated using C I 8 ZipTips (EMD Millipore; Billerica. MA, USA) according to the manufacturer's

specifications. Digested peptide mixtures were analyzed by LC-MS/MS on a Thermo Scientific LTQ Orbitrap Elite mass spectrometry system equipped with a Proxeon Easy nLC 1000 ultra-high-pressure liquid chromatography and autosampler system. Samples were injected onto a pre-column (2 cm x 100 um I.D. packed with ReproSil Pur CI 8 AQ 5um particles) in 0.1 % formic acid and then separated with a one-hour gradient from 5% to 30% ACN in 0.1 % formic acid on an analytical column (10 cm x 75 um I.D. packed with ReproSil Pur CI 8 AQ 3 um particles). The mass spectrometer collected data in a data-dependent fashion, collecting one full scan in the Orbitrap at 120,000 resolution followed by 20 collision-induced dissociation MS/MS scans in the dual linear ion trap for the 20 most intense peaks from the full scan. Dynamic exclusion was enabled for 30 seconds with a repeat count of 1. Charge state screening was employed to reject analysis of singly charged species or species for which a charge could not be assigned. The raw data was matched to protein sequences by the Protein Prospector algorithm (Clauser and Baker, 1999, Anal Chem 71 :2871-2882). Data were searched against a database containing SwissProt Human protein sequences (downloaded March 6, 2012) sequences, concatenated to a decoy database where each sequence was randomized in order to estimate the false positive rate. The searches considered a precursor mass tolerance of 20 ppm and fragment ion tolerances of 0.8 da, and considered variable modifications for protein N-terminal acetylation, protein N-terminal acetylation and oxidation, glutamine to pyroglutamate conversion for peptide N-terminal glutamine residues, protein N-terminal methionine loss, protein N-terminal acetylation and methionine loss, and methionine oxidation, and constant modification for carbamidomethyl cysteine. Prospector data was filtered using a maximum protein expectation value of 0.01 and a maximum peptide expectation value of 0.05.

[00585] Raw mass spectrometry data was matched to peptide sequences using the Protein Prospector algorithm (Clauser and Baker, 1999, Anal Chem 71 :2871-2882). The Prospector algorithm uses the MOWSE method to score each mass spectrum to database sequences meeting mass tolerance and in silico digestion criteria (Pappin et al., 1993 Curr Biol 3 :327- 332). An expectation value was calculated comparing the top-scoring match to a distribution of all other matches for each individual spectrum. A peptide discriminant score combined the MOWSE score and the expectation value into one score using a formula that was determined to best differentiate between true and false positive matches (Chalkley et al., 2005, Mol Cell Proteomics 4: 1 189-1 193). Peptide discriminant scores were summed for all peptides detected within a protein sequence to generate a protein discriminant score. The protein list was ranked by this protein discriminant score.

vii. Immunoblotting Antibodies

[00586] The following commercial antibodies were used: anti-IFIl 6 (Santa Cruz

Biotechnology (Dallas, TX, USA), cat# sc-8023, 1 : 1000), anti-RIG-I (Cell Signaling Technology (Danvers, MA, USA), cat#3743, 1 : 1000), anti-SAMHD l (Sigma-Aldrich (St. Louis, MO, USA), cat#SAB l 101454, 1 : 1000) and anti-beta-actin (Sigma-Aldrich (St. Louis, MO, USA), cat#A5316, 1 :5000), anti-NLRP3 (Abeam (Cambridge, MA, USA), cat# abl 7267, 1 : 1000), anti-DAI (Abeam (Cambridge, MA, USA), cat# ab81526, 1 : 1000), anti- histone H3 (Abeam (Cambridge, MA, USA), cat# abl791, 1 :1000), anti-AIM2 (Novus Biologicals (Littleton, CO, USA), cat#H00009447-B01P, 1 : 1000), and anti-DNAPK-1 (Proteintech (Chicago, IL, USA), cat#l 9983-1 -AP, 1 : 1000). Anti-STING antibody was provided by Drs. D. Burdette and R. Vance (University of California, Berkeley; Ishikawa et al., 2009, Nature 461 :788-792). viii. shR As

[00587] shRNA target sequences from the RNAi consortium (TRC) shRNA library were imported into pSicoOligomaker 1.5 (a publicly available online program, e.g., provided by The Jacks Lab) to generate sense and antisense oligos. Annealed shRNA oligos were ligated into pSicoR-mCherry after Hpal/Xhol digestion. Resulting constructs were either pseudotyped with VSV-G or HIV g l60 and packaged into the pCMVAR8.91 lentivirus delivery system (Zuffrey et al., 1997, Nat Biotechnol 15:871-875), concentrated at 20,000 rpm for 2 hours at 4°C in a Beckman Coulter ultracentrifuge with a SW28 rotor, resuspended in cell culture media, and quantified via p24 ELISA (Perkin Elmer; Aktron, Ohio, USA). shRNA oligo sequences used herein are shown in Fig. 10H. shRNA knockdown was assessed by Western blot and quantitative RT-PCR using TaqMan primer/probes (Applied Biosystems; Grand Island, NY, USA) on an ABI Prism 7900HT (Applied Biosystems; Grand Island, NY, USA).

ix. shRNA Knockdown in Primary CD4 T Cells

[00588] VLP-Vpx Method: Introduction of gp 160 pseudotyped shRNA lentiviruses into tonsillar CD4 T cells was facilitated by incubation of lOOng viral like particles containing Vpx (VLP-Vpx) per 1 million cells at 4°C for 20-30 minutes followed by spinoculation at l,200xg for 2 hours at 4°C in a V-bottom 96-well plate. 24 hours later the media was changed and shRNA lentiviral spinoculation was performed under the same conditions. Cells were incubated for 48 hours at 37°C, and then treated with 5uM AZT. The same day, HEK293T cells were plated at 50% confluency in 24-well plates and transfected using Fugene HD (Promega Corporation; Madison, WI, USA) with 50ng per well of NL4-3 HIV-1 DNA or 5ng gpl60 plus 45ng delta Env NL4-3 (single round HIV-1) where noted. Twenty- four hours post-transfection, 4 xlO ⁶ tonsillar cells were co-cultured with HEK293T cells producing virus. Cell populations were visualized with CD4-APC (BD Biosciences, clone RPA-T4) and CD8-FITC (BD Biosciences (San Jose, CA, USA), clone SKI) FACS antibodies incubated on ice for 30 minutes at 24, 36, and 48 hours post-co-culture. Flow cytometry was performed on a FACS Calibur (B.D. Biosciences; San Jose, CA, USA) and data were analyzed with FlowJo software (Tree Star; Flow Jo, LLC, Ashland, OR, USA). CD4 ⁺ and mCherry postive populations were normalized based on CD8 ⁺ T cell counts.

[00589] Activation-Rest Method: Splenic CD4 T cells were isolated by negative selection (Stem Cell Technologies, Inc., Vancouver, BC, Canada) and activated with lOOU/ml IL-2 (R&D Systems; Minneapolis; MN, USA) and 10 ug/ml PHA (Sigma Aldrich; St. Louis, MO, USA) for 24-48 hours. Activated CD4 T cells were spinoculated with VSV-G pseudotyped shRNA lentiviruses at an MOI of 200 for 2 hours at 32°C. Cells were cultured for 6-7 days in l OOU/ml IL-2, and then mCherry positive cells were sorted on a FACSAria-II (B.D.

Biosciences; San Jose, CA, USA). Cells were expanded with CD3/CD28 Dynabeads (Life Technologies; Grand Island, NY, USA) 48 hours later, according to the manufacturer's protocol. Dynabeads were removed and cells were cultured in 30U/ml for 24 hours, then lOU/ml IL-2 for 3 days followed by co-culture with either donor-matched mCherry negative splenic CD4 T cells or tonsillar HLACs spinoculated with HIV-1-GFP reporter virus. Co- culture was performed 3 days post-spinoculation with either uninfected, infected, or infected plus l OuM efavirenz treated mCherry positive CD4 ⁺ cells. Efavirenz was added to mCherry positive CD4 ⁺ cells one hour before co-culture. mCherry positive CD4 ⁺ versus mCherry negative CD4 ⁺ T cell depletion was assessed by flow cytometry on a FACS Calibur (B.D. Biosciences; San Jose, CA, USA) and normalized to fluorescent beads (Beckman Coulter; Indianapolis, IN, USA). Activation status of mCherry positive cells was determined by CD25 expression (CD25-FITC, B.D. Biosciences (San Jose, CA, USA), clone 2A3) and analyzed by flow cytometry on the day of co-culture.

Example 2. An Unbiased Proteomic Approach Identified Cellular DNA

Sensor Candidates

[00590] HIV- 1 /AIDS is a devastating global epidemic with over 70 million infections and 35 million deaths (WHO). AIDS is primarily caused by loss of the quiescent "bystander" CD4 T-cells that populate lymphoid organs. These cells are not permissive for viral replication resulting in abortive infection and the accumulation of incomplete DNA transcripts (Doitsh et al., 2010, Cell 143:789-801). These cytosolic viral DNAs trigger an innate immune response that activates a highly inflammatory form of programmed cell death, pyroptosis (Doitsh et al, 2013, Nature doi: 10.1038/naturel2940). Here, Applicants sought to identify the host DNA sensor that initiates pyroptosis in abortively infected CD4 T-cells.

[00591] An unbiased proteomic approach involving DNA affinity chromatography and mass spectrometry was utilized to identify potential viral DNA sensor candidates. Cytosolic fractions of tonsillar CD4 T-cell lysates were incubated with a biotinylated 500-bp HIV-1 Nef DNA fragment and subjected to streptavidin immunoprecipitation, SDS-PAGE, and silver staining (Fig. 1 A), The Nef region is reverse transcribed early. Thus, this DNA RT product is likely present during abortive HIV infection. Streptavidin immunoprecipitation samples incubated with biotinylated HIV DNA showed numerous bands (Fig. 1 A). Nonspecific background binding was very low: protein was not detected when non- biotinylated DNA was tested (Fig. 1A). The cytosolic lysates appeared free of nuclear contamination as immunoblotting showed no histone H3 (Fig. I B). Mass spectrometry was employed to identify cytosolic proteins from the tonsillar CD4 T-cells that bound to HIV-1 DNA. A complete list of identified polypeptides is shown in Figs. 2A-2P.

[00592] The top six hits, based on protein discriminant scores (Orzalli et al., 2012, Proc Natl Acad Sci USA 109:E3008-E3017), correspond to Ku80, PARP-1, Ku70, RPA-1, IFI16, and IF1X (Fig. 3A). A rational approach investigating biologically relevant DNA sensor candidates was pursued in parallel. Expression of various known innate immune sensors was assessed by immunoblotting cytosolic lysates from resting tonsillar CD4 T-cells, confirming the presence of IFI16 (Unterholzner et al.. 2010, Nat Immunol 1 1 :997-1004; Kerur et al, 2011, Cell Host Microbe 9:363-375), AIM2 (Roberts et al., 2009, Science 323: 1057-1060; Burckstummer et al., 2009, Nat Immunol 10:266-272; Ferandes-Alnemri et al, 2009, Nature 458:509-513; Hornung et al., 2009, Nature 458:514-518), DAI (Takaoka et al„ 2007, Nature 448:501 -505), STING (Burdette et al., 2011 , Nature 478:515-518; Ishikawa et al., 2009, Nature 461 :788-792; Ishikawa et al., 2008, Nature 455:674-678), DNPK-1 (Cooper et al., 2013, Nature 498:376-379), NLRP3 (Mariathasan et al., 2006, Nature 440:228-232;

Sutterwala et al., 2006, Immunity 24:317-327; Kanneganti et al., 2006, Nature 440:233-236), SAMHD1 (Baldauf et al, 2012, Nat Med 18(1 1): 1682-7), and IFIX (PYHIN-1) (Brunette et al„ 2012, J Exp Med 209:1969-1983) (Fig. 3B).

[00593] cGAS (Sun et al, 2013, Science 339:786-791 ; Gao et al, 2013, Science 341 :903- 906) was neither detected at the protein level in tonsillar CD4 T-cells (Fig. 4D), nor in the affinity chromatography-mass spectrometry experiments (Figs 2A-2P). IFI16 was identified in both approaches. IFI16 had been shown to form an inflammasome (Kerur et al., 201 1, Cell Host Microbe 9:363-375 ; Brunette et al., 2012, J Exp Med 209: 1969- 1983). Of the known inflammasome DNA sensors, IFI16, but not AIM2, bound HIV-1 DNA (Fig. 3B). Since AIM2 binds DNA in a non-sequence-specific manner, it would have been expected that it would be a top candidate, but it was not identified by mass spectrometry (Figs 2A-2P). IFI16 mRNA levels are ~5-fold higher than AIM2 mRNA in resting tonsil CD4 T-cells (Fig. 4A). Of note, all three IFI16 isoforms were detected in the cytosol and nucleus of primary tonsillar CD4 T-cells (Fig. 4B). Example 3. IFI16 Binds To Double-Stranded DNA And To Single- Stranded DNA

[00594] Reverse transcription (RT) of the HIV-1 RNA genome initially generates single- stranded DNA (ssDNA) and then double-stranded DNA (dsDNA); either might be sensed during abortive infection. To test whether IFI16 binds to dsDNA, ssDNA,or both, a biotinylated dsDNA probe (5 ' -

AAGGCAGCTGTAGATCTTAGCCACTTTTTAAAAGAAAAGGGGGGACTGGAAGGG CTAATTCACTCCCAAAGAAGACAAGATATCCTTGATCTGTGGATCTACCACACAC AAGGCTACTTCCCTGATTGGCAGAACTACACACCAGGGCCAGGGGTCAGATATC CACTGACCTTTGGATGGTGCTACAAGCTAGTACCAGTTGAGCCAGATAAGGTAG AAGAGGCCAATAAAGGAGAGAACACCAGCTTGTTACACCCTGTGAGCCTGCATG GAATGGATGACCCTGAGAGAGAAGTGTTAGAGTGGAGGTTTGACAGCCGCCTAG CATTTCATCACGTGGCCCGAGAGCTGCATCCGGAGTACTTCAAGAACTGCTGACA TCGAGCTTGCTACAAGGGACTTTCCGCTGGGGACTTTCCAGGGAGGCGTGGCCTG GGCGGGACTGGGGAGTGGCGAGCCCTCAGATGCTGCATATAAGCAGCTGCTTTTT GCCTGTACTG-3') was incubated with cytosolic extracts from tonsillar CD4 T-cells with 10-fold excess of unlabeled ssDNA as a competitor (Fig. 5 A). IFI16 effectively bound dsDNA (Fig. 5B) as described (Unterholzner et al., 2010, Nat Immunol 1 1 :997-1004; Jin et al., 2012, Immunity 36:561 -571) and was competed by "cold" ssDNA. Biotinylated ssDNA was subjected to binding and competition with cold dsDNA, but IFI16 was not initially detected by immunoblotting. However, further analysis using higher protein input confirmed that IFI16 also binds to ssDNA, albeit more weakly than dsDNA (Fig. 5C). RIG-I selectively bound dsRNA as a control (Figs. 5B, 5C).

Example 4. Specific Intracellular DNA Sensors Identified Using

"Activation-Rest" Strategy

[00595] Standard methods, including liposome-mediated delivery of siRNAs or infection with VSV-G pseudotyped lentiviruses encoding shRNAs, are ineffective for targeted gene knockdown in resting CD4 T-cells (Agosto et al, 2009, J Virol 83:8153-8162; Wang et al.,

2009, PLos Pathog 5:el 000633). siRNA nucleofection is highly variable, often toxic, and associated with extensive cell death in tonsillar cultures. To overcome these challenges and to test whether specific DNA sensor candidates are required for cell death in primary lymphoid CD4 T-cells undergoing abortive HIV-1 infection, an "activation-rest" strategy was used. Splenic CD4 T-cells were activated with PHA and cultured in l OOU/ml of IL-2, which rendered cells permissive for infection with VSV-G-pseudotyped lentiviruses encoding shRNA and mCherry. mCherry-positive cells were isolated by cell sorting (Fig. 6), expanded by two rounds of activation with anti-CD3/anti-CD28 antibody-conjugated beads, and then rested by reducing IL-2 levels to 10 U/ml for 3-4 days (Bosque and Planelles, 2009, Blood 1 13:58-65).

[00596] IFI16 protein expression was markedly decreased in the mCherry-positive splenic CD4 T-cells receiving the lentivirus encoding shIFI16-A compared to cells receiving the lentivirus encoding the control scramble shRNA (Fig. 7A).

[00597] Next, the rested mCherry-positive CD4 ⁺ T-cells were co-cultured with tonsil or spleen CD4 T cells infected with an HIV- 1 -GFP reporter virus (NLENG1). In cells expressing the scramble-shRNA, marked depletion of CD4 T-cells occurred (Fig. 7B); this death was rescued by adding a non-nucleoside reverse-transcriptase inhibitor (NNRTI) efavirenz (EFV), implicating abortive HIV infection as previously described (Doitsh et al., 2010, Cell 143 :789-801). In sharp contrast, introduction of shIFI 16-A resulted in survival of the mCherry-positive CD4 ⁺ T-cells. In the same experiments, mCherry-negative CD4 ⁺ T cells were markedly depleted, suggesting that they had returned to a sufficient state of rest to undergo abortive infection.

[00598] To exclude more formally the possibility that the "activated and rested" CD4 T- cells were dying as a result of productive infection, the activation status of these cells was assessed. Flow cytometry analysis revealed that CD4 T-cells cultured in reduced IL-2 levels had lower levels of CD25 and CD69 than cells activated with 100 U/ml IL-2 and 10 ^ig/ml PHA indicated that they have returned to a quiescent state (Fig. 7C). However, CD25 levels were higher than those found in unactivated cells, indicating that these cells had not fully returned to a resting state. This finding likely relates in part to the up-regulation of CD25 expression by IL-2 (Depper et al., 1985, Proc Natl Acad Sci USA 82:4230-4234). To directly test the permissivity of these cells to productive HIV-1 infection, an HIV-1 -GFP reporter virus was used. In cells expressing shScramble or shIFI16-A, only -1 -2% of the mCherry- positive cells, and -1-2% of mCherry-negative cells, were productively infected as indicated by GFP expression. These data indicate that the majority of the target cells are in a resting state, and do not become productivey infected with the virus (Fig. 7D). Thus, the 60-70%) depletion of CD4 T-cells observed was not due to abortive infection of resting CD4 T cells, but not due to high levels of productive viral infection. Example 5. Confirmation Of IFI16 As A Specific Intracellular HIV-1

DNA Sensor

[00599] To confirm 1F116 as an HIV-1 DNA sensor and to test a broader array of potential candidates, a second, more rapid shRNA knockdown strategy was employed. Virus-like particles (VLPs) were packaged with the SIV accessory protein Vpx that degrades the SAMHD1 restriction factor and render cells susceptible to lentiviral infection (Descours et al., 2012, Retrovirology 9:87; Baldauf et al., 2012, Nat Med 18: 1682-1689). This method was adapted for use in resting CD4 T-cells based on prior success in monocyte-derived dendritic cells (Berger et al., 2011, Nat Protoc 6:806-816). Twenty-four hours after VLP- Vpx sp inoculation, complete tonsillar HLACs were spinoculated with shRNA-mCherry lentiviral vectors pseudotyped with HIV gpl60 Env. Bumber in gates predict the percentage of CD4 T cells expressing the shRNA lentiviral vector (mCherry positive) against cell that do not express the shRNA vector (mCherry negative) (Fig 8, Orzaili et al., 2012, Proc Natl Acad Sci USA 109:E3008-E3017). Cells were co-cultured 3 days later with HEK293T cells producing or not producing HIV-1 virions. CD4 T-cell death was assessed 2 days later in mCherry-positive CD4 ⁺ T-cells expressing the shRNA and mCherry-negative CD4 ⁺ T-cells lacking the shRNA. In parallel, EFV was added to select wells.

[00600] Three independent shRNAs targeting IFH6 were designed. Each reduced IFI16 protein expression in mCherry-positive CD4 ⁺ T-cells, compared to the shScramble control (Figs. 9A, 9C). All three IFI16 shRNAs prevented depletion of mCherry-positive CD4 ⁺ T cells, while shScramble did not (Figs. 9B, 9D). EFV rescued depletion of scramble-shRNA- expressing cells, supporting the notion that the CD4 T-cell depletion resulted from abortive infection (Fig. 9B). Moreover, mCherry negative CD4 ⁺ T-cells were depleted regardless of the shRNA demonstrating that experimental conditions were sufficient for abortive infection in all infected samples (Figs. 9B, 9D). Thus, using an independent method for shRNA knockdown, it was confirmed that IFI16 is required for lymphoid CD4 T-cell depletion by HIV-1 following abortive HIV-1 infection.

[00601] To confirm that shScramble mCherry-positive CD4 T-cells die via abortive infection, which requires RT but not integration (Doitsh et al., 2010, Cell 143:789-801), cells were co-cultured with 293T cells producing single round HIV-l(AEnv with gpl 60 coexpressed) or HIV-1 containing a disabling integrase mutation, Dl 16N (Fig. 9E). These replication-defective, non-spreading viruses induced depletion of mCherry-positive CD4 T- cells expressing shScramble. In contrast, introduction of shIFI16-A rescued cells from HIV- 1-mediated depletion. Thus, neither productive infection nor HIV-1 integration is required for cell death. Knockdown of IFI16 decreased caspase-1 activation in the mCherry positive cells, while ΓΡΝβ was induced in HIV-1 -infected cells with the shScramble control, but not in cells expressing shIFI16-A (Fig. 9F). These findings suggest that IFI16 is required to sense incomplete DNA reverse transcripts that accumulate in abortively infected cells, leading to caspase-1 activation, which results in the subsequent death of these cells via pyroptosis (Doitsh et al., 2013, Nature 10.1038/naturel2940). IFI16 sensing also leads to IFNp induction.

Example 6. Inhibition Of IFI16, But Not Of Other Known DNA Sensors

Rescued Death Of Lymphoid CD4 T-Cells

[00602] Although IFI16 shRNAs consistently rescued death of lymphoid CD4 T-cells during abortive infection, other DNA sensor candidates were also evaluated. The VLP-Vpx method was used to render resting lymphoid CD4 T-cells permissive to infection with lentiviruses encoding shRNAs directed against AIM2 and STING. Although effective in inhibiting expression of AIM2 and STING protein in THP-1 cells (Fig. 10A), neither of these shRNAs rescued the mCherry positive cells from depletion (Fig. 10B). Validated shRNAs targeting IFIX (Fig. IOC) or DNPK-1 (Fig. 10E) also did not rescue mCherry-positive CD4

T-cell depletion (Figs. 10D, 10F). Moreover, small-molecule inhibitors of DNPK-1, Nu7026 and Nu7441 (Cooper et al., 2013, Nature 498:376-379), did not rescue cells from abortive infection and pyroptosis (Fig 10G). These findings and a recent publication suggest that

DNPK-1 may play a role in DNA sensing only within the small fraction of cells (5% in tonsil) that are permissive for productive HIV- 1 infection and trigger noninflammatory apoptosis (Cooper et al., 2013, Nature 498:376-379). In contrast, IFI16 appears to be required to detect abortive infection and induction of highly inflammatory pyroptosis in nonpermissive CD4 T-cells (Fig. 101). These cells form the majority of HIV- 1 cellular targets in most lymphoid tissues (95% in tonsil cultures). Both mechanisms likely contribute to HIV-1 -induced AIDS, but at different frequencies determined by the number of permissive versus nonpermissive cellular targets residing within various lymphoid tissues.

[00603] As described herein, IFI16 evolved as an anti-viral DNA sensor (Unterholzner et al., 2010, Nat Immunol 1 1 :997-1004; Kerur et al, 201 1, Cell Host Microbe 9:363-375). In addition, IFI16 exerts novel antiviral activity, including restriction of herpesvirus replication by inhibiting viral gene expression. That IFI16 is targeted for degradation by herpesviruses (Gariano et al, 2012, PLoS Pathog 8 :e 1002498) further highlights an evolutionary pressure to counteract its activity. Studies described herein reveal that IFI16 initiates an innate immune response that, rather than protecting the host, drives the debilitating CD4 T-cell depletion that underlies progression to AIDS in untreated HI V-1 -infected individuals. The cycle of abortive infection, inflammatory death, and recruitment of new cells likely explains how this innate host response is undermined and, in fact, centrally contributes to HIV- 1 pathogenesis. The findings described herein now identify IFI16 as a critical DNA sensor required for cell death during abortive HIV-1 infection. Therapies, not limited to those described herein, directed against this host pathway might preserve CD4 T-cells and reduce chronic inflammation— two signature pathologies in HIV-1 infection.